text
stringlengths
1.55k
332k
label
int64
0
8
a preferred embodiment of the modular packaging machine 10 of the present invention is illustrated in fig1 . specifically , the modular packaging machine 10 shown in fig1 includes multiple modules , each of the modules performing a function in the packaging of articles . an infeed conveyor lane divider module 12 , a blank magazine and infeed tray module 14 , a collation and synchronization module 16 , a gluing and closing module 18 , a stacker module 20 , a film cutting module 22 , a film wrapper module 24 , and a heat shrink tunnel module 26 , comprise the packaging machine shown in fig1 . modules providing other functions including , without limitation , a turner module ( see fig5 ) can be added to the packaging machine 10 shown in fig1 without departing from the principles of the present invention . articles are received and packaged by sequentially going from module to module in the packaging stream of the modular packaging machine 10 of the present invention . specifically , means for conveying are provided in each module that move articles and packages along from module to module . an infeed and lane divider conveyor 30 , a collation and synchronization conveyor 32 , a gluing and closing conveyor 34 , a stacker conveyor 36 , a film wrapper conveyor 38 , and a heat shrink tunnel conveyor 40 , all move articles through their respective modules and onto the next module . the conveyors are arranged at identical heights to allow one module to be butted up against an adjoining module without the need for any additional mechanical connection or adjustment therebetween . the first module , the infeed conveyor lane divider module 12 , is shown in fig1 . articles 46 are received in unordered arrangement and held on the conveyor 30 by infeed side rails 42 , 44 . the infeed conveyor 30 is driven in the direction shown and moves the unordered articles 46 into lanes defined by the side rails 42 , 44 and lane dividers 48 , 50 , 52 . the articles emerge from the infeed conveyor lane divider module 12 as laned articles 56 . a servo drive 54 provides the motive force for the infeed lane conveyor 30 thereby defining the speed of the conveyor 30 and of articles 46 , 56 transported thereby . the servo drive 54 is coupled to the infeed lane conveyor 30 by coupling 55 . the servo drive 54 is depicted in fig3 as being side mounted , although other mountings and mechanical connections to the conveyor 30 are contemplated and do not depart from the principles of the present invention . the next module in the packaging machine 10 shown in fig1 , the collation and synchronization module 16 , separates the laned articles 56 into a process group 58 ( see fig3 ). the collation and synchronization module 16 receives laned articles 56 and separates them into a process group 58 by inserting a separator bar 60 . the separator bar 60 is mounted on and travels with collation and synchronization conveyor 32 . the separator bar 60 moves in the direction indicated in fig3 and moves the process group 58 along with it . a servo drive 62 provides the motive force for the collation and synchronization conveyor 32 and thereby defines the speed of the conveyor 32 and the process group 58 transported thereby . similar to the other modules discussed herein , the servo drive 62 of the collation and synchronization module 16 is shown being side mounted and coupled to the conveyor 32 . other mechanical linkages between the servo drive 62 and conveyor 32 are contemplated by the principles of the present invention . for a packaging machine that is to include capabilities as a pad shrink packer or tray shrink packer , a pad or blank magazine and infeed module 14 is required . a stack of cardboard blanks 66 resting on an inclined tabletop 68 is provided from which pads or trays are provided for each process group 58 . specifically , a suction cup 70 engages the top pad or blank 72 of the stack 66 , rotates about extension arm 76 in the direction shown in fig2 and places the pad or blank 72 on an elevator conveyor 74 mechanically linked to the collation and synchronization module 16 ( see fig3 ). the pad or blank 72 is positioned under the pack group 58 as shown in fig3 . the elevator conveyor 74 is mechanically linked by a belt 65 to the collation and synchronization conveyor 32 , which is driven by servo drive 62 . it is contemplated that a separate drive for the elevator conveyor 74 may be used without departing from the principles of the present invention . on the blank magazine and infeed module 14 the suction cup 70 is driven by a servo drive 78 . for specific use as a tray shrink packer a gluing and closing module 18 is provided in packaging machine 10 to complete the tray formation . the gluing and closing conveyor 34 includes a separator bar 82 similar to the collation and synchronization separator bar 60 . the separator bar 82 controls the flow of the process group 58 through the gluing and closing module 18 . as the process group 58 and blank 72 proceed through the gluing and closing module 18 , the extended side flaps 88 , 90 of the blank 72 engage angled fold bars 84 , 86 and are folded upright as a result ( see fig4 ). glue applicators 92 , 94 apply adhesive to the side flaps 88 , 90 prior to folding so that , after engaging the fold bars 84 , 86 the tray retains the shape of a tray around the pack group 58 . a servo drive 96 defines the speed of the gluing and closing conveyor 34 , thereby also defining the speed with which packages are processed through the gluing and closing module 18 . after the gluing and closing module 18 , a turner module 28 may be inserted to turn the package 104 as shown in fig5 . specifically , a turner conveyor 100 receives the package 104 and moves it in the direction indicated in fig5 . when the package 104 engages an angled fixed block 102 , the package is turned and reoriented as desired . a servo drive 106 drives the turner conveyor 100 and defines the speed of the conveyor 100 and , thereby , the speed with which packages are turned in the turner module 28 . a stacker module 20 may also be provided to perform the function of stacking every other package 112 on top of the preceding package 114 prior to exiting the module 20 . the stacker conveyor 36 moves packages 114 in the direction shown . lifter arms 108 , 110 engage and lift and place every other package 112 on top of the preceding package 114 as shown in phantom in fig6 . the lifter arms 108 , 110 ride on endless belts 116 , 118 which are driven in the indicated direction . a servo drive 120 drives the endless belts 116 , 118 and thereby controls the speed of lifter arms 108 , 110 and the speed with which packages 112 are picked up and placed on the preceding package 114 . the speed of the servo drive 120 will necessarily be faster and variable compared to the speed of the stacker conveyor 36 . a servo drive 122 drives the stacker conveyor 36 such that packages are processed through the stacker module 20 at the same speed as through the other modules . providing heat shrinkable film around packages as in a tray shrink packer , pad shrink packer or shrink packer requires an additional three modules to be employed . first , a film cutting module 22 is necessary wherein a spool of film 124 is provided , unrolled and threaded through the rest of the film cutting module 22 . the film engages a guide roll 126 and is threaded between pinch rolls 128 , 129 , 130 , 131 . a knife 134 is provided to cut the film off at a desired length to wrap a package . a standalone base 136 supports the spool 124 , guide roll 126 , pinch rolls 128 , 129 , 130 , 131 and the rest of the film cutting module . a servo drive 138 coupled to pinch roll 129 controls the unrolling of the film and the supply thereof to the knife 134 . a film wrapper module 24 is also necessary to receive a sheet 140 from the film cutting module 22 . as a package 146 is received on film wrapper conveyor 38 and transported thereby , the front edge 142 of the sheet 140 is tucked under the package 146 in the film wrapper module 24 . a film wrapper arm 148 engages the sheet 140 of film and wraps it around the package 146 . the film wrapper arm 148 is driven around frame 150 , 152 and is necessarily driven at a higher rate of speed than the film wrapper conveyor 38 to allow completion of the film wrapping while the package 146 is still on the film wrapper conveyor 38 . a servo drive 154 on the film wrapper arm 148 drives the film wrapper arm 148 accordingly . meanwhile , servo drive 156 on the film wrapper conveyor 38 drives the film wrapper conveyor 38 at a pace consistent with the rest of the packaging machine 10 . finally , a heat shrink tunnel module 26 is provided down stream of the film wrapper module 24 to shrink the film 140 into tight engagement with the package 160 . a housing 158 is provided which encloses heat and through which the package 160 passes in the direction indicated in fig9 . the heat shrink tunnel conveyor 40 is driven by a variable speed drive 162 at a rate consistent with the rest of the machine . the embodiment of the packaging machine 10 of the present invention described above eliminates the need for a large frame for the equipment to be mounted on and provides modules that need not be mechanically linked . the speeds with which the modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 operate are controlled and coordinated by a supervisory computer 200 ( see fig1 ). each module 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 in the embodiment performs a discrete packaging function and includes conveyors driven by an onboard servo drive 54 , 78 , 62 , 96 , 120 , 122 , 138 , 154 , 156 , 162 which moves packages through it at a predetermined rate . by tightly controlling the onboard drives through the use of precise electrical drives and feedback , it is possible to arrange the modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 end to end and have them orderly and continuously create packages without the need for mechanically linking them together . the infeed lane divider drive 54 , the collation and synchronization drive 62 , the gluing and closing drive 96 , the stacker drive 122 , the film wrap drive 156 and the heat shrink tunnel drive 162 all have their speeds calculated , checked and modified by the supervisory computer 200 to ensure orderly and continuous operation of the packaging machine . the computer 200 can speed up or slow down all of the modules or selected modules only in the event a module is running too fast or too slow . by tightly controlling the speed within each module 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 efficiencies are realized because the servo drives 54 , 78 , 62 , 96 , 120 , 122 , 138 , 154 , 156 , 162 can , within a module , slow down the speed to perform difficult operations then increase the speed to perform routine functions . the computer 200 controls the speed of the modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 differently , but in such a way that the flow of articles from modules to module is coordinated . the control of the servo drives 54 , 78 , 62 , 96 , 120 , 122 , 138 , 154 , 156 , 162 by the computer 200 provides great flexibility and variability of the packaging machine 10 . defining the packaging machine 10 through the use of multiple modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 that are interchangeable and are readily added or removed to change functionality of the machine 10 has significant advantages . the use of a supervisory computer 200 to control the drives 54 , 78 , 62 , 96 , 120 , 122 , 138 , 154 , 156 , 162 and the operation of the machine is easy and removes the necessity of mechanically linking the modules together 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 . the interchangability and removability of the modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 of the present invention are advantageous in that a problem with one module does not incapacitate the entire machine 10 . a single problematic module can be taken off line and replaced , or taken off line and fixed while packaging continues . the various modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 disclosed herein perform separate , discrete functions of the packaging machine 10 . the use of onboard drives 54 , 78 , 62 , 96 , 120 , 122 , 138 , 154 , 156 , 162 and the lack of necessity of mechanical connection between modules 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 allows each module to perform as a separate machine . in addition , the commonality of parts between modules allows more efficient maintenance and less down time when a problem is encountered . while the servo drives used with the various modules of the above described preferred embodiment have been depicted as being side mounted and directly coupled to the conveyors , other mechanical connections between the servo drives and conveyors , including , without limitation , alternate positioning with belt drives or through gearing , are specifically contemplated and do not depart from the principles of the present invention . another embodiment of the present invention is illustrated in fig1 wherein an alternative module drive means 250 to the individual servo drives described above is illustrated . specifically , fig1 shows a gluing and closing module 252 and a stacker module 254 which perform successive steps in the packaging sequence . the conveyor 256 is shown in fig1 being driven by a belt 258 which engages its drive sprocket 257 . the belt 258 is threaded around a hub 260 , the teeth 262 of which engage teeth 264 of a drive shaft 266 which is mounted below the conveyor 256 . rotation of the drive shaft 266 results in rotation of the hub 260 , belt 258 and conveyor drive sprocket 257 . as shown in fig1 , the stacker module 254 has a similar mechanical linkage wherein the conveyor 276 and its sprocket 277 are driven by belt 278 , hub 280 and drive shaft 286 . the closing and gluing module 252 and the stacker module 254 shown in fig1 are designed such that , when positioned in succession as shown , the closing and gluing module drive shaft 266 is on the same center line with the stacker module drive shaft 286 . a mechanical coupling 290 affixed to bridge the gap between the drive shafts 266 , 286 thus completes the mechanical linkage so that rotation of one drive shaft causes the other to rotate . in this way a single drive motor may be positioned anywhere along the combined drive shaft to drive both modules . other modules similarly designed with a drive shaft on the same center line will be similarly compatible . thus , the modularity of the packaging machine is maintained without requiring an individual servo drive on each module . rather , successive modules , such as the closing and gluing module 252 and stacker module 254 depicted in fig1 , are readily interchangeable and removable by installing or removing simple mechanical linkages such as the coupling 290 . the modules 252 , 254 are designed such that their drive shafts are aligned or readily accessible to allow the easy and quick installation or removal of the modules . the foregoing description of a preferred embodiment of the invention has been presented for purpose of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . obvious modification or variations are possible in light of the above teachings . the embodiment was chosen and described in order to best illustrate the principles of the invention and its practical application to thereby enable one of ordinary skill in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto .
1
embodiments of the present invention will be described in detail below with reference to drawings . note that the present invention is not limited to the description below , and it is easily understood by those skilled in the art that modes and details of the present invention can be modified in various ways . in addition , the present invention should not be construed as being limited to the description in the embodiments given below . in this embodiment , a structure of a transistor and a method for manufacturing the transistor according to one embodiment of the present invention will be described with reference to fig1 a to 1c . fig1 a is an example of a cross - sectional view of a transistor 162 in a channel - length direction . fig1 b is an example of a cross - sectional view of an element isolation region 165 between the transistor 162 and a transistor 163 . fig1 c is an example of a top view of the transistor 162 and the transistor 163 . note that fig1 b is part of a cross - sectional view of the transistor 162 in a channel - width direction , and corresponds to a cross - sectional view taken along a dotted line d 1 - d 2 in fig1 c . fig1 a corresponds to a cross - sectional view taken along a dotted line a 1 - a 2 in fig1 c . first , an insulating layer 130 is formed with an oxide film over a semiconductor substrate . then , a plurality of trenches ( also referred to as grooves ) is formed in the insulating layer 130 . then , a wide - gap semiconductor layer 144 is formed so as to cover the trenches . the trenches can be formed using a known technique ; in this embodiment , trenches having a depth of approximately 0 . 4 ฮผm are formed . in addition , the trenches for gate electrodes are formed in a single etching step or through a plurality of etching steps . as the semiconductor substrate , an soi substrate , a semiconductor substrate provided with a driver circuit including a transistor with a mosfet structure , a semiconductor substrate provided with a capacitor , or the like is used . the insulating layer 130 can be formed using a silicon oxide film , a gallium oxide film , an aluminum oxide film , a silicon nitride film , a silicon oxynitride film , an aluminum oxynitride film , or a silicon nitride oxide film . the wide - gap semiconductor layer 144 can have a thickness of 1 nm to 100 nm and can be formed by a sputtering method , a molecular beam epitaxy ( mbe ) method , a cvd method , a pulse laser deposition method , an atomic layer deposition ( ald ) method , a coating method , a printing method , or the like as appropriate . the wide - gap semiconductor layer 144 may be formed using a sputtering apparatus which performs film formation with surfaces of a plurality of substrates set substantially perpendicular to a surface of a sputtering target , which is so called a columnar plasma ( cp ) sputtering system . as a material of the wide - gap semiconductor layer 144 , an oxide semiconductor having a wider band gap than at least silicon , gallium nitride , gallium oxynitride , or gallium zinc oxynitride is used . as the oxide semiconductor having a wider band gap than silicon , at least indium ( in ) or zinc ( zn ) is preferably contained . in particular , in and zn are preferably contained . as a stabilizer for reducing changes in electrical characteristics of a transistor including the oxide semiconductor , gallium ( ga ) is preferably additionally contained . tin ( sn ) is preferably contained as a stabilizer . hafnium ( hf ) is preferably contained as a stabilizer . aluminum ( al ) is preferably contained as a stabilizer . as another stabilizer , one or more lanthanoids selected from lanthanum ( la ), cerium ( ce ), praseodymium ( pr ), neodymium ( nd ), samarium ( sm ), europium ( eu ), gadolinium ( gd ), terbium ( tb ), dysprosium ( dy ), holmium ( ho ), erbium ( er ), thulium ( tm ), ytterbium ( yb ), and lutetium ( lu ) may be contained . as the oxide semiconductor , for example , an indium oxide , a tin oxide , a zinc oxide , a two - component metal oxide such as an in โ€” zn - based oxide , a sn โ€” zn - based oxide , an al โ€” zn - based oxide , a zn โ€” mg - based oxide , a sn โ€” mg - based oxide , an in โ€” mg - based oxide , or an in โ€” ga - based oxide , a three - component metal oxide such as an in โ€” ga โ€” zn - based oxide ( also referred to as igzo ), an in โ€” al โ€” zn - based oxide , an in โ€” sn โ€” zn - based oxide , a sn โ€” ga โ€” zn - based oxide , an al โ€” ga โ€” zn - based oxide , a sn โ€” al โ€” zn - based oxide , an in โ€” hf โ€” zn - based oxide , an in โ€” la โ€” zn - based oxide , an in โ€” ce โ€” zn - based oxide , an in โ€” pr โ€” zn - based oxide , an in โ€” nd โ€” zn - based oxide , an in โ€” sm โ€” zn - based oxide , an in โ€” eu โ€” zn - based oxide , an in โ€” gd โ€” zn - based oxide , an in โ€” tb โ€” zn - based oxide , an in โ€” dy โ€” zn - based oxide , an in โ€” ho โ€” zn - based oxide , an in โ€” er โ€” zn - based oxide , an in โ€” tm โ€” zn - based oxide , an in โ€” yb โ€” zn - based oxide , or an in โ€” lu โ€” zn - based oxide , a four - component metal oxide such as an in โ€” sn โ€” ga โ€” zn - based oxide , an in โ€” hf โ€” ga โ€” zn - based oxide , an in โ€” al โ€” ga โ€” zn - based oxide , an in โ€” sn โ€” al โ€” zn - based oxide , an in โ€” sn โ€” hf โ€” zn - based oxide , or an in โ€” hf โ€” al โ€” zn - based oxide can be used . note that here , for example , an โ€œ in โ€” ga โ€” zn - based oxide โ€ means an oxide containing in , ga , and zn as its main components and there is no limitation on the ratio of in : ga : zn . further , a metal element in addition to in , ga , and zn may be contained . alternatively , a material represented by inmo 3 ( zno ) m ( m & gt ; 0 , where m is not an integer ) may be used as the oxide semiconductor . note that m represents one or more metal elements selected from ga , fe , mn , and co . alternatively , a material represented by in 3 sno 5 ( zno ) n ( n & gt ; 0 , where n is an integer ) may be used as the oxide semiconductor . for example , an in โ€” ga โ€” zn - based oxide with an atomic ratio of in : ga : zn = 1 : 1 : 1 (= 1 / 3 : 1 / 3 : 1 / 3 ) or in : ga : zn = 2 : 2 : 1 (= 2 / 5 : 2 / 5 : 1 / 5 ), or an oxide with an atomic ratio close to the above atomic ratios can be used . alternatively , an in โ€” sn โ€” zn - based oxide with an atomic ratio of in : sn : zn = 1 : 1 : 1 (= 1 / 3 : 1 / 3 : 1 / 3 ), in : sn : zn = 2 : 1 : 3 (= 1 / 3 : 1 / 6 : 1 / 2 ), or in : sn : zn = 2 : 1 : 5 (= 1 / 4 : 1 / 8 : 5 / 8 ), or an oxide with an atomic ratio close to the above atomic ratios may be used . further , an in โ€” sn โ€” zn - based oxide can be referred to as itzo ( registered trademark ), and as a target , an oxide target having a composition ratio of in : sn : zn = 1 : 2 : 2 , 2 : 1 : 3 , 1 : 1 : 1 , 20 : 45 : 35 , or the like in an atomic ratio is used . however , the composition is not limited to those described above , and a material having an appropriate composition may be used in accordance with necessary semiconductor characteristics ( such as mobility , threshold voltage , and variation ). in order to obtain necessary semiconductor characteristics , it is preferable that the carrier density , the impurity concentration , the defect density , the atomic ratio of a metal element to oxygen , the interatomic distance , the density , and the like be set as appropriate . for example , with the in โ€” sn โ€” zn - based oxide , a high mobility can be relatively easily obtained . however , the mobility can be increased by reducing the defect density in the bulk also in the case of using the in โ€” ga โ€” zn - based oxide . note that for example , the expression โ€œ the composition of an oxide including in , ga , and zn at the atomic ratio , in : ga : zn = a : b : c ( a + b + c = 1 ), is in the neighborhood of the composition of an oxide including in , ga , and zn at the atomic ratio , in : ga : zn = a : b : c ( a + b + c = 1 )โ€ means that a , b , and c satisfy the following relation : ( a โˆ’ a ) 2 +( b โˆ’ b ) 2 +( c โˆ’ c ) 2 โ‰ฆ r 2 , and r may be 0 . 05 , for example . the same applies to other oxides . the oxide semiconductor may be either single crystal or non - single - crystal . in the latter case , the oxide semiconductor may be either amorphous or polycrystalline . further , the oxide semiconductor may have either an amorphous structure including a crystalline portion or a non - amorphous structure . an amorphous oxide semiconductor can have a flat surface with relative ease ; therefore , when a transistor is manufactured with the use of the oxide semiconductor , interface scattering can be reduced , and relatively high mobility can be obtained with relative ease . in this embodiment , an oxide including a crystal with c - axis alignment , which has a triangular or hexagonal atomic arrangement when seen from the direction of an a - b plane , a surface , or an interface , will be described . in the crystal , metal atoms are arranged in a layered manner , or metal atoms and oxygen atoms are arranged in a layered manner along the c - axis , and the direction of the a - axis or the b - axis is varied in the a - b plane ( the crystal rotates around the c - axis ). such a crystal is also referred to as a c - axis aligned crystal ( caac ). an oxide including caac means , in a broad sense , a non - single - crystal oxide including a phase which has a triangular , hexagonal , regular triangular , or regular hexagonal atomic arrangement when seen from the direction perpendicular to the a - b plane and in which metal atoms are arranged in a layered manner or metal atoms and oxygen atoms are arranged in a layered manner when seen from the direction perpendicular to the c - axis direction . the caac is not a single crystal , but this does not mean that the caac is composed of only an amorphous component . although the caac includes a crystallized portion ( crystalline portion ), a boundary between one crystalline portion and another crystalline portion is not clear in some cases . in the case where oxygen is included in the caac , nitrogen may be substituted for part of oxygen included in the caac . the c - axes of individual crystalline portions included in the caac may be aligned in one direction ( e . g ., a direction perpendicular to a surface of a substrate over which the caac is formed or a surface of the caac ). alternatively , the normals of the a - b planes of the individual crystalline portions included in the caac may be aligned in one direction ( e . g ., a direction perpendicular to a surface of a substrate over which the caac is formed or a surface of the caac ). the caac becomes a conductor , a semiconductor , or an insulator depending on its composition or the like . the caac transmits or does not transmit visible light depending on its composition or the like . as an example of such a caac , there is a crystal which is formed into a film shape and has a triangular or hexagonal atomic arrangement when observed from the direction perpendicular to a surface of the film or a surface of a supporting substrate , and in which metal atoms are arranged in a layered manner or metal atoms and oxygen atoms ( or nitrogen atoms ) are arranged in a layered manner when a cross section of the film is observed . an example of a crystal structure of the caac will be described in detail with reference to fig1 a to 13e , fig1 a to 14c , and fig1 a to 15c . in fig1 a to 13e , fig1 a to 14c , and fig1 a to 15c , the vertical direction corresponds to the c - axis direction and a plane perpendicular to the c - axis direction corresponds to the a - b plane , unless otherwise specified . when the expressions โ€œ an upper half โ€ and โ€œ a lower half โ€ are simply used , they refer to an upper half above the a - b plane and a lower half below the a - b plane ( an upper half and a lower half with respect to the a - b plane ). furthermore , in fig1 a to 13e , o surrounded by a circle represents tetracoordinate o and o surrounded by a double circle represents tricoordinate o . fig1 a illustrates a structure including one hexacoordinate in atom and six tetracoordinate oxygen ( hereinafter referred to as tetracoordinate o ) atoms proximate to the in atom . here , a structure including one metal atom and oxygen atoms proximate thereto is referred to as a small group . the structure in fig1 a is actually an octahedral structure , but is illustrated as a planar structure for simplicity . note that three tetracoordinate o atoms exist in each of an upper half and a lower half in fig1 a . in the small group illustrated in fig1 a , electric charge is 0 . fig1 b illustrates a structure including one pentacoordinate ga atom , three tricoordinate oxygen ( hereinafter referred to as tricoordinate o ) atoms proximate to the ga atom , and two tetracoordinate o atoms proximate to the ga atom . all the tricoordinate o atoms exist on the a - b plane . one tetracoordinate o atom exists in each of an upper half and a lower half in fig1 b . an in atom can also have the structure illustrated in fig1 b because an in atom can have five ligands . in the small group illustrated in fig1 b , electric charge is 0 . fig1 c illustrates a structure including one tetracoordinate zn atom and four tetracoordinate o atoms proximate to the zn atom . in fig1 c , one tetracoordinate o atom exists in an upper half and three tetracoordinate o atoms exist in a lower half . alternatively , three tetracoordinate o atoms may exist in the upper half and one tetracoordinate o atom may exist in the lower half in fig1 c . in the small group illustrated in fig1 c , electric charge is 0 . fig1 d illustrates a structure including one hexacoordinate sn atom and six tetracoordinate o atoms proximate to the sn atom . in fig1 d , three tetracoordinate o atoms exist in each of an upper half and a lower half . in the small group illustrated in fig1 d , electric charge is + 1 . fig1 e illustrates a small group including two zn atoms . in fig1 e , one tetracoordinate o atom exists in each of an upper half and a lower half . in the small group illustrated in fig1 e , electric charge is โˆ’ 1 . here , a plurality of small groups forms a medium group , and a plurality of medium groups forms a large group ( also referred to as a unit cell ). now , a rule of bonding between the small groups will be described . the three o atoms in the upper half with respect to the hexacoordinate in atom in fig1 a each have three proximate in atoms in the downward direction , and the three o atoms in the lower half each have three proximate in atoms in the upward direction . the one o atom in the upper half with respect to the pentacoordinate ga atom in fig1 b has one proximate ga atom in the downward direction , and the one o atom in the lower half has one proximate ga atom in the upward direction . the one o atom in the upper half with respect to the tetracoordinate zn atom in fig1 c has one proximate zn atom in the downward direction , and the three o atoms in the lower half each have three proximate zn atoms in the upward direction . in this manner , the number of the tetracoordinate o atoms above the metal atom is equal to the number of the metal atoms proximate to and below each of the tetracoordinate o atoms . similarly , the number of the tetracoordinate o atoms below the metal atom is equal to the number of the metal atoms proximate to and above each of the tetracoordinate o atoms . since the coordination number of the tetracoordinate o atom is 4 , the sum of the number of the metal atoms proximate to and below the o atom and the number of the metal atoms proximate to and above the o atom is 4 . accordingly , when the sum of the number of tetracoordinate o atoms above a metal atom and the number of tetracoordinate o atoms below another metal atom is 4 , the two kinds of small groups including the metal atoms can be bonded . for example , in the case where the hexacoordinate metal ( in or sn ) atom is bonded through three tetracoordinate o atoms in the lower half , it is bonded to the pentacoordinate metal ( ga or in ) atom or the tetracoordinate metal ( zn ) atom . a metal atom whose coordination number is 4 , 5 , or 6 is bonded to another metal atom through a tetracoordinate o atom in the c - axis direction . in addition to the above , a medium group can be formed in a different manner by combining a plurality of small groups so that the total electric charge of the layered structure is 0 . fig1 a illustrates a model of a medium group included in a layered structure of an in โ€” sn โ€” zn โ€” o - based material . fig1 b illustrates a large group including three medium groups . note that fig1 c illustrates an atomic arrangement in the case where the layered structure in fig1 b is observed from the c - axis direction . in fig1 a , a tricoordinate o atom is omitted for simplicity , and a tetracoordinate o atom is illustrated by a circle ; the number in the circle shows the number of tetracoordinate o atoms . for example , three tetracoordinate o atoms existing in each of an upper half and a lower half with respect to a sn atom are denoted by circled 3 . similarly , in fig1 a , one tetracoordinate o atom existing in each of an upper half and a lower half with respect to an in atom is denoted by circled 1 . fig1 a also illustrates a zn atom proximate to one tetracoordinate o atom in a lower half and three tetracoordinate o atoms in an upper half , and a zn atom proximate to one tetracoordinate o atom in an upper half and three tetracoordinate o atoms in a lower half . in the medium group included in the layered structure of the in โ€” sn โ€” zn โ€” o - based material in fig1 a , in the order starting from the top , a sn atom proximate to three tetracoordinate o atoms in each of an upper half and a lower half is bonded to an in atom proximate to one tetracoordinate o atom in each of an upper half and a lower half , the in atom is bonded to a zn atom proximate to three tetracoordinate o atoms in an upper half , the zn atom is bonded to an in atom proximate to three tetracoordinate o atoms in each of an upper half and a lower half through one tetracoordinate o atom in a lower half with respect to the zn atom , the in atom is bonded to a small group that includes two zn atoms and is proximate to one tetracoordinate o atom in an upper half , and the small group is bonded to a sn atom proximate to three tetracoordinate o atoms in each of an upper half and a lower half through one tetracoordinate o atom in a lower half with respect to the small group . a plurality of such medium groups is bonded , so that a large group is formed . here , electric charge for one bond of a tricoordinate o atom and electric charge for one bond of a tetracoordinate o atom can be assumed to be โˆ’ 0 . 667 and โˆ’ 0 . 5 , respectively . for example , electric charge of a ( hexacoordinate or pentacoordinate ) in atom , electric charge of a ( tetracoordinate ) zn atom , and electric charge of a ( pentacoordinate or hexacoordinate ) sn atom are + 3 , + 2 , and + 4 , respectively . accordingly , electric charge in a small group including a sn atom is + 1 . therefore , electric charge of โˆ’ 1 , which cancels + 1 , is needed to form a layered structure including a sn atom . as a structure having electric charge of โˆ’ 1 , the small group including two zn atoms as illustrated in fig1 e can be given . for example , with one small group including two zn atoms , electric charge of one small group including a sn atom can be cancelled , so that the total electric charge of the layered structure can be 0 . when the large group illustrated in fig1 b is repeated , an in โ€” sn โ€” zn โ€” o - based crystal ( in 2 snzn 3 o 8 ) can be obtained . note that a layered structure of the obtained in โ€” sn โ€” zn โ€” o - based crystal can be expressed as a composition formula , in 2 snzn 2 o 7 ( zno ) m ( m is 0 or a natural number ). the above - described rule also applies to the following oxides : a four - component metal oxide such as an in โ€” sn โ€” ga โ€” zn - based oxide ; a three - component metal oxide such as an in โ€” ga โ€” zn - based oxide ( also referred to as igzo ), an in โ€” al โ€” zn - based oxide , a sn โ€” ga โ€” zn - based oxide , an al โ€” ga โ€” zn - based oxide , a sn โ€” al โ€” zn - based oxide , an in โ€” hf โ€” zn - based oxide , an in โ€” la โ€” zn - based oxide , an in โ€” ce โ€” zn - based oxide , an in โ€” pr โ€” zn - based oxide , an in โ€” nd โ€” zn - based oxide , an in โ€” sm โ€” zn - based oxide , an in โ€” eu โ€” zn - based oxide , an in โ€” gd โ€” zn - based oxide , an in โ€” tb โ€” zn - based oxide , an in โ€” dy โ€” zn - based oxide , an in โ€” ho โ€” zn - based oxide , an in โ€” er โ€” zn - based oxide , an in โ€” tm โ€” zn - based oxide , an in โ€” yb โ€” zn - based oxide , or an in โ€” lu โ€” zn - based oxide ; a two - component metal oxide such as an in โ€” zn - based oxide , a sn โ€” zn - based oxide , an al โ€” zn - based oxide , a zn โ€” mg - based oxide , a sn โ€” mg - based oxide , an in โ€” mg - based oxide , or an in โ€” ga - based oxide ; and the like . as an example , fig1 a illustrates a model of a medium group included in a layered structure of an in โ€” ga โ€” zn โ€” o - based material . in the medium group included in the layered structure of the in โ€” ga โ€” zn โ€” o - based material in fig1 a , in the order starting from the top , an in atom proximate to three tetracoordinate o atoms in each of an upper half and a lower half is bonded to a zn atom proximate to one tetracoordinate o atom in an upper half , the zn atom is bonded to a ga atom proximate to one tetracoordinate o atom in each of an upper half and a lower half through three tetracoordinate o atoms in a lower half with respect to the zn atom , and the ga atom is bonded to an in atom proximate to three tetracoordinate o atoms in each of an upper half and a lower half through one tetracoordinate o atom in a lower half with respect to the ga atom . a plurality of such medium groups is bonded , so that a large group is formed . fig1 b illustrates a large group including three medium groups . note that fig1 c illustrates an atomic arrangement in the case where the layered structure in fig1 b is observed from the c - axis direction . here , since electric charge of a ( hexacoordinate or pentacoordinate ) in atom , electric charge of a ( tetracoordinate ) zn atom , and electric charge of a ( pentacoordinate ) ga atom are + 3 , + 2 , and + 3 , respectively , electric charge of a small group including any of an in atom , a zn atom , and a ga atom is 0 . as a result , the total electric charge of a medium group having a combination of such small groups is always 0 . in order to form the layered structure of the in โ€” ga โ€” zn โ€” o - based material , a large group can be formed using not only the medium group illustrated in fig1 a but also a medium group in which the arrangement of the in atom , the ga atom , and the zn atom is different from that in fig1 a . next , electrodes 142 a and 142 b each of which functions as a source electrode or a drain electrode are formed in contact with the wide - gap semiconductor layer 144 . the electrodes 142 a and 142 b can be formed using a metal material such as molybdenum , titanium , tantalum , tungsten , aluminum , copper , chromium , neodymium , or scandium or an alloy material which contains any of these materials as its main component . in the case where gan is used for the wide - gap semiconductor layer 144 , titanium or the like is used as a material of the electrodes 142 a and 142 b each functioning as a source electrode or a drain electrode , and aluminum gallium nitride ( algan ) is used for a buffer layer for forming a two - dimensional electron gas between the electrodes 142 a and 142 b and the wide - gap semiconductor layer 144 . in addition , insulating layers 143 a and 143 b are formed in order to protect the electrodes 142 a and 142 b . next , planarization treatment is performed using chemical mechanical polishing ( cmp ) or the like . in this planarization treatment , the insulating layers 143 a and 143 b function as buffer layers for preventing the electrodes 142 a and 142 b from being removed . next , trenches for element isolation in the channel - length direction and trenches for element isolation in the channel - width direction are formed . these trenches for element isolation may have a continuous upper surface pattern shape or separate upper surface pattern shapes . in this embodiment , division of the wide - gap semiconductor layer is achieved by formation of the trenches ; thus , these trenches have a continuous upper surface pattern shape ( a lattice shape ) in fig1 c . during the formation of the trenches for element isolation in the channel - width direction , division into the electrode 142 a and the electrode 142 b can also be achieved . note that the timing of formation of the trenches for element isolation is not particularly limited . in addition , the depth of the trenches for element isolation is not limited to a depth at which the horizontal position of the bottoms thereof is the same as that of the bottoms of the trenches for the gate electrodes , as long as sufficient element isolation can be achieved . element isolation can be ensured by setting the horizontal position of the bottoms of the trenches for element isolation to be deeper than that of the bottoms of the trenches for the gate electrodes . then , a gate insulating layer 146 is formed so as to cover part of the wide - gap semiconductor layer 144 , the electrodes 142 a and 142 b each functioning as a source electrode or a drain electrode , and the insulating layers 143 a and 143 b . the gate insulating layer 146 is also formed on the inner walls and bottoms of the trenches for element isolation in the channel - length direction and the inner walls and bottoms of the trenches for element isolation in the channel - width direction . the gate insulating layer 146 can have a thickness of 1 nm to 100 nm and can be formed by a sputtering method , an mbe method , a cvd method , a pulse laser deposition method , an ald method , a coating method , a printing method , or the like as appropriate . the gate insulating layer 146 may be formed using a sputtering apparatus which performs film formation with surfaces of a plurality of substrates set substantially perpendicular to a surface of a sputtering target , which is so called a columnar plasma ( cp ) sputtering system . the gate insulating layer 146 can be formed using a silicon oxide film , a gallium oxide film , an aluminum oxide film , a silicon nitride film , a silicon oxynitride film , an aluminum oxynitride film , or a silicon nitride oxide film . further , the gate insulating layer 146 is preferably formed in consideration of the size of a transistor to be formed and the step coverage with the gate insulating layer 146 . in this embodiment , a silicon oxide film of sio 2 + ฮฑ ( ฮฑ & gt ; 0 ) is used as the gate insulating layer 146 . by using the silicon oxide film as the gate insulating layer 146 , oxygen can be supplied to the in โ€” ga โ€” zn โ€” o - based oxide semiconductor and favorable characteristics can be obtained . when the gate insulating layer 146 is formed using a high - k material such as hafnium oxide , yttrium oxide , hafnium silicate ( hfsi x o y ( x & gt ; 0 , y & gt ; 0 )), hafnium silicate to which nitrogen is added ( hfsi x o y n z ( x & gt ; 0 , y & gt ; 0 , z & gt ; 0 )), or hafnium aluminate ( hfal x o y ( x & gt ; 0 , y & gt ; 0 )), gate leakage current can be reduced . further , the gate insulating layer 146 may have a single - layer structure or a stacked structure . then , a gate electrode 148 a is formed over the gate insulating layer 146 so as to fill the trench for the gate electrode . the gate electrode 148 a can be formed using a metal material such as molybdenum , titanium , tantalum , tungsten , aluminum , copper , chromium , neodymium , or scandium or an alloy material which contains any of these materials as its main component . the gate electrode 148 a may have a single - layer structure or a stacked structure . as one layer of the gate electrode 148 a which is in contact with the gate insulating layer 146 , a metal oxide containing nitrogen , specifically , an in โ€” ga โ€” zn โ€” o film containing nitrogen , an in โ€” sn โ€” o film containing nitrogen , an in โ€” ga โ€” o film containing nitrogen , an in โ€” zn โ€” o film containing nitrogen , a sn โ€” o film containing nitrogen , an in โ€” o film containing nitrogen , or a metal nitride ( inn , snn , or the like ) film is used . these films each have a work function of 5 ev or higher , preferably 5 . 5 ev or higher , which enables the threshold voltage of the transistor to be positive when used as the gate electrode . accordingly , a so - called normally off switching element can be provided . when the gate electrode 148 a is formed in the trench for the gate electrode , the transistor 162 with a trench structure is formed . then , an insulating layer 149 is formed so as to cover the gate electrode 148 a and a gate electrode 148 b . as the insulating layer 149 , an insulating film providing favorable step coverage is preferably used . the insulating layer 149 can be formed using a silicon oxide film , a gallium oxide film , an aluminum oxide film , a silicon nitride film , a silicon oxynitride film , an aluminum oxynitride film , or a silicon nitride oxide film . in this embodiment , an aluminum oxide film is used as the insulating layer 149 . in fig1 a and 1b , the gate insulating layer 146 is formed in contact with a side surface of the wide - gap semiconductor layer 144 , and furthermore , the insulating layer 149 is formed . accordingly , in this embodiment , a silicon oxide film of sio 2 + ฮฑ ( ฮฑ & gt ; 0 ) covers a side surface of the wide - gap semiconductor layer 144 and an aluminum oxide film covers the silicon oxide film , thereby blocking oxygen so as not to be diffused from the silicon oxide film and pass through the insulating layer 149 . after the insulating layer 149 is formed , an insulating layer 150 for filling the trenches for element isolation is formed by a cvd method or the like . by filling the trenches for element isolation with the insulating layer 150 , element isolation regions 161 and 165 are formed . note that when the gate insulating layer 146 and the insulating layer 149 are stacked in the trenches for element isolation before the insulating layer 150 is formed , regions to be filled with the insulating layer 150 can be smaller and can be smoothly filled with the insulating layer 150 . after that , planarization treatment is performed using cmp or the like , whereby the structure illustrated in fig1 a and 1b can be obtained . as illustrated in fig1 b , a space between the gate electrode 148 a of the transistor 162 and the gate electrode 148 b of the transistor 163 adjacent thereto is also filled with the insulating layer 150 , which makes it possible to prevent a short - circuit between the gate electrodes . furthermore , as illustrated in fig1 a , a space between the electrode which functions as a source electrode or a drain electrode of the transistor 162 and an electrode which functions as a source electrode or a drain electrode of a transistor adjacent thereto in the channel - length direction is also filled with the insulating layer 150 , which makes it possible to prevent a short - circuit between these electrodes . in this embodiment , the wide - gap semiconductor layer 144 is formed in contact with the inner wall of the trench of 0 . 4 ฮผm ; thus , the channel length is approximately 0 . 8 ฮผm or more . in the case where an in โ€” ga โ€” zn โ€” o - based oxide semiconductor is used as the wide - gap semiconductor layer 144 , a transistor with a channel length of 0 . 8 ฮผm or more can be a normally off transistor , and the occurrence of short - channel effect can be prevented . in addition , by employing the trench structure , a reduction in the planar area of a transistor can be achieved , so that higher integration can be achieved . fig2 a and 2b illustrate an example of a semiconductor device which includes the transistor 162 illustrated in fig1 a to 1c , which can hold stored data even when not powered , and which has an unlimited number of write cycles . since the off - state current of the transistor 162 is small , stored data can be held for a long time owing to such a transistor . in other words , the frequency of refresh operation can be extremely lowered , which leads to a sufficient reduction in power consumption . fig2 a illustrates an example of a cross section of the semiconductor device . the semiconductor device illustrated in fig2 a includes a transistor 160 including a first semiconductor material in a lower portion , and a transistor 162 including a second semiconductor material in an upper portion . the transistor 162 is the same as that in embodiment 1 ; thus , for description of fig2 a and 2b , the same reference numerals are used for the same parts as those in fig1 a . here , the first semiconductor material and the second semiconductor material are preferably materials having different band gaps . for example , the first semiconductor material can be a semiconductor material ( such as silicon ) other than an oxide semiconductor , and the second semiconductor material can be an oxide semiconductor . a transistor including a material other than an oxide semiconductor can operate at high speed easily . on the other hand , a transistor including an oxide semiconductor can hold electric charge for a long time owing to its characteristics . although both of the above transistors are n - channel transistors in the following description , it is needless to say that p - channel transistors can be used . the technical nature of the disclosed invention is to use a wide - gap semiconductor in the transistor 162 so that data can be held . therefore , it is not necessary to limit a specific structure of the semiconductor device , such as a material of the semiconductor device or a structure of the semiconductor device , to the structure described here . the transistor 160 in fig2 a includes a channel formation region 116 provided in a substrate 100 including a semiconductor material ( such as silicon ), impurity regions 120 provided such that the channel formation region 116 is sandwiched therebetween , metal compound regions 124 provided in contact with the impurity regions 120 , a gate insulating layer 108 provided over the channel formation region 116 , and a gate electrode 110 provided over the gate insulating layer 108 . an electrode 126 is connected to part of the metal compound region 124 of the transistor 160 . here , the electrode 126 functions as a source electrode or a drain electrode of the transistor 160 . further , an element isolation insulating layer is formed on the substrate 100 so as to surround the transistor 160 , and an insulating layer 130 is formed so as to cover the transistor 160 . note that for higher integration , it is preferable that , as in fig2 a , the transistor 160 does not have a sidewall insulating layer . on the other hand , when the characteristics of the transistor 160 have priority , the sidewall insulating layer may be formed on a side surface of the gate electrode 110 and the impurity regions 120 may include a region having a different impurity concentration . as illustrated in fig2 a , the transistor 162 includes the wide - gap semiconductor layer 144 and has a trench structure . here , the wide - gap semiconductor layer 144 is preferably a purified wide - gap semiconductor layer . by using a purified wide - gap semiconductor , the transistor 162 which has extremely favorable electrical characteristics can be obtained . note that for the transistor 162 in fig2 a , an element isolation region 161 is provided in order to suppress leakage between elements due to miniaturization . furthermore , the wide - gap semiconductor layer 144 which is processed in an island shape and smaller than a region surrounded by the element isolation region 161 is used ; however , as described in embodiment 1 , a structure in which the wide - gap semiconductor layer 144 is not processed into an island shape until trenches for element isolation are formed may be employed . when the wide - gap semiconductor layer 144 is not processed into an island shape , the wide - gap semiconductor layer 144 can be prevented from being contaminated by etching during processing . it is needless to say that the number of steps can be reduced in the case where the wide - gap semiconductor layer 144 is not processed into an island shape . in the case of using the wide - gap semiconductor layer 144 which is processed in an island shape and smaller than the region surrounded by the element isolation region 161 , there is no need to divide the wide - gap semiconductor layer by formation of trenches for element isolation , and thus , the horizontal position of the bottoms of the trenches for element isolation can be shallower than that of the bottoms of trenches for gate electrodes , or the total area of the trenches for element isolation can be reduced . an insulating layer 151 is provided over the transistor 162 , and an electrode 153 which is electrically connected to the gate electrode 148 a is provided over the insulating layer 151 . in addition , an insulating layer 152 is provided over the electrode 153 . an electrode 154 is provided in an opening formed in the gate insulating layer 146 , the insulating layer 150 , the insulating layer 151 , the insulating layer 152 , and the like , and a wiring 156 which is connected to the electrode 154 is formed over the insulating layer 152 . note that although the metal compound region 124 , the electrode 142 b , and the wiring 156 are connected to one another through the electrode 126 and the electrode 154 in fig2 a , the disclosed invention is not limited thereto . for example , the electrode 142 b may be in direct contact with the metal compound region 124 . alternatively , the wiring 156 may be in direct contact with the electrode 142 b . next , an example of a circuit configuration corresponding to fig2 a is illustrated in fig2 b . in fig2 b , a first wiring ( 1st line ) is electrically connected to a source electrode of the transistor 160 . a second wiring ( 2nd line ) is electrically connected to a drain electrode of the transistor 160 . a third wiring ( 3rd line ) is electrically connected to one of a source and a drain electrodes of the transistor 162 , and a fourth wiring ( 4th line ) is electrically connected to a gate electrode of the transistor 162 . a gate electrode of the transistor 160 and the other of the source and drain electrodes of the transistor 162 are electrically connected to one electrode of a capacitor 164 . a fifth wiring ( 5th line ) is electrically connected to the other electrode of the capacitor 164 . the capacitor 164 can be formed with a pair of electrodes and an insulating layer interposed therebetween and serving as a dielectric , through the same process as the process for manufacturing the transistor 160 and the transistor 162 . note that the present invention is not limited to formation of the capacitor 164 through the same process as the process for manufacturing the transistor 160 and the transistor 162 , and layers of the capacitor 164 may be separately provided above the transistor 162 . for example , a trench - type capacitor or a stack - type capacitor may be separately formed above the transistor 162 or below the transistor 160 so as to be three - dimensionally stacked , whereby the degree of integration may be increased . the semiconductor device in fig2 b utilizes a characteristic in which the potential of the gate electrode of the transistor 160 can be held , and thus enables data writing , holding , and reading as follows . writing and holding of data will be described . first , the potential of the fourth wiring is set to a potential at which the transistor 162 is turned on , so that the transistor 162 is turned on . accordingly , the potential of the third wiring is supplied to the gate electrode of the transistor 160 and to the capacitor 164 . that is , predetermined charge is supplied to the gate electrode of the transistor 160 ( writing ). here , one of two kinds of charges providing different potentials ( hereinafter referred to as a low - level charge and a high - level charge ) is applied . after that , the potential of the fourth wiring is set to a potential at which the transistor 162 is turned off , so that the transistor 162 is turned off . thus , the charge supplied to the gate electrode of the transistor 160 is held ( holding ). in addition , a back gate electrode may be provided , and it is preferable that the transistor 162 be surely a normally off transistor by application of the voltage to the back gate electrode . in this embodiment , a semiconductor device which includes the transistor 162 illustrated in fig1 a to 1c , which can hold stored data even when not powered , which has an unlimited number of write cycles , and which has a structure different from the structure described in embodiment 2 will be described with reference to fig3 . the semiconductor device illustrated in fig3 includes a transistor 350 including a first semiconductor material in a lower portion , and a transistor 162 including a second semiconductor material in an upper portion . although a plurality of transistors is formed using semiconductor materials in the upper and lower portions , the transistor 350 and the transistor 162 will be typically described . note that fig3 which is taken along line b 1 - b 2 corresponds to a cross - sectional view perpendicular to the channel - length direction of transistors . here , the first semiconductor material and the second semiconductor material are preferably materials having different band gaps . for example , the first semiconductor material can be a semiconductor material ( such as silicon ) other than an oxide semiconductor , and the second semiconductor material can be an oxide semiconductor . a transistor including a material other than an oxide semiconductor can operate at high speed easily . on the other hand , a transistor including an oxide semiconductor can hold electric charge for a long time owing to its characteristics . the transistor 162 including the second semiconductor material in the upper portion is the same as the transistor 162 described in embodiments 1 and 2 ; thus , for description of fig3 , the same reference numerals are used for the same parts as those in fig1 a . the transistor 350 formed using the first semiconductor material in the lower portion will be described below . the transistor 350 includes a semiconductor substrate 310 , a gate insulating layer 314 , a semiconductor layer 316 , a conductive layer 318 , a protective insulating layer 320 , a sidewall insulating layer 322 , impurity regions 324 , and an insulating layer 326 . note that the semiconductor layer 316 and the conductive layer 318 function as a gate electrode , and the impurity regions 324 each function as a source region or a drain region . in addition , the transistor 350 is adjacently provided with shallow trench isolation ( sti ) regions 312 . the sti regions 312 can be formed as follows : first , trenches ( also referred to as grooves ) are formed by forming a protective insulating film in a desired region over the semiconductor substrate 310 and performing etching ; then , after the formation of the trenches , the trenches are filled with an insulating dielectric film . as the insulating dielectric film , a silicon oxide film , a silicon nitride film , or the like can be used . next , the transistor 350 will be described in detail . the gate insulating layer 314 of the transistor 350 can be formed as follows . an insulating film is formed over the semiconductor substrate 310 provided with the sti regions 312 , and then , patterning and etching are performed in a desired position , whereby a trench having a depth different from that of the sti regions 312 is formed in the semiconductor substrate 310 . after that , heat treatment is performed in an oxygen atmosphere , whereby the semiconductor substrate 310 in the trench is oxidized . in this manner , the gate insulating layer 314 can be formed . after the gate insulating layer 314 is formed , a silicon film is formed using an lpcvd method or the like . note that the silicon film is subjected to n + or p + doping treatment , heat treatment , or the like so as to obtain a polysilicon film , whereby a highly conductive semiconductor layer is formed . after that , a metal film is formed over the semiconductor layer by a sputtering method or the like . as the metal film , tungsten , titanium , cobalt , or nickel or an alloy film , a metal nitride film , a silicide film , or the like containing tungsten , titanium , cobalt , or nickel can be used . patterning is performed on a desired region over the metal film , and etching is performed , whereby the conductive layer 318 is formed . in addition , the semiconductor layer is etched using the conductive layer 318 as a mask , whereby the semiconductor layer 316 can be formed . note that the conductive layer 318 and the semiconductor layer 316 function as a gate electrode of the transistor 350 . next , the protective insulating layer 320 is formed over the conductive layer 318 . the protective insulating layer 320 can be formed in such a manner that a silicon oxide film , a silicon nitride film , or the like is formed using a plasma cvd method or the like and patterning and etching treatments are performed on a desired region . next , a silicon nitride film is formed using a plasma cvd method or the like so as to cover the semiconductor substrate 310 and the protective insulating layer 320 and is etched back , whereby the sidewall insulating layer 322 can be formed . next , the impurity regions 324 are formed by performing doping treatment using the protective insulating layer 320 and the sidewall insulating layer 322 as a mask . note that as a dopant , boron , phosphorus , or the like may be used , and as the impurity regions 324 , n + regions , p + regions , or the like can be formed as appropriate depending on the dopant used . note that the impurity regions 324 each function as a source region or a drain region of the transistor 350 . next , the insulating layer 326 is formed so as to cover the impurity regions 324 , the protective insulating layer 320 , and the sidewall insulating layer 322 . the insulating layer 326 can be formed using a silicon oxide film or the like by a plasma cvd method or the like . next , openings are provided in desired regions of the insulating layer 326 , and a connection electrode 325 and a connection electrode 331 are formed so as to be electrically connected to the impurity regions 324 . note that after the connection electrode 325 and the connection electrode 331 are formed , cmp treatment or the like may be performed to planarize surfaces of the insulating layer 326 , the connection electrode 325 , and the connection electrode 331 . next , a conductive film is formed using a sputtering method or the like over the insulating layer 326 , the connection electrode 325 , and the connection electrode 331 , and patterning and etching are performed on a desired region , whereby an electrode 328 and an electrode 332 are formed . as a material of the electrode 328 and the electrode 332 , tungsten , copper , titanium , or the like can be used as appropriate . next , an insulating layer 329 is formed over the insulating layer 326 , the electrode 328 , and the electrode 332 . the insulating layer 329 can be formed using a material and a method similar to those for the insulating layer 326 . through the above - described process , the semiconductor material 310 provided with the transistor 350 formed using a first semiconductor substrate can be formed . here , connections between the transistor 350 including the first semiconductor material in the lower portion and the transistor 162 including the second semiconductor material in the upper portion will be described below . the transistor 350 is electrically connected to the transistor 162 through the impurity region 324 , the connection electrode 325 , the electrode 328 , and a connection electrode 330 . on the other hand , another transistor 350 is electrically connected to the wiring 156 through the impurity region 324 , the connection electrode 331 , the electrode 332 , a connection electrode 334 , an electrode 336 , and a connection electrode 338 . in addition , the gate electrode of the transistor 350 ( i . e ., the semiconductor layer 316 and the conductive layer 318 ) is electrically connected to a source electrode of the transistor 162 . note that the connection between the gate electrode of the transistor 350 and the source electrode of the transistor 162 is not illustrated in fig3 , and the connection is established in a three - dimensional direction . as described above , the plurality of memory cells is formed in the upper portion with the transistors including an oxide semiconductor which is one of wide - gap semiconductors . since the off - state current of the transistor including an oxide semiconductor is small , stored data can be held for a long time owing to such a transistor . in other words , the frequency of refresh operation can be extremely lowered , which leads to a sufficient reduction in power consumption . on the other hand , for the peripheral circuit , a semiconductor material other than the oxide semiconductor is used . the semiconductor material other than the oxide semiconductor may be , for example , silicon , germanium , silicon germanium , silicon carbide , gallium arsenide , or the like and is preferably a single crystal semiconductor . a transistor including such a semiconductor material can operate at sufficiently high speed . therefore , the transistor including the material other than the oxide semiconductor can favorably realize a variety of circuits ( e . g ., a logic circuit or a driver circuit ) which needs to operate at high speed . a semiconductor device having a novel feature can be obtained by being provided with both a peripheral circuit including the transistor including a material other than an oxide semiconductor ( in other words , a transistor capable of operating at sufficiently high speed ) and a memory circuit including the transistor including an oxide semiconductor ( in a broader sense , a transistor whose off - state current is sufficiently small ). in addition , with a structure where the peripheral circuit and the memory circuit are stacked , the degree of integration of the semiconductor device can be increased . this embodiment can be implemented in appropriate combinations with the configurations described in the other embodiments . in this embodiment , a semiconductor device which includes the transistor 162 illustrated in fig1 a to 1c , which can hold stored data even when not powered , which has an unlimited number of write cycles , and which has a structure different from the structures described in embodiments 2 and 3 will be described with reference to fig4 a and 4b and fig5 . fig4 a illustrates an example of a circuit configuration of a semiconductor device , and fig4 b is a conceptual diagram illustrating an example of a semiconductor device . first , the semiconductor device illustrated in fig4 a will be described , and then , the semiconductor device illustrated in fig4 b will be described . in the semiconductor device illustrated in fig4 a , a bit line bl is electrically connected to a source electrode or a drain electrode of the transistor 162 , a word line wl is electrically connected to a gate electrode of the transistor 162 , and a source electrode or a drain electrode of the transistor 162 is electrically connected to a first terminal of a capacitor 254 . the transistor 162 including an oxide semiconductor as a wide - gap semiconductor has a characteristic of a significantly small off - state current . for that reason , a potential of the first terminal of the capacitor 254 ( or a charge accumulated in the capacitor 254 ) can be held for an extremely long period by turning off the transistor 162 . further , in the transistor 162 including an oxide semiconductor as a wide - gap semiconductor , a short - channel effect is not likely to be caused , which is advantageous . next , writing and holding of data in the semiconductor device ( a memory cell 250 ) illustrated in fig4 a will be described . first , the potential of the word line wl is set to a potential at which the transistor 162 is turned on , so that the transistor 162 is turned on . accordingly , the potential of the bit line bl is supplied to the first terminal of the capacitor 254 ( writing ). after that , the potential of the word line wl is set to a potential at which the transistor 162 is turned off , so that the transistor 162 is turned off . thus , the charge at the first terminal of the capacitor 254 is held ( holding ). because the off - state current of the transistor 162 is extremely small , the potential of the first terminal of the capacitor 254 ( or the charge accumulated in the capacitor ) can be held for a long time . next , reading of data will be described . when the transistor 162 is turned on , the bit line bl which is in a floating state and the capacitor 254 are electrically connected to each other , and the charge is redistributed between the bit line bl and the capacitor 254 . as a result , the potential of the bit line bl is changed . the amount of change in potential of the bit line bl varies depending on the potential of the first terminal of the capacitor 254 ( or the charge accumulated in the capacitor 254 ). for example , the potential of the bit line bl after charge redistribution is ( c b * v b0 + c * v )/( c b + c ), where v is the potential of the first terminal of the capacitor 254 , c is the capacitance of the capacitor 254 , c b is the capacitance of the bit line bl ( hereinafter also referred to as bit line capacitance ), and v b0 is the potential of the bit line bl before the charge redistribution . therefore , it can be found that assuming that the memory cell 250 is in either of two states in which the potentials of the first terminal of the capacitor 254 are v 1 and v 0 ( v 1 & gt ; v 0 ), the potential of the bit line bl in the case of holding the potential v 1 (=( c b * v b0 + c * v 1 )/( c b + c )) is higher than the potential of the bit line bl in the case of holding the potential v 0 (=( c b * v b0 + c * v 0 )/( c b + c )). then , by comparing the potential of the bit line bl with a predetermined potential , data can be read . as described above , the semiconductor device illustrated in fig4 a can hold charge that is accumulated in the capacitor 254 for a long time because the off - state current of the transistor 162 is extremely small . in other words , refresh operation becomes unnecessary or the frequency of the refresh operation can be extremely lowered , which leads to a sufficient reduction in power consumption . moreover , stored data can be held for a long period even when power is not supplied . next , the semiconductor device illustrated in fig4 b will be described . the semiconductor device illustrated in fig4 b includes a memory cell array 251 including a plurality of memory cells 250 illustrated in fig4 a and a memory cell array 252 including a plurality of memory cells 250 illustrated in fig4 a as memory elements in the upper portion , and a peripheral circuit 253 in the lower portion which is necessary for operating the memory cell array 251 and the memory cell array 252 . note that the memory cell array 252 is provided in an intermediate position between the memory cell array 251 and the peripheral circuit 253 and is provided over the peripheral circuit 253 ; thus , the memory cell array 251 and the memory cell array 252 are regarded as being provided in the upper portion . in the structure illustrated in fig4 b , the peripheral circuit 253 can be provided under the memory cell array 251 and the memory cell array 252 , and the memory cell array 251 and the memory cell array 252 can be stacked . thus , the size of the semiconductor device can be decreased . next , a specific structure of the semiconductor device illustrated in fig4 b will be described with reference to fig5 . the semiconductor device illustrated in fig5 includes a plurality of memory cells ( a memory cell 452 a and a memory cell 452 b ) formed in multiple layers in the upper portion , and a peripheral circuit 400 in the lower portion . the peripheral circuit 400 in the lower portion includes a transistor 450 including a first semiconductor material , and the plurality of memory cells ( the memory cell 452 a and the memory cell 452 b ) formed in multiple layers in the upper portion each include a transistor 162 including a second semiconductor material . note that fig5 which is taken along line c 1 - c 2 corresponds to a cross - sectional view perpendicular to the channel - length direction of transistors . here , the first semiconductor material and the second semiconductor material are preferably materials having different band gaps . for example , the first semiconductor material can be a semiconductor material ( such as silicon ) other than an oxide semiconductor , and the second semiconductor material can be an oxide semiconductor . a transistor including a material other than an oxide semiconductor can operate at high speed easily . on the other hand , a transistor including an oxide semiconductor can hold electric charge for a long time owing to its characteristics . the transistor 162 including the second semiconductor material in the upper portion is the same as the transistor 162 described above in embodiments 1 to 3 ; thus , for description of fig5 , the same reference numerals are used for the same parts as those in fig1 a and are not described in detail . here , the transistor 450 including the first semiconductor material in the lower portion will be described below . the transistor 450 in fig5 includes a channel formation region 404 provided in a substrate 402 including a semiconductor material ( such as silicon ), impurity regions 406 and high - concentration impurity regions 408 ( collectively , simply also referred to as impurity regions ) provided such that the channel formation region 404 is sandwiched therebetween , metal compound regions 410 provided in contact with the high - concentration impurity regions 408 , a gate insulating layer 411 provided over the channel formation region 404 , a gate electrode layer 412 provided in contact with the gate insulating layer 411 , and a source or drain electrode 418 a and a source or drain electrode 418 b electrically connected to the impurity regions . here , a sidewall insulating layer 414 is provided on a side surface of the gate electrode layer 412 . further , an element isolation insulating layer 403 is formed on the substrate 402 so as to surround the transistor 450 , and an interlayer insulating layer 420 and an interlayer insulating layer 422 are formed so as to cover the transistor 450 . the source or drain electrode 418 a and the source or drain electrode 418 b are electrically connected to the metal compound regions 410 through openings formed in the interlayer insulating layer 420 and the interlayer insulating layer 422 . in other words , the source or drain electrode 418 a and the source or drain electrode 418 b are electrically connected to the high - concentration impurity regions 408 and the impurity regions 406 through the metal compound regions 410 . note that in some cases , the sidewall insulating layer 414 is not formed , in order to achieve a higher degree of integration of the transistor 450 or the like . in addition , an electrode 424 a , an electrode 424 b , and an electrode 424 c which are electrically connected to the source or drain electrode 418 a and the source or drain electrode 418 b of the transistor 450 are provided over the interlayer insulating layer 422 , and planarization is achieved with an insulating layer 425 which covers the interlayer insulating layer 422 , the electrode 424 a , the electrode 424 b , and the electrode 424 c . the electrode 424 c is electrically connected to an electrode 428 through a connection electrode 426 . note that the electrode 428 is formed using the same layer as the source electrode layer and the drain electrode layer of the transistor 162 . in addition , a wiring 432 is electrically connected to the electrode 428 through a connection electrode 430 and is electrically connected to an electrode 436 which is formed using the same layer as the source electrode layer and the drain electrode layer of the transistor 162 , through a connection electrode 434 . in addition , the electrode 436 is electrically connected to a wiring 440 through a connection electrode 438 . with the electrode 424 c , the wiring 432 , and the wiring 440 , an electrical connection between memory cells , an electrical connection between the peripheral circuit 400 and memory cells , or the like can be established . note that fig5 illustrates , as an example , the semiconductor device in which two memory cells ( the memory cell 452 a and the memory cell 452 b ) are stacked ; however , the number of memory cells to be stacked is not limited thereto . three or more memory cells may be stacked . in addition , fig5 illustrates , as an example , the semiconductor device in which the memory cell 452 a , the memory cell 452 b , and the peripheral circuit 400 are connected through the electrode 424 c , the electrode 428 , the wiring 432 , the electrode 436 , and the wiring 440 ; however , the present invention is not limited thereto . two or more wiring layers and electrodes may be provided between the memory cell 452 a , the memory cell 452 b , and the peripheral circuit 400 . as described above , the plurality of memory cells formed in multiple layers in the upper portion is each formed with a transistor including an oxide semiconductor as a wide - gap semiconductor layer . since the off - state current of the transistor including an oxide semiconductor as a wide - gap semiconductor layer is small , stored data can be held for a long time owing to such a transistor . in other words , the frequency of refresh operation can be extremely lowered , which leads to a sufficient reduction in power consumption . on the other hand , for the peripheral circuit , a semiconductor material other than the oxide semiconductor is used . the semiconductor material other than the oxide semiconductor may be , for example , silicon , germanium , silicon germanium , silicon carbide , gallium arsenide , or the like and is preferably a single crystal semiconductor . alternatively , an organic semiconductor material or the like may be used . a transistor including such a semiconductor material can operate at sufficiently high speed . therefore , the transistor including the material other than the oxide semiconductor can favorably realize a variety of circuits ( e . g ., a logic circuit or a driver circuit ) which needs to operate at high speed . a semiconductor device having a novel feature can be obtained by being provided with both a peripheral circuit including the transistor including a material other than an oxide semiconductor ( in other words , a transistor capable of operating at sufficiently high speed ) and a memory circuit including the transistor including an oxide semiconductor ( in a broader sense , a transistor whose off - state current is sufficiently small ). in addition , with a structure where the peripheral circuit and the memory circuit are stacked , the degree of integration of the semiconductor device can be increased . this embodiment can be implemented in appropriate combinations with the configurations described in the other embodiments . in this embodiment , examples of application of the semiconductor device described in any of the above embodiments to portable devices such as cellular phones , smartphones , or electronic books will be described with reference to fig9 a and 9b and fig1 to 12 . in a portable device such as a cellular phone , a smartphone , or an electronic book , an sram or a dram is used so as to store image data temporarily . the reason why an sram or a dram is used is that a flash memory is slow in responding and is not suitable for image processing . on the other hand , an sram or a dram has the following characteristics when used for temporary storage of image data . in an ordinary sram , as illustrated in fig9 a , one memory cell includes six transistors , that is , transistors 801 to 806 , which are driven with an x decoder 807 and a y decoder 808 . the transistor 803 and the transistor 805 , and the transistor 804 and the transistor 806 form inverters , which enables high - speed driving . however , because one memory cell includes six transistors , a large cell area is one disadvantage . provided that the minimum feature size of a design rule is f , the area of a memory cell in an sram is generally 100 f 2 to 150 f 2 . therefore , the price per bit of an sram is the most expensive among memory devices . in a dram , as illustrated in fig9 b , a memory cell includes a transistor 811 and a storage capacitor 812 , which are driven with an x decoder 813 and a y decoder 814 . one cell is configured with one transistor and one capacitor and has a small area . the area of a memory cell in a dram is generally 10 f 2 or less . note that the dram needs to be refreshed periodically and consumes electric power even when a rewriting operation is not performed . on the other hand , the memory cell of the semiconductor device described in any of the above embodiments has an area of approximately 10 f 2 and does not need to be refreshed frequently . therefore , the area of a memory cell can be decreased , and power consumption can be reduced . next , fig1 is a block diagram of a portable device . the portable device illustrated in fig1 includes an rf circuit 901 , an analog baseband circuit 902 , a digital baseband circuit 903 , a battery 904 , a power supply circuit 905 , an application processor 906 , a flash memory 910 , a display controller 911 , a memory circuit 912 , a display 913 , a touch sensor 919 , an audio circuit 917 , a keyboard 918 , and the like . the display 913 includes a display portion 914 , a source driver 915 , and a gate driver 916 . the application processor 906 includes a cpu 907 , a dsp 908 , and an interface 909 ( if 909 ). in general , the memory circuit 912 includes an sram or a dram . by employing the semiconductor device described in any of the above embodiments for that portion , data can be written and read at high speed and can be held for a long time , and power consumption can be sufficiently reduced . next , fig1 illustrates an example of using the semiconductor device described in any of the above embodiments in a memory circuit 950 for a display . the memory circuit 950 illustrated in fig1 includes a memory 952 , a memory 953 , a switch 954 , a switch 955 , and a memory controller 951 . the memory circuit 950 is connected to a display controller 956 that reads and controls image data input through a signal line ( input image data ) and data stored in the memory 952 and the memory 953 ( stored image data ), and is also connected to a display 957 that displays an image based on a signal input from the display controller 956 . first , image data ( input image data a ) is produced by an application processor ( not illustrated ). the input image data a is stored in the memory 952 through the switch 954 . then , the image data stored in the memory 952 ( stored image data a ) is transmitted to the display 957 through the switch 955 and the display controller 956 , and is displayed on the display 957 . when the input image data a remains unchanged , the stored image data a is read from the memory 952 through the switch 955 by the display controller 956 normally at a frequency of approximately 30 hz to 60 hz . next , for example , when a user performs an operation to rewrite a screen ( i . e ., when the input image data a is changed ), the application processor produces new image data ( input image data b ). the input image data b is stored in the memory 953 through the switch 954 . also during that time , the stored image data a is regularly read from the memory 952 through the switch 955 . after the completion of storing the new image data ( the stored image data b ) in the memory 953 , from the next frame for the display 957 , the stored image data b starts to be read , transmitted to the display 957 through the switch 955 and the display controller 956 , and displayed on the display 957 . this reading operation continues until the next new image data is stored in the memory 952 . by alternately writing and reading image data to and from the memory 952 and the memory 953 as described above , images are displayed on the display 957 . note that the memory 952 and the memory 953 are not limited to separate memories , and a single memory may be divided and used . by employing the semiconductor device described in any of the above embodiments for the memory 952 and the memory 953 , data can be written and read at high speed and held for a long time , and power consumption can be sufficiently reduced . next , fig1 is a block diagram of an electronic book . fig1 includes a battery 1001 , a power supply circuit 1002 , a microprocessor 1003 , a flash memory 1004 , an audio circuit 1005 , a keyboard 1006 , a memory circuit 1007 , a touch panel 1008 , a display 1009 , and a display controller 1010 . here , the semiconductor device described in any of the above embodiments can be used for the memory circuit 1007 in fig1 . the memory circuit 1007 has a function to temporarily hold the contents of a book . for example , a user may use a highlight function . in some cases , a user wants to mark a specific portion while reading an electronic book . this marking function is called highlight function and is used to make a difference from the other portions by changing the display color , underlining , making characters bold , changing the font of characters , or the like . the function makes it possible to store and hold data of a portion specified by a user . in order to store the data for a long time , the data may be copied to the flash memory 1004 . also in such a case , by employing the semiconductor device described in any of the above embodiments , data can be written and read at high speed and held for a long time , and power consumption can be sufficiently reduced . as described above , the portable devices described in this embodiment each incorporates the semiconductor device according to any of the above embodiments . therefore , it is possible to obtain a portable device which is capable of reading data at high speed , holding data for a long time , and reducing power consumption . the configurations , methods , and the like described in this embodiment can be combined as appropriate with any of the configurations , methods , and the like described in the other embodiments . in this example , calculations were carried out to determine whether or not a short - channel effect is caused in the transistor having a trench structure which is described in embodiment 1 . for the calculations , device simulation software sentaurus device manufactured by synopsys , inc . was used . fig6 a shows a structure used for the calculation and the sizes of components . the thickness of the gate insulating layer is set to 5 nm , the thickness of the wide - gap semiconductor layer is set to 5 nm , and the depth of the trench for the gate electrode is set to 0 . 4 ฮผm . fig6 a shows a transistor having a trench structure in which the length of the bottom of the trench ( the length in the channel - length direction ) is 90 nm and the distance between the source electrode and the drain electrode ( the length in the channel - length direction ) is 110 nm . a material of the wide - gap semiconductor layer is an in โ€” ga โ€” zn โ€” o - based oxide semiconductor ( with a band gap of 3 . 15 ev , an electron affinity of 4 . 6 ev , and an electron mobility of 10 cm 2 / vs ), the work function of the electrodes in contact with the wide - gap semiconductor layer ( the source electrode and the drain electrode ) is 4 . 6 ev , and the work function of the gate electrode is 5 . 5 ev . fig6 b shows the result of a calculation of vg - id characteristics of the transistor having the trench structure ( with vds = 1 v at a temperature of 27 ยฐ c .). fig7 a shows a transistor having a trench structure in which the length of the bottom of the trench ( the length in the channel - length direction ) is 60 nm and the distance between the source electrode and the drain electrode ( the length in the channel - length direction ) is 80 nm fig7 b shows the result of a calculation carried out with the same conditions as in fig6 b except the length of the bottom of the trench and the distance between the source electrode and the drain electrode . fig8 a shows a transistor having a trench structure in which the length of the bottom of the trench ( the length in the channel - length direction ) is 30 nm and the distance between the source electrode and the drain electrode ( the length in the channel - length direction ) is 50 nm fig8 b shows the result of a calculation carried out with the same conditions as in fig6 b except the length of the bottom of the trench and the distance between the source electrode and the drain electrode . the results of the calculations show that all the transistors having the structures in fig6 a , 7 a , and 8 a have substantially the same characteristics . the threshold voltage ( vth ) of each transistor is 0 . 8 v and the subthreshold swing ( s value ) thereof is 60 mv / dec , which are favorable values . these calculation results reveal that a short - channel effect such as a negative shift of the threshold voltage or an increase in the subthreshold swing is not caused even when the distance between the source electrode and the drain electrode ( the length in the channel - length direction ) is decreased to 50 nm , and favorable transistor characteristics are obtained . for comparison , similar calculations were carried out using transistors having not a trench structure but a planar structure . as the distance between the source electrode and the drain electrode ( the length in the channel - length direction ) decreased , the channel length also decreased . a short - channel effect such as a negative shift of the threshold voltage or an increase in the subthreshold swing was caused . furthermore , an increase in leakage current ( off - state current ) generated when a negative bias was applied to the gate was also observed . compared with the results of the comparative calculations , the results of the calculations in fig6 b , 7 b , and 8 b are favorable . with the transistor structure described in embodiment 1 , the change in substantial channel length is small even when the distance between the source electrode and the drain electrode ( the length in the channel - length direction ) is decreased . therefore , a short - channel effect is not caused , and off - state current can be small . accordingly , a memory cell having favorable retention characteristics can be produced . this application is based on japanese patent application serial no . 2011 - 014628 filed with japan patent office on jan . 26 , 2011 and japanese patent application serial no . 2011 - 112673 filed with japan patent office on may 19 , 2011 , the entire contents of which are hereby incorporated by reference .
7
the present invention is one type of probe of the optical fiber , which is to be applied for rapid temperature measurement . refer to fig1 for a full structure diagram . when the probe is inserted into the object to be measured , the infrared wave from object &# 39 ; s radiation is received . the object &# 39 ; s composition , whether loose or solid , or structure , whether big or small , is irrelevant ; all can be measured . aimed at a certain distance from the object , the probe is also capable of receiving the infrared signals emitted . in fact , the optical fiber &# 39 ; s probe is an infrared wave - guide . the wavelength &# 39 ; s window of a general optical fiber composed of quartz is between 0 . 4 ฮผm and 2 . 0 ฮผm . the probe by use of this fiber , mentioned above , can measure the temperature of an object of 752 ยฐ f . ( 400 ยฐ c .) or above . even if the temperature exceeds 1832 ยฐ f . ( 1000 ยฐ c . ), the said fiber can still function in regard to non - contact measurement . however , in a submerge measuring case , the materials utilized to compose the optical fiber must be able to withstand high temperatures , above 1000 ยฐ c ., such as the blue gem fiber . when the measuring temperature is below 752 ยฐ f ., especially below room temperature , a quick response time and a high level of accuracy is difficult to maintain . the present invention applies a quartz capillary instead of the wave - guide at the low temperature block . the capillary has a diameter of 1 หœ 2 mm , and an inside hole diameter of 50 หœ 300 ฮผm . the middle ir ( 3 หœ 7 ฮผm ) is able to pass through the capillary inside the wave - guide , length of 1000 mm ; an 80 % transmission level can be achieved the outside surface of the capillary is covered by a nano refractive film , such as au , ag , and li . this type of nano film can easily be adjusted to control the thickness , between 40 and 200 ฮผm , while maintaining a relatively low cost . a heated object , any size , is a wave source . at this temperature , of the heated object , the optimum wavelength of radiation correlates , the same temperature . the optimum wavelength will shift to the direction of the short wave as temperature increases . in specific cases , involving certain waves , radiation power increases as the temperature increases , known as the plank law . w = ษ› ฮป ๎ขž ๎ขž ( t ) ๎ขž c 1 ฮป 5 ๎ข  [ exp ๎ข  ( c 2 ฮป ๎ขž ๎ขž t ) - 1 ] - 1 ( 1 ) where w is the power of light at the known wavelength with the corresponding temperature , c 1 and c 2 are constant , and ฮต ฮป ( t ) is the radiation coefficient , a function of ฮป and t . ฮต ฮป ( t ) can also be modified by utilizing different materials . for example , ฮต = 1 if the radiation is emitted by the blackbody . in order to remove the radiation coefficient , the powers obtained from two adjacent wavelengths must be compared , i . e . powers w 1 โ–ก w 2 are obtained from wavelengths ฮป 1 โ–ก ฮป 2 . suppose r ( t ) ๎ขž ๎ขž ยฃ ๎ขž 1 2 ๎ขž w 1 w 2 . r ( t ) = w 1 w 2 = [ ฮป 2 ฮป 1 ] 5 ๎ขž exp ๎ข  [ c 2 t ๎ขž ( 1 ฮป 2 - 1 ฮป 1 ) ] ( 2 ) first , in practice , radiation from a heat source , entering the wave - limiter 1 , functions to allow only two waves with wavelength ฮป 1 , ฮป 2 to enter the waveguide . the wave - limiter is , in fact , a block film of the visible light ; only a wave - block with a wavelength above 0 . 76 ฮผm is able to pass through . in general , the film is composed of polymers , such as polyethylene and polypropylene . the end surface can be molded , resembling a lens shape , to increase the diameter of the infrared wave - guide &# 39 ; s hole . second , the light wave will enter into the wave - splitter 2 , formed by a photoeching method of grating on the outer circle of the wave - guide ; the splitter 2 resembles the bragg grating of the optical fiber . the refractive wave will then divide a wide spectrum into two separate narrow - band spectra , or one narrow - band and one wide - band spectrum by adjusting the grating constant . the grating is then covered with a nano carbon film , 20 mm in length . the layer of carbon film applied forms a blackbody to adsorb stray lights emitted before the exponent / logarithm transfer occurs . the energy from the incident light transmits into the wave - guide in the form of an exponent , an anti - function of the logarithm . values are between 0 and 1 . in the following case , if a compound film composed of nano silicon crystal and polymer was previously painted on the inside wall of the capillary , the width of ฮป 1 โ–ก ฮป 2 would shift rapidly towards the long - wavelength direction . a compress function effect would occur , as well as a 3 หœ 7 ฮผm spectra enhancement , if the film &# 39 ; s layers utilized were between 20 and 50 . the compressed waves then enter into the logarithmic subtractive device 4 ; this principle idea is shown in fig2 . based on equation ( 2 ), the following is now assumed : once the two waves enter into the logarithmic subtractive device 4 , ฮป 2 will fall into a coupling waveguide due to a ฮป 2 transmission film 15 on the outer rim of the circle . the photon energy of ฮป 2 , ln w 2 , is absorbed by an adsorption layer 8 on both end surfaces of the wave - guide ; ฮป 1 corresponding energy , ln w 1 , will follow along through to the main wave - guide . the total energy in can be compared to that of the dual - wavelength . the radiation coefficient is eliminated as well as environmental disruptions . gathered from the logarithmic subtractive device 4 , drives the self - adjustable wave - cutting device 5 . as the photon energy passes through the vibration film 17 , lights emitted produce a shift and scanning phenomenon ; vibration frequency fluctuations occurring while photon energy strength changes , is the cause of the above - mentioned . light , from the grating 19 , converts into a light signal with a digital pulse , received by an infrared probe 6 . inside the probe , the optical digital value becomes an electric digital signal . fig3 shows structure details , describing the basic principle of the wave - cutting device . the vibration film 17 utilized is a compound film , composed of magnetic particles and polymer , on the substrate of polyester . when an infrared light illuminates the above compound film , a deformation of the polyester film occurs , the continuous change of ordered direction arrangement in the polarized magnetic molecules is the cause ; the electric and magnetic field in the light beam alternate . this type of deformation results transmission light scanning . an integrate ball of stray light 18 is able to absorb any light emitted at the edge . lights on the axis will pass disconnectedly through the grating 19 ; can be replaced by a micro - lens constructed of polymer . the sequence of optical pulses , with varying frequencies , released from the grating , is the optical digital signals . the signals are able to transmit over long distances or can be received directly by an opto - electric probe . in the present invention a cost efficient thermo - electric probe is applied . the digital signals carrying electric pulses , from above probe , display the corresponding temperature value onto a liquid crystal screen 11 ; a signal treating circuit 12 allows the above - mentioned . a variety of measured data is obtainable by utilizing the functional push button 10 ; another option is to connect to a computer to display the data . the nano - film of tic 16 on the infrared wave - guide and the nano - film of carbon on the wave - splitter can be adjusted by using the metal protecting sleeve , i . e . outer shell 8 and protect cover 9 . the optical fiber can be used directly without utilizing the mentioned protection . when the optical fiber probe is submerged into a high temperature environment , such as liquid steel , the material of the infrared waveguide will be constructed of blue gem from the optical fiber . in this case , a ceramic material , heat expansion efficient , similar to the blue gem , can replace the metal protecting sleeve . concluding from the above that , the optical fiber probe will first absorb the infrared light wave , gained from the heat source . the ฮป 1 หœ ฮป 2 wide band spectrum then divides into a dual - wavelength spectrum by passing through the wave - limiter and wave - splitter simultaneously before entering into the exponent / logarithm transfer 3 and the logarithm subtractive device 4 ; the comparison of the dual - wavelength can be concluded at this point . lastly , the self - adjustable wave - cutting device 5 , obtains the optical digital signals , performing the temperature measurement with high speed and accuracy . therefore , based on the principle of non - contact temperature measurement , the present invention does achieve contact measuring of the temperature . the digital transfer is realized by the utilization of the following : the wave - splitter 2 , the logarithm subtractive device 4 , and the self - adjustable wave - cutting device 5 , all of the present invention . the a / d exchange , carried out in the head of the sensor , increases the anti - disruption abilities of the sensor , as well as provides a method to resolve the issue of transmitting signals of the sensor over along range . [ 0031 ] fig4 shows an expanded application for this invention . lights from the led transmit to the sensor head , modulated by the measured biological , chemical , and physical quantities . a portion of the light flows into the measuring field , while other portions of the light reach the a / d exchange by the following : the wave - splitter 2 , the logarithm subtractive device 4 , and the self - adjustable wave - cutting device 5 . the signals , transmittable long - range , throughout the optical fiber , perform the data analysis . the head of the sensor 20 can be constructed out of a variety of materials , quartz , blue gem , and dual - refractive crystals , varying in shape such as a lens or prism . the end fragment can be painted with a variety of corresponding nano films to achieve quick and accurate measurements for various situations , such as temperature , pressure , velocity , density , concentration , refractive index , toxic gases , and bacteria .
6
the data processing apparatus with schedule control function according to the present invention mainly comprises a keyboard for inputting schedule data and various designation , memory units such as random access memory and read only memory ( ram and rom ) for storing schedule data and programs , and a central controlling unit which includes a microprocessor , for processing various data . the schedule data according to the present invention are basically composed of date , a time and contents entered at every time ; alarm setting data ( hereafter referred to as alarm data ) for setting date and time to generate an alarm when arriving at the date and time entered in the contents ; and preliminary alarm setting data ( hereafter referred to as preliminary alarm data ) for setting date and time obtained by calculating a time which is a predetermined time , for example several minutes , before the time when the alarm setting data is set and stored in the memory system at the unit of day . moreover , the schedule data may include marks such as picture marks , etc . visually expressing the aforesaid contents and secret setting data for preventing the entered contents from perusal by other persons . the data processing apparatus with schedule control functions according to the present invention is constructed so that the schedule data , the alarm data or preliminary alarm data which are set are displayed on a display unit or display screen based on the alarm data . fig1 a and 1b are block diagrams showing a construction of a data processing apparatus with schedule control function in a word processor designed for the japanese language . in fig1 a and 1b , reference numeral 20 denotes a key input part having numerical keys , function keys , alphabet / kana keys and the like . the key input part 20 is connected to a main control part 21 , and schedule data inputted from the key input part 20 , a character string for kana / kanji conversion and various designations are provided to the main control part 21 . the main control part 21 controls the text edit control part 22 , a schedule control part 23 , a directory control part 24 and an alarm control part 25 according to various programs stored in rom ( not indicated ) and incorporated therein , and also controls a display part 26 , a print part 27 and a timer 28 . in order to control the kana / kanji conversion part 29 and a text data memory 30 , the text edit control part 22 creates text according to data inputted from the key input part 20 , and stores the created text in the text data memory 30 . the kana / kanji conversion part 29 is a unit for converting inputted kana data into corresponding kanji or kana , and any construction known in the relevant field may be employed . text data memory 30 may be constructed , of , for example ram , or may be constructed of ram and an external memory using floppy disk or the like as storage mediums . the basic function of the japanese word processor is carried out according to the aforementioned construction . main controlling of the schedule control is carried out by the schedule control part 23 so that respective data are stored in a schedule data memory 31 , memo data memory 32 , the first to fifth format data memories 33 to 37 , calendar data memory 38 and keyword memory 39 . the memo data stored in the memo data memory 32 consists of additional information which cannot be entered in the contents of the schedule data and information which is inputted at the time of preliminary alarm data setting stating the reason for setting the preliminary alarm . an additional information is assigned to one particular data . the first format data memory 33 stores an initial display screen format f which is displayed when the power is supplied initially , and as shown in fig2 functions to display a schedule data of the day ( today &# 39 ; s ), which is computed , by the timer 28 , and includes a memo data of the day , and a calendar of the month to which the day pertains each on the same display screen . the second format data memory 34 stores , as shown in fig3 a display screen format a for displaying calendars for three complete months including the month and the day on which the power is supplied or a specified data , the preceding month and the following month thereto , and a schedule for several days including today &# 39 ; s date or specified date each on the same display screen . the third format data memory 35 stores , as shown in fig4 a display screen format b consisting of the schedule from a certain starting date only . the fourth format data memory 36 stores , as shown in fig5 a display screen format c consisting of a schedule for the one month immediately preceding today &# 39 ; s date . the fifth format data memory 37 stores , as shown in fig6 a display screen format d consisting of an annual schedule of predetermined events , anniversaries and others . the calendar data memory 38 stores plural calendars formed in a table type by arranging days of one month according to seven days in a week provided by the schedule control part 23 . the keyword memory 39 stores a keyword inputted from the key input part 20 , for example , a synonym which is a word having similar signification such as &# 34 ; parents &# 34 ; and &# 34 ; father and mother &# 34 ;, or a title of a project and a name of person concerned . then , the directory control part 24 operates for controlling data on directory management , stores directory data such as full name , company name , phone number , address and others in an address data memory 40 , reads the directory data and displays on a screen of the display part 26 in a predetermined display format stored as the sixth format data memory 41 . when an alarm data is set in the schedule data , the alarm control part 25 drives an alarm generator 43 which is activated when alarm time data stored in an alarm time memory 42 corresponds to a predetermined date . the display part 26 is composed of , for example , crt ( cathode - ray tube ), lcd ( liquid crystal display ), driving circuits and a displaying buffer temporarily for storing data to be displayed . printers widely known in the art such as heat transfer type , needle dot impact type printers or the like can be supplied as the print part 27 . print part 27 may be other than a centronics - type interface for external printers . the timer 28 computes the present date and time according to date and time data inputted from the key input part 20 at initialization , and outputs specific time information used for schedule management and alarm control to the schedule control part 23 through the main control part 21 . the timer 28 is backed up by a battery so that it will operate even after power for the entire system is cut off . furthermore , the timer 28 stores the alarm time nearest to the present time while using period sent from the alarm control part 25 , and also compares point by point the present date and time with the stored alarm time data after the power source is cut off . in such a manner , when these times are equal , the alarm signal which engages the power source is outputted to a power source circuit which is not illustrated in the diagram . the operation of an embodiment of the instant invention is shown in fig7 to fig1 , in which the schedule data and memo data are assumed to be stored respectively in the schedule data memory 31 and memo data memory 32 . in fig7 when an operator first inputs a keyword from the key input part 20 , the keyword is stored through the main control part 21 and the schedule control part 23 into the keyword memory 39 ( step 200 ). then , the schedule data having the stored keyword is retrieved . in this retrieval of the schedule date , one schedule datum is first picked out from the schedule data memory 31 ( step 201 ) and the schedule datum is compared with the keyword memory stored in the keyword memory 39 ( step 202 ). if they are the same , the schedule data is outputted to the display part 26 or print part 27 , which are output means ( step 203 ). then , the schedule control part 23 judges whether the remained data exist or not in the schedule data memory 31 ( step 204 ). if it exists , the next piece of data is provided to be picked out ( step 205 ) and the processing then returns to step 201 . thereafter , the aforesaid step 201 to step 205 are repeatedly executed until the last of all the schedule data having the keyword are collectively displayed on the display part 26 or print part 27 so that they can be seen visually . accordingly , even if many kinds of different schedule data are inputted , only the schedule data mutually concerned can be displayed collectively by designating the keyword of a project title and a name of person concerned , for instance . therefore , it becomes easy to display a schedule data list without complication and only a desired schedule data can be confirmed quickly . the operation of the alarm will be explained as it is shown in fig8 a and 8b to fig1 . in fig8 a and 8b , the initial conditions of each memory and the display part 26 and the like are first set by the initialization processing ( step 210 ). thereafter , key sense is executed ( step 211 ) in order to judge whether any key is depressed on the key input part 20 or not ( step 212 ). if any key is depressed , the keycode of the depressed key is judged ( step 213 ), and then , processing occurs in correspondence with the keycodes such as schedule data inputting ( a - processing ), alarm setting ( b - processing ) and further schedule data registration ( c - processing ), executed respectively ( step 214 , 215 and 216 ). if the keycode indicates that a key has an inhibited input , the operator will be informed by a buzzer sound that the input cannot be executed ( step 217 ). after each processing is executed , the key sense will be executed again by returning to step 211 . if the key input is not executed , the present data and time are displayed ( step 218 ). then , the displayed present date is compared with alarm time data stored in the alarm time memory 42 ( step 219 ), and the present date and alarm time data are compared to determine whether they are conformable or not ( step 220 ). if they are incongruent , the processing returns to step 211 . on the contrary , if they are conformable , the alarm control part 25 will sound the buzzer by driving an alarm generator 43 ( step 221 ). at the same time , the date and time , and the contents of the schedule data that are set by the alarm ( alarm requisition ) are displayed ( step 222 ). next , the time of the schedule data and the time of a next schedule data ( i . e ., after the schedule data in time order ) are set into the alarm time memory 42 ( step 223 ). then , in addition to calculating and displaying the time difference between both times ( step 224 ), the time and contents of the next schedule data are displayed ( step 225 ). since the pictures of steps 222 , 224 and 225 are displayed on the same display screen , respective elements are displayed at the same time . in this case , an example of the picture plane or display screen is shown in fig9 . accordingly , when the schedule data set by the alarm is displayed , the contents and time difference between the next piece of schedule data and the original piece of schedule data can be confirmed simultaneously . so , the time to spare , i . e . the time remaining before the schedule event , can be known without using other devices and functions , and therefore the operator is able to use time more effectively . further , the next data may be that for which the alarm is set , and the picture plane may be employed to show respective schedule data , and the data and time thereof , displayed partially as a window display on the display screen with the picture plane format a , as shown in fig1 . as hereafter described , the data processing apparatus with schedule control function according to the embodiment may be designed so that the schedule data having the set alarm are displayed in preference to other data during operation , and moreover , when the apparatus is not operated , the schedule data is displayed after the power source of the apparatus is turned on . namely , as illustrated in fig1 a and 11b , after the power source is turned on either by a power source switch or a signal of the timer 28 , the initial conditions for each memory and the display part 26 and the like are set by the initialization processing ( step 230 ). then , in order to check that the power source is turned on either by the power source switch or an alarm signal outputted from the timer 28 , the timer 28 is checked to determine whether the alarm signal exists or not ( step 231 ). if the alarm signal does not exist , a decision is made that the power source was turned on by the power source switch , and then , ordinary processing such as text input , schedule input and others will be executed ( step 232 ). during ordinary processing , where a key input is not executed , the present date and time are compared with the alarm time data ( step 233 ). if they are conformable ( step 234 ), an interruption processing signal is generated ( step 235 ). if they are incongruent , the processing returns to step 232 . when the interruption processing signal is generated , ordinary processing is suspended for a period of time , and the alarm control part 25 drives the alarm generator 43 to sound the buzzer ( step 236 ). thereafter , as shown in fig1 , the time scheduled , and the contents and reason ( memo ) are displayed in the window ( step 237 ). in this condition , if a function key ( not illustrated in the drawing ) which means &# 34 ; release &# 34 ; of the key input part 20 is depressed ( step 238 ), the display screen treated by step 237 is cleared ( step 239 ) and the processing returns to step 232 . if it is determined that the alarm signal exists at step 231 , the display is first cleared ( step 240 ), and then the time and contents of the schedule and the reason are displayed ( step 241 ). at the same time , the alarm generator 43 is engaged to sound the buzzer ( step 242 ). thereafter , the schedule data memory 31 is retrieved and schedule data which is set for the alarm time in the nearest future from the present time is extracted from the schedule data memory 31 ( step 243 ). then , the contents of the alarm time memory 42 is updated ( step 244 ), and furthermore , the alarm time data stored in the timer 28 is updated ( step 245 ). thereafter , in order to stop the sound of the alarm after the predetermined time has passed , a counter for an alarm control part 25 is set ( step 246 ) and decreased ( step 247 ), and the alarm sound is stopped when the counter becomes zero ( steps 248 and 249 ). after these processing are finished , the power source is turned off automatically ( step 250 ). accordingly , in spite of the operating conditions and whether the power source is turned on or off , the scheduled matter is presented and the contents of the corresponding schedule data and others are displayed when the set date and time come to the present date and time . therefore , the operator can easily grasp the time for which items have is scheduled . since the alarm is generated even while the power source is turned off , it is unnecessary to leave the power source turned on . so , the apparatus can be used economically from the view of minimizing power consumption . next , the operation of the preliminary alarm is shown in fig1 a and 13b . in fig1 a and 13b , when an alarm is set via input through the key input part 20 ( step 260 ), the input is analyzed by the main control part 21 and then transferred to the schedule control part 23 as an item of data . the schedule control part 23 determines whether the date and time of the transferred data is after or before the present data and time , that is , whether the date and time of the transferred data exists within the range capable of being setting or not ( step 261 ) and if the data is unsuitable , it is treated as erroneous . if the data exists within the range , the alarm data is arranged and the information data about the type of generated alarm are set as a unit of data by the main control part 21 ( step 262 ). in this instance , the decision whether the preliminary alarm is to be set several minutes before ( effective or ineffective ) is executed by the schedule control part 23 ( step 263 ). if the result is effective , the time which is a predetermined time ( about five minutes ) before the time of the inputted date and time is calculated ( step 264 ). then , the present time outputted from the timer 28 is compared with the calculated time to judge whether the calculated time is past or not against the present time ( step 265 ). if the calculated time is not past , the data of the time is transferred through the main control part 21 to the alarm control part 25 in order to set a preliminary alarm time data entry ( step 266 ). the preliminary alarm time data entry is compared with other data stored in the alarm time memory 42 by the alarm control part 25 to check whether the preliminary alarm time data entry is in nearest future from the present time or not and to judge whether the preliminary alarm time data can be set in the timer 28 or not ( step 267 ). if it is possible to set the preliminary alarm time data , the preliminary alarm time data entry is made as a structure for setting the timer 28 ( step 268 ) and is also set into the timer 28 through the main control part 21 ( step 269 ). simultaneously , the preliminary alarm time data is saved in the buffer for setting the present time in the alarm time memory 42 ( step 270 ). regarding the generation of an alarm , the alarm generating time is first judged to determine whether the time is correct or not ( step 271 ). if it is correct , the time is judged to determine whether it is a scheduled alarm of the aforesaid alarm data set with a requisition of alarm and the preliminary alarm time data or only a simple alarm data which is set at another time to sound the buzzer when the set time arrives ( step 272 ). in the instance where it is a scheduled alarm , a decision is made to determined if there is a memo data entry associated with ( step 273 ). if there is a memo data entry , the memo data is picked out ( step 274 ) and displayed in the window of the display part 26 together with the date and time , and the contents of the schedule data ( step 275 ). in this instance , the alarm generator 43 is simultaneously actuated to sound the buzzer . in the next place , the generated alarm is viewed to determine whether it is the preliminary alarm or not ( step 276 ). if it is the preliminary alarm , the alarm time data of an original alarm is set for the original alarm generation ( step 277 ). thereafter , the retrieval for alarm data set at the next time is executed ( step 278 ) to determine whether the alarm data exists or not ( step 279 ). when the alarm data exists , the processing returns to step 262 . where the alarm data does not exist , the alarm generation is released ( step 280 ). accordingly , by generating the preliminary alarm before the original alarm generating time , it becomes possible to prepare for one &# 39 ; s schedule , set the alarm , and prevent the person from being tardy . further , where the preliminary alarm time data is effectively set in the timer 28 , if the preliminary alarm data is changed to be ineffective , the data is deleted at this point of time and the aforesaid series of operations are repeated on the assumption that new data will be inputted by changing to actual time data . next , the operation for designating a day of week to generate the alarm will be explained as shown in to fig1 to fig1 . in fig1 , in order to enter into the alarm setting mode , when the key input part 20 is first operated on the initial picture plane , the alarm setting picture plane is displayed ( step 290 ). under these conditions , the system waits for a key input from the key input part 20 ( step 291 ). at the time , on the display screen , the alarm time and day - of - week which are set at present time are displayed with a picture plane or screen ( or window ) as shown in fig1 . in the alarm setting mode , adding , changing and erasing can be executed , and new settings can be entered . when the function keys ( for changing and deleting ) are depressed ( steps 292 and 293 ), processing for changing or deleting can be executed respectively ( steps 294 and 295 ). when the cursor moving keys are depressed on the key input part 20 in order to adequately move the cursor 50 on the display screen ( step 296 ), the cursor moving processor is executed and the cursor 50 is moved to the desired position ( step 297 ). also , when the function keys for end or release are depressed ( step 298 ), the processing for deleting the displayed picture plane is executed ( step 299 ). in the next place , when the alarm is actually set , the required modes are respectively selected in order to execute the above adding processing as mentioned in step 294 and changing processing in step 295 . when the changing mode is selected , the processing will be explained below . in fig1 , the alarm data located in the cursor position is first picked out ( step 300 ). here , if there is data ( step 301 ), the picture plane is changed for data inputting ( step 302 ). as shown in fig1 , for a display screen for changing , the areas for time designation and day - of - week designation are set in the window . when the cursor is moved within the window , the position of the cursor is judged to determined whether it is placed in the time designation area or day - of - week designation area ( step 303 ). if the cursor is placed in the time designation area , only in the case when a correct time is inputted , the time can be set ( step 304 ). thereafter , the state is checked to determine whether it is &# 34 ; end &# 34 ; or not ( step 305 ). if it is &# 34 ; end &# 34 ;, the changing mode will be released . in the case of step 303 , if the cursor is placed in the day - of - week designation area , the system await key inputting ( step 306 ). the day - of - week designation is executed by respective keys on the key input part 20 . namely , on the key input part 20 , there are seven function keys to individually designate each day of the week from monday to sunday , a function key to collectively designate five days of the week from monday to friday , a function key to collectively designate saturday and sunday , and furthermore , a function key to designate every day . the next stage is a determination of which function key is depressed ( step 307 ). if any function key is depressed , the day - of - week processing is executed corresponding to the function of the depressed function key ( step 308 ). for example , if the function key set for wednesday is depressed where &# 34 ; monday , friday and saturday &# 34 ; are already set , the setting state is changed to &# 34 ; monday , wednesday , friday and saturday &# 34 ;, and then , &# 34 ; sun , wed , fri and sat &# 34 ; are displayed in the day - of - week designation area . also , if the function key set for &# 34 ; monday to friday &# 34 ; is depressed where &# 34 ; monday , tuesday , saturday and sunday &# 34 ; are already set , the setting state is changed to &# 34 ; monday to saturday &# 34 ;, and then , &# 34 ; mon , tue , wed , thu , fri and sat &# 34 ; are displayed in the day - of - week designation area . after the inputting of the day of the week is completed according to the processing as described above , if the execute key is depressed without moving the cursor 50 ( steps 309 and 310 ), the alarm setting processing ( alarm handler ) is executed ( step 311 ). if the release key is depressed without depressing the execute key ( step 312 ), the changing mode is finished without setting . if it is determined that the cursor 50 is moved at step 309 , the cursor moving processing is executed ( step 313 ), and cursor position is determined after returning to step 303 . among the function keys , there is a function key for setting the function to delete all the days of the week that where set ( deleting for day - of - week ). when the function key is depressed , all the days of the week that were set are collectively and simultaneously deleted . also , where a designated day of the week is to be deleted , the day can be deleted by depressing the function key which is set for that day of week desired to be deleted . by designating the day of the week as mentioned above , an alarm setting corresponding to the purpose for generating that alarm can be achieved . after setting the alarm corresponding to importance ( rank ) of the contents of the schedule data or type of contents ( such as company business and private use ), various types of alarm are generated by changing the tone , sound length , volume and rhythm corresponding to the setting . hereinafter , the operation for generating the various types of alarm will be described according to fig1 . in fig1 , where an alarm is set for schedule data , a processing of alarm generating judgment is executed after checking if the alarm time is conformable ( step 320 ). if the generation of alarm is judged ( step 321 ), the generation of alarm and the time of alarm generation are displayed on the display screen ( step 322 ). the alarm generated in this point of time is judged to determine whether it is a scheduler alarm or a weekly alarm designated with a day of the week ( step 323 ). in the case of scheduler alarm , the existence of message accompanying the scheduled alarm is locked ( step 324 ). if a message exists , the message is displayed in the window of the display screen ( step 325 ). where a weekly alarm without a message and after the message of step 325 is displayed , whether the alarm sound is given or not is determined since the requisition of the alarm sound has been set ( step 326 ). where an alarm has been set , a type of alarm sound is classified ( step 327 ). when the alarm is set , the importance of the schedule data are to be entered . for example , &# 34 ; most important , important and ordinary &# 34 ; can be classified . the words of the classification are associated with symbols and are also set so the words can displayed . by correspondence with the classification of importance , types of the alarm sound are respectively selected . apart from these , the classification may be set according to an attribute of schedule data such as &# 34 ; schedule 1 , schedule 2 and schedule 3 &# 34 ;. regarding the sound of the alarm , all the sounds of the buzzer are varied by changing a musical interval ( high - and low - pitched sounds ), a continuously generated length of the buzzer sound , and interval between shots of buzzer and others . for example , by combining the three elements abovementioned , a multiplicity of types of alarm sound can be made . and , after step 327 is executed , the alarm sound is generated ( step 328 ). high - pitched sound is especially recommended for most important schedule data so that the generated sound can be recognized by the operator . also , in the case of classification by an attribute of schedule data , the classification may be done by changing an interval and rhythm of the alarm sound . in such a manner , the tone quality of the alarm can be changed according to an operator &# 39 ; s intention about types of contents of schedule data , such as importance of the schedule data , kinds of company business and private use , purpose and place of schedule . accordingly , when the alarm sounds , the cause of the alarm can be grasped without viewing the display screen , so , the schedule can be controlled more smoothly and quickly .
6
a grounded metal plate may be embedded within a land grid array ( lga ) electronic socket . the plate may provide a balancing capacitance that compensates for the inductance of the socket , reducing the discontinuity presented by the socket interconnect elements in some embodiments . referring to fig1 , a package assembly 10 includes an lga package 12 coupled by contacts 22 to a socket 16 . the embedded conductive plate 18 is grounded . the socket contact 22 has a land 23 on one end , extends through the conductive plate 18 , and has a deformed end 26 over the plate 18 that spring contacts the package 12 . the grounded conductive plate 18 has openings 20 to allow contacts 22 to pass through . capacitance c arises between a contact 22 and the grounded conductive plate 18 as indicated in fig1 . the conductive plate 18 provides capacitive coupling to each contact 22 , which may reduce the impedance discontinuity at the socket 16 . morover , coupling between adjacent contact 22 pairs may be improved , enabling use of the socket 16 for differential signaling in some embodiments . initially , the electrical properties of the electronic package 12 are identified . the electrical properties of the contacts 22 in the socket 16 are determined . an inductance is determined . a desired impedance between each contact 22 and the conductive plate 18 is determined . the inductance may be fixed for a particular socket . therefore , by identifying a desired impedance , the capacitance c can be varied to get the desired performance . the diameter of each hole 20 in the conductive plate 18 is determined to achieve the desired impedance . the diameter of the hole 20 can be varied to vary the capacitance c between the conductive plate 18 and the contact 22 . therefore , knowing a desired impedance , the hole 20 diameter may be set to achieve a particular capacitance c that produces the desired impedance . for a particular electronic package assembly 10 , the desired impedance may be the same for every contact 22 on the socket 16 . in this case , the diameter of each hole 20 in the grounded conductive plate 18 may be the same . however , it is possible that different impedances are desired for different contacts 22 on a socket 16 based , for instance , on the size of the contact 22 or the signal evolving from the contact . in this case , the grounded conductive plate 18 may have holes 20 of varying diameters . a land grid array package 12 , which may carry an integrated circuit , may be contacted from below by the deformed end 26 . the deformed end 26 may have a curved upper contact portion . the contact 22 may have a generally horizontally deformed portion 24 , and a bent section 21 that couples to a vertical section 23 . the vertical section 23 may be the portion of the contact 22 that extends through the embedded conductive plate 18 . in one embodiment , stamped metal contact land grid array technology may be utilized . referring to fig2 , the package 12 may be clamped onto the socket 16 in accordance with one embodiment , depressing the contact 22 deformed ends 26 . some of the contacts 22 may be coupled to solder balls 32 , which are electrically coupled to a grounded motherboard 28 . however , other contacts 30 are of a slightly different configuration . those contacts 30 may have v - shaped contacting portions 31 , which have land surfaces 33 , which contact the embedded conductive plate 18 when the package 12 engages the socket 16 . as a result , when the package 12 is pressed onto the socket 16 , the deformed ends 26 of the contacts 22 are deformed to make tight spring biased electrical connections to the package 12 . however , the contacts 30 deform so that their lands 33 make electrical connection to the embedded conductive plate 18 . this connection grounds the embedded conductive plate 18 via solder balls 32 to the grounded motherboard 28 . referring to fig3 , additional contacts 34 may be permanently electrically coupled to the embedded conductive plate 18 in one embodiment . the contacts 34 couple to ground through the motherboard 28 via solder balls 32 . thus , in this embodiment , the metal conductive plate 18 is connected to ground through the motherboard 28 . in accordance with still another embodiment , shown in fig4 , the socket contacts 36 electrically contact the conductive plate 18 through land ends 38 when the package 12 is pressed onto the socket 16 . however , in this case , the socket contacts 36 are floating because they do not ground through the motherboard 28 . sockets with conductive plates , according to some embodiments of the present invention , may reduce the impedance discontinuity of lga contacts . moreover , some embodiments allow extension of present lga sockets to differential signaling applications . further , electrical parasitics ( inductance and capacitance ) may be distributed to avoid potential resonance issues at high frequencies in some cases . referring to fig5 , a processor - based system 46 may be a laptop computer , a desk top computer , an entertainment system , a personal digital assistant , a camera , a cellular telephone , to mention a few examples . the system 46 may include a package 12 , which includes a processor 40 . the processor 40 may be coupled over the motherboard 28 to a bus 48 . the bus 48 may in turn be coupled to input / output pads 42 and a storage 44 . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .
7
referring to fig1 - 3 , auxiliary bag 10 has a six - sided sleeve 12 that can be formed of leather , plastic or other appropriate materials , including a cloth tube reinforced with supporting struts . side faces 10b form an angle of about 120 degrees with the outside face 10a of auxiliary bag 10 . outside face 10a is parallel to rear face 10c . the outer face 10a of auxiliary bag 10 has a handle 36 . the upper part of auxiliary bag 10 has a reinforcing collar 14 . the bottom of auxiliary bag 10 has a cup - shaped boot 16 . boot 16 has a bottom portion 16a under an overhanging portion 16b . bottom portion 16a is sized and keyed to fit into pocket 18 . pocket 18 is a receptacle formed in base 20 of main bag 22 . main bag 22 has a main sleeve 24 whose perimeter is almost octagonal except for an auxiliary region 26 , which forms a concavity 26 bordered by ribs 28 . the upper end of main sleeve 24 is capped by a reinforcing collar 30 shown with partitions to allow segregation of golf clubs placed within the bag . a shoulder strap 38 is attached to the main bag 22 opposite region 26 . underlying shoulder strap 38 is a handle 40 , also mounted on main bag 22 . mounted in a lateral upper recess 32 of auxiliary bag 12 is a hook 34 , which is part of a holding means . another part of the holding means is eye 37 shown in fig2 as a u - shaped bracket riveted to reinforcing collar 30 between the ribs 28 in the auxiliary region 26 . in fig2 main bag 22 is shown leaning against a support bracket 42 , which is part of a golf cart ( either powered or hand drawn ). bracket 42 has a bag belt 44 designed to attach to a bag buckle ( shown hereinafter ) on the outer end of bracket 42 . referring to fig4 and 9 , main bag 22 is shown having a main buckle 46 , shown with a tab 48 reinforced with a grommet 50 . grommet 50 is held in eye 54 , which is riveted to the side of main bag 22 . a swivel joint 52 allows buckle 46 to roll 180 ยฐ around a horizontal axis . buckle 46 is shown swung back to receive bag belt 44 from bracket 42 of the golf cart . opposite buckle 46 is a main strap 56 looped through a steel ring 58 . ring 58 fits through an eye 60 , riveted to the outside of main bag 22 . main strap 56 is shown passing through bag buckle 62 mounted on the golf cart bracket 42 . accordingly , by tightening strap 56 and belt 44 , main bag 22 can be secured to bracket 42 of the golf cart . the positions of strap 56 and buckle 46 can be exchanged when the buckle and belt on the golf cart are the reverse of that illustrated . such reversal normally exists between the right and left side of a motorized golf cart . the exchange of strap 56 and buckle 46 can be accomplished by undoing eyes 54 and 60 ( or by undoing elements 50 and 58 ). for example eyes 54 and 60 may be hollow split rings , each containing a slider that moves to close and open the split . alternatively , the eyes may be solid split rings , each having a sleeve that slides to close and open the split . still other embodiments may employ a ring having a hinged segment that swings open and closed . referring again to fig3 auxiliary bag 10 is shown mounted against main bag 22 . previously mentioned main strap 56 is now shown wrapped across the auxiliary bag 10 underneath handle 36 . the end of strap 56 is shown fastened in main buckle 46 . buckle 46 has for this reason been swung toward auxiliary bag 10 . referring to fig6 and 8 , previously illustrated main base 20 is shown having an approximately octagonal footprint . a main receptacle 64 in base 20 is encircled by a main rim 66 having six sides , two pairs of them being parallel . pocket 18 ( also referred to as an auxiliary receptacle ) is encircled by an auxiliary rim portion 68 . the rim portion 68 is at a lower elevation than main rim 66 . auxiliary boot 16 is shown as a cup - shaped member , namely a hollow polygonal prism . the overhanging portion 16b has a larger perimeter and therefore connects to lower portion 16a by means of a transition , shown as a shelf 16c . base 20 has a number of drain holes 20a for draining . similarly , boot 16 has a hole 16d for draining as well . fig8 shows auxiliary sleeve 12 inserted into the overhanging portion 16b of boot 16 to abut the shelf 16c . also , main sleeve 24 is shown inserted into the main receptacle 64 of base 20 . to facilitate an understanding of the principles associated with the foregoing apparatus , its operation will be briefly described . the golfer may arrive carrying the golf bag assembled as shown in fig3 using the shoulder strap 38 . clubs such as the putter , nine iron , sand wedge and chipping wedge may be placed in auxiliary bag 10 . the other clubs and accessories may be placed in the various compartments in main bag 22 . when the bag is placed in a golf cart , strap 56 may be undone from buckle 46 . the auxiliary bag 10 will not release immediately from main bag 22 since hook 34 is still captured in eye 37 . the bag may next be arranged as shown in fig9 . specifically , the shoulder strap 38 can be placed around the bracket 42 . then the main buckle 46 can be rolled around a horizontal axis and swung backwards to the position shown in fig9 . in this position , bag belt 44 can be inserted through the main buckle 46 as shown . at the same time , strap 56 can be inserted through the bag buckle 62 on golf cart bracket 42 . strap 56 and belt 44 can then be tightened to secure the golf bag against bracket 42 . at this time , strap 56 no longer restrains auxiliary bag 10 . accordingly , auxiliary bag 10 can be removed by lifting it with handle 36 so that hook 34 disengages eye 37 . the golfer may then carry auxiliary bag 10 to the green where the various clubs contained inside auxiliary bag 10 can be used . after such use , the auxiliary bag 10 can be returned to the main bag by inserting the lower boot portion 16a ( fig1 ) into the pocket 18 ( fig2 ) of the main bag 22 . since boot 16 is keyed to the pocket 18 , auxiliary bag 10 will always be oriented in the correct direction with handle 36 pointing outwardly and with hook 34 oriented towards the eye 37 . once the auxiliary bag 10 is positioned in approximately the correct position , it is lowered to place hook 34 into eye 34 . overhanging portion 16b then abuts the rim of pocket 18 . when the golfer is finished , the buckles 46 and 62 ( fig9 ) may be undone . the bag is not yet ready for transport since hook 34 is not secure enough . accordingly , buckle 46 is returned to its original position so that strap 56 can be inserted into buckle 46 , thereby securing auxiliary bag 10 to main bag 22 . the strap 56 provides a high degree of security from accidental removal . with the strap 56 in the transport configuration , the bag combination can be safely carried , even with handle 36 . referring to fig1 and 11 , previously illustrated reinforcing collars 14 and 30 are shown without the hook and eye described above . instead , the inside face of collar 14 is shown carrying a magnet 70 . reinforcing collar 30 is shown with a metal plate 72 . in some embodiments , the magnet and plate can be reversed . alternatively , a pair of magnets can be used instead . the magnet and plate ( or magnet to magnet combination ) is referred to as a complementary pair of magnetically attractive devices . accordingly , collars 14 and 30 can be secured by the magnetic attraction between magnet 70 and metal plates 72 . this arrangement allows the auxiliary bag to be removed without the lifting necessary when a hook is used . referring to fig1 , the previously mentioned magnets are replaced with a pair of velcro pads 74 and 76 . pad 74 is mounted in a recess in reinforcing collar 14 by gluing , riveting or otherwise . pad 76 is shown mounted on the face of reinforcing collar 30 by means of rivets 78 , although in some embodiments pad 76 may be glued instead . pads 74 and 76 will operate similarly to the previously mentioned magnet and metal plate and are referred to as a complimentary pair of adhering pads . referring to fig1 , reinforcing collar 14 of auxiliary bag 10 is shown secured to collar 30 of main bag 22 by a strap 80 . strap 80 is shown having a snap 82 that attaches to an underlying stud ( not shown ) on reinforcing collar 30 . the opposite end of strap 80 is riveted to the opposite side of reinforcing collar 30 . alternatively , snap 82 can be replaced with velcro pads or other fastening means . strap 80 may replace the previously illustrated holding means , i . e . the velcro pads , the magnet and the hook . alternatively , the strap 80 may work with those holding means and replace the previously illustrated transport strap ( strap 56 of fig3 ). referring to fig1 , 15 and 16 , the previously illustrated auxiliary bag 10 is shown outfitted with a u - shaped assembly 84 . assembly 84 has a cross member 86 connecting to a pair of legs 88 . assembly 84 is journalled to auxiliary bag 10 with trunions 90 . trunions 90 fit into matching grommet holes in the side of auxiliary bag 10 . legs 88 ( as shown in fig1 ) make an angle of about 120 ยฐ with cross member 86 . cross member 86 acts as a stop to restrict the angular rotation of legs 88 to the approximate 90 ยฐ degrees shown in fig1 . because trunions 90 are not mounted on the widest portion of bag 10 , legs 88 must spread outwardly to be deployed as shown in fig1 . this spreading increases the stability of the bag . thus by rotating the legs outwardly as shown in fig1 ( in full line ) the bag 10 may be placed on the ground with the collar 14 raised to facilitate removal of clubs from the auxiliary bag 10 . it is to be appreciated that various modifications may be implemented with respect to the above described preferred embodiments . while the main and auxiliary bags are shown having the general shape of a polygonal prism , in other embodiments they may have curved perimeters including elliptical perimeters . also , the bags may be attached by various means including elastic cords ( bungee cords ), and fasteners of various types such as those found in luggage , etc . also , the main and auxiliary bags can have accessory pockets of various sizes for holding golf balls , gloves , clothing , etc . also , the bags may have more handles , fewer handles or no handles at all . moreover , the pocket for holding the bottom of the auxiliary bag need not have a shape exactly matching that of the auxiliary bag and need not be keyed . furthermore , the auxiliary bag need not have an overhang to limit the extent to which the auxiliary bag descends into the pocket . also , the various dimensions illustrated and the material used can be varied depending upon the number of clubs to be carried , and the desired physical strength , durability and weight of the bag . also , while the auxiliary bag is shown smaller than the main bag , it need not be so . obviously many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .
0
in the following description of the present invention , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration an embodiment in which the invention may be practiced . it is to be understood that other embodiments may be utilized as structural changes may be made without departing from the scope of the invention . aspects of the present invention provide a method and apparatus for designing modular components for software and firmware employed in embedded systems . aspects of the present invention also provide a method and system for generating , distributing , and applying update packages for modular , componentized firmware / software upgrades in embedded systems . fig1 is a block diagram of an embedded system 105 , employing , for example , a component architecture platform ( cap ) framework , that comprises a processor 107 , reference lookup table management unit 109 , primary memory 113 , reference lookup table 111 , and secondary memory storage 115 , in accordance with the present invention . in fig1 , embedded system 105 facilitates easier updates of embedded system software , such as firmware or applications in a mobile electronic device . in one embodiment , the embedded system 105 employing a component architecture platform ( cap ) framework comprises at least one reference lookup table , non - volatile memory ( such as flash ) in a primary memory 113 , volatile memory ( such as ram ), software resident in memory , and secondary memory storage 115 . the processor 107 executes program instructions that may be retrieved from primary memory 113 or a secondary memory 115 , and the program instructions may require reference lookups . a component architecture platform supports replacement , addition , or deletion of software function , by using symbolic rather than physical memory addresses in program instructions . the symbolic addresses are resolved at runtime to physical memory addresses using a reference lookup table . the resolution of symbolic addresses to physical memory addresses may be performed in a reference lookup table management unit . the reference lookup table management unit may provide to the associated processor the physical memory address corresponding to a symbolic address contained in a program instruction . the reference lookup table management unit may be implemented within a processor ( hardware ) or in code ( software ). in general , references are symbolic names for operands , modules , method names , functions , components , etc . that need a runtime lookup to be resolved into addresses . addresses for references may be absolute or relative . the ability to look up addresses at runtime provides flexibility to relocate associated modules / functions / components , etc . in general , it may be assumed that invocation of branch - link instructions , jump commands , subroutine calls , and etc . will be preceded by look up of an address from a reference lookup table . in another embodiment , a process of loading a new module / function / component into an image of an embedded system is accompanied by activities which may update a reference lookup table , such as reference lookup table 111 , with appropriate values for addresses of new or modified functions / components / modules , etc . in another embodiment , every module ( component / function / method , etc .) may maintain a local reference lookup table , such as reference lookup table 111 , that provides mapping of local ( internal ) variables , functions , and methods . when a new module is inserted into an embedded system , a local reference lookup table may also be inserted . subsequent modifications to a module may be accompanied by changes to the local reference lookup table , in addition to updates to an overall reference lookup table that maintains non - local reference lookup information . in another embodiment of the present invention , an embedded system 105 may employ chipsets that facilitate maintenance and management of reference lookup tables . the chipsets , such as reference lookup table management unit 109 , may employ micro - coding techniques to implement reference table lookups , reference table management , and access to references during execution of code at runtime . software development tools such as compilers that compile applications , may generate binary or hex output for compiled code that create entries to the reference lookup tables , and may also manipulate tables , such as reference lookup table 111 . fig2 a illustrates a flow chart of compiler activities for compiling code that may be executed in an embedded system having the cap architecture . at block 207 , a compiler compiles code targeted to the cap architecture . this may involve extracting reference information and maintaining the reference information . later , at block 209 , a reference lookup table may be created and populated with entries of extracted reference information . the entries may be a map of symbolic names of references encountered in the code during compilation , and address values ( relative or absolute ) that may be assigned to entries in a compiler phase or in a subsequent link / load phase ( when the references may be loaded into memory for execution ). at block 211 , the compiled code may be saved along with an associated reference lookup table . actual compiling activity may be executed by the embedded system or by another system that targets the embedded system for execution . the compiled code may be executed in an embedded system . the processor may execute the code by retrieving and executing individual program instructions , often in a specific order . the program instructions may be retrieved ahead of an execution order and a pipeline of instructions may be maintained , with references for the pipeline of instructions resolved into addresses or other values in preparation for execution of the instructions . by pre - fetching instructions into a pipeline of instructions and by resolving references before it is time to execute the instructions , the processor may avoid spending additional time in resolving addresses or values associated with the references . the reference lookup table management unit 109 may facilitate resolution of the references for program instructions in the pipeline . fig2 b illustrates an exemplary process of generating update packages for updating firmware / software in an embedded system from one version to another version and a process of retrieving and updating the embedded system , in accordance with an embodiment of the present invention . the embedded system may employ a cap architecture . at block 221 , new and old versions of code , such as a collection of code loaded into an embedded system , may be retrieved by a generator environment , for example . the generator environment may determine what modules / component / functions may be added , deleted , or modified between the old and the new versions . only modules that are added , deleted , or modified may be considered as candidates for inclusion in an update package . at block 223 , an update package may be generated and reference lookup table modifications may be determined . modifications to the reference lookup table may be associated with modules / components / functions that are added , deleted , or modified between the old and new versions . at block 225 , an update package may be transferred to the embedded system along with associated reference lookup table modifications . in one embodiment , the update package may comprise the reference lookup table modifications . in another related embodiment , reference lookup table modifications and the update package may be treated as two different but related units of data to be transferred to the embedded system . at block 227 , the update agent in the embedded system processes the retrieved update package and associated reference lookup table modifications . the embedded system loads new modules ( methods , functions , subroutines , classes , etc .) if any , for the new version of the embedded system being in the update package . the new modules replace existing modules in the embedded system . the update agent in the embedded system also applies modifications to those modules that are to be modified but not replaced . these activities may be only part of an update process facilitated by an update agent in an embedded system . references to newly added modules , modified modules , or deleted modules may be updated in a reference lookup table at block 229 . processing stops at block 231 when the update process is completed . fig3 illustrates an execution model for an exemplary processor , such as processor 107 of embedded system 105 , in accordance with an embodiment of the present invention . the processor may execute in one of at least two modes : a reference lookup table ( rlt ) mode , where the processor may resolve at runtime symbolic references in instructions into addresses of modules or operands , etc . ; and a regular mode , where the processor may execute program instructions in which references have already been resolved , and for which a reference lookup table is not employed . at block 321 , the processor may determine whether to execute program instructions in rlt mode and may set the execution mode to rlt , if not yet set . at block 323 , the processor may send a message to a reference lookup table management unit , such as reference lookup management unit 109 disclosed in fig1 , to indicate whether to lookup addresses / values for symbolic references in program instructions . the reference lookup table management unit may initialize the reference lookup table , if necessary , with name / value pairs and other related information , wherein each name may be a symbolic reference to be resolved in a current program context . at block 327 , the processor may initiate a pipeline of program instructions to be executed and reference lookup table management unit may be employed to retrieve addresses for all references and populate the references into the pipeline to prepare the pipelined instructions for execution by the processor . at block 329 , the processor may look up any additional references that may not yet have been resolved and may retrieve addresses or values for the additional references . at the conclusion of execution of program instructions within the current program context , the processor may switch modes to regular execution mode from rlt mode . although a system and method according to the present invention has been described in connection with a preferred embodiment , it is not intended to be limited to the specific form set forth herein , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents , as can be reasonably included within the spirit and scope of the invention as defined by this disclosure and the appended diagrams .
6
methods and systems for manufacturing ultrathin ptc sheets having nominal thicknesses of less than 50 ฮผm or less than 20 ฮผm are described below . the ultrathin ptc sheets can be cut into sections and inserted within the layers of a battery structure without severely impacting the size of the battery , thus overcoming the issues described above . fig1 illustrates a first exemplary set of operations for manufacturing an ultrathin ptc sheet . at block 100 , a ptc material may be provided in a extruded slab form . the ptc material may be converted into a powdered form . for example , the ptc material provided in the extruded slab form may be ground down using a mechanical process such as milling or grinding or a different process . other processes may be used to pulverize the ptc material into the powder form . the powder form of the ptc material includes ptc particles having a median diameter of between 0 . 1 ฮผm and 50 ฮผm . the ptc material may include one or more conductive and polymer fillers . the conductive filler may include conductive particles of tungsten carbide , nickel , carbon , titanium carbide , or a different conductive filler or different materials having similar conductive characteristics . the size of each conductive particle may have a median diameter of between 0 . 1 ฮผm and 50 ฮผm . the polymer filler may include particles of polyvinylidene difluoride , polyethylene , ethylene tetrafluoroethylene , ethylene - vinyl acetate , ethylene butyl acrylate or different materials having similar characteristics . the size of each polymer particle may have a median diameter of between 1 ฮผm and 1000 ฮผm . at block 105 , the powdered ptc material is inserted into a press or roll press and compressed . fig2 a and 2b illustrate an exemplary pressing operation . in fig2 a , powdered ptc material 210 a ( shown in an exaggerated size ) is placed between opposing plates of a press 205 . the powdered ptc material 210 a may be applied over one of the plates of the press 205 . for example , the powdered ptc material 210 a may be sprayed or dropped onto the plate until a desired thickness is achieved . the thickness of the powdered ptc material 210 a after application may be between about 5 ฮผm and 130 ฮผm . in some implementations , a substrate material , such as copper , nickel , etc ., may be initially inserted against one or both of the plates of the press 205 and the powdered ptc material 210 a may be sprayed or dropped onto one of the substrates to provide a final ptc sheet having top and bottom conductive layers . as illustrated in fig2 b , the plates of the press 205 are compressed against one another . during compression , the particles of the powdered ptc material deform and blend into one another until a ptc sheet 210 b of the ptc material having a uniform thickness is formed . for example , for a ptc particle size of 2 - 3 ฮผm , an applied thickness of 25 ฮผm , a plate area of 400 cm 2 , and a pressure of 5500 psi , the particles of ptc material may be compressed into a ptc sheet having a thickness , t ( fig2 d ), of about 25 ฮผm . in some implementations , heat may be applied to the powdered ptc material before and / or during compression of the powdered ptc material . for example , the powdered ptc material may be heated to a temperature of the polymer melting temperature . returning to fig1 , at block 110 , the ptc sheet 210 b may be allowed to cool and is then removed from the press 205 as illustrated in fig2 c . in some implementations , an annealing process may be applied to the ptc sheet 210 b to improve polymer crystallinity and polymer stress relaxation . at block 115 , in some implementations , one or more conductive layers may be applied to the ptc sheet 210 b . for example , a conductive layer such as nickel foil or a different conductive material may be formed on the surfaces between which current is intended to flow . in cases where the ptc sheet 210 b was compressed against one or more conductive substrates , the operations in this block may not be required . at block 125 , the ptc sheet 210 b may be cut into sections . the sections may then be used in a desired application . for example , the sections may be used as a protection layer in a battery ( see fig6 , described below ). the sections may be used in different applications that require protection against over current / over temperature conditions where space is at a premium . fig3 is a chart that illustrates the performance characteristics of a ptc sheet having a thickness of about 48 ฮผm that was formed via the process described above . the ptc sheet comprises tungsten carbide and polyethylene . as shown , at temperatures below 120 ยฐ c ., the resistance across the ptc sheet is less than about 0 . 01 ohms . at around 120 ยฐ c ., the resistance abruptly rises to about 30 ohms . fig4 illustrates a second exemplary set of operations for manufacturing an ultrathin ptc sheet . at block 400 , a ptc ink solution may be formed . in one implementation , the solution is formed by mixing a conductive filler material and a polymer material in a solvent . the conductive filler may include conductive particles of metal , metal ceramic , carbon , or different materials having similar conductive characteristics . the d50 particle size of each conductive particle may have a range of between 0 . 1 ฮผm and 50 ฮผm . in this regard , particle size distributions may be calculated based on sieve analysis results , creating an s - curve of cumulative mass retained against sieve mesh size , and calculating the intercepts for 10 %, 50 % and 90 % mass . a d50 correspond to particle size having a 50 % mass . the polymer filler may be provided in pelletized or powdered form and may include particles of semi - crystalline polymer such as polyvinylidene difluoride , polyethylene , ethylene tetrafluoroethylene , ethylene - vinyl acetate , ethylene butyl acrylate or different materials having similar characteristics . the size of each polymer particles may have a median diameter of between 1 ฮผm and 1000 ฮผm . the solvent may correspond to dimethylformamide , n - methyl - 2 - pyrrolidone , tetrahydrofuran , tricholorobenzene , dichlorobenzene , dimethylacetamide , dimethyl sulfoxide , cyclohexane , toluene or a different solvent capable of dissolving the selected polymer matrix . in some implementations , an additive such as an antioxidant , adhesion promoter , anti arcing material or different additive may be added to the solution to improve characteristics of the ptc sheet such as , polymer stability , voltage capability or film adhesion . at block 405 , the ptc ink is applied over a surface or substrate . for example , as illustrated in fig5 a , the ptc ink 510 a may be poured or sprayed onto a surface 505 . a blade 515 may be pulled over the ptc ink 510 a to produce a uniform layer of ptc ink 510 a having a desired thickness . the thickness of the uniform layer of ptc ink 510 a may be between about 5 ฮผm and 130 ฮผm . at block 410 , the ptc ink 510 a is allowed to dry , at which point the solvent evaporates out of the solution leaving behind a ptc sheet 510 b having a uniform layer , as illustrated in fig5 b . the final thickness of the ptc sheet 510 b , t ( fig5 c ), may be between about 5 ฮผm and 130 ฮผm . in some implementations , an annealing process may be applied to the ptc sheet 510 b to improve the ath or autotherm height ( i . e ., the magnitude order of the resistance change ) behavior of the ptc . for example , the ptc sheet 510 b may be heated to 120 ยฐ c . for about two hours and then allowed to slowly cool down . fig6 is a chart that illustrates the performance characteristics of a ptc sheet 510 b having a thickness of about 15 ฮผm that was formed via the process described above in fig4 , including the described annealing process . the conductive filler material used in the process was tungsten carbide . the polymer filler used was polyvinylidene difluoride . the volume ratio of polymer filler to conductive filler material was about 1 . 1 : 1 . as shown , at temperatures below 100 ยฐ c ., the resistance across the ptc sheet is about 1000 ohms or less . above 100 ยฐ c ., the resistance abruptly rises to about 1 ร— 10 10 ohms . returning to fig4 , at block 415 , conductive layers may be applied to the ptc sheet 510 b . where current is intended to flow between the top and bottom surfaces of the ptc sheet 510 b , a conductive layer such as nickel foil or a different conductive material may be formed on the top and bottom surfaces of the ptc sheet 510 b . at block 425 , the ptc sheet 510 b may be cut into sections . the sections may then be used in a desired application . for example , the sections may be used as a protection layer in a battery ( see fig6 , described below ). the sections may be used in different applications that require protection against over current / over temperature where space is at a premium . fig7 illustrates an exemplary apparatus 700 for mass - producing an ultrathin ptc sheet using the process of fig4 . the apparatus includes a steel belt 710 wrapped around a pair of drums that rotate the steel belt 710 . ptc ink 715 a is poured into a hopper 712 , which directs the ptc ink 715 a onto the rotating steel belt 710 . the distance between the bottom opening of the hopper 712 and the belt 710 , and the shape of the bottom opening of the hopper 712 , is selected to form a uniform layer of ptc ink 715 b having a desired thickness . the belt 710 pulls the uniform layer of ptc ink 715 b through a channel defined between an outer wall 702 of the apparatus 700 and the belt 710 . drying air 720 is injected into a first opening 714 in the outer wall 702 . the drying air 720 flows through the channel , over the uniform layer of ptc ink 715 b , and out a second opening 716 defined in the outer wall 702 . the rate of air flow and the speed of the belt 710 is selected so that the uniform layer of ptc ink 715 b dries and forms a ptc sheet 715 c having a uniform thickness by the time the uniform layer of ptc ink 715 b reaches an extraction opening 718 of the apparatus 700 . a continuous ptc sheet 715 c flows out of the extraction opening 718 and may proceed to other stations for further processing . for example , additional drying may be performed . stations for annealing , cutting , and plating the ptc sheet 715 c may be provided . fig8 illustrates an exemplary battery 800 which illustrates but one of the many uses of an ultrathin ptc sheet / layer formed by either of the processes described above . the exemplary battery 800 includes anode and cathode conductive layers 805 ab , lithium electrolyte layers 810 ab , a separator layer 815 , and a ptc layer 820 . the ptc layer 820 is disposed between the anode layer 805 a and a first lithium electrolyte layer 810 a . in this configuration , the ptc layer 820 is effectively in series with the battery 800 so that any current flowing through the battery 800 necessarily flows through the ptc layer 820 . during an over current / over temperature condition , the resistance of the ptc layer 820 increases to thereby reduce current flow through the rest of the layers . in this way , the ptc layer 820 protects the battery 800 . the exemplary battery 800 includes anode and cathode conductive layers 805 ab , lithium electrolyte layers 810 ab , a separator layer 815 , and a ptc layer 820 . the ptc layer 820 is disposed between the anode layer 805 a and a first lithium electrolyte layer 810 a . in this configuration , the ptc layer 820 is effectively in series with the battery 800 so that any current flowing through the battery 800 necessarily flows through the ptc layer 820 . during an over current / over temperature condition , the resistance of the ptc layer 820 increases to thereby reduce current flow through the rest of the layers . in this way , the ptc layer 820 protects the battery 800 . fig9 a - 9c illustrate an exemplary free standing embodiments 900 a - c of ptc devices that incorporate the an ultrathin ptc sheet / layer 905 formed by either of the processes described above . in a first exemplary embodiment 900 a , conductive layers 905 ab may be formed on the top and the bottom surfaces of the ptc sheet 905 . in this embodiment , the current is intended to flow through the thinnest section of the ptc sheet 905 . such an embodiment could be retroactively applied between layers of a different device , such as the layers of a battery , to provide overcurrent / over temperature protection . in the second and third exemplary embodiment , conductive layers 910 ab may be formed on the front and back surfaces of the ptc sheet 905 . ( see fig9 b ) or conductive layers 915 ab may be formed on left and right surfaces of the ptc sheet 905 . ( see fig9 c ). in the second and third embodiments , the current is intended to flow through one of the longitudinal sections of the ptc sheet 905 . placement of the conductive layers on the other surfaces and / or on different regions of any given surface facilities controlling the direction of current flow through the ptc sheet 905 , which may be advantageous in certain applications . while the method for manufacturing the ultrathin ptc sheet has been described with reference to certain embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the spirit and scope of the claims of the application . other modifications may be made to adapt a particular situation or material to the teachings disclosed above without departing from the scope of the claims . therefore , the claims should not be construed as being limited to any one of the particular embodiments disclosed , but to any embodiments that fall within the scope of the claims .
7
a dimmer rack according to the present invention is illustrated in fig1 through 3 . as shown therein , a rack 10 comprises a housing 12 with a front bay 14 including a plurality of dimmer modules 16 stacked vertically one on top of the other received within slots formed in the side panels of the front bay of the housing . the dimmer rack &# 39 ; s housing also comprises a rear bay 18 including a plurality of connector modules 20 stacked vertically one on top of the other received within slots formed in the side panels of the rear bay of the housing . the front bay 14 and rear bay 18 of the housing are &# 34 ; mirror images &# 34 ; of each other . the dimmer modules and connector modules are interconnected through a patch panel 22 mounted adjacent the dimmer module stack and accessed through the front door of the rack . in the embodiment shown in the drawings , the patch panel is mounted on the front panel of a side bay 23 , adjacent the dimmer and connector bays . dimmer racks according to the present invention can be provided in various configurations and are characterized in the drawings by a rack having a single vertical stack containing all the dimmer modules . likewise , dimmer racks incorporating the present invention are characterized in the drawings by a rack having a single vertical stack containing all the connector modules . configuration of the dimmer rack incorporating the present invention for mobile use is accomplished by wheel mounting the frame of the rack as shown in fig1 or mounting the rack on a fork lift skid for easy transportation . details of the structural arrangement of the rack are best seen in fig3 and 5 shown with the dimmer modules and connector modules removed from the rack . in the dimmer module bay , power feed buses 26 each receiving power from one phase of a three phase supply are provided at three locations on the left side of the rack vertically spaced such that each blade of the power bus feed supplies one - third of the slots for dimmer modules . in alternative embodiments for single phase power applications , two power bus blades each feeding half the slots may be employed . an extension 25 is integrally formed with power distribution bus 26 and extends at right angles from bus 26 . one or more connector lugs are mounted on extension 25 . an input power cable is connected directly or through a removable connector ( not shown ) to the lug for delivering input power to the rack . neutral connections are routed to a neutral bus bar 70 as described in greater detail subsequently . a pair of load output terminals 30 corresponding to each slot in the dimmer bay of the rack are mounted on a main insulator 32 adjacent the right hand wall of the bay and control signal cards 34 terminating in edge connectors are mounted intermediate the load terminals and right wall of the bay . load terminals 30 include integrally formed blade - shaped contacts 31 . the load terminals are mounted on and snap fitted into stand off insulators . the contacts 31 are spaced from the side wall of the dimmer module bay so that the contacts can engage mating receptacles at the rear of the dimmer modules , as will be described in greater detail subsequently . the load terminals also incorporate receptacles and clamping screws . individual load wires from the dimmer bay to the patch panel are inserted into receptacles and secured by the clamping screws . each wire extends to the patch panel 22 . supporting slots for the dimmer modules are formed in interior sheet metal panels 38 on the left and right walls of the dimmer bay by a precision punch and brake operation forming a forward support guide 40 and a rearward support guide 42 for each slot on each side of the bay . keying to avoid placement of an improperly rated dimmer module in a pre - wired slot in the rack is accomplished using a punched metal tab 44 and two retaining screw holes 46 and 48 in each slot . the punch tab is located forward of the retaining screw holes for initial engagement of a mating protrusion , which on present embodiments comprises a counter sink screw head having an angle complimentary to the angle of the tab , mounted on higher amperage dimmer modules as will be described in greater detail subsequently . keying for higher power modules is accomplished by physically removing the punch tab by bending into the punch aperture flush with the wall to allow engagement of a retaining screw mounted in hole 48 depending on the type of module for which the slot has been wired . a screw present in hole 48 will prevent installation of the highest amperage rated dimmer module while no tab or screw allows any amperage dimmer into a slot wired for the highest amperage rating . hole 46 is provided for insertion of a screw to act as a replacement for the keying tab if the tab is removed and subsequent use of that slot for a lower power module is required . the triple keying approach provides great flexibility in pre - wiring slots for various dimmer module configurations . the rear connector module bay of the rack is similarly configured to receive connector modules in slots formed by punched tabs extending from the walls of the bay . mating load input terminals 58 and 59 which include integrally formed blade - shaped contacts 60 are mounted on and snap fitted into standoff insulators . the contacts 60 are spaced from the side wall of the connector module bay , two vertical pairs adjacently mounted in each slot , so that the contacts can engage the slot - shaped receptacles in the load input connectors in the rear of the connector modules , as will be described in greater detail subsequently . for the embodiment shown in the drawings , the load output terminals are mounted in pairs in two vertical rows . additional density for rack connection circuitry may be obtained by mounting a third vertical row of load output terminal pairs . for connection to the patch panel , terminals 58 and 59 also incorporate receptacles and clamping screws . individual wires 88 leading from the patch panel 22 to the load input terminals are inserted into receptacles and secured by the clamping screws . details of the support structure for load input terminals 58 and 59 is shown in detail in fig3 b and 3c . a molded insulator 72 provides a plurality of receptacles 74 and 76 which receive load input connectors 58 and 59 respectively . each of the load input connectors incorporates a tang 78 received over a web 80 in the receptacle with a snap retainer to secure the load input connector to the receptacle . in fig3 b only the top two input load connectors are shown while in fig3 c only the top outer load connector 58 and inner load input connector 59 are shown to allow demonstration of the features of the insulator . the connection lug of outer load input connector 58 is angled as shown in the drawings to allow easy routing and insertion of connection cables 88 from the patch panel to receiving holes 82 in the lug . a clamping screw 84 retains the interconnection cables in the lug . inner load input connector 59 employs a lug arrangement perpendicular to the blade of the connector and apertures 86 in the material of the insulator allow insertion of cables through the insulator into the receiving hole 90 of the inner lug . a retaining screw 92 is employed to secure inserted cable in the inner lug . the web of the receptacle for the outer load input connector is molded to be wider than the web on the receptacles for the inner load input connector to provide greater stability for the outer load input connector in view of its shorter length . the shorter length of the outer load input connector accommodates clearance for the apertures 86 for wire pass through to the inner load input connector . the combined arrangement of the pass through aperture for cabling insertion into the inner load input connector and the angled lug on the outer load input connector provides excellent cable direction management for ease of wiring in the connector bay . probes 92 on the insulator standoff are received in slots 312 on the connector modules as shown in fig7 to retain the datum wall of the connector module adjacent the interior wall of the connector bay for tolerance control . neutral bussing is provided for the connector modules through neutral bus blade 70 similar in configuration to the power bus blades contained in the dimmer module bay . the neutral bus blade , in the embodiment shown in the drawings , extends the entire vertical extent of the connector module bay . an extension 71 is integrally formed with the neutral bus blade and extends at right angles from the bus . one or more connector lugs are mounted on extension 71 . a neutral conductor cable is connected from the lug directly or through a removable connector ( not shown ) for input power return from the rack . the dimmer rack is of modular configuration employing extruded corner posts 45 mounted between base and top frame members 47 . the interior sidewall panels 38 previously discussed are attached to the corner posts and exterior panels 49 provide a finished appearance for the rack attaching to the corner posts through blind fastening arrangements . dimmer modules designed for use in accordance with the present invention employ single , dual or quad dimmer configurations . the embodiments shown in the drawings demonstrate a dual dimmer configuration while a quad dimmer configuration is disclosed in co - pending patent application ser . no . 08 / 588 , 393 , filed on jan . 1 , 1996 , having a common assignee with the present application . a quad dimmer capable system would require the addition of a second vertical row of load connectors 30 mounted on insulator standoffs inboard from the load connectors shown in fig3 and 4 . the physical design of a dual dimmer module employed in the present invention is illustrated in fig6 . the dimmer module 110 comprises a chassis 112 formed , in the embodiment shown , from die - cast aluminum . the chassis incorporates a left side wall 114 , a right side wall 116 and a face plate 118 . as depicted in fig6 the dimmer module is capable of controlling two separate lighting fixtures or two groups of interconnected fixtures . input power is received by the module through connector 124 located adjacent the left wall of the chassis . a floating contact 126 is incorporated in the power connector to accommodate tolerance buildup in mating the connector module to dimmer racks . the floating contact includes an extended conductor 128 . two circuit breakers 132a and 132b control the input power for the two loads of the dimmer module . breakers 132a and 132b are mounted in a stack 134 attached to the face plate of the chassis . two inductors 136a and 136b comprising toroidal chokes for current supply in the dimming control circuits are mounted in the chassis . input power is provided from the conductor extension to the line contacts of the circuit breakers . vertical interconnection of the breakers in the stack is accomplished , in the embodiment shown in the drawings , through a standard bus bar arrangement . power is routed from the load contacts 140 of the circuit breaker stack to the inputs of inductors 136a and 136b . a power device generally designated 142 is mounted in the chassis adjacent the right wall . the power device comprises a top board 144 which incorporates control circuitry for the dimmer module , and printed circuit substrate 146 which is mounted to a finned heat sink 150 . the arrangement of the dimmer module compensates for tolerance accumulation in fabrication of the device and the dimmer rack . the right hand wall of the dimmer module and the interior panel for the right hand wall of the rack constitute the datum for dimensioning . the left hand wall of the dimmer module incorporates a slot arrangement 226 which receives a side load spring 228 . in the embodiment shown in the drawings the side load spring comprises two lobes 230 and 232 connected by a web 234 which incorporates a formed clip 236 received over the top edge of the left wall of the dimmer module chassis substantially centered in the slot arrangement to secure the spring to the chassis . the lobes of the side load spring flex to engage the left hand interior panel in the dimmer bay intermediate the guides for each slot urging the entire chassis to the right thereby firmly engaging the right chassis wall with the right interior panel of the dimmer bay . this allows high accuracy in placement and dimensioning of the control signal connector 34 and the mating connector 224 on the dimmer module due to their close proximity to the datum . performance of the invention is thereby enhanced since the control signal connector 34 may employ standard printed circuit board edge connector technology without concern over highly accurate dimensional control of the dimmer module engagement in the dimmer rack slot . similarly , the load connectors may employ substantially lower tolerance contacts based on placement proximate the datum . a probe 33 extending from the main insulator as best seen in fig3 and 4 is received in slot 238 in the chassis to prevent displacement of the chassis to &# 34 ; jump &# 34 ; the configuration tabs . the power connector for the dimmer module is specially designed , as shown in the embodiment presented in fig6 b , to provide a floating contact 126 received in the housing 242 of the power connector . the floating contact comprises two spring contacts 244 engaging one another in connection tangs 246 which are mated employing a standard rivet or other compressive mounting technology or welding the contacts and braid . the conductor braid 128 is engaged between the connection tangs and similarly secured by the rivet . the floating contacts are constrained within the connector case by engagement slots 250 . lateral motion is therefore possible by the floating contact to engage the blade of the power bus 26 which is received in slot 252 in the connector . slot 252 is oversized in lateral dimension sufficient to accommodate any tolerance buildup in the dimmer module construction . the flexible braid allows lateral motion of the floating connector and is connected opposite the floating contacts for electrical attachment to the circuit breakers in the dimmer module . in addition to providing lateral positioning of the dimmer module , the side load spring masks the left hand interface of the dimmer module with the dimmer rack to preclude airflow through the slot exterior to the dimmer module . additionally , the side load spring provides the ground contact with the dimmer rack for the dimmer module providing a common chassis ground . the physical design and arrangement of the connector module components are shown in fig7 . as shown therein , the connector module 300 comprises an assembly which is mounted in a chassis 302 . the chassis is two slots in height in the embodiment shown in fig7 and eight three pin connectors 304 are mounted in the front face of the chassis . on the rear face of the chassis , eight load input connectors 306 are mounted in pairs adjacent the left wall to receive the blades of the load terminals 58 . these input connectors provide the load inputs to the connector module which are distributed to the connectors on the front face of the module as described with respect to fig8 a and 11a . also mounted on the rear face of the chassis adjacent the right wall is a floating connector 308 substantially identical to the power connector 124 in the dimmer modules described above . this floating connector receives the neutral bus blade 70 , providing neutral return for the circuits carried by the connector module . flexible conductor braid 309 is employed for connection to neutral return of the individual pin connectors through a bus block or other conventional means . as with the dimmer module , the connector module employs a side load spring 310 mounted to the side wall of the chassis to urge the connector module chassis toward the interior bay wall which comprises the dimensioning datum . the right hand wall of the connector module ( looking from the front of the connector module ) incorporates a slot arrangement 313 which receives the side load spring . the spring also provides ground contact for the chassis to the structure of the rack . the electrical connectors 304 provide the interface for connection to an external lighting load ( not shown ). a front view of the 2 slot height connector module of the embodiment described is shown in fig8 a with a rear view shown in fig9 a . in multiple alternative embodiments of the connector module , the electrical connectors 304 are replaced by any of the finite number of electrical connectors used to complete a connection to an external light load or effects controller . fig8 b and 9b show an additional preferred embodiment for the connector module employing a 3 slot height chassis 402 . two 19 pin ( 6 circuit ) veam / socapex connectors 404 are provided in the front panel of the module . on the rear face of the chassis , 12 load input connectors 306 , four in each slot height , are mounted to engage the blades of load terminals 58 . three floating connectors 308 are mounted vertically adjacent the right wall of the chassis , one in each slot height , to receive the neutral bus blade . a third preferred embodiment for the connector module employing a 6 slot height chassis 502 is shown in fig8 c and 9c . two 12 circuit pyle national connectors 504 are mounted in the front panel for connection to the lighting or effects controller loads . 24 load input connectors 306 are mounted in the rear face of the chassis , four in each slot height . six floating connectors 308 are mounted vertically adjacent the right wall of the chassis , one in each slot height , to receive the neutral bus blade . electrical schematics showing the wiring scheme for the 2 , 3 and 6 slot height connector modules are shown in fig1 a , b and c respectively . active autonomous control for various effects controllers to be attached to the connector modules is accomplished with the present invention through incorporation of a microprocessor controller in the connector module . communication between the microprocessor in each dimmer module and the associated connector module , as determined by appropriate patching , is accomplished by insertion of board connectors intermediate the connector bay interior wall and the load input connectors 58 in complimentary fashion to that disclosed for the dimmer module ; e . g . board connector 34 and mating connector 224 as shown in fig3 a and 6a respectively . addition of connection lugs to the board connectors in the dimmer module bay and connector bay with routing of cabling from those lugs to the patch panel as described previously for load output and input connections , provides patching capability for desired control signals . having now described the invention in detail as required by the patents statutes , those skilled in the art will recognize modifications and substitutions to the embodiments disclosed for use in particular applications . such modifications and substitutions are within the scope and intent of the present invention as defined in the following claims .
7
shown in fig1 are substrate 1 , oxide layer 3 , and nitride layer 5 . the term substrate is used to mean any material that lies underneath and supports another material . the term thus includes a silicon wafer and may further include a wafer with an epitaxial layer , etc . the oxide layer is a relatively thin layer , such as a pad oxide layer , grown by thermal oxidation . an exemplary thickness is approximately 20 nm . the nitride layer , e . g ., silicon nitride with the nominal stoichiometry si 3 n 4 , is thicker than the oxide layer . an exemplary thickness is 120 nm . those skilled in the art will readily fabricate the structure depicted using conventional oxidation and deposition techniques . fig2 depicts the structure of fig1 after further processing . the nitride layer 5 is patterned using well known techniques to form regions which expose selected portions of oxide 3 . an oxidation step is then performed which forms first oxide regions 7 in the exposed portions of the oxide 3 . these regions will generally function as field oxide regions , i . e ., the regions which electrically isolate individual devices from each other . the nitride layer and remaining oxide 3 are then removed using well - known techniques . a new , thin oxide layer 4 is grown or otherwise formed ; the substrate thus has an oxide surface , and the entire surface is covered with a second nitride layer . an exemplary thickness for the oxide surface is approximately 35 nm . the second nitride layer 9 and oxide surface have approximately the same thickness and both are relatively thin ; the thickness is generally less than 70 nm , and a thickness in the range between 30 and 40 nm is typical . approximately the same thickness means that the thicknesses of the layers differ by less than 50 percent . these layers are then patterned so that the materials cover substantial portions of the field oxide regions , and substantial portions of the oxide surface between the field oxide regions are exposed . ion implantation is then performed to form doped regions 11 in the exposed regions between the field oxide regions 7 . the wafers are annealed after the implant to drive in the dopants and to reduce the defect density . details of the annealing will be discussed later . the implant is typically an n - type impurity , such as arsenic . this is the structure depicted in fig2 . further processing produces the structure depicted in fig3 . there is another oxidation step which produces second oxide regions 13 between the field oxide regions 7 , i . e ., the surfaces of the doped regions are oxidized . this oxidation step further drives the implanted dopants into the substrate to form buried dopant regions 15 . these buried dopant regions 15 will ultimately serve as the bit line and source / drain regions of the field - effect transistor . further processing is now performed to complete the fabrication of the eeprom . this processing is well known and need not be described . the ion implantation and oxidation steps , as previously mentioned , produce defects . the origin and nature of the defects is better understood by consideration of fig4 which is a top view of the structure depicted in fig3 . fig3 is along line a -- a &# 39 ; of fig4 . shown in fig4 are first oxide regions 7 and patterned nitride layer 9 as well as the buried doped region 15 and oxide layer 4 . as can be seen , the nitride layer 9 covers a substantial portion of the first oxide regions 7 and the oxide layer 4 between the first oxide regions 7 . it was found that the defect density is highest along the line b -- b &# 39 ; at the midpoint between the first oxide regions 7 . fig5 is a sectional view along line b -- b &# 39 ; of fig4 . the nitride layer along line b -- b &# 39 ; is entirely on the oxide substrate surface and can rise as the exposed portions of the substrate are oxidized . however , the nitride layer along line a -- a &# 39 ; is effectively pinned on the first oxide region 7 , i . e ., the first oxide region 7 does not grow significantly during the second oxidation step and the nitride layer 9 on the first oxide region 7 can not rise to provide stress relief . consequently , defects are generated which are concentrated at the midpoint , i . e ., b -- b &# 39 ; between the first oxide regions 7 . the defect density is controlled and reduced by two factors : ( i ) the oxide surface and the nitride layer are thin with approximately the same thickness , and ( ii ) there is a two step annealing process . we have found that both steps are required to reduce the defect density that results from the ion implantation step . the annealing begins with a relatively low first temperature , approximately 500 degrees c ., and then goes to a relatively high second temperature . the second temperature is typically 1000 degrees c . or greater . we found that silicon defects are observed after the second local oxidation for either nitride thickness greater than 70 nm or second annealing temperature less than 1000 degrees c . the defects are not observed if there is no ion implantation . both ion implantation and the first local oxidation appear necessary to create defects and both the thin nitride and annealing are required to prevent the defects . 7 ) implant arsenic ( 1 ร— 10 16 cm - 2 , 100 kev ) variations in the embodiment described will be apparent to and thought of by those skilled in the art . for example , the thin oxide may be removed when the first nitride layer is patterned .
7
the configuration of fig1 and 2 is such that the respective pilot control stage in the form of a pilot valve is illustrated in section i , the pilot control stage in the form of the primary valve proper is illustrated in section ii , and the complete valve including stages i and ii , along with the valve switching symbol customary in the literature is illustrated in section iii . all the components shown in fig1 are those of a pressure relief valve . all the components shown in fig2 those of a pressure control or pressure reduction valve . all the pilot valves illustrated in i are identical both in the embodiment shown in fig1 and the embodiment in that shown in fig2 . a manually operated pilot valve 10 , an electrically operated pilot valve in the form of a proportional magnet 12 , a proportional magnet 14 with emergency pressure actuation 16 , and a proportional magnet 18 with an inverted characteristic curve relative to embodiments 12 , 14 are shown from left to right as viewed in each of fig1 and 2 . the manually operated pilot valve 10 has a valve seat 20 and a valve element 22 . the valve element 22 rests against an energy accumulator in the form of a pressure spring 26 . the closing force of spring 26 may be assigned or adjusted by a resetting element 28 and is guided in an adjustment housing 30 . the closing force may be assigned or set manually by a hexagonal head screw 32 with retaining ring 34 . such manually adjustable pilot valves 10 are of the state of the art or conventional , and accordingly will not be described in detail . if the individual components referred to are completed along the assembly line 36 , the pilot valve as completed may be screwed into one end 38 of the valve housing 40 . another energy accumulator in the form of a pressure spring 44 is introduced from the other end 42 of the valve housing . on one end of valve housing 40 , the main piston 46 rests . on the other end of valve housing 40 there rests on a multipart closing element 50 which may be screwed into the lower free end 42 of the valve housing 40 . to this extent the primary control stage ii and thus the primary valve proper is standardized in the form of a pressure relief valve . as the other assembly lines 36 demonstrate , appropriately modified pressure springs 26 and resetting elements 28 are used , while the valve elements 22 and pilot chambers 20 remain unchanged to obtain modified pressure relief valves having appropriately modified pilot control stages i in the versions indicated on different switching magnets 12 , 14 , and 18 . the pressure relief valves shown in section iii having the customary switching symbol reproduced on their lower side on the basis of their characteristics may be obtained . if the complete total valve of section iii is to be used under the modular valve system of the present invention to control a different fluid volume stream , the rated values at the valve housing 40 are to be correspondingly modified , especially with respect to the interior and circumferential side at the opposite ends 38 and 42 and with respect to the housing interior 52 . as is shown in fig2 , the structure of the pilot pressure control valve is selected accordingly . in particular , the pilot control stage i is essentially the same as that of the pilot control stage i in fig1 . in the manually operated pilot valve 110 another energy accumulator in the form of the pressure spring 154 engaging the opposite side of the pilot chamber 120 is added in addition to the energy accumulator in the form of the pressure spring 26 . the structure in question is of the state of the art or conventional and will not be discussed in detail at this point . in addition , to the extent that the components in the modified embodiment in fig2 correspond to the valve design shown in fig1 , the same reference numbers are used with each increased by 100 . what has been stated also applies to this extent to the embodiment of a pressure control valve as shown in fig2 . in contrast to the pressure relief valve of fig1 , in the embodiment shown in fig2 the control piston 146 has a nozzle element 156 . in other respects , the valve housing 140 is adapted with respect to its fluid connections to the functions to be performed by a pressure control valve . the valve housing 140 with its structural valve components is to be adapted to the extent that the fluid flows to be controlled vary with respect to volume and / or pressure . as a rule , however , the same pilot control stages indicated in fig1 are employed in the valve design illustrated in fig2 . the average expert in the field of valve technology may find it surprising that he can employ only a few basic components to develop a multiplicity of valve designs with different rated values without the need for developing his own structure on each occasion . the modular valve system of the present invention permits configuration of each valve obtained as a screw - in cartridge . both the pressure relief valves and the pressure control valves may then be fastened on other structural components , such as ones in the form of a valve block in an all - hydraulic system . while various embodiments have been chosen to illustrate the invention , it will be understood by those skilled in the art that various changes and modifications can be made therein without departing from the scope of the invention as defined in the appended claims .
8
the above groups of the compounds for use in the present invention will be described . the protective group r 1 is preferably alkenyl , aralkyl , alkyloxyalkyl , cyclic alkyl having a hetero - atom or silyl , and is more preferably silyl . the protective group r 2 is preferably alkyloxyalkyl , cyclic alkyl having a hetero - atom or silyl , and is more preferably 1 - alkyloxyethyl . the protective group r 2 may be the same as or different from the protective group r 1 . more specific examples of protective groups r 1 and r 2 are allyl as an alkenyl group ; benzyl , p - methoxybenzyl , diphenylmethyl and trityl as aralkyl groups ; methoxymethyl , benzyloxymethyl , tert - butoxymethyl , 2 , 2 , 2 - trichloroethoxymethyl , 2 - methoxyethoxymethyl and like alkyloxymethyl groups , and 1 - ethoxyethyl , 1 - methylmethoxyethyl , 1 - isopropoxyethyl and like 1 - alkyloxyethyl groups as alkyloxyalkyl groups ; tetrahydropyranyl and tetrahydrofuranyl as cyclic alkyl groups having a hetero - atom ; and trimethylsilyl , triethylsilyl , tert - butyldimethylsilyl , tert - butyldiphenylsilyl , methylditert - butylsilyl , triphenylsilyl , phenyldimethylsilyl , triphenylmethyldimethylsilyl and the like as silyl groups . examples of protective groups r 3 are methyl , ethyl , 2 , 2 , 2 - trichloroethyl and like alkyl groups , and benzyl and like aralkyl groups . examples of cyclic acetals formed by two groups r 3 attached to each other are as follows . ## str14 ## the protective group r 3 is preferably alkyl , and is more preferably ethyl . = p the group r 5 is straight - chain or branched alkyl , alkenyl , alkynyl or alkylaryl which has 5 to 22 carbon atoms and which may contain oxygen , sulfur or silicon . such groups r 5 include alkoxyl , alkyloxyalkoxyl , cyclic or noncyclic acetal , silyl and alkylthio group . preferred examples of group r 5 are groups represented by the following formulae . ## str15 ## among these , the group of the formula ( 5 ) is more preferred . examples of groups r 6 are preferably methyl , ethyl and like alkyl groups , phenyl , p - tolyl , p - chlorophenyl and like aryl groups , and 2 - pyridyl and like heterocyclic groups , among which phenyl is more preferable . examples of x &# 39 ; s are halogen atoms ; methanesulfonyloxy , trifluoromethanesulfonyloxy and like alkylsulfonyloxy groups ; benzenesulfonyloxy , p - toluenesulfonyloxy , m - trifluoromethylbenzenesulfonyloxy , m - chlorobenzenesulfonyloxy and like arylsufonyloxy groups ; etc . halogen atoms represented by x 1 , x and y are chlorine atom , bromine atom , iodine atom and the like . according to the present invention , the optically active cyclopentenone derivative ( xi ) which is an intermediate for preparing a prostaglandin is prepared by the process represented by the following reaction scheme . the reactions involved in the above process will be described below . a ) an acetal derivative ( i ) of 2 - halogenoacrylic aldehyde which is known by tetrahedron lett ., 4797 ( 1969 ) is reacted with a strong base , such as methyllithium , n - butyllithium , sec - butyllithium or tert - butyllithium in an amount at least equivalent thereto to prepare a vinyl anion solution . examples of useful reaction solvents are tetrahydrofuran , diethyl ether , ethylene glycol diethyl ether and like ethers , and hexane and like hydrocarbons . next , an optically active epoxy compound ( ia ) is reacted with the anion in the presence of a lewis acid , such as trifluoroboron etherate , to obtain an optically active 4 - hydroxy - 2 - methylenepentane derivative ( ii ). this reaction is conducted preferably at a low temperature of - 30 ยฐ to - 100 ยฐ c . although the reaction proceeds in the absence of a catalyst , the lewis acid , if used , effects the reaction at an accelerated velocity . b ) the compound ( ii ) is converted to an optically active 2 - methylenepentane derivative ( iii ) by introducing a protective group r 1 into the hydroxyl of the compound . when the group r 1 is , for example , alkenyl , aralkyl , alkyloxymethyl or silyl , corresponding r 1 y 1 ( wherein y 1 a halogen atom such as chlorine , bromine or iodine ) is reacted with the compound ( ii ) in an amount of at least one mole per mole of the compound in the presence of at least one mole of a base per mole of the compound ( ii ). examples of useful bases are triethylamine , ethyldiisopropylamine , pyridine , 4 - dimethylaminopyridine , imidazole and like organic bases , and sodium hydride , sodium amide and like inorganic bases . when r 1 is a 1 - alkyloxyethyl group or cyclic alkyl group having a hetero - atom , the reaction is conducted using at least one mole of corresponding vinyl ether or the like per mole of the compound ( ii ), and an acid catalyst such as hydrogen chloride , p - toluenesulfonic acid , pyridine - p - toluenesulfonic acid salt or an acidic ion exchange resin ( such as amberlyst h15 ). c ) the compound ( iii ) is made into an optically active 2 - methylenepentanal derivative ( iv ) by hydrolyzing the acetal portion of the compound in the presence of a weak lewis acid . this reaction can be conducted by reacting the compound ( iii ) with a weak lewis acid catalyst , such as copper sulfate , zinc bromide or silica gel , in a water - containing solvent , such as a mixture of water and ethanol . d ) the compound ( iv ) is converted to an optically active cyanohydrin derivative ( vi ). the conversion to the cyanohydrin derivative is effected using hydrogen cyanide in the usual manner . alternatively , the compound ( iv ) can be readily converted to the compound ( vi ) by reacting the compound ( iv ) with trimethylsilyl cyanide in the presence of 18 - crown ether - 6 catalyst to obtain a trimethylsilylated cyanohydrin derivative ( v ), and hydrolyzing the derivative . the compound ( v ) can be made directly into the compound ( viii ) to be described below . e ) a protective group r 2 is introduced into the hydroxyl of the compound ( vi ), whereby the compound is converted to a protected cyanohydrin derivative ( vii ). the introduction of protective group r 2 is done under the same conditions as the introduction of protective group r 1 for the conversion of the compound ( ii ) to the compound ( iii ). f ) the compound ( vii ) is cyclized by being treated in the presence of a base for conversion to an optically active 2 - methylenecyclopentane derivative ( viii ). examples of useful bases are lithium hydride , sodium hydride , potassium hydride , lithium amide , sodium amide , potassium amide , lithium diisopropylamide , sodium hexamethyldisilazane , lithium hexamethyldisilazane , potassium hexamethyldisilazane and the like . the reaction time and the solvent to be used are suitably determined according to the kind of base to be used . for example , in the case where lithium diisopropylamide is used , it is desirable to conduct the reaction at + 60 ยฐ to - 100 ยฐ c . in diethyl ether or tetrahydrofuran . when sodium hexamethyldisilazane is used , it is desirable to carry out the reaction in tetrahydrofuran , dioxane , benzene or toluene at room temperature to 110 ยฐ c . the base is used in 1 to 10 times , preferably 1 to 5 times , the amount equivalent to the compound ( vii ). g ) the compound ( viii ) is treated in the presence of an acid to hydrolyze the group -- or 2 thereof and then treated in the presence of a base for decyanohydrogenation to obtain an optically active 2 - methylenecyclopentanone derivative ( ix ). the hydrolysis of -- or 2 is effected by a known method . for example , this reaction can be conducted in a water - containing solvent at a temperature of 0 ยฐ to 100 ยฐ c . using an acid such as hydrochloric acid , p - toluenesulfonic acid or acetic acid , acidic ion exchange resin , lewis acid such as trifluoroboron etherate , zinc bromide or aluminum chloride , or weakly acidic substance such as pyridine - p - toluenesulfonic acid salt . when the protective group r 2 is silyl , it is also possible to remove the protective group with use of tetra - n - butyl ammonium fluoride or like quaternary ammonium fluoride salt . when the protective group r 2 is aralkyl , hydrogenation decomposition with use of palladium is also an effective method . the decyanohydrogenation is conducted using at least an equivalent amount of sodium hydroxide , potassium hydroxide , sodium hydrogencarbonate , potassium carbonate or like inorganic base , or ammonia , triethylamine , pyridine , 4 - dimethylaminopyridine or like organic base . h ) the compound ( ix ) is reacted with an organozinc compound or organocopper compound ( r 5 m ) separately prepared to introduce an alpha - chain into the compound ( ix ), and the resulting enolate is reacted with an organoselenium compound or organosulfur compound ( r 6 zy ) to give an optically active cyclopentanone derivative ( x ). the derivative ( x ) is oxidized with an oxidizing agent , such as hydrogen peroxide or organic peracid , followed by an elimination reaction at a temperature of 0 ยฐ to 150 ยฐ c . to obtain a known optically active cyclopentenone derivative ( xi ) which is an intermediate for preparing a prostaglandin . the organozinc compound or organocopper compound r 5 m is prepared by the following method . the organocopper compound is prepared by lithiating a compound r 5 x 2 ( wherein x 2 is chlorine , bromine , or like halogen atom ), for example , with methyllithium , sec - butyllithium , tert - butyllithium or like organolithium compound or metallic lithium , or reacting the compound r 5 x 2 with metallic magnesium to obtain a grignard reagent , and treating the resulting compound with cuprous cyanide , cuprous iodide or separately prepared ( 2 - thienyl ) cu ( cn ) li . the organozinc compound can be prepared by reacting the tetramethylethylenediamine complex of zinc chloride with two equivalents of methyllithium to obtain dimethylzinc , and adding a reaction mixture obtained by lithiating the compound r 5 x 2 to the product . the reaction for preparing the organometallic compound r 5 m can be conducted at a temperature of - 100 ยฐ to 0 ยฐ c . in an inert solvent , such as n - hexane , toluene or like hydrocarbon , diethyl ether , tetrahydrofuran , dioxane or like ether , or a mixture of such solvents . i ) the compound ( xi ) can be converted to an aldehyde or alcohol by removing the acetal , silyl , alkyloxyalkyl or like protective group from the group r 5 thereof . a prostaglandin derivative can be prepared from the compound ( xi ) by a known process ( f . s . alvarez et al ., j . am . chem . soc ., 94 , 7823 ( 1972 ); a . f . kluge et al , j . am . chem . soc ., 94 , 7828 , 9256 ( 1972 ); c . j . sih et al ., j . am ., chem . soc ., 97 , 857 , 865 ( 1975 )). to clarify the technical features of the present invention , the present invention will be described in greater detail with reference to the following examples . in an argon atmosphere with stirring , n - butyllithium was added dropwise over a period of 20 minutes to a solution of 9 . 35 g ( 44 . 9 mmoles ) of 2 - bromo - 3 , 3 - diethoxypropene in 80 ml of anhydrous tetrahydrofuran cooled to - 78 ยฐ c ., and the mixture was further stirred at - 78 ยฐ c . for 40 minutes to prepare a vinyllithium solution . on the other hand , 5 . 31 g ( 37 . 4 mmoles ) of trifluoroboron etherate was added dropwise to a solution of 3 . 46 g ( 37 . 4 mmoles ) of optically active ( s )- epichlorohydrin ( at least 98 . 5 % in chemical purity , at least 99 % in optical purity ) in 70 ml of anhydrous tetrahydrofuran cooled to - 78 ยฐ c ., with stirring in an argon atmosphere , followed by further stirring for 10 minutes . the vinyllithium solution previously prepared was added dropwise to the epichlorohydrin at - 78 ยฐ c . over a period of 35 minutes , and the mixture was further stirred for 20 minutes . with vigorous stirring , the resulting reaction mixture was poured into a saturated aqueous solution of ammonium chloride which was precooled . the aqueous layer was subjected to extraction with ether six times , the ethereal extract was washed with a saturated aqueous ammonium chloride solution twice and with a saturated sodium chloride aqueous solution twice and then dried over anhydrous magnesium sulfate . the dried extract was distilled in a vacuum to remove the solvent , giving 6 . 97 g ( yield 84 %) of an optically active 4 - hydroxy - 2 - methylenepentane derivative ( ii - a ) represented by the following chemical formula . ## str17 ## nmr ( cdcl 3 ): ฮด : 1 . 23 ( 6h , t , j = 7 . 0 hz , ch 3 ); 2 . 34 - 2 . 52 ( 2h , m , ch 2 ); 3 . 25 - 4 . 17 ( 9h , m , ch 2 o , ch 2 cl , ch , oh ); 4 . 70 ( 1h , s , och -- o ); 5 . 14 - 5 . 50 ( 2h , m , โ• ch 2 ). the same procedure as above was repeated except that optically active ( s )- epibromohydrin was used instead of optically active ( s )- epichlorohydrin to obtain an optically active 4 - hydroxy - 2 - methylenepentane derivative ( ii - b ) represented by the above chemical formula . nmr ( cdcl 3 ): ฮด : 1 . 23 ( 6h , t , j = 7 . 0 hz , ch 3 ); 2 . 34 - 2 . 55 ( 2h , m , ch 2 ); 3 . 29 - 3 . 80 ( 8h , m , ch 2 o , ch 2 br , ch ); 3 . 80 - 4 . 14 ( 1h , m , oh ); 4 . 71 ( 1h , s , och -- o ); 5 . 14 - 5 . 32 ( 2h , m , โ• ch 2 ). imidazole ( 6 . 43 g , 94 . 5 mmoles ) was added dropwise to a solution of 6 . 96 g of the above 4 - hydroxy - 2 - methylenepentane derivative ( ii - a ) in 10 ml of n , n - dimethylformamide at 0 ยฐ c . with stirring , 14 . 07 g ( 51 . 3 mmoles ) of tert - butyldiphenylsilyl chloride was then added dropwise to the solution , followed by stirring on a water bath overnight . the reaction mixture was thereafter neutralized with 3n hydrochloric acid , the aqueous layer was subjected to extraction with ether three times , and the extract was washed with a saturated aqueous solution of sodium bicarbonate twice and then with saturated aqueous solution of sodium chloride three times and dried over anhydrous magnesium sulfate . the solvent was distilled off in a vacuum , giving 19 . 96 g of an optically active 2 - methylenepentane derivative ( iii - a ) having protected hydroxyl and represented by the following chemical formula . ## str18 ## the same procedure as above was repeated except that the optically active compound ( ii - b ) wherein x is br was used in place of the optically active 4 - hydroxy - 2 - methylenepentane derivative ( ii - a ) to obtain an optically active compound ( iii - b ) represented by the above chemical formula . preparation of compounds ( iv ) a 19 . 87 g quantity of the optically active 2 - methylenepentane derivative ( iii - a ) was dissolved in 120 ml of 80 % aqueous solution of methanol , and the solution was heated with stirring for 1 hour with the addition of 10 . 09 g of copper sulfate . the reaction mixture was passed through celite for filtration . with addition of 300 ml of benzene , the filtrate was subjected to azeotropic distillation to remove methanol and water . the residue was subjected to extraction with ether , and the ethereal extract was washed with a saturated aqueous solution of sodium bicarbonate . the aqueous layer was subjected to extraction with ether six times , and the extract was washed with an aqueous solution of sodium chloride , dried over anhydrous magnesium sulfate and distilled in a vacuum to remove the solvent , giving 18 . 66 g of an optically active 2 - methylenepentanal derivative ( iv - a ) represented by the following chemical formula . ## str19 ## nmr ( cdcl 3 ): ฮด : 1 . 07 ( 9h , s , ch 3 ); 2 . 49 - 2 . 71 ( 2h , m , ch 2 ); 3 . 34 ( 2h , d , j = 5 . 0 hz , ch 2 ); 3 . 94 - 4 . 26 ( 1h , m , ch ); 5 . 99 ( 1h , s , โ• ch ); 6 . 24 ( 1h , s , โ• ch ); 7 . 29 - 7 . 91 ( 10h , m , c 6 h 5 ); 9 . 94 ( 1h , s , cho ). the same procedure as above was repeated except that the optically active compound ( iii - b ) wherein x is br was used in place of the optically active 2 - methylenepentane derivative ( iii - a ) to obtain an optically active ( iv - b ) represented by the above chemical formula . nmr ( cdcl 3 ): ฮด : 1 . 07 ( 9h , s , ch 3 ); 2 . 43 - 2 . 83 ( 2h , m , ch 3 ); 3 . 21 ( 2h , d , j = 5 . 0 hz , ch 2 ); 3 . 86 - 4 . 23 ( 1h , m , ch ); 5 . 99 ( 1h , br s , โ• ch ); 6 . 26 ( 1h , br s , โ• ch ); 7 . 29 - 7 . 91 ( 10h , m , c 6 h 5 ); 9 . 94 ( 1h , s , cho ). in an argon atmosphere , a catalytic quantity of potassium cyanide complex of 18 - crown ether was added to 18 . 66 g of the optically active 2 - methylenepentanal derivative ( iv - a ), and 3 . 65 g ( 36 . 8 mmoles ) of trimethylsilyl cyanide was added dropwise to the mixture with stirring . the reaction mixture was further stirred on a water bath for 1 hour , diluted with 100 ml of tetrahydrofuran , and stirred for 20 minutes with addition of 30 ml of 1n hydrochloric acid . the aqueous layer was subjected to extraction with ether six times , and the extract was washed with water , then dried over anhydrous magnesium sulfate and distilled in a vacuum to remove the solvent , giving an optically active 1 - cyano - 2 - methylenepentane derivative ( vi - a ) in the form of a crude product and represented by the following chemical formula . the crude product was subjected to silica gel column chromatography ( n - hexane : ether = 8 : 1 ) to obtain 6 . 14 g of a purified product . the yield was 47 . 4 % based on the compound ( ii - a ). a 2 . 80 g quantity of the material compound ( iv - a ) was recovered from the process . ## str20 ## nmr ( cdcl 3 ): ฮด : 1 . 0 - 1 . 17 ( 9h , d , ch 3 ); 2 . 51 - 2 . 86 ( 2h , m , ch 2 ); 3 . 00 - 3 . 57 ( 3h , m , ch 2 , ch ); 3 . 91 - 4 . 23 ( 1h , m , ch ); 4 . 71 - 4 . 96 ( 1h , m , oh ); 5 . 21 - 5 . 63 ( 2h , m , โ• ch 2 ); 7 . 25 - 7 . 91 ( 1h , m , ch ). the same procedure as above was repeated except that the optically active compound ( iv - b ) wherein x is br was used in place of the optically active 2 - methylenepentanal derivative ( iv - a ) to obtain an optically active compound ( vi - b ). nmr ( cdcl 3 ): ฮด : 1 . 0 - 1 . 32 ( 9h , m , ch 3 ); 2 . 55 - 3 . 67 ( 5h , m , ch 2 , ch ); 3 . 90 - 4 . 21 ( 1h , m , ch ); 4 . 84 ( 1h , s , oh ); 5 . 18 - 5 . 67 ( 2h , m , โ• ch 2 ); 7 . 28 - 7 . 85 ( 10h , m , c 6 h 5 ). a catalytic quantity of p - toluenesulfonic acid was added to a solution of 6 . 14 g ( 14 . 8 mmoles ) of the optically active 1 - cyano - 2 - methylenepentane derivative ( vi - a ) in 90 ml of anhydrous benzene in an argon atmosphere , and 1 . 18 g ( 16 . 3 mmoles ) of ethyl vinyl ether was added dropwise to the solution on a water bath with stirring . the reaction mixture was further stirred for 40 minutes and neutralized with a precooled saturated aqueous solution of sodium bicarbonate . the aqueous layer was subjected to extraction with ether four times , and the extract was washed with an aqueous solution of sodium chloride , then dried over anhydrous magnesium sulfate and distilled in a vacuum to remove the solvent , giving 6 . 68 g of an optically active 1 - cyano - 2 - methylenepentane derivative ( vii - a ) represented by the following chemical formula . ## str21 ## nmr ( cdcl 3 ): ฮด : 0 . 93 - 1 . 43 ( 15h , m , ch 3 ); 2 . 35 - 2 . 74 ( 2h , m , ch 2 ); 3 . 23 - 3 . 77 ( 4h , m , ch 2 ); 3 . 89 - 4 . 11 ( 1h , m , ch ); 4 . 34 - 5 . 03 ( 2h , m , ch ); 5 . 19 ( 1h , br s , โ• ch ); 5 . 43 - 5 . 63 ( 1h , m , โ• ch ); 7 . 29 - 7 . 91 ( 10h , m , c 6 h 5 ). the same procedure as above was repeated except that the optically active compound ( vi - b ) wherein x is br was used in place of the optically active 1 - cyano - 2 - methylenepentane derivative ( vi - a ) to obtain an optically active compound ( vii - b ) represented by the above chemical formula . nmr ( cdcl 3 ): ฮด : 0 . 93 - 1 . 43 ( 15h , m , ch 3 ); 2 . 37 - 2 . 74 ( 2h , m , ch 2 ); 3 . 09 - 3 . 77 ( 4h , m , ch 2 , ch ); 3 . 89 - 4 . 23 ( 1h , m , ch ); 4 . 60 - 5 . 14 ( 2h , m , ch ); 5 . 14 - 5 . 71 ( 2h , m , โ• ch 2 ); 7 . 31 - 7 . 91 ( 10h , m , c 6 h 5 ). ir ( neat ): 1700 ( c โ• c ), 1110 , 1050 , 940 , 830 , 740 , 700 cm - 1 . a 10 . 3 ml quantity of benzene solution of sodium hexamethyldisilazane ( concentration : 0 . 66n ) was added to 50 ml of anhydrous tetrahydrofuran in an argon atmosphere . a solution of 1 . 23 g of the optically active 1 - cyano - 2 - methylenepentane derivative ( vii - a ) in 20 ml of anhydrous tetrahydrofuran was added dropwise to the mixture at 50 ยฐ c . over a period of 70 minutes with stirring . with vigorous stirring , the reaction mixture was poured into a precooled saturated aqueous solution of ammonium chloride , followed by extraction with ether five times . the extract was washed with 1n hydrochloric acid and then with an aqueous solution of sodium chloride and purified by silica gel column chromatography ( n - hexane : ether = 20 : 1 ), affording 756 mg of an optically active 2 - methylenecyclopentanecyanohydrin derivative ( viii ) represented by the following chemical formula . the yield from the compound ( vi - a ) was 61 . 6 %. ## str22 ## nmr ( cdcl 3 ): ฮด : 0 . 93 - 1 . 57 ( 15h , m , ch 3 ); 2 . 06 - 2 . 71 ( 4h , m , ch 2 ); 3 . 23 - 3 . 86 ( 1h , m , ch ); 4 . 14 - 4 . 60 ( 1h , m , ch ); 4 . 69 - 5 . 11 ( 1h , m , ch ); 5 . 11 - 5 . 37 ( 1h , m , ch ); 5 . 37 - 5 . 66 ( 1h , m , ch ); 7 . 31 - 7 . 90 ( 10h , m , c 6 h 5 ). the same procedure as above was repeated except that the optically active compound ( vii - b ) wherein x is br was used in place of the optically active 1 - cyano - 2 - methylenepentane derivative ( vii - a ), whereby an optically active compound ( viii ) was obtained in a yield approximate to the above . a catalytic quantity of pyridine p - toluenesulfonic acid salt was added to a solution of 756 mg ( 1 . 68 mmoles ) of the optically active 2 - methylenecyclopentanecyanohydrin derivative ( viii ) in 30 ml of anhydrous methanol in an argon atmosphere , followed by refluxing for 1 . 2 hours . the solvent was distilled off in a vacuum , 25 ml of anhydrous tetrahydrofuran and 10 ml of saturated aqueous solution of sodium bicarbonate were thereafter added to the residue at room temperature , and the mixture was stirred for 1 . 5 hours . ether was added to the reaction mixture for extraction , and the extract was washed with an aqueous solution of sodium chloride . the aqueous layer was further subjected to extraction with ether five times . the extracts were combined together , washed with 1n hydrochloric acid and then with an aqueous solution of sodium chloride and thereafter dried . the solvent was distilled off in a vacuum , and the residue was purified by silica gel column chromatography ( n - hexane : ether = 40 : 1 ), giving 307 . 5 mg ( yield 52 . 2 %) of an optically active 2 - methylenecyclopentanone derivative ( ix ) represented by the following chemical formula . ## str23 ## 1 hnmr ( cdcl 3 ): ฮด : 1 . 04 ( 9h , s , ch 3 ); 2 . 42 ( 2h , d , j = 5 . 0 hz , ch 2 ); 2 . 72 ( 2h , quint , 2 . 4 hz , ch 2 ); 4 . 47 ( 1h , quint , 5 . 0 hz , ch ); 5 . 29 ( 1h , dt , j = 2 . 4 hz , 1 . 5 hz , โ• ch ); 6 . 03 ( 1h , dt , j = 2 . 4 hz , 1 . 5 hz , โ• ch ); 7 . 31 - 7 . 91 ( 10h , m , c 6 h 5 ). 13 cnmr ( cdcl 3 ): ฮด : 19 . 06 , 26 . 79 , 40 . 02 , 48 . 26 , 68 . 51 , 118 . 03 , 127 . 70 , 127 . 76 , 129 . 82 , 129 . 86 , 133 . 50 , 133 . 73 , 135 . 64 , 143 . 22 , 204 . 40 . a solution of 247 . 8 mg ( 0 . 831 mmole ) of a vinyl iodide derivative represented by the following chemical formula ## str24 ## in 7 ml of n - hexane was cooled to - 78 ยฐ c . in an argon stream . this compound is known by j . am . chem . sco ., 97 4745 ( 1975 ). using a syringe , tert - butyllithium was added dropwise to the solution with stirring over a period of 5 minutes , followed by stirring at the same temperature for 90 minutes to obtain a vinyllithium compound represented by the following chemical formula ## str25 ## on the other hand , 230 . 8 mg ( 0 . 914 mmole ) of tetramethylethylenediamine complex of zinc chloride was placed in an argon stream into a three - necked flask , 7 ml of anhydrous tetrahydrofuran was further placed in , and the mixture was cooled to - 20 ยฐ c . with stirring . using a syringe , 1 . 07 ml of 1 . 7n solution of methyllithium ( 1 . 828 mmoles ) in n - hexane was added dropwise to the mixture over a period of 3 minutes , and the reaction mixture was stirred for a further period of 10 minutes and thereafter cooled to - 80 ยฐ c . a solution of the above vinyllithium compound was added dropwise to the resulting solution at - 78 ยฐ c . over a period of 5 minutes using a bridge , followed by stirring at - 78 ยฐ c . to - 60 ยฐ c . for 1 hour . a 7 ml quantity of anhydrous tetrahydrofuran solution of 223 . 5 mg ( 0 . 6376 mmole ) of the optically active 2 - methylenecyclopentanone derivative ( ix ) was added dropwise to the reaction mixture at - 78 ยฐ c . with full stirring over a period of 40 minutes . the container used was washed with 2 ml of anhydrous tetrahydrofuran , and the washings were added to the reaction mixture with stirring over a period of 10 minutes , followed by continued stirring at - 78 ยฐ c . for 30 minutes . a 7 ml quantity of anhydrous tetrahydrofuran solution of 996 . 0 mg ( 3 . 197 mmoles ) of diphenyl diselenide was added to the resulting reaction mixture at - 78 ยฐ c . with vigorous stirring using a syringe , followed by stirring at - 50 ยฐ c . for 30 minutes . the reaction mixture was thereafter poured into a cooled saturated aqueous solution of ammonium chloride with vigorous stirring . the aqueous layer was subjected to extraction with ether six times . the combined ethereal extract was washed with a saturated aqueous solution of sodium chloride twice , then dried over anydrous magnesium sulfate and filtered . the solvent was distilled off from the filtrate . the resulting crude product was purified by silica gel column chromatography ( n - hexane : ether = 5 : 1 ), giving 220 . 1 mg ( yield 50 . 9 %) of an optically active 2 - phenylselenocyclopentanone derivative ( x ) represented by the following chemical formula . ## str26 ## nmr ( cdcl 3 ): ฮด : 1 . 04 ( 9h , s , ch 3 ); 1 . 04 - 1 . 74 ( 12h , m , ch 3 , ch 2 ); 1 . 82 - 2 . 86 ( 6h , m , ch 2 co , ch 2 c โ• c ); 3 . 30 - 3 . 82 ( 4h , m , ch 2 o ); 4 . 34 - 4 . 78 ( 2h , m , och ); 5 . 15 - 5 . 50 ( 2h , m โ• ch ); 7 . 10 - 7 . 70 ( 15h , m , c 6 h 5 ). a 115 . 7 mg quantity ( 0 . 170 mmole ) of the optically active 2 - phenylselenocyclopentanone derivative ( x ) was dissolved in 15 ml of tetrahydrofuran . to the solution thereafter cooled to 0 ยฐ c . was added at a time 0 . 14 ml ( 156 . 1 mg , 1 . 90 mmoles ) of 30 % hydrogen peroxide with stirring . the reaction mixture was slowly returned to room temperature and further stirred at room temperature for 3 hours . the reaction mixture was diluted with ether , and the ethereal layer was separated off and washed with a saturated aqueous solution of sodium chloride . the aqueous layer was further subjected to extraction five times . the ethereal layers were combined together , washed with a saturated aqueous solution of sodium chloride again and thereafter dried over anhydrous magnesium sulfate . the solvent was distilled off in a vacuum from the dry extract . the residue , which was an oily product , was purified by silica gel chromatography ( n - hexane : ether = 5 : 1 ) and further purified by high performance liquid chromatography ( silica gel &# 34 ; si - 160 ,&# 34 ; 7 . 6 cm ( diam . )ร— 30 cm , n - hexane : ethyl acetate = 1 : 4 ), giving 40 . 6 mg ( yield 45 . 9 %) of an optically active cyclopentenone derivative ( xi ) represented by the following chemical formula and 25 . 8 mg of a by - product of undetermined structure . ## str27 ## nmr ( cdcl 3 ): ฮด : 1 . 07 ( 9h , s , ch 3 ); 1 . 07 - 1 . 79 ( 12h , m , ch 2 , ch 3 ); 1 . 87 - 2 . 26 ( 2h , m , ch 2 ); 2 . 34 - 2 . 54 ( 2h , m , ch 2 ); 2 . 70 - 2 . 94 ( 2h , m , ch 2 ); 3 . 18 - 3 . 82 ( 4h , m , ch 2 ); 4 . 66 ( 1h , q , j = 5 . 5 hz , ch ); 4 . 75 - 4 . 98 ( 1h , m , ch ); 5 . 44 ( 1h , m , โ• ch ); 6 . 88 - 7 . 02 ( 1h , m , โ• ch ); 7 . 26 - 7 . 78 ( 10h , m , c 6 h 5 ). to a solution of 31 . 9 mg ( 0 . 06 mmole ) of the optically active cyclopentenone derivative ( xi ) in 2 ml of anhydrous methanol was added a catalytic quantity of p - toluenesulfonic acid in an argon stream with ice - cooling . the reaction mixture was stirred with ice - cooling for 1 hour and 20 minutes and thereafter stirred at room temperature for 1 hour . the reaction mixture was then neutralized with a precooled saturated aqueous solution of sodium bicarbonate . the aqueous layer was subjected to extraction with dichloromethane five times , and the extracts were combined together , washed with a saturated aqueous solution of sodium chloride twice and thereafter dried over anhydrous magnesium sulfate . the solvent was distilled off from the dry extract in a vacuum , and an oily product obtained as the residue was subsequently purified by silica gel column chromatography ( n - hexane : ether = 1 : 1 ), giving 24 . 8 mg ( yield 90 . 2 %) of an optically active cyclopentenone derivative ( xii ) represented by the following chemical formula . ## str28 ## 1 hnmr ( cdcl 3 ): ฮด : 1 . 07 ( 9h , s , ch 3 ); 1 . 15 - 1 . 79 ( 5h , m , ch 2 , oh ); 1 . 87 - 2 . 27 ( 2h , m , ch 2 ); 2 . 06 ( 2h , br q , j = 6 . 4 hz , ch 2 ); 2 . 87 ( 2h , br d , j = 6 . 0 hz , ch 2 ); 3 . 62 ( 2h , t , j = 6 . 4 hz , ch 2 ); 4 . 75 - 4 . 96 ( 1h , m , ch ); 5 . 30 - 5 . 55 ( 2h , m , โ• ch ); 6 . 93 - 6 . 98 ( 1h , m , โ• ch ); 7 . 27 - 7 . 75 ( 10h , m , c 6 h 5 ). 13 cnmr ( cdcl 3 ): ฮด : 19 . 72 , 23 . 24 , 26 . 22 , 27 . 47 , 32 . 89 , 43 . 94 , 46 . 00 , 63 . 34 , 70 . 54 , 125 . 38 , 128 . 41 , 130 . 58 , 132 . 64 , 134 . 26 , 136 . 26 , 146 . 51 , 157 . 23 , 177 . 87 . ir ( neat ): 3400 , 1710 , 1110 , 1070 , 780 , 700 cm - 1 .
2
the trellis - based decoding algorithm naming convention is shown in fig1 . the processing time for one of the processing modes ( usually the feed - forward processing mode ) is generally dependent on a variable m , which is the number of bits in the bit - stream or block 10 . the processing time of the other processing mode ( usually the traceback processing mode ) is generally dependent on m + p * l , where p is the number of d blocks and l is the traceback learning period . in the case of p = 0 , which means that the traceback mode starts only after the feed - forward mode ends for all m bits , the traceback processing time is equal to m , and the amount of path metric / trellis memory required is multiplied by m as well . for small m blocks , where m is on the order of ( 5 * k ), where k is the constraint length , the p = 0 solution may satisfy both the memory and power requirements of mobile communication devices . however in currently deployed wireless standards , the size of m is much greater than ( 5 * k ), and for many systems , in particular wireless communication devices , the reduced power and memory size requirements make this computation unmanageable . the m - bit blocks 10 may each be divided into sub - blocks called โ€œ windows โ€ of d - bits 12 - 14 , where m = p * d + t . p is the number of full d - bit windows 12 - 14 in m and t 16 is the tail bits at the end of the block ( t & lt ; d ). the process of dividing the m blocks 10 into a chain of d sub - blocks 12 - 14 does not affect the feed - forward mode in the trellis decoding algorithm . however , this process may significantly affect the traceback session , since traceback time is m + p * l , where l is the traceback learning period 18 . hence , the more d sub - blocks are in the m block , the greater the traceback processing time . for certain applications , for example , for wcdma , where k = 9 for viterbi , d = 64 , m = 5114 , l = 45 and traceback overhead time is about 3600 cycles . it may be seen that it is desirable to increase the size of d for a given m , but also reduce the traceback processing time or the traceback overhead time of ( p * l ). increasing the size of d or window size may result in adverse implications on the memory requirement and increase power consumption . focusing on reducing l , a trellis - based decoder is devised and shown in fig2 . fig2 is a simplified block diagram of a decoder or method 20 that enables a reduction in overhead in processing time and power consumption . the decoder and method 20 are operable to detect low / high signal - to - noise ratio ( snr ) inputs and further operable to manually or automatically adjust the length of l based on the bit - error - rate ( ber ) or frame - error - rate ( fer ). the circuit comprises a demodulator 22 operable to receive data input from an antenna 24 . the demodulator 22 is operable to provide a hard value as a soft - input 26 into a channel decoder 28 and a hard - input 30 to a comparator 32 . a soft value is a value that has associated therewith a probability . the channel decoder produces a hard output 34 , which is provided as a hard - input 36 to a convolution encoder 38 which re - encode the decoded bits . the re - encoded bits 40 from the convolution encoder 38 is also provided to the comparator 32 . the comparator 32 compares the hard - input 30 received from the demodulator 22 and the re - encoded bits 40 from the convolution encoder 38 and generates a bit - error - rate or frame - error - rate output 42 , which is used to adjust l , the traceback learning period of the channel decoder 28 . for low bit - error - rate , the l can be reduced to about ( k - 1 ), for example . for example , for wcdma , where k = 9 for viterbi , d = 64 , and m = 5114 , ( p * l )= 640 for l = 8 . this reduces the overhead by 2960 cycles . the overhead portion is only ( 640 / 5114 ), which is 0 . 125 instead of ( 3600 / 5114 ), which is 0 . 7 . this translates to significant power savings in case of high signal - to - noise - ratio and low bit - error - rate . for high bit - error - rate , l is about 5 * k . therefore , l is between the values of ( 5 * k ) and ( k - 1 ) or ( 5 * k )& gt ; l & gt ;( k - 1 ). the system components โ€” the demodulator , channel decoder , convolution encoder , and comparator may be implemented with components as known in the art or incorporate technology to be developed in the future . the primary functionality of these components in view of the system shown in fig2 are well - known and thus details of these components are not described herein for the sake of clarity and brevity . the method provides the re - encoding of decoded bits 36 and comparing the re - encoded bits 40 with the received encoded bits 26 to generate a bit - error - rate or frame - error - rate 42 . the bit - error - rate or frame - error - rate 42 is then used to adjust or reduce the learning period length , l , of the channel encoding process . therefore , the channel decoder 28 produces an output that takes into account of both the hard and soft values of the data bits . with the reduction in the learning period , performance and power consumption are both improved . fig3 is a simplified block diagram of an embodiment of a reconfigurable processing system 50 having a plurality of context - based reconfigurable processors 52 - 53 . the reconfigurable processing system 50 is a software - defined radio ( sdr ) that comprises n context - based reconfigurable processors 52 - 53 , where n is at least two . the context - based reconfigurable processors 52 - 53 are interconnected and coupled to a memory 56 , a digital signal processor ( dsp ) and / or direct memory access ( dma ) module ( s ) 58 , and a real - time sequencer 60 via an interconnect fabric 62 . each context - based reconfigurable processor may be a specialized processor operable to focus on a particular signal processing task . for example , one context - based reconfigurable processor may be a viterbi processor that is optimized to perform viterbi decoding operations . another context - based reconfigurable processor may be a correlator processor that is optimized to perform correlation processes . yet another context - based reconfigurable processor may be a turbo code decoder that is optimized to perform forward error correction decoding . one or more of these context - based reconfigurable processors may employ the decoder and method shown in fig2 to reduce the overhead associated with trellis - based decoding processing . context - based reconfigurable processors 52 - 53 each include generic hardware modules that execute context - related instructions in an optimized manner . each context - based reconfigurable processor may operate independently of one another under the scheduling and control of the real - time sequencer 60 . one or more context - based reconfigurable processors may be independently inactivated or shut - down in applications that do not require them to optimize power consumption . the interconnect fabric 62 is reconfigurable and provides connectivity between the components in the reconfigurable processing system 50 . each context - based reconfigurable processor 52 - 53 may act as a master of the interconnect fabric 62 and may initiate access to the memory . the reconfigurable processing system 50 may be used to implement a broadband modem of a mobile phone or similar wireless communications device . the device additionally comprises an rf ( radio frequency ) section 64 and a plurality of applications 66 to carry out specialized functions . because the technology and standards for wireless communications is a continuously moving target , fixed hardware architecture for mobile phones becomes outdated very quickly . therefore , a software - defined context - based reconfigurable system such as the system 50 can adapt to different technologies and standards now known and to be developed . although embodiments of the present disclosure have been described in detail , those skilled in the art should understand that they may make various changes , substitutions and alterations herein without departing from the spirit and scope of the present disclosure . accordingly , all such changes , substitutions and alterations are intended to be included within the scope of the present disclosure as defined in the following claims . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents , but also equivalent structures .
7
the present invention now will be described more filly hereinafter with reference to the accompanying drawings , in which typical and exemplary embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will filly convey the scope of the invention to those skilled in the art . in the drawings , the thickness of layers and regions are exaggerated for clarity . it will be understood that when an element such as a layer or region is referred to as being โ€œ on โ€ another element , it can be directly on the other element or intervening elements may also be present . furthermore , relative terms , such as โ€œ beneath ,โ€ may be used herein to describe one element &# 39 ; s relationship to another elements as illustrated in the drawings . it will be understood that relative terms are intended to encompass different orientations of a structure in addition to the orientation depicted in the drawings . for example , if the structure in the drawings is turned over , elements described as โ€œ below โ€ other elements would then be oriented โ€œ above โ€ 1 the other elements . the exemplary term โ€œ below ,โ€ therefore , encompasses both an orientation of above and below . it will be understood that although the terms โ€œ first โ€ and โ€œ second โ€ are used herein to describe various regions , layers and / or components , these regions , layers and / or components should not be limited by these terms . these terms are only used to distinguish one region , layer or section from another region , layer or section . thus , a first region , layer or section discussed below could be termed a second region , layer or section , without departing from the teachings of the present invention . as used herein the term โ€œ and / or โ€ includes any and all combinations of one or more of the associated listed items . like numbers refer to like elements throughout . fig4 and 5 illustrate a polishing pad 400 according to some embodiments of the present invention . the pad 400 includes a disk - shaped resilient layer 401 having a recess 410 formed therein about its center . the recess 410 is configured to open towards the surface of the platen of the polishing machine ( e . g ., the machine in fig1 ) when the pad 400 is installed , thus forming an air cushion between the pad 400 and the platen . the recess 410 may be formed using any of a variety of different techniques , including cutting or skiving . the pad 400 may include any of a number of different materials , including , but not limited to , any of a variety of materials including polycarbonate , acrylic rubber , acrylic resin , cellulose , polystyrene , thermoplastic polyester , acrylonitrile butadiene styrene ( abs ), polyvinyl chloride ( pvc ), allyl diglycol carbonate ( adc ), polyurethane , and / or polybutadiene . fig6 - 10 illustrate a variety of polishing pad configurations according to various embodiments of the present invention . fig6 is a cross - sectional view of a polishing pad 600 according to further embodiments of the present invention , wherein a recess for forming an air cushion under the pad 600 includes a circular groove 610 formed in a disk - shaped resilient layer 601 . fig7 is a cross sectional view of a polishing pad 700 according to additional embodiments , which includes a disk - shaped resilient layer with a recess 710 having sloped sidewalls . a pad 800 according to other embodiments of the present invention illustrated in fig8 includes disk 801 having a recess 8 10 therein filled with a material 812 that is less rigid than the disk 801 . for example , the disk 801 may be formed of polycarbonate , acrylic rubber , acrylic resin , cellulose , polystyrene , thermoplastic polyester , acrylonitrile butadiene styrene ( abs ), polyvinyl chloride ( pvc ), allyl diglycol carbonate ( adc ), polyurethane , and / or polybutadiene , and the less rigid material 814 in the recess 812 may be , for example , an open - cell foam or non - woven fiber material . fig9 illustrates a pad 900 including first and second disks 901 , 902 , wherein the first disk 901 is made of a stiffer material , such as polycarbonate , acrylic rubber , acrylic resin , cellulose , polystyrene , thermoplastic polyester , acrylonitrile butadiene styrene ( abs ), polyvinyl chloride ( pvc ), allyl diglycol carbonate ( adc ), polyurethane , and / or polybutadiene , and the second disk 902 is a less rigid material , such as an open - cell foam or a non - woven fiber material . the first disk 901 is adhesively bonded to the second disk 901 , and has recess 910 formed therein . fig1 illustrates a pad 100 including rigid and less rigid disks 1001 , 1002 , respectively , and a recess 1010 that passes through the second disk 1002 and into the first disk 1001 . it will be appreciated that a number of other pad configurations fall within the scope of the present invention , and that the invention is not limited to the configurations illustrated . for example , a reduced - rigidity area in a polishing pad may be provided by other structures that provide a cushion at a selected area of a pad , for example , by embedding air or gas bubbles in selected portions of a resilient layer to provide reduced rigidity and / or by using a less rigid material at a selected area of a pad . the present invention is also applicable to pads having non - disk - like shapes , including , but not limited to , belt - like pads . fig1 illustrates a polishing apparatus 1100 according to some embodiments of the present invention , including a pad 400 as illustrated in fig4 and 5 . as shown , the apparatus 1100 includes a platen 120 driven by a motor 150 and shaft 160 , a polishing head 110 driven by a motor 170 and a shaft 180 , and a pad conditioner 140 . the pad 400 is affixed to the platen 120 such that the recess 410 faces the surface of the platen 120 . the recess 410 is configured to provide decreased rigidity proximate the edge of the wafer w as the polishing head 110 forces the wafer w against the pad 400 . as further shown in fig1 , the apparatus 1100 may further include a detector 190 , such as the laser interferometer - based detector described in u . s . pat . no . 5 , 964 , 643 to birang et al ., that monitors the polished surface of the wafer w through an opening or window 123 in the platen 120 and through the pad 400 to enable monitoring of the surface condition of the wafer w . such monitoring may be used , for example , to detect when a desired polishing result has been achieved . it will be appreciated that at least portion of the pad 400 overlying the opening or window 123 preferably is transparent in the spectrum used by the detector 190 to allow for such monitoring . as shown in fig1 and 13 , when the pad 400 is affixed to the platen 120 , the recess 410 is centered around an axis of a circular loop 1200 described by the polishing head 110 as it moves the wafer w across the surface of the pad 400 . preferably , the recess 410 is proximate a locus of movement 1210 of the retaining ring 114 of the polishing head 110 , i . e ., as the polishing head 110 moves the wafer w around the surface of the pad 400 around the loop 1200 , the recess 410 of the pad 400 is proximate an innermost portion 1220 of the loop 1200 . it will be appreciated that the size and / or shape of the recess may be altered depending on the nature of the movement of the polishing head ( e . g ., oscillatory or non - oscillatory movement ), the nature of the pad material , and / or the nature of the polishing process ( e . g ., the type of slurry and / or material being polished ). it will be further appreciated that other pad configurations may be used in similar ways to those described above with reference to fig1 and 13 . for example , the pads shown in fig6 - 9 may be mounted with their recesses and / or less rigid portions positioned in a manner similar to that described with reference to fig1 and 13 . it will also be understood that the present invention is applicable to other types of machines than the one illustrated in fig1 - 13 , such as machines that have a polishing head that moves a rotating wafer in a loop around a fixed platen . investigations of pad designs have been conducted for an ebara frex 3005 polishing machine having a structure along the lines shown in fig1 . the machine has a polishing head with an approximately 300 mm diameter retaining ring , with the width of the retaining ring being around 25 mm . as the polishing head oscillates , the centerline of the retaining ring moves between about 30 mm and about 50 mm from the center of the polishing pad . it has been determined that a pad having a circular recess as shown in fig1 i 1 with a radius of about 15 mm to about 50 mm may be particularly advantageous for such a machine . if the recess is too small , for example , such that it does not reach to under the retaining ring , the pad may erode and / or tear . if the recess is too large , the polishing rate at the edge portion of wafer may be undesirably decreased . for a polybutadiene pad with a thickness of about 2 mm , it has been found that a recess with a depth of about 0 . 1 mm to about 0 . 5 mm produces desirable results . it will be appreciated that optimal recess size and / or shape may depend on a number of different factors , including , but not limited to , the type of machine , pad material , slurry properties and wafer properties . fig1 and 15 show polishing profiles produced using a conventional polishing pad configuration and a pad configuration according to some embodiments of the present invention , respectively . the profile produced using a conventional configuration ( fig1 ) exhibits significant non - uniformity , including a hunting area near the edge of the wafer , while the polishing profile using a polishing pad according to embodiments of the present invention ( fig1 ) exhibits improved uniformity . according to further aspects of the present invention , registration features may be provided on a polishing pad and / or platen to facilitate alignment of a recess or other feature that is used to vary the surface rigidity of a polishing pad . for example , as shown in fig1 , a platen 120 โ€ฒ may have registration lines 122 โ€ฒ thereon which are configured to align with corresponding lines 420 โ€ฒ on a polishing pad 400 โ€ฒ having a recess 410 โ€ฒ therein . alignment of the marks 420 โ€ฒ, 122 โ€ฒ may be facilitated by fabricating the pad 400 โ€ฒ out of a transparent material , such that the marks may be viewed through the pad 400 โ€ฒ. in this manner , the recess 4 lo can be accurately positioned at the center of the platen 120 โ€ฒ. as shown in fig1 , a circular alignment mark 122 โ€ฒ configured to match a recess 410 โ€ณ of a polishing pad 400 โ€ณ may be provided on a platen 120 โ€ณ to provide a similar alignment capability . according to further embodiments of the present invention illustrated in fig1 , a polishing apparatus 1800 may achieve improved performance by using a recess 1820 in its platen 1810 to provide a reduced - rigidity area . as shown in fig1 and 19 , the recess 1820 may be positioned similarly to the pad recess 410 shown in fig1 - 13 . it will be appreciated that , in other embodiments of the present invention , a recess or recesses having other configurations ( e . g ., grooved ) and / or filled with a less rigid material that reduces surface rigidity may be used . it will also be appreciated that , some embodiments of the present invention , recesses and / or other selective cushioning strictures may be provided in both platen and polishing pad . as further shown in fig1 , the apparatus 1800 may further include a detector 190 that is operative to monitor a surface of a wafer w through an opening 123 in the platen 120 and through the pad 130 , along the lines described above with reference to fig1 . in the drawings and specification , there have been disclosed typical embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims .
1
the term โ€œ nucleotide โ€ refers to any of the four deoxyribonucleotides , da , dg , dt , and dc ( constituents of dna ), and the four ribonucleotides , a , g , u , and c ( constituents of rna ). ina , lna , and any other nucleic acid capable of specific base pairing are also suitable in accordance with the present invention . each natural nucleotide comprises or essentially consists of a sugar moiety ( ribose or deoxyribose ), a phosphate moiety , and a natural / standard base moiety . natural nucleotides bind to complementary nucleotides according to well - known rules of base pairing ( watson and crick ), where adenine ( a ) pairs with thymine ( t ) or uracil ( u ); and where guanine ( g ) pairs with cytosine ( c ), wherein corresponding base - pairs are part of complementary , anti - parallel nucleotide strands . the base pairing results in a specific hybridization between predetermined and complementary nucleotides . modified nucleotides can have alterations in sugar moieties and / or in pyrimidine or purine base moieties . sugar modifications include , for example , replacement of one or more hydroxyl groups with halogens , alkyl groups , amines , and azido groups , or sugars can be functionalized as ethers or esters . moreover , the entire sugar moiety can be replaced with sterically and electronically similar structures , such as aza - sugars and carbocyclic sugar analogs . examples of modifications in a base moiety include alkylated purines and pyrimidines , acylated purines or pyrimidines , or other well - known heterocyclic substitutes . nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages . analogs of phosphodiester linkages include phosphorothioate , phosphorodithioate , phosphoroselenoate , phosphorodiselenoate , phosphoroanilothioate , phosphoranilidate , phosphoramidate , and the like . the term โ€œ nucleic acid molecule โ€ also includes e . g . so - called โ€œ peptide nucleic acids ,โ€ which comprise naturally - occurring or modified nucleic acid bases attached to a polyamide backbone . nucleic acids can be either single stranded or double stranded . in an aspect of the present invention , โ€˜ nucleic acid โ€™ is meant to comprise antisense oligonucleotides ( aso ), small inhibitory rnas ( sirna ), short hairpin rna ( shrna ) and microrna ( mirna ). the term antimir ( or antagomir ) refers to an oligonucleotide complementary to a microrna , such as mir - 138 . the term blockmir refers to an oligonucleotide that is complementary to the microrna target sequence on the mrna it regulates . microrna modulation can be achieved either by using antimirs or by using blockmirs . the term bone loss disorder in accordance with the present invention should be interpreted broadly . in certain embodiments , the bone loss is associated with ankylosing spondylitis , renal osteodystrophy ( e . g ., in patients undergoing dialysis ), osteoporosis , glucocorticoid - induced osteoporosis , paget &# 39 ; s disease , abnormally increased bone turnover , periodontitis , bone fractures , rheumatoid arthritis , osteoarthritis , periprosthetic osteolysis , osteogenesis imperfecta , metastatic bone disease , hypercalcemia of malignancy , multiple myeloma , bone loss associated with microgravity , langerhan &# 39 ; s cell histiocytosis ( lhc ), bone loss associated with renal tubular disorders , or bone loss associated with bed - ridden conditions . in certain embodiments , the bone loss is associated with ankylosing spondylitis , renal osteodystrophy ( e . g ., in patients undergoing dialysis ), osteoporosis , glucocorticoid - induced osteoporosis , paget &# 39 ; s disease , abnormally increased bone turnover , bone fractures , osteoarthritis , periprosthetic osteolysis , osteogenesis imperfecta , metastatic bone disease , hypercalcemia of malignancy , multiple myeloma , bone loss associated with microgravity , langerhan &# 39 ; s cell histiocytosis ( lhc ), bone loss associated with renal tubular disorders , or bone loss associated with bed - ridden conditions . in certain embodiments , the bone loss is associated with ankylosing spondylitis , renal osteodystrophy ( e . g ., in patients undergoing dialysis ), osteoporosis , glucocorticoid - induced osteoporosis , abnormally increased bone turnover , periodontitis , bone fractures , periprosthetic osteolysis , osteogenesis imperfecta , hypercalcemia of malignancy , multiple myeloma , bone loss associated with microgravity , langerhan &# 39 ; s cell histiocytosis ( lhc ), bone loss associated with renal tubular disorders , or bone loss associated with bed - ridden conditions . in certain embodiments , the bone loss is associated with osteoporosis , glucocorticoid - induced osteoporosis , paget &# 39 ; s disease , abnormally increased bone turnover , periodontitis , bone fractures , rheumatoid arthritis , osteoarthritis , periprosthetic osteolysis , osteogenesis imperfecta , metastatic bone disease , hypercalcemia of malignancy , multiple myeloma , bone loss associated with microgravity , langerhan &# 39 ; s cell histiocytosis ( lhc ), bone loss associated with renal tubular disorders , or bone loss associated with bed - ridden conditions . in certain embodiments , the bone loss is associated with osteoporosis , glucocorticoid - induced osteoporosis , paget &# 39 ; s disease , abnormally increased bone turnover , bone fractures , osteoarthritis , periprosthetic osteolysis , osteogenesis imperfecta , metastatic bone disease , hypercalcemia of malignancy , multiple myeloma , bone loss associated with microgravity , langerhan &# 39 ; s cell histiocytosis ( lhc ), bone loss associated with renal tubular disorders , or bone loss associated with bed - ridden conditions . in certain embodiments , the bone loss is associated with osteoporosis , glucocorticoid - induced osteoporosis , abnormally increased bone turnover , periodontitis , bone fractures , periprosthetic osteolysis , osteogenesis imperfecta , hypercalcemia of malignancy , multiple myeloma , bone loss associated with microgravity , langerhan &# 39 ; s cell histiocytosis ( lhc ), bone loss associated with renal tubular disorders , or bone loss associated with bed - ridden conditions . with the aim to identify specific mirnas with a potential to improve bone formation in vivo the present inventors first performed mirna microarray to compare mirna expression profile of undifferentiated hmscs to hmscs differentiated into osteogenic lineage . microarray analysis and further validation of mirna expression by qrt - pcr revealed significant downregulation of mir - 138 during osteoblast differentiation of hmscs . overexpression of mir - 138 by transfection with pre - mir - 138 decreased osteogenic differentiation capacity of hmscs in vitro , demonstrated by alp activity assay and gene expression analysis . additionally , overexpression of mir - 138 reduced ectopic bone formation in vivo by 85 %. in contrast , silencing mir - 138 by anti - mir - 138 increased osteogenesis of hmscs in vitro and ectopic bone formation in vivo by 60 %. target prediction analysis suggested focal adhesion kinase ( fak / ptk2 ) as a potential target for mir - 138 . since the fak pathway has been reported to play a role in promoting osteoblast differentiation it is likely that mir - 138 regulates bone formation by targeting ptk2 and inhibiting fak pathway and subsequently osteogenesis . in conclusion , the inventors have shown that mir - 138 plays an important role in enhancing bone formation in vivo , possibly through inhibition of fak signaling pathway . inhibition of mir - 138 is a new strategy for enhancing bone formation and osteoblast differentiation of msc in vivo thereby treating osteoporosis . telomerase immortalized human bone marrow - derived mesenchymal stem cells ( hmsc - tert4 ) ( 3 , 36 ) were cultured in minimum essential medium ( mem ) ( gibco invitrogen corporation ), with glutamax i ( gibco invitrogen corporation ) supplemented with 10 % fetal bovine serum ( fbs ) ( gibco invitrogen corporation ) and 1 % penicillin / streptomycin ( p / s ) ( gibco invitrogen corporation ) at 37 ยฐ c . in a humidified atmosphere of 5 % co 2 . cells were induced to osteoblast differentiation when cultures were 70 - 80 % confluent . the osteoblast differentiation medium ( mem supplemented with 10 % fbs , 10 โˆ’ 8 m dexamethasone , 0 . 2 mm i - ascorbic acid , 10 mm 3 - glycerophosphate , 10 mm 1 . 25 - vitamin - d 3 , 1 % p / s ) was refreshed every 3 days . cells were simultaneously cultured with mem , 10 % fbs and 1 % p / s for control . the osteoblast phenotype was evaluated by determining alkaline phosphatase ( alp ) activity , alp and alizarin red staining , and expression of osteogenic genes by quantitative rt - pcr analysis . for detection of alp , cells were washed with pbs , fixed with acetone / citrate buffer ( centralapoteket ) ph 4 . 2 for 5 minutes at room temperature and stained with naphtol - as - tr - phosphate solution for 1 hour at room temperature . naphtol - as - tr - phosphate solution consist of naphtol - as - tr - phosphate ( sigma ) diluted 1 : 5 in h 2 o and fast red tr ( sigma ) dissolved in 0 . 1 m tris buffer ( bie and berntsen ), ph 9 . 0 , in the ratio 1 . 2 : 1 . the solutions were mixed 1 : 1 . cells were rinsed with destilled h 2 o ( dh 2 o ) and counterstained with mayers - hematoxylin ( bie and berntsen ) for 5 minutes at room temperature . alizarin red staining was performed to detect matrix mineralization . cells were fixed with 70 % ice - cold ethanol for 1h at โˆ’ 20 ยฐ c . and stained with 40 mm alizarin red s ( ar - s ; sigma - aldrich corp . ), ph 4 . 2 for 10 min at room temperature . alkaline phosphatase activity was quantified as previously described ( 37 ). briefly , cells were cultured on 96 - well plates at a density of 10 000 cells / cm 2 and induced to osteogenic differentiation as described above . cells were rinsed with tbs and fixed in 3 . 7 % formaldehyde - 90 % ethanol for 30s at room temperature . cells were incubated for 20 min at 37 ยฐ c . with reaction substrate solution ( 1 mg / ml p - nitrophenylphosphate in 50 mm nahco 3 , ph 9 . 6 , 1mm mgcl 2 ), and absorbance was measured at 405 nm using elisa - reader . total rna was extracted using trizol - phenol - choroform method ( invitrogen ) according to the manufacturer &# 39 ; s protocol . rna concentration was measured on a nd - 1000 spectrophotometer ( nanodrop ยฎ technologies ) and quality of total rna was determined on an agilent 2100 bioanalyzer ( agilent technologies ). microrna microarray was performed at molecular medicine partnership unit ( mmpu ), university of heidelberg , germany , based on exiqon &# 39 ; s microarray platform ( version 8 . 0 ) with lna capture probes in quadruplicates . microarray probes were lna - modified oligonucleotide ( mircury exiqon ) capture probes with sequence complementary to mirnas . slides were scanned using genepix 4000b laser scanner ( axon instruments ). artifact - associated spots were eliminated by software ( tigr spotfinder 3 . 1 . 1 ). image intensities were measured as a function of the median of foreground minus background . negative values and values below 50 were normalized to one . further data analysis was performed using microsoft excel with significant analysis of microarrays ( sam ) excel software using multiclass response dataset analysis . the data was normalized using the limma package for statistical programming language r ( version 2 . 5 . 1 ). medians of four background - corrected replicas for each mirna capture probe were uploaded into the microarray analysis software for more advanced analysis for qrt - pcr analysis of mrna expression total rna was extracted using trizol reagent ( invitrogen ) according to manufacturer &# 39 ; s protocol . cdna was prepared using revertaid h minus first strand cdna synthesis kit ( fermentas ). sybr green qrt - pcr was performed using the primers alp forward ( 5 โ€ฒ- acgtggctaagaatgtcatc - 3 โ€ฒ), alp reverse ( 5 - ctggtaggcgatgtcctta - 3 โ€ฒ), col1a1 forward ( 5 โ€ฒ- tgacgagaccaagaactg - 3 โ€ฒ), col1a1 reverse ( 5 โ€ฒ- ccatccaaaccactgaaacc - 3 โ€ฒ), runx2 forward ( 5 โ€ฒ- tcttcacaaatcctcccc - 3 โ•), runx2 reverse ( 5 โ€ฒ- tggattaaaaggacttgg - 3 โ€ฒ), ptk2 forward ( 5 โ€ฒ- gcgctggctggaaaaagagcaa - 3 โ€ฒ), ptk2 reverse ( 5 โ€ฒ- tcggtgggtgctggctggtagg - 3 โ€ฒ), ฮฒ - actin forward ( 5 โ€ฒ- agccatgtacgttgcta - 3 โ€ฒ) and ฮฒ - actin reverse ( 5 โ€ฒ- agtccgcctagaagca - 3 โ€ฒ). expression levels were analyzed by qrt - pcr ( sybr green supermix and icycler iq detection system , bio - rad ) using conventional protocols . qrt - pcr consisted of 40 cycles ( 95 ยฐ c . for 30 seconds , 60 ยฐ c . for 30 seconds and 72 ยฐ c . for 1 min ) after an initial denaturation step ( 95 ยฐ c . for 3 min ). qrt - pcr products were quantified by comparative ct ( aact ) method . for mirna qrt - pcr , total rna was extracted using trizol reagent ( invitrogen ). primers specific for human mir - 26a , mir - 26b , mir - 30c , mir - 101 , mir - 138 , mir - 143 , mir - 222 and internal control snornu44 were purchased from applied biosystems . amplification and detection were performed using 7500ht fast real - time pcr system ( applied biosystems ), using 40 cycles of denaturation at 95 ยฐ c . ( 10 s ) and annealing / extension at 60 ยฐ c . ( 60 s ). this was preceded by reverse transcription at 42 ยฐ c . for 30 min and denaturation at 85 ยฐ c . for 5 min . lna oligonucleotides were synthesized as unconjugated lna / dna mixmers with a complete phosphorothioate backbone ( idt , usa ). the antimir - control ( mir - c ) was purchased from idt , usa . lna modified antimirs sequences : antimir - 138 3 โ€ฒ- attcacaacaccagc - 5 โ€ฒ and antimir - c 3 โ€ฒ- tgtaacacgtctata - 5 โ€ฒ, where uppercase letters refers to lna and lowercase letters refers to dna . synthetic pre - mir - 138 sequence 3 โ€ฒ- agcugguguugugaaucaggccg - 5 โ€ฒ was rna oligonucleotides . transfections of 25 nm antimir oligonucleotide ( idt , usa ) or pre - mir ( ambion ) with lipofectamine 2000 ( invitrogen ) were performed according to the manufacturer &# 39 ; s instructions . cells were seeded in 6 - well plates and transfections were performed when cells reached 60 - 70 % confluence . one hour prior transfection , the medium was changed to 1 ml opti - mem i reduced serum ( invitrogen ). cells were incubated with transfection medium , which was changed four hours after transfection to normal mem medium with 10 % fbs and 1 % p / s . the transfection efficiency was evaluated by transfection of a 5 โ€ฒ fam - labeled lna oligonucleotide . hmscs were lysed by ripa buffer ( sigma - aldrich corp .) and total protein concentration was determined with pierce coomassie plus bradford assay kit ( thermo fisher scientific inc .). proteins were separated by 10 % sds - page and electrotransferred into nitrocellulose filters . after blocking with 5 % not - fat milk for 1 h at room temperature , membranes were incubated with primary antibodies against anti - rabbit fak and pfak ( santa cruz biotechnology ) and anti - mouse erk perk and anti - rabbit ฮฑ - tubulin ( cell signaling ) overnight at 4 ยฐ c . membranes were incubated with horseradish - peroxidase ( hrp ) conjucated anti - mouse or anti - rabbit secondary antibody for 45 min at rt and protein bands were visualized with amersham ecl chemiluminescence detection system ( ge healthcare bio - sciences corp .). a 655 by fragment of the fak ( ptk2 ) 3 โ€ฒ utr , containing the predicted binding site for hsa - mir - 138 , was amplified from human genomic dna using primers with a short extension , containing cleavage sites for xhol ( 5 โ€ฒ- end ) and notl ( 3 โ€ฒ- end ). ptk2 forward ( 5 โ€ฒ- a tactcgagaaactggcccagcagtatg - 3 โ€ฒ), ptk2 reverse ( 5 โ€ฒ- atagcggccgcttgcaactgaagggtgttc - 3 โ€ฒ). amplicons were cleaved with xhol and notl and cloned in between the xhol and notl cleavage sites of the psicheck โ„ข- 2 vector ( promega ) downstream of the renilla luciferase reporter gene . huh7 cells were grown to 85 - 90 % confluence in white 96 well plates in dulbecco &# 39 ; s modified eagle medium ( dmem ) ( invitrogen ) supplemented with 10 % fbs , 1 % non - essential amino acids , l - glutamine and penicillin / straptamicin , at 37 ยฐ c . under 5 % co 2 . cells were transfected with 20 ng of either the empty psicheck โ„ข- 2 vector , or the psicheck โ„ข- 2 - ptk2 3 โ€ฒ utr reporter , for four hours in reduced - serum and antibiotics - free opti - mem ( invitrogen ) with lipofectamine 2000 ( invitrogen ). cells were co - transfected with the pre - mir - 138 or a negative control ( mir - c ) ( applied biosystems ) at concentrations of 0 , 10 or 20 nm . after transfection , opti - mem was replaced by normal culture medium and cells were incubated for 24 hours . firefly and renilla luciferase were measured in cell lysates according to manufacturer &# 39 ; s protocol using a dual - luciferase reporter assay system ( promega ) on a fusion โ„ข plate reader ( perkin elmer ). firefly luciferase activity was used for normalization and as an internal control for transfection efficiency . hmscs were transfected as described above , loaded on hydroxyapatite / tricalcium phosphate ( ha / tcp ) ceramic powder ( zimmer scandinavia ) and implanted subcutaneously into 8 - week old nod / mrkbom tac - prkdc scid mice ( taconic ) as previously described ( 22 , 23 ). briefly , cells ( 5 ร— 10 5 ) were resuspended in 500 ฮผl medium , transferred to 40 mg of wetted ha / tcp and incubated at 37 ยฐ c . overnight . the following day , cells loaded on ha / tcp vehicles were implanted subcutaneously on the dorsal surface of the nod / scid mice . each mouse received four identical implants , two on each side . mice were anaesthetized by intra - peritoneal injection of ketaminal ยฎ ( ketamine 100 mg / kg ) ( intervet ) and rampun ยฎ ( xylazine , 10 mg / kg ) ( bayer healthcare ). after the surgery , mice received a subcutaneous injection of temgesic ยฎ ( buprenorphin , 0 . 3 mg / ml ) ( schering - plough ) for pain relief . implants were removed after 1 or 8 weeks . one - week implants were subjected to rna extraction while 8 - week implants were fixed in 4 % paraformaldehyde ( bie & amp ; berntsen ), decalcified in formic acid ( local pharmacy , odense university hospital ) and embedded in paraffin using conventional histopathologic methods . samples were cut into 4 ฮผm sections and stained with hematoxylin and eosin y ( bie & amp ; berntsens reagent laboratories ). total bone volume per total volume was quantified as previously described ( 23 ). four implants per treatment were engrafted into mice and three sections of each implant were quantified to minimize variation within the implants . a search for predicted target mrnas was performed using the databases targetscan and pictar . targetscan requires perfect complementarity with a mirna seed sequence , whereas pictar allows for targets with imperfect seed matches given that they pass a defined binding - energy threshold . additionally , pictar implements a maximum likelihood approach to incorporate the combinatorial nature of mirna targeting ( 38 ). data are presented as mean ยฑ sd . comparisons were made by using a two - tailed t - test or 1 - way anova for experiments with more than two subgroups . probability values were considered statistically significant at p & lt ; 0 . 05 . in fig1 telomerized mscs ( hmsc - tert4 ) were induced to osteoblast differentiation . a ) osteoblast differentiation confirmed by qrt - pcr analysis of osteoblast marker genes ( runx2 , alp and oc normalized to ฮฒ - actin ). b ) alp activity was measured during the course of differentiation . white bars represent non - induced and black bars represent induced samples . *** p & lt ; 0 . 001 between non - induced and induced sample . c ) alp and alizarin red staining were performed at day 15 . n = 3 for all experiments . in fig2 the effect of mir - 138 on osteoblast differentiation was studied . hmscs transfected with 25nm mir - c , pre - mir - 138 or antimir - 138 were induced into osteoblast differentiation for 15 days . a ) osteoblast differentiation was evaluated with qrt - pcr analysis of osteoblast marker genes ( runx2 , alp and oc , normalized to ฮฒ - actin ) at day 15 . b ) alkaline phosphatase activity was measured at day 10 of osteoblast differentiation . c ) alkaline phosphatase and alizarin red staining were performed at day 15 . * p & lt ; 0 . 05 , ** p & lt ; 0 . 01 , *** p & lt ; 0 . 001 , n = 3 for all experiments . in the experiment of fig3 hmsc were transfected with 25nm mir - c , pre - mir - 138 or antimir - 138 and implanted into nod / scid mice . a ) qrt - pcr analysis of osteoblast genes ( runx2 , col1a1 , alp and oc normalized to ( ฮฒ - actin ) was performed after 1 week of implantation . b ) h & amp ; e staining was performed after 8 weeks of implantation . bone formation was quantified as total bone volume per total volume from h & amp ; e staining and expressed as fold change of mir - c . * p & lt ; 0 . 05 , ** p & lt ; 0 . 01 , four implants per treatment were engrafted into mice and three sections of each implant were quantified to minimize variations within the implants . in the experiment of fig4 a ) ptk2 gene expression profile during osteoblast differentiation of hmsc was quantified with qrt - pcr . b ) computational analysis was performed for the complementarily of mir - 138 seed sequence to the 3 โ€ฒ utr of ptk2 and conservation of the putative binding site in vertebrates . c ) huh7 cells were transfected with 20 ng of either the empty psicheck โ„ข- 2 vector , or the psicheck โ„ข- 2 - ptk2 vector . cells were co - transfected with 0 , 10 or 20 nm of the pre - mir - 138 or a negative control . firefly and renilla luciferase were measured in cell lysates and values are normalized to the psicheck vector and presented as fold change of mir - c . ** p & lt ; 0 . 01 , *** p & lt ; 0 . 001 in the experiment of fig5 hmsc were transfected with 25 nm mir - c , pre - mir - 138 or antimir - 138 and induced to osteoblast differentiation and western blot analysis for fak protein , phosphorylation of fak and erk1 / 2 were performed at day 2 . graphs represent quantifications of western blot results . in fig6 mir - 138 is expressed in undifferentiated msc and suppresses fak translation , thereby decrease phosphorylation of fak and its downstream target erk1 / 2 . subsequently , inhibition of the cascade results in decreased expression of osx and suppression of osteoblast differentiation of msc . in fig7 there is shown an expression analysis of microrna - 138 ( mir - 138 ) and protein tyrosine kinase 2 ( ptk2 ). ( a ) expression of mir - 138 was measured in primary human stromal ( mesenchymal ) stem cells ( hmscs ) and calvarial preosteoblastic mc3t3 - e1 cells during osteoblast differentiation . ( b ) mir - 138 expression was evaluated in 5 - d - old mouse tissues . ( c ) expression of focal adhesion kinase ( fak ; ptk2 ) in primary hmscs . expression of ptk2 in primary hmscs during osteoblast differentiation evaluated at day 1 , 5 , 10 , and 15 by quantitative rt - pcr ( qrt - pcr ). in fig8 there is shown effects of mir transfection into cells . ( a ) expression of mir - 138 in transfected hmscs . hmscs were transfected with mir - c , premir - 138 , and antimir - 138 and induced to osteoblast differentiation . the mir - 138 expression levels in premir - 138 โ€”( left ) and antimir - 138 โ€” transfected ( right ) hmscs were quantified by qrt - pcr and normalized to sn / snornu44 , and values are presented as log2 fold change over mir - c . ** p & lt ; 0 . 01 ; *** p & lt ; 0 . 001 ( n = 3 ). ( b ) osteoblast differentiation of mir - 138 โ€” transfected primary hmscs . primary hmscs were transfected with mir - c , premir - 138 , and antimir - 138 and induced to osteoblast differentiation . differentiation was evaluated at day 15 by alkaline phosphatase ( alp ) staining . ( c ) morphology of mir - 138 โ€” tranfected hmscs . morphology was evaluated by photography of primary hmscs transfected with mir - c , premir - 138 , and antimir - 138 under the microscope at day 1 . ( d ) proliferation of mir - 138 โ€” tranfected primary hmscs and mc3t3 - e1 cells . proliferation was evaluated by cell count in primary hmscs and mc3t3 calvarial cells transfected with mir - c , premir - 138 , and antimir - 138 . osteoblast differentiation of hmsc was induced by using standard osteoblast - induction medium containing dexamethasone , ascorbic acid , ฮฒ - glycerolphosphate and vitamin - d 3 and evidenced by increased expression of genes associated with osteoblast differentiation ; runx2 , alkaline phosphatase ( alp ) and osteocalcin ( oc ) at day 1 , 10 and 15 after induction ( fig1 a ). the osteoblast phenotype was also confirmed by demonstration of increased alkaline phosphatase activity ( fig1 b and c ) and alizarin red staining for matrix mineralization ( fig1 c ). increased expression of osteoblast - associated genes and the observed osteoblast phenotype were in accordance with previous reports describing hmsc differentiation into osteoblasts ( 1 - 3 ). to identify differentially expressed mirnas during osteoblast differentiation we carried out mirna array profiling of hmsc 10 days after induction to osteoblasts using lna microarrays ( 24 ). expression levels of 33 mirnas were significantly altered between differentiated and non - differentiated cells . of these , 7 mirnas were selected for validation by qrt - pcr , based on their relative difference score and up - or down - regulation ( si table 1 ). microarray analysis and qrt - pcr data showed that the expression of mir - 26a , 26b , 30c , 101 and 143 were up - regulated and mir - 138 and 222 were down - regulated during osteoblast differentiation of hmscs . to evaluate the biological effect of the differentially expressed mirnas on osteogenesis , antimirs and mirna over - expression for selected mirnas were applied in a pilot functional screening for the impact on osteoblast differentiation in vitro and ectopic bone formation in vivo ( data not shown ) and pointed out to mir - 138 as a novel negative regulator of osteoblastic differentiation . we over - expressed or inhibited mir - 138 levels utilizing synthetic pre - mir and lna - modified anti - oligonucleotides designed as complementary sequences to mature mirnas , so - called antimirs . antimir oligonucleotides can be used as specific inhibitors of mirna function , thus providing a valuable tool to access the biological function of specific mirnas in vitro and in vivo ( 25 , 26 ). transfection efficiency of 80 % was observed using a 5 โ€ฒ fam - labeled control lna oligonucleotide ( data not shown ). the degree of mirna inhibition and over - expression was monitored by qrt - pcr after transfection of antimir - 138 or pre - mir - 138 to hmscs at 25 nm , respectively . the mature mir - 138 levels were elevated หœ 900 - fold relative to control - treated cells 24 hours post transfection , with the levels still being 16 - and 8 - fold higher than in the control 10 and 15 days after pre - mir - 138 transfection , respectively fig7 ). by comparison , treatment of hmscs with antimir - 138 led to inhibition of mir - 138 by 1 . 1 -, 1 . 5 - and 2 - fold 1 , 10 and 15 days after transfection ( fig7 ). to study the impact of mir - 138 on hmsc osteoblast differentiation , hmscs were induced to differentiate to osteoblasts after transfection with either pre - mir - 138 or antimir - 138 . inhibition of mir - 138 significantly enhanced osteogenic differentiation , as indicated by higher expression of the osteoblast - specific genes runx2 , alp and oc and ( fig2 a ), and increased alp activity and enhanced in vitro matrix mineralization visualized by alizarin red staining ( fig2 b , c ) in antimir - 138 transfected hmscs as compared to control transfected cells . in contrast , alp activity , matrix mineralization and the osteoblast marker gene expression were reduced in pre - mir - 138 transfected hmscs ( fig2 a , b , c ). taken together , our results indicate that mir - 138 is a negative regulator of osteoblast differentiation of hmscs . to study whether silencing of mir - 138 enhances ectopic bone formation also in vivo , untransfected control hmscs and hmscs transfected with mir - 138 , antimir - 138 or mir - control were loaded on hydroxyapatite implants in nod / scid mice for 1 or 8 weeks . no major changes were observed by histology of the implants with untransfected hmscs compared to mir - c transfected hmscs . gene expression of osteoblast marker genes was analyzed after one week of implantation . qrt - pcr analysis revealed up - regulation of runx2 , alp , col1a1 and oc in the antimir - 138 treated implants as compared to implants transfected with mir - c ( fig3 a ), corroborating the results obtained from in vitro cell culture assays . additionally , we determined the ability of mir - 138 inhibition or over - expression to regulate ectopic bone formation in vivo by quantifying the area of bone per total area after 8 weeks . bone formation was increased 2 . 2 - fold in implants treated with the antimir - 138 compared to mir - c ( fig3 b ), indicating that inhibition of mir - 138 enhances bone formation of hmsc . furthermore , over - expression of mir - 138 decreased bone formation by 6 . 7 fold , compared to mir - c implants ( fig3 b ), supporting the notion that mir - 138 negatively regulates osteoblast differentiation and bone formation in vivo . to understand the molecular mechanisms that underlie mir - 138 - mediated regulation , we searched for potential targets of mir - 138 implicated in osteoblast differentiation using the mirna target prediction algorithms targetscan and pictar ( 27 ). among the predicted targets we identified focal adhension kinase ( fak ), which provides a link between activation of erk1 / 2 and stimulation of the runx2 / cbfa1 transcription factor . to confirm the involvement of fak in osteogenesis of hmsc we studied the expression pattern of fak during differentiation . qrt - pcr analysis revealed that expression of ptk2 , the gene encoding fak , was increased during osteoblast differentiation similar to osteoblast marker genes and coinciding with down - regulation of mir - 138 ( fig4 a ). according to in silico analysis , ptk2 has a 7 nucleotide seed match site for mir - 138 within its 3 โ€ฒ utr , and this putative target site is highly conserved among the vertebrates ( fig4 b ). to determine whether mir - 138 inhibits ptk2 gene expression by binding to the predicted target site in the 3 โ€ฒ utr , we used a dual luciferase reporter gene system ( 28 ), with renilla luciferase as a reporter gene and firefly luciferase as an internal control . assays were performed in huh7 cells that were chosen based on their low endogenous expression of mirnas ( 29 ). co - transfection of the ptk2 3 โ€ฒ utr luciferase reporter with pre - mir - 138 resulted in concentration - dependent down - regulation of luciferase activity , compared to the mock or scrambled oligonucleotide controls ( mir - c ) ( fig4 c ). in comparison , pre - mir - 138 had no effect on the luciferase control reporter without the ptk2 3 โ€ฒ utr , implying that ptk2 is a direct target of mir - 138 . gene expression analysis revealed no significant change in ptk2 mrna levels when mir - 138 was either over - expressed or antagonized ( fig8 a ). however , western blot analysis showed reduced fak protein levels in the pre - mir - 138 treated cells at day 2 compared to mir - c transfected samples ( fig5 ). since the fak signaling pathway is suggested to provide a link between activation of erk1 / 2 by ecm proteins in osteogenesis ( 7 ), we next assessed phosphorylation of fak and erk1 / 2 . western blot analysis showed markedly decreased phosphorylation of both fak and erk1 / 2 in mir - 138 over - expressing hmscs , while levels of pfak and perk1 / 2 were increased in the antimir - 138 transfected hmsc ( fig5 ). accordingly , expression of osterix ( osx ), a downstream target gene of the erk1 / 2 pathway ( 7 ), was decreased when mir - 138 was over - expressed and increased in the absence of mir - 138 ( fig8 b ), which is consistent with the notion that mir - 138 suppresses fak downstream signaling by negatively regulating fak at the post - transcriptional level . bone marrow contains a population of stromal ( skeletal , mesenchymal ) stem cells ( hmsc ) that under appropriate in vivo and in vitro conditions can differentiate into osteoblastic cells ( 30 ). differentiation of hmsc into osteoblastic cells is a highly regulated process involving complex pathways and de - regulation may lead to pathological conditions . therefore the molecular mechanisms of this process needs to be explored to ultimately improve therapies for the related diseases . recently , it has been shown that mirnas influence the complexity of the โ€œ sternness state โ€ in a number of cellular compartments through negative regulation of gene expression at the post - transcriptional level ( 31 ). the present inventors have identified mir - 138 as a negative regulator of hmsc osteoblast differentiation and demonstrated that antimir mediated silencing of mir - 138 significantly enhance ectopic bone formation in vivo . this suggests functional silencing of mir - 138 as a potential novel strategy for anabolic treatment of osteoporosis . the therapeutic feasibility of such an approach has been demonstrated in the work by li and co - workers who demonstrated that a single tail vein injection of antimir - 2861 caused minimum femur bone mineral density in ovarectomized mice ( 15 ). the present inventors conducted genome - wide array analysis of the mirna levels during osteogenic differentiation of hmsc and found deregulation of several mirnas during osteoblast differentiation of hmsc in vitro . more detailed analysis suggested mir - 138 as a novel negative regulator of osteoblastic differentiation . in vitro experiment revealed that inhibition of mir - 138 function enhanced osteoblast differentiation , whereas mir - 138 over - expression inhibited the osteogenic potential . these experiments were extended to an in vivo milieu where silencing of mir - 138 by antimir - 138 led to increased ectopic bone formation while over - expression of mir - 138 significantly diminished bone formation . these findings suggest that mir - 138 plays a pivotal role in bone formation in vivo by negative regulation of osteogenic differentiation in hmscs leading to reduced ectopic bone formation . recently , mir - 138 has been implicated in differentiation of human adipose tissue - derived mesenchymal stem cells ( had - mscs ) and mir - 138 was found to be a negative regulator of adipocyte differentiation ( 21 ). these new data , together with our findings suggests a general role of mir - 138 as an inhibitor of hmsc differentiation and maintenance of the โ€œ sternness state โ€. to study the molecular mechanism whereby mir - 138 regulates osteogenesis , the present inventors searched for potential target genes that have an established function in promoting osteogenesis . interestingly , the 3 โ€ฒ utr of ptk2 possess a seven nucleotides perfect match site to the mir - 138 seed region . the protein encoded by ptk2 , fak , has been shown to function as an activator of extracellular signal - related kinase ( erk1 and erk2 ) via the grb2 - sos - ras pathway during osteogenic differentiation of hmsc ( 32 , 33 ). recently , mir - 138 was found to target rhoc and rock ( 34 ), which are also involved in regulation of osteoblast differentiation and this may be an additional mechanism for mir - 138 as negative modulator of osteoblast differentiation . however , the exact organization of these pathways in developing bone is not well understood , although osteoblasts in osteoporosis and osteoarthritis patients have reduced fak activity ( 35 ). here , the present inventors show that mir - 138 over - expression results in down - regulation of fak at the protein level , whereas functional inhibition of mir - 138 by antimir - 138 leads to de - repression of fak , strongly suggesting that fak is regulated by mir - 138 during osteogenesis . indeed , ptk2 3 โ€ฒ utr luciferase reporter assays confirmed that fak is a direct target of mir - 138 . furthermore , over - expression of mir - 138 decreased phosphorylatation of fak and subsequently attenuated activation of fak downstream signaling , as shown by decreased phosphorylation of erk1 / 2 in hmscs . activation of erk1 / 2 pathway has emerged as an important regulator of osteoblast differentiation , where it regulates runx2 phosphorylation and subsequently expression of osterix ( 7 ). significant up - regulation of osterix in the absence of mir - 138 supports the hypothesis that inhibition of osteoblast differentiation by mir - 138 is due to suppression of the downstream pathway of fak ( fig6 ). the impact of mirnas on osteoblastic differentiation of a number of cell types has been investigated by modulation of mirna function by antimirs and over - expression . these approaches have successfully demonstrated that mir - 204 / 211 targets runx2 , stimulates adipocyte differentiation and diminishes osteoblastic differentiation ( 18 ). employing similar approach , enhanced activity of mir - 125b in mouse st2 cells inhibits osteoblastic differentiation ( 13 ) whereas mir - 2861 acts as a positive regulator by targeting hdac5 ( 15 ). luzi et al . ( 11 ) showed that mir - 26a expression was increased hadsc differentiation , where expression of smad1 was inversely correlated to that of mir - 26a , suggesting the presence of a negative regulatory mechanism in late osteogenic differentiation of hasc . moreover kim et al . ( 12 ) demonstrated an increase in mir - 196a expression and concomitant decrease of hox8 expression , a negative regulator of smad1 , during osteogenic differentiation of hascs . the present inventors found that mir - 138 repress fak expression , which , in turn , results in suppression of the fak - erk1 / 2 signaling pathway . importantly , our results show that functional inhibition of mir - 138 can accelerate osteogenic differentiation of hmscs leading to increased bone formation in vivo , suggesting that therapeutic approaches targeting mir - 138 could be useful in the enhancing bone formation and treatment of pathological conditions of bone loss . 1 . jaiswal , r . k ., jaiswal , n ., bruder , s . p ., mbalaviele , g ., marshak , d . r ., & amp ; pittenger , m . f . ( 2000 ) j . biol . chem . 275 , 9645 - 9652 . 2 . pittenger , m . f ., mackay , a . m ., beck , s . c ., jaiswal , r . k ., douglas , r ., mosca , j . d ., moorman , m . a ., simonetti , d . w ., craig , s ., & amp ; marshak , d . r . ( 1999 ) science 284 , 143 - 147 . 3 . abdallah , b . m ., haack - sorensen , m ., burns , j . s ., elsnab , b ., jakob , f ., hokland , p ., & amp ; kassem , m . ( 2005 ) biochem . biophys . res . commun . 326 , 527 - 538 . 4 . abdallah , b . m . & amp ; kassem , m . ( 2008 ) gene ther . 15 , 109 - 116 . 5 . xiao , g ., jiang , d ., thomas , p ., benson , m . d ., guan , k ., karsenty , g ., & amp ; franceschi , r . t . ( 2000 ) j . biol . chem . 275 , 4453 - 4459 . 6 . takeuchi , y ., suzawa , m ., kikuchi , t ., nishida , e ., fujita , t ., & amp ; matsumoto , t . ( 1997 ) j . biol . chem . 272 , 29309 - 29316 . 7 . salasznyk , r . m ., klees , r . f ., williams , w . a ., boskey , a ., & amp ; plopper , g . e . ( 2007 ) exp . cell res . 313 , 22 - 37 . 8 . brennecke , j ., hipfner , d . r ., stark , a ., russell , r . b ., & amp ; cohen , s . m . ( 2003 ) cell 113 , 25 - 36 . 9 . xu , p ., vernooy , s . y ., guo , m ., & amp ; hay , b . a . ( 2003 ) curr . biol . 13 , 790 - 795 . 11 . luzi , e ., marini , f ., sala , s . c ., tognarini , i ., galli , g ., & amp ; brandi , m . l . ( 2008 ) j . bone miner . res . 23 , 287 - 295 . 12 . kim , y . j ., bae , s . w ., yu , s . s ., bae , y . c ., & amp ; jung , j . s . ( 2009 ) j . bone miner . res . 24 , 816 - 825 . 13 . mizuno , y ., yagi , k ., tokuzawa , y ., kanesaki - yatsuka , y ., suda , t ., katagiri , t ., fukuda , t ., maruyama , m ., okuda , a ., amemiya , t . et al . ( 2008 ) biochem . biophys . res . commun . 368 , 267 - 272 . 14 . li , z ., hassan , m . q ., volinia , s ., van wijnen , a . j ., stein , j . l ., croce , c . m ., lian , j . b ., & amp ; stein , g . s . ( 2008 ) proc . natl . acad . sci . u . s a 105 , 13906 - 13911 . 15 . li , h ., xie , h ., liu , w ., hu , r ., huang , b ., tan , y . f ., xu , k ., sheng , z . f ., zhou , h . d ., wu , x . p . et al . ( 2009 ) j . clin . invest 119 , 3666 - 3677 . 16 . li , z ., hassan , m . q ., jafferji , m ., aqeilan , r . i ., garzon , r ., croce , c . m ., van wijnen , a . j ., stein , j . l ., stein , g . s ., & amp ; lian , j . b . ( 2009 ) j . biol . chem . 284 , 15676 - 15684 . 17 . hu , r ., li , h ., liu , w ., yang , l ., tan , y . f ., & amp ; luo , x . h . ( 2010 ) expert . opin . ther . targets . 14 , 1109 - 1120 . 18 . huang , j ., zhao , l ., xing , l ., & amp ; chen , d . ( 2010 ) stem cells 28 , 357 - 364 . 19 . itoh , t ., nozawa , y ., & amp ; akao , y . ( 2009 ) j . biol . chem . 284 , 19272 - 19279 . 20 . inose , h ., ochi , h ., kimura , a ., fujita , k ., xu , r ., sato , s ., iwasaki , m ., sunamura , s ., takeuchi , y ., fukumoto , s . et al . ( 2009 ) proc . natl . acad . sci . u . s . a . 21 . yang , z ., bian , c ., zhou , h ., huang , s ., wang , s ., liao , l ., & amp ; zhao , r . c . ( 2010 ) stem cells dev . 22 . stenderup , k ., rosada , c ., justesen , j ., al - soubky , t ., gnaes - hansen , f ., & amp ; kassem , m . ( 2004 ) biogerontology . 5 , 107 - 118 . 23 . abdallah , b . m ., ditzel , n ., & amp ; kassem , m . ( 2008 ) pu methods mol . biol . 455 , 89 - 100 . 24 . castoldi , m ., schmidt , s ., benes , v ., noerholm , m ., kulozik , a . e ., hentze , m . w ., & amp ; muckenthaler , m . u . ( 2006 ) rna . 12 , 913 - 920 . 25 . elmen , j ., lindow , m ., schutz , s ., lawrence , m ., petri , a ., obad , s ., lindholm , m ., hedtjarn , m ., hansen , h . f ., berger , u . et al . ( 2008 ) nature 452 , 896 - 899 . 26 . petri , a ., lindow , m ., & amp ; kauppinen , s . ( 2009 ) cancer res . 69 , 393 - 395 . 27 . lewis , b . p ., shih , i . h ., jones - rhoades , m . w ., bartel , d . p ., & amp ; burge , c . b . ( 2003 ) cell 115 , 787 - 798 . 28 . kuhn , d . e ., martin , m . m ., feldman , d . s ., terry , a . v ., jr ., nuovo , g . j ., & amp ; elton , t . s . ( 2008 ) methods 44 , 47 - 54 . 29 . landgraf , p ., rusu , m ., sheridan , r ., sewer , a ., lovino , n ., aravin , a ., pfeffer , s ., rice , a ., kamphorst , a . 0 ., landthaler , m . et al . ( 2007 ) cell 129 , 1401 - 1414 . 30 . friedenstein , a . j ., chailakhjan , r . k ., & amp ; lalykina , k . s . ( 1970 ) cell tissue kinet . 3 , 393 - 403 . 31 . oakley , e . j . & amp ; van , z . g . ( 2007 ) leukemia 21 , 612 - 621 . 32 . schaller , m . d . ( 2001 ) biochim . biophys . acta 1540 , 1 - 21 . 33 . schlaepfer , d . d ., hanks , s . k ., hunter , t ., & amp ; van der , g . p . ( 1994 ) nature 372 , 786 - 791 . 34 . jiang , l ., liu , x ., kolokythas , a ., yu , j ., wang , a ., heidbreder , c . e ., shi , f ., & amp ; zhou , x . ( 2010 ) int . j . cancer 127 , 505 - 512 . 35 . perinpanayagam , h ., zaharias , r ., stanford , c ., brand , r ., keller , j ., & amp ; schneider , g . ( 2001 ) j . orthop . res . 19 , 993 - 1000 . 36 . simonsen , j . l ., rosada , c ., serakinci , n ., justesen , j ., stenderup , k ., rattan , s . i ., jensen , t . g ., & amp ; kassem , m . ( 2002 ) nat . biotechnol . 20 , 592 - 596 . 37 . qiu , w ., hu , y ., andersen , t . e ., jafari , a ., li , n ., chen , w ., & amp ; kassem , m . ( 2010 ) j . biol . chem . 285 , 14438 - 14449 . 38 . sethupathy , p ., megraw , m ., & amp ; hatzigeorgiou , a . g . ( 2006 ) nat . methods 3 , 881 - 886 .
2
illustrative embodiments of the invention may be described herein in the context of detecting atmospheric contaminants in data center environments . however , it is to be understood that the techniques of the invention are not limited to use in data centers but are more broadly applicable to detection of corrosive contaminants affecting any electrical and electronic components and devices . furthermore , such inventive corrosion sensors can be used to monitor corrosion of any suitable types of metal - based components , artifacts and devices that are susceptible to corrosion . as will be explained in detail herein , illustrative embodiments of the invention provide a metal film resistor based corrosion sensor with a linear response that is capable of sensing corrosion rates down to a sensitivity of approximately zero nm / month . the sensors are optimized to work on a relatively low corrosion rate with corrosion product formed at a rate of about 30 nanometers / month or lower . a โ€œ thin metal film โ€ or โ€œ metal film โ€ is an example of a โ€œ sensor element โ€ that may be employed by the corrosion sensor of the invention . the metal film ( e . g ., silver film , copper film , etc .) is also referred to herein as a โ€œ metal wire โ€ and may alternatively be considered a โ€œ nanowire .โ€ metal films are current conducing elements with a resistance characteristic that is dependent on their spatial dimensions . it is to be appreciated that the spatial dimensions of the sensor elements used in accordance with the invention are dependent on the type of corrosion being detected and the duration of the time period intended for detection . thus , corrosion sensor principles of the invention are not intended to be limited to any specific spatial dimensions or specific range of spatial dimensions . rather , the sensor according to illustrative embodiments has multiple corrosion sensitive resistor arms with progressively increasing widths that can be used to sense the corrosive environment for an extended period of time with the same high sensitivity by selectively changing the sensing arm of the sensor being monitored . the metal film ( wire ) based resistors change their resistance as corrosion proceeds from the sides of the film or wire , while the top of the film or wire is protected with a corrosion resistive material , as will be explained in detail below . this ensures a linear response for the inventive sensor . highly sensitive corrosion sensors , such as those described herein in accordance with principles of the invention , are advantageous for use in gaseous contamination monitoring in museums , hospitals , and data centers so as to mitigate and control the amount of outside air allowed in such facilities . that is , when a certain level of corrosion is detected via the sensor response , the cooling environment of the facility can be correspondingly regulated to reduce the cause of the corrosion level , i . e ., gaseous contaminants in the outside air supply used in the facility cooling process . this may be accomplished by filtering techniques , or cutting back or even eliminating outside air for use in cooling components of the facility . fig1 illustrates a top view of a multi - metal film corrosion sensor , according to an embodiment of the invention . as shown , corrosion sensor 100 comprises a set of multiple corrosion sensor elements 102 - 1 through 102 - 4 , with progressively increasing widths . the corrosion sensor elements 102 are in the form of metal films , although other suitable sensor elements may be employed . the corrosion sensor 100 also comprises a set of reference sensor elements 104 - 1 through 104 - 4 , with progressively increasing widths . the reference sensor elements 104 are also in the form of metal films , although other suitable sensor elements may be employed . note that the width of the corrosion sensor element 102 - 1 is equal to ( or approximately or substantially equal to ) the width of the reference sensor element 104 - 1 . the same is true for sensor elements 102 - 2 and 104 - 2 , for sensor elements 102 - 3 and 104 - 3 , and for sensor elements 102 - 4 and 104 - 4 . the rationale for this will be explained below . as further shown in fig1 , the corrosion sensor 100 also comprises a connecting bus 106 . the connecting bus 106 is composed of the same metal ( electrical conducting material ) as the variable width sensor elements ( 102 and 104 ). the connecting bus 106 , like the reference sensor elements but unlike the corrosion sensor elements , has a conductive coating to protect it from corrosion . while not visible in fig1 ( but which is visible in fig2 as 206 ), the corrosion sensor 100 also comprises a substrate . the substrate may be any substantially non - conducting material , by way of example only , glass or glass - based , or silicon or silicon - based . the substrate maintains the sensor elements 102 and 104 , the connecting bus 106 , and contact pads 108 and 110 in place so that they remain electrically connected , as will be explained . in one embodiment , the various components of the corrosion sensor 100 are formed on top of the substrate via well - known electron beam lithography fabrication processes . contact pads 108 are electrically conductive pads to which the sensor elements 102 and 104 are respectively connected . that is , each sensor element 102 and 104 has one of its ends connected to its own dedicated contact pad 108 . contact pads 108 are then connected to a current or voltage reading device ( i . e ., monitor ) so that a current signal or voltage signal can be received by the monitor . as will be explained below , these signals are used to detect the level of corrosion being experienced by the corrosion sensor 100 . contact pads 110 are also electrically conductive pads which connect to the connecting bus 106 . thereby , the sensor elements 102 and 104 are respectively connected to the contact pads 110 . in this case , each sensor element 102 and 104 has the other one of its ends connected to one contact pad 110 ( via connecting bus 106 ) that is itself connected to a voltage supply source v . the other contact pad 110 is connected to a ground potential . thus , one contact pad 110 is grounded while the current from contact pad 108 is going to a detection circuit that can be a trans - impedance amplifier or voltage detector . also shown in fig1 , the corrosion sensor 100 comprises an encapsulation layer 112 . encapsulation layer 112 encapsulates the reference sensor elements 104 - 1 through 104 - 4 and the connecting bus 106 to protect them from the corrosive atmospheric environment to which the corrosion sensor elements 102 - 1 through 102 - 4 are exposed . the encapsulation layer 112 may be formed from materials such as thick dielectric film that is inert to corrosion , e . g ., sio 2 , si 3 n 4 , or organic coatings like polystyrene or other corrosion resistant materials . in accordance with this illustrative embodiment , the corrosion sensor 100 operates such that the resistance of each corrosion sensor element 102 , in this case , each metal film ( wire ) 102 , changes due to a reduced conduction path as the width of the metal film is converted from a metal to a nonconductive oxide due to corrosion . as the corrosive gases in the atmospheric environment , in which the sensor 100 operates , attack the metal of the metal film and transform it to a nonconductive oxide , the width is reduced thus increasing the resistance of the metal film . the sensor elements 102 and 104 of the corrosion sensor 100 are preferably fabricated by electron beam lithography . further , the connecting bus 106 may be formed that has arms ( sensor elements ) extending along the sides , such as is illustrated in fig1 . the sensor elements have variable ( progressively increasing ) widths and the width of each sensor element determines the lifetime of the sensor element . as an example , as shown in fig1 , the progressively - increasing widths of the sensor elements 102 and 104 can be fabricated to be about 60 nm ( sensor elements 102 - 1 and 104 - 1 ), about 120 nm ( sensor elements 102 - 2 and 104 - 2 ), about 180 nm ( sensor elements 102 - 3 and 104 - 3 ), and about 360 nm ( sensor elements 102 - 4 and 104 - 4 ) wide . for a corrosion rate of 30 nm / month ( recall the ashrae recommendation mentioned above ), the 60 nm wide sensor element ( 102 - 1 ) could be used for corrosion monitoring for a time duration of one month , while the 120 nm wide sensor element ( 102 - 2 ) would be usable for a two month period , and the 180 nm wide sensor element ( 102 - 3 ) would be usable for a three month period . although not expressly illustrated in fig1 , there could be 240 nm and 360 nm wide corrosion sensor elements for use for time durations of four and five months , respectively . the 360 nm wide sensor element ( 102 - 4 ) would be usable for a six month period . of course , shorter / longer individual time intervals can be achieved simply by decreasing / increasing the progressively - increasing widths . likewise , less / more time durations can be achieved simply by subtracting / adding corrosion sensitive resistor arms . it is to be appreciated that the reduced width assures that the changes associated with a relatively small corrosion rate can be easily detected as the change in width is significant compared with the total width . the width of the sensor elements can be fabricated according to the expected corrosion rate in the environment and , in this embodiment , would be twice as large as the expected corrosion thickness due to corrosion proceeding from both sides . this operation is illustrated in the context of fig2 a and 2b , where fig2 a illustrates a cross section view of a corrosion sensitive resistor arm of a corrosion sensor before corrosion , and fig2 b illustrates a cross section view of a corrosion sensitive resistor arm of a corrosion sensor during or after corrosion . the particular corrosion sensitive resistor arm shown in fig2 a and 2b is the aim that includes corrosion sensor element 102 - 1 ( note the cross section line 2 a / b in fig1 ); however , this is for illustration purposes only and each corrosion sensitive resistor aim of the sensor 100 is formed and operates in a similar manner as described herein . as shown , in fig2 a and 2b , a protective film 202 is formed on the top of corrosion sensor element 102 - 1 . note that as shown here in the subject figures , the sensor element 102 - 1 is formed on top of the non - conductive substrate 206 . the protective film 202 can be formed from such material as al 2 o 3 ( aluminum oxide ) or si 3 ni 4 ( silicon nitride ). it is to be understood that the protective layer 202 is preferably formed via the electron - beam fabrication process that is used for the deposited metal film ( sensor elements ). the protective film may be also be made of the same material as the encapsulation layer 112 ( recall that the encapsulation layer encapsulates the reference sensor elements 104 and the conducting bus 106 ). thus , note that for the corrosion sensor element 102 , the protective film coating covers the top of the sensor element ( as shown in fig2 a ), but in the case of the reference sensor elements 104 , the protective film ( encapsulation layer ) covers both the top and the sides of the metal film resistors such that they are fully protected from corrosion . this is also the case for the conducting bus 106 so that it is fully protected from corrosion . note that the bottoms of the sensor elements 102 and 104 , and the conducting bus 106 are protected from corrosion by the substrate 206 . more specifically , the protective film 202 shown in fig2 a serves to prevent the corrosion sensor element 102 - 1 from corroding in a spatial dimension other than width w . that is , since the height h of the sensor element 102 - 1 is contained by the substrate 206 on one end and the protective film 202 on the other end , as the sensor element is exposed to contaminants , it corrodes in a single spatial dimension , i . e ., width w . that is what reference numeral 204 denotes , i . e ., corroded lateral sides 204 . thus , the two respective sides of the sensor element 102 - 1 corrode an amount denoted by a and b , and this is what ฮดw represents ( a plus b ). the resistance r of a given metal film ( wire ) prior to corrosion ( in this case , corrosion sensor element 102 - 1 in fig2 a ) is represented as : where w is the width of the sensor element , h is the height of the sensor element ( wh denoting the area of the metal film ), l is the length of the sensor element , and ฯ is the electrical resistivity ( also known as specific electrical resistance or volume resistivity ) of the sensor element . electrical resistivity is a measure of how strongly a material opposes the flow of electric current ( measured in ohm meters ). the resistance r corr of a given metal film after or during corrosion ( in this case , corrosion sensor element 102 - 1 in fig2 b ) is represented as : where ฮดw represents a plus b ( i . e ., the corroded width from both lateral sides of the metal film ). recall from fig1 that the reference sensor elements 104 are encapsulated via encapsulation layer 112 so as not to be affected by corrosive contaminants . thus , the resistance r of each of these metal films ( wires ) will remain substantially constant and thus be represented by eq . ( 1 ). that is , there is no ฮดw associated with the reference sensor elements 104 . note that while fig2 a and 2b show corrosion effects for corrosion sensor element 102 - 1 , the same corrosion effects and resulting equations apply to the other corrosion sensor elements ( 102 - 2 , 102 - 3 , etc .). a measurement operation of the corrosion sensor 100 will now be explained in the context of fig3 . a constant voltage v is applied to one end of the sensor 100 ( at contact pad 110 ) and the current passes through the connecting bus 106 to each of the variable width arms of the sensor 100 . the current passing through each sensor element ( each variable width arm ) is monitored . for example , in one embodiment , the current may be converted to voltage using a transimpedance amplifier ( not shown , but generally depicted as monitor ( s ) in fig3 ) where the resulting voltage is proportional to the width of the metal films ( wires ). as corrosion proceeds , each sensor element 102 corrodes laterally and its resistance increases as per eq . ( 2 ), i . e ., as ฮดw increases , the denominator of eq . ( 2 ) gets smaller , and the resistance r corr increases . thus , in accordance with the present invention , by measuring the current flowing through corrosion sensor element 102 - 1 and measuring the current flowing through the reference sensor element 104 - 1 , and comparing the two measurements , the result will be directly proportional to the corrosion thickness . that is , as shown in fig3 , the current measured from reference sensor element 104 - 1 is : while the current measured from reference sensor element 104 - 2 is : furthermore , the current measured from corrosion sensor element 102 - 1 is : while the current measured from corrosion sensor element 102 - 2 is : thus , at beginning before corrosion effects are present ( fig2 a ), the difference between , for example , the current from the corrosion sensor element 102 - 1 and the reference sensor element 104 - 1 ( i = i 1 โˆ’ i 10 ) is zero . however , as corrosion proceeds ( fig2 b ), the current difference changes linearly , as the width of the corrosion sensor element 102 - 1 decreases . the maximum current would be when the corrosion sensor element is fully corroded . this may be denoted as : advantageously , the current i represents the rate of corrosion for the particular corrosion sensitive resistor arm being monitored . it is to be appreciated that this same signal measurement and comparison applies to each pair of reference and corrosion sensor elements . all elements are connected to detection circuitry ( a monitor ) and they will record the corrosion rate as it proceeds for all of the different widths metal films . the parallel measurement allows for correlation of the corrosion rate from all the different width sensors . the same rate will be measured by all of the sensors . as expected , the widest sensor will have the longest operational lifetime . to enhance the sensitivity of a corrosion sensor detection to be able to monitor small a corrosion rate , a corrosion sensor can be integrated in a bridge circuit setup as illustrated in fig4 . as shown , the bridge setup 400 comprises three corrosion sensors 402 , 404 and 406 ( although more or less sensors can be employed ). each corrosion sensor is comprised of two thin film sensor elements ( metal films or wires ) that are exposed to corrosion ( 410 - 1 in sensor 402 ; 410 - 2 in sensor 404 ; and 410 - 3 in sensor 406 ) and two thin film sensor elements ( metal films or wires ) that are covered with conformal coating 411 ( i . e ., similar material as encapsulation layer 112 and protective film 202 ) so as not to be exposed to corrosion ( 412 - 1 in sensor 402 ; 412 - 2 in sensor 404 ; and 412 - 3 in sensor 406 ). the conformal coated sensor elements are the reference sensor elements while two other sensor elements are exposed to the corrosive environment and their resistance will change as the width of the thin film decreases . the widths of the sensor elements for each corrosion sensors 402 , 404 and 406 ( i . e ., w 1 , w 2 and w 3 ) progressively increase . this provides the progressive time period corrosion monitoring explained above with respect to the corrosion sensor in fig3 . at the beginning , all the sensor elements in a given corrosion sensor have the same value and the bridge circuit 400 is balanced , i . e ., the differential voltage from the two node points ( v 01 and v 02 for sensor 402 ; v 03 and v 04 for sensor 404 ; and v 05 and v 06 for sensor 406 ) is zero . however , small changes in the resistance value of the sensor elements not conformally coated will take the bridge circuit out of balance . the bridge can be operated under constant voltage v that would decrease the current flowing through each corrosion sensor circuit as the corrosion resistance value increases . the bridge circuit 400 advantageously allows a two fold increase in resistance change sensitivity detection . advantageously , in this particular embodiment , the bridge circuit arrangement of fig4 is constructed such that all the parts of the sensors ( 402 , 404 , and 406 ) are fabricated from the same metal having two opposite elements of the bridge exposed to the corrosive environment while the two other elements are protected from the corrosive atmosphere by a protective coating . for a corrosion sensor in the bridge circuit arrangement , all four sensor elements are equal in size such that when none of the corrosion sensors experiences corrosion , the bridge arrangement is in a balanced condition , and when at least one of the corrosion sensors experiences corrosion , the bridge arrangement is in a unbalanced condition . since all the elements of the bridge circuit are from the same metal deposited on the same substrate , the temperature variation that can cause resistance changes are advantageously eliminated . as an example , the detection sensitivity for 120 nm and 240 nm wide sensors ( which are actually 60 nm and 120 nm , respectively , as the corrosion proceeds from both sides ) is shown in fig5 . both sensors have sufficient dynamic range so as to be able to detect variation down to about 0 . 1 nm variation in film width . furthermore , in an integrated circuit implementation of the invention , multiple integrated circuit dies are typically formed in a repeated pattern on a surface of a wafer . each such die may include a device comprising corrosion detection circuitry as described herein , and may include other structures or circuits . still further , in another embodiment , the corrosion detection circuitry could be implemented in multiple dies and in multiple integrated circuit packages . in any case , the dies are cut or diced from the wafer , then packaged as integrated circuits . one skilled in the art would know how to dice wafers and package dies to produce packaged integrated circuits . integrated circuits so manufactured are considered part of this invention . thus , methods for forming one or more of the components of a corrosion sensor device as described herein are within the scope of the invention . accordingly , as has been illustratively described herein , principles of the invention provide a corrosion sensor with a linear response , as the corrosion proceeds , combined with ultra low corrosion rate sensitivity ( e . g ., 10 nm / month ). the sensor is based on the width reduction of a metal film ( wire ) exposed to a corrosive environment and its response is compared to a reference resistor that is shielded from the corrosive environment . employing different width metal films ( wires ) the sensor can be deployed over an extended period of time while maintaining the same corrosion sensitivity . the sensor can be deployed both for monitoring internal and external environmental conditions in real time . it will be appreciated and should be understood that the exemplary embodiments of the invention described above can be implemented in a number of different fashions . given the teachings of the invention provided herein , one of ordinary skill in the related art will be able to contemplate other implementations of the invention . indeed , although illustrative embodiments of the present invention have been described herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various other changes and modifications may be made by one skilled in the art without departing from the scope or spirit of the invention .
6
a typical ntsc receiver can be generalized with regards to its performance characteristics as a function of frequency . fig1 is an illustration of the response of a typical ntsc receiver to luminance , chrominance and aural signals as a function of frequency . the frequency axis shows the luminance carrier signal as the zero frequency . the luminance signal is a vestioial side - band , that is , it is predominantly an upper side - band signal with a &# 34 ; vestige &# 34 ; of the lower side - band , which modulates the luminance carrier . the receiver &# 39 ; s luminance channel response has a bandwidth encompassing frequencies from approximately 0 - 3 mhz relative to the luminance carrier . the receiver &# 39 ; s chrominance channel response has a bandwidth encomposing frequencies from approximately 2 . 0 to 4 mhz . the aural signal is transmitted on a relatively narrow band approximately 4 . 5 mhz above the luminance carrier . as can be seen by inspection of fig1 the close proximity and overlap of the luminance and chrominance responses may result in cross - channel modulation between the luminance and chrominance signals when high - frequency luminance or chrominance changes are present . high - frequency luminance changes may cause spurious colors or &# 34 ; rainbows &# 34 ; in light areas of the display . high - frequency chrominance changes may cause unwanted luminance variations . accordingly , it is especially important to limit the high - frequency content of the luminance and chrominance signals applied to the ntsc receiver without degrading the contrast and luminance uniformity of the resulting display . the preferred embodiment of the present invention provides 40 characters , each having a 6 - dot character width , on each horizontal raster of a television display . thus , there are 240 dots or bits of binary data displayed on each horizontal line . if alternating dots are illuminated , corresponding to the maximum display frequency , the bandwidth of the luminance channel becomes 2 . 685 mhz . this frequency is low enough to afford some immunity to cross - channel modulation ; however , the chrominance response at this frequency may still be substantial in some ntsc receivers and must be compensated for . to provide a positive clock - edge for each dot , a dot - clock having a frequency of 5 . 37 mhz is provided . this dot - clock is precisely related to the frequency of the chrominance clock by digital logic . specifically , the present system has a 14 . 3 mhz systel clock . dividing this system clock by 4 provides chrominance clock signal of 3 . 58 mhz . multiplying the system clock by three - eights provides the dot - clock of 5 . 37 mhz . referring to fig2 there are six dot - clock periods and four chrominance ( or &# 34 ; chroma &# 34 ;) clock periods for every character . in the preferred embodiment of the present invention a number of methods and circuits have been implemented to particularly compensate the digital signals for the problems identified with regard to the interface with a ntsc receiver . the following detailed description is divided into sections associated with the major compensation methods and circuits of a digital ntsc interface circuit . specifically , the following description will describe the methods used for luminance compensation , chrominance compensation and finally , the detailed circuitry implementing the luminance and chrominance compensation and a description of its operation . the first problem associated with digitally interfacing with an ntsc receiver manifests itself as a loss of contrast in response to rapidly alternating bright and dark dots . particularly , there is an attenuation of high - frequency luminance signals in a ntsc &# 39 ; s rf and if sections . fig3 a is an illustration of a digital high - frequency luminance signal corresponding to rapidly alternating bright and dark dots as might be provided by a digital circuit . attenuation of the high - frequency components of the digital signal by a ntsc receiver results in the demodulated wave - form illustrated in fig3 b . the wide spatial field designated as a has a greater amplitude , this appears brighter than the individual peaks 8 associated with individual bright dots . further , the individual dark dots c between the individual bright dots are much brighter than dark spatial field d . to counteract these amplitude variations , a luminance amplitude precompensation technique boosts the amplitude of individual bright dots and decreases the amplitude of individual black dots adjacent to individual bright dots . this increase in the a . c . amplitude of the luminance signal increases the luminance and contrast of individual bright dots . the decrease in the black level amplitudes on both sides of a bright dot also limits color fringing by lowering the luminance of the black background to a level at which color cannot be perceived . fig3 c is an illustration of a digital luminance signal ( in dotted lines ) which has been digitally compen - sated for luminance amplitude precompensation and the resulting response of an ntsc receiver ( in solid lines ). a second method known as luminance pulse - width precompensation further increases the luminance of individual high - frequency bright dots and further decreases the cross - channel modulation between the luminance and chrominance signals caused by high - frequency luminance signals . particularly , when the present circuitry detects a decrease in luminance in the next bit of the luminance signal , the present bit is extended by one - half the dot - clock period . this allows the individual luminance dots to reach a luminance level perceptually equal to the high - luminance of a bright spatial field . further , by increasing the pulse - width to a 75 % duty cycle , the frequency of an alternating bright - dark pattern is separated into two predominant side - bands . the first side - band is a frequency of approximately 1 . 79 mhz , which is in the middle of the luminance response band and is well removed from the chrominance passband . the second side - band , 5 . 37 mhz , is also well removed above the total passband , thus , it does not affect either the chrominance or the luminance signals . visually , the extended dot is not noticeable at normal viewing distances . naturally , it causes vertical character segments to be wider than horizontal character segments . however , this effect does not degrade subjective viewing of tv graphics . the net effect of luminance pulse - width precompensation is to increase the dc offset of the net luminance response of the receiver for high frequency luminance changes . the luminance amplitude precompensation provides an ac amplification during high bandwidth luminance changes . graphically , the signal resulting from pulse - width precompensation and luminance amplitude precompensation is illustrated in fig4 . the luminance signal detected by the receiver exhibits an equal average luminance amplitude regardless of the luminance frequency . particularly , the wide spatial field a and the individual bright dots b appear to have equal luminances . the intersticed black dots appear to be black due to the close proximity to the highly luminent white dots . further , an additional benefit of these two luminance compensation methods is to provide for an improvement in color purity due to the observed improvement in the uniformity of the luminance levels of spatial fields having varying widths . a third luminance compensation method is related to the problem of color fringing caused by rapid dark - to - light transitions . particularly , the high - frequency digital transition from a dark dot to bright dot cross - modulates the chrominance channel and is interpreted as a color signal . this cross - channel modulation causes a rainbow effect , known as color ringing , in the white areas following such a transition period . accordingly , a luminance slope precompensation method raises the level of a black dot immediately preceding a large luminance increase so as to decrease the detected dv / dt of the luminance signal . this decrease in the rate of change of the digital signal decreases the bandwidth of the detected luminance signal and decreases the cross - channel modulation and the resulting color fringing . the ntsc system encodes color as a phase shift of a 3 . 58 mhz chrominance signal . specifically , a color burst of 9 cycles of the 3 . 58 mhz signal having a reference amplitude is provided with each horizontal line . the phase of this color burst is compared to a subsequent phase of the chrominance carrier to determine the desired color . the amplitude of this color burst is compared to subsequent amplitudes of the chrominance carrier to determine the desired color saturation . in the preferred embodiment of the present invention an eight - phase 3 . 58 mhz color generator generates signals representing six discrete colors . particularly , the phase shifts and the corresponding colors are : these colors and the corresponding phase shifts are illustrated graphically in fig5 . since there are only four color reference periods for every six dot periods , as shown in fig2 the receiver &# 39 ; s color demodulator may not always have enough time to generate the necessary decoded color for a single colored dot . a first color compensation method designated &# 34 ; advance chroma precompensation &# 34 ; advances the selection of the decoded chroma phase by half a dot - clock prior to a low - to - high luminance transition . this allows the receiver &# 39 ; s color demodulator time to track the chrominance signal when a luminance transition occurs . the advanced chroma signal is not apparent to the viewer because of the reduced color perception in low luminance color areas . further , the advanced locking of the demodulator with the color carrier prevents the color demodulator from erroneously locking onto the phase of the high - frequency luminance transition . a second color compensation method designated &# 34 ; extended chroma precompensation &# 34 ; extends the chrominance signal phase for one - half a dot - clock after a high - to - low luminance transition . similar to the advance chroma precompensation , this method holds the receiver &# 39 ; s color demodulator in lock during the high - frequency luminance transition and prevents trailing edge color distortion that might otherwise occur . again , the viewer does not notice the extension of the color into the low luminance area . a third color compensation method known as subjective pseudo - color enhancement compensates for the small chrominance signal bandwidth by providing luminance changes where high - frequency color changes are desired . specifically , when a background ( low luminance ) color dot occurs between two foreground ( high luminance ) color dots , the chrominance of the background color dot is unchanged but its luminance level is lowered to the luminance level at a normal background color dot . the resulting background color dot appears to the viewer as having the background color . specifically , for this small area the brain &# 34 ; fills in &# 34 ; the background color having an equal luminance from the background area . finally , the color yellow is considered as a special case due to its apparently high luminance . to correct for this phenomenon , a &# 34 ; yellow compensation &# 34 ; method reduces the chrominance level while concurrently increasing the luminance level during a yellow dot period . this produces a yellow dot which has the same apparent luminance as dots of the other colors . fig6 is a detailed schematic diagram of internal clock circuit 100 . the internal clock circuit generates three internal clock signals ฯ† , pฯ† , and 2ฯ† in response to an external clock signal dclk . external clock signal dclk is applied to one of the inputs of and gate 110 and has a frequency of 5 . 3693175 mhz . the ฯ† clock signal is used as the main system clock . this signal is delayed by the gate delay of and gates 110 and 120 to provide a signal preferably delayed 10 nanoseconds with respect to the dclk signal . the pฯ† clock signal is simply the unprocessed dclk signal . the pฯ† signal is used when an advanced positive clock edge relative to the ฯ† clock signal is required . the 2ฯ† clock signal is generated by frequency doubling the pฯ† clock by the use of inverters 130 and 140 and exclusive or gate 150 . the gate delays of the devices in internal clock circuit 100 are selected such that the positive edge of the pฯ† signal occurs first , followed by the 2ฯ† signal positive edge , and finally the ฯ† signal positive edge . further , the external clock signal dclk preferably has a duty cycle of 50 % to insure that alternating positive edges of the the 2ฯ† signals are characterized by accurate one - half bit shift delays . the waveforms of these signals , including external clock signal dclk , the intermediate signal a appearing at the output of inverter 140 , and system clock signals ฯ† and 2ฯ† are illustrated in the waveform diagrams of fig7 . fig8 is a detailed schematic diagram of the color attribute multiplexer 160 and the luminance pattern and color encoder 170 . the color attribute multiplexer 160 receives attribute codes and character generator video data from external crt controller video ram circuitry . specifically , the color attribute multiplexer 160 receives background and foreground codes as defined in table 2 . for example , the foreground attribute inputs f - r , f - g and f - b correspond to the &# 34 ; foreground red &# 34 ;, &# 34 ; foreground green &# 34 ; and &# 34 ; foreground blue &# 34 ; bits of the table . table 2______________________________________background codes foreground codes______________________________________000 black 000 black001 blue 001 blue010 green 010 green011 cyan 011 cyan100 red 100 red101 magenta 101 magenta110 yellow 110 yellow111 white 111 white______________________________________ these signals are multiplexed into four data signals on address lines a0 , a1 , a2 , and a3 . the specific levels of these signals are defined in table 3 , the color attribute multiplexer data format . table 3______________________________________a3 a2 a1 a0 assignment______________________________________0 0 0 0 -- black dot0 0 0 1 -- background blue dot0 0 1 0 -- background green dot0 0 1 1 -- background cyan dot0 1 0 0 -- background red dot0 1 0 1 -- background magenta dot0 1 1 0 -- background yellow dot0 1 1 1 -- white dot1 0 0 0 -- black dot1 0 0 1 -- foreground blue dot1 0 1 0 -- foreground green dot1 0 1 1 -- foreground cyan dot1 1 0 0 -- foreground red dot1 1 0 1 -- foreground magenta1 1 1 0 -- foreground yellow1 1 1 1 -- white dot______________________________________ the signal on address line a3 is advanced by one clock period of clock signal 0 ( one dot - clock period ) with respect to address signals a0 - a2 . accordingly , a high level signal on address line a3 indicates that the next dot will be a foreground ( high luminance ) dot . a low level signal on address line a3 indicates that the next dot will be a background ( low luminance ) dot . the signals on address lines a0 - a2 designate the color of the present dot . specifically , signals on address lines a0 , a1 , and a2 represent the colors blue , green and red , respectively , as indicated in table 3 . the color attribute multiplexer 160 comprises a 6 - bit d - type latch 180 , an 8 - bit d - type latch 190 , and a quad 2 - line to 1 - line data selector / multiplexer 200 . inverters 210 and 220 are designed to have gate delays equivalent to the propagation delay through ppn generator 180 . thus , the inputs to the integrated circuit 190 from ppn generator 180 and pin y are received at the same time . luminance pattern and color encoder 170 comprises a 32 ร— 6 rom coupled to address lines a0 - a4 . address line a4 is used to reverse the color phase for pal operation . for ntsc operation address line a4 is grounded . encoder 170 produces outputs on data lines d0 - d2 and d4 - d6 in response to signals on the address lines a0 - a4 . specifically , data line d6 has a high level output if the present dot on address lines a0 - a2 is yellow . data lines d5 and d4 indicate the luminance of the present dot as shown below in table 4 . data lines d0 - d2 indicate the color of the present dot in response to the signals on address lines a0 - a2 and pal select line a4 as shown in table 4 . table 4__________________________________________________________________________d2 d1 d0 -- color ntsc ( a4 = 0 ) d5 d4 -- dot type__________________________________________________________________________1 1 1 -- green 0 0 -- black dot1 1 0 -- not used 0 1 -- white dot1 0 1 -- cyan 1 0 -- background1 0 0 -- blue 1 1 -- foreground0 1 1 -- not used0 1 0 -- magenta0 0 1 -- red0 0 0 -- yellow__________________________________________________________________________d2 d1 d0 -- color pal ( a4 = 1 ) __________________________________________________________________________1 1 1 -- red1 1 0 -- magenta1 0 1 -- not used1 0 0 -- blue0 1 1 -- cyan0 1 0 -- not used0 0 1 -- green0 0 0 -- yellow__________________________________________________________________________ fig9 is a detailed schematic diagram of past / present / next ( ppn ) generator 180 and bit pattern and color decoder 190 . ppn generator 180 comprises three pipelined &# 34 ; d &# 34 ; type flipflops 200 , 210 and 220 clocked by the 0 clock signal . flipflop 200 is coupled to receive data lines d6 - d4 and d0 - d2 from encoder 170 and data line blank from ic 190 . flipflops 200 , 210 and 220 provide output signals delayed in phase by one dot - clock period with respect to the signals applied to their inputs . for example , signal d6 is delayed by one dot - clock period in flipflop 200 to provide a signal on line d6a . flipflop 210 delays the signal on line d6a and provides a signal delayed another dot - clock period on line d6b . bit pattern and color decoder 190 comprises a 256 * 7 rom . decoder 190 is coupled to data lines d5a and d4a indicating the dot type of the next bit in accordance with table 4 . data lines d5b and d4b indicate the dot type of the present bit , and data lines d5c and d4c indicate the dot type of the past bit . the signal on data line d6b indicates whether the present dot is yellow . in operation , if blank is high , the output signals on lines d10 - d17 are forced low , denoting no chroma change , no chroma output and a blanking luminance level . otherwise , the chroma phase , chroma amplitude and luminance amplitude signals from decoder 190 are functions of the color and luminance of past , present , and next bits . definitions of these signals are given in table 5 and the specific rom listing is given in table 6 for values of the luminance amplitude and table 7 is the chroma phase and amplitude . table 5__________________________________________________________________________luminance amplitude luminanced17 ( msb ), d16 , d15 , d14 levels modulation__________________________________________________________________________9 -- white deviation level 20 % 8 -- white reference level & amp ; foreground 25 % yellow reference level7 -- foreground yellow level & amp ; foreground 30 % deviation level6 -- foreground color reference level 35 % ( except yellow ) 5 -- background deviation level 40 % 4 -- background yellow level 45 % 3 -- background color reference level 50 % 2 -- black level ( deviation level ) 65 % 1 -- black level ( reference black ) 70 % 0 -- blank level__________________________________________________________________________ table 6______________________________________luminance luminanceamplitude amplitudep p n not yel yel p p n not yel yel______________________________________b b b 1 n / a * b b 0 n / ab b w 2 n / a * b w 1 n / ab b * 0 n / a * b * 0 n / ab b c 0 n / a * b c 0 n / ab w b 9 n / a * w b 9 n / ab w w 8 n / a * w w 8 n / ab w * 9 n / a * w * 9 n / ab w c 9 n / a * w c 9 n / ab * b 4 5 * * b 3 4b * w 4 5 * * w 3 4b * * 3 4 * * * 3 4b * c 3 4 * * c 2 3b c b 7 8 * c b 8 9b c w 7 8 * c w 7 8b c * 7 8 * c * 8 9b c c 6 7 * c c 7 8w b b 2 n / a c b b 0 n / aw b w 1 n / a c b w 1 n / aw b * 1 n / a c b * 0 n / aw b c 1 n / a c b c 0 n / aw w b 8 n / a c w b 9 n / aw w w 8 n / a c w w 8 n / aw w * 8 n / a c w * 9 n / aw w c 8 n / a c w c 9 n / aw * b 4 5 c * b 4 5w * w 3 4 c * w 3 4w * * 3 4 c * * 2 3w * c 3 4 c * c 2 3w c b 7 8 c c b 6 7w c w 3 4 c c w 3 4w c * 7 8 c c * 7 8w c c 3 4 c c c 6 7______________________________________ ( note : &# 34 ; b &# 34 ; = black dot &# 34 ; w &# 34 ; = white dot &# 34 ;*&# 34 ; = background color dot &# 34 ; c &# 34 ; = foreground color dot ) table 7______________________________________p p n change chroma level______________________________________1 . x b b no 0 % 2 . x b w no 0 % 3 . x b * yes 12 . 5 % 4 . x b c yes 25 % ( yellow = 12 . 5 %) 5 . x w b no 0 % 6 . x w w no 0 % 7 . b w * yes 0 % 8 . w w * yes 12 . 5 % 9 . * w * yes 0 % 10 . c w * yes 0 % 11 . b w c yes 12 . 5 % 12 . w w c yes 25 % ( yellow = 12 . 5 %) 13 . * w c yes 12 . 5 % 14 . c w c yes 12 . 5 % 15 . b * b no 25 % ( yellow = 12 . 5 %) 16 . w * b no 12 . 5 % 17 . * * b no 12 . 5 % 18 . c * b no 12 . 5 % 19 . n * * w no 12 . 5 % 20 . * * w no 12 . 5 % ( yellow = 0 %) 21 . x * * yes 12 . 5 % 22 . x * c yes 12 . 5 % 23 . x c b no 25 % ( yellow = 12 . 5 %) 24 . x c w no 25 % ( yellow = 12 . 5 %) 25 . x c * no 25 % ( yellow = 12 . 5 %) 26 . x c c yes 25 % ( yellow = 12 . 5 %) ______________________________________ ( note : following are abbreviations used in the table : &# 34 ; p p n &# 34 ; = past / present / next bit pattern &# 34 ; change &# 34 ; = new color coding being latched into the chroma phase selector . chroma phase will change in the middle of the present dot while the selected color phase is the phase for the next dot . &# 34 ; chroma level &# 34 ; = peak to peak swing referenced to i . r . e . standard ). line d13 provides a color change signal in accordance with table 7 which selectively causes chroma select circuit 430 ( fig1 ) to latch an updated color code into color control and gating circuit 420 ( fig1 ) from flip - flop 210 output lines d2b , d1b and d0b . this color code corresponds to the color code on lines d2 , d1 and d0 as defined in table 4 except that it is delayed two clock periods . lines d12 and d11 provide the chroma level control signals in accordance with table 7 . specifically , the signals on these lines are : ______________________________________d12 d11 chroma level______________________________________0 0 zero chroma ( 0 %) 1 0 1 unit of chroma ( 12 . 5 %) 1 1 2 units of chroma ( 25 %) ______________________________________ luminance decoder 235 and luminance pulse width modifier 240 are illustrated in detailed schematic diagram fig1 . luminance level signals d14 - d17 are coupled to decoder 245 which decodes the multiplexed signal and provides a signal on one of its ten output lines in response to the level of the decoded signal . these signals are then translated to twelve ( 12 ) volt signals by integrated circuits 270 and 280 and the associated 1k and 470 ohm resistors . modifier 240 of fig1 performs the pulse width modifications associated with the luminance pulse - width precompensation . luminance level signals d14 - 17 are coupled to ic &# 39 ; s 310 and 320 , which compare past and present luminance levels . if the present dot has the same or greater luminance than the past dot , clocking circuitry 330 provides a clock signal to pipeline flipflops 340 and 350 at the normal rate of 186 ns per bit ( 2 . 685 mhz ). however , if a decreasing luminance is detected , clocking circuitry 330 delays the clock signal to flipflops 340 and 350 by one - half a 2 . 685 mhz clock period , which extends the present high luminance dot for one - half a period . fig1 is a detailed schematic diagram of luminance digital - to - analog converter 360 and luminance / chrominance mixing circuit 370 . a set of ten ( 10 ) analog switches 380 are coupled to receive the luminance level signals from modifier 240 . an eleventh analog switch 390 is coupled for inserting the lower ntsc ( or higher pal ) amplitude composite synchronizing pulses in response to signals on the cs external input . these analog switches are coupled to resistor ladder 400 which is coupled between the terminals of a 12 - volt supply . these switches are also coupled to a power buffer 410 which provides the composite video analog luminance signal . fig1 is detailed schematic diagram of color control and gating circuit 420 . a chroma select circuit 430 receives signals on lines d0b , d1b and d2b from past / present / next generator 180 , indicating the color of the present bit . the chroma select circuit is also coupled to receive a color change signal on line d13a and chrominance amplitude control signals on lines d12a and d11a . these chrominance amplitude control signals are coupled to tri - state control inputs of inverters 450 and 460 for providing three levels of chroma output . specifically , the chroma levels as provided by ppn generator 180 are given in table 7 . tri - state inverters 450 and 460 are coupled to cmos - inverters 470 and 480 respectively for generating chroma waveforms similar to conventional ntsc chroma phase signals . these waveforms are desirable for driving a chroma - mixing transformer because dc charging and discharging slopes are not coupled to the luminance channel . the cmos inverters are driven rail - to - rail at a phase of 3 . 579 mhz in response to the chroma being enabled . chroma reference gating circuit 490 gates one of eight phases to the cmos inverters 470 and 480 . a signal applied to input cbg ( color burst gate ) enables the reference chroma burst phase signal . eight - phase color frequency generator 500 provides eight color frequency signals of varying phases in response to an external 14 . 31818 mhz clock ( 3 . 579545 * 4 ) applied to input 14m . each signal varies by 45 degrees in phase with respect to the sequent phase . six color hues have been assigned to six of the eight signals . generator 500 comprises four &# 34 ; d &# 34 ; type flipflops 510 , 520 , 530 and 540 , one master flipflop 550 , and three exclusive - or gate 560 , 570 and 580 . the master reset 550 sets the &# 34 ; d &# 34 ; type flipflops to a predefined sequence in response to an external power on pulse on input rst . the relationship between phases and colors is given below in table 8 . table 8______________________________________ degrees phase fromcolor burst reference______________________________________chroma reference 0yellow 12red 57magenta 102 ( not used ) 147blue 192cyan 237 ( not used ) 282green 327______________________________________ the yellow phase is used for the color burst reference signal which provides a final composite video color burst whose phase is near yellow . referring to fig1 , luminance / chrominance mixing circuit 370 utilizes a 10 mm - three - winding transformer having two of the windings connected in series with a grounded center - tap . two of the windings are connected in series with the center tap to ground . the two hot points are driven by the bi - phase chroma frequency buffers ( tr1 thru tr4 ). three levels of chroma are obtained by tri - stating the circuit on and off . the third winding serves two purposes , first , it sums the chroma signals from the former two windings and superimposes the output onto the liminance channel , secondly , with two capacitors connected to its terminals , it performs a low - pass filter function , which band - limits the luminance and chrominance signals . the half - power point of the filter is set at approximately 2 . 8 mhz . the two capacitors are chosen in such a way that the value of the output capacitor is about one - fifth of the input capacitor , thus , the majority of the chroma signal will be delivered to the rf modulator preventing back - feeding of the luminance buffer . this reduces intermodulation distortion at the luminance buffer amplifier . the resistors around the mixing transformer lower the &# 34 ; q &# 34 ; of the filter network , which eliminates possible over - shoot excursions from affecting the rf modulator . while the invention has been particularly taught and described with reference to the preferred embodiments , those versed in the art will appreciate that minor modifications in form and detail may be made without departing from the spirit and scope of the invention . accordingly , all such modifications are embodied within the scope of this patent as properly come within my contribution to the art and are particularly pointed out by the following claims .
6
referring again to the drawings , fig3 is a block diagram of the components of a memory system used to implement an embodiment of the present invention . although the present invention will be described with reference to the typical components of a flash memory system , it is not restricted to such and may also be implemented in other forms of memory systems . as with the components of the memory system shown in fig2 an input / output pad 40 is connected to circuit elements which form a data read path 42 and a data write path 44 to memory array 12 . read path 42 and write path 44 are electrically connected to data line 46 , which connects those paths to memory array 12 by means of decoder or multiplexer 16 . as with fig2 only y decoder 16 and the columns of array 12 are indicated . in a complete diagram of the components , both x decoder 14 of fig1 and the rows of array 12 could typically be shown . it is noted that certain aspects of the present invention which relate to accessing the internally generated signals by entering a test mode of operation and which will be discussed in greater detail later are described in u . s . pat . no . 5 , 526 , 364 , entitled , &# 34 ; apparatus for entering and executing test mode operations for memory &# 34 ;, issued jun . 11 , 1996 , the disclosure of which is hereby incorporated in full by reference . when reading a memory cell of array 12 , decoder ( multiplexer ) 16 is used to access a desired memory cell in the array . sense amplifier 52 is used to determine the state of the cell , and is enabled by means of sense amplifier enable signal 54 . the output of sense amplifier 52 is sent to output buffer 56 which drives the data to output pad 40 where it is accessed by a user . output buffer 56 is enabled by means of output enable signal 57 . as discussed with reference to fig2 when an external processor polls status register 26 to determine the status of a read or write operation , sense amplifier enable signal 54 is used to disable sense amplifier 52 by bringing that node to a high impedance . status register enable signal 27 , which is used to place that node at a high impedance during a read operation , is then used to enable the register and to route the contents of status register 26 to pad 40 . as previously mentioned , pad 40 is connected to an input / output pin 15 of fig1 . in accordance with the present invention , the memory system of fig3 includes a test mode detector / decoder 60 which is used to place the memory system into a test mode and to verify that a valid code has been entered to select an internal signal for routing to either pad 40 ( in the case of a digital signal ) or to an address pin 13 ( in the case of an analog signal ). test mode detector 60 controls digital test signal switch ( multiplexer ) 62 and analog test signal switch ( multiplexer ) 64 which act to route the selected internally generated signal 66 to pad 40 or address pin 13 ( or another desired location ) for purposes of monitoring the operation of the memory system and / or determining the cause of a device failure . the memory system is designed so that a selected group of internal signals indicative of the operating status or state of the memory system are available as test signals 66 which can be accessed by the present invention . these signals 66 typically include those which indicate the state which the internal state machine ( and hence memory system ) is in , and those used to initiate actions which cause the internal state machine to transition from one state to another . in general terms , the signals 66 provided are used to evaluate the status and operation of the internal circuitry of the memory system , and are of the type which would not be of use to a normal user of the system . the manner in which the desired signals are routed to the multiplexers is layout dependent and is accomplished by methods known in the industry . it is noted that if capacitance loading of the signal paths is an issue in routing the signals to the multiplexers , then this should be taken into consideration in the design of the multiplexers . as noted , digital and analog test signal switches 62 and 64 typically take the form of a multiplexer which is controlled so as to select one of its multiple inputs for routing to other parts of the circuit where the signals may be accessed by a chip designer . the digital signals which are included in internal signals 66 are routed to digital switch 62 , while the analog signals which are included in internal signals 66 are routed to analog switch 64 . digital and analog test signal switches 62 and 64 are enabled by means of a signal provided by test mode detector 60 , where the enabling signal is provided in response to the memory system being placed into a test mode . the memory system is capable of operating in a normal mode of operation and an alternative or test mode of operation . in the normal mode of operation , an end user can carry out normal memory functions including programming , erasing and reading of the memory cells . the alternative or test mode of operation is used for carrying out various memory functions other than the normal functions and is a mode not intended to be accessed by end users . detector / decoder 60 detects certain test inputs to the memory and switches the memory to a selected test mode . the memory system can be placed into a test mode by one of several methods . it has been found desirable to utilize a method which reduces the possibility of a standard user of the memory system being able to access the test mode . this has been achieved by a procedure in which a high voltage is simultaneously applied to two or more pins of the memory system circuit that normally have much lower voltages applied during operation of the system . thus , the applied voltages used to enter the test mode are outside of the range of voltages which would be applied during normal operation of the memory system by a user wishing to program , erase , or read the contents of the memory cells . for example , if the range of voltages applied to a particular pin or pins during normal operation of the memory system is in the range of 5 volts ยฑ 1 volt , then the voltage applied to initiate the test mode might be chosen to be 10 volts . other signal characteristics , such as pulse width or period , may also be varied in order to differentiate the test mode initiating signals from those applied to the pin ( s ) during normal operation of the system . in addition , the memory system can be placed into a test mode by application of a sequence of commands ( such as write data a - write data b - write data c ) which would not occur during the normal operation of the system . test mode detector 60 responds to the appropriate applied voltages and / or sequence of test mode signals by allowing access to the test mode of operation . after this step , a test mode code which is associated with an internally generated signal of interest is applied on an input / output line , such as pad 40 . the test mode code is written to a test mode latch ( not shown ) which allows pad 40 or address pin 13 ( or another data input location ) to be used for other purposes during processing of the data associated with the testing process . the test mode code is compared to a set of predetermined codes by decoding logic contained in test mode detector / decoder 60 , in order to verify the validity of the entered test mode code . if the entered code corresponds to a valid test mode , a test mode enabling signal is sent to both digital test signal switch 62 and analog test signal switch 64 . this sequence of steps places the system into a desired test mode and causes a desired one of the digital internal signals 66 to be routed out of digital test signal switch 62 to data read line 42 . if an analog signal is to be accessed , the signal is routed by analog test signal switch 64 to address pin 13 . further details of the method by which the memory system is placed into a test mode and how a test mode signal is decoded and verified can be found in the previously mentioned u . s . pat . no . 5 , 526 , 364 , entitled , &# 34 ; apparatus for entering and executing test mode operations for memory &# 34 ;. in order to prevent incorrect data from being provided to pad 40 or address pin 13 when a test mode enable signal is provided by test mode detector / decoder 60 , sense amplifier 52 is disabled by means of sense amplifier enable line 54 , and status register 26 is disabled by means of status read enable line 27 . this disabling can be achieved by bringing enable lines 54 and 27 to a low level , thereby bringing the output of sense amplifier 52 and status register 26 to a high impedance . this ensures that in the case of a digital signal , only the desired internal signal 66 will be routed to pad 40 along data read path 42 . examples of the internal signals 66 which are provided to digital test signal switch 62 or analog test signal switch 64 and can be routed to pad 40 or address pin 13 include signals indicative of the major stages in the erase operation of the memory system : pre - program , erase high voltage , verify signal , verify ok signal , increment address signal , increment pulse signal , maximum address detected signal , and maximum pulse allowed signal . another type of internal signal which can be accessed is one which enables reading or verifying the contents of an internal storage register . still another type of internal signal which can be accessed are those which can be used to perform a current / voltage characterization on a selected memory cell . other signals indicative of the operation or status of the memory system may also be supplied as internal signals 66 by routing them so that they are available to digital or analog test signal switches 62 and 64 . fig4 is a schematic of a circuit for the test mode detector / decoder circuit 60 of fig3 which can be used to place the present invention into a test mode and to decode which internal signal is to be accessed . in order to switch the memory system to a test mode of operation , test mode commands must be applied to the data i / o terminals of the memory to indicate which one of various test modes is to be entered , i . e ., which of the internal signals is to be accessed . typically , the end user of the memory system would have no reason to cause the memory system to enter the test mode since this mode is intended to be used by the memory fabrication facility . furthermore , accidental entry into the test mode is to be avoided since the memory could be rendered permanently inoperable in this mode . thus , the test mode circuitry is designed to reduce the likelihood of accidental entry into the test mode by requiring simultaneous application of high voltages to multiple memory system terminals . in one embodiment , the circuit of fig4 is activated by application of a high voltage to two or more terminals 100 and 102 of the memory system from an external source . these terminals are typically non - dedicated terminals used during normal memory operations . terminals 100 and 102 may include , for example , address terminal ( pad ) a10 and the write enable terminal we . the magnitude of the high voltage applied to terminals 100 and 102 is chosen to be outside of the range of voltages which would typically be applied to those terminals during use of the terminals in normal ( non - test mode ) operation of the memory system . this is done to prevent an end user from unintentionally entering the test mode . the high voltage applied to terminals 100 and 102 is detected by detectors 104 and 106 . a detector circuit suited for use in constructing detectors 104 and 106 is described in u . s . patent application ser . no . 08 / 493 , 162 , entitled , &# 34 ; integrated circuit having high voltage detection circuit &# 34 ;, filed jun . 21 , 1995 , the disclosure of which is hereby incorporated in full by reference . as noted , the memory system can also be placed into a test mode by application of a sequence of commands which would not occur during the normal operation of the system . after application of the high voltage to terminals 100 and 102 , a signal on another terminal 108 , in this case the chip enable ce terminal , is made active ( low ). test code data corresponding to one of several possible test modes is placed on the data i / o terminals 110 of the memory and forwarded to an i / o buffer 112 . an and gate 114 provides a test mode load enable signal when the outputs of both high voltage detectors 104 and 106 indicate that a sufficiently high voltage ( i . e ., outside the range of voltages applied during normal operation ) is being applied to the two terminals 100 and 102 . the load enable signal is coupled to one input of an and gate 116 together with an inverted signal ce . this causes and gate 116 to turn on pass transistor 118 which will forward the test code data to buffer 112 and then to a test mode code latch 120 . separate i / o terminals and pass transistors 118 are used for each bit of input test mode data so that the data will be loaded into latch 120 in parallel . typically there are a total of eight bits of test code data so that latch 120 will contain eight bits . signal ce is then brought back to a high state , thereby latching the test code data in latch 120 . after latch 120 has been loaded with the test code data , one of the high input voltages , such as the input to address a10 terminal 102 is removed so that the output of detector 106 will go low thereby providing a high input to an and gate 128 by way of inverter 130 . since the remaining input of gate 128 , the output of the second high voltage detector 104 , will still be high , gate 128 will produce a test mode enable signal 124 . among other things , this will enable test mode and format check and decode logic unit 122 which will verify that the data in latch 120 corresponds to one of the proper test modes . in addition , unit 122 will decode the test mode code to determine which one of the different memory test modes has been entered , thereby determining which set of internal signals will be accessible . the test modes each have an associated test mode signal 126 which is produced by test mode and format check and decode logic unit 122 and which is used by the memory system in combination with other signals for carrying out the various test mode functions , such as controlling the routing of the internal signals which will be accessed . the system will remain in the selected test mode as long as the voltage applied to terminal 100 remains high . when signal ce is brought back to a high state , detector activation logic 132 keeps detector circuits 104 and 106 enabled as long as the voltage applied to terminal 100 remains high . during the course of carrying out the various test modes operations , it may be necessary to periodically change the state of the chip enable ce signal . however , since address a10 on line 102 has been shifted to a low state , the low output of and gate 116 will prevent any change in the contents of the test mode code latch . once the test mode operation is completed , the high voltage applied to terminal 100 is removed thereby causing the output of and gate 128 to go low and ending the test mode operation . the test mode codes loaded into latch 120 are preferably of a specific format thereby further reducing the possibility of accidental entry into a test mode . the test mode code is typically divided into two groups of bits , with the first group of bits , the format bits , signifying a test mode operation and the remaining bits signifying a particular one of the test modes . a further description of the test code formats can be found in the previously mentioned u . s . patent entitled , &# 34 ; apparatus for entering and executing test mode operations for memory &# 34 ;. test mode enable signal 124 enables digital test signal switch ( multiplexer ) 62 and analog test signal switch ( multiplexer ) 64 . valid test mode code signal 126 then specifies which internal signal ( s ) 66 are routed by test signal switches 62 and 64 to read data path 42 ( in the case of a digital signal ) or to an address pin 13 ( in the case of an analog signal ). the present invention enables a memory chip designer to access signals generated during the operation of the memory system . these signals are not available to a normal user of the memory system who is carrying out programming , erasing , and read operations on the cells of the memory system . access to the test signals is achieved by placing the memory system into a test mode and entering a code corresponding to the particular signal ( s ) which are desired . a digital or analog multiplexer is then used to route the specified signal to an i / o pad or address pin where it can be accessed . as the procedure for placing the memory system into a test mode involves applying voltages which are outside of the normal operating range , the test mode cannot be accidentally accessed by a standard user of the memory system . the terms and expressions which have been employed herein are used as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding equivalents of the features shown and described , or portions thereof , it being recognized that various modifications are possible within the scope of the invention claimed .
6
aspects of the exemplary embodiment relate to a system and method for providing the ability to modify a document using natural language commands through a user interface . natural language commands are particularly friendly for user interaction because the user identifies with the particular description in a familiar language . however , not all users may be familiar with the particular language . therefore , human readable sentences identified by the user are provided in an interface that allows users to select portions of the sentences for creating complete sentences designating how a document are modified . various image modifications can be implemented within the user interfaces . for example , color modifications , object modifications , and / or picture modifications , such as blurriness , sharpness , etc . consequently , the present disclosure is not limited to any specific type of modification , although the disclosure refers mainly to image modifications involving color as one example of the image modifications implemented within the system and methods herein . colors vary greatly in how they are designated . thus , in one embodiment a user selects a color for an image modification to be implemented within the user &# 39 ; s document . the colors are presented , for example , within an easy to use text - based interface under certain categories simply designed for eliciting a selection from a user for a specific color to be modified . for example , the categories may be titled with a question for eliciting a response from the user , and the colors may be selections presented as options for the user to select from among the categories . the selections may be color selections that are in the form of patches of colors or a color sample among a palette of colors that are presented . further , the selection can comprise a text description of the particular color to compliment the color sample . this provides the advantage of eliminating some of the ambiguity with language , but allows an interface utilizing natural language to identify a selected color desired by users to be adjusted in a document , which may be any type of document ( e . g ., a photo image , a text document , presentation , etc .). a human readable sentence representing a natural language command identifies the image modification to be generated through a natural language control system . where a human readable sentence , for example , may be โ€œ make greens a lot more blue ,โ€ the sentence generated becomes a command for mapping changes to regions of color space within the document . for example , affecting the regions of blue in a document to make them a lot more green . this concept will be discussed in more detail infra with respect to the methods and apparatus disclosed . an image modification is based on the type of change to be modified in a document or the particular image within the document , the magnitude of the modification desired , and the resultant image modification ( i . e ., the direction of the modification within the document ). for example , any color selected from the category of colors presented designates which color to be modified in a user document . as stated above , this color is selected from among color selections presented under a category of a text - based interface . for example , certain purples may be selected either from colors extracted out of the document and presented within a category for selecting the color to be modified or a number of predefined patches or color samples are presented . these samples may include a range of samples under each color . the range of purples , for example , comprises various purples of differ characteristics comprising various spectral characteristics , brightness values , hues , and / or saturation amounts . the colors provide different textures , such as glossy , grainy , fuzzy , etc . additionally , the colors in the range of purples , for example , provide various shades considered within the purple spectrum of visible colors from which the user may choose from . any number of colors therefore is selected for a color modification within the document . the colors can be predefined or extracted from the document for populating the category presented to the user for selection . in another embodiment , objects within the document or properties of the image within the document may also be modified in a similar fashion . the disclosure is not limited to color . the magnitude of change for a modification designates the amount or intensity in which the modification is implemented within the user &# 39 ; s document . for example , natural color languages use additional words to describe color differences , and thus , the magnitude of the modification is specified in combination with the color selected . for example , phrases or words , such as โ€œ slightly less ,โ€ โ€œ a lot more ,โ€ โ€œ a little more ,โ€ โ€œ a smidgen more ,โ€ etc . can designate the intensity or amount in which the image modification is implemented . for example , if the user selects a shade of green , for example , under a first text - based category , and then selects โ€œ a lot more โ€ in another second category , then this designates to modify these particular shades of greens in the document with a higher intensity of green . the disclosure , however , is not limited to any specific phrase or words , in any particular language , and / or does not preclude mathematical phrases or symbols , or other designations for a language , and / or color samples and symbols . additionally , a direction for the modification is a resultant image modification , in which the modification should be made towards within the document . for example , the user may first select a particular shade of green within the user &# 39 ; s document for modification , and then , the user may select a magnitude or intensity ( e . g ., โ€œ a lot โ€) for the modification under a second category , and finally , the user selects the direction in which the color modification should occur , which is the resultant color for adjustment towards ( e . g ., blue ). a sentence is created that designates a complete and specific color modification to be implemented in the user &# 39 ; s document that would make greens a lot more blue , for example . consequently , the human readable sentence is representative of a natural language command for generating the particular image modification to be made to the document . for example , the sentence in the above example would read โ€œ a shade of green a lot more blue ,โ€ if blue was the direction selected for green colors within the document to be modified . fig1 illustrates one embodiment of an exemplary user interface system 100 for editing a user document . the system 100 comprises a processor 114 coupled to an image input device 116 . the device comprises any device capable of executing a set of logical instructions and can comprise , for example , a computer , a personal digital assistant ( fda ), digital camera , cell phone , printer , copier , or the like . such devices can include the user interface 100 , which may further comprise , but is not limited to , a key board , microphone , pointing device , display , speakers , audio / visual inputs / outputs network connections and / or other devices of the device 116 and / or processor 114 . the image input device 116 is configured to receive a document 112 for a color modification to be made by a user through the interface 100 . the image input device 116 comprises a memory 120 for storing the document 114 . a natural language control ( nlc ) system 118 executed via the processor 114 of the device 116 , which can map the colors and / or features of the document 112 to a working color space in order for modifications entered by the user to be affected therein . the nlc 118 will be discussed in further detail infra . a document can be provided by a user to an image processing system for processing images , such as a xerographic imaging system . the document may be any document , such a photo image , a text based document , or any document that may be printed , modified , and / or transferred in digital format , for example . a document may be any physical or digital representation of a body of information capable of being communicated to an output device for display , print , and / or alteration ( e . g ., a photo , or presentation document ). a user display 110 is coupled to the image input device and may be any display or multiple displays for viewing a graphical user interface or the user interface system 100 as an lui . stored within memory 120 are images that are graphic images for representing the user document 112 and / or a set of thumbnail images 122 included . in general , each thumbnail image comprises image data derived from the respective document . usually , the thumbnail image 122 contains less information than the original document , but not always . for example , each thumbnail image 122 may be a reduced resolution and / or cropped , digital image generated from the original document or processed original document . all of the thumbnails in the set may be the same size . in some embodiments , the image may be otherwise digitally modified in creating the thumbnail , for example by conversion from color to monochrome ( e . g ., a black and white thumbnail ). in other embodiments , a representative portion of the image is automatically selected as the thumbnail , avoiding the need for reducing resolution or resizing . indeed , the thumbnail can be any visual representation of the document which allows documents to be distinguished from each other in the set . in one embodiment , the thumbnail is a context - dependent image , as described , for example , in above - mentioned application ser . no . 12 / 049 , 520 incorporated herein by reference . in such an approach , the portion of the image selected as the thumbnail may be dependent on the context in which the image is to be used . for example , if the user is known to be interested primarily in faces , a region of the image can be identified with suitable face recognition software and used as a basis for determining a suitable crop area . the user display 110 comprises a first view 102 that displays an image 106 of the system 100 , which can be the actual document 112 , or a thumbnail image 122 . the thumbnail images 122 may be selected by a user for representation of the document 112 within the interface system 100 . for example , the first view 102 is a preview of the image 106 selected via preview controls 126 . a user may select a representative image similar to the document for color modification , for example . the first view 102 presents the image modifications in real time to the user as selections are entered . in addition , the modifications build upon one another , and thus , the effect of multiple modifications are displayed in the image 106 selected for the first view 102 . the user interface 100 further comprises a second view 126 in which a text - based interface 102 is presented . in one embodiment , the text - based interface 102 is displayed alongside the image 106 for observing the modifications concurrently with receiving inputted commands at the text - based interface 102 . the text - based interface 102 comprises categories for receiving input for an image modification thereat . the categories are text - based categories 108 , for example . each of the categories represents a number of selections to be displayed within . a user selects a selection from each category in order for a human readable sentence to be comprised for representing a natural language command of a particular image modification , such as , for example , a color modification . the text - based interface 102 of the interface system 100 comprises a first text - based category 134 , a second text - based category 136 , and a third text - based category 138 . the first text - based category 134 includes selections therein ( not shown ) for selecting which color to modify within the user &# 39 ; s document 110 . for example , green may be selected or any other color may be selected . the second text - based category 136 includes selections therein that represent a magnitude ( e . g ., intensity ) of the color modification . the third text - based category 138 includes selections for a resultant color or a direction for which the color modification is made . all three selections made within the first , second and third categories combine to form a human readable sentence effectuating a particular image modification . in one embodiment , each text - based category is presented in the form of a question . the first text - based category 108 is presented as an activated menu that is entitled with a question for eliciting a user &# 39 ; s input in a simple and easily conveyable manner . for example , the question illustrated in fig1 has a drop - down menu that inquires a user interacting with the interface the following : โ€œ what color to change ?โ€ a drop - down list is a user interface control gui element , similar to a list box , which allows the user to choose one value from a list . when a drop - down list is inactive , it displays a single value or a category title as illustrated . when activated , it displays ( drops down ) a list of values or selections , from which the user may select from . when the user selects a new value , the control can revert to its inactive state , displaying the selected value . the disclosure is not limited to any particular manner of drop - down list or the like . although one design actually places the list box below the box showing the single value or category title , many other user interface designs ( such as motif ) and aqua from mac os x place the list box so that the currently - selected item is at the location of the box , thus eliminating the need to move a pointer to pick the same value . this is sometimes called a โ€œ popup list โ€ or a โ€œ choice โ€ or โ€œ chooser โ€. a drop - down list differs from a combo box in that the entry portion of a drop - down list cannot be edited . many various designs may be appreciated by one of ordinary skill in the art . an advantage of a drop - down list vs . a list box or tabs is that only one option is visible at a time and the box can be presented in the form of a question to elicit a portion of a color modification from a user from a list of selections or options . in addition , drop - down lists use far less space due to their show / hide functionality . referring to fig2 , illustrates an exemplary embodiment of the user interface system 100 . the text - based category 108 in this example questions the user for a color to be modified that is previewed within the image 102 and effectuating the user &# 39 ; s document . a selected color 128 might be cyan , for example . selections 130 provide multiple color samples with descriptions thereat for a user to select from . selections 132 for certain shades or classes of colors are additionally provided . in addition , selections ( not shown ) representing colors of various image properties ( e . g ., hue , brightness , gloss , etc .) can also be provided . fig3 illustrates an exemplary embodiment of interface system 100 comprising human readable sentences 40 . for example , a sentence 42 is displayed in a window 50 , such as a scrollbar window , upon being compiled from the selections under the text - based categories 108 . each of the text - based categories comprises a portion of the sentence 42 . a color selection 160 , for example , comprises the portion of the sentence selecting the color to be modified , namely cyan . additionally , a magnitude selection 162 comprises a portion of the sentence indicating an intensity of โ€œ a lot more โ€ in which the color cyan should be adjusted . likewise , a resultant color selection 164 comprises a portion of the sentence indicating that cyan colors in the user &# 39 ; s document should be made a lot more zippy , for example . while zippy can be any color indicating a brownish - orange or a color known in the art comprising properties distinguishable from other color properties . each human readable sentence is presented for display to a user in the window 50 in an order in which each sentence affects the image modification in the image 106 . in one embodiment , the user is capable of altering the order of the human readable sentences 40 for various expressions to result in priority in which modifications are implemented within the user &# 39 ; s document . referring back to fig1 , a sorting engine 115 is configured to sort the human readable sentences 40 of fig3 corresponding to a respective modification . for example , the sentence 42 modifies cyan colors in the image 106 to make them a lot more zippy . the sentence 44 thereafter produces all yellow colors slightly more red . consequently , if zippy is meant to define a shade of yellow , then all cyan colors will be made a lot more yellow , and these regions within the color space of the document / image 106 , in addition to other regions that were yellow already will be made more red . in one embodiment , the user can specify a priority of the sentences , such as via a control feature 168 and 170 ( e . g ., an arrow button ) and / or delete a sentence at a delete 172 if the modification shown in the image 106 is not desirable . the arrows can move the sentences to provide a specified priority to each sentence , in which the modifications presented first , will be the first to be expressed within the image 106 . an example methodology 700 for implementing a user interface system for modifying colors of a document is illustrated in fig7 . while the method 700 is illustrated and described below as a series of acts or events , it will be appreciated that the illustrated ordering of such acts or events are not to be interpreted in a limiting sense . for example , some acts may occur in different orders and / or concurrently with other acts or events apart from those illustrated and / or described herein . in addition , not all illustrated acts may be required to implement one or more aspects or embodiments of the description herein . further , one or more of the acts depicted herein may be carried out in one or more separate acts and / or phases . at 702 a document is received from an image output device of a user interface system . the user interface system is configured to modify the document with imaging components using a natural language control system discussed in detail herein . at 704 an image modification is presented in real time within an image displayed in a first view of a display . concurrently , the image modification is received as input from a user . this input is provided to the user at 706 within a text - based interface that may be alongside the first display of real time modifications being presented . at 706 the text - based interface is presented with text - based categories corresponding to portions of a human readable sentence . in an exemplary embodiment , a first text - based category in the text - based interface provides various color selections for receiving a color to be modified in the document from the user . in addition , a second text - based category in the text - based interface provides selections for receiving a magnitude of the image modification or a resultant image modification . further , a third text - based category in the text - based interface provides selections that are different from the second text - based category for receiving the magnitude or the resultant image modification . for example , if the second text - based category provides selections for magnitude , the third text - based category can provide selections for the resultant image modification . at 708 more than one human readable sentence is displayed . the human readable sentences correspond to more than one image modification and may be displayed alongside the first view in a second view of the text based - interface to see modifications occur in the same display . at 710 the sentences are sorted from a specified ordering being received as input . the ordering has a corresponding priority in which the sentence can affect modifications in the order provided . sentences sorted with a higher priority in the specified ordering generate respective image modification in the image displayed first , before other modifications , and thus , can affect the image modification of subsequent sentences . the method illustrated in fig7 may be implemented in a computer program product that may be executed on a computer . the computer program product may be a tangible computer - readable recording medium on which a control program is recorded , such as a disk , hard drive , or may be a transmittable carrier wave in which the control program is embodied as a data signal . common forms of computer - readable media include , for example , floppy disks , flexible disks , hard disks , magnetic tape , or any other magnetic storage medium , cd - rom , dvd , or any other optical medium , a ram , a prom , an eprom , a flash - eprom , or other memory chip or cartridge , transmission media , such as acoustic or light waves , such as those generated during radio wave and infrared data communications , and the like , or any other medium from which a computer can read and use . the exemplary method may be implemented on one or more general purpose computers , special purpose computer ( s ), a programmed microprocessor or microcontroller and peripheral integrated circuit elements , an asic or other integrated circuit , a digital signal processor , a hardwired electronic or logic circuit such as a discrete element circuit , a programmable logic device such as a pld , pla , fpga , or pal , or the like . in general , any device , capable of implementing a finite state machine that is in turn capable of implementing the flowchart shown in fig7 , can be used to implement the method for editing images in a document . u . s . patent application ser . no . 11 / 479 , 484 and u . s . patent application ser . no . 11 / 762 , 155 are incorporated herein by reference in their entirety . portions have been reproduced below to provide detailed support in the present disclosure . a usable natural language control system could be created as described in the flowchart of fig4 . the acts are listed in a particular order in the flowchart . however , this order should not be considered limiting , as the order of many of these acts may be changed without affecting the resulting color control system . first , a natural language color description dictionary of terms would be created and / or chosen from a set of pre - existing dictionaries 400 . then a color space in which the transformations will be performed is chosen 410 . the regions of the color space are then mapped to terms in the color dictionary 420 . a dictionary of command terms also needs to be created or selected 430 . in embodiments , a library of basic transforms in the color space corresponding to various command terms would also be generated 440 . there would be a general mapping between particular transform forms and command forms . the details of a user command would be used to tailor a transform once it was selected from the library as described in more detail with respect to fig6 . in addition to generating a lexicon of command terms , a syntax for using the command terms from the command dictionary in combination with the color terms of the color dictionary would be chosen as well 150 . both of the command and color term dictionaries may simply be part of one big dictionary . fig5 illustrates an embodiment of a natural language color control and calibration system that a user would use to adjust an image or portion thereof . again , the acts are listed in a particular order in the flowchart . however , this order should not be considered limiting , as the order of many of these acts may be changed without affecting the resulting color control system . at 500 , the user would select a subject . the subject may be , for example , a scanned or created image or a set of input colors of a multi - dimensional lookup table . the subject may also be a portion of an image . for example , the user may be able to identify a quadrant of an image or a particular object in an image that the user would want to adjust . the natural language system included herein also encompasses the ability to mark areas of an image to be adjusted using a point and click system . at 610 , some or all of the selected subject would be mapped from the initial color space into the working color space of the color control system before or after the command is entered . the initial color space may be , for example , rgb on a display screen or cmyk on a printed document . for an image , for example , this may be a pixel - by - pixel mapping . however , many programs exist to reduce the time and processing power of such a mapping . for example , various algorithms use sampling techniques and / or allow a system to recognize uniform patches . the working color space could be any color encoding in which the color adjustment algorithms referenced in 530 are conveniently applied . in general , perceptually uniform , device independent color encodings are preferred as working spaces . the user also issues a verbal or written instruction to indicate the change required in the image at 520 . this command may be entered before or after the image or portion of the image is mapped into the working color space . the language used for this instruction could be the natural language of the user or it might be a language defined or limited by the application ; e . g ., the application may provide a user interface that could limit the language to a defined vocabulary or facilitate the parsing operation . at 530 , the program would translate the entered verbal or written instruction into a color transform in the color working space . the program would contain a set of rules or instructions for parsing the instruction and implementing a transformation to the image corresponding to the user &# 39 ; s command . the natural language command may be parsed to separate the command into components such as , for example , a target or resultant color range specification 540 , and a color modification specification 550 . the target color range specification would include the color or colors to be modified . the target color range specification may also specifically identify colors that are not to be modified . the image adjustment would then be applied only to those colors that are included in the color range specified to be adjusted . in 560 , an image mask would be created from the specified color range 540 and the image in the working color space . the image adjustment will therefore be applied only to those colors that are included in the mask . in embodiments , a particular color might be present in an area of overlapping regions of specified color ranges and therefore might be contained within two or more overlapping ranges . if the user were to enter verbal commands involving both these regions then the program make an internal logic decision based upon a set of preprogrammed rules . for example , the commands may be followed consecutively with the last command entered given priority over earlier commands . there are many methods , familiar to those of ordinary skill in the art , by which a mask can be created . one such method involves representing the specified color range as a subvolume of the working color space and then determining , for each pixel in the mapped image , if the color of the pixel is inside the specified color range subvolume . all such pixels inside the specified color range subvolume are in the mask while all pixels outside the specified color range subvolume are excluded from the mask . another method of creating the image mask is to associate with each color in the color name dictionary or dictionaries one or more prototypical locations ( points rather than subvolumes ) in the working color space . for each image pixel the nearest prototypical color name location is determined and those pixels with nearest prototypical locations associated with color names in the specified color range are included in the mask . pixels with a nearest prototypical location associated with color names not in the specified color range are excluded from the mask . while it is possible to map each individual pixel , algorithms exist to simplify such mappings . for example , various algorithms use sampling techniques and / or allow a system to recognize uniform patches . yet another alternative method to construct the mask is to construct a multidimensional lookup table , the input values of which sample the working color space . when the image pixel colors are mapped through this multi - dimensional lookup table the output values indicate whether the pixel are included in the mask or excluded from the mask . such an embodiment might result in output values between 0 and 1 where a value of 0 represents exclusion from the mask and a value of 1 represents inclusion in the mask . since multi - dimensional lookup tables generally use interpolation to determine output values the possibility of values between 0 and 1 exists . in such cases these fractional values could be retained , resulting in a fuzzy or blurred mask . in such a fuzzy or blurred mask pixels returning values between 0 and 1 would be considered to be partially included in the mask . pixels that are partially in the mask would undergo a partial image adjustment . alternatively , the output values might be rounded , or otherwise adjusted , to give only values of 0 or 1 , thereby generating a binary mask . other methods for mapping such input terms into the working color space include , for example , use of voronoi partitions , other tessellation methods , and k - d trees . a general example of such a method , suitable for both convex and non - convex regions , comprises tessellating each named region in the color space with tetrahedral simplices . testing whether a given color lies inside any of the tetrahedra comprising the region will determine whether the color lies within the region . in the case of convex regions of the color space simpler tests not requiring tessellation of the region can be used . in 600 , the natural language instruction is used to create a color adjustment transform . there are numerous methods by which such transforms could be constructed but in general all such methods will include the act of parsing the verbal color modification specification to determine 1 ) the magnitude of the desired modification , 2 ) the property that is to be modified and 3 ) the direction in which it is to be modified . these three pieces of information are a minimum requirement for any color adjustment transform . additional information might be required to more fully specify the required transform before it can be constructed . such additional information might be acquired from the pixels that are included in the mask . such pixel - related information might include color values and spatial locations . the values of individual pixels or population statistics might be used in transform construction . what follows is a general example of transform construction , using an example command or instruction language such as , for example , those discussed herein . the acts involved in this general example of transform construction are illustrated in fig6 . first , a verbal color modification specification is parsed 610 to obtain verbal specifications for the color property to be modified 620 , the magnitude of the color modification 630 , and the direction of the color modification 640 . the command , โ€œ make the red colors slightly less saturated โ€ is first parsed per into a target color range specification 540 ( the red colors ), and a color modification specification 550 ( slightly less saturated ), as noted earlier . then , at act 600 , the color modification specification is parsed into the color property to be modified 620 ( saturation ), the magnitude of the color modification 630 ( slightly ), and the direction of the color modification 640 ( less ). the verbal description of the color property to be modified is mapped to a numerical normalizing scale factor in step 650 . this act allows for the magnitude specifications to be normalized such that the verbal descriptions of magnitude ( 630 ) correspond to equivalent or very similar perceptual changes in the target color regardless of the property that is being modified and regardless of the color being modified . for this example , the magnitude of color change requested is โ€œ slight โ€ and this should lead to a perceptually similar โ€œ slight โ€ change in the target โ€œ red โ€ colors regardless of what perceptual property we are changing . perceptual properties can include , for example , saturation , lightness , darkness , colorfulness , chroma , hue , contrast , redness , greenness , yellowness , blueness , orange - ness , pink - ness , brown - ness , purple - ness , and grayness . additionally , one could modify any property that could be described as ( color - name )- ness by moving the selected colors in a direction toward the prototypical location of ( color - name ). e . g ., to increase the mauve - ness of a selection of colors move them toward the prototypical location of color name โ€˜ mauve โ€™. at 660 , the verbal magnitude of the color modification is mapped onto a numerical magnitude value . generally , and in the interests of common sense , words that signify a larger magnitude would be mapped onto larger numerical magnitude values , but this is not a requirement . it is desirable however that the numerical magnitude scale , onto which magnitude words are mapped , corresponds linearly to the perceived magnitude that an average population , with normal color vision , associates with the verbal magnitude word or phrase . perceptual changes in a property will likely depend in part upon the color being modified and upon its initial scaled value in that property . for example , what constitutes a slight lessening of the saturation of reds in an image would likely be different if there was a low saturation of red in the image , then if there was a high saturation of red . in embodiments , the magnitude of a โ€œ slight โ€ property change in the working color space would depend upon the context in which it was used . act 670 involves mapping the verbal direction to a numerical sign value (+ or โˆ’). this can be simply implemented by mapping the verbal direction to a multiplicative factor of + 1 for verbal indications that increase a property and โˆ’ 1 for verbal indications that decrease a property . the numerical values determined in 650 , 660 and 670 are used as parameters in a color adjustment transform . this occurs in 690 . generally a color adjustment transform will have some pre - determined functional form and the numerical values are applied to this functional form to control its specific effect on the colors . the choice of functional form of the color adjustment transform would be made in 680 . the choice might be arbitrarily made by the application designer or the functional form might be algorithmically determined by , for example , the values of the color property to be modified , the verbal magnitude of the color modification and the verbal direction of the color modification . the program implementing converting the natural language command into a transform in the color working space may have a library of basic forms to map to different sets of user instructions . based upon the natural language command entered by the user , the program selects a functional form from this library . for example , one functional form might be chosen for lightness modifications and a different form chosen for chroma modifications . in this case , the functional form to which the numerical values determined in s 650 , 660 and 670 are applied , would depend on the type of color property to be modified . as a trivial example of applying the numerical values to a functional form , consider the simple functional form of a linear mapping . such a mapping will have two parameters โ€” the slope of the line and an intercept . in this trivial example , the linear function would map the original value of the specified color property to a modified output value of that property . the slope of the line could be determined from the product of the values of the numerical normalizing scale factor , the numerical magnitude value and the numerical sign value . the intercept value of such a linear mapping would generally be zero , but might also be derived from the numerical magnitude value in special cases . more complex functional forms will generally require more parameters to define them . the numerical values determined in 650 , 660 and 670 would therefore be used to determine the values of the parameters . the numerical values may simply be assigned to the parameters , or parameters may be determined by some mathematical modification of combination of the numerical values . returning to fig5 , in 570 , a modified color image is created by applying the color modification transform and the image mask created in 680 and 560 respectively to the original image . finally , the modified color image is then converted back to the original color space in 580 . it will be appreciated that variants of the above - disclosed and other features and functions , or alternatives thereof , may be combined into many other different systems or applications . various presently unforeseen or unanticipated alternatives , modifications , variations or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims .
6
preferred embodiments of the invention will now be described with reference to the drawings . fig1 is a circuit diagram illustrating the construction of an intermediate frequency circuit for a television tuner according to a first embodiment of the invention , including a front part circuit . furthermore , fig2 is a plan view illustrating the disposition state of main components when the intermediate frequency circuit for the television tuner shown in fig1 is formed on a circuit board . in addition , even in this case , the same reference numerals as in the components shown in fig1 denote the same components of fig2 in the description below . as shown in fig1 , the intermediate frequency circuit 11 of the television tuner according to the first embodiment includes an intermediate frequency tuning circuit 1 in which two coils 1 ( 1 ) and 1 ( 2 ) connected in series are connected parallel to a capacitor 1 ( 3 ), a n โˆ’ 1 channel trap circuit 2 in which a coil 2 ( 1 ) is connected parallel to a capacitor 2 ( 2 ), an intermediate frequency signal amplifier 3 , an intermediate frequency signal resonance circuit 4 in which a coil 4 ( 1 ) and a capacitor 4 ( 2 ) are connected in series , a frequency converter 5 including a mixer circuit and a local oscillation circuit , a buffer resistor 6 , a bypass capacitor 7 , a coupling capacitor 8 , a bypass capacitor 9 , a shunt capacitor 10 , an input terminal 11 ( i ), an output terminal 11 ( o ), and a power supply terminal 11 ( b ). these components 1 to 10 are interconnected , as shown in fig1 . the circuit configuration is the same as the intermediate frequency circuit for a television tuner according to the related art shown in fig7 in appearance . furthermore , the front part circuit of the intermediate frequency circuit 11 of the television tuner includes a high frequency circuit 12 having a bandpass filter , a high frequency amplifier , a television signal select filter or the like , and a reception antenna 13 , both of which are connected , as shown in fig1 . this configuration of the front part circuit is the same as that of the intermediate frequency circuit for the television tuner according to the related art , shown in fig7 . furthermore , as shown in fig2 , in the disposition state of the respective components when the intermediate frequency circuit 11 of the television tuner according to the first embodiment is formed on the circuit board , an integrated circuit block 3 , 5 of the intermediate frequency signal amplifier 3 and the frequency converter 5 is disposed at the central region of the board . the integrated circuit block 3 , 5 has two mixer output terminals ( mix out ) and one intermediate frequency input terminal ( if in ) that are derived from one side of the block , and two intermediate frequency output terminals ( if out ) and one intermediate frequency input terminal ( if in ) that are derived from another side opposite to the one side . the two coils 1 ( 1 ) and 1 ( 2 ) are disposed in parallel along the one side of the integrated circuit block 3 , 5 . the coil 2 ( 1 ) is disposed along a side orthogonal to the one side . the coil 4 ( 1 ) is also cascaded to the coil 2 ( 1 ). furthermore , the two coils 1 ( 1 ) and 1 ( 2 ) each have one end connected to the capacitor 1 ( 3 ) therebetween and the other end directly connected to each other by a lead , thus forming the intermediate frequency tuning circuit 1 . the coil 2 ( 1 ) has both ends connected to the capacitor 2 ( 2 ) therebetween , thus forming the n โˆ’ 1 channel trap circuit 2 . the coil 4 ( 1 ) is connected to the capacitor 4 ( 2 ) in series , thus forming the intermediate frequency signal resonance circuit 4 . in addition , the respective components 6 to 10 are connected , as shown in fig2 , and the intermediate frequency circuit 11 of the television tuner is constructed . as described above , in the intermediate frequency circuit 11 of the television tuner shown in fig1 and 2 according to the first embodiment , the coil 2 ( 1 ) of the n โˆ’ 1 channel trap circuit 2 and the coil 4 ( 1 ) of the intermediate frequency signal resonance circuit 4 are coaxially cascaded to each other . in the integrated circuit block 3 , 5 , the one intermediate frequency input terminal ( if in ) and the two intermediate frequency output terminals ( if out ) are derived on the same side of the integrated circuit block 3 , 5 . due to this , some induction coupling is generated between the coil 2 ( 1 ) and coil 4 ( 1 ). capacitance coupling is also generated due to minute capacitance formed between one hot - side intermediate frequency input terminal and one hot - side intermediate frequency output terminal . some feedback is performed between the input and output of the intermediate frequency amplifier 3 due to the induction coupling and the capacitance coupling . in this case , fig3 a and 3b show characteristics obtained in the intermediate frequency circuit for the television tuner shown in fig1 and 2 according to the first embodiment . fig3 a shows a frequency characteristic and fig3 b shows a video frequency characteristic . as shown in fig3 a and 3b , in the intermediate frequency circuit for the television tuner , some feedback is carried out between the input and output of the intermediate frequency amplifier 3 . therefore , it can be seen from the frequency characteristic of fig3 a that there is a portion where a peak level is approximately identical to a picture ( p ) portion and the level of the picture ( p ) portion is the peak level . it can also be seen from the video frequency characteristic of fig3 b that a portion near 1 mhz , which rises from a reference level of 0 mhz , has been prevented , and a portion near 3 . 58 mhz , which abruptly declines , has been prevented , so that the video frequency characteristic is generally flat . thereafter , fig4 is a circuit diagram illustrating an intermediate frequency circuit for a television tuner according to a second embodiment of the invention , including a front part circuit . furthermore , fig5 is a plan view illustrating the disposition state of main components when the intermediate frequency circuit for the television tuner shown in fig4 is formed on a circuit board . in addition , even in this case , the same reference numerals as in the components shown in fig4 denote the same components of fig5 in the description below . the intermediate frequency circuit for the television tuner shown in fig1 according to the first embodiment ( hereinafter , referred to as โ€œ the former โ€) is different from the intermediate frequency circuit for the television tuner shown in fig4 according to the second embodiment ( hereinafter , referred to as โ€œ the latter โ€) in that in the latter , a feedback capacitor 14 is connected between the input and output of an intermediate frequency amplifier 3 , whereas in the former , the feedback capacitor 14 is not provided . there is no difference between the former and the latter in the components of the circuit including the front part circuit , except for the above element . for this reason , the same reference numerals as in the former will denote the same components of the latter and the description thereof will be omitted . furthermore , as shown in fig5 , in the disposition state of the respective components when the intermediate frequency circuit 11 of the television tuner according to the second embodiment is formed on the circuit board , an integrated circuit block 3 , 5 of the intermediate frequency signal amplifier 3 and a frequency converter 5 is disposed at the central region of the board . the integrated circuit block 3 , 5 has one intermediate frequency input terminal ( if in ) and one intermediate frequency output terminal ( if out ) that are derived from one side of the block , and two mixer output terminals ( mix out ) and one intermediate frequency input terminal ( if in ) that are derived from another side orthogonal to the one side . two coils 1 ( 1 ) and 2 ( 1 ) are disposed in parallel along one side of the integrated circuit block 3 , 5 . furthermore , the intermediate frequency circuit 11 of the television tuner according to the second embodiment uses a chip coil in each coil 1 ( 2 ) and coil 4 ( 1 ). the chip coil 1 ( 2 ) has one end connected to one mixer output terminal ( mix out ) of the integrated circuit block 3 , 5 , one end of a capacitor 1 ( 3 ) and one end of a coupling capacitor 8 , and the other end connected to the other end of the coil 1 ( 1 ). the chip coil 4 ( 1 ) has one end connected to one end of a capacitor 4 ( 2 ) and the other end connected to an output terminal 11 ( o ). the feedback capacitor 14 is connected between the hot - side intermediate frequency input terminal ( if in ) and the hot - side intermediate frequency output terminal ( if out ) of the integrated circuit block 3 , 5 . in this case , the capacitor 1 ( 3 ) is connected between both ends of the one coil 1 ( 1 ) and the one chip coil 1 ( 2 ) connected in series , thus forming the intermediate frequency tuning circuit 1 . the coil 2 ( 1 ) has both ends connected to a capacitor 2 ( 2 ), thus forming the n โˆ’ 1 channel trap circuit 2 . the coil 4 ( 1 ) is connected in series to a capacitor 4 ( 2 ), thus forming the intermediate frequency signal resonance circuit 4 . in addition , the respective components 6 to 10 are connected , as shown in fig5 , and the intermediate frequency circuit 11 of the television tuner is constructed . as described above , in the intermediate frequency circuit 11 of the television tuner shown in fig4 and 5 according to the second embodiment , one intermediate frequency input terminal ( if in ) and one intermediate frequency output terminal ( if out ) in the integrated circuit block 3 , 5 are derived on the same side of the integrated circuit block 3 , 5 . the feedback capacitor 14 is connected between the intermediate frequency input terminal and the intermediate frequency output terminal . capacitance coupling is generated due to minute capacitance generated between the hot - side intermediate frequency input terminal and the hot - side intermediate frequency output terminal , and the feedback capacitor 14 connected between them , and thus some feedback is carried out between the input and output of the intermediate frequency amplifier 3 . fig6 a and 6b show characteristics obtained in the intermediate frequency circuit for the television tuner shown in fig4 and 5 according to the second embodiment . fig6 a shows a frequency characteristic and fig6 b shows a video frequency characteristic . as shown in fig6 a and 6b , in the intermediate frequency circuit for the television tuner , some feedback is performed between the input and output of the intermediate frequency amplifier 3 . therefore , it can be seen from the frequency characteristic shown in fig6 a that there is a portion where a peak level is approximately identical to a picture ( p ) portion and the level of the picture ( p ) portion is the peak level . it can also be seen from the video frequency characteristic shown in fig6 b that a portion near 1 mhz , which rises from the reference level of 0 mhz , has been prevented , and a portion near 3 . 58 mhz , which abruptly declines , has been prevented , so that the video frequency characteristic is generally flat . as described above , according to the intermediate frequency circuit for the television tuner in accordance with the invention , some feedback is performed between the input and output of the intermediate frequency amplifier 3 . accordingly , a frequency characteristic and a video frequency characteristic can be improved and desired characteristics can be obtained through a simple circuit configuration . furthermore , as described above , according to an intermediate frequency circuit for a television tuner in accordance with the invention , the coupling state of components disposed between the input and output of an intermediate frequency amplifier on a circuit board is selected . a picture portion in a frequency characteristic of the intermediate frequency circuit is highlighted so that it is identical to the peak level . accordingly , there are effects in that a picture portion of a frequency characteristic can be enhanced and a video frequency characteristic can be relatively made flat .
7
embodiments of the present invention relate to providing a global network for instant transfer of funds between financial institutions that enables immediate , or โ€œ real - time โ€, funds transfers between financial institutions ( e . g ., banks ) regardless of whether the banks are in the same country or different countries . for brevity โ€œ bank โ€ has been used for the more general term โ€œ financial institution โ€ ( fi ) in the illustrative examples that follow , but no limitation of financial institutions only to banks is intended unless specifically stated . โ€œ instant โ€ means the payment transaction is not subjected to any waiting period ; the transactions are settled as soon as they are processed , comparable to real - time settlement systems such as rtgs . transactions conducted using the instant global funds transfer network according to one or more embodiments may be more economical for use by individuals than rtgs systems yet provide faster settlement than transactions that clear through swiftnet . for example , the rtgs system is suited for low - volume ( e . g ., less than a hundred per day per institution ), high - value ( e . g ., more than $ 10 , 000 ) transactions . rtgs systems are an alternative to systems of settling transactions at the end of the day , also known as net settlement systems , for example , automated clearing house ( ach ) or swiftnet . in a net settlement system , all the inter - institution transactions during the day are accumulated . at the end of the day , the accounts of the institutions are adjusted . a system according to one or more embodiments may be more convenient for users than a typical net settlement system . for example , transactions may be conducted on - line rather than the user having to walk up to a bank counter or teller window ; the funds recipient may receive funds right away so that the user &# 39 ; s transaction may be completed more quickly ; and errors may be detected and corrected right away instead of taking perhaps as long as a week to correct , as in some conventional systems , during which time neither the user nor the recipient may have use of the money . for banks or financial institutions , the faster service provided by an embodiment may allow the bank to charge more for the faster service than for a conventional net settlement system funds transfer . also , suitability for low - value funds transfers using an embodiment may lead to wider usage than that of rtgs , increasing volume of business for the bank providing the faster service . fig1 illustrates a system 100 , according to one embodiment , for facilitating financial transactions , e . g ., transactions involving money in any of its various forms supported by system 100 , in which a buyer 102 and seller 104 may wish to conduct a transaction 106 , which may include sending money from buyer 102 to seller 104 . buyer 102 may be able to use any of several different mechanisms for sending money from an account at a bank ( or other financial institution or financial service provider ), for example , of the buyer 102 to seller 104 for accomplishing transaction 106 . for example , buyer 102 may use an echeck 108 , an integrated electronic fund transfer ( ieft ) 110 , or a manual electronic funds transfer ( meft ) 112 to fund the transaction 106 . note that buyer and seller are used as an example , as any payer and payee may use features herein to effect instant money or fund transfers . using echeck 108 , buyer 102 may perform a credit / debit transaction that is similar to the use of a regular bank check , generally familiar to most people . like a regular bank check , an echeck 108 may be settled using the automated clearing house ( ach ) network and may generally take 3 to 5 business days to clear , e . g ., to be settled , meaning that the bank account of the recipient , also referred to as โ€œ creditor โ€, e . g ., seller 104 , has been credited ( recipient has full use of the money ) and the bank account of the payer , also referred to as โ€œ debtor โ€, e . g ., buyer 102 , has been debited ( payer no longer has use of the money ). with echeck 108 the money may be paid to seller 104 from an account of buyer 102 by direct debit , which is a method of ach collection in which the debtor , e . g ., buyer 102 , gives authorization to debit the account of buyer 102 upon the receipt of an entry issued by the creditor , e . g ., seller 104 . a financial service provider ( fsp ) 120 , such as paypal , inc . of san jose , calif ., may provide a service ( e . g ., acting as an intermediary between buyer 102 and seller 104 ) that insulates buyer 102 from seller 104 by allowing completion of transaction 106 through the fsp 120 via transaction 122 , between buyer 102 and fsp 120 , and transaction 124 , between seller 104 and fsp 120 , as shown in fig1 . for example , fsp 120 may provide an echeck 108 transaction in which buyer 102 sends money to fsp 120 , and fsp 120 may then send the money to seller 104 via using a transaction 124 between fsp 120 and seller 104 that is agreeable to both parties . in this way , information need only pass between seller 104 and fsp 120 without seller 104 needing to know any financial information about buyer 102 . using this echeck service , buyer 102 may give authorization to debit the account of buyer 102 upon the receipt of an entry issued by the fsp 120 . the authorization may be enabled , for example , by buyer 102 providing the fsp 120 with appropriate information about the bank and account of buyer 102 . returning to fig1 , using ieft 110 , buyer 102 may perform an integrated electronic fund transfer through the fsp 120 . to use the ieft service provided by fsp 120 , buyer 102 may or may not provide the fsp 120 with appropriate information about the bank and account of buyer 102 . using this ieft service , the buyer 102 may initiate the transaction 106 on a website of fsp 120 and the buyer 102 may be redirected to an on - line banking web page of the bank of buyer 102 , bank a . buyer 102 may log on to bank a at the on - line banking web page , and bank a may provide buyer 102 the capability to confirm the payment and the amount . once the buyer 102 confirms the payment and amount , the fsp 120 may receive instant payment verification , e . g ., the payment is approved , authorization is completed , and it may be guaranteed to fsp 120 to receive payment within , for example , 2 to 3 days . at that time , because the money is deemed safe , fsp 120 may make immediate payment to the seller 104 , e . g ., release the funds or credit the funds to the seller 104 . referring again to fig1 , using meft 112 , buyer 102 may perform a manual electronic funds transfer through the fsp 120 . to use the meft service provided by fsp 120 , buyer 102 may or may not provide the fsp 120 with appropriate information about the bank and account of buyer 102 . using this meft service , the buyer 102 may provide fsp 120 with funds to be kept with fsp 120 in a user account of buyer 102 . in effect , funds for the transaction 106 will be prepaid into an account with fsp 120 by the buyer 102 . having prepaid appropriate funds to fsp 120 ( e . g ., via transaction 122 ), buyer 102 may initiate the transaction 106 on a website of fsp 120 . fsp 120 may then send the money to seller 104 using an appropriate method for accomplishing transaction 124 . in this way , information need only pass between seller 104 and fsp 120 without seller 104 needing to know any financial information about buyer 102 . with meft , as with ieft , because the money is deemed safe , fsp 120 may make immediate payment to the seller 104 , e . g ., release the funds or credit the funds to the seller 104 . returning again to fig1 , seller 104 may have several options for receiving the money sent by buyer 102 in transaction 106 from fsp 120 and putting the money into a bank account of seller 104 . in one option , the seller 104 may maintain a seller account with fsp 120 . once the fsp 120 has provided the money from transaction 106 to the fsp seller account of seller 104 , seller 104 may then withdraw the money ( withdrawal 111 ) from the fsp seller account and , for example , deposit it with the bank of seller 104 , bank b . fsp 120 may provide financial services that allow instant fund transfers , e . g ., fund transfers in real time โ€” such as those accomplished by rtgs systems โ€” but adapted to low value transfers โ€” such as those accomplished by swiftnet or ach transfers . the instant fund transfers may , however , be provided more economically than by rtgs and more quickly than by swiftnet . some of the financial services are illustrated in fig1 as an instant top - up 114 , an instant account confirmation ( using withdrawals ) 115 , an instant direct debit 116 , and an instant funds out ( withdrawal ) 117 . fig2 illustrates a portion of system 100 for facilitating financial transactions according to one embodiment . financial service provider 120 may provide system 100 as a bank - to - bank fund transfer network to which bank a and bank b belong , enabling instant or real - time transfer transaction 106 between bank a and bank b . the network of system 100 may be global , and bank a and bank b may be in the same or different countries . transaction 106 may occur from a user ( e . g . buyer 102 or ultimate debtor ) of bank a and a user ( e . g ., seller 104 or ultimate creditor ) of bank b , and in the case that user 104 is identical to user 102 it may be understood that user 102 is thus able to transfer money between his or her own accounts at different banks using system 100 . bank a may offer interbank , instant funds transfers for banks in the network of system 100 as a product through on - line banking . a user ( e . g ., buyer 102 or ultimate debtor ) having an account at bank a may , for example , log on to an on - line banking web page of bank a , and choose the global instant funds transfer service . the buyer 102 may then be presented , for example , with a drop down list of banks in the network of system 100 to which a transfer can be made . upon the buyer 102 providing enough information ( e . g ., transfer amount , destination bank , destination account number , or seller 104 identification ), bank a may invoke an application programming interface ( api ) 151 to accomplish the transfer transaction 106 . api 151 , as well as apis 152 , 153 , and 154 , may be pre - defined such as iso 20022 โ€œ fitoficredittransfer โ€. api 151 may communicate with api 152 for performing transaction 122 . based on the information received by api 152 from bank a , api 152 may chain to api 153 to communicate with api 154 at bank b to perform transaction 124 so that transaction 106 between user 102 and user 104 may be completed . by chaining apis in this manner , fsp 120 may form the network of system 100 and enable instant global interbank funds transfer via the network of system 100 . as seen in fig2 , transfer transaction 106 may be completed in several steps or links through fsp 120 , which may be transparent to user 102 and user 104 as indicated by the dashed line representing transaction 106 in fig2 . in other words , user 102 may perceive that user 102 only needs to deal with bank a in order to accomplish the entire transaction 106 , without user 102 being aware of fsp 102 or partial transactions 122 and 124 . on the other hand , bank a may display , for example , on its on - line banking webpage that enables use of the funds transfer service , a trademark or logo of fsp 120 to indicate affiliation of the network of system 100 or the funds transfer service provided by bank a with fsp 120 . such information may be displayed by bank a for purposes of using the good will associated with the name of fsp 120 in encouraging trust of user 102 in system 100 and the funds transfer service provided by bank a . fig3 illustrates an example of various operations of system 100 for financial transactions . in system 100 , according to one or more embodiments , instant bank funds transfers can be made , on behalf of various users , between financial institutions , which in the example of fig3 are illustrated by banks bank a , bank b , and a partner bank 121 of fsp 120 . users may be different users of the same or different banks , for example , or the same user may wish to transfer funds between that user &# 39 ; s own accounts at different banks . as shown in fig3 , bank a may be a bilateral bank , meaning there is an established bilateral relationship between bank a and fsp partner bank 121 . fsp partner bank 121 may provide a hosting service for cash accounts , e . g ., business checking accounts , some of which are owned by banks in the system 100 , e . g ., bank a cash account 172 owned by bank a , and some of which are owned by fsp 120 , e . g ., fsp cash account 182 . for example , if a user of bank a wishes to transfer money to a user of bank b ( e . g ., transaction 106 shown in fig1 and 2 ), the bank a user may so instruct bank a and bank a may begin a transaction 171 for transfer of funds using api 161 and api 162 to move funds ( e . g ., transfer 185 ) from the user &# 39 ; s account at bank a to bank a โ€ฒ s cash account 172 at fsp partner bank 121 . fsp partner bank 121 may then make an internal transfer 181 of funds between bank a &# 39 ; s cash account 172 and fsp cash account 182 . fsp partner bank 121 may use cash accounts 172 , 174 , and 182 , by which multiple transactions โ€” such as transfers 181 , 183 , and 185 โ€” are netted to maintain an aggregate balance for each cash account . the financial institutions in system 100 , e . g ., bank a and fsp partner bank 121 , may use a due to - due from accounting model for operating the network of system 100 . due to - due from accounts ( as opposed , e . g ., to transfer accounts ) generally are similar to liability accounts in that they appear on the balance sheet of year - end statements and maintain a balance at the end of the year that is carried forward to the next year . this type of account is usually used for transferring money between companies . by way of contrast , transfer accounts generally are similar to expense accounts in that their balance is closed into the fund balance account at the end of the year and they appear on the income statement . this type of account is usually used for balancing transactions across funds . continuing the example ( e . g ., transaction 106 shown in fig1 and 2 ), subsequent to internal transfer 181 , the funds transfer from the user of bank a to the user of bank b ( which may be the same or a different user ) may be completed via internal transfer 183 to bank b &# 39 ; s cash account 174 and transfer 187 ( accomplished , e . g ., via transaction 173 ) to the account of the user of bank b at bank b . transaction 173 may be made using api 164 and api 163 . the overall transfer from the user of bank a to the user of bank b ( e . g ., transaction 106 shown in fig1 and 2 ) may be completed instantly because : 1 ) transfer 181 and transfer 183 are internal funds transfers of fsp partner bank 121 , 2 ) transfer 185 , occurring between bank a and its own cash account 172 with fsp partner bank 121 , may be accomplished by properly crediting and debiting the appropriate accounts via the use of api 161 , api 162 , and transaction 171 , and 3 ) transfer 187 may be accomplished , like transfer 185 , by properly crediting and debiting the appropriate accounts via the use of api 164 , api 163 , and transaction 173 , without actual movement of funds between bank b and its own cash account 174 at fsp partner bank 121 . to facilitate immediate settlement of transactions ( e . g ., transaction 106 shown in fig1 and 2 ), each financial institution ( e . g ., bank a and bank b ) and the fsp 120 may take steps to ensure that each cash account in the fsp partner bank 121 maintains a large enough balance for settlement of a few days of transactions on a total aggregate basis . for example , fsp 120 may make funds transfers 189 , and bank a and bank b may make funds transfers 185 and 187 respectively . thus , at the end of each day , fsp 120 may issue fund transfer instructions to fsp partner bank 121 ; for example : โ€œ today there is net $ 1 , 000 , 000 . 00 transaction payment amount from bank a cash account to fsp cash account hosted by fsp partner bank โ€. because both cash accounts are hosted by the same bank , e . g ., fsp partner bank 121 , the instruction is satisfied by an intrabank account loop transfer . an intrabank loop transfer is instant . for example , error reporting can take place immediately , e . g ., if any cash account has an insufficient balance . thus , transactions , such as funds transfer transaction 106 , may be settled immediately , e . g ., do not take a number of business days to clear as with a conventional transfer made using , for example , swiftnet or ach . system 100 may be scalable in the sense that a new bank ( or financial institution ) may integrated into the system in practicably short amount of time so that the system can grow by hundreds to thousands of new financial institutions within a moderate time horizon , for example , 100 new banks within a year rather than 1 year for each new bank . for example , integrating bank b into system 100 may require setting up bank b &# 39 ; s cash account 174 to be hosted by fsp partner bank 121 for facilitating intrabank loop transfers 183 . open apis , that is , apis defined by iso rather than the fsp 120 โ€” such as iso 20022 apis โ€œ fitoficredittransfer โ€ โ€” may be used so that not only the fsp 120 can implement and host appropriate apis , but the new financial institution , e . g ., bank b for this example , can also invoke and host the appropriate apis ; thus , api invocation is bi - directional . with such an approach , integration of a new bank , e . g ., bank b , may require only configuring pre - defined apis , e . g ., configuring api 163 and api 164 for performance of transactions 173 . configuring the open apis can save significant amount of product development time ( e . g . up to about one year in each case ) that would otherwise conventionally be required on the part of fsp 120 on a customized basis for each new financial institution . fig4 illustrates a method 400 for transferring funds instantly in a global financial network such as system 100 according to one embodiment . at step 401 , a user ( e . g ., buyer 102 ) may log in to the user &# 39 ; s account at a financial institution ( e . g ., bank a ) using , for example , on - line banking provided by bank a . for this example , the user may wish to move funds from an account with bank a to an account at bank b , so the transaction may be instant transfer of funds from the user &# 39 ; s ( e . g ., buyer 102 ) account with bank a to the account of a user ( e . g ., seller 104 ) at bank b . the user may choose the transaction to perform at the on - line banking web page of bank a and may provide additional choices and information โ€” such as selecting bank b from a drop down list of available banks that belong to the instant global funds transfer network of system 100 . a bank may be available , for example , if the bank has been integrated into instant global funds transfer network of system 100 by fsp 120 and the bank has a cash account hosted by fsp partner bank 121 , as shown in fig3 . at the end of the day , if the transaction is the only one for bank a , that may be the only fund transfer issued to fsp partner bank 121 in that case ; otherwise , several transactions may be netted against each other and an aggregate fund transfer issued to fsp partner bank 121 at the end of the day . on day 1 , in real - time , at step 402 , fsp 120 may receive the credit transfer api invocation from bank a to transfer $ 100 ( in this example , to illustrate that some specific amount of funds is chosen by the user , $ 100 is used as the chosen amount ) of the user &# 39 ; s ( e . g ., buyer 102 ) account balance to an account at bank b . because the api provides instant results , the money movement settlement is guaranteed , e . g ., reliance by fsp partner bank 121 on availability of funds in bank a cash account 172 is safe . using the information , fsp 120 may sequence the invocations of api 162 and api 164 to accomplish the complete transaction of transferring funds from bank a to bank b which may be described as chaining the transactions 171 and 173 or chaining the apis for transactions 171 and 173 . for example , fsp 120 having information from api 162 that transfer to bank b is requested , may invoke api 164 and provide requisite information for completing the transfer of funds from bank a to bank b . upon receipt of the instructions via the api , at step 403 , fsp partner bank 121 may use internal cash accounts ( e . g ., a general ledger account ) which is hosted inside the instant global funds transfer network of system 100 ( e . g ., hosted by fsp partner bank 121 ) to credit the $ 100 to the cash account 174 of bank b via transaction 181 and transaction 183 using , for example , intrabank loop transfers . bank b may then transfer the money from its own cash account 174 to the account of the bank b user ( e . g ., seller 104 ) at bank b using , for example , funds transfer 187 . thus , money may be credited to the bank b user &# 39 ; s account at bank b immediately ( because money movement settlement is guaranteed ) even though bank b may wait the standard 3 to 5 days for settlement . because bank b can credit the funds immediately to the user &# 39 ; s account with bank b , bank b may release the funds immediately for completion of a transaction desired by the user of bank a ( e . g ., buyer 102 ). for example , bank b may release funds immediately to seller 104 , who then may process the order of buyer 102 and proceed immediately , for example , to ship goods to buyer 102 . in implementation of the various embodiments , embodiments of the invention may comprise a personal computing device , such as a personal computer , laptop , pda , cellular phone or other personal computing or communication devices . the payment provider system may comprise a network computing device , such as a server or a plurality of servers , computers , or processors , combined to define a computer system or network to provide the payment services provided by a payment provider system . in this regard , a computer system may include a bus or other communication mechanism for communicating information , which interconnects subsystems and components , such as processing component ( e . g ., processor , micro - controller , digital signal processor ( dsp ), etc . ), system memory component ( e . g ., ram ), static storage component ( e . g ., rom ), disk drive component ( e . g ., magnetic or optical ), network interface component ( e . g ., modem or ethernet card ), display component ( e . g ., crt or lcd ), input component ( e . g ., keyboard or keypad ), and / or cursor control component ( e . g ., mouse or trackball ). in one embodiment , disk drive component may comprise a database having one or more disk drive components . the computer system may perform specific operations by processor and executing one or more sequences of one or more instructions contained in a system memory component . such instructions may be read into the system memory component from another computer readable medium , such as static storage component or disk drive component . in other embodiments , hard - wired circuitry may be used in place of or in combination with software instructions to implement the invention . logic may be encoded in a computer readable and executable medium , which may refer to any medium that participates in providing instructions to the processor for execution . such a medium may take many forms , including but not limited to , non - volatile media , volatile media , and transmission media . in one embodiment , the computer readable medium is non - transitory . in various implementations , non - volatile media includes optical or magnetic disks , such as disk drive component , volatile media includes dynamic memory , such as system memory component , and transmission media includes coaxial cables , copper wire , and fiber optics , including wires that comprise bus . in one example , transmission media may take the form of acoustic or light waves , such as those generated during radio wave and infrared data communications . some common forms of computer readable and executable media include , for example , floppy disk , flexible disk , hard disk , magnetic tape , any other magnetic medium , cd - rom , any other optical medium , punch cards , paper tape , any other physical medium with patterns of holes , ram , rom , eprom , flash - eprom , any other memory chip or cartridge , carrier wave , or any other medium from which a computer is adapted . in various embodiments , execution of instruction sequences for practicing the invention may be performed by a computer system . in various other embodiments , a plurality of computer systems coupled by communication link ( e . g ., lan , wlan , ptsn , or various other wired or wireless networks ) may perform instruction sequences to practice the invention in coordination with one another . computer system may transmit and receive messages , data , information and instructions , including one or more programs ( i . e ., application code ) through communication link and communication interface . received program code may be executed by processor as received and / or stored in disk drive component or some other non - volatile storage component for execution . where applicable , various embodiments provided by the present disclosure may be implemented using hardware , software , or combinations of hardware and software . also , where applicable , the various hardware components and / or software components set forth herein may be combined into composite components comprising software , hardware , and / or both without departing from the spirit of the present disclosure . where applicable , the various hardware components and / or software components set forth herein may be separated into sub - components comprising software , hardware , or both without departing from the scope of the present disclosure . in addition , where applicable , it is contemplated that software components may be implemented as hardware components and vice - versa . software , in accordance with the present disclosure , such as program code and / or data , may be stored on one or more computer readable and executable mediums . it is also contemplated that software identified herein may be implemented using one or more general purpose or specific purpose computers and / or computer systems , networked and / or otherwise . where applicable , the ordering of various steps described herein may be changed , combined into composite steps , and / or separated into sub - steps to provide features described herein . the foregoing disclosure is not intended to limit the present invention to the precise forms or particular fields of use disclosed . it is contemplated that various alternate embodiments and / or modifications to the present invention , whether explicitly described or implied herein , are possible in light of the disclosure . having thus described various example embodiments of the disclosure , persons of ordinary skill in the art will recognize that changes may be made in form and detail without departing from the scope of the invention . thus , the invention is limited only by the claims .
6
hereinafter , embodiments of the present invention will be described with reference to the accompanying drawings . fig1 to 5 are cross - sectional views of optical systems according to embodiments of the present invention , each corresponding to each of examples 1 to 5 . as the basic configurations of the examples shown in fig1 to 5 are identical and the illustration methods of fig1 to 5 are also identical , an optical system according to an embodiment of the present invention will be described hereinafter with reference mainly to fig1 . the optical system according to an embodiment of the present invention may be mounted , for example , on an imaging device and used as an imaging optical system for imaging a subject . further , the optical system according to an embodiment of the present invention may be mounted on a projection display device and used as a projection optical system for projecting on a screen image information displayed on a light valve . fig1 shows an example in which the optical system according to an embodiment of the present invention is mounted on a projection display device . in fig1 , the left side is the magnification side and the right side is the reduction side , and an optical member 2 a , assuming a prism and the like , an optical member 2 b , assuming various filters , a cover glass , and the like , and an image display surface 1 of a light valve are also illustrated . in the projection display device , a light beam with image information given by the image display surface 1 enters the optical system through the optical members 2 b and 2 a and is projected on a screen ( not shown ) disposed on the left side direction of the drawing by the optical system . fig1 illustrates only one image display surface 1 for the simplicity of the drawing , but the projection display device may be configured to display a full color image by separating a light beam from the light source into three primary colors by a color separation optical system and disposing three light valves , each for each primary color . the optical system of the present embodiment consists essentially of , in order from the magnification side , a first lens l 1 having a positive refractive power with a convex surface on the magnification side , a second lens l 2 having a negative refractive power , a third lens l 3 having a negative refractive power , a fourth lens l 4 having a positive refractive power , a fifth lens l 5 having a positive refractive power , and a sixth lens l 6 having a positive refractive power . fig1 shows an example in which an aperture stop st is disposed between the second lens l 2 and the third lens l 3 . note that the aperture stop st shown in fig1 does not necessarily represent the size or the shape but indicates the position on the optical axis z . assigning a positive refractive power to the first lens l 1 is advantageous for the correction of distortion and lateral chromatic aberration . forming the magnification side surface of the first lens l 1 in a convex surface is advantageous for the correction of spherical aberration . the first lens l 1 can be , for example , a positive meniscus lens with a convex surface on the magnification side . assigning a negative refractive power to the second lens l 2 causes a back focus of an appropriate length to be ensured easily . the second lens l 2 is preferably a meniscus lens with a concave surface on the reduction side and if that is the case , the generation amount of astigmatism may be suppressed . assigning a negative refractive power to the third lens l 3 is advantageous for the correction of spherical aberration and longitudinal chromatic aberration . the magnification side surface of the third lens l 3 is preferably a concave surface and if that is the case , spherical aberration is advantageously corrected . the third lens l 3 can be , for example , a biconcave lens . assigning positive refractive powers to the fourth lens l 4 , the fifth lens l 5 , and the sixth lens l 6 causes distortion and spherical aberration to be prevented easily from being aggravated , while maintaining telecentricity on the reduction side by allowing the positive refractive power to be shared by the three lenses . maintaining telecentricity on the reduction side allows the optical system to be suitably used for a projection display device having a cross prism , a total reflection prism , or the like disposed between the lens system and the image display surface 1 . the reduction side surface of the lens l 4 is preferably a convex surface and if that is the case , the generation amount of astigmatism may be suppressed . the fourth lens l 4 can be , for example , a positive meniscus lens with a convex surface on the reduction side . the reduction side surface of the fifth lens l 5 is preferably a convex surface and if that is the case , the generation amount of astigmatism may be suppressed . if the reduction side surface of the fourth lens l 4 and the reduction side surface of the fifth lens l 5 are both convex surfaces , the generation amount of astigmatism may further be suppressed in comparison with the case in which only either one of the surfaces is a convex surface . the fifth lens l 5 is preferably a biconvex lens and if that is the case , the generation amount of spherical aberration may be suppressed . the magnification side surface of the sixth lens l 6 is preferably a convex surface and if that is the case , the generation amount of spherical aberration may be suppressed . the sixth lens l 6 can be , for example , a biconvex lens . the optical system of the present embodiment may use an uncemented single lens for each of the first lens l 1 to the sixth lens l 6 . the use of single lenses may improve design flexibility in comparison with the case in which cemented lenses are used , which is advantageous for realizing a high resolution lens system . the optical system of the present embodiment preferably satisfies any one or any combination of the following conditional expressions ( 1 ) to ( 3 ): d2 : distance on the optical axis between the first lens and the second lens ฮฝd1 : abbe number of the first lens with reference to d - line ฮฝd2 : abbe number of the second lens with reference to d - line preventing the optical system from falling to or below the lower limit of the conditional expression ( 1 ) allows chromatic aberration and distortion to be corrected satisfactorily . preventing the optical system from exceeding the upper limit of the conditional expression ( 1 ) may result in that the overall length of the lens system is prevented from increasing excessively and the diameter of the first lens l 1 is prevented from increasing largely . for further enhancing the foregoing advantageous effects of the conditional expression ( 1 ), the optical system preferably satisfies a conditional expression ( 1 - 1 ) given below : preventing the optical system from falling to or below the lower limit of the conditional expression ( 2 ) allows longitudinal chromatic aberration to be corrected satisfactorily . preventing the optical system from exceeding the upper limit of the conditional expression ( 2 ) allows lateral chromatic aberration to be corrected satisfactorily . for further enhancing the foregoing advantageous effects of the conditional expression ( 2 ), the optical system preferably satisfies a conditional expression ( 2 - 1 ) given below : satisfying the conditional expression ( 3 ) allows lateral chromatic aberration and distortion to be corrected within an appropriate range . for further enhancing the foregoing advantageous effects of the conditional expression ( 3 ), the optical system preferably satisfies a conditional expression ( 3 - 1 ) given below : the foregoing preferable configurations may be combined arbitrarily and are preferably employed selectively , as appropriate , according to the matters required of the optical system . for example , an optical system with an f - number of 2 . 5 or less may be configured by appropriately employing the foregoing configurations . optical systems of two aspects will be given hereinafter as preferable configurations that appropriately employ the foregoing configurations . in the optical systems of the first and second aspects described below , the foregoing preferable configurations may be selectively employed , as appropriate . the optical system of the first aspect consists essentially of , in order from the magnification side , a first lens having a positive refractive power with a convex surface on the magnification side , a second lens having a negative refractive power , a third lens having a negative refractive power , a fourth lens having a positive refractive power , a fifth lens having a positive refractive power , and a sixth lens having a positive refractive power , and satisfies the foregoing conditional expressions ( 1 ) and ( 2 ). the optical system of the second aspect consists essentially of , in order from the magnification side , a first lens having a positive refractive power with a convex surface on the magnification side , a second lens having a negative refractive power , a third lens having a negative refractive power , a fourth lens having a positive refractive power , a fifth lens having a positive refractive power , and a sixth lens having a positive refractive power , and satisfies the foregoing conditional expressions ( 1 ) and ( 3 ). next , specific examples of the optical system of the present invention will be described . note that all the numerical data of the examples shown below are those normalized such that the focal length of the entire system is 1 . 000 and rounded at a predetermined digit . the configuration diagram of the optical system of example 1 is as shown in fig1 . lens data of the optical system of example 1 are shown in table 1 below . table 1 shows , within the frame , numerical values when the magnification side conjugate distance ( distance from the most magnification side surface to the screen ) is 8 . 7 . the si column in table 1 indicates i th surface number when a number i ( i = 1 , 2 , 3 , - - - ) is given to each surface of constituent elements in a serially increasing manner toward the reduction side with the magnification side surface of the most magnification side constituent element being taken as the first surface . the ri column indicates the radius of curvature of i th surface and the di column indicates the surface distance on the optical axis z between i th surface and ( i + 1 ) th surface . the ndj column indicates the refractive index of j th constituent element with respect to d - line ( wavelength of 587 . 6 nm ) when a number j ( j = 1 , 2 , 3 , - - - ) is given to each constituent element in a serially increasing manner toward the reduction side with the most magnification side constituent element being taken as the first element , and the ฮฝdj column indicates the abbe number of j th constituent element with reference to d - line . the sign of the radius of curvature is positive if the surface shape is convex on the magnification side and negative if it is convex on the reduction side . note that the aperture stop st and the optical members 2 a , 2 b are also included in the lens data , and the surface number column corresponding to the aperture stop st includes the word ( st ), as well as the surface number . the values at the bottom of the di column indicates the surface distance between the optical member 2 b and the image display surface 1 . table 1 shows , as specs with respect to d - line , focal length โ€œ f โ€ of the entire system , f - number โ€œ fno .โ€, and total angle of view 2ฯ‰ ( unit : degree ) at the bottom outside the frame . fig6 shows , in order from the left , respective aberration diagrams of spherical aberration , astigmatism , distortion , and lateral chromatic aberration of the optical system of example 1 when the magnification side conjugate distance is 8 . 7 . in fig6 , the spherical aberration diagram shows aberrations with respect to d - line ( wavelength 587 . 6 nm ), c - line ( wavelength 656 . 3 nm ), f - line ( wavelength 486 . 1 nm ), and g - line ( wavelength 435 . 8 nm ) by the solid line , the long - dashed line , the short - dashed line , and the gray solid line respectively . the astigmatism diagram shows aberrations with respect to d - line in the sagittal direction and the tangential direction by the solid line and the dotted line respectively . the distortion diagram shows distortion with respect to d - line by the solid line . the lateral chromatic aberration diagram shows aberrations with respect to c - line , f - line , and g - line by the long - dashed line , the short - dashed line and the gray solid line respectively . the โ€œ fno .โ€ in the spherical aberration diagram refers to f - number and โ€œ ฯ‰ โ€ in other aberration diagrams refers to half angle of view . the symbols in the various data and their meanings , illustration method , and the fact that numerical values within the frame of the lens data and each aberration diagram are those when the magnification side conjugate distance is 8 . 7 are also applied to the following examples unless otherwise specifically described and a duplicated explanation will be omitted in the following description . the configuration diagram of the optical system of example 2 is as shown in fig2 . lens data of the optical system of example 2 are shown in table 2 below . fig7 shows , in order from the left , respective aberration diagrams of spherical aberration , astigmatism , distortion , and lateral chromatic aberration of the optical system of example 2 . the configuration diagram of the optical system of example 3 is as shown in fig3 . lens data of the optical system of example 3 are shown in table 3 below . fig8 shows , in order from the left , respective aberration diagrams of spherical aberration , astigmatism , distortion , and lateral chromatic aberration of the optical system of example 3 . the configuration diagram of the optical system of example 4 is as shown in fig4 . lens data of the optical system of example 4 are shown in table 4 below . fig9 shows , in order from the left , respective aberration diagrams of spherical aberration , astigmatism , distortion , and lateral chromatic aberration of the optical system of example 4 . the configuration diagram of the optical system of example 5 is as shown in fig5 . lens data of the optical system of example 5 are shown in table 5 below . fig1 shows , in order from the left , respective aberration diagrams of spherical aberration , astigmatism , distortion , and lateral chromatic aberration of the optical system of example 5 . table 6 shows values corresponding to the conditional expressions ( 1 ) to ( 3 ) for examples 1 to 5 . note that the values shown in table 6 are those with reference to d - line . as can be seen from the foregoing data , each of the imaging lenses of examples 1 to 5 is a six - lens system configured compact , has a small f - number of 2 . 4 and a sufficient back focus to insert a prism and the like , and realizes high optical performance with well corrected aberrations . next , embodiments of an optical apparatus that uses the optical system of the present invention will be described with reference to fig1 , 12 , 13a , and 13b . fig1 is a schematic configuration diagram of a projection display apparatus according to a first embodiment of the optical apparatus of the present invention . the projection display apparatus 100 shown in fig1 includes a light source 101 , an illumination optical system 102 , a dmd 103 as a light valve , and a projection lens 104 which is an optical system according to an embodiment of the present invention . note that each constituent element described above is schematically illustrated . a light beam emitted from the light source 101 is selected in time series and converted to each of three primary color light beams ( r , g , b ) by a color wheel ( not shown ) and incident on the dmd 103 after being homogenized in light intensity distribution on a cross - section orthogonal to the optical axis z by the illumination optical system 102 . in response to a change in color of the incident light , modulation is switched to that color in the dmd 103 . the light optically modulated by the dmd 103 enters the projection lens 104 . the projection display apparatus 100 is configured such that the exit pupil position of the illumination optical system 102 substantially coincides with the entrance pupil position of the projection lens 104 ( corresponding to the reduction side pupil position of the projection lens 104 ). the projection lens 104 projects an optical image formed by the optically modulated light on the screen 105 . fig1 is a schematic configuration diagram of a projection display apparatus according to a second embodiment of the optical apparatus of the present invention . the projection display apparatus 200 shown in fig1 includes a projection lens 10 which is an optical system according to an embodiment of the present invention , a light source 20 , transmissive display elements 11 a to 11 c as light valves , each corresponding to each color light , dichroic mirrors 12 , 13 for color separation , a cross - dichroic prism 14 for color combining , condenser lenses 16 a to 16 c , and total reflection mirrors 18 a to 18 c for deflecting optical paths . note that the projection lens 10 is depicted schematically in fig1 . an integrator is disposed between the light source 20 and the dichroic mirror 12 , but it is omitted in fig1 . white light from the light source 20 is separated into three colored beams ( g light beam , b light beam , r light beam ) by the dichroic mirrors 12 , 13 . the three colored beams pass through the respective condenser lenses 16 a to 16 c and enter the transmissive display elements 11 a to 11 c corresponding to the respective colored beams and optically modulated . the optically modulated colored beams are color combined by the cross - dichroic mirror 14 and the color combined beam enters the projection lens 10 . the projection lens 10 projects an optical image formed by the light optically modulated by the transmissive display elements 11 a to 11 c on the screen 205 . fig1 a and 13b are external views of a camera 300 which is an imaging apparatus according to a third embodiment of the optical apparatus of the present invention . fig1 a is a perspective view of the camera 300 viewed from the front side and fig1 b is a perspective view of the camera 300 viewed from the rear side . the camera 300 is a single - lens digital camera without a reflex viewfinder on which an interchangeable lens 38 is removably mounted . the interchangeable lens 38 includes an imaging lens 39 , which is an optical system according to an embodiment of the present invention , housed in a lens barrel . the camera 300 has a camera body 31 and includes a shutter button 32 and a power button 33 on the upper surface of the camera body 31 . operation parts 34 and 35 , and a display 36 are provided on the rear surface of the camera body 31 . the display 36 is used to display a captured image or an image within the angle of view before being captured . the camera body 31 is provided with an imaging aperture in the front center from which light from an imaging target enters and a mount 37 is provided at the position corresponding to the imaging aperture , whereby the interchangeable lens 38 is mounted on the camera body 31 via the mount 37 . the camera body 31 includes inside thereof an image sensor , such as a charge coupled device ( ccd ) or the like , ( not shown ) that outputs an image signal according a subject image formed by the interchangeable lens 38 , a signal processing circuit that processes the image signal outputted from the image sensor and generates an image , a recording medium for recording the generated image , and the like . the camera 300 is capable of taking a still image or a motion picture when the shutter button 32 is pressed and the image data obtained by the imaging are recorded on the recording medium . so far , the present invention has been described by way of embodiments and examples , but the present invention is not limited to the foregoing embodiments and examples and various modifications may be made . for example , values of the radius of curvature of each lens , surface distance , refractive index , abbe number , and the like may be changed , as appropriate . further , the optical apparatus of the present invention is not limited to those of the foregoing configurations . for example , light valves and optical members used for beam splitting or beam combining are not limited to those having the foregoing configurations , and various modifications may be made . further , in the embodiments of the imaging apparatus , the description has been made of a case in which the optical system of the present invention is applied to a single - lens digital camera without a reflex viewfinder , but the optical system of the present invention may also be applied , for example , to single - lens reflex cameras , film cameras , video cameras , and the like .
6
further scope of applicability of the present invention will become apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . fig1 is a sectional view of a cutting and transport roller 1 , according to the invention . the cutting and transport roller 1 is cut along the plane , defined by the radial and angular coordinates of the roller . within the shell 3 of the cutting and transport roller 1 there is also the cutter 4 with the knives 9 , which in this presentation are reaching through the knife slit 6 . the material web 7 , which normally rests against the shell 3 and is being cut in this knife position , is not drawn for the sake of a better overview . the entire cutter 4 is housed in a box 2 , which in turn is attached to the inside of the shell 3 of the roller 1 . to permit a view of the interior of the box 2 of the cutter 4 in fig1 the vertical wall 40 b of the box of the cutter is broken open . in the illustrated embodiment , the cutter bar comprises in essence a t profile 10 . below the horizontal overhang of the t profile , a pressure cylinder 39 is attached to the floor 42 of the box 2 . the pressure cylinder 39 , which may be embodied as an origa ยฎ pressure cylinder was drawn as a square for reasons relating to the graphical presentation . the pressure cylinder 39 has a projecting portion or cone 41 , which reaches through the slit 43 in the horizontal overhang 11 of the t profile and moves the carriage 13 of the pull - thrust rod 14 during the cutting process . the cone 41 was drawn as a rectangle for reasons relating to the graphical presentation . usually the cutting and transport roller rotates during the cutting process around its main axis of symmetry 24 . in the rest of the description the invention is presented primarily with reference to the coordinate system of the cylinder of the cutting and transport roller that has already been sketched in fig1 . the details of the function of the cutter bar are sketched in fig2 . fig2 depicts the cutter bar 8 of the inventive cutter , which has already been shown in fig1 . for reasons relating to a better overview , the cutting and transport roller 1 , which contains the cutter , the entire holding mechanism of the cutter bar and the pressure cylinder are not shown . the base element of the cutter bar is a t profile 10 , to which various components are attached . a locking plate 12 is mounted on the horizontal overhang 11 of the t profile 10 . the carriage 13 of the pull and thrust rod 14 can slide with negligible clearance between the locking plate 12 and the horizontal overhang of the t profile , when it is driven by means of the cones 41 of the pressure cylinder 39 extending through the in the horizontal overhang 11 the cones 41 are not shown in fig2 . the pull and thrust rod 14 has boreholes 15 , through which the cones 16 reach . the cones 16 also reach through the oblong holes 17 of the knives 9 . the oblong holes are not visible in fig2 . the knives 9 can slide with negligible clearance in the space between the vertical overhang 18 of the t profile 10 and the guide plate 10 . in the illustrated embodiment of the invention , the knives 9 are provided with guide beads 20 , which can be made , for example , of teflon . the bolts 21 reach through the vertical overhang 18 of the t profile beam 10 , the guide plate 19 and the knives 9 and form the point of rotation for the knives 9 . the axis of rotation for the knives is labelled d in fig2 . during the cutting process the thrust and pull rod 14 is driven , as stated above , by the pressure cylinder 39 . however , the rotational motion of the knives required to carry out the cutting process can also be induced by any other suitable device which provides a force or directly generates a torque . this device can be , among other things , a pneumatic cylinder , an electric linear drive or an electric machine . during its linear motion the pull and thrust rod 14 moves the cones 16 , which reach through the oblong holes 17 of the knives 9 and transfer in this manner transfer the force to the knives 9 . thus , the knives 9 are put into rotational motion . the rotational or swivel motion of the knives 9 , depicted in this embodiment , sweeps an angle of significantly less than 360 degrees and may , as shown in the drawings , be less than 180 degrees . the swivel motion of an individual knife 9 is shown in more detail in the fig3 and 4 . fig3 is a drawing of a cutting motion of several knives of a cutter . in fig3 the oblong holes 17 n of the knives 9 n are also depicted . in this embodiment , the spacing an between the knives 9n is significantly less than the cutting lengths sn of the respective knives 9 n . the dashed line 22 indicates the position of the cutting surface 9 n at the end of the cutting process of the knife 9n . the bolts 21 n define the point of rotation of the knives 9 n . fig4 is a sketch , which shows in detail once again the cutting motion of a single knife 9 with the two cutting surfaces 9 a and 9 b . before the start of the cutting process , the knife is located in the resting position r 1 . in this position the knife 9 is depicted broken . during the cutting process the knife 9 rotates around the bolt 21 . at the start of the cutting process the knife exerts a force f 1 on the film , which in the radial direction ( r ) leads away from the main axis of symmetry of the cutting and transport roller . however , the material web 7 has not been completely severed during this period so that it contributes to the process of forcing the material web against the roller by maintaining the web tension and optionally by partially looping the film around the roller 1 . the effect of the force f 1 on the film is terminated , when the knife reaches the apex p s during the cutting process . after passing the apex p s , the knife 9 applies a force effect f 2 on the material web that supports the forcing of the material web against the roller 1 . at the end of the cutting process , the knife 9 has introduced a cut having a cut length s into the material web 7 . the knife remains in the second resting position r 2 . because the knife 9 has a second two cutting surfaces 9 a , 9 b , can , therefore , also cut when the cutting process is carried out in the opposite direction . at the end of the cutting process , the knife 9 has introduced a cut having a cut length s into the material web 7 . the knife remains in the second resting position r 2 . because the knife 9 has a second two cutting surfaces 9 a , 9 b , can , therefore , also cut when the cutting process is carried out in the opposite direction . in fig5 is a drawing of a cutting process , wherein a first group n of knives 9 n , 9 n - 1 a rotational motion with negative direction of rotation during the cutting process , whereas a second group of m of knives 9 m , 9 m + 1 , etc . makes a rotational motion with a positive direction of rotation . the knife 9 n sweeps an angle - alpha . the different cutting direction of the two groups of knives m and n is shown once again by means of the curved arrows 22 n and 22 m . in this manner the opposite rotational motion of the knife blades of the two groups n and m results in two forces , whose axial component f n and f m act in the opposite direction . owing to these measures the resulting total force f g , which acts on the film in the axial direction during the cutting process , is reduced . it is possible to coordinate in such a manner the cutting forces fn , fm , which belong to the two groups of knives n , m and which act in the axial direction such that the resulting total force f g which is exerted on the film in the axial direction , largely disappears . in the illustrated embodiment , the cut lengths of the knives are coordinated in such a manner that the result is a continuous cut over the entire width of the material web 7 . in coordinating the cutting motion of adjacent knives with the cutting motion of a different sense of rotation โ€” in fig5 this description applies to the knives 9 n and 9 m โ€” a collision of the two knives must also be avoided . to this end , it can be provided that the knife 9 m does not reach the overlap point o until the knife 9 n has already completed the cutting process and its entire width is located inside the radius of the film reel r f . fig5 also shows that it is possible with the aid of an individual force , which acts here in the axial direction to generate the opposite rotational motion of both groups of knives n and m . in the illustrated embodiment , the thrust and pull rod 14 reaches for this purpose with the cone 16 n underneath the point of rotation 21 n into the non - illustrated oblong holes 17 of the knives 9 n , 9 n โˆ’ 1 of the group n . in this embodiment the pull and thrust rod 14 is running in the axial direction , and thus parallel to the main axis of symmetry 24 of the roller . however , the knives of the groups n and m are made differently . thus , the bolts 21 n of the group n are located above the thrust and pull rod 14 whereas the bolts 21 m of the other group m are disposed below the rod 14 . with simple means of this kind the opposite motion of rotation of the two groups of knives n and m can be induced with a single force . mechanisms which realize the rotational motion of the two groups of knives with the aid of drive units , like an electric machine which provides immediately a torque instead of a force , can be provided with similar simple torque reversing mechanisms . in this manner the opposite motion of rotation of both groups of knives can be induced by one drive unit . the knives of both groups of knives can also be arranged less uniformly than depicted in the example . thus , an alternating arrangement of the knives from both groups n and m is also conceivable . fig6 shows another embodiment of the invention with a circular cutter , which has a disk shaped , essentially round knife 25 , which severs the film web 7 , so that the severed film web 34 can be seen to the left of the round knife 25 . the round knife 25 rotates around the axle 26 , which defines thus an axis of rotation 36 that runs perpendicular to the plane , which is defined by the axial ( r ) and radial ( r ) coordinates in the reference system of the roller . in this embodiment the rotational direction is shown by means of the curved arrow 38 . since the axis of rotation 36 extends beyond the drawing plane , it can be represented only as a point in fig6 . the torque for the rotational motion is provided by the drive unit 28 and transferred from the shaft 29 over the belt 27 to the axle 26 in the point of rotation 36 of the knife 25 . during the cutting process the entire circular cutter 35 executes a translation in the axial direction ( z ). in fig6 there is a motion in the direction , depicted by means of the straight arrow 37 . to this end , the circular cutter 35 is mounted on the carriage 30 , which slides on the rail 31 . the force for this linear motion is provided by the driving mechanism 32 , which transfers said force with the cone 33 to the carriage 30 . it must also be noted that the cutting process , shown in fig6 can begin in different ways . thus , the knife 25 can make contact with the material web 7 by means of a motion of the circular cutter 35 in the axial direction . this is possible especially when the width of the material web 7 is less than the maximum working width of the knife 25 , which is defined by the length of the travel path of the carriage 30 and the length of the knife slit 6 in the shell 3 of the roller 1 . however , it is also possible for the knife 25 to make contact with the material web 7 by moving in the radial direction at the start of the cutting process . to this end , the carriage 30 can exhibit , for example , a lifting device , which can move the circular cutter in the radial direction ( r ). in this respect it must be emphasized once again that it would be advantageous for all of the illustrated embodiments of the invention if the cutting motion were also supported with translatory components in the radial direction . to this end , a suitable lifting device can be provided in the radial direction below the cutter bar 8 . some of the claims below also disclose advantageous embodiments of devices and processes of this kind . fig7 is a drawing of several knives with exemplary shaped cutting blades , which further improve the cutting process . to this end , knives are used that exhibit special shapes of these knives directly at the contact point p k , where the knives 9 z and 9 z + 3 make contact with the material web 7 for the first time . thus , the knife 9 z has a semicircular recess 51 in the area of its cutting blade directly below the point p k . the presence of this semicircular recess 51 results in an angle x between the upper area of the cutting edge 50 of the knife 9 z and the edge 49 , which is less than 90 degrees . in this manner a force component is generated in the radial direction ( r ) during the cutting process of the knife 9 z , before the knife reaches the apex of the cutting motion p s , shown in fig4 . in any event with these measures the force effect of the knife on the web is changed in an advantageous manner . the knife 9 z + 3 consists of two parts 45 and 46 . the part 45 is wedge shaped and shaped in such a manner that between the cutting edge 48 and the edge 47 there is an angle delta , which is also less than 90 degrees . both the knife 9 z and the knife 9 z + 3 are only exemplary shapes of knives that have edges , whose angle is less than 90 degrees and which provide the aforementioned force effect during an early phase of the cutting process , in the immediate vicinity of the point p k . especially advantageous is the use of knives of the described type on the edge of the material web 7 , resting on the shell 3 . however , the use of knives of the described kind for severing the material web 7 over its entire width can also be advantageous . the invention being thus described , it will be apparent that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be recognized by one skilled in the art are intended to be included within the scope of the following claims .
8
in the following detailed description of exemplary embodiments of the invention , reference is made to the accompanied drawings , which form a part hereof , and which is shown by way of illustration , specific exemplary embodiments of which the invention may be practiced . each embodiment is described in sufficient detail to enable those skilled in the art to practice the invention , and it is to be understood that the embodiments may be utilized , and other changes may be made , without departing from the spirit or scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense and the scope of the present invention is defined only by the appended claims . in the following description , for the purpose of explanation , specific numbers , times , structures , protocols , and other parameters are set forth in order to provide a thorough understanding of the present invention . however , it will be apparent to anyone skilled in the art that the present invention may be practiced without these specific details . fig1 illustrates a system that supports the present invention , consisting of a controller ue 101 that controls a collaborative session , a normal ue 105 that participates in the session without the right of control , an application server 102 that coordinates the session among ues and the remote party , the ims core network 103 that provide ims signaling and routing functions for the session , and the remote party 104 that has the session with the ues . all ues , controller or controller , communicate to application server through standard ims procedure . in the invention , communication from controller to application server 110 has additional information beyond standard elements and includes user preference for session control ; and the communication from normal ue to application server 113 has additional information beyond standard elements and includes ue capacity parameters . only controller ue 101 is required to send control preference ; while other users 105 may choose to send or not send their capacity parameters . the user control preference from 101 may be sent at collaborative / interactive session setup or at ims registration . the control preference could be in any format that is understandable by the application server 102 . it is used to instruct the application server on how to perform control if the controller leaves with notice , and how to manage the session if controller lost connection without notice . ue capacity parameters could be sent in any format that is understandable by application server . it includes for example ue &# 39 ; s capacity of control , battery level , ims release version , etc . this additional information will be used by application server for decision making when controller leaves the session or loses the connection . in the present invention , application server 102 has additional capability of taking over session control based on control preferences and deciding control transfer to ues belonging to the session . however , application server 102 will never take over charge for the session . thus it will control the session representing controller in authorization but never representing the controller in charging . charging is required to be assigned to ue ( s ). connection between application server and ims cn 111 and connection between ims cn and remote party 112 make use of standard ims procedures and carry standard information defined in ims . fig2 , is a communication device with control capability . it can serve as the controller of a session . besides traditional functions of user equipment , it also contains gui block 201 for preference generating interaction ; a user preference generator 202 connected to gui ; a user preference transmission function 204 that sends the preference through transmission layer functions 205 if it is the controller of the session ; a passive control function 203 that can initiate signals requesting to change to passive control mode . the preference contains one or more lists . these lists are used to designate the successor controller if current controller lost connection ; to provide rules on how to choose its successor ; to set limitation on media management ; and to set trigger point for session release . for example , the use may indicate in preference that โ€œ session termination : 10 min โ€. then if it leaves , the session will be released after 10 min from his left . another example may contain media management rules like โ€œ add media : reject ; modify media : agree โ€. when controller leaves with this preference , application server will reject all add - media requests from controllers and agree all modify - media requests . another new function for the terminal is to send request to application server for changing itself to passive control mode . during passive control , normal decisions like media resolution modification etc are automatically made by application server through preference control rules set at the beginning of a session or ims registration , or updated using any ims procedures . to generate user preference , user preference generator 202 prepares questions and queries to user through gui 201 . user &# 39 ; s answer of the question is stored and processed at user preference generator 202 , from where a preference file is generated in the format that is understandable by application server 102 . it is obvious to anyone skilled in the art that this preference file also can be loaded into the terminal via different means , e . g . a storage card , download via internet , transferred via bluetooth from another terminal , etc . when a terminal registers as a controller , user preference transmission function 204 is triggered to send the preference out . the preference is targeted at solving the control handover problem in case the controller loses connection . the preference can also contain a set of rules to perform automatic control when controller intentionally changes to passive - control mode . for terminals that are not a controller , user preference generator 202 can skip the procedure of generating a user preference during registration . it is obvious to anyone skilled in the art that the preference can be generated later at any time , before the terminal becomes the controller . additionally , the preference can be updated during the session when changes happened to the session . fig3 illustrated an example structure for application server 102 that manages the collaborative session . new functionalities are introduced to the application server . it contains preference receive function 301 that filters the control preference from other register information ; preference process function 303 that analyzes the received control preference ; controller loss detection function 302 that periodically checks the availability of controller ; control transfer decision function 304 that decides the control ( and / or charge ) transfer in case of controller not involved , based on default rules stored in application server or control preferences passed from preference process function 303 ; passive control function 305 conducts control when controller changes to passive - control mode or session release procedure is activated after controller &# 39 ; s lost . in cases when application server does not have capacity parameters of other ues in the session , it needs to query ue on such information for decision . ue query function 306 is to fulfill this purpose . after obtaining enough information , control transfer decision function 304 decides to perform control transfer or release the session . if control needs to be taken over by application server , it will activate passive control function 305 to conduct control based on user preferences . with these function , application server acts as an intelligent agent that can save the session by selecting and transferring control to another ue or even take over control itself when controller is lost or left . preference process function 303 is responsible to explain and classify the control preferences written in any format agreed between terminal and application server . for example , the preference may be written with xml and it indicates that the controller successor can only be selected under the same subscription . after processing , this preference is passed to control transfer decision function 304 . when control loss detection function 302 detects a controller loss , through a timer or other bearer monitors , the control transfer decision function 304 will only consider those terminals under the same subscription as previous controller to be the successive controller . if no terminal ue is of the same subscription as the lost controller , application server should treat it as no preference case . other operation sequences of the present invention for that case can be utilized to handle it . fig4 illustrates an example architecture for a terminal device 400 that is a normal communication device with or without control capability . it acts as controller or controller in the collaborative session , but it is not the target controller which will lose connection or changes to passive control mode . besides traditional functions of normal user equipment , it also contains additional function block that can process and response the query from application server 102 . in this invention , application server may query terminals for their control capability and willingness to take over the control and charge . query receive function 401 and query process function 402 are used to receive such messages and process them . the processed query will be passed to query response function 403 to generate response back to the application server 102 . ue configuration / status record function 404 serves like a database . it provides the parameters and status of the ue and assists query response function 403 to generate the response to application server . if the query cannot be understood by the query process function 402 , query response function 403 would generate a response to application server 102 indicating that it received an unknown query . all signaling messages exchanged among 200 , 300 , 400 can be transported over normal ims mechanism , e . g . via tcp channel or udp channel with retransmission mechanism . user preferences are sent together with sip signal during ims registration or in a separate packet during collaborative session establishment , or when a ue becomes a controller ue . user decides how many preferences to generate through gui on terminal device 200 . all generated preferences will be sent to application server 300 from a controller ue . fig5 is the flowchart of example logic for the application server 102 , which is a major management and decision making device . solutions for controller loss or passive control problems are summarized in this flowchart . the diagram consists of major two branches . one is the situation that application server needs to take over the control . the other is application server does not need to take over the control . the second case is further divided into two braches . one is that controller preference is available and feasible to make decision . the other is preference is not available or exist preference cannot be applied due to confliction with current situation . when application server 102 detected a controller loss or receives a signal indicating a controller changes to passive - control mode , it perform step 502 to check whether a corresponding user preference is available . in case where preference is available , it continues to step 503 and checks whether it needs to take over the control . there are two situations where application server 102 needs to take over control . one situation is controller changes to passive - control mode and requests application server to answer control related questions instead of processing it on controller . the other situation is that controller lost connection without notice , and according to pre - set preference , the application server 102 is responsible to handle the session , e . g . release it after some trigger , select a different controller and transfer the control over , etc . in case that application server does not need to take over control , it will further go to step 505 to check current session status parameters . step 506 is a checking procedure that matches user preference with current session status . current session status includes all information related to the current session . for example , the id of ue involved in the session , the subscription of each ue , the number of media terminate at each ue , etc . matching preference with session status is to compare the string or value from two parts . for example , if preference indicates tom is the successor , tom will be translated to tom &# 39 ; s ue &# 39 ; s id by function 303 and step 506 will compare this id with all participated ue ids in the session . if preference indicates the ue that has maximum number of media flows taking over the control , step 506 will check if there is a ue that possesses maximum number of media flows . if ue satisfying the preference criteria exists in the session , it is said that current session status matches the user preference . if current session status mismatches with user preference , the decision making procedure will be directed to step 511 , which is a branch where no preference is available . an example of mismatch is as following : user preference indicates john will be the successor of current controller . however , when controller is lost , john already left the session . this example can be avoided if application server can send a trigger to controller ue to update its control preference whenever something changes in the session . however , without such kind of triggers , mismatch may happen . if no mismatch happens between current session status and user preference , in step 507 a successor is decided and selected successor is asked in step 508 whether it accepts to be a new controller . if the selected terminal ( successor ) is capable of control and agreed to take over , the control is transferred to it ; while if it rejected the offer or not capable of performing the control , other operations will be taken in step 510 , e . g . release the session . the selection - query - response procedure may be repeated before session release if multiple terminals satisfy the user preference criteria . when controller is lost without preference , application server 102 can neither decide to transfer control nor take over control . it can only try to save the affected session at step 512 by checking whether affected users are willing to take over the charge of his media flow ( s ). if yes , charge will be transferred to affected user in step 513 ; while if no , both control and media will be released in step 510 . note that if affected user is the last ue in the collaborative session , there will be no collaborative session anymore after charge transfer , the affected user changes to a normal ims session , continuing his media flow with remote party 104 . fig6 illustrates the structure of preferences . six sets of rules are presented based on solutions in this patent . list of priority of successive controllers 551 is a set of rules that designate successive controllers using exclusive identities like subscription information 562 , user name 563 , ue identification number 561 , etc . it also specifies the priority of these potential successors so that application server knows who to choose first when controller is lost . for example , the preference indicates the successor sequence is tom - marry - john . then application server will ask tom first to take over control in case of controller loss . if tom rejects the request , marry will be asked . such a preference will be updated whenever ues join or leave the session . if controller does not want to explicitly designate its successors , successive controller selection rules 552 may be used to set criteria for application server to select the successor . for example , successors are selected according to the sequence of controllers join the session 568 . the application server will record the join sequence of controllers and select based on it . another criterion is ue capacity 571 , ue capacity includes ue &# 39 ; s ability to control , ue &# 39 ; s battery level , ue &# 39 ; s signal stability , etc . rule 559 set the criteria of choosing successive controller to be the same subscription . in this case , application server may refer to default rule 590 to choose successive controller within those ues under the same subscription as lost controller . termination rules 553 is a rule set that determines trigger events to terminate a session after loss of controller . it may set a time out 575 for the current session ; it may limit the bytes consumed by controllers 576 ; it may terminate only certain type of media 577 ( e . g . video flows 596 ); it may set maximum amount of money chargeable 578 after the controller is lost . media management rules 554 are specially used for passive control mode . application server could make control decision based on these rules representing the controller . charge transfer rules 555 decide whether transfer charge together with control or separate from it . if separating from control transfer , the preference will give explicit rules 597 to specify who to transfer the charge . these rules may be similar to rules of successive controller selection but they need to be executed separately from control transfer when controller is lost . default rules 556 are stored at application server and serve as backup rules when controller preference does not give a specific candidate for control / charge transfer or when controller preference does not give a specific answer for a controller request . for example , a controller preference only specifies that successive controller should be selected within ues under the same subscription 559 . then application server will use default rule 590 to choose a unique candidate . another example is that controller request to change one component of a media flow but controller did not give rules for this request in media management rules 554 before changing to passive control mode . in this case application server will use default rule 591 to reject the request representing the controller . fig7 illustrates an example operation sequence of the presented solution . it illustrates the solution when controller changes to passive control mode . this solution contains controller 601 , controller 602 , application server 603 , and remote party 604 . in step 610 , a collaborative session is established with preferences . application server 603 processes the preference as in step 611 . when controller 601 requests to add media to controller at step 612 , application server accepts the request and performs the media adding at step 613 . after these steps , a collaborative session is activated with control from controller ( 614 ) and media flow between controller and remote party ( 615 ). then controller requests to change to passive control mode at step 616 . application server returns an acknowledgement and loads user preference on step 617 . after successful loading the preference , the collaborative session changes to passive control mode ( step 621 ). under passive control mode , if any request comes from the controller ( 619 ), application server 603 will look up for control rules in preference ( 620 ), make decision and perform the decision ( 621 ). after a while , controller 601 can request to change back to active control mode ( 623 ). at the point of receiving this message , application server needs to deactivate its passive control function 605 and return to normal mode ( 625 ). fig8 illustrates another operation sequence of the present solution . it illustrates the solution where controller set criteria on terminating the session upon his lost . this solution contains controller 651 , controller 652 , application server 653 , and remote party 654 . at the beginning of the session , preference is sent and processed at application server in steps 660 to 661 . this preference does not contain rules to select a successive controller , but it contains the criteria about when to terminate the session if controller is lost . for example , it specifies a timer that should start from the detection of it lost . when the timer expires , the whole session is torn down . in step 663 , the application server ( 653 ) detects controller loss , and it will automatically start session termination control by passive control function 305 . the application server may send a signal to affected controller ( s ) to inform them their session will be terminated after some time , as in step 665 . this signal will help controller to complete the most important conversation before their session is forcefully released . when termination event happened as preference indicated ( 666 ), the whole session is terminated in step 667 and 668 . fig9 illustrates another operation sequence of the present invention where the controller nominates its successor or set criteria on how to select it successor if it lost connection . this solution contains controller 701 , ue - 1 702 and ue - 2 703 , application server 704 , and remote party 705 . ue - 1 and ue - 2 may be other controller ( s ) in the session , or they may be controller ( s ). in this solution , application server obtains preference after steps 710 and 711 . when the application server ( 704 ) detects a controller loss as in step 712 , it loads preference as in step 713 and matches the designated successor or successor selection criteria with current status in step 714 . the selected ue will be queried on his willingness to take over the control as in step 715 . if selected ue accepts the request , control is transferred to this ue as in step 720 . if selected ue rejects the request , actions will be taken . for example in step 730 , the whole session will be released . fig1 illustrates yet another operation sequence of the present solution where no preference is set during ims registration or collaborative session establishment . this solution contains controller 751 , ue - 1 752 and ue - 2 753 , application server 754 , and remote party 755 . ue - 1 and ue - 2 may be other controller ( s ) in the session , or they may be controller ( s ). in this solution , when the application server ( 754 ) detects a controller loss , no preference is provided in step 760 . to save the on - going media flows , the application server broadcast requests to ues with control capacity at step 762 querying their willingness to take over the control . the first ue accepted the request ( as in step 763 ) will be selected as new controller . if nobody wants to take over the control , the session will be released after certain time . fig1 illustrate another operation of the solution when there is no preference set by controller before the session . it focuses on the terminal that affected by the loss of a controller . this solution contains controller - 1 801 , controller - 2 802 , ue 803 , application server 804 , and remote party 805 . controller - 1 controls media - a and it is the controller that going to be lost , while controller - 2 is another controller in the session controls different media ( media - b ). ue 803 is a controller that has media - a with remote party 805 . when application server ( 804 ) detects controller - 1 801 is lost , it sends query 814 to affected ue 803 for charge transfer since media - a terminates at ue 803 . if ue 803 accepts the transfer , steps in 820 are conducted and he will continue the media with remote party 805 . if ue 803 rejects the charge transfer , media flow may be cut as steps in 830 . the media - b controlled by controller - 2 802 will not be influenced .
7
with reference now to the figures , and in particular with reference to fig1 , a schematic diagram of a data processing system in accordance with an embodiment of the present invention is depicted . data processing system 100 may be a symmetric multiprocessor ( smp ) system including a plurality of processors 102 and 104 connected to system bus 106 . alternatively , a single processor system may be employed . also connected to system bus 106 is memory controller / cache 108 , which provides an interface to local memory 109 . i / o bus bridge 110 is connected to system bus 106 and provides an interface to i / o bus 112 . memory controller / cache 108 and i / o bus bridge 110 may be integrated as depicted . peripheral component interconnect ( pci ) bus bridge 114 connected to i / o bus 112 provides an interface to pci local bus 116 . a number of modems 118 - 120 may be connected to pci bus 116 . typical pci bus implementations will support four pci expansion slots or add - in connectors . communications links to network computers may be provided through modem 118 and network adapter 120 connected to pci local bus 116 through add - in boards . additional pci bus bridges 122 and 124 provide interfaces for additional pci buses 126 and 128 , from which additional modems or network adapters may be supported . in this manner , system 100 allows connections to multiple network computers . a memory mapped graphics adapter 130 and hard disk 132 may also be connected to i / o bus 112 as depicted , either directly or indirectly . those of ordinary skill in the art will appreciate that the hardware depicted in fig1 may vary . for example , other peripheral devices , such as optical disk drive and the like also may be used in addition or in place of the hardware depicted . the depicted example is not meant to imply architectural limitations with respect to the present invention . the data processing system depicted in fig1 may be , for example , an ibm risc / system 6000 system , a product of international business machines corporation in armonk , n . y ., running the advanced interactive executive ( aix ) operating system . processors 102 and 104 , for example , each provide an implementation of the data address break register support service . with reference now to fig2 , a block diagram of a typical layout of instructions as executed by the data processing system of fig1 is shown in accordance with illustrative embodiments . instruction 200 is an example of โ€œ load word and zero โ€ instruction showing a typical arrangement of fields . fields 204 , 206 , 208 and 210 correspond to the operation code ( opcode ), first register , second register , and displacement / remainder of the instruction , respectively . field 204 represents the operation code , or instruction type , of the specific instruction and may be indicative of particular interest , in illustrative embodiments , such as a load or store operation . field 206 representing a first register indicates where the data value of the instruction is to be stored , the โ€œ store to โ€ location as in instruction 200 or the โ€œ data value โ€ to be stored as in โ€œ store word โ€ instruction 202 . similarly , field 208 representing a second register of the instruction may also have a different meaning depending upon the operation code of the specific instruction . for example in instruction 200 , second register field 208 contains the โ€œ load from โ€ address to be used to perform the load operation . field 210 contains the displacement or offset from the address found in second register field 208 and other information of no particular interest in this example . in instruction 202 , field 208 of the second register contains the โ€œ to address โ€ indicating the target location into which the data is to be stored . further , field 210 of instruction 202 contains a displacement or offset from the โ€œ to address โ€ indicating the desired target storage location . examining these instructions would allow one to determine , in the event of a store operation , what data would be stored and at which location . both of these pieces of information may prove useful when performing problem determination or application flow verification and debugging operations . performance of a trace and debug process may be further improved through use of a trap in the form of a trap handler within the traced process that is given control , rather than the debugger , when a hardware exception is generated . the trap handler may also be given context data allowing the trap handler to monitor the conditional data watchpoint and determine what action to take when the conditional data watchpoint condition is met . in a preferred embodiment , instructions that execute and store to a memory location would have โ€œ trap - before โ€ semantics . โ€œ trap before โ€ allows the processor to generate a hardware - based exception for the data watchpoint before the instruction performing the store type operation completes execution . the trap handler provides the capability to examine and evaluate components of the specific instruction causing the conditional data watchpoint exception . the trap handler logic comprises a comparator for comparing the instruction component values with those of user provided predetermined values . for example the opcode component of the specific instruction would be compared to the predetermined store type opcode and a determination made regarding a choice of actions . further context data related to the instruction may be factored into the determination as well . referring now to fig3 , is a flowchart of a data address break exception handling process shown in accordance with illustrative embodiments . the data address break exception handling is a combination of the existing hardware support of the data address break register with additional logic provided to support the use of the trap handler . the enhanced support of the new process enables selective entry into the debug environment while tracing a set of instructions in a program flow . enabling selective entry reduces the overhead of invoking the debug environment unless actually needed . the data value of interest triggers only one call to the debugger after each change in the data value is examined by the trap handler of the traced process , thereby ensuring efficient debugging . the selective enablement is determined by examination of the current instruction that caused the watchpoint exception to occur , before completion of the current instruction execution , and the data value in the register . using a combination of hardware and software one is then able to more accurately detect when a predetermined condition requiring the debug environment has been met . if the specific condition has not been met , tracing may continue without the unnecessary overhead of invoking the debug environment . process 300 begins as the data address break register , a specialized hardware feature as is known , is initialized with the desired data address value , establishing the conditional data watchpoint , to be monitored by the hardware , for example , of processors 102 and 104 of data processing system 100 shown in fig1 ( step 302 ). the desired conditional data watchpoint is monitored by the processor hardware ( step 304 ) wherein process 300 determines a conditional data watchpoint match and therefore causing an exception to be generated ( step 306 ). if an exception is generated (โ€œ yes โ€ at step 306 ), process 300 continues with invocation of the trap handler ( step 308 ). if no exception is generated (โ€œ no โ€ at step 306 ), process 300 reverts to step 304 . the trap handler analyzes the current instruction before the current instruction execution completes and determines if the instruction opcode component is representative of the store type operation of interest ( step 310 ). depending upon the specific opcode component value , the content of first register component may represent the data to be stored into the watched location while the other register and offset components represent the watched location address and offset value from that address . necessary logic to handle at least both types of instructions previously described is available within the context handling capability of the trap handler . the comparator component of the trap handler determines if the opcode component value of the analyzed instruction matches the desired store type opcode component . if โ€œ yes โ€ at step 310 , process 300 then determines if the register containing the data value to be stored is of further interest and to be examined for a match , again using the comparator ( step 312 ). having matched both the store type opcode component and the data value component criteria , a positive context examination results , a first action is identified and the debug environment is invoked ( step 314 ). the user , or programmatic means of the debugger , is allowed to examine the data of interest and perform further actions as necessary ( step 316 ). a determination is made if the debugging is complete ( step 318 ). if the debug process is not complete (โ€œ no โ€ to step 318 ), process 300 returns to step 316 . if the debug process is complete (โ€œ yes โ€ to step 318 ), process 300 proceeds to clear the data address break register for this instruction on this processor ( step 320 ). process 300 restores the current instruction to resume execution in the set of instructions of the traced process ( step 322 ), and re - sets the data address break register to the conditional data watchpoint on this processor ( step 324 ), with process 300 returning to step 304 in which the processor hardware resumes monitoring the conditional data watchpoint occurs returning now to steps 310 and 312 , if the opcode component of the analyzed instruction does not match the desired store type opcode (โ€œ no โ€ to step 310 ) or if the register containing the data value to be stored is not of further interest and therefore not to be examined for a match (โ€œ no โ€ to step 312 ), a negative context results , and a second action identified as process 300 proceeds to step 320 . it is also noted that since the register context is unique for each thread that activates a watchpoint , concurrent updates to the watched location in memory by multiple threads does not require serialization as before . the flowcharts and block diagrams in the different depicted embodiments illustrate the architecture , functionality , and operation of some possible implementations of apparatus , methods and computer program products . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of computer usable or readable program code , which comprises one or more executable instructions for implementing the specified function or functions . in some alternative implementations , the function or functions noted in the block may occur out of the order noted in the figures . for example , in some cases , two blocks shown in succession may be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . illustrative embodiments provide enhanced conditional data watchpoint management . in particular enhancement of the previous hardware exception handling process related to conditional data watchpoints to provide additional capabilities of the exemplary trap handler and โ€œ trap before โ€ semantics reduces the need to call the debug environment . avoiding unnecessary calls to the debug environment typically saves time allowing the processor to be more productive . the invention can take the form of an entirely hardware embodiment , an entirely software embodiment or an embodiment containing both hardware and software elements . in a preferred embodiment , the invention is implemented in software , which includes but is not limited to firmware , resident software , microcode , etc . furthermore , the invention can take the form of a computer program product accessible from a computer - usable or computer - readable medium providing program code for use by or in connection with a computer or any instruction execution system . for the purposes of this description , a computer - usable or computer readable medium can be any tangible apparatus that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the medium can be an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system ( or apparatus or device ) or a propagation medium . examples of a computer - readable medium include recordable type media comprising a semiconductor or solid state memory , magnetic tape , a removable computer diskette , a random access memory ( ram ), a read - only memory ( rom ), a rigid magnetic disk and an optical disk . current examples of optical disks include compact disk - read only memory ( cd - rom ), compact disk - read / write ( cd - r / w ) and dvd . further , a computer storage medium may contain or store a computer readable program code such that when the computer readable program code is executed on a computer , the execution of this computer readable program code causes the computer to transmit another computer readable program code over a communications link . this communications link may use a transmission type medium that is , for example without limitation , physical or wireless . a data processing system suitable for storing and / or executing program code will include at least one processor coupled directly or indirectly to memory elements through a system bus . the memory elements can include local memory employed during actual execution of the program code , bulk storage , and cache memories which provide temporary storage of at least some program code in order to reduce the number of times code must be retrieved from bulk storage during execution . input / output or i / o devices ( including but not limited to keyboards , displays , pointing devices , etc .) can be coupled to the system either directly or through intervening i / o controllers . network adapters may also be coupled to the system to enable the data processing system to become coupled to other data processing systems or remote printers or storage devices through intervening private or public networks . modems , cable modem and ethernet cards are just a few of the currently available types of network adapters . the description of the present invention has been presented for purposes of illustration and description , and is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art . the embodiment was chosen and described in order to best explain the principles of the invention , the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated .
6
in the embodiment shown in fig1 and 2 , the rear projection apparatus 1 comprises a screen 2 with a front face ( 2 a ) and a rear face ( 2 b ), projection optics 3 , an image module 4 and a housing 5 , which is represented by dashed lines in fig1 . the projection optics 3 are arranged in the housing 5 of the rear projection apparatus 1 , with the housing 5 having a foot part 6 and a screen part 7 . the depth t of the rear projection apparatus is about 140 to 150 mm or 150 to 160 mm , and the front height h of the foot part is only about 140 mm . the height of the screen 2 , which is illustrated as being rectangular , that is to say the distance from the lower edge 8 to the upper edge 9 of the screen 2 is in this case about 747 mm . the width of the screen ( at right angles to the plane of the drawing in fig1 ) is about 1328 mm which means that the screen 2 has a diagonal of about 1524 mm . the projection optics 3 of the rear projection apparatus 1 , or the projection optics 3 with a field lens structure , are illustrated partially in fig1 and 2 and partially in fig3 . this is because of the fact that the elements of the projection optics 3 which are shown from the image module 4 to the deflection mirror 19 in fig3 are located vertically and above the plane of the drawing in fig1 , in the illustration in fig1 and 2 . the following tables 1 and 2 show the distances and radii of curvature of the surfaces 10 to 36 of the elements of the projection optics 3 when using a fresnel mirror ( table 1 ) and when using a second aspherical mirror ( table 2 ). when two surfaces bound a lens material ( and not air ), the refractive power and the abbe dispersion number are also quoted for the material . radii , thickness distances and air distances are quoted in millimeters in the table . in the surface characteristic column s represents a mirror , a an aspherically curved surface and af an aspherically curved fresnel surface . in the rows between two surfaces , the respective distances are quoted in the โ€œ thickness and air distances โ€ column , with the distance from the fresnel pane 2 โ€ฒ to the fresnel mirror 10 a being indicated by 140 in the first row of table 1 , and the distance from the fresnel pane 2 โ€ฒ to the second aspherical mirror 10 b being indicated by 150 in table 2 . in operation , an image is produced in a known manner by means of the image module 4 , which in this case has a tilting minor matrix . the illumination unit which is required for image production as well as the control unit for operating the tilting mirror matrix are not illustrated , in order to simplify the illustration . the image which is produced by means of the image module 4 is projected by the projection optics 3 from the rear onto the screen 2 , as is indicated by the arrows p 1 , p 2 and p 3 . a viewer who is positioned in front of the rear projection apparatus ( that is to say to the left of it , as seen in fig1 ) can then perceive the image that is projected onto the screen . for this purpose , the screen 2 has a transmissive fresnel pane 2 โ€ฒ which extends over the entire screen area . the fresnel pane 2 โ€ฒ is designed such that the light from the screen propagates essentially at right angles to the screen plane , as is illustrated by the arrows p 1 โ€ฒ, p 2 โ€ฒ and p 3 โ€ฒ. transmissive fresnel panes such as these are known to a person skilled in the art . the fresnel pane 2 โ€ฒ used here is rotationally symmetrical with respect to the axis a in fig1 , which coincides with the optical axis oa of the projection optics 3 . the screen 2 may also have a diffuser pane ( not shown ), which follows the fresnel pane 2 โ€ฒ and is used to ensure that the light from the screen 2 is emitted into a predetermined angle range . the light therefore propagates not only along the direction indicated by the arrows p 1 โ€ฒ- p 3 โ€ฒ but within the angle range , in such a way that the screen 2 provides a desired viewing angle range . the surface 10 a shown in fig1 is in the form of an aspherically curved fresnel mirror and is used to keep the incidence angle ฮณ less than 60 ยฐ when the image that is produced by means of the image module 4 is projected onto the screen 2 . the surface 10 b as shown in fig2 is in the form of an aspherically curved mirror and is used to keep the incidence angle ฮณ less than 60 ยฐ when the image that is produced by means of the image module 4 is projected onto the screen 2 . fig4 shows , schematically , three mirror surface elements 40 , 41 , 42 of the fresnel mirror 10 , with the mirror surfaces 40 , 41 , 42 respectively being formed by the effective flank of the fresnel structures 43 , 44 , 45 , which have a triangular section . the other flanks 46 , 47 , 48 are not used for beam deflection and are therefore frequently referred to as disturbance flanks . the fresnel structures 43 - 45 are in this case sections of rings whose center points coincide with the axis a , with the width b 1 , b 2 , b 3 , of the fresnel structures ( which in this case is in the region of 0 . 4 mm ) decreasing as the distance from the axis a increases , as is indicated schematically in fig4 . furthermore , the flank angle ฮฑ 1 , ฮฑ 2 , ฮฑ 3 of the mirror surface 40 - 42 relative to the optical axis ( or to a straight line which runs parallel to the optical axis oa and through the left - hand corner e 1 , e 2 , e 3 of the triangular section of the fresnel structures 43 - 45 ) decreases as the distance from the optical axis oa increases ( that is to say ฮฑ 1 & gt ; ฮฑ 2 & gt ; ฮฑ 3 ). in this case , the flank angle ฮฑ 1 , ฮฑ 2 , ฮฑ 3 corresponds to the tangent of the following function : z = h 2 r + r โข ( 1 - ( 1 + kfr ) โข ( h / r ) 2 ) + โˆ‘ i = 3 7 โข โข cfr i ยท h i where h is the distance of a point on the fresnel structure 40 , 41 , 42 ( for example the left - hand corner e 1 - e 3 ) from the optical axis oa , r is the spherical curvature of the entire fresnel mirror 10 and the parameters kfr and cfr i have the values indicated in the following table 3 . where h is the distance from the optical axis oa and z is the distance of the apex plane ( the plane which is located at right angles to the optical axis oa and includes the intersection of the apex of the surface with the plane ). the aspherical coefficients are indicated in the following table 4 ( fresnel mirror ) and table 5 ( second aspherical mirror ) for the aspherical mirror 11 and for the aspherical surfaces 13 and 14 , as well . apart from the deflection by the planar mirrors 12 and 19 , the projection optics are a rotationally symmetrical system whose image field is used only on one side . the deflection mirror 12 is tilted through 10 ยฐ with respect to the optical axis , and the axis of the following three lenses ( with the surfaces 13 - 18 ) is in consequence tilted through 20 ยฐ with respect to the axis oa . the deflection mirror 19 is tilted through 45 ยฐ with respect to the optical axis oa such that the optical elements with the surfaces 20 to 36 are arranged one behind the other at right angles to the plane of the drawing in fig1 and 2 . in the described embodiment shown in fig1 , the fresnel structures 43 - 45 are formed on a planar plane e 1 ( fig3 ). however , it is also possible for the plane e 1 to be curved ( for example spherically or aspherically ) such that the fresnel structures 43 - 45 are in this case provided on the curved plane e 1 . the curved configuration of the plane e 1 makes it possible , for example , to compensate for imaging errors in the projection optics 3 . because of the described design of the projection optics and in particular because of the fresnel mirror 10 a or second aspherical mirror 10 b , it is possible to produce a rear projection apparatus with a small physical depth t and a small foot height h , in which the screen may have a transparent fresnel pane which extends over the entire screen area , since the maximum incidence angle of the light beams on the screen 2 or the fresnel pane 2 โ€ฒ is no greater than 60 ยฐ. since this can be ensured over the entire pane area , there is no longer any need to make the fresnel pane of the screen reflective at least in one subarea . the projection apparatus according to the invention therefore provides an extremely compact projection apparatus with expert image characteristics . fig5 shows a side view of the rear projection apparatus according to a further refinement in which , in particular , it is possible to clearly see that the lens group , which may be regarded as output imaging elements ( surfaces 112 - 115 ) of the projection optics , has the same optical axis as the first aspherical mirror 11 . as can also be seen , both the first aspherical minor 11 and the second aspherical mirror 10 b and the lens group of the output imaging elements of the projection optics have the same optical axis ( a 1 ). it can likewise clearly be seen that the projection optics together with the first and the second aspherical mirror are in the form of a rotationally symmetrical system . as can also clearly be seen , the image field is used only on one side , as a result of which , for example , the part which is underneath the optical axis is not used , and the optical elements around this part can be shortened . fig6 shows a plan view of the rear projection apparatus according to the application , from which it can clearly be seen that the deflection mirror which is located in the projection optics 3 is suitable for injection of images from the side , to be precise for example between the screen and the second aspherical minor , as a result of which the flat structure of the projection apparatus is a particular feature , although the image quality is still optimal . because of the aspherical curvature of the second aspherical mirror , it is advantageous for the optical imaging elements of the projection optics which are located before and after the deflection mirror to be arranged such that , because of the deflection minor , the respective optical axes have an angle of less than or equal to 90 ยฐ. this measure means that the depth of the rear projection apparatus is appropriately limited just on the basis of the optical characteristics and imaging prerequisites of the projection optics 3 , of the first aspherical mirror and of the second aspherical minor . fig7 shows a lens section of a further embodiment of the part of the projection optics 3 , clearly showing that the deflection minor 116 subdivides the projection optics into two parts , specifically into input optics 117 - 138 and output optics 112 - 115 with output imaging elements which , in this case , are represented by two lenses with different surfaces . it should be stressed that the optical axis of the output imaging elements is chosen such that it is identical to the optical axis ( a 1 ) of the first aspherical minor . the spatial characteristic and the interaction of the minor and the second aspherical minor are taken into account by the geometric arrangement of the subdivided parts of the projection optics . to be precise in such a way that the respective optical axes of the subdivided images have an angle of less than or equal to 90 ยฐ. at this point , it should also be stressed that , for example , the element formed by the surfaces 134 and 135 can likewise be in the form of a deflection prism in order in this way , for example , to achieve total internal reflection of the image to be displayed . table 6 shows the distances and radii of curvature of the surfaces 112 - 138 of the elements of the projection optics 3 a . the refractive power and the abbe dispersion number are also indicated for the material , for the situation in which two surfaces bound a lens material . radii , thicknesses and air distances are indicated in millimeters in the table . the explanatory notes relating to tables 1 and 2 apply in a corresponding manner to the explanation of this table . the aspherical curvatures of the surfaces 10 b , 11 , 112 , 113 , 130 , 131 can also be described using the previous aspherical equation . the respective explanatory notes are also applicable in this case . in principle , it can be stated that the embodiment shown in fig5 to 7 in principle has the advantage , in particular with regard to the projection optics , that there is no need to use a mirror for deflection downward between the projection optics and the first aspherical mirror , thus resulting in particular in a small physical height . in principle , only one deflection by the deflection mirror or planar mirror is carried out on the basis of the presence of the deflection mirror . these projection optics furthermore achieve the advantage that the output imaging elements are arranged further from the aperture , and can therefore be used particularly well for optical images .
6
fig1 schematically shows a configuration in which a superconducting load 5 , in this case a superconducting magnet , is connected to a current feed point 3 a through an inventive current lead 1 . from the current feed point 3 a , which is at room temperature in this case and is provided on a current source 3 , a first conductor 2 , for example , a copper conductor , goes to a first end 1 a of the current lead 1 ; there , a first connection element ( not shown in greater detail ) is provided . in the region of the first end 1 a , a connection 5 a is provided on a first cryocooler ( not shown ), which cools the first end 1 a to a medium low temperature t 1 of approx . 50 to 90 k ( max . 35 k for mgb2 in the htsc ). the temperature t 1 should be below the critical temperature of the htsc in the current lead 1 . at a second end 1 b of the current lead 1 , there is a connection 5 b to a second cryocooler ( not shown ) that cools the second end 1 b to a cryogenic temperature t 2 of approx . 1 to 30 k ; the temperature t 2 should be at least approximately as cold as the operating temperature of the superconducting load 5 . instead of the first and second cryocooler , it is also possible to use one cryocooler with a first and a second cooling stage ( not shown ). a connection element constituted at the second end 1 b ( not shown ) is connected to the superconducting load 5 by a second conductor , for example , an htsc cable or low - temperature superconductor cable . the fig2 a to 2 e illustrate a first embodiment of an inventive current lead 1 . as can be seen from the plan view fig2 a and from the longitudinal section fig2 c ( cf . intersecting plane a - a in fig2 a ), the current lead 1 includes a carrier 6 made of stainless steel (โ€œ flat steel support โ€), in particular , made of steel din 1 . 4306 , din 1 . 4404 , din 1 . 4571 , din 1 . 4435 , aisi 316l , aisi 304l , or aisi 316ln , which is soldered to connection elements 7 at its longitudinal ends . the connection elements 7 have drill - holes 8 for mounting current contacts and potential taps 9 . both on the top side and the underside of the carrier 6 , a plurality ( in this case five ) of high - temperature superconductors ( htsc ) 10 are disposed that are connected by means of a soldered connection both with the carrier 6 and with the connection elements 7 . the solder used is preferably snag4 solder . solders can also be used with a melting point & lt ; 200 ยฐ c . ( for example , solders from fusion gmbh , type solder paste ssx 430 - 830 ). the carrier 6 is used as a support for htsc 10 and takes up mechanical loads that act on the current lead 1 . it must be noted that the carrier 6 and the htsc 10 should have similar heat expansion properties because otherwise damage could occur due to differing expansions caused by temperature fluctuations , in particular , during initial cooling of the current lead . as can be seen from fig2 b , which shows the plan view of fig2 a with the htscs omitted , and fig2 c , the carrier 6 has a plurality of cut - outs 15 that extend perpendicularly with respect to the longitudinal direction ( the longitudinal direction extends from left to right in fig2 a , 2 b , and 2 c ) of the carrier 6 . in the embodiments shown , a total of seventeen cut - outs 15 are distributed over the outer length al of the carrier 6 . fig2 e shows a transverse section through the current lead 1 at the height of a cut - out 15 ( cf . intersecting plane c - c in fig2 c ). the outer contours of the carrier 6 , with an outer height ah and an outer width ab , define a cross - sectional area that is occupied by the carrier material at lateral webs only ; approx . 80 % of the defined cross - sectional area is occupied by the cut - out 15 . in an associated section 20 along the longitudinal direction of the carrier 6 , that is , over the longitudinal extent of each cut - out 15 ( cf . fig2 b and 2 c ), thermal conduction is therefore heavily restricted because it can only occur through the โ€œ bottlenecks โ€ of the two webs . the cut - outs 15 are continuous in the vertical direction . most of the htscs 10 bridge the cut - out 15 completely ; the edge htscs are partly lying on the webs . fig2 d shows a transverse cross - section through the current lead 1 between two cut - outs ( cf . intersecting plane b - b in fig2 c ). in this region , the entire cross - sectional area defined by the outer height ah and the outer width ab is occupied by the carrier material . in this region , the htscs 10 lie directly on the carrier 6 and are soldered onto the surface of the carrier 6 in this embodiment . fig3 illustrates , in a longitudinal section view , a first possibility for mounting a connection element 7 on a carrier 6 as part of the invention . the carrier 6 and the connection element 7 are soldered together at their face ends ( butting ends ). the soldered connection 16 is ( irrespective of the shape of the soldered connection ) preferably implemented with solders containing silver , in particular , solder type l - ag72 . the connection element 7 is ( irrespective of the shape of the soldered connection ) preferably made of ag , cu , or au , or of alloys of the said materials ; optionally , a connection element 8 can be coated with one of the materials ni , ag , or au . an alternative mounting of a connection element 7 is depicted in fig4 . in this case , the carrier 6 and the connection element 7 each form , in the longitudinal section , approximately l - shaped edges so that an approximately s - shaped ( stepped ) contact surface is provided between the two components . the soldered connection 16 a extends over the entire s - shaped contact surface and is noticeably larger than the contact surface in case of contacting on the end face only . a second embodiment of the inventive current lead 1 is shown in a schematic perspective view in fig5 a ( without htsc ) and fig5 b ( with htsc ). the carrier 6 of the current lead 1 has a meander - shaped structure . alternating cut - outs 15 each project from the two opposite upright edges 70 a , 70 b into the space defined by the outer length al , the outer height ah , and the outer width ab of the carrier 6 . the cut - outs 15 extend over the entire outer height ah ( that is , the cut - outs are continuous in the vertical direction in fig5 a ). the carrier 6 therefore extends in sections that are parallel to the longitudinal extent ( cf . section 20 ) and in sections that are transverse with respect to the longitudinal extent of the carrier 6 ; the carrier 6 therefore extends in a meandering path . in the case of a completely meander - shaped carrier 6 , as is described here , the length of this meandering path is approx . three times longer than the outer length al of the carrier 6 , which provides a correspondingly higher thermal resistance . in the sections of the carrier 6 that extend transversely with respect to the longitudinal extent of the carrier , further cut - outs , that is , longitudinal slots 11 , are constituted in the top side and the underside of the carrier 6 ( e . g . by milling ). as seen in fig5 b , in this case , the longitudinal slots 11 have a depth that approximately corresponds to the height of the htscs 10 that are disposed on the carrier 6 . the htscs 10 are carried in the longitudinal slots 11 , which facilitates manufacturing , and the htscs 10 are mechanically stabilized and protected by the side walls of the longitudinal slots 11 . the longitudinal slots 11 also reduce the thermal conductivity of the carrier 6 along the meandering path . fig6 shows a schematic perspective view of the carrier 6 for an inventive current lead that is comparable with the carrier 6 from fig2 b . the essentially flat , elongated , cuboidal carrier 6 has a plurality of cut - outs 15 that are distributed over the longitudinal extent , cut through the full height of the carrier , and leave lateral webs ( to ensure mechanical integrity ). fig7 shows a perspective view of a further carrier 6 for an inventive current lead . the carrier 6 is based on a u - section that has its base at the upright side 70 a , and is open at the opposite upright side 70 b . the legs of the u - section constitute the top side and underside ( outer sides ) 90 , 91 of the carrier 6 on which the htscs are disposed ( not shown ). the outer sides 90 , 91 are provided , starting from the upright side 70 b facing away from the base , with slot - like cut - outs 15 a extending in the transverse direction . the slot - like cut - outs 15 a reduce the thermal conductivity of the carrier 6 in the longitudinal direction considerably . the open region in the interior of the u - section of the carrier 6 forms the greatest cut - out 15 b in the space ( volume ) defined by the outer width ab , outer height ah , and the outer length al of the carrier 6 of fig7 . in the case of the carrier 6 based on a u - section , occupancy of the space defined by the outer width ab , the outer height ah , and the outer length ah by carrier material is especially low , that is , this defined space is mainly occupied by the cut - outs 15 a , 15 b ( more than 90 % in this case ) and thermal conduction is therefore correspondingly low . the outer height ah is the height range over which the high - grade steel carrier 6 extends ( seen over the entire longitudinal extent of the carrier 8 ). the outer width ab is the width range over which the high - grade steel carrier 6 extends ( seen over the entire longitudinal extent of the carrier 6 ). the outer length al is the length range over which the high - grade carrier 6 extends ( seen over the entire vertical extent and longitudinal extent of the carrier 6 ). the outer height ah , outer width ab , and outer length al are measured at right angles . a flat , elongated cuboid is constituted by the outer length al , the outer width ab , and the outer height ah lying against the outer contours of the carrier 6 (โ€œ defined space โ€), into which the carrier 6 just about fits . a further embodiment of an inventive current lead 1 is shown in fig8 a ( without htscs ) and fig8 b ( with htscs ). the current lead 1 again has a carrier 6 based on a u - section ( similar to the carrier in fig7 ). the legs of the u - section constitute the top side and underside ( outer sides ) 90 , 91 of the carrier 6 on which the htscs 10 are disposed . the outer sides 90 , 91 each have a cut - out 15 c , in the shape of meander - shaped slots . this reduces the thermal conduction in the carrier 6 in the longitudinal direction ( toward the outer length al ). furthermore , gap - like cut - outs ( slots ) 15 d are provided that extend transversely with respect to the longitudinal direction in the base - side upright side 70 a of the u - section - like carrier 6 . this reduces the thermal conduction in the longitudinal direction in the region of the base , too . the largest cut - out 15 b is constituted by the free region in the interior of the u - section of the carrier 6 . note that on an inventive current lead for protecting the htsc and for electrical insulation , the htsc tape conductor region can be encapsulated in epoxy resin , such as stycast 1266 , and / or wrapped in kapton tape .
7
ideally , energy should be replenished to the tank circuit when either the voltage or the current in the switching device is zero . the electromagnetic noise is lower during zero - voltage or zero - current switching and is lowest during zero - voltage switching . the switching device dissipates the least power under zero switching . that ideal switching point occurs twice per cycle when the sine wave crosses zero and reverses polarity ; i . e ., when the sine wave crosses zero in a first direction from positive to negative , and when the sine wave crosses zero in a second direction from negative to positive . embodiments of the invention eliminate hard - switching and its negative consequences , and replace it with zero - voltage switching in a full - bridge configuration . the integrated functions of the synchronous full - bridge power oscillator heater driver of the invention will be explained with reference to fig2 , which is a simplified representation of a circuit in accordance with embodiments of the invention with many of the basic components not shown for clarity . specific or general values , ratings , additions , inclusion or exclusion of components are not intended to affect the scope of the invention . l 1 may be located inside a fuel injector . l 1 is an induction heater coil that provides ampere - turns for induction heating a suitable fuel - injector component . a synchronous full - bridge power oscillator in accordance with embodiments of the invention may include r 1 , r 2 , d 1 , d 2 , q 1 , q 2 , q 3 , q 4 , l 2 , c 1 and l 1 . q 1 and q 2 are enhancement - type n - mosfet ( n - channel metal - oxide - semiconductor field - effect transistor ) switches that alternatively connect tank resonator , c 1 and l 1 , circuit to ground and , when each is turned on in the respective state , enables current to flow through induction heater coil and ground . q 3 and q 4 are enhancement - type p - mosfet ( p - channel metal - oxide - semiconductor field - effect transistor ) switches that alternatively connect tank resonator , c 1 and l 1 , circuit to the voltage supply , which may be a power supply , or in the case of a vehicle , a battery or an alternator , and which is a source of potential energy to replenish energy lost in the oscillator . replenishment current for the tank passes through l 2 , and with q 1 and q 2 in the appropriate state , enable current to flow through induction heater coil . c 1 and l 1 are the tank resonator capacitor and tank resonator inductor , respectively , of a resonant tank circuit . the resonant frequency of the tank circuit is fr = 1 /( 2ฯ€ โˆš{ square root over ( lc )}), where l is the heater coil inductance l 1 , and c is the capacitance of tank capacitor c 1 . the peak voltage in the tank circuit is set by v out = ฯ€ * v in where v in is the supply voltage . the current level in the tank circuit is determined from the energy balance of the zero - switching power oscillator circuit is self - starting in oscillation , but may be forced into oscillation by selectively sequencing the switching of q 1 - q 4 in a full - reversing h - bridge strategy . the complimentary pairs , or here , the pairs of transistors that are flowing current between the mosfet โ€˜ drain โ€™ and โ€˜ source โ€™ at the same time are q 3 and q 2 or q 4 and q 1 . it is not desirable to have q 1 flowing current when q 3 flows current , and likewise , it is not desirable to have q 2 flowing current when q 4 flows current . l 2 provides this transient separation during state change of the h - bridge transistors . l 2 additionally isolates the resonant tank from the voltage source . when q 3 is flowing current , current passes through the induction heater coil and then through q 2 to ground . when q 4 is flowing current , current passes through the induction heater coil in the reverse direction as when q 3 was flowing current , and then through q 1 to ground , this is โ€˜ full - reversal โ€™ of current . a mosfet is a device that has a threshold for an amount of coulomb charge into the gate , which is drain - source current - dependent . satisfying the charge threshold enhances the device into an โ€˜ on โ€™ state . first and second gate resistors r 1 , r 2 supply the gate charging current to first and second legs of the h - bridge . r 1 supplies current to gates of q 1 and q 3 , r 2 supplies current to the gates of q 2 and q 4 , respectively , and r 1 , r 2 limit the current flowing into first and second gate diodes d 1 , d 2 , respectively . q 3 and q 4 , p - mosfet conduct between drain and source when source is more positive than gate . q 1 and q 2 , n - mosfet conduct between drain and source when source is more negative than gate . the loading caused by the resistive and hysteretic loss of the heated component reflects back as a loss in the resonant tank circuit . that loss is replenished by current flowing from current source inductor l 2 , from the voltage supply . depending on the state of reversal of the h - bridge in which the current flows , the current will flow either through q 3 or q 4 and then through induction heater coil l 1 . l 2 will supply current to the tank circuit from the energy stored in the magnetic field . that energy is replenished from the supply voltage as a current that constantly flows into l 2 from the voltage source during operation of the synchronous full - bridge power oscillator . if current is flowing through q 3 , as determined by the polarity of the sine wave half - cycle at that time , then the conduction to ground from q 2 drain - to - source is pulling charge out of the gate of q 3 and q 1 through forward biased d 1 . q 1 is also now not conducting and does not pull the gate charge out of q 4 and q 2 to ground through d 2 . meanwhile , r 1 draws current from the supply voltage . but the ir drop across r 1 cannot charge the gate of q 3 and q 1 with the gate shunted to ground by conduction through q 2 . when the sine wave crosses zero , then q 3 becomes reverse biased and conducts through the internal intrinsic diode to reverse - bias d 1 . d 1 stops conducting current away from the q 3 and q 1 gate , and r 1 can charge the gate of q 3 and q 1 , which stops conduction in q 3 and starts conduction in q 1 to begin conducting current for the continuing sine half - cycle . q 1 also pulls the gate charge out of q 2 and q 4 to ground through d 2 and holds q 2 in a non - conducting state , which continues to allow r 1 to enhance q 1 . and q 4 conducts . that process repeats as the sine wave alternates polarity , crossing zero in a first direction from negative to positive , and then in a second direction from positive to negative . this generates full - reversal of current in l 1 , the induction heater coil . current continues to be replenished in the tank circuit from l 2 . an igbt ( insulated gate bipolar transistor ) device can replace the n - mosfet in this embodiment if the intrinsic diode of the n - mosfet is represented by the addition of an external diode across the drain and source of the igbt . fig1 shows an expanded circuit of cascaded half - bridges that operates in accordance with the principles of operation of the full - bridge as described above and in reference to fig2 . relative to fig2 , fig1 shows three additional induction heater coils and three corresponding additional half bridges . in the embodiment shown in fig2 , the induction heater coils and the half bridges are arranged such that each induction heater coil , ihc 1 - ihc 4 , is driven by a corresponding pair of half bridges , hb 1 and hb 2 drive ihc 1 ; hb 2 and hb 3 drive ihc 2 ; hb 3 and hb 4 drive ihc 3 ; and hb 4 and hb 5 for ihc 4 . the foregoing detailed description is to be understood as being in every respect illustrative and exemplary , but not restrictive , and the scope of the invention disclosed herein is not to be determined from the description of the invention , but rather from the claims as interpreted according to the full breadth permitted by the patent laws . for example , while the synchronized array power oscillator of the invention is described herein driving an induction heater coil for the heater in an internal combustion engine fuel injector , the driver may be used to drive other induction heaters in other applications . it is to be understood that the embodiments shown and described herein are only illustrative of the principles of the present invention and that various modifications may be implemented by those skilled in the art without departing from the scope and spirit of the invention .
5
a generalized computer network diagram , consistent with the present invention is illustrated in fig1 . the invention consists of an application 105 , written in a computer - readable language , executed in memory 103 on any number of computers or servers 102 that are used in conjunction with search engine crawling practices . the application 105 is therefore a search engine used in connection with a crawler , spider , or bot 106 in accordance with the present invention discussed in greater detail below . the application / bot is performed on a computer 102 that may be logically connected to a private local area network 120 containing any number of document servers 115 and / or database servers 110 . the computer 102 is also logically connected to a public network 130 ( such as the internet ) containing any number of document servers 140 . fig1 illustrates the invention as being executed in memory 103 in conjunction with the computer 102 running the search engine bot 106 . the computer 102 can , but isn &# 39 ; t required to , run the search engine bot application 106 locally . in cases where the bot 106 is not executed locally , the application 105 can be accessed over networks 120 or 130 . within the servers 110 , 115 , or 140 details about cookies used by the target web site or documents are stored . these cookie details may be stored in database applications including ( but not limited to ) mysql , oracle , microsoft sql server , or filemaker pro , or as static documents formatted as ( but not limited to ) text , xml , or html . the search engine application 105 , as well known in the prior art , creates listings of web pages automatically . typically , the bot 106 will visit a web site , read it , save it it and follow links to other secondary pages in the web site . the bot 106 will automatically return to the site on a regular basis to look for changes or new pages . the search engine application 105 will retrieve the information obtained by the bot 106 and create an index or catalog , which contains a copy of every web page the bot 106 locates . the index or catalog is stored on a database 110 directly accessible by the search engine application 105 . as the original web site is updated , the index will change . the search engine application 105 when accessed by a user sifts through the index to find matches to the specific search request . the matches are returned to the user with the link to the actual web page or document . as such , when the user selects a link from the search engine , the user is redirected to the web page that matches to the stored index page . problems arise , as mentioned above , when cookies are involved . since search engine bots 106 do not use cookies , the bots are often restricted from entering the linked pages or the links stored on the index will not accurately open . the search engine bots 106 thus are not capable of indexing secondary or linked pages , limiting the available index to the default or initial web page or other secondary pages which do not require cookies for access . fig2 generally represents an application context in which the invention may be utilized . if the search engine has not previously indexed any page on the target web site , the invention will perform an initial analysis of the root page of the web site , step 10 . this may require automatically truncating the uniform resource indicator (โ€œ uri โ€) to its root uri . for example , if the initial crawl is started on the target web site uri www . dipsie . com / bot . html the invention will truncate the uri to the root domain , www . dispsie . com . in the next step the invention will analyze any cookies on the root page , step 20 . the analysis is referred to herein as an audit of the cookies . this function discussed in greater detail below , examines the cookies and adds and / or updates information relating to the cookie to the database 110 , that is later used by the bot 106 . an application is designed to strip the cookies of its relevant information or attributes . since cookies are uniformly defined the information contained therein is relatively easy to read and dissect . in the crawl processes , as mentioned above , the bot 106 will be instructed to retrieve a target document or will be given a specific url for the search engine index . as such , the bot 106 will return to the target web site ( in the example above the target website was www . dipsie , com / bot . html ), step 30 . prior to initiating the retrieval request , the bot 106 will access the database 110 and retrieve the cookies associated with the initial root url or initial web page from where the document is being retrieved , step 40 . this is done because the targeted web page has been linked to the stored cookie . once the cookies have been retrieved from the database 110 , they are included in the bot &# 39 ; s request for the target document . the bot 106 uses the retrieved cookie in its request to gain access to the target document . in step 50 , the bot 106 retrieves the target page , step 54 , from the web server . the application 105 is then able to index and save the target page . in addition , the bot 106 also retrieves the target page &# 39 ; s header information ( which typically contains the cookie ) and sends it to the application 105 for a further cookie audit , step 56 . as discussed herein below , the header information of a web page contains cookies . within the cookie audits , the invention will identify cookies associated with the target document and add or update the database 110 on an ad hoc basis . the cookies obtained from the target page can be used by the bot to gain access to other secondary pages linked from the target page . the links in the retrieved page can be stripped during the indexing by the application 106 and provided to the bot with the relevant cookie information for additional deeper crawls , thereby permitting the bot to dig deeper into a web site and retrieve much more web pages and information then previous prior art crawls . once the initial cookie audit function has been completed , the bot will begin a cycle of indexing the target web site until all pages identified to be indexed in the crawl have been indexed , as such step 50 is repeated until the crawl is finished . for each page being indexed , the invention will first retrieve all cookie data for the target web site from the database , step 200 , fig3 . as mentioned above , the cookie data is obtained from the web page header information . next , the invention analyzes the cookie by cataloging the cookie &# 39 ; s attributes and then may create a container on the database 110 to store the cookie data returned from the web site 210 . for each cookie returned to the database 110 , the invention will create an entry in the container that stores details of the cookie data , such as name , path , domain , expires and secure , step 230 . the name is a value string of a sequence of characters excluding semi - colon , comma and white space . this is the only required attribute on the cookie header . the path attribute is used to specify the subset of urls in a domain for which the cookie is valid . if a cookie has already passed domain matching , then the pathname component of the url is compared with the path attribute , and if there is a match , the cookie is considered valid and is sent along with the url request . if the path is not specified , it is assumed to be the same path as the document being described by the header which contains the cookie . the domain attribute of the cookie may be the host name of the server which generated the cookie . a domain attribute of โ€œ dipsie . com โ€ would match host names โ€œ bot . dipsie . com โ€ as well as โ€œ app . bot . dipsie . com โ€. the expires attribute specifies a date string that defines the valid life time of that cookie . once the expiration date has been reached , the cookie will no longer valid . if the secure attribute is marked it will only be transmitted if the communications channel with the bot is a secure one . currently this means that secure cookies will only be sent to https ( http over ssl ) servers . if secure is not specified , a cookie is considered safe to be sent over unsecured channels . continuing to refer to fig3 , once all cookies returned from the database have been attached to the container , the container is returned to the database 110 for future use and updating by the bot 106 , step 240 . the cookie container is linked or attached to the web site , such that during future crawls or updates by the bot 106 , the bot 106 will grab the cookie container linked to the web site . referring now to fig4 , once the initial cookie audit is complete the bot 106 will systematically return to the web site to update the container by cataloging new cookies and updating preexisting cookies . the bot 106 will retrieve the cookie container on the database linked to the web site , step 300 . the bot 106 examines the uri ( uniform resource indicator ) for the page that was returned in response to the crawl request which was made for the targeted document , step 310 . once the non - redirected page has been returned , and if cookies exist on the retrieved page , the invention performs a cookie audit ( described above ) appending the database as needed and returning the cookies for the target site to the bot . if the uri of the page returned is not the same as the uri of the page requested , the bot 106 was redirected to another web page . the bot 106 grabs the header information on the returned page and investigates as to whether there are cookies , step 320 . the cookies are then added to the cookie container and linked to the returned page , step 325 . the bot 106 may then make another request for the target page and check to see if the uri of the returned page is the same as the requested page , step 330 . if it is the target page , the page is indexed and any cookies on the returned requested page cataloged . if the uri is not the same , than the bot 106 was redirected again , step 340 . the bot 106 then checks and updates the cookies , step 350 and step 360 . this may be repeated until the returned requested page matches the targeted page . referring now to fig5 , each time a bot begins crawling a web site , the bot will access the database 110 and retrieve the cookies associated to the web site to perform a preliminary cookie audit of the target web site . to do this , the method of the invention retrieves a page for the website , which may be the root page . called by an application , the cookie audit is a sub function residing within the application 105 and along with bot 106 . the cookie audit function is provided the document header information , step 400 . specifically the information contained within the set - cookie header key and uri for processing . the cookie audit function then splits the cookies into individual cookies and stores the split cookies into a collection for further analysis 410 . in some instances , a cookie header may include numerous cookies . in step 420 , for each cookie , the function then extracts the values for the cookie variables : โ€œ name ,โ€ step 422 , โ€œ path ,โ€ step 424 , โ€œ domain ,โ€ step 426 , โ€œ expires ,โ€ step 440 , and โ€œ secure ,โ€ step 450 . if the variable โ€œ domain โ€ does not have a value , step 430 , the function will assign the root of the uri for the โ€œ domain โ€ variable , step 435 . for example , if the uri was http :// www . dipsie . com / bot / sample . html , the function would assign the variable โ€œ domain โ€ the value of root domain ( i . e . www . dipsie . com ). the function would also check the value of the variable โ€œ date โ€, step 445 . if the value of the expires attribute is not a valid date or is empty the function assigns the โ€œ date โ€ variable a value of the date one year from the current date , step 448 . once all variables have been assigned values , the function will add the cookie to database or the cookie container for the target web site , step 460 . if a cookie with the same name currently exists in the database , the function will update the cookie data in the database with the newly cataloged cookie information . from the foregoing and as mentioned above , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the novel concept of the invention . it is to be understood that no limitation with respect to the specific embodiments illustrated herein is intended or should be inferred . it is , of course , intended to cover by the appended claims all such modifications as fall within the scope of the claims .
6
a first embodiment will be explained , referring to fig1 to 3 . fig1 is a front cross sectional view of a lamp of a light source apparatus 1 according to the embodiment , taken along a longitudinal direction . fig2 is a front cross sectional view of the light source apparatus 1 shown in fig1 , in which a reflection mirror support plate 71 , a first lamp holding section supporting plate 52 and a second lamp holding supporting member 62 are separated from one another , and a xenon lamp 2 is omitted . fig3 is a plan view of the light source apparatus shown in fig2 . as shown in these figures , the light source apparatus 1 includes a short arc type xenon lamp 2 having a spherical bulb 21 , a pair of electrodes 22 which face each other in the bulb 21 , and a pair of sealing portions 23 in which the respective electrode 22 are buried in the bulb 21 at both ends thereof . mouthpieces 24 and 25 are provided in the respective sealing portions 23 . reflection mirrors 3 and 4 are arranged so that the bulb 21 of the xenon lamp 2 may be surrounded by the reflection mirrors 3 and 4 and provided between the mouthpiece 24 and the mouthpiece 25 . a first lamp holding section 51 holds the mouthpiece 24 , and a first lamp holding section supporting plate 52 supports the first lamp holding section 51 . a first lamp holding section side positioning member 53 is provided on the first lamp holding section supporting plate 52 , and the first lamp holding section supporting plate 52 has an end surface 54 . screw holes 55 are formed in the first lamp holding section side positioning member 53 . a second lamp holding section 61 holds the mouthpiece 25 at the other side thereof . a second lamp holding section supporting plate 62 supports the second lamp holding section 61 . the second lamp holding section side positioning member 63 is provided on the second lamp holding section supporting plate 62 . the second lamp holding section supporting plate 62 has an end surface 64 . screw holes 65 are formed in the second lamp holding section side positioning member 63 . the reflection mirror support plate 71 supports the reflection mirrors 3 and 4 . the first positioning member 72 is provided on the reflection mirror support plate 71 in the reflection mirror 3 side . the second positioning member 73 is provided on the reflection mirror support plate 71 in the reflection mirror 4 side . the reflection mirror support plate 71 has one end face 74 and the other end face 75 . screw holes 76 are formed in the reflection mirror support plate 71 . a first fixing member 81 such as a screw is provided in the first positioning member 72 . a second fixing member such as a screw is provided in the second positioning member 73 . first temporary fixing members 83 such as screws are used at time of transportation . second temporary fixing members 84 are also used at time of transportation . the light source apparatus 1 according to an embodiment can be disassembled so that the reflection mirror support plate 71 , the first lamp holding section supporting plate 52 , and the second lamp holding section supporting plate 62 may be separately removed , as shown in fig1 - 3 . in fig1 , the xenon lamp 2 is installed in a state where the first lamp holding section supporting plate 52 and the reflection mirror support plate 71 which supports the reflection mirrors 3 and 4 respectively are joined by the first temporary fixing members 81 , and where the reflection mirror support plate 71 and the second lamp holding section supporting plate 62 are joined by the second temporary fixing member 82 . in addition , xenon gas is enclosed inside the bulb 21 of the xenon lamp 2 so that the gas pressure at time of lamp lighting may be set to 2 - 8 mpa . the pair of electrodes 22 is connected with a power supply ( not shown ), and rated lighting electric power of 2 - 7 kw is inputted thereto so that the xenon lamp 2 is turned on . at the time of lighting of the xenon lamp 2 , since the pair of electrodes 22 which face each other has a short distance between electrodes 22 ( close to each other ), the diameter of an arc is small so that a point light source becomes small . in addition , as shown in fig1 , a direction of a central axis of the pair of electrodes 22 of the xenon lamp 2 is shown as an x axial direction , a direction which is perpendicular to the electrodes 22 and in which the first lamp support member 5 which supports the xenon lamp 2 extends , is shown as a y axial direction , and a direction which is perpendicular to the x axial direction and the y axial direction is shown as a z axial direction . fig2 and 3 shows a state where after reflection mirrors 3 and 4 etc . are damaged , the reflection mirror support plate 71 on which reflection mirrors 3 and 4 are newly installed is about to be joined with the first lamp holding section supporting plate 52 which supports the first lamp holding section 51 which was not broken , and the second lamp holding section supporting plate 62 which supports the second lamp holding section 61 . as shown in these figures , the first lamp holding section side positioning member 53 is provided at an end portion of the first lamp holding section supporting plate 52 , which is located in the reflection mirror support plate 71 side of the plate 52 . the second lamp holding section side positioning member 63 is provided at an end portion of the second lamp holding section supporting plate 62 which is located in the reflection mirror support plate 71 side of the plate 62 . at the first lamp holding section side positioning member 53 and an end portion of the reflection mirror support plate 71 which is located in the first lamp holding section supporting plate 52 side of the support plate 71 , screw stop holes 55 and 76 for the first temporary fixing members 83 are provided . screw stop holes 65 and 76 for the second temporary holding members 84 are respectively provided in the second lamp holding section side positioning member 63 and an end portion of the reflection mirror support plate 71 which is located in the second lamp holding section supporting plate 62 side of the support plate 71 . at time of conveyance of the light source apparatus 1 , the first lamp holding section supporting plate 52 and the reflection mirror support plate 71 are temporarily fixed by the first temporary fixing members 83 , and the second lamp holding section supporting plate 62 and the reflection mirror support plate 71 are temporarily fixed by the second temporary fixing members 84 , whereby the light source apparatus 1 except the xenon lamp 1 is conveyed as a unit . in assembly of the separated parts of the light source apparatus 1 , the first and second temporary fixing members 83 and 84 for temporarily holding the parts are removed , and as shown in fig3 , the one end face 74 of the reflection mirror support plate 71 and the end face 54 of the first lamp holding section supporting plate 52 are made in contact with each other by sliding the reflection mirror support plate 71 in between the support plates 52 and 62 . however , for convenience of explanation , in fig3 , the one end face 74 of the reflection mirror support plate 71 and the end surface of the first lamp holding section supporting plate 52 are apart , and the other end face 75 of the reflection mirror support plate 71 and the end surfaces 64 of the second lamp holding section supporting plate 62 are apart . moreover , at the same time , the other end face 75 of the reflection mirror support plate 71 and the end surface 64 of the second lamp holding section supporting plate 62 are in contact with each other by sliding the support plate 71 , so that the reflection mirror support plate 71 is inserted between the first lamp holding section supporting plate 52 and the second lamp holding section supporting plate 62 . the first positioning member 72 which is located in the reflection mirror side of the support plate 71 and the first lamp holding section side positioning member 53 are made in contact with each other by the insertion , and then the second positioning member 73 which is located in the reflection mirror side and the second lamp holding section side positioning member 63 are made in contact with each other . next , the end surface 54 of the first lamp holding section supporting plate 52 and the one end face 74 of the reflection mirror support plate 71 are arranged so as to be in contact with each other , and the end surface 64 of the second lamp holding section supporting plate 62 and the other end face 75 of the reflection mirror support plate 71 are arranged so as to be in contact with each other , so that the focal point of the xenon lamp ( not shown ) held by the first lamp holding section 51 and the second lamp holding section 61 is in agreement with focal points of the reflection mirrors 3 and 4 supported on the reflection mirror support plate 71 , next , the first positioning member 72 which is located in the reflection mirror 3 side of the support plate 71 and the first lamp holding section side positioning member 53 are fixed by the first fixing members 81 , whereby the first lamp holding section supporting plate 52 and the reflection mirror support plate 71 are fixed . the second positioning member 73 which is located in the reflection mirror 4 side of the support plate 71 and the second lamp maintenance section side positioning member 63 are fixed by the second fixing member 82 , whereby the second lamp holding section supporting plate 62 and the reflection mirror support plate 71 are fixed . that is , the first lamp holding section supporting plate 52 , the reflection mirror support plate 71 , and the second lamp holding section supporting plate 62 are formed as a united light source apparatus so that the focal point of the xenon lamp ( not shown ) held by the first lamp holding section 51 and the second lamp holding section 61 is in agreement with focal points of the reflection mirrors 3 and 4 supported on the reflection mirror support plate 71 . then , the first lamp holding section supporting plate 52 and the second lamp holding section supporting plate 62 of the light source apparatus 1 , are fixed to the projector ( not shown ). for this reason , as a result , the reflection mirror support plate 71 fixed to the first lamp holding section supporting plate 52 and the second lamp holding section supporting plate 62 is also fixed to the projector ( not shown ). when the xenon lamp 2 is blown out so that the reflection mirrors 3 and 4 are damaged , the first fixing member 81 and the second fixing member 82 are removed , so that only the reflection mirror support plate 71 which supports the damaged reflection mirrors 3 and 4 is removed while the first lamp holding section supporting plate 52 and the second lamp holding section supporting plate 62 are fixed to the projector . the reflection mirror support plate 71 which supports the reflection mirrors 3 and 4 to be replaced is inserted between the first lamp holding section supporting plate 52 fixed to the projector , and the second lamp holding section supporting plate 62 , by sliding the reflection mirror support plate 71 in between the supporting plates 52 and 62 , so as to be in contact with one another . when the reflection mirror support plate 71 is inserted therein , the one end face 74 of the reflection mirror support plate 71 and the end surface 54 of the first lamp holding section supporting plate 52 are in contact with each other , and the other end face 75 of the reflection mirror support plate 71 and the end surface 64 of the second lamp holding section supporting plate 62 are in contact with each other , so that positioning thereof in the x axial direction is secured . moreover , while the first positioning member 72 which is located in the reflection mirror 3 side of the support plate 71 and the first lamp holding section side positioning member 53 are in contact with each other , the second positioning member 73 which is located in the reflection mirror 4 side of the support plate 71 and the second lamp holding section side positioning member 63 are in contact with each other , so that positioning thereof in the z axial direction can be secured . positioning of the support plate 71 in the y axial direction can be realized with the self - weight of the reflection mirror support plate 71 . according to the embodiment , the reflection mirror support plate 71 which supports the reflection mirrors 3 and 4 can be replaced by release and fixation of the first fixing member 81 and the second fixing member 82 . even if the reflection mirror support plate 71 is replaced , positioning of the support plate 71 in the x axial direction can be performed by the one end face 74 , the other end face 75 of the reflection mirror support plate 71 , the end surface 54 of the first lamp holding section supporting plate 52 , and the end surface 64 of the second lamp holding section supporting plate 62 , and further the positioning of the support plate 71 in the y axial direction can be performed by the self - weight of the reflection mirror support plate 71 . while the first positioning member 72 which is located in the reflection mirror 3 side of the support plate 71 and the first lamp holding section side positioning member 53 are in contact with each other , the second positioning member 73 which is located in the reflection mirror 4 side of the support plate 71 and the second lamp holding section side positioning member 63 are in contact with each other , so that the positioning of the support plate 71 in the z axial direction can be realized . for this reason , even if the reflection mirror support plate 71 is replaced , the focal point of the xenon lamp ( not shown ) and the focal points of reflection mirrors 3 and 4 can be made in agreement with each other . since while the support plate of light source apparatus can be separated into three parts , that is , the first lamp holding section supporting plate 52 , the reflection mirror support plate 71 , and the second lamp holding section supporting plate 62 , only the reflection mirror support plate 71 which supports the reflection mirrors 3 and 4 can be replaced by providing the first fixing members 81 and the second fixing members 82 . therefore , it is possible to reduce the cost of parts for replacement , compared with the case where the entire light source apparatus is replaced . a second embodiment of a light source apparatus is explained , referring to fig4 and 5 . fig4 is a front cross sectional view of the light source apparatus according to the embodiment , in which the light source apparatus 1 is taken apart into a reflection mirror support plate 71 , a first lamp holding section supporting plate 52 , and a second lamp holding section supporting plate 62 . fig5 is a plan view of the light source apparatus in which the reflection mirrors 3 and 4 and the reflection mirror support plate 71 which are shown in fig4 , are omitted . in these figures , elastic members 56 such as flat springs are provided on a face on which the first lamp holding section side positioning member 53 is slidably in contact with the reflection mirror support plate 71 . elastic members 66 such as flat springs are provided on a face on which the second lamp holding section side positioning member 63 is in contact with the reflection mirror support plate 71 . an elastic member 67 such as a flat spring is provided on an end surface 64 on which the second lamp holding section supporting plate 62 is in contact with the reflection mirror support plate 71 . in addition , instead of providing the elastic member 67 on the end surface 64 on which the second lamp holding section supporting plate 62 is slidably in contact with the reflection mirror support plate 71 , the elastic member may be provided on the one end face 74 , the other end face 75 of the reflection mirror support plate 71 , or the end surface 54 on which the first lamp holding section supporting plate 52 is slidably in contact with the reflection mirror support plate 71 . in these figures , explanation of the other structures corresponding to the reference numerals shown in fig2 and 3 is omitted . according to the embodiments , by providing the elastic members 56 and 66 , it is possible to securely position the reflection support plate 71 in the y axial direction . in addition , by providing the elastic member 67 , it is possible to press the one end face 74 of the reflection mirror support plate 71 onto the end face 54 of the first lamp holding section support plate 52 whereby it is possible to position it in the x axial direction . the preceding description has been presented only to illustrate and describe exemplary embodiments of the light source apparatus according to the present invention . it is not intended to be exhaustive or to limit the invention to any precise form disclosed . it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the claims . the invention may be practiced otherwise than is specifically explained and illustrated without departing from its spirit or scope .
5
the invention concerns firstly a pricking device for taking a blood sample with a moveable holder device for a pricking means , with a linear guide to guide the moveable holder device , with means for driving the moveable holder device and with a trigger device to trigger the pricking movement of the pricking means , wherein after manual activation of the trigger device the moveable holder device can be moved translationally by means of the drive means . secondly the invention concerns a method for taking a blood sample in which a pricking means is moved forward and then immediately backward , whereby the pricking means can briefly penetrate a body at least with its tip , wherein the pricking aid is guided translationally in a moveable holder device and wherein the moveable holder device is driven by a spring drive . generic devices are well known from the prior art . they are used preferably for taking blood samples in order to be able to perform medical tests on the blood drop , for example measuring the blood sugar . for this such a device can be placed on a patient &# 39 ; s skin area in order to allow insertion in the skin of a suitable pricking means , such as an interchangeable lancet of the device , whereby after pricking by the pricking means one or more drops of blood can be taken from the damaged capillary vessels in the upper skin layers . in order to reduce the damage to the skin layers as far as possible , such pricking means are often moved forward and back translationally along a pricking axis . for example patent specification u . s . pat . no . 5 , 527 , 334 describes a generic pricking aid in which a needle or lancet is held by a needle holder , wherein the needle holder is mounted mobile linearly between two guide ribs inside the pricking aid . the needle is driven by a tensionable torsion spring which is attached firstly with a first leg end in the housing of the pricking aid and secondly with a second leg end in a moving coupling part of the pricking aid . the coupling part is connected by a first end area by form fit but resiliently with the needle holder and mounted by a second end area in a guide slot . when the torsion spring is released by manual activation of a corresponding trigger device , the second end area of the coupling part can be moved along the guide slot , whereby the coupling part can move the needle holder linearly forward and back . as a result the needle can in turn execute a pricking movement in which the needle tip can briefly accelerate out of the housing of the pricking aid . the object of the invention is to refine such generic pricking devices , frequently also called pricking aids , for taking blood samples . the object of the invention is achieved by a pricking device for taking a blood sample with a moveable holder device for a pricking aid , with a linear guide for guiding the moveable holder device , with means for driving the movable holder device and with a trigger device for triggering a pricking movement of the pricking aid , in which after manual operation of the trigger device the moveable holder device can be moved translationally by means of the drive means , whereby the pricking device is characterised in that the drive means have a curved track in which the moveable holder device engages directly . if the holder device engages directly in a curved track of the drive means , the construction of the pricking device can be kept very simple . thus the pricking device can be constructed particularly flat . in particular no additional coupling devices are required between the holder device and the drive means , so that smaller masses must be accelerated and / or decelerated during the pricking movement of the pricking aid or holder device . as a result a pricking movement can be performed substantially faster , whereby the puncture pain can be reduced . advantageously the holder device is driven translationally by means of the curved track so that a translational pricking movement , such as of a lancet , can be achieved by means of the curved track . the curved track serves here as a guide curve for the holder device concerned . suitable pricking means can be any structure such as lancets or needles which can penetrate suitably easily into the upper skin layers . a pricking means can for example be moved forward and back only along a straight track and / or along a curved track . evidently the course of the curved track here can be selected and designed in many ways in order to move the holder device advantageously . a movement course along the curved track is particularly simple if the curved track is formed in a closed loop . consequently an excellent embodiment also provides that the curved track is an endless curved track . in particular the benefits explained in connection with the curved track can also be transferred to the endless curved track . in particular with an endless curved track , the drive means can perform a particularly even drive movement , whereby the pricking result of the pricking means in relation to the body , such as on the upper skin layers , can be substantially improved . in this connection the object of the invention is also achieved by a method for taking a blood sample in which a pricking means is moved forwards and then directly back , whereby the pricking means can penetrate briefly into a body at least with its tip , wherein which the pricking means is guided translationally in a moveable holder device , and wherein the moveable holder device is driven by a spring drive , wherein the moveable holder device is guided directly inside and along an endless curved track of a control curved track element . advantageously in such a closed endless curved track the holder device moves only in a single peripheral direction , whereby the entire movement kinematics of the mobile components within the pricking device can be simplified . in particular because of such movement kinematics , the reverberation of the pricking means on the pricking movement can be reduced or ideally even fully excluded , whereby the risk of secondary pricking by the pricking means can be further reduced . as a result the pricking process can take place substantially less painfully . to this extent the taking of a blood sample can be made substantially more comfortable for the patient . the spring drive can be provided easily and very compactly if the drive means comprise a spring element for storage of energy . preferably the spring element can be constructed relatively flat as a leg spring . furthermore an advantageous method variant provides that the holder device is moved only in a single peripheral direction along the curved track both on the forward movement of the pricking means and on the return movement of the pricking means . in particular this extremely effectively reduces the risk of reverberation of the moveable holding device . a preferred embodiment variant in this respect thus provides that the drive means comprise a curved track element which comprises the endless curved track . this allows particularly good guidance of the endless curved track . if the control curved track element of the drive means is mounted swivelably about a swivel axis , the holder device can be mounted so that it is easily moveable translationally on the linear guide . therefore with regard to a further advantageous method variant , it is provided that the curved track is swivelled along an arc section about a swivel axis , whereby the moveable holder device is moved translationally . a swivel movement in this respect can be initiated advantageously by means of a leg spring . if also the spring element is mounted on a swivel axis of a control curved track element , the construction of the present pricking device can be further simplified . preferably the curved track is formed oval , whereby an acceleration and speed profile with regard to the holder device of the pricking means can be further influenced . in particular the holder device can be accelerated substantially better in straighter sections of an oval curved track , so that as a result in particular a faster forward movement of the pricking aid or holder device can be achieved . this is presumably because in the straighter areas of the oval curved track , there is less friction between the holder device and the guide areas of the curved track . a further advantageous embodiment provides that the curved track has a side guiding element within which the holder device is at least partly arranged and guided . if the curved track has a side guiding element , for example in the form of a groove , the holder device can be guided particularly reliably along the curved track . the holder device can engage particularly simply in the curved track , in particular in the guiding element , if the holder device has a curve follower . such a curve follower can very easily be produced by means of a guide peg which engages in the guiding element . preferably the guide peg is formed by the holder device itself . for example a curve follower is moulded on the holder device in an injection moulding method . evidently the curve follower can also be connected with the holder device in another way . if the curve follower of the holder device can always only move in one peripheral direction along the curved track both on the translational forward movement of the holder device and on the translational return movement of the holder device , only by means of the present holder device can an essentially circular drive motion be transferred directly into a linear output movement . such a transfer of movement can be achieved very well if a curve follower of the holder device is arranged inside a profile of a curved track such that the curve follower is mounted mobile inside the profile only in a single peripheral direction along the curved track . also the movement kinematics of the pricking means on a pricking device can be executed advantageously . in particular a good trigger safety of the present pricking device can be guaranteed if the curve follower of the holder device is arranged in a starting position inside the curved track , and the curved track with regard to the starting position has a inlet area for the curve follower and an outlet area for the curve follower , wherein the inlet area and outlet area are different . the operating reliability of the pricking device can be further improved if the curve follower is in a starting position such that when the pricking device is in a state ready for operation , on triggering of the pricking device the curve follower can move out of the start position over the outlet area , and after the pricking means has performed a pricking movement , it can return via the inlet area to the starting position . further advantages , objectives and properties of the present invention are explained in the description below with reference to the enclosed drawing which shows as an example a pricking device for taking a blood sample with a pricking means which can be operated repeatedly . fig1 diagrammatically a first cross - section view of a pricking device for taking a blood sample in a state ready for operation in which a curve follower of a holder device is arranged in a starting position inside a curved track of a control curved track element ; fig2 diagrammatically a further cross - section view of the pricking device in the state ready for operation of fig1 ; fig3 diagrammatically a perspective cross - section view of the pricking device in the state ready for operation of fig1 and 2 ; fig4 diagrammatically a cross - section view of the pricking device in a pricking position of a pricking means of the pricking device ; fig5 diagrammatically a further cross - section view of the pricking device in the pricking position in fig4 ; fig6 diagrammatically a cross - section view of the pricking device in a rest position after performing a pricking movement and in an untensioned state ; fig7 diagrammatically a cross - section view of a pricking device during a pricking process with spring drive again tensioned , and fig8 diagrammatically a perspective view of the housing of the pricking device from fig1 to 7 . the pricking device 1 shown in fig1 to 8 for taking blood samples has a flat housing 2 ( see in particular fig8 ) on the underside 3 of which a treatment opening 4 is provided through which for treatment a pricking means 5 can be accelerated briefly out of a housing interior 7 of the pricking device 1 in a pricking movement 6 ( see fig4 and 5 ). the pricking device 1 is a pricking device 1 which can be operated repeatedly , which after successful pricking , allows the pricking means 5 to be retracted again into the housing 2 immediately and then the pricking device 1 can be pre - tensioned again in order to be operated a second time . the pricking means 5 in the form of a pricking needle 8 , after successfully piercing the upper skin layer of a patient , is retracted again immediately into the flat housing 2 so there is no further risk of injury from the tip 9 of the pricking needle 8 . the pricking means 5 is held by a suitable moveable holder device 10 , often called a lancet holder , wherein the moveable holder device 10 can be moved forward and back translationally by means of a linear guide 11 along a fictitious pricking axis which is embodied by the pricking needle 8 . so that the pricking means 5 can ideally always perform an almost identical pricking movement 6 , the pricking device 1 has further means 12 for driving the moveable holder device 10 . these drive means 12 in this embodiment example comprise in particular a control curved track element 13 and a spring element 14 in the form of a leg spring 15 . the spring element 14 is here clamped with a first leg 16 in a housing holder 17 and with a second leg 18 in a holder 19 of the control curved track element 13 so that it can be tensioned . the drive means 12 furthermore have a curved track 20 in which the moveable holder device 10 engages directly . the curved track 20 is here allocated to the control curved track element 13 . so that the holder device 10 can follow the curved track 20 reliably when the control curved track element 13 is swivelled about a swivel axis 21 , the holder device 10 forms a curve follower 22 which is arranged in a guiding element 23 of the curved track 20 . the curved track 20 in itself is formed as an oval endless curved track 24 on the control curved track element 13 so that the curve follower 22 can also follow the curved track 20 endlessly in just one direction . in order to be able to move the control curved track element 13 manually such that the spring element 14 can be pre - tensioned with a sufficiently great spring force , on the top 25 of the flat housing 2 is provided a manually activatable button 26 which can be pressed into the flat housing 2 along arrow direction 27 . during such activation the curved track element 13 can be moved , the spring element 14 pre - tensioned and the entire pricking device 1 transferred to a tensioned state ready for operation as shown in fig1 . during the tensioning process a button element bar 28 of the manually activatable button element 26 can press against a projection 29 of the control curved track element 13 , whereby the control curved track element 13 is swivelled about the swivel axis 21 . as a result the spring element 14 is tensioned . the button element 26 can then be moved back to its starting position ( see fig1 ) by means of a coil spring 30 . in order to be able to trigger the pricking device 1 , the pricking device 1 has a suitable trigger device 31 which comprises a pusher 32 ( see for examples fig2 and 3 ) with a locking arm 33 . the locking arm 33 can suitably correspond with the moveable holder device 10 so that the moveable holder device 10 is locked with the locking arm 33 , in particular when the spring element 14 is pre - tensioned . as a result a pricking movement 6 can be prevented as long as the pusher 32 of the trigger device 31 is not activated and the trigger device 31 is not triggered . according to the depictions in fig1 to 3 , the pricking device 1 is in a tensioned state ready for operation in which the curve follower 22 inside the guiding element 23 is in a starting position 34 on the curved track 20 . the geometries and interplay of the control curved track element 13 , curved track 20 , the swivel ability 35 of the control curved track element 13 and hence the curved track 20 , the holder device 10 and the curve follower 22 are selected such that the curve follower 22 can move only in one peripheral direction 36 along the curved track 20 . in particular as a result it can be guaranteed that the holding device 10 with the pricking means 5 cannot reverberate after the actual pricking movement 6 , so it is ensured that per activation of the pricking device 1 , the pricking means 5 can only reach through the treatment opening 4 a single time . to trigger the pricking device 1 ready for operation , the pusher 32 is activated manually whereby the locking arm 33 releases the control curved track element 13 . the holder device 10 can then perform a translational forward movement 37 ( see fig4 ) in the sense of the pricking movement 6 , initiating the translational forward movement 37 and associated possible pressurisation of the pricking means 5 by the spring force or a spring movement 38 of the expanding leg spring 15 or the spring movement 38 of the second leg 18 of the spring leg 15 . the spring movement 38 swivels the control curved track element 13 about the swivel axis 21 . the control curved track element 13 is thus guided additionally in a guide 39 along an arc section 40 . due to the swivel movement of the control track element 13 , the curve follower 22 follows the curved track 20 along peripheral direction 36 and the holding device 10 with pricking means 5 can perform the pricking movement 6 . according to the depictions in fig4 and 5 , the pricking device 1 is shown in a pricking state in which the holder device 10 is deflected to a maximum in its translation forward movement 37 . the curve follower 22 is here in a position closest to the treatment opening 4 . advantageously on a translational return movement 41 of the holder device 10 , at the same time the curve follower 22 is guided in the continued forward peripheral direction 36 , as shown in particular in the view in fig4 . this immediate translational return movement 41 is also made possible by the still expanding leg spring 15 . consequently there is never an essentially reversed movement of the curve follower 22 within the curved track 20 of the control curved track element 13 . rather the curve follower 22 always moves further in the clockwise direction along the curved track 20 until the pricking device 1 reaches a rest state in an untensioned state , as shown in the view in fig6 . now the pricking device 1 can be re - tensioned for a further pricking movement 6 in that the manually activatable button element 26 is pushed in direction of arrow 27 , whereby the spring element 14 can be re - tensioned i . e . compressed with a tension movement 42 . in this tensioning process the curve follower 22 moves further along the curved track 20 in the peripheral direction 36 until the curve follower 22 has moved back to its starting position 34 , the spring element 14 is pre - tensioned and the pricking device 1 is again ready for use as shown in the view in fig7 . here too an inlet area 43 for the curve follower 22 on the curved track 20 and an outlet area 44 for the curve follower 22 on the curved track 22 are marked . the curve follower 22 runs through the outlet area 44 only when the pricking device 1 is triggered , when the curve follower 22 leaves its starting position . curve follower 22 only runs through the inlet area 43 when the pricking device 1 or spring element 14 is tensioned and the curve follower 22 is moved into the starting position 34 . to this extent the inlet area 43 and outlet area 44 are different areas of the curved track 20 . advantageously the holder device 10 with the present pricking device 1 engages directly in the curved track 20 so that a rotational movement of swivel movement of the control curved track element 13 can be converted directly with very little loss into a translational pricking movement 6 of the holding device 10 . advantageously a substantially oval curved track is used here with regard to the control curved track element 13 in order to allow maximum acceleration of the curve follower 22 and hence the pricking means 5 in the forward and subsequently in the reverse direction in the straighter sections of the substantially oval curved track 20 . this ideally allows a further reduction of the puncture pain . the curved track 20 essentially serves as a guide curve for the holding device 10 and its triggering . thus the pricking means 5 can only pierce the skin once and not โ€” as in previous spring - guided systems โ€” lead to reverberation and thus secondary pricking or repeated piercing of the skin . also the entire structure of the present pricking device 1 advantageously has a particularly flat design as all essentially moveable components can be formed flat and are low in number . in particular only one curve follower 22 is required , which is also arranged in a guiding element 23 and thus requires no additional construction height inside the pricking device 1 . all features disclosed in the application documents are claimed as essential to the invention as they where novel individually or in combination in relation to the prior art .
0
embodiments of the invention are directed to a seal assembly for use with a coaxial cable system component and to a coaxial cable system component including a seal assembly in accordance with the described embodiments . throughout the description , like reference numerals will refer to like parts in the various drawing figures . for ease of description , the coaxial cable system components such as connectors , termination devices , filters and the like , referred to and illustrated herein will be of a type and form suited for connecting a coaxial cable or component , used for catv or other data transmission , to an externally threaded port having a โ…œ inch - 32 unef 2a thread . those skilled in the art will appreciate , however , that many system components include a rotatable , internally threaded nut that attaches the component to a typical externally threaded port , the specific size , shape and component details may vary in ways that do not impact the invention per se , and which are not part of the invention per se . likewise , the externally threaded portion of the port may vary in dimension ( diameter and length ) and configuration . for example , a port may be referred to as a โ€œ short โ€ port where the connecting portion has a length of about 0 . 325 inches . a โ€œ long โ€ port may have a connecting length of about 0 . 500 inches . all of the connecting portion of the port may be threaded , or there may be an unthreaded shoulder immediately adjacent the threaded portion , for example . in all cases , the component and port must cooperatively engage . according to the embodiments of the present invention , a sealing relationship is provided for the otherwise exposed region between the component connector and the externally threaded portion of the port . a preferred embodiment of the invention is directed to a seal assembly 90 for use with a coaxial connector , exemplary aspects of which are illustrated in fig2 - 5 . in a general aspect 90 - 1 illustrated in fig2 and 3 , the seal assembly 90 includes a seal 60 and a nut component 40 . the seal and the nut component form an integral assembly as illustrated in fig2 . an exemplary seal 60 is illustrated in fig1 a , 1b , 1 c , and fig2 . the seal 60 has a generally tubular body that is elastically deformable by nature of its material characteristics and design . in general , the seal 60 is a one - piece element made of a compression molded , elastomer material having suitable chemical resistance and material stability ( i . e ., elasticity ) over a temperature range between about โˆ’ 40 ยฐ c . to + 40 ยฐ c . a typical material can be , for example , silicone rubber . alternatively , the material may be propylene , a typical o - ring material . other materials known in the art may also be suitable . the interested reader is referred to http :// www . applerubber . com for an exemplary listing of potentially suitable seal materials . the body of seal 60 has an anterior end 58 and a posterior end 59 , the anterior end being a free end for ultimate engagement with a port , while the posterior end is for ultimate connection to the nut component 40 of the seal assembly . the seal has a forward sealing surface 68 , a rear sealing portion 61 including an interior sealing surface 62 that integrally engages the nut component ( described in greater detail below ), and an integral joint - section 65 intermediate the anterior end 58 and the posterior end 59 of the tubular body . the forward sealing surface 68 at the anterior end of the seal 60 may include annular facets 68 a , 68 b and 68 c to assist in forming a seal with the port . alternatively , forward sealing surface 68 may be a continuous rounded annular surface that forms effective seals through the elastic deformation of the internal surface and end of the seal compressed against the port . the integral joint - section includes a portion of the length of the seal which is relatively thinner in radial cross - section to encourage an outward expansion or bowing of the seal upon its axial compression . in the exemplary embodiment , the nut grasping surface includes an interior sealing surface 62 which forms an annular surface on the inside of the tubular body , and an internal shoulder 67 of the tubular body adjacent the posterior end 59 , as illustrated . in its intended use , compressive axial force may be applied against one or both ends of the seal depending upon the length of the port intended to be sealed . the force will act to axially compress the seal whereupon it will expand radially in the vicinity of the integral joint - section 65 . in an aspect , the integral joint - section 65 is located axially asymmetrically intermediate the anterior end 58 and the posterior end 59 of the tubular body , and adjacent an anterior end 62 โ€ฒ of the interior sealing surface 62 , as illustrated . in a preferred embodiment , the tubular body has an interior diameter , d 2 , at the integral joint - section 65 equal to about 0 . 44 inches in an uncompressed state . the tubular body has a length , l , from the anterior end 58 to the posterior end 59 of about 0 . 36 inches in an uncompressed state . however , it is contemplated that the joint - section 65 can be designed to be inserted anywhere between sealing surface 62 and anterior end 58 . the seal is designed to prevent the ingress of corrosive elements when the seal is used for its intended function . the nut component 40 of the seal assembly 90 , illustrated by example in fig2 and 3 , has an interior surface , at least a portion 41 of which is threaded , a connector - grasping portion 42 , and an exterior surface 45 including a seal - grasping surface portion 47 . in an aspect , the seal - grasping surface 47 can be a flat , smooth surface or a flat , roughened surface suitable to frictionally and / or adhesively engage the interior sealing surface 62 of the seal 60 . in an exemplary aspect , the seal - grasping surface 47 may also contain a ridge 48 that together with the seal grasping surface forms a groove or shoulder that is suitably sized and shaped to correspondingly engage the internal shoulder 67 of the seal adjacent the interior sealing surface 62 in a locking - type interference fit between the nut component 40 and the seal 60 as illustrated in fig2 . the exemplary nut component 40 further includes a nut - turning surface portion 46 on surface 45 . in the exemplary aspect shown in fig3 , the nut - turning surface portion 46 has at least two flat surface regions that allow engagement with the surfaces of a tool such as a wrench . typically , the nut - turning surface in this aspect will be hexagonal . alternatively , the nut turning surface may be a knurled surface to facilitate hand - turning of the nut component . upon engagement of the seal with the nut component , a posterior sealing surface 64 of the seal abuts a side surface 43 of the nut as shown in fig2 to form a sealing relationship in that region . in an exemplary aspect , the connector - grasping portion 42 of the nut component 40 is an internally - projecting shoulder that engages a flange 25 on the connector post 23 ( described below ) in such a manner that the nut component ( likewise , the seal assembly 90 ) can be freely rotated as it is held in place as part of the connector . an additional exemplary aspect 90 - 2 of the seal assembly is illustrated in fig4 . the seal assembly of the invention may further include a seal ring 180 having an inner surface 182 and an outer surface 184 . the inner surface has a diameter such that the seal ring is slid over the nut component and creates a press - fit against an exterior rear surface portion 61 of the seal that is radially adjacent the interior sealing surface 62 . this press fit over the posterior end 59 of the seal 60 enhances the sealing characteristics between the nut 40 and posterior sealing surfaces 62 and 64 . in an exemplary aspect , the outer surface 184 of the seal ring 180 is knurled to facilitate hand - turning of the seal assembly . flat portions 46 of the nut turning surface may remain exposed to additionally facilitate the use of a tool for turning the assembly . a further exemplary aspect 90 - 3 of the seal assembly is illustrated in fig5 . a seal ring 180 โ€ฒ has a flange 183 extending outwardly from a posterior perimeter of the seal ring . as in the case of seal ring 180 described above , an internal surface 182 of seal ring 180 โ€ฒ creates a press - fit against the exterior surface portion 61 of the seal that is radially adjacent the interior sealing surface 62 . the flange 183 provides a surface that facilitates pushing the seal ring into its assembled position . as described above , flat portions 46 of the nut turning surface may remain exposed to additionally facilitate the use of a tool for turning the assembly . another embodiment of the invention is directed to a connector 10 as shown , for example , in fig3 and 6 , for connecting a coaxial cable to a port 100 , 110 and 120 as shown for illustration in fig1 - 12 . the exemplary connector 10 , illustrated in exploded view in fig3 , includes a tubular connector body 20 having first and second ends 21 and 22 , respectively . the connector body 20 accepts and retains a coaxial cable 12 as shown in fig6 , by any one of many methods well known in the art . well known means for attaching a connector body to the cable include hexagonal , circular or conical crimping and the radial compression of components caused by the axial or threaded rotational movement of tapered or stepped sleeves or rings . the exemplary connector 10 includes a connector post 23 that functions , as is well known in the art , to electrically engage the outer conductor of the coaxial cable . furthermore , the post 23 has a flange 25 , which upon assembly with the connector body 20 provides a slot 26 between the flange and the second end 22 of the body 20 . connector 10 further includes a nut component such as nut component 40 described above . the connector grasping shoulder 42 of the nut component 40 shown in fig2 engages the slot 26 , allowing the nut component to be an integral , rotatable part of the connector upon assembly . in the exemplary connector 10 , a compression ring 24 slides over the connector body 20 to secure the integrity of the connector assembly . as described previously , seal 60 and nut component 40 form integral seal assembly 90 , which are part of connector 10 . a cut - away view of exemplary connector 10 is shown in fig6 and , as assembled , as connector 10 - 1 in fig7 . alternative exemplary connectors 10 - 2 , 10 - 3 , incorporating respective seal assemblies 90 - 2 , 90 - 3 , are illustrated in fig8 and 9 , respectively . exemplary illustrations of the intended use and configurations of connector 10 are shown in fig1 - 12 . referring to fig1 a , connector 10 - 1 is positioned in axial alignment with a โ€œ short โ€ externally threaded port 100 . short port 100 has a length of external threads 102 extending from a terminal end 104 to an enlarged shoulder 106 . the length of the external threads 102 is shorter than the length , l , of seal 60 ( i . e ., seal 60 in uncompressed state ). referring to fig1 b , connector 10 - 1 and short port 100 are shown โ€œ connected โ€. seal 60 is axially compressed between nut 40 and enlarged shoulder 106 of port 100 . posterior sealing surface 64 is axially compressed against side surface 43 of nut 40 and the end face 68 a of forward sealing surface 68 is axially compressed against enlarged shoulder 106 thus preventing ingress of environmental elements between nut 40 and enlarged shoulder 106 of the port 100 . referring to fig1 a , connector 10 - 1 is positioned in axial alignment with a โ€œ long โ€ externally threaded port 110 . long port 110 is characterized by having a length of external threads 112 extending from a terminal end 114 of port 110 to an unthreaded diameter 116 that is approximately equal to the major diameter of external threads 112 . unthreaded portion 116 then extends from external threads 112 to an enlarged shoulder 118 . the length of external threads 112 in addition to unthreaded portion 116 is longer than the length that seal 60 extends outward from side surface 63 when seal 60 is in an uncompressed state . connector 10 - 1 and long port 110 are shown connected in fig1 b . seal 60 is not axially compressed between nut 40 and enlarged shoulder 118 . rather , internal sealing surface 62 is radially compressed against the seal grasping surface 47 of nut 40 and the interior portion 68 b and 68 c of forward sealing surface 68 are radially compressed against unthreaded portion 116 , preventing the ingress of environmental elements between nut 40 and unthreaded portion 116 of port 110 . the radial compression of both internal sealing surface 62 against seal grasping surface 47 of nut 40 and forward sealing surface 68 against unthreaded portion 116 is created by an interference fit between the sealing surfaces and their respective mating surfaces . fig1 a shows connector 10 - 1 positioned in axial alignment with an alternate externally threaded port 120 . the portions 126 , 122 of alternate port 120 are similar to those of long port 110 ( fig1 ), however , the diameter of the unthreaded portion 126 is larger than the major diameter of the external threads 122 . as shown in fig1 b , connector 10 - 1 is connected to alternate port 120 . internal sealing surface 62 is radially compressed against seal grasping surface 47 of nut 40 and forward sealing surface 68 is radially compressed against unthreaded portion 126 , preventing the ingress of environmental elements between nut 40 and unthreaded portion 126 . the radial compression of both the internal sealing surface 62 against seal grasping surface 47 of nut 40 and forward sealing surface 68 against unthreaded portion 126 is created by an interference fit between the sealing surfaces and their respective mating surfaces . a modified embodiment of the seal assembly 90 โ€ฒ is illustrated in fig1 and 14 . the materials function and operation of the modified embodiment of the seal assembly is substantially similar to the exemplary embodiment described above with the exception that the posterior portion of the seal 60 โ€ฒ attaches to the interior surface rather than the exterior surface of the nut component 40 โ€ฒ. the modified embodiment of the seal also has a generally tubular body that is elastically deformable by nature of its material characteristics and design . the tubular body of seal 60 โ€ฒ has an anterior end 58 and a posterior end 59 , the anterior end being a free end for ultimate engagement with a port , while the posterior end is for ultimate connection to the nut component 40 โ€ฒ of the alternative seal assembly . the seal has a forward sealing surface 68 that may either have facets or a continuously curved surface , a rear sealing portion 61 including an exterior sealing surface 62 โ€ฒ that integrally engages the nut component ( described in greater detail below ), and an integral joint - section 65 intermediate the anterior end 58 and the posterior end 59 of the tubular body . the sealing surface 62 โ€ฒ is an annular surface on the exterior of the tubular body . the seal 60 โ€ฒ may also have a ridge 67 โ€ฒ at the posterior end 59 which together with the nut grasping surface 62 โ€ฒ locks in an interference fit with a corresponding shoulder 48 on the nut component 40 โ€ฒ, as illustrated . in its intended use , compressive axial force may be applied against one or both ends of the seal depending upon the length of the port intended to be sealed . the force will act to axially compress the seal whereupon it will expand radially in the vicinity of the integral joint - section 65 . the nut component 40 โ€ฒ of the modified seal assembly 90 โ€ฒ and connector 10 โ€ฒ, illustrated by example in fig1 and 14 , has an interior surface , at least a portion 41 of which is threaded , a connector - grasping portion 42 , and an interior surface including a seal - grasping surface portion 47 . in an aspect , the seal - grasping surface 47 can be a flat , smooth surface or a flat , roughened surface suitable to frictionally and / or adhesively engage the interior sealing surface 62 โ€ฒ of the seal 60 โ€ฒ. in an aspect , the seal - grasping surface 47 contains a shoulder 48 that is suitably sized and shaped to engage the ridge 67 of the posterior end 59 of the seal 60 โ€ฒ sealing surface groove 62 โ€ฒ in a locking - type interference fit as illustrated in fig1 and 14 . the modified nut component 40 โ€ฒ further includes nut - turning surface portions 46 on surface 45 . upon engagement of the seal with the nut component , a sealing surface 64 โ€ฒ of the seal abuts a end surface 43 โ€ฒ of the nut as shown in fig1 and 14 to form a sealing relationship in that region . this modified embodiment of the seal assembly may be substituted for the preferred seal assembly of fig4 through 9 in the exemplary embodiments incorporating connectors and seal rings as described above . a second modified embodiment of the seal assembly is illustrated in fig1 and 16 . the seal - grasping surface 47 similarly can be a flat , smooth surface or a flat , roughened surface suitable to frictionally and / or adhesively engage the interior sealing surface of the seal 60 . in this modified embodiment , however , the forward ridge that formed the interlocking interference fit between corresponding shoulders 48 and 67 of the nut and the seal , respectively , have been eliminated . rather , the nut seal is retained on the seal grasping surface due to either the compressive force of the elastomer material of the seal member on the seal grasping surface 47 or the frictional forces between these surfaces , alone or in conjunction with an adhesive bond between the seal grasping surface 47 of the nut 40 and the nut grasping surface 62 of the seal 60 . in all other aspects , this second modified embodiment of the nut seal assembly and connectors incorporating the same operate in the same manner as exemplary embodiment of the assembly discussed above and depicted in fig1 through 12 . a modified embodiment of the invention incorporated in a termination device or terminator is depicted in fig1 . the terminator 130 includes a housing 30 having a first end 32 and a second end 33 , and a seal assembly 90 - 2 . the first end 32 of the housing includes a bore defining an inner surface . a portion of the inner surface has interior threads 31 for engaging the threads of an unused cable port . the inner surface may also include a resistor chamber 35 for holding a resistor 36 . the resistor matches the impedance of a coaxial cable to maintain the integrity of the signal carried to subscribers . the second end 33 of the housing may have an external surface including two or more flats for the engagement of a tool such as a wrench . the external surface may be hexagonal in shape . the first end of the housing also an exterior surface including a seal - grasping surface portion 37 . in an aspect , the seal - grasping surface 37 can be a flat , smooth surface or a flat , roughened surface suitable to frictionally and / or adhesively engage the interior sealing surface 62 of the seal 60 . in an exemplary aspect , the seal - grasping surface 37 may also contain a ridge 38 that together with the seal grasping surface forms a groove or shoulder that is suitably sized and shaped to correspondingly engage the internal shoulder 67 of the seal adjacent the interior sealing surface 62 in a locking - type interference fit between the terminator housing 30 and the seal 60 as illustrated in fig1 . in all aspects , the seal 60 is substantially as the exemplary seal described above and as illustrated in fig1 a , 1b , 1 c , and fig2 . the seal 60 has a generally tubular body that is elastically deformable by nature of its material characteristics and design . the seal has a forward sealing surface 68 , a rear sealing portion 61 including an interior sealing surface 62 that integrally engages either the cylindrical outer surface of the housing 37 or the ridge 38 , and an integral joint - section 65 intermediate the anterior end 58 and the posterior end 59 of the tubular body . the seal assembly of the invention incorporated in a termination device may further include a seal ring 180 having an inner surface 182 and an outer surface 184 . in all aspects , the seal ring 180 is as described above and as illustrated in fig4 . the seal ring inner surface has a diameter such that the seal ring is slid over the terminator housing 30 and creates a press - fit against an exterior rear surface portion 61 of the seal that is radially adjacent the interior sealing surface 62 . this press fit over the posterior end 59 of the seal 60 enhances the sealing characteristics between the housing 30 and posterior sealing surfaces 62 and 64 . in an exemplary aspect , the outer surface 184 of the seal ring 180 is knurled to facilitate hand - turning of the seal assembly . in all other aspects , this embodiment of the seal assembly incorporated on the terminator operates in the same manner as exemplary embodiment of the assembly discussed above and depicted in fig1 through 12 . a further modified embodiment of the invention incorporated in a tamper - resistant termination device is depicted in fig1 . the terminator 130 a includes a generally cylindrical housing 30 a having a first end 32 and a second end 33 , an outer shell 70 with a first end 72 and a second end 73 , and a seal assembly 90 - 2 . the first end 32 of the housing includes a bore defining an inner surface . a portion of the inner surface has interior threads 31 for engaging the threads of an unused cable port . the outer shell 70 rotates independently of the housing 30 and has an opening 74 at the second end for the insertion of a specialized tool ( not shown ) for mating with a complementary structure 75 on the second end of the housing . once the tool is properly engaged with the housing , rotation of the tool causes rotation of the housing 30 to selectively install or remove the housing from the threaded port . in all aspects , the seal 60 is substantially the exemplary seal described above and as illustrated in fig1 a , 1b , 1 c , and fig2 . the first end 72 of the shell also an exterior surface including a seal - grasping , cylindrical surface portion 77 . in an aspect , the seal - grasping surface 77 can be a flat , smooth surface or a flat , roughened surface suitable to frictionally and / or adhesively engage the interior sealing surface 62 of the seal 60 . in an exemplary aspect , the seal - grasping surface 77 may also contain a ridge 78 that together with the seal grasping surface forms a groove or shoulder that is suitably sized and shaped to correspondingly engage the internal shoulder 67 of the seal adjacent the interior sealing surface 62 in a locking - type interference fit between the outer shell 70 and the seal 60 as illustrated in fig1 . the seal assembly of the invention incorporated in the tamper resistant termination device may further include a seal ring 180 having an inner surface 182 and an outer surface 184 . in all aspects , the seal ring 180 is as described above and as illustrated in fig4 . the seal ring inner surface has a diameter such that the seal ring is slid over the outer shell 70 and creates a press - fit against an exterior rear surface portion 61 of the seal that is radially adjacent the interior sealing surface 62 . this press fit over the posterior end 59 of the seal 60 enhances the sealing characteristics between the outer shell 70 and posterior sealing surfaces 62 and 64 . in all other aspects , this embodiment of the seal incorporated on the tamper - resistant terminator operates in the same manner as the exemplary embodiment of the seal discussed above and depicted in fig1 through 12 . a still further modified embodiment of the invention incorporated in another tamper - resistant termination device is depicted in fig1 . the terminator 130 b is in many features similar to the termination device 130 a of fig1 . the second end 73 of the outer shell also includes external threads 76 for the mating of a coaxial cable connector ( not shown ). such a termination device may be positioned between a previously used output port and the corresponding drop line when the service to that particular subscriber is suspended without requiring that the full wiring to that subscriber be removed . service can be restored simply by removing the interposed termination device and reconnecting the cable to the port . in lieu of the seal ring , the first end 72 of the outer shell 70 has an inner surface 78 and an outer surface 79 . the inner surface 78 of the first end of the outer shell is 70 configured to be radially above the seal - grasping , cylindrical surface 37 of the terminator housing 30 b and creates a press - fit against an exterior rear surface portion 61 of the seal that is radially adjacent the interior sealing surface 62 . in other all aspects , this embodiment of the seal 60 incorporated on the tamper - resistant terminator 130 b operates in the same manner as exemplary embodiment of the seal assembly discussed above and depicted in fig1 . a modified embodiment of the invention incorporated in a filter or trap 140 is depicted in fig2 and 21 . the filter includes a generally cylindrical housing 145 having a first end 142 including an internally threaded connector 141 and a second end 143 including an externally threaded connector 144 , and a seal assembly 90 - 3 surrounding the internally threaded connector 141 at the first end of the filter housing . the exterior surface of the internally threaded connector includes a seal - grasping surface portion 147 . in an aspect , the seal - grasping surface 147 can be a flat , smooth surface or a flat , roughened surface suitable to frictionally and / or adhesively engage the interior sealing surface 62 of the seal 60 . in an exemplary aspect , the seal - grasping surface 147 may also contain a ridge 148 that together with the seal grasping surface forms a groove or shoulder that is suitably sized and shaped to correspondingly engage the internal shoulder 67 of the seal adjacent the interior sealing surface 62 in a locking - type interference fit between the connector 141 and the seal 60 as illustrated in fig2 and 18 . in all aspects , the seal 60 is substantially the exemplary seal described above and as illustrated in fig1 a , 1b , 1 c , and fig2 . the seal 60 has a generally tubular body that is elastically deformable by nature of its material characteristics and design . the seal has a forward sealing surface 68 , a rear sealing portion 61 including an interior sealing surface 62 that integrally engages either the seal - grasping surface 147 of the connector 141 or the ridge 148 , and an integral joint - section 65 intermediate the anterior end 58 and the posterior end 59 of the tubular body . the seal assembly of the invention incorporated in a filter housing may further include a seal ring 180 โ€ฒ having an inner surface 182 and an outer surface 184 . in all aspects , the seal ring 180 โ€ฒ is as described above and as illustrated in fig5 . the seal ring inner surface has a diameter such that the seal ring 180 โ€ฒ is slid over the internally threaded connector and creates a press - fit against an exterior rear surface portion 61 of the seal that is radially adjacent the interior sealing surface 62 . this press fit over the posterior end 59 of the seal 60 enhances the sealing characteristics between the connector 141 and posterior sealing surfaces 62 and 64 . in an exemplary aspect , the outer surface 184 of the seal ring 180 may include a flange 183 to facilitate pushing the seal ring into its assembled position and to facilitate hand - turning of the seal assembly . in all other aspects , this embodiment of the seal assembly incorporated on the filter operates in the same manner as exemplary embodiment of the assembly discussed above and depicted in fig5 and 9 . in accordance with another exemplary embodiment of the present invention that is applicable to any or all of the aforementioned embodiments or aspects , the seal 60 can be at least partially formed of a material that enhances the likelihood of a conductive path being maintained within the connector even if one or more of the connections within the connector become ( s ) loosened . that , in turn , has the beneficial effect of decreasing the occurrence of undesired system performance conditions ( e . g ., radio frequency interference ( rfi )) that can arise due to the loss of a conductive path caused by one or more loosened connections . exemplary such materials include , but are not limited to those that have similar physical properties to the materials described above ( e . g ., silicone rubber , propylene or other elastomer materials having suitable chemical resistance and material stability ( i . e ., elasticity ) over a temperature range between about โˆ’ 40 ยฐ c . to + 40 ยฐ c .) from which the seal 60 can be made , yet that also exhibit high electrical conductivity . by way of non - limiting example , materials that possess this combination of properties include , but are not limited to conductive elastomers , such as so - called โ€œ metal rubber ,โ€ which includes but is not limited to the โ€œ metal rubber โ€ material commercially available from nanosonic , inc . of blacksburg , va . usa . still in accordance with an exemplary embodiment of the present invention , at least some of the seal 60 can be formed of one or more of such โ€œ metal rubber โ€ materials . by way of non - limiting example , portions anterior and / or posterior to the integral joint section 65 ( see fig1 a and 1b ) of the seal 60 can be formed of โ€œ metal rubber .โ€ however , for various reasons ( e . g ., ease of manufacture ), it is currently preferred for the entire seal 60 , rather than merely portions thereof , to be made of โ€œ metal rubber .โ€ in accordance with an exemplary embodiment of the present invention , and prior to actual installation of the connector 10 , a seal assembly 90 ( see fig2 ) is formed by attaching , connecting or otherwise placing into tactile communication the โ€œ metal rubber โ€ seal 60 and the nut component 40 . this can occur , by way of non - limiting example , by causing a seal - grasping surface 47 ( see fig3 ) to frictionally and / or adhesively engage the interior sealing surface 62 of the seal 60 . in an exemplary embodiment of the present invention , the seal - grasping surface 47 may also contain a ridge 48 that , together with the seal grasping surface , forms a groove or shoulder that is suitably sized and shaped to correspondingly engage the internal shoulder 67 of the seal adjacent the interior sealing surface 62 in a locking - type interference fit between the nut component 40 and the seal 60 as illustrated , e . g ., in fig2 . the nut component 90 to which the seal 60 is engaged is also itself engaged ( e . g ., rotatably ) with a connector post 23 ( see , e . g ., fig3 ) that functions , as is well known in the art , to electrically engage the outer conductor of the coaxial cable . optionally , the seal 60 also can cooperatively engage a port 100 ( see , e . g ., fig1 a , 10b , 11 a and 11 b ) such that upon rotation of the seal assembly 60 the nut component 90 engages ( e . g ., threadedly ) the port whereby the forward sealing surface 68 of the seal engages the port to form a moisture - resistant barrier between the connector 10 and the port . also by way of non - limiting example , and as is currently preferred , the entire nut component 90 , or at least the portions thereof that are in tactile communication with the seal 60 once the seal assembly 90 has been assembled , can be made of a conductive material ( e . g ., a metal - based material such as brass ), as can the post 23 and the port 100 . this , in turn , ensures that a conductive path is formed through the seal assembly 90 , including between the โ€œ metal rubber โ€ seal 60 and the metal nut component 90 , and to the port 100 and the post 23 . as such , even if any or all of the connections between the seal 60 and the nut component 90 , the seal and post 23 , and the seal and the port 100 become ( s ) somewhat loosened ( yet still remains at least partially connected ), the highly conductive โ€œ metal rubber โ€ from which the seal 60 is made will act to maintain an uninterrupted conductive path from the connector 10 to the cable , thus , in turn , decreasing the occurrence of negative system performance conditions ( e . g ., radio frequency interference ( rfi )) that could otherwise arise due to the loss of a conductive path . while the invention has been described in terms of exemplary embodiments and aspects thereof , and with reference to the accompanying drawings , it will be understood by those skilled in the art that the invention is not limited to the exemplary and illustrative embodiments . rather , various modifications and the like could be made thereto without departing from the scope of the invention as defined in the appended claims .
7
it is to be understood that the figures and descriptions of embodiments of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for the purpose of clarity , many other elements found in typical website and audio / visual content delivery systems and methods . those of ordinary skill in the art may recognize that other elements and / or steps are desirable and / or required in implementing the present invention . however , because such elements and steps are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements and steps is not provided herein . for non - limiting purposes of explanation only , โ€œ computer ,โ€ as referred to herein , refers to a general purpose computing device that includes a processor . โ€œ processor ,โ€ as used herein , refers generally to a device including a central processing unit ( cpu ), such as a microprocessor . a cpu generally includes an arithmetic logic unit ( alu ), which performs arithmetic and logical operations , and a control unit , which extracts instructions ( e . g ., code ) from memory and decodes and executes them , calling on the alu when necessary . โ€œ memory ,โ€ as used herein , refers to one or more devices capable of storing data , such as in the form of chips , or other medium like magnetic or optical discs . memory may take the form of one or more random - access memory ( ram ), read - only memory ( rom ), programmable read - only memory ( prom ), erasable programmable read - only memory ( eprom ), or electrically erasable programmable read - only memory ( eeprom ) chips , by way of further non - limiting example only . memory may be internal or external to an integrated unit including the processor . memory may be internal or external to the computer such memory may store a computer program , e . g ., code or a sequence of instructions being operable by the processor . such a computer may include one or more data inputs . such a computer may include one or more data outputs . the code stored in memory may cause the processor , when executed by the processor , to set an output to a value responsively to a sensed input . one type of computer executable code typically stored in memory so as to be executable by an internet enabled computer is a browser application . for non - limiting purposes of explanation only , โ€œ browser application โ€ or โ€œ browser ,โ€ as used herein , generally refers to computer executable code used to locate and display web pages . commercially available browsers are microsoft internet explorer , netscape navigator , apple safari , google chrome and firefox , which all support text , graphics and multimedia information , including sound and video ( sometimes through browser plug - in applications ). โ€œ plug - in ,โ€ as used herein , generally refers to computer executable code that adds a specific feature or service to a larger system , in the case of a browser plug - in , the browser application . the terms โ€œ computer ,โ€ โ€œ computer device and / or โ€œ computer system โ€ as used herein may generally take the form of single computing devices or collections of computing devices having a common operator or under common control . according to certain embodiments of the present invention , content may be aggregated for presentation to users . according to certain embodiments of the present invention , audio content may be aggregated for presentation to users . according to certain embodiments of the present invention , video content may be aggregated for presentation to users . according to certain embodiments of the present invention , audio and video content may be aggregated for presentation to users . referring now to fig1 , there is shown a block diagram of a system of networked computers 10 . the illustrated system 10 includes a plurality of user computers 20 , a plurality of network server computers 30 and a network 40 interconnecting computers 20 , 30 together . illustrated system 10 includes personal computing devices 22 and a personal digital assistant computer / web - enabled cell phone computer 24 by way of non - limiting example only . communication links 26 communicatively couple devices 20 with network 40 . links 26 may take the form of wired and / or wireless communications links , including fiber optic , pots , dsl , cable and / or multiple access or gsm based wireless telephony or data communications systems , for example . network 40 may include portions of proprietary and service provider networks , as well as the internet , for example . illustrated system 10 includes a database server 32 , a content or web server 34 and a file server 36 , all by way of non - limiting example only . communication links 26 communicatively couple devices 30 with network 40 as well . โ€œ server โ€, as used herein , generally refers to a computing device communicatively coupled to a network and that manages network resources . a server may refer to a discrete computing device , or may refer to an application that is managing resources rather than the entire computing device . referring now also to fig2 , there is illustrated a web page 200 according to an embodiment of the present invention . web page 200 may be provided to computers 20 by computers 30 via network 40 . illustrated web page 200 aggregates audio and / or video content for presentation to users of computers 20 . referring still to fig2 , the particularly illustrated web page 200 includes a category selector 205 , a ranking selector 210 , a new content indicator 215 , a content type indicator 220 , a page selector 225 , particular content graphics 230 , particular content type indicators 235 and particular content information 240 organized under a browser tab 245 . web page 200 may take other forms and / or present different content as is conventionally achieved in the pertinent arts . particular content graphics 230 , particular content type indicators 235 and particular content information 240 are organized to indicate individual presentations . in the illustrated embodiment , presentations 265 , 270 , 275 , are respectively shown . a user may select such a presentation for display by selecting an individual presentation for streaming or downloading , such as by clicking on an indicator 235 , 240 or 245 . for non - limiting purposes of explanation , โ€œ streaming ,โ€ as used herein , generally refers to a technique for transferring data such that it can be processed as a substantially steady or continuous stream and a user &# 39 ; s browser or plug - in can start presenting the data before the entire file has been transmitted . for non - limiting purposes of explanation , โ€œ downloading ,โ€ as used herein , generally refers to a technique for transmitting data ( e . g ., an entire data file ) between computers , such as between file server 36 ( fig1 ) and a computing device 22 ( fig1 ). in certain embodiments of the present invention , a commercially available content ( e . g ., audio and / or video podcast ) delivery application , such as the flash product available from adobe systems inc ., may be used to provide selected presentations to users &# 39 ; computers 20 ( fig1 ). referring still to fig1 and 2 , a user of a device 20 may request page 200 from content server 34 using a browser application in a conventional manner . server 34 may provide page 200 to the requesting computer 20 in a conventional manner , optionally using database server 32 to populate page 200 , for example . in certain embodiments of the present invention , when a user selects a category in selector 205 , content server 34 may request database server 32 identify which presentations should be used to populate page 200 according to the selected category . server 34 may then provide such a populated page 200 to the requesting user computer 20 . examples of categories that may be included and selected using selector 205 include art , autos and vehicles , bloggers and people , celebrity gossip , comedy , education , gadgets , health , how to and diy , legal , music , news , and pets and animals , for example . by selecting one of these categories , a user may receive pages 200 populated with content according to the selected category . in certain embodiments of the present invention , when a user selects a ranking in indicator 210 , content server 34 may request database server 32 identify which presentations should be used to populate page 200 according to the selected ranking . server 34 may then provide such a populated page 200 to the requesting user computer 20 . examples of rankings that may be included and selected using indicator 210 include most recent presentations and most popular presentations , for example . by selecting one of these rankings , a user may receive pages 200 populated with content according to the selected ranking . in certain embodiments of the present invention , a user may select a populated presentation ( e . g ., 265 , 270 or 275 , fig2 ). in response thereto , server 34 may request file server 36 either stream or download the selected presentation to the requesting user &# 39 ; s computer 20 , such as via a web page 200 in a conventional manner . referring now to fig3 , there is shown a view of web page 200 when tab 250 is selected . in the illustrated embodiment of fig3 , web page 200 includes a text box 255 and search button 260 under tab 250 . in certain embodiments of the present invention , when tab 250 is selected , text box 255 and search button 260 may be presented on the user &# 39 ; s computer 20 by server 34 . a user may enter a search term into window 255 in a conventional manner . a user may then activate search button 260 in a conventional manner . responsively thereto , content server 34 may request database server 32 identify which presentations should be used to populate page 200 according to the entered search term ( s ). server 34 may then provide such a populated page 200 to the requesting user computer 20 . as will be appreciated by those possessing an ordinary skill in the pertinent arts , there are a number of ways to aggregate and provide content using web page 200 . in certain embodiments of the present invention , users may be permitted to directly upload and enter information regarding content , e . g ., to file server 36 ( fig1 ). in certain embodiments of the present invention , users may be permitted to link presentations housed elsewhere in memory so as to be accessible to a computer 20 ( fig1 ) via network 40 ( fig1 )โ€” essentially registering them with database server 32 ( fig1 ). in certain embodiments of the present invention , presentations may be created using computers 20 , 30 . and , in certain embodiments of the present invention , presentations housed elsewhere in memory so as to be accessible to a computer 20 ( fig1 ) via network 40 ( fig1 ) may be automatically linked to โ€” essentially registering them with database server 32 ( fig1 ). referring now also to fig4 , there is shown a flow diagram of a process 400 according to an embodiment of the present invention . process 400 is suitable for permitting users to directly upload and enter information regarding content . process 400 commences with a user providing log on information using a computer 20 at block 405 , which is provided to computers 30 via network 40 , in certain embodiments to server 34 . computers 30 log the user on at block 410 , and communicates this status to the user via network 40 , in certain embodiments by serving a page 200 ( fig2 , 3 ) to the logged on user &# 39 ; s computer 20 . at block 415 , the logged on user requests to upload content , e . g ., by interacting in a conventional manner with web page 200 . this request is provided to computers 30 via network 40 . at block 420 , computers 30 request information regarding the content to be uploaded . in certain embodiments , the requested information may include a content title , date , series information and description , akin to that to be displayed in a corresponding indicator 240 ( fig2 , 3 ). the request may further include a file identifier and location of the content indicative file to ultimately be uploaded . this request may be communicated to the user &# 39 ; s computer 20 via network 40 . at block 425 , the user provides at least a portion of the requested information , which is communicated to computers 30 via network 40 . some or all of the information provided may be screened or filtered or verified in conventional manners at block 430 . in certain embodiments of the present invention , information provided at block 425 may be received and screened or filtered or verified at block 430 using web server 34 . all or a portion of that information may then be stored using database server 32 , for later use in populating web pages 200 , for example . at block 430 , computers 30 indicate the received information is suitable for use and confirms the content may be uploaded . this indication is provided to the user &# 39 ; s computer 20 via network 40 . at block 435 , the user &# 39 ; s computer transmits the content to computers 30 via network 40 , e . g ., performs a file upload in a conventional manner . the content is received by computers 30 at block 440 . in certain embodiments of the present invention , content transmitted and received at blocks 435 , 440 may take the form of media file suitable for use as a podcast , for example . such a file may be received by server 34 for example , and provided to server 36 for storage 450 and later retrieval for downloading and / or streaming pursuant to a user &# 39 ; s interaction with webpage 200 ( fig2 , 3 ), for example . in such a case , server 32 may associate the stored content indicative information provided at block 425 with the file stored at block 450 . referring now also to fig5 , there is shown a flow diagram of a process 500 according to an embodiment of the present invention , process 500 is suitable for permitting users to link presentations housed elsewhere in memory so as to be accessible to a computer 20 via network 40 . process 500 commences with a user providing log on information using a computer 20 at block 505 , which is provided to computers 30 via network 40 , in certain embodiments to server 34 . computers 30 log the user on at block 510 , and communicate this status to the user via network 40 , in certain embodiments by serving a page 200 ( fig2 , 3 ) to the logged on user &# 39 ; s computer 20 . at block 515 , the logged on user requests to link or register content , e . g ., by interacting in a conventional manner with web page 200 . this request is provided to computers 30 via network 40 . at block 520 , computers 30 request information regarding the content to be linked . in certain embodiments , the requested information may include a content title , date , series information and description , akin to that displayed in a corresponding indicator 240 ( fig2 , 3 ). the request may further include a file identifier and location of the content indicative file to be linked . this request may be communicated to the user &# 39 ; s computer 20 via network 40 . at block 525 , the user provides at least a portion of the requested information , which is communicated to computers 30 via network 40 . some or all of the information provided may be screened or filtered or verified in conventional manners at block 530 . in certain embodiments of the present invention , information provided at block 525 may be received and screened or filtered or verified at block 530 using web server 34 . in certain embodiments of the present invention , the file location data ( e . g ., an internet address at which the file is available ) may be checked to see if a valid media file is located thereat . all or a portion of that information may then be stored using database server 32 , for later use in populating web pages 200 , for example . at block 530 , computers 30 indicate the received information is suitable for use and confirms the content may be linked . at block 550 the received information may be stored using server 32 for later retrieval and use . server 32 may also associate the linked content indicative information provided at block 525 with the file address stored at block 550 . certain embodiments of the present invention may provide the ability to track the number of visitors to the platform of the present invention , and additionally the number of visitors per content via the platform of the present invention . further , the number of pages viewed by each visitor may additionally be tracked , such as in a tabular format , and such information may be continuously updated for as long as a user remains on a given page , that is , for as long as a user continues to watch a particular show . for example , it may be determined when a user begins and ends listening to and / or watching a presentation , e . g ., a podcast , for example . where a selected presentation is streamed from computers 30 , such an inquiry may be relatively simple , by confirming the content streaming is progressing as expected , for example . where content is housed elsewhere and linked to by computers 30 , such a direct inquiry may not be readily available though . tracking may be performed , for example , via entry into one or more tables of database server 32 of timed data . at each expiration of a timer , such as every 15 seconds , a table entry may be made corresponding to the user , the page the user is on , and , to the extent the user is on the same page as was the user upon the last expiration of the timer , the user &# 39 ; s total time , to the current time , spent on that same page . the user may be identified by , for example , any of a number of known methodologies , such as the information the user used to login , the user &# 39 ; s ip address , the user &# 39 ; s response to an identifying query , or the like . thus , certain embodiments of the present invention provide a capability to know that a viewer began viewing a particular show at a certain time , and when a user began viewing a different page , or show , thereby providing knowledge of how long a particular viewer spent on a particular page . such knowledge is not conventionally available , and the provision of such knowledge by certain embodiments of the present invention allows for an increasing scale of payments for advertising displayed on a given page correspondent to how long a viewer or viewers remain , or typically remain , on that particular page or like pages . thus , a tabular tracking of the present invention allows for the knowledge of how long a viewer spends on a page , what the viewer was viewing or listening to on the given page , the ads shown while the viewer was viewing or listening , how long the ads were shown , and what ads were shown to the view correspondent to that viewer &# 39 ; s identification and / or login . referring now also to fig6 , there is shown a flow diagram of a process 600 according to an embodiment of the present invention . process 600 is suitable for permitting users to create presentations , such as by hosting an audio show that may be recorded to create a podcast , using computers 20 , 30 . process 600 commences with a user providing log on information using a computer 20 at block 605 , which is provided to computers 30 via network 40 , in certain embodiments to server 34 . computers 30 log the user on at block 610 , and communicate this status to the user via network 40 , in certain embodiments by serving a page 200 ( fig2 , 3 ) to the logged on user &# 39 ; s computer 20 . at block 615 , the logged on user requests to create content or host a show , e . g ., by interacting in a conventional manner with web page 200 . this request is provided to computers 30 via network 40 . at block 620 , computers 30 request information regarding the content to be created . in certain embodiments , the requested information may include a content title , date , series information and description , akin to that displayed in a corresponding indicator 240 ( fig2 , 3 ). the request may further include a phone number at which the user may be reached . this request may be communicated to the user &# 39 ; s computer 20 via network 40 . at block 625 , the user provides at least a portion of the requested information , which is communicated to computers 30 via network 40 . some or all of the information provided may be screened or filtered or verified in conventional manners at block 630 . in certain embodiments of the present invention , information provided at block 625 may be received and screened or filtered or verified at block 630 using web server 34 . in certain embodiments of the present invention , the user &# 39 ; s phone number may be checked to see if it is valid . all or a portion of that information may ten be stored at block 635 using database server 32 , for later use in populating web pages 200 , for example . at block 640 , the requesting user indicates he would like to begin creating the presentation , e . g ., by interacting in a conventional manner with web page 200 . this indication is communicated to computers 30 via network 40 . at block 645 computers 30 initiate a new presentation creation session . at block 650 , a voice communications session between computers 30 and the user is commenced . in certain embodiments of the present invention , a telephone call may be automatically placed by computers 30 at block 650 to the phone number indicated at block 625 . referring now to fig7 , there is shown a block diagram of a system of networked computers and telephones 700 . like system 10 , illustrated system 700 includes personal computing devices 22 and a personal digital assistant / web - enabled cellular phone computer 24 by way of non - limiting example only . communication links 26 communicatively couple devices 20 with network 40 . links 26 may take the form of wired and / or wireless communications links , including fiber optic , pots , osl , cable and / or multiple access or gsm based wireless telephony or data communications systems , for example . network 40 may include portions of proprietary and service provider networks , as well as the internet , for example . illustrated system 10 includes a database server 32 , a content or web server 34 and a file server 36 , all by way of non - limiting example only . communication links 26 communicatively couple devices 30 with network 40 as well . system 700 additionally includes conventional telephone 705 associated with ( as indicated by label 720 ) a particular computing device 22 , e . g ., by both corresponding to a given requesting user , for example . in the illustrated embodiment , phone 705 may be communicatively coupled to computers 30 independent of network 40 ( e . g ., via 725 ). in the illustrated embodiment , phone 705 may be communicatively coupled to computers 30 via network 40 ( e . g ., link 710 ). in certain embodiments of the present invention phone 705 may take the form of a pots phones . in certain embodiments of the present invention phone 705 may take the form of a voip phone . in certain embodiments of the present invention , phone 705 may take the form of a cellular phone . in certain embodiments of the present invention , phone 705 is independent of the associated computer 22 . in certain embodiments of the present invention , phone 705 may be communicatively coupled to computers 30 independent of any connection between the associated computer 22 and computers 30 . referring still to fig6 and 7 , a requesting user may be called at block 650 by computers 30 placing a conventional telephone call to the phone number provided at block 625 . upon the call being answered using phone 705 , a pre - recorded audio message indicating the content will be created may be played . thereafter , the requesting user , or his designee for example , may speak into phone 705 , thereby hosting a show , for example . responsively thereto , computers 30 may digitize the spoken show and store a media file indicative of it ( e . g ., using file server 36 ), as indicated at block 655 . information provided at block 625 and stored at block 635 may include identifications of intended audience members for the presentation , e . g ., an audience for the show to be hosted . this additional information may be used at block 660 to initiate analogous telephone calls to those numbers as well . in this way , a phone audience may hear the show live at a plurality of locations . for non - limiting purposes of explanation , this is shown in fig7 as phone 730 , which is associated with computer 24 as designated by label 740 . such a โ€œ dial out โ€ functionality allows for an understanding of where the user / viewer / listener can be reached , located , and / or may allow for a myriad additional features in the present invention . for example , a pinpoint geographic location of broadcast listeners may be placed on a map , such as via website 200 to thereby illustrate where other listeners of the broadcast are specifically located . such a mapping functionality may be realized using a commercially available mapping application , such as google maps , for example . in certain embodiments of the present invention , shows may be streamed analogously as described above as they are being recorded , for example . it should further be understood such a content generation functionality provides additional advantages . for example , enhanced telephone conferences may be readily achieved according to certain embodiments of the present invention . such enhanced conferences may exhibit an automatic dial out to conference attendees , including the host and audience . such enhanced conferences may exhibit automatic recording and archival for later playback as a podcast , for example . such enhanced functionalities may advantageously be achieved without the host having access to any particular resources other than a general purpose internet enabled computer and a conventional telephone . such enhanced functionalities may advantageously be achieved without the any audience member having access to any particular resources other than a conventional telephone . accordingly , enhanced telephone conferencing may be readily achieved . in certain embodiments of the present invention , certain portions of aggregated content may have access thereto restricted to authorized members . for example , information provided at blocks 425 , 525 and / or 625 may include an authorized group identifier or content password . such an identifier and / or password may be stored using database server 32 . when a user seeks to playback such protected content , e . g ., by interacting with web page 200 as set forth above , the user may need to log in ( e . g ., analogously to log in at blocks 405 , 410 , 505 , 510 , 605 , 610 ) or provide the corresponding password . where a group identifier is used , database server 32 may indicate what groups a logged in user is authorized for , so as to selectively permit access to protected content to authorized users . such groups may , by way of non - limiting example only , include businesses and other private organizations . referring now also to fig8 , there is shown a flow diagram of a process 800 according to an embodiment of the present invention . process 800 is suitable for automatically aggregating and linking to presentations housed elsewhere in memory so as to be accessible to a computer 20 ( fig1 ) via network 40 ( fig1 )โ€” essentially registering them with database server 32 ( fig1 ). syndication of internet content is becoming more commonplace . really simple syndication (โ€œ rss โ€) is a family of internet feed formats used to publish content that may be frequently updated , such as podcasts ( rss 2 . 0 ). rss utilizes a standardized format . an rss document ( sometimes referred to as a โ€œ feed ,โ€ โ€œ web feed โ€ or โ€œ channel โ€) typically contains either a summary of content from an associated web site or the full text . an rss may itself be used to aggregate content from multiple web sources in one place . rss content is typically accessed using an rss reader application . such an application may be a thin , web - page based application or a downloaded application executed on a user &# 39 ; s computer ( e . g ., 20 , fig1 ). rss feeds may typically be subscribed to by entering or selecting the feed &# 39 ; s link using the reader . the rss reader typically checks the user &# 39 ; s subscribed feeds for new content at predetermined intervals , downloads updates , and provides a user interface to monitor and view the feeds . embodiments of the present invention will be discussed with regard to rss 2 . 0 feeds for non - limiting purposes of explanation only . it should be recognized that embodiments of the present invention may be suitable for use with other types of content ( e . g ., audio / video ) feeds . referring again to fig8 , process 800 commences with a user providing log on information using a computer 20 at block 805 , which is provided to computers 30 via network 40 , in certain embodiments to server 34 . computers 30 log the user on at block 810 , and communicate this status to the user via network 40 , in certain embodiments by serving a page 200 ( fig2 , 3 ) to the logged on user &# 39 ; s computer 20 . at block 815 , the logged on user requests to link an rss feed , e . g ., by interacting in a conventional manner with web page 200 . this request is provided to computers 30 via network 40 . at block 820 , computers 30 request information regarding the content to be created . in certain embodiments , the requested information may include a content title , series information and description , akin to that displayed in a corresponding indicator 240 ( fig2 , 3 ). the request may further include rss feed identification and / or access information through which the feed may be accessed . this request may be communicated to the user &# 39 ; s computer 20 via network 40 . at block 825 , the user provides at least a portion of the requested information , which is communicated to computers 30 via network 40 . some or all of the information provided may be screened or filtered or verified in conventional manners at block 830 . in certain embodiments of the present invention , information provided at block 825 may be received and screened or filtered or verified at block 830 using web server 34 . in certain embodiments of the present invention , the feed identifier and / or access information may be checked to see if it is valid . all or a portion of that information may then be stored at block 850 using database server 32 , for later use in populating web pages 200 , for example . at block 850 , the feed may further be accessed to acquire information regarding and / or either links to or the feed content itself then present . all of this information may be automatically aggregated using computers 30 in accordance with the methods described herein - above with regard to fig4 and / or 5 , where the feed information ( e . g ., rss associated xml data ) is used in lieu of user provided information . the date and time when content is automatically acquired via such a registered rss feed may also be stored at block 850 using computers 30 , e . g ., database server 32 . at block 855 , computers 30 may determine if new content exists for one or more feeds stored at block 850 . this may be accomplished in any of a number of conventional manner , including periodically checking when the feed was last updated and / or the content available there - through to data stored at block 850 . when new of changed content is found , the data stored at block 855 may be appended or amended to reflect the new content . it should further be understood such a content acquisition provides additional advantages . for example , each user wishing to identify and view content available via an rss feed may conventionally need to obtain and operate an rss reader application . further , each such rss reader application would need to access each identified rss feed . this leads to substantial bandwidth usage , for example . in contrast , certain embodiments of the present invention permit a user to access rss content without the need for his own rss reader . further , embodiments of the present invention only require that system 30 access each rss feed , as opposed to each system 30 user computer 20 wishing to access the rss feeds , leading to substantial savings in network resources . further , certain embodiments of the present invention allow user to access and compare content available via rss feeds they are not even aware of , e . g ., by their interaction with webpage 200 as discussed above , where webpage 200 includes content added using the methodology of process 800 , for example . accordingly , certain embodiments of the present invention provide for enhanced content syndication and aggregation , as compared to even rss feeds themselves , for example . and , certain embodiments of the present invention provide for automatic aggregation of rss fed content in combination with non - rss fed content in a single application independent of any user rss reader application . in certain embodiments of the present invention , web page views and / or web site visits ( e . g ., sessions ) may be tracked . a page view , as used herein , generally refers to a request made to a web server for a web page , as opposed to just a page component , such as a graphic , for example . a visit , as used herein , generally refers to a sequence of web page and / or component requests from a particular user &# 39 ; s computer , within some predetermined period of time . commercially available server log file analysis applications may be used to gather such information , for example . in certain embodiments of the present invention , more detailed tracking information may be desired . for example , it may be desirable to know not only that a certain number of users requested and accessed certain presentations , but also how long a user actually watched , and / or listened , to a presented program , after selection via webpage 200 ( fig2 , 3 ), for example . certain embodiments of the present invention may provide the ability to track the number of visitors to the platform of the present invention , and additionally the number of visitors per content via the platform of the present invention , and additionally information regarding how long presentations were watched and / or listened . for example , and referring now to fig9 , there is shown a view of a web page 900 according to an embodiment of the present invention . web page 900 generally includes portions 910 , 920 , 930 and 940 . web page 900 may be provided to a user &# 39 ; s computer 30 responsively to user selection of a presentation shown on a populated web page 200 ( fig2 ). by way of non - limiting explanation , should a user viewing web page 200 ( fig2 ) select a presentation 265 for viewing and / or listening , a suitably populated web page 900 may be served by computers 20 . in such a served web page 900 , portion 930 may be utilized to playback the selected presentation in a conventional manner , e . g ., by downloading the content into or streaming the content to a media player application or plug - in . portions 910 , 940 may be used to display related information , such as advertisements for example . in such a case , it may be desirable to be able to reliable identify how long the media was actually , or may typically be played , in order to appropriately value portions 910 , 920 as available advertising billboard space . by way of further , non - limiting , example , while a per - click or per - display pricing schedule for portions 910 , 940 may be used , where portion 920 is used to play - back content a typical user watches and / or listens to for ten minutes , portions 910 , 940 may be worth more than where content play - back is typically for less than thirty - seconds . where content is directly stored using an operator &# 39 ; s system ( e . g ., computers or computer system 20 , fig2 ), such as by using the methodology of process 400 ( fig4 ) or process 600 ( fig6 ), such a tracking may be achieved by tracking requests from and pages viewed by each visitor , such as in a tabular format . as a system operator maintains control over the operation of system 30 in such a case , system 30 may be monitored to determine how long data is streamed therefrom , for example . data indicative of this period , such as a presentation identifier and a value indicative of the time the presentation was actually streamed for , may be logged by system 30 ( e . g ., using database server 32 , for example ). for example , it may be determined when a user begins and ends listening to and / or watching a presentation , e . g ., a podcast , by tracking when a web page was loaded and for example by determining when streaming of data to such a loaded web page ceases . where a selected presentation is streamed from computers 20 , such a methodology may be directly implemented by system 20 , by confirming the content streaming is progressing as expected , for example . where content is not uploaded to an operator &# 39 ; s system ( e . g ., computers or computer system 20 , fig2 ) and is instead remotely stored from yet aggregated by system 30 , e . g ., using the methodology of process 500 ( fig5 ) or process 800 ( fig8 ), for example , tracking may not be so straight forward . as an operator of system 30 does not necessarily exercise control over the content data storage resource , the operator may not be able to directly operate the storage resource in a manner to directly track how long content is streamed therefrom to a particular user . in certain embodiments of the present invention , aggregated content playback may advantageously be tracked in a substantially same manner , regardless of whether it is streamed from system 30 or otherwise unrelated computer systems operated by third parties . in certain embodiments of the present invention , tracking information may be continuously or substantially continuously updated for as long as a user continues to watch or listen to a particular show , regardless of whether the content data is streamed from an operator &# 39 ; s computer system 30 or a third party &# 39 ; s computer system . referring now to fig1 , there is shown a block diagram of a process 1000 according to an embodiment of the present invention . process 1000 commences with a user &# 39 ; s computer 20 receiving a web page from system 20 ( fig2 ) at block 1010 . such a received web page may take the form of page 900 ( fig9 ), for example . as is shown in fig9 , page 900 includes portion 930 , which may be used to play - back user selected content via his computer 20 and a suitable plug - in or media player , for example . as explained herein , data indicative of the content played using portion 920 may be supplied by system 30 or a third party &# 39 ; s computer system . regardless , page 900 may include a timer applet . โ€œ applet ,โ€ as used herein , generally refers to a software component that runs in the context of another program , in the case of page 900 of fig9 , a web browser . such an applet may typically used to perform a specific function or task , usually narrow in scope . in the case of fig9 and 10 , such a timer applet may be used to indicate when a pre - determined temporal period has elapsed . for example , such an applet may be used to indicate each time some temporal period , such as 10 , 15 or 30 seconds , elapses . such a timer applet may be started at block 1020 . at block 1030 , when the applet determines the predetermined temporal period has elapsed , it signals its continued execution to system 20 . in response , system 30 may log receipt of this indication , such as by using database server 32 . in certain embodiments of the present invention , web page 900 ( fig9 ) may be accompanied with identifying data , such as in form of a cookie . a โ€œ cookie ,โ€ as used herein , generally refers to a message provided to a web browser by a web server . the browser stores the message in a data or text file . in certain embodiments of the present invention , the applet may cause the cookie , or associated data , to be transmitted from the user &# 39 ; s computer 20 to system 30 , where upon receipt it , or data associated with it , may be logged , such as by using database server 32 . by way of further non - limiting example , at each expiration of temporal period as determined by the timer applet , such as every 15 seconds , a table entry may be made of the user , the page the user is on , and , to the extent the user is on the same page as was the user upon the last expiration of the timer , the user &# 39 ; s total time , to the current time , spent on that same page using database server 32 . the user may be identified by , for example , any of a number of known methodologies , such as the information the user used to login , the user &# 39 ; s ip address , the user &# 39 ; s response to an identifying query , or the like . in certain embodiments of the present invention , the timer applet may cause data indicative of the total time spent on the web page presenting the presentation that has elapsed . in certain embodiments of the present invention , the timer applet may cause data indicative of another temporal cycle having passed while the web page presents the presentation . in the latter , a value indicative of the number of cycles that have passed in database 32 may be incremented each time the data is received , for example . thus , certain embodiments of the present invention provide the capability to know that a viewer began viewing a particular show at a certain time , and to know when a user began viewing a different page , or show , thereby providing knowledge of how long a particular viewer spent on a particular page . such knowledge is not conventionally available , and the provision of such knowledge by certain embodiments of the present invention allows for an increasing scale of payments for advertising displayed on a given page correspondent to how long a viewer or viewers remain , or typically remain , on that particular page or like pages . thus , the tabular tracking of the present invention allows for the knowledge of how long viewer spends on a page , what the viewer was viewing or listening to on the given page , the ads shown while the viewer was viewing or listening , how long the ads were shown , and what ads were shown to the view correspondent to that viewer &# 39 ; s identification and / or login . those of ordinary skill in the art may recognize that many modifications and variations of the present invention may be implemented without departing from the spirit or scope of the invention . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .
7
the epoxy resin composition of the present invention includes at least one epoxy resin component , at least one curing agent , at least one alkali metal containing accelerator , and optionally one or more solvents . the epoxy resin compositions of the invention include at least one epoxy resin component . epoxy resins are those compounds containing at least one vicinal epoxy group . the epoxy resin may be saturated or unsaturated , aliphatic , cycloaliphatic , aromatic or heterocyclic and may be substituted . the epoxy resin may also be monomeric or polymeric . the epoxy resin compound utilized may be , for example , an epoxy resin or a combination of epoxy resins prepared from an epihalohydrin and a phenol or a phenol type compound , prepared from an epihalohydrin and an amine , prepared from an epihalohydrin and a carboxylic acid , or prepared from the oxidation of unsaturated compounds . in one embodiment , the epoxy resins utilized in the compositions of the present invention include those resins produced from an epihalohydrin and a phenol or a phenol type compound . the phenol type compound includes compounds having an average of more than one aromatic hydroxyl group per molecule . examples of phenol type compounds include dihydroxy phenols , biphenols , bisphenols , halogenated biphenols , halogenated bisphenols , hydrogenated bisphenols , alkylated biphenols , alkylated bisphenols , trisphenols , phenol - aldehyde resins , novolac resins ( i . e . the reaction product of phenols and simple aldehydes , preferably formaldehyde ), halogenated phenol - aldehyde novolac resins , substituted phenol - aldehyde novolac resins , phenol - hydrocarbon resins , substituted phenol - hydrocarbon resins , phenol - hydroxybenzaldehyde resins , alkylated phenol - hydroxybenzaldehyde resins , hydrocarbon - phenol resins , hydrocarbon - halogenated phenol resins , hydrocarbon - alkylated phenol resins , or combinations thereof . in another embodiment , the epoxy resins utilized in the compositions of the invention preferably include those resins produced from an epihalohydrin and bisphenols , halogenated bisphenols , hydrogenated bisphenols , novolac resins , and polyalkylene glycols , or combinations thereof . in another embodiment , the epoxy resin compounds utilized in the compositions of the invention preferably include those resins produced from an epihalohydrin and resorcinol , catechol , hydroquinone , biphenol , bisphenol a , bisphenol ap ( 1 , 1 - bis ( 4 - hydroxyphenyl )- 1 - phenyl ethane ), bisphenol f , bisphenol k , tetrabromobisphenol a , phenol - formaldehyde novolac resins , alkyl substituted phenol - formaldehyde resins , phenol - hydroxybenzaldehyde resins , cresol - hydroxybenzaldehyde resins , dicyclopentadiene - phenol resins , dicyclopentadiene - substituted phenol resins , tetramethylbiphenol , tetramethyl - tetrabromobiphenol , tetramethyltribromobiphenol , tetrachlorobisphenol a , or combinations thereof . the preparation of such compounds is well known in the art . see kirk - othmer , encyclopedia of chemical technology , 3rd ed ., vol . 9 , pp 267 - 289 . examples of epoxy resins and their precursors suitable for use in the compositions of the invention are also described , for example , in u . s . pat . nos . 5 , 137 , 990 and 6 , 451 , 898 which are incorporated herein by reference . in another embodiment , the epoxy resins utilized in the compositions of the present invention include those resins produced from an epihalohydrin and an amine . suitable amines include diaminodiphenylmethane , aminophenol , xylene diamine , anilines , and the like , or combinations thereof . in another embodiment , the epoxy resins utilized in the compositions of the present invention include those resins produced from an epihalohydrin and a carboxylic acid . suitable carboxylic acids include phthalic acid , isophthalic acid , terephthalic acid , tetrahydro - and / or hexahydrophthalic acid , endomethylenetetrahydrophthalic acid , isophthalic acid , methylhexahydrophthalic acid , and the like or combinations thereof . in another embodiment , the epoxy resin compounds utilized in the compositions of the invention include those resins produced from an epihalohydrin and compounds having at least one aliphatic hydroxyl group . in this embodiment , it is understood that such resin compositions produced contain an average of more than one aliphatic hydroxyl groups . examples of compounds having at least one aliphatic hydroxyl group per molecule include aliphatic alcohols , aliphatic diols , polyether diols , polyether triols , polyether tetrols , any combination thereof and the like . also suitable are the alkylene oxide adducts of compounds containing at least one aromatic hydroxyl group . in this embodiment , it is understood that such resin compositions produced contain an average of more than one aromatic hydroxyl groups . examples of oxide adducts of compounds containing at least one aromatic hydroxyl group per molecule include ethylene oxide , propylene oxide , or butylene oxide adducts of dihydroxy phenols , biphenols , bisphenols , halogenated bisphenols , alkylated bisphenols , trisphenols , phenol - aldehyde novolac resins , halogenated phenol - aldehyde novolac resins , alkylated phenol - aldehyde novolac resins , hydrocarbon - phenol resins , hydrocarbon - halogenated phenol resins , or hydrocarbon - alkylated phenol resins , or combinations thereof . in another embodiment the epoxy resin refers to an advanced epoxy resin which is the reaction product of one or more epoxy resins components , as described above , with one or more phenol type compounds and / or one or more compounds having an average of more than one aliphatic hydroxyl group per molecule as described above . alternatively , the epoxy resin may be reacted with a carboxyl substituted hydrocarbon , which is described herein as a compound having a hydrocarbon backbone , preferably a c 1 - c 40 hydrocarbon backbone , and one or more carboxyl moieties , preferably more than one , and most preferably two . the c 1 - c 40 hydrocarbon backbone may be a straight - or branched - chain alkane or alkene , optionally containing oxygen . fatty acids and fatty acid dimers are among the useful carboxylic acid substituted hydrocarbons . included in the fatty acids are caproic acid , caprylic acid , capric acid , octanoic acid , versatic โ„ข acids , available from resolution performance products llc , houston , tex ., decanoic acid , lauric acid , myristic acid , palmitic acid , stearic acid , palmitoleic acid , oleic acid , linoleic acid , linolenic acid , erucic acid , pentadecanoic acid , margaric acid , arachidic acid , and dimers thereof . in another embodiment , the epoxy resin is the reaction product of a polyepoxide and a compound containing more than one isocyanate moiety or a polyisocyanate . preferably the epoxy resin produced in such a reaction is an epoxy - terminated polyoxazolidone . in one embodiment , the curing agents utilized in the compositions of the invention include amine - and amide - containing curing agents having , on average , more than one active hydrogen atom , wherein the active hydrogen atoms may be bonded to the same nitrogen atom or to different nitrogen atoms . examples of suitable curing agents include those compounds that contain a primary amine moiety , and compounds that contain two or more primary or secondary amine or amide moieties linked to a common central organic moiety . examples of suitable amine - containing curing agents include ethylene diamine , diethylene triamine , polyoxypropylene diamine , triethylene tetramine , dicyandiamide , melamine , cyclohexylamine , benzylamine , diethylaniline , methylenedianiline , m - phenylenediamine , diaminodiphenylsulfone , 2 , 4 bis ( p - aminobenzyl ) aniline , piperidine , n , n - diethyl - 1 , 3 - propane diamine , and the like , and soluble adducts of amines and polyepoxides and their salts , such as described in u . s . pat . nos . 2 , 651 , 589 and 2 , 640 , 037 . in another embodiment , polyamidoamines may be utilized as a curing agent in the resin compositions of the invention . polyamidoamines are typically the reaction product of a polyacid and an amine . examples of polyacids used in making these polyamidoamines include 1 , 10 - decanedioic acid , 1 , 12 - dodecanedioic acid , 1 , 20 - eicosanedioic acid , 1 , 14 - tetradecanedioic acid , 1 , 18 - octadecanedioic acid and dimerized and trimerized fatty acids . amines used in making the polyamidoamines include aliphatic and cycloaliphatic polyamines such as ethylene diamine , diethylene triamine , triethylene tetramine , tetraethylene pentamine , 1 , 4 - diaminobutane , 1 , 3 - diaminobutane , hexamethylene diamine , 3 -( n - isopropylamino ) propylamine and the like . in another embodiment , polyamides are those derived from the aliphatic polyamines containing no more than 12 carbon atoms and polymeric fatty acids obtained by dimerizing and / or trimerizing ethylenically unsaturated fatty acids containing up to 25 carbon atoms . in another embodiment , the curing agents are aliphatic polyamines , polyglycoldiamines , polyoxypropylene diamines , polyoxypropylenetriamines , amidoamines , imidazoles , reactive polyamides , ketimines , araliphatic polyamines ( i . e . xylylenediamine ), cycloaliphatic amines ( i . e . isophoronediamine or diaminocyclohexane ), menthane diamine , 4 , 4 - diamino - 3 , 3 - dimethyldicyclohexylmethane , heterocyclic amines ( aminoethyl piperazine ), aromatic polyamines ( methylene dianiline ), diamino diphenyl sulfone , mannich base , phenalkamine , n , n โ€ฒ, n โ€ณ- tris ( 6 - aminohexyl ) melamine , and the like . in another embodiment , imidazoles , which may be utilized as an accelerator for a curing agent , may also be utilized as a curing agent . in another embodiment , the curing agent is a phenolic curing agent which includes compounds having an average of one or more phenolic groups per molecule . suitable phenol curing agents include include dihydroxy phenols , biphenols , bisphenols , halogenated biphenols , halogenated bisphenols , hydrogenated bisphenols , alkylated biphenols , alkylated bisphenols , trisphenols , phenol - aldehyde resins , phenol - aldehyde novolac resins , halogenated phenol - aldehyde novolac resins , substituted phenol - aldehyde novolac resins , phenol - hydrocarbon resins , substituted phenol - hydrocarbon resins , phenol - hydroxybenzaldehyde resins , alkylated phenol - hydroxybenzaldehyde resins , hydrocarbon - phenol resins , hydrocarbon - halogenated phenol resins , hydrocarbon - alkylated phenol resins , or combinations thereof . preferably , the phenolic curing agent includes substituted or unsubstituted phenols , biphenols , bisphenols , novolacs or combinations thereof . in another embodiment , the curing agent is a polybasic acid or its corresponding anhydride . examples of polybasic acids include di -, tri -, and higher carboxylic acids , such as , oxalic acid , phthalic acid , terephthalic acid , succinic acid , alkyl and alkenyl - substituted succinic acids and tartaric acid . examples also include polymerized unsaturated acids , for example , those containing at least 10 carbon atoms , and preferably more than 14 carbon atoms , such as , dodecenedioic acid , and 10 , 12 - eicosadienedioic acid . examples of suitable anhydrides include phthalic anhydride , succinic anhydride , maleic anhydride , nadic anhydride , nadic methyl anhydride , pyromellitic anhydride , trimellitic anhydride and the like . other types of acids that are useful are those containing sulfur , nitrogen , phosphorus or halogens ; chlorendic acid , benzene phosphonic acid , and sulfonyl dipropionic acid bis ( 4 - carboxyphenyl ) amide . the ratio of curing agent to epoxy resin is preferably suitable to provide a fully cured resin . the amount of curing agent which may be present may vary depending upon the particular curing agent used ( due to the cure chemistry and curing agent equivalent weight ) as is known in the art . the accelerators of the invention include those alkali metal containing compounds which catalyze the reaction of the epoxy resin with the curing agent . the alkali metal compound of the invention acts with curing agent to form an infusible reaction product between the curing agent and the epoxy resin in a final article of manufacture such as a structural composite or laminate . by an infusible reaction product , it is meant that the epoxy resin has essentially completely cured , which for example may be at a time when there is little or no change between two consecutive t g measurements ( ฮดt g ). in one embodiment , the alkali metal containing compound is an alkali metal hydroxide or alkoxide . in another embodiment , the alkali metal containing compound is represented by the formulae : in each of formula 1a and 1b , m is a metal selected from group 1 of the periodic table of the elements . in another embodiment , m is lithium , sodium or potassium . in another embodiment m is sodium or potassium . in another embodiment m is potassium . o is oxygen . r is hydrogen or a substituted or unsubstituted hydrocarbyl group . n is an integer , preferably n is 1 to 50 or 1 to 20 . the term โ€œ hydrocarbyl โ€ encompasses all groups containing only carbon and hydrogen atoms including alkyl , alkenyl , alkynyl , aryl , arylalkyl , arylalkenyl and alkylaryl groups . preferred hydrocarbyl groups comprise 1 to 40 , 1 to 20 , 1 to 12 or 1 to 6 carbon atoms . substituted means that at least one hydrogen atom on a group is replaced with a hydrocarbyl , halide , halocarbyl , alkylamido , alkoxy , siloxy , aryloxy , alkylthio , arylthio , dialkylamino , dialkylphosphino , or other substituents . the term โ€œ alkyl โ€, means a straight - chain , branched - chain or cyclic alkyl group . examples of such groups include , but are not limited to , methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl , sec - butyl , tert - butyl , pentyl , iso - amyl , hexyl , 2 - ethylhexyl , octyl , cyclopentyl , cyclohexyl and the like . the cyclic alkyl groups may be substituted with one or more straight - chain and / or branched - chain alkyl groups ( i . e ., may be alkylcycloalkyl groups such as , e . g ., methylcyclohexyl etc .). conversely , the straight - chain and branched - chain alkyl groups may be substituted with one or more cyclic alkyl groups ( i . e ., may be cycloalkylalkyl groups such as cyclohexylmethyl etc .). moreover , unless indicated otherwise , the above alkyl groups may be substituted by one or more groups independently selected from halogen ( e . g ., f , cl , br ), alkoxy ( e . g ., methoxy , ethoxy , propoxy , butoxy and the like ), hydroxy , amino , monoalkylamino ( e . g ., methylamino , ethylamino , propylamino and the like ) and dialkylamino ( e . g ., dimethylamino , diethylamino , dipropylamino , diisopropylamino , piperidino and the like ) and trihydrocarbylsilyl ( e . g ., trimethylsilyl , triphenylsilyl and the like ). unless otherwise stated , the above definition of the term โ€œ alkyl โ€ also applies to groups comprising one or more alkyl groups . the term โ€œ alkenyl โ€ means โ€œ alkyl โ€ as defined above having one or more double bonds , and the term โ€œ alkynyl โ€ means โ€œ alkyl โ€ as defined above having one or more triple bonds . examples of alkenyl groups include , but are not limited to , ethenyl , propenyl , allyl , butenyl , 1 , 4 - butadienyl , isopropenyl , cyclopentenyl , cyclohexenyl , cyclooctenyl , cyclopentadienyl , cyclohexadienyl , cyclooctadienyl and the like . the term โ€œ aryl โ€ means an aromatic group , which optionally may contain one or more heteroatoms ( preferably selected from n , o and s and combinations thereof ) in the ring . illustrative , non - limiting examples of aryl groups are phenyl , naphthyl , fluorenyl , chlorophenyl , dichlorophenyl , fluorophenyl , perfluorophenyl , hydroxyphenyl , anisyl , biphenyl , nitrophenyl , acetylphenyl , aminophenyl , pyridyl , pyridazyl , quinolyl , and the like . unless otherwise stated , the above definition of the term โ€œ aryl โ€ also applies to groups which comprise one or more aryl groups . for example , the term โ€œ aryloxy โ€ means an aryl ether group wherein the term โ€œ aryl โ€ is as defined above . the term โ€œ alkoxy โ€ means an alkyl or alkenyl ether group wherein the terms โ€œ alkyl โ€ and โ€œ alkenyl โ€ are as defined above . examples of suitable alkyl ether groups include , but are not limited to , methoxy , ethoxy , n - propoxy , isopropoxy , n - butoxy , iso - butoxy , sec - butoxy , tert - butoxy , phenoxy , allyloxy , trifluoromethoxy and the like . in one embodiment , referring to formula 1a or 1b , m is lithium , sodium or potassium , or m is sodium or potassium , and r is hydrogen or an alkyl group , preferably a c 1 to c 40 alkyl group , a c 1 to c 20 alkyl group , or a c 1 to c 6 alkyl group . in another embodiment m is sodium or potassium and the group or represents a methoxy , ethoxy , n - propoxy , isopropoxy , n - butoxy , iso - butoxy , sec - butoxy , tert - butoxy , or phenoxy group . in another embodiment , the alkali metal containing accelerator compound is sodium hydroxide , potassium hydroxide , lithium hydroxide , sodium methoxide , potassium methoxide , lithium methoxide , or combinations thereof . in one embodiment formula 1a or 1b refers to an alkali metal phenoxide formed from a phenolic or a polyphenolic compound . examples of phenolic compounds and polyphenolic compounds include phenols , dihydroxy phenols , biphenols , bisphenols , halogenated biphenols , halogenated bisphenols , hydrogenated bisphenols , alkylated biphenols , alkylated bisphenols , trisphenols , phenol - aldehyde resins , novolac resins ( i . e . the reaction product of phenols and simple aldehydes , preferably formaldehyde ), halogenated phenol - aldehyde novolac resins , substituted phenol - aldehyde novolac resins , phenol - hydrocarbon resins , substituted phenol - hydrocarbon resins , phenol - hydroxybenzaldehyde resins , alkylated phenol - hydroxybenzaldehyde resins , hydrocarbon - phenol resins , hydrocarbon - halogenated phenol resins , hydrocarbon - alkylated phenol resins , or combinations thereof . in one embodiment , the alkali metal containing compound is an alkali metal carboxylate . in another embodiment , the alkali metal containing compound is represented by the formulae : in each of formula 2a and 2b , o is oxygen , c is carbon and m , r and n are defined as above . in one embodiment , referring to formula 2a or 2b , m is sodium or potassium and r is an alkyl group , preferably a c 1 to c 40 alkyl group , a c 1 to c 20 alkyl group or a c 1 to c 6 alkyl group . in another embodiment , the alkali metal containing carboxylate is a saturated , unsaturated , aliphatic , aromatic or saturated cyclic carboxylic acid salt where the carboxylate group has preferably from 2 to 24 carbon atoms , such as for example acetate , propionate , butyrate , valerate , pivalate , caproate , isobutylacetate , t - butyl - acetate , caprylate , heptanoate , pelargonate , undecanoate , oleate , octoate , palmitate , myristate , margarate , stearate , arachidonate and tricosanoate . in one embodiment , the alkali metal containing compound is an alkali metal halide ; preferably the halide is chloride , bromide or iodide . more preferably the alkali metal halide is licl , nacl or kcl . in another embodiment the alkali metal containing compound is an alkali metal borate , bicarbonate , carbonate , chlorate , nitrate , phosphate , sulfate , sulfide , sulfite , polysulfide or thiocyanate , silicate , aluminate , phosphonate , sulfonate , cyanate , thiolate , thiophenoxide , thiocarboxylate , thiophosphate , imide salt , or similar alkali metal salt . in another embodiment , the alkali metal containing compound is an alkali metal ion complexed with coordinating compounds such as with crown ethers , cryptands , aza - crowns , polyglycols , or compounds containing two or more ketone or aldehyde groups . the alkali metal containing accelerator compounds of the invention may be used alone , in combination with each other , or in combination with other accelerator compounds known in the art . other known general classes of accelerator compounds include , but are not limited to phosphine compounds , phosphonium salts , imidazoles , imidazolium salts , amines , ammonium salts , and diazabicyclo compounds as well as their tetraphenylborates salts , phenol salts and phenol novolac salts . examples of suitable accelerator compounds to be used in combination with the accelerator compound of the invention also include those compounds listed in u . s . pat . no . 6 , 255 , 365 , incorporated herein by reference . in the resin compositions of the invention , the epoxy resin , curing agent , and alkali metal containing accelerator compound may optionally be dissolved in a solvent . preferably the concentration of solids in the solvent is at least about 50 percent and no more than about 80 percent solids . non - limiting examples of suitable solvents include ketones , alcohols , water , glycol ethers , aromatic hydrocarbons and mixtures thereof . preferred solvents include acetone , methyl ethyl ketone , methyl isobutyl ketone , cyclohexanone , methylpyrrolidinone , propylene glycol monomethyl ether , ethylene glycol monomethyl ether , methyl amyl ketone , methanol , isopropanol , toluene , xylene , dimethylformamide ( dmf ) and the like . a single solvent may be used , but also separate solvents may be used for one or more components . preferred solvents for the epoxy resins are ketones , including acetone , methylethyl ketone and the like . preferred solvents for the curing agents include , for example , ketones , amides such as dimethylformamide ( dmf ), ether alcohols such as methyl , ethyl , propyl or butyl ethers of ethylene glycol , diethylene glycol , propylene glycol or dipropylene glycol , ethylene glycol monomethyl ether , or 1 - methoxy - 2 - propanol . preferred solvents for the accelerators of the invention include alcohols , ketones , water , dimethylformamide ( dmf ), glycol ethers such as propylene glycol monomethyl ether or ethylene glycol monomethyl ether , and combinations thereof . the amount of accelerator utilized is an amount effective to catalyze the reaction of the epoxy resin with the curing agent . as is known in the art , the amount of accelerator to be utilized depends upon the components utilized in the compositions , the processing requirements , and the performance targets of the articles to be manufactured . in one embodiment the accelerator of the invention is utilized in the range of 0 . 00001 to 0 . 1 and preferably in the range of 0 . 0002 to 0 . 02 molar equivalents per 100 grams of epoxy resin solids . in another embodiment , the accelerator of the invention is utilized in an amount greater than 0 . 00001 molar equivalents per 100 grams of epoxy resin solids . for purposes herein molar equivalents of the accelerator relate to the alkali metal functionality . for example , sodium hydroxide and sodium chloride are monofunctional and the dialkali metal salt of bisphenol a would be difunctional . the resin compositions of the invention may also include optional constituents such as inorganic fillers and additional flame retardants , for example antimony oxide , octabromodiphenyl oxide , decabromodiphenyl oxide , and other such constituents as is known in the art including , but not limited to , dyes , pigments , surfactants , flow control agents and the like . in one embodiment , the resin composition of the invention includes : ( 1 ) an epoxy resin , prepared from the reaction of an epihalohydrin and a phenol or a phenol type compound , as described above , which is preferably a brominated epoxy resin ; ( 2 ) an alkali metal containing cure accelerator represented by formula 1 a where m is lithium , sodium or potassium , preferably sodium or potassium , and r is hydrogen or a c 1 to c 12 hydrocarbyl group , preferably a methyl , ethyl , or phenyl group and more preferably a methyl group ; and ( 3 ) a curing agent . preferably , in this embodiment , the alkali metal containing cure accelerator is selected from sodium hydroxide , potassium hydroxide , lithium hydroxide , sodium methoxide , potassium methoxide , lithium methoxide , and combinations thereof . in one embodiment , the resin composition of the invention includes : ( 1 ) an epoxy resin , prepared from the reaction of an epihalohydrin and a phenol or a phenol type compound , as described above , which is preferably a brominated epoxy resin ; ( 2 ) an alkali metal containing cure accelerator that is an alkali metal carboxylate represented by formula 2a where m is lithium , sodium or potassium , preferably sodium or potassium , and r is hydrogen or a c 1 to c 20 alkyl group ; and ( 3 ) a curing agent . in one embodiment , the resin composition of the invention includes : ( 1 ) an epoxy resin , prepared from the reaction of an epihalohydrin and a phenol or a phenol type compound , as described above , which is preferably a brominated epoxy resin ; ( 2 ) an alkali metal containing compound which is an alkali metal ion complexed with coordinating compounds such as with crown ethers , cryptands , aza - crowns , polyglycols , or compounds containing two or more ketone or aldehyde groups . ; and ( 3 ) a curing agent . in one embodiment , the resin composition of the invention includes : ( 1 ) an epoxy resin , prepared from the reaction of an epihalohydrin and an phenol or a phenol type compound , as described above , and is preferably a brominated epoxy resin ; ( 2 ) an alkali metal containing cure accelerator that is an alkali metal halide , carbonate , bicarbonate , acetate , nitrate , sulfate , sulfite , chlorate , or thiocyanate where the alkali metal is lithium , sodium or potassium , preferably sodium or potassium ; and ( 3 ) a curing agent . resin compositions prepared utilizing the epoxy resin cure accelerators of the invention may be impregnated upon a reinforcing material to make laminates , such as electrical laminates . the reinforcing materials which may be coated with the compositions of this invention include any material which would be used by one skilled in the art in the formation of composites , prepregs , laminates and the like . examples of appropriate substrates include fiber - containing materials such as woven cloth , mesh , mat , fibers , and the like , and unwoven aramid reinforcements such as those sold under the trademark thermount , available from dupont , wilmington , del . preferably , such materials are made from glass , fiberglass , quartz , paper , which may be cellulosic or synthetic , a thermoplastic resin substrate such as aramid reinforcements , polyethylene , poly ( p - phenyleneterephthalamide ), polyester , polytetrafluoroethylene and poly ( p - phenylenebenzobisthiazole ), carbon , graphite , ceramic or metal and the like . preferred materials include glass or fiberglass , in woven cloth or mat form . compositions containing the alkali metal containing accelerators of the invention may be contacted with an article by any method known to those skilled in the art . examples of such contacting methods include powder coating , spray coating , die coating , roll coating , resin infusion process , and contacting the article with a bath containing the composition . in a preferred embodiment the article is contacted with the composition in a varnish bath . in one embodiment , the reinforcing material is contacted with a varnish bath comprising the epoxy resin composition of the invention dissolved and intimately admixed in a solvent or a mixture of solvents . the coating occurs under conditions such that the reinforcing material is coated with the epoxy resin composition . thereafter the coated reinforcing materials are passed through a heated zone at a temperature sufficient to cause the solvents to evaporate , but below the temperature at which the resin composition undergoes significant cure during the residence time in the heated zone . the reinforcing material preferably has a residence time in the bath of from 1 second to 300 seconds , more preferably from 1 second to 120 seconds , and most preferably from 1 second to 30 seconds . the temperature of such bath is preferably from 0 ยฐ c . to 100 ยฐ c ., more preferably from 10 ยฐ c . to 40 ยฐ c . and most preferably from 15 ยฐ c . to 30 ยฐ c . the residence time of the coated reinforcing material in the heated zone is from 0 . 1 to 15 min , more preferably from 0 . 5 to 10 min , and most preferably from 1 to 5 min . the temperature of such zone is sufficient to cause any solvents remaining to volatilize away yet not so high as to result in a complete curing of the components during the residence time . preferable temperatures of such zone are from 80 ยฐ c . to 250 ยฐ c ., more preferably from 100 ยฐ c . to 225 ยฐ c ., and most preferably from 150 ยฐ c . to 210 ยฐ c . preferably there is a means in the heated zone to remove the solvent , either by passing an inert gas through the oven , or drawing a slight vacuum on the oven . in many embodiments the coated materials are exposed to zones of increasing temperature . the first zones are designed to cause the solvent to volatilize so it can be removed . the later zones are designed to result in partial cure of the polyepoxide ( b - staging ). one or more sheets of prepreg are preferably processed into laminates optionally with one or more sheets of electrically - conductive material such as copper . in such further processing , one or more segments or parts of the coated reinforcing material are brought in contact with one another and / or the conductive material . thereafter , the contacted parts are exposed to elevated pressures and temperatures sufficient to cause the epoxy resin to cure wherein the resin on adjacent parts react to form a continuous epoxy resin matrix between and about the reinforcing material . before being cured the parts may be cut and stacked or folded and stacked into a part of desired shape and thickness . the pressures used can be anywhere from about 1 to about 1000 psi with from about 10 to about 800 psi being preferred . the temperature used to cure the resin in the parts or laminates , depends upon the particular residence time , pressure used , and resin used . preferred temperatures which may be used are between about 100 ยฐ c . and about 250 ยฐ c ., more preferably between about 120 ยฐ c . and about 220 ยฐ c ., and most preferably between about 150 ยฐ c . and about 190 ยฐ c . the residence times are preferably from about 10 min to about 120 min , more preferably from about 20 to about 90 min , and most preferably from about 30 to about 50 min . in one embodiment , the process is a continuous process where the reinforcing material is taken from the oven and appropriately arranged into the desired shape and thickness and pressed at very high temperatures for short times . in particular such high temperatures are from about 180 ยฐ c . to about 250 ยฐ c ., more preferably about 190 ยฐ c . to about 210 ยฐ c ., at times of about 1 to about 10 min and from about 2 to about 5 min . such high speed pressing allows for the more efficient utilization of processing equipment . in such embodiments the preferred reinforcing material is a glass web or woven cloth . in some embodiments it is desirable to subject the laminate or final product to a post cure outside of the press . this step is designed to complete the curing reaction . the post cure is usually performed at from 130 ยฐ c . to 220 ยฐ c . for from 20 to 200 minutes . this post cure step may be performed in a vacuum to remove any components which may volatilize . the resin compositions of the invention , due to their thermal properties , are especially useful in thee preparation of articles for high temperature continuous use applications . examples include electrical laminates and electrical encapsulation . other examples include molding powders , coatings , structural composite parts and gaskets . the epoxy resin compositions described herein may be found in various forms . in particular , the various compositions described may be found in powder form , hot melt , or alternatively in solution or dispersion . in those embodiments where the various compositions are in solution or dispersion , the various components of the composition may be dissolved or dispersed in the same solvent or may be separately dissolved in a solvent or solvents suitable for that component , then the various solutions are combined and mixed . in those embodiments wherein the compositions are partially cured or advanced , the compositions of this invention may be found in a powder form , solution form , or coated on a particular substrate . the laminates prepared utilizing the cost effective alkali metal containing accelerators of the invention exhibit enhanced thermal properties when compared to laminates utilizing prior art accelerators , such as for example imidazoles . in another embodiment , laminates prepared utilizing the accelerators of the invention exhibit enhanced thermal properties , such as delamination time , delamination temperature , solder resistance and / or thermal degradation temperature , while maintaining a glass transition temperature ( tg ) similar to laminates utilizing prior art accelerators , such as , for example , imidazoles . in another embodiment , in addition to the above , the tg is maintained in ยฐ c ., measured by differential scanning calorimetry at a heating rate of 20 ยฐ c ./ min , of at least 90 % of that for comparable systems prepared utilizing imidazole accelerators . as utilized herein , tg refers to the glass transition temperature of the thermosettable resin composition in its current cure state . as the prepreg is exposed to heat , the resin undergoes further cure and its tg increases , requiring a corresponding increase in the curing temperature to which the prepreg is exposed . the ultimate , or maximum , tg of the resin is the point at which essentially complete chemical reaction has been achieved . โ€œ essentially complete โ€ reaction of the resin has been achieved when no further reaction exotherm is observed by differential scanning calorimetry ( dsc ) upon heating of the resin . the time to delamination of laminates prepared utilizing the alkali metal containing accelerators of the invention as measured with a thermomechanical analyzer at a heating rate of 10 ยฐ c ./ min to 260 ยฐ c . ( t 260 ) increases by at least 10 %, preferably at least 20 %, more preferably at least 50 % relative to the delamination time for laminates manufactured utilizing imidazole accelerators , or the delamination time at 288 ยฐ c . ( t 288 ) increases by at least 5 %, preferably at least 20 %, more preferably at least 100 % relative to the delamination time when compared to laminates manufactured utilizing imidazole accelerators , or the delamination time at 350 ยฐ c . ( t 350 ) increases by at least 2 %, preferably at least 10 % relative to the delamination time when compared to laminates manufactured utilizing imidazole accelerators . in addition , and referring to the examples , when compared to prior art formulations containing imidazoles , such as 2 - methyl imidazole , the laminates from the compositions of the invention also show measurable improvement in the thermal properties of solder float resistance , the time to sudden and irreversible delamination ( constant temperature and constant heat rate test conditions ), and / or the temperature at which 5 % of the sample weight is lost upon heating . in addition to enhanced thermal properties , and again referring to the examples , the non - thermal properties of the laminates prepared from the compositions of the invention , such as water absorption , a copper peel strength , dielectric constant , and dissipation factor are comparable with those of prior art formulations utilizing an imidazole accelerator . in order to provide a better understanding of the present invention including representative advantages thereof , the following examples are offered . epoxy resin formulations were prepared by dissolving the individual resin , curing agent , and accelerator components in suitable solvents at room temperature and mixing the solutions . varnish gel times were measured with a hot plate at 171 ยฐ c . using a test method similar to ipc - tm - 650 number 2 . 3 . 18 . prepregs were prepared by coating the accelerated resin varnish on style 7628 glass cloth ( bgf 643 finish ) and drying in a laboratory convection oven at 163 ยฐ c . for 2 - 10 minutes to evaporate the solvents and advance the reacting epoxy / curing agent mixture to a non - tacky b - stage . laminates were prepared using 1 - 8 prepreg plies sandwiched between sheets of copper foil ( gould jtc , 1 ounce / ft 2 ) and pressing at 100 psi with the following cure cycle : ( 1 ) heat from room temperature to 350 ยฐ f . at 10 ยฐ f ./ min , ( 2 ) hold for 60 minutes , and ( 3 ) cool at 20 ยฐ f ./ min to 100 ยฐ f . prepreg resin flow during lamination was calculated for 4 - ply , 4 - inch square laminates as the percent laminate weight decrease due to the flow of resin out the laminate edge , similar to ipc - tm - 650 number 2 . 3 . 17 . in general , prepreg resin flow values of 10 - 15 % were targeted . laminate glass transition temperatures ( tg ) were measured by differential scanning calorimetry ( dsc ) at a heating rate of 20 ยฐ c ./ min . time to delamination measurements were performed at 260 , 288 , or 350 ยฐ c . with a thermomechanical analyzer ( tma ) by heating copper clad samples at 110 ยฐ c ./ min to the desired temperature and holding the samples at that temperature until a sudden and irreversible delamination occurred ( in accordance with ipc - tm - 650 number 2 . 4 . 24 . 1 ). similarly , tma delamination temperatures were measured by heating copper clad samples at 110 ยฐ c ./ min until a sudden and irreversible delamination occurred . a third method used to quantify thermal stability was to measure the temperature at which a laminate sample lost a specified weight fraction , 5 % in this case . this test was performed on samples without the copper cladding using a thermogravimetric analyzer ( tga ) with an air environment and a heating rate of 110 ยฐ c ./ min . other laminate properties measured were water absorption ( ipc - tm - 650 number 2 . 6 . 2 . 1 and 2 . 6 . 16 ), copper peel strength ( ipc - tm - 650 number 2 . 4 . 8 condition a ), dielectric constant ( permittivity ) and dissipation factor ( loss factor ) ( ipc - tm - 650 number 2 . 5 . 5 . 2 ), and solder float resistance at 288 and 300 ยฐ c . as measured by the time to delamination ( similar to ipc - tm - 650 number 2 . 4 . 13 . 1 ). this latter test was only performed on single ply laminates . several different resin and curing agent systems were tested to verify the performance increase provided by the invention presented here and these systems are summarized by the following examples . however , one skilled in the art would expect the present invention to provide improved performance for similar resin and curing agent systems . varnish formulations typical of conventional fr - 4 laminate systems were prepared with 125 parts by weight ( pbw ) of an 80 % solution of a brominated epoxy resin ( the reaction product of diglycidyl ether of bisphenol a and tetrabromobisphenol a , such as epon resin 1124 - a - 80 ( available from resolution performance products llc , houston , tex .) 28 parts of a 10 % by weight solution of dicyandiamide dissolved in dimethylformamide , and 18 parts of acetone . to the varnishes were added one of the following accelerator solutions : ( 1 ) 0 . 9 parts of a 10 % by weight solution of 2 - methylimidazole ( 2 - mi ) dissolved in propylene glycol monomethyl ether or ( 2 ) 0 . 45 parts of a 10 % solution of sodium hydroxide ( naoh ) dissolved in ethylene glycol monomethyl ether . prepregs and 8 - ply laminates ( 12 in .ร— 12 in .) were prepared as described above . the resulting laminates were tested as reported in table 1 . comparative system 1 - 1 represents the state of technology today for fr - 4 laminates , namely a brominated bpa epoxy resin cured with dicyandiamide and accelerated with an imidazole compound . replacing the imidazole accelerator in the comparative system with sodium hydroxide provided increased thermal resistance ( as indicated by improvements in delamination time at 260 ยฐ c ., tma delamination temperature , 5 % weight loss temperature , and solder float resistance ) without sacrificing general laminate performance ( tg , moisture resistance , copper peel , and electrical properties ). varnish formulations typical of conventional fr - 4 laminate systems were prepared with 125 parts by weight of an 80 % solution of a brominated epoxy resin ( the reaction product of diglycidyl ether of bisphenol a and tetrabromobisphenol a , such as epon resin 1124 - a - 80 ), 28 or 30 parts of a 10 % by weight solution of dicyandiamide dissolved in dimethylformamide , and 12 - 20 parts of acetone . to the varnishes were added one of the following accelerator solutions : ( 1 ) a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether or ( 2 ) a 10 % by weight solution of potassium hydroxide ( koh ) dissolved in ethylene glycol monomethyl ether . prepregs and 4 - ply laminates were prepared as described above . the resulting laminates were tested as reported in table 2 . replacing the imidazole accelerator in both comparative formulations with potassium hydroxide gave increased thermal resistance as measured by delamination time at 260 ยฐ c . while maintaining comparable laminate glass transition temperature . varnish formulations typical of conventional fr - 4 laminate systems were prepared with 125 parts by weight of an 80 % solution of a brominated epoxy resin ( the reaction product of diglycidyl ether of bisphenol a and tetrabromobisphenol a , such as epon resin 1124 - a - 80 ), 28 parts of a 10 % by weight solution of dicyandiamide dissolved in dimethylformamide , and 14 - 22 parts of acetone . to the varnishes were added one of the following accelerator solutions : ( 1 ) 0 . 8 parts of a 10 % by weight solution of lithium hydroxide ( lioh ) dissolved in a 54 / 46 by weight blend of methanol and water , ( 2 ) 1 . 4 parts of a 10 % by weight solution of potassium methoxide ( koch 3 ) dissolved in methanol , ( 3 ) 7 . 0 parts of a 10 % by weight solution of dabco ยฎ t - 45 ( a 60 % solution of potassium 2 - ethylhexanoate in a glycol mixture from air products ) dissolved in ethylene glycol monomethyl ether , or ( 4 ) 1 . 0 parts of a 10 % by weight solution of lithium chloride ( licl ) dissolved in methanol . prepregs and 4 - ply laminates were prepared as described above . the resulting laminates were tested as reported in table 3 . relative to the comparative formulation ( system 2 - 1 ), all of the systems in table 3 provide increased thermal resistance as measured by delamination time at 260 ยฐ c ., with the formulations accelerated by lithium hydroxide and potassium methoxide providing comparable laminate tg values to that of the control . varnish formulations typical of a high tg , fr - 4 laminate system were prepared with 118 parts by weight of an 85 % solution of a high tg , brominated epoxy resin ( an epoxy - terminated polymer with oxazolidone , bisphenol a , and tetrabromobisphenol a backbone character and with an epoxide equivalent weight of 310 g / eq ), 27 parts of a 10 % by weight solution of dicyandiamide dissolved in dimethylformamide , and 0 - 6 parts by weight of acetone . to the varnishes were added one of the following accelerator solutions : ( 1 ) 6 . 0 parts of a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether , ( 2 ) 4 . 6 parts of a 10 % by weight solution of sodium hydroxide dissolved in ethylene glycol monomethyl ether , ( 3 ) 6 . 0 parts of a 10 % by weight solution of potassium hydroxide dissolved in ethylene glycol monomethyl ether , or ( 4 ) a combination of 2 . 0 parts of a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether and 3 . 7 parts of a 10 % solution of potassium hydroxide dissolved in ethylene glycol monomethyl ether . prepregs and 4 - ply laminates were prepared as described above . the resulting laminates were tested as reported in table 4 . relative to the comparative system 4 - 1 , replacing all or part of the imidazole accelerator with an alkali metal hydroxide accelerator as shown in table 4 resulted in an increase in thermal resistance while maintaining comparable laminate tg . varnish formulations were prepared with 51 parts by weight of a diglycidyl ether of bisphenol a ( epoxide equivalent weight of 187 g / eq ), 35 parts by weight tetrabromobisphenol a , 14 parts by weight of a phenol novolac ( number average molecular weight of 750 g / mol ), 24 - 26 parts by weight of acetone , and 17 - 18 parts by weight of methyl ethyl ketone . similar to example 1 , this varnish formulation is representative of some commercial systems used for fr - 4 laminate applications , especially those offering improved laminate thermal resistance . to the varnish formulations were added one of the following accelerator solutions : ( 1 ) 1 . 2 parts of a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether or ( 2 ) 3 . 6 parts of a 10 % solution of potassium methoxide dissolved in methanol . prepregs and 8 - ply laminates ( 12 in . by 12 in .) were prepared as described above . the resulting laminates were tested as reported in table 5 . while the comparative system 5 - 1 provides excellent thermal resistance , the performance is further improved by replacing the imidazole accelerator with potassium hydroxide . relative to system 5 - 1 , system 5 - 2 provides significantly increased thermal resistance ( as indicated by improvements in delamination time at 288 ยฐ c ., tma delamination temperature , 5 % weight loss temperature , and solder float resistance ) without sacrificing general laminate performance ( tg , moisture resistance , copper peel , and electrical properties ). this result demonstrates application of the invention to curing agents with phenolic hydroxyl moieties . varnish formulations were prepared with 51 parts by weight of a diglycidyl ether of bisphenol a ( epoxide equivalent weight of 187 g / eq ), 35 parts by weight tetrabromobisphenol a , 14 parts by weight of a phenol novolac ( number average molecular weight of 750 g / mol ), 5 - 10 parts by weight of acetone , and 35 - 43 parts by weight of methyl ethyl ketone . to the varnishes were added one of the following accelerator solutions : ( 1 ) 1 . 2 parts of a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether , ( 2 ) 3 . 6 parts of a 10 % solution of potassium methoxide dissolved in methanol , ( 3 ) 2 . 9 parts of a 10 % solution of potassium hydroxide dissolved in ethylene glycol monomethyl ether , ( 4 ) 5 . 5 parts of a 20 % solution of dabco t - 45 dissolved in ethylene glycol monomethyl ether , or ( 5 ) 4 . 0 parts of a 10 % solution of sodium carbonate ( na 2 co 3 ) dissolved in water . prepregs and 4 - ply laminates were prepared as previously described . the resulting laminates were tested as reported in table 6 . increased thermal resistance as measured by delamination time at 288 ยฐ c . was obtained by replacing the imidazole accelerator typically used in the comparative formulation ( system 6 - 1 ) with a variety of accelerators as listed in table 6 . in all cases , laminate tg values were similar to the comparative formulation . varnish formulations were prepared with two commercially available , brominated epoxy resin / curing agent systems used for laminating applications : ( 1 ) 125 parts by weight of epon resin 1213 - b - 80 ( an 80 % solids solution in methyl ethyl ketone consisting of epoxy resin and phenolic curative materials with a nominal epoxide equivalent weight of 375 g / eq , available from resolution performance products llc , houston , tex .) or ( 2 ) 142 . 9 parts by weight of epon custom solution 373 ( a 70 % solids solution in methyl ethyl ketone and propylene glycol monomethyl ether consisting of epoxy resin and phenolic curative materials with a nominal epoxide equivalent weight of 380 g / eq , available from resolution performance products llc , houston , tex .). to the resin systems were added additional ketone solvents to lower the varnish viscosity and one of the following accelerator solutions : ( 1 ) a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether or ( 2 ) a 10 % solution of potassium hydroxide dissolved in ethylene glycol monomethyl ether . prepregs and 4 - ply laminates were prepared as described above . the resulting laminates were tested as reported in table 7 . for both the standard and high tg , brominated resin systems , replacing the imidazole cure accelerator with potassium hydroxide gave similar processing characteristics ( gel time and flow ), slightly increased laminate glass transition temperature , and significantly increased thermal resistance as measured by time to delamination at 288 ยฐ c . varnish formulations were prepared with epon custom solution 360 , a commercially available , epoxy resin / curing agent system used for structural composite applications . to 125 parts by weight of epon custom solution 360 ( an 80 % solids solution in methyl ethyl ketone consisting of epoxy resin and phenolic curative materials with a nominal weight per epoxide of 310 g / eq , available from resolution performance products llc , houston , tex .) were added 15 parts by weight of methyl ethyl ketone , 10 parts by weight of propylene glycol monomethyl ether , and one of the following accelerator solutions : ( 1 ) 1 . 2 parts of a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether or ( 2 ) 1 . 8 parts of a 10 % solution of potassium hydroxide dissolved in ethylene glycol monomethyl ether . prepregs and 4 - ply laminates were prepared as described above . the resulting laminates were tested as reported in table 8 . as has been demonstrated for a variety of resin and curing agent systems , replacing the 2 - methylimidazole cure accelerator with potassium hydroxide resulted in similar formulation processing behavior , similar laminate tg , and an increase in thermal resistance as measured by the delamination time at 350 ยฐ c . as taught by u . s . pat . no . 4 , 251 , 594 , a brominated resin was prepared by reacting 53 . 92 parts by weight of a diglycidyl ether of bisphenol a ( epoxide equivalent weight of 187 g / eq ) with 21 . 07 parts tetrabromobisphenol a and 0 . 076 parts potassium hydroxide . the resulting fusion product ( epoxide equivalent weight of 355 g / eq ) was dissolved in acetone to 74 . 5 % solids . varnish formulations were prepared with 134 . 2 parts by weight of a 74 . 5 % solution of the brominated epoxy resin described above and 30 parts of a 10 % by weight solution of dicyandiamide dissolved in dimethylformamide . to the varnishes were added one of the following accelerator solutions : ( 1 ) 1 . 24 parts of a 10 % by weight solution of 2 - methylimidazole dissolved in propylene glycol monomethyl ether or ( 2 ) 1 . 43 parts of a 10 % by weight solution of potassium hydroxide dissolved in ethylene glycol monomethyl ether . prepregs and 4 - ply laminates were prepared . the resulting laminates were tested as listed in table 9 . replacing the imidazole accelerator in the comparative formulation with potassium hydroxide gave increased thermal resistance as measured by delamination time at 260 ยฐ c . and a slight increase in laminate glass transition temperature . thus , when used as a cure accelerator , potassium hydroxide provided increased thermal resistance even for a fusion resin prepared with potassium hydroxide as the fusion catalyst . while the present invention has been described and illustrated by reference to particular embodiments , those of ordinary skill in the art will appreciate that the invention lends itself to variations not necessarily illustrated herein . for example , the alkali metal containing compound may be added as such or generated in - situ in the compositions of the invention . for this reason , then , reference should be made solely to the appended claims for purposes of determining the true scope of the present invention .
8
the present invention is further described by means of examples , but in no way limited to the scope of the examples . for the experimental methods in the following examples where no specific conditions are given , conventional procedures and conditions are used , or procedures and conditions are selected following a product instruction . 3 - nitro - 4 - chlorobenzoic acid ( 10 . 0 g , 49 . 6 mmol ), n , n - dimethyl formamide ( 0 . 3 ml , 3 . 6 mmol ) and toluene ( 50 ml ) were added to a reactor , and heated to 70 ยฐ c . thionyl chloride ( 4 . 3 ml , 59 . 5 mmol ) was added , and heating was resumed to reflux for 30 min . thionyl chloride and the solvent were distilled away under reduced pressure , to obtain a pale yellow oil ( compound 2 ) which was dissolved in dichloromethane ( 60 ml ) and directly used in the next reaction . ethyl 3 -( pyridin - 2 - yl - amino ) propionate ( 9 . 6 g , 49 . 6 mmol ), thiethylamine ( 13 . 8 ml , 99 . 2 mmol ), and dichloromethane ( 20 ml ) were added to a reactor , and the dichloromethane solution of the compound 2 obtained in example 1 was added dropwise , and then stirred at room temperature for 1 hr . the reaction solution was washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , and the remaining solid was purified by column chromatography , to obtain the compound 3 ( 16 . 3 g , yield 87 . 0 %). mp 63 - 65 ยฐ c . : esi - ms ( m / z ): 378 [ m + h ] + , 400 [ m + na ] + ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 19 ( t , 3h ), 2 . 70 ( t , 2h ), 3 . 95 ( q , 2h ), 4 . 20 ( t , 2h ), 7 . 22 ( d , 2h ), 7 . 25 ( t , 1h ), 7 . 44 ( dd , 1h ), 7 . 66 ( d , 1h ), 7 . 75 ( m , 1h ), 7 . 92 ( d , 1h ), 8 . 35 ( dd , 1h ). purity by hplc : 98 . 5 %. the compound 3 ( 16 . 3 g , 47 . 15 mmol ) and ethanol ( 60 ml ) were added to a reactor , and heated to 40 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 16 . 3 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 2 hrs . the reaction solution was evaporated to dryness , and the remaining solid was purified by column chromatography , to obtain the compound 4 ( 13 . 6 g , yield 84 . 6 %). mp 86 - 88 ยฐ c . ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 11 ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ), 3 . 96 ( q , 2h ), 4 . 18 ( t , 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( m , 1h ), 7 . 93 ( d , 1h ), 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 97 . 9 %. 3 - nitro - 4 - chlorobenzoic acid ( 1 . 0 g , 4 . 96 mmol ), n , n - dimethyl formamide ( 0 . 03 ml , 0 . 36 mmol ), and toluene ( 8 ml ) were added to a reactor , and heated to 70 โ€ฒ c . thionyl chloride ( 0 . 43 ml 5 . 95 mmol ) was added , and heating was resumed to reflux for 30 min , thionyl chloride and the solvent were distilled a way under reduced pressure , to obtain a pale yellow oil ( compound 2 ) which was dissolved in tetrahydrofuran ( 6 ml ) and directly used in the next reaction . ethyl 3 -( pyridin - 2 - yl - amino ) propionate ( 0 . 96 g , 4 . 96 mmol ), triethylamine ( 1 . 38 ml , 9 . 92 mmol ), and tetrahydrofuran ( 4 ml ) were added to a reactor , and the tetrahydrofuran solution of the compound 2 obtained in example 4 was added dropwise , and then stirred at room temperature for 1 hr . the reaction solution as washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , and the remaining solid was purified by column chromatography , to obtain the compound 3 ( 1 . 59 g , yield 84 . 9 %). mp 63 - 65 ยฐ c . ; esi - ms ( m / z ): 378 [ m + h ] + , 400 [ m + na ] + ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 19 ( t , 3h ), 2 . 70 ( t , 2h ), 3 . 95 ( q , 2h ), 4 . 20 ( t , 2h ), 7 . 22 ( d , 2h ), 7 . 25 ( t , 1h ), 7 . 44 ( dd , 1h ), 7 . 66 ( d , 1h ), 7 . 75 ( m , 1h ), 7 . 92 ( d , 1h ), 8 . 35 ( dd , 1h ). purity by hplc : 98 . 9 %. 3 - nitro - 4 - chlorobenzoic acid ( 1 . 0 g , 4 . 96 mmol ), n , n - dimethyl formamide ( 0 . 03 ml , 0 . 36 mmol ) and toluene ( 8 ml ) were added to a reactor , and heated to 70 ยฐ c . thionyl chloride ( 0 . 43ml , 5 . 95 mmol ) was added , and heating was resumed to reflux for 30 min . thionyl chloride and the solvent were distilled away under reduced pressure , to obtain a pale yellow oil ( compound 2 ) which was dissolved in tetrahydrofuran ( 6 ml ) and directly used in the next reaction . ethyl 3 -( pyridin - 2 - yl - amino ) propjonate ( 0 . 96 g , 4 . 96 mmol ), n , n - diisopropylethylamine ( 1 . 64 ml , 9 . 92 mmol ), and tetrahydrofuran ( 4 ml ) were added to a reactor , and the tetrahydrofuran solution of the compound 2 obtained in example 6 was added dropwise , and then stirred at room temperature for 1 hr . the reaction solution was washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , and the remaining solid was purified by column chromatography , to obtain the compound 3 ( 1 . 61 g , yield 85 . 92 %). mp 63 - 65 ยฐ c . ; esi - ms ( m / z ): 378 [ m + h ] + , 400 [ m + na ] + ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 19 ( t , 3h ), 2 . 70 ( t , 2h ), 3 . 95 ( q , 2h ), 4 . 20 ( t , 2h ), 7 . 22 ( d , 2h ), 7 . 25 ( t , 1h ), 7 . 44 ( dd , 1h ), 7 . 66 ( d , 1h ), 7 . 75 ( m , 1h ), 7 . 92 ( d , 1h ), 8 . 35 ( dd , 1h ). purity by hplc : 98 . 7 %. the compound 3 ( 21 . 2 g , 56 . 12 mmol ) and dimethyl sulfoxide ( 77 . 0 ml ) were added to a reactor , and heated to 70 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 21 . 0 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 30 min . ethyl acetate ( 39 . 0 ml ) was added to the reaction solution , washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , to obtain the compound 4 ( 20 . 6 g , yield 98 . 56 %). mp 86 - 88 ยฐ c . ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 11 ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ), 3 . 96 ( q , 2h ), 4 . 18 ( t , 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( m , 1h ), 7 . 93 ( d , 1h ), 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 98 . 3 %. the compound 3 ( 50 g , 13 . 24 mmol ) and n , n - dimethyl formamide ( 18 . 0 ml ) were added to a reactor , and heated to 70 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 5 . 0 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 30 min . ethyl acetate ( 10 . 0 ml ) was added to the reaction solution , washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , to obtain the compound 4 ( 4 . 8 g , yield 97 . 36 %). mp 86 - 88 ยฐ c . ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 11 ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ), 3 . 96 ( q , 2h ), 4 . 18 ( t , 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( m , 1h ), 7 . 93 ( d , 1h ), 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 98 , 9 %. the compound 3 ( 5 . 0 g , 13 . 24 mmol ) and n , n - dimethyl acetamide ( 18 . 0 ml ) were added to a reactor , and heated to 70 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 5 . 0 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 30 min . ethyl acetate ( 10 . 0 ml ) was added to the reaction solution , washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , to obtain the compound 4 ( 4 . 9 g , yield 99 . 39 %). mp 86 - 88 ยฐ c . ; 1 h - nms ( dmso - d 6 , 400 mhz ) ฮด : 1 . 11 ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ), 3 . 96 ( q , 2h ), 4 . 18 ( t ,, 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( m , 1h ), 7 . 93 ( d , 1h ), 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 98 . 0 %. the compound 3 ( 3 . 5 g , 9 . 40 mmol ) and n - methyl pyrrolidone ( 12 . 6 ml ) were added to a reactor , and heated to 70 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 3 . 5 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 30 min . ethyl acetate ( 7 . 0 ml ) was added to the reaction solution , washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , to obtain the compound 4 ( 3 . 4 g , yield 98 . 55 %). mp 86 - 88 ยฐ c . ; 1 h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 110 . ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ), 3 . 96 ( q , 2h ), 4 . 18 ( t , 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( ms 1h ), 7 . 93 ( d , 1h ), 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 98 . 8 %. the compound 3 ( 5 . 0 g , 13 . 24 mmol ) and n , n - dimethyl acetamide ( 18 . 0 ml ) were added to a reactor , and heated to 90 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 5 . 0 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 30 min . ethyl acetate ( 10 . 0 ml ) was added to the reaction solution , washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , to obtain the compound 4 ( 4 . 8 g , yield 97 . 36 %). mp 86 - 88 ยฐ c . 1h - nmr ( dmso - d 6 , 400 mhz ) ฮด : 1 . 11 ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ), 3 . 96 ( q , 2h ), 4 . 18 ( t , 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( m , 1h ), 7 . 93 ( d , 1h , 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 98 / 4 % the compound 3 ( 3 . 5 g , 9 . 40 mmol ) and n - methyl pyrrolidone ( 12 . 6 ml ) were added to a reactor , and heated to 60 ยฐ c . a 27 . 0 - 32 . 0 % solution ( 3 . 5 ml ) of methylamine in ethanol was slowly added dropwise , and stirred for 30 min . ethyl acetate ( 7 . 0 ml ) was added to the reaction solution , washed with water , dried over anhydrous sodium sulfate , and filtered . the filtrate was evaporated to dryness , to obtain the compound 4 ( 3 . 4 g , yield 98 . 55 %). mp 86 - 88 ยฐ c . ; 1h - nmr ( dmso - d6 , 400 mhz ) ฮด : 1 . 11 ( t , 3h ), 2 . 66 ( t , 2h ), 2 . 91 ( t , 3h ). 3 . 96 ( q , 2h ), 4 . 18 ( t , 2h ), 6 . 83 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 21 ( m , 1h ), 7 . 32 ( dd , 1h ), 7 . 69 ( m , 1h ), 7 . 93 ( d , 1h ), 8 . 36 ( d , 1h ), 8 . 43 ( dd , 1h ). purity by hplc : 98 . 4 % although the present invention is described above with reference to specific embodiments , it should be understood by those skilled in the art that the description is merely illustrative , and many changes or modifications can be made to the embodiments without departing from the principle and spirit of the present invention . therefore , the protection scope of the present invention is as defined by the appended claims .
2
fig1 and 2 illustrate refuse collection vehicle 10 supporting container 12 during loading and unloading of container 12 . fig1 is a side elevational view of refuse collection vehicle 10 illustrating container 12 supported in front of vehicle 10 and further illustrating container 12 nested partially within vehicle 10 for unloading . fig2 schematically illustrates the orientation of container 12 as container 12 is elevated above and lowered into vehicle 10 . container 12 is configured for being engaged and carried by refuse collection vehicle 10 and includes at least one bottom discharge opening 14 through which refuse contained within container 12 is emptied . container 12 additionally includes at least one bottom discharge door 16 for selectively opening and closing discharge opening 14 . refuse collection vehicle 10 lifts container 12 to unload the contents of container 12 into vehicle 10 . refuse collection vehicle 10 generally includes storage body 20 and lift actuators 24 . storage body 20 is conventionally known and is configured for containing refuse , recyclable commodities , or a segregated combination thereof during collection and transport . as is conventionally known , storage body 20 includes a rear discharge opening 28 , a rear discharge door 30 , a top access opening 32 and a canopy 34 . rear discharge opening 28 is generally located at a rear of storage body 20 and is sized for unloading refuse from storage body 20 at a disposal or recycling facility . discharge door 30 is supported by storage body 20 adjacent discharge opening 28 and is configured for closing discharge opening 28 . as can be appreciated , the size and configuration of storage body 20 may be varied depending upon the particular configuration of refuse collection vehicle 10 . access opening 32 is defined along a top horizontal surface of storage body 20 and is sized for receiving container 12 . in the preferred embodiment illustrated , refuse collection vehicle 10 is a front loading refuse collection vehicle . accordingly , access opening 32 is located towards a front end of refuse collection vehicle 10 . alternatively , access opening 32 may be positioned towards a rear of refuse collection vehicle 10 or towards a side of refuse collection vehicle 10 for rear and side loading refuse collection schemes , respectively . access opening 32 communicates with an interior 33 of storage body 20 for loading refuse from container 12 into the interior . canopy 34 is a generally elongate hood extending forward and adjacent to access opening 32 towards a front end of refuse collection vehicle 20 . canopy 34 preferably defines a generally hollow cavity 38 in communication with the interior storage body 20 . canopy 34 encloses and protects the front end of refuse collection vehicle 10 . in addition , canopy 34 aerodynamically reduces wind resistance of storage body 20 . lift arms 22 are generally elongate members having a first end 40 pivotally connected to refuse collection vehicle 10 about pivot 42 and a second end 44 pivotally coupled to container 12 about pivot 46 . in the preferred embodiment illustrated , end 44 of each of arms 22 is pivotally coupled to container 12 above a center of gravity of container 12 towards a top end of container 12 . arms 22 are pivotally coupled to container 12 along opposite sides of container 12 so as to permit container 12 to pivot between arms 22 to maintain container 12 in a substantially level or horizontal orientation as arms 22 are pivoted about pivot 42 by lift actuator 24 . lift actuator 24 preferably comprises a hydraulic rotary actuator assembly coupled between refuse collection vehicle 10 and lift arm 22 . actuator 24 pivots arms 22 about pivot 42 so as to elevate container 12 over canopy 34 and above access opening 32 . as shown by fig1 actuator 24 further pivots arms 22 so as to lower container 12 through access opening 32 into the interior of storage body 20 . actuator 24 may alternatively comprise other well known pneumatic , electrical , hydraulic or mechanical actuating mechanisms for pivoting lift arms 22 about pivot 42 so as to elevate container 12 above access opening 32 and so as to further lower container 12 through access opening 32 into a nested relationship within storage body 20 . as schematically illustrated by fig2 container 12 pivots about pivot 46 while actuator 24 simultaneously pivots arms 22 about pivot 42 . consequently , refuse collection vehicle 10 maintains container 12 in a substantially level orientation at all times while container 12 is being lifted over and above access opening 32 and while container 12 is being lowered through access opening 32 into the interior of storage body 20 . as a result , refuse is maintained within container 12 to minimize spillage . because arms 22 are pivotally coupled to container 12 directly above the center of gravity of container 12 , container 12 pivots about pivot 46 under the force of gravity to maintain its substantially level orientation while being lifted and lowered over and into storage body 20 . consequently , other complex and expensive leveling mechanisms are not needed . alternatively , refuse collection vehicle 10 may be provided with a slave hydraulic system or a linkage for maintaining the level orientation of container 12 . as shown by fig1 once container 12 is lowered through access opening 32 into the interior of storage body 20 , bottom discharge door 16 is selectively actuated so as to open discharge opening 14 to release the contents of container 12 into storage body 20 . because refuse collection vehicle 10 lowers container 12 through access opening 32 such that discharge opening 14 and substantially the entire bottom portion of container 12 is surrounded by at least one vertical wall , refuse released from container 12 must fall into storage body 20 . moreover , the vertical walls surrounding discharge opening 14 on substantially all sides prevent wind from carrying lighter weight refuse away from access opening 32 . consequently , refuse collection vehicle 10 minimizes littering of the surrounding environment . in addition to providing for more reliable unloading of container 12 , refuse collection vehicle 10 improves driving visibility as well as vehicle maneuverability . during transportation of refuse collection vehicle 10 from collection site to collection site or from a collection site to a recycling or disposal site , arms 22 support and maintain container 12 in a nested relationship within storage body 20 . because container 12 is not supported forward of refuse collection vehicle 20 , driver visibility is improved . at the same time , because container 12 nests within storage body 20 , container 12 does not substantially increase the clearance height of refuse collection vehicle 10 . consequently , the vertical height of storage body 20 may be maximized without impairing the ability of refuse collection vehicle 10 to travel and operate in height restricted areas such as beneath low bridges . fig3 is a perspective view illustrating refuse collection vehicle 10 and container 12 in greater detail as container 12 is lifted by lift arms 22 above access opening 32 and lowered through access opening 32 into the interior of storage body 20 . as best shown by fig3 container 12 preferably includes divider panel 60 , bins 62a and 62b , discharge openings 14a and 14b , discharge doors 16a and 16b , and door actuators 68a and 68b . divider panel 60 is a generally vertical wall supported within container 12 so as to partition container 12 into side - by - side bins 62a and 62b . in the preferred embodiment illustrated , divider panel 60 mates with a corresponding divider panel 80 when container 12 is lowered through access opening 32 . alternatively , divider panel 60 may include an elongate slot extending within divider panel 60 between bins 62a and 62b so as to receive divider panel 80 when container 12 is lowered through access opening 32 . in such an alternative embodiment , the elongate slot enables container 12 to be lowered a greater distance through access opening 32 and further insures against cross contamination of segregated refuse . each bin 62a and 62b defines a top load opening 70a and 70b , respectively . load openings 70a and 70b enable refuse to be easily deposited into bins 62a and 62b . discharge openings 14a and 14b generally extend opposite discharge openings 70a and 70b , and extend on opposite sides of divider panel 60 . load openings 14a and 14b are each selectively opened and closed by actuation of discharge doors 16a and 16b by door actuators 68a and 68b . alternatively , doors 16a and 16b may be interconnected by a link such that load openings 14a and 14b may be simultaneously open and closed with one door actuator . discharge doors 16a and 16b are generally flat , horizontally extending panels supported adjacent to and below discharge openings 14a and 14b by guides 64a and 64b , respectively . doors 16a and 16b are sized and shaped for closing and opening discharge openings 14a and 14b upon being selectively actuated by door actuators 68a and 68b . in the preferred embodiment illustrated , doors 16a and 16b slide within guides 64a and 64b , respectively , to open and close discharge openings 14a and 14b , respectively . guides 64a and 64b slidably support discharge doors 16a and 16b below bins 62a and 62b . guides 64a and 64b preferably comprise an elongate , inwardly facing c - shaped tracks longitudinally extending on opposite sides of each discharge opening 14a and 14b , respectively . guides 64a and 64b are sized for slidably receiving an edge of discharge doors 16a and 16b . door actuators 68a and 68b are fixedly coupled between container 12 and discharge doors 16a and 16b , respectively . actuators 68a and 68b selectively reciprocate doors 16a and 16b along guides 64a and 64b so as to open and close discharge openings 14a and 14b of bins 62a and 62b . actuators 68a and 68b are preferably housed by an above shield or hood 74 . in the preferred embodiment illustrated , door actuators 68a and 68b comprise conventional hydraulic cylinder assemblies . alternatively , door actuators 68a and 68b may comprise other linear actuating mechanisms such as pneumatic , electrical or mechanical devices . as further shown by fig3 storage body 20 preferably includes a vertically extending divider panel 80 supported within the interior of storage body 20 below access opening 32 . divider panel 80 partitions the interior storage body 20 below access opening 32 into two side - by - side loading chutes 82a and 82b below access opening 32 . chutes 82a and 82b are positioned below access opening 32 so as to receive refuse from bins 62a and 62b of container 12 after container 12 has been lowered through access opening 32 and after discharge doors 16a and 16b have been opened by actuation of actuators 68a and 68b . chutes 82a and 82b communicate with rearward compartments of storage body 20 . as shown by fig3 once lift arms 22 elevate container 12 above access opening 32 and lower container 12 through access opening 32 into the interior of storage body 20 , actuators 68a and 68b slide discharge doors 16a and 16b within tracks 64a and 64b towards and within cavity 38 of canopy 34 to open discharge openings 14a and 14b . as a result , track 64a and 64b securely support discharge doors 16a and 16b as discharge doors 16a and 16b are moved into cavity 38 . once discharge doors are within cavity 38 , canopy 34 covers and protects the moving elements of container 12 . moreover , once discharge doors 16a and 16b are positioned within cavity 38 to open discharge openings 14a and 14b , refuse contained within bins 62a and 62b falls through discharge openings 14a and 14b into load chutes 82a and 82b . because discharge doors 16a and 16b slide into cavity 38 of canopy 34 , discharge doors 16a and 16b do not require space below discharge openings 14a and 14b to open discharge openings 14a and 14b . as a result , interior 33 of storage body 20 may be more completely filled with refuse without interfering with the opening of discharge doors 16a and 16b . although discharge doors 16a and 16b are illustrated as being simultaneously opened so as to simultaneously release refuse into storage body 20 , actuators 68a and 68b may alternatively be selectively actuated so as to only release refuse from one of bins 62a and 62b . fig4 is a perspective view of refuse collection vehicle 110 , an alternate embodiment of refuse collection vehicle 10 illustrated in fig1 - 3 . refuse collection vehicle 110 is similar to refuse collection vehicle 10 except that refuse collection vehicle 110 includes discharge doors 116a and 116b , hinges 164a and 164b and actuators 168a and 168b in lieu of doors 16a and 16b , guides 64a and 64b and actuators 68a and 68b , respectively . for ease of illustration , those remaining elements of refuse collection vehicle 110 which are the same as corresponding elements of refuse collection vehicle 10 are numbered similarly . as shown by fig4 discharge doors 116a and 116b are similar to discharge doors 16a and 16b except that discharge doors 116a and 116b are pivotally coupled to container 12 by hinges 164a and 164b , respectively . in the preferred embodiment illustrated , hinges 164a and 164b extend along outermost side walls of bins 62a and 62b , respectively , such that upon being selectively pivoted by actuators 168a and 168b , discharge doors 116a and 116b pivot outwardly away from divider panel 60 of container 12 and away from divider panel 80 of storage body 20 . alternatively , hinges 164a and 164b may be supported along divider panel 60 or along either a front wall or rear wall of container 12 adjacent discharge openings 14a and 14b so as to pivotally support discharge doors 116a and 116b adjacent discharge openings 14a and 14b , respectively . furthermore , in lieu of discharge doors 116a and 116b each compromising a single panel pivotally supported by a single hinge , discharge doors 16a and 16b may alternatively each comprise a pair of doors pivotally supported opposite one another by a pair of hinges below each refuse bin . actuators 168a and 168b are fixedly coupled between container 12 and discharge doors 116a and 116b , respectively . actuators 168a and 168b selectively pivot discharge doors 116a and 116b about hinges 164a and 164b to selectively open and close discharge openings 14a and 14b , respectively . in the preferred embodiment illustrated , actuators 168a and 168b comprise conventionally known hydraulic cylinder assemblies . alternatively , actuators 168a and 168b may comprise other well known actuating mechanisms including pneumatic , electrical and mechanical actuating mechanisms . as further shown by fig4 once arms 22 elevate container 12 above access opening 32 and lower container 12 through access opening 32 into the interior of storage body 20 , actuators 168a and 168b are actuated so as to pivot discharge doors 116a and 116b about the axes of hinges 164a and 164b so as to open discharge openings 14a and 14b to release refuse within bins 62a and 62b into load chutes 82a and 82b , respectively . as a result , similar to refuse collection vehicle 10 , refuse collection vehicle 110 enables refuse within container 12 to be easily unloaded into storage body 20 while preventing cross contamination of refuse within bins 62a and 62b and also while preventing the refuse from missing access opening 32 entirely . consequently , refuse collection 110 minimizes cross contamination of segregated refuse and littering of the surrounding environment . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .
8
the novel rotor head or hub disclosed herein includes some elements that are similar to those used in the v - 22 tilt - rotor , but is otherwise mechanically quite different from the latter . the hub disclosed herein uses a low maintenance , all - elastomer - and - metal laminate ( i . e ., completely oil - less ) bearing system . the exemplary rotor head also provides a high speed , low drag design for a helicopter hub having three or more rotor blades , while enabling a more compact intermeshing blade tandem rotorcraft configuration by eliminating the lead - lag blade motions and dampers associated with conventional fully articulated rotor heads 100 , such as that illustrated in fig9 . one of the major problems of the prior art rotor heads that is overcome by the rotor head of the present disclosure is the provision of a low maintenance hub design that uses all lubrication - free elastomeric - metal laminated bearings of a type referred to as โ€œ high capacity laminate โ€ ( hcl ) bearings , available from , e . g ., lord aerospace corp ., cary , n . c ., and described in , e . g ., u . s . pat . nos . 4 , 105 , 266 to r . finney and 4 , 913 , 411 to f . collins et al . these types of bearings not only provide superior vibration control , but also require no lubrication , thereby substantially lowering operating and maintenance costs , and are available in a variety of configurations , including cylindrical , conical , spherical and disc - shaped sections , and various combinations of the foregoing . another problem solved by the novel stiff in - plane rotor head disclosed herein is that it enables a greater number of rotor blades to be used on the hub than does the prior art , viz ., greater than three blades per rotor head . in the particular exemplary embodiment illustrated in the figures , the hub herein incorporates six blades (# 1 -# 6 ), but can incorporate either more or less blades , as may be indicated by the particular design constraints at hand . the novel rotor head also enables a more compact intermeshing tandem rotor configuration to be achieved than the fully articulated rotor heads of the prior art , which require substantial clearance between the two rotors due to in - plane leading and lagging motions and out - of - plane โ€œ flapping โ€ of the blades . this combination of features of this disclosure results in a rotor head that virtually eliminates large hub moments generated by thrust offset in high speed flight of a type that occurs if a rigid ( e . g ., a โ€œ propeller โ€ type ) hub is used . they also result in rotor head assemblies that are relatively light in weight , due to the low hub moments that are generated only by the respective spring rates of the hub bearings themselves . the constant velocity gimbal system provided by the rotor head is thus well suited for high power and high torque applications . it includes a โ€œ paddle bearing โ€ arrangement that results in a much larger bearing area than can be achieved with the rod ends of a three - drive link installation , such as that used in the prior art . when compared to a prior art โ€œ teeter โ€ rotor head ( not illustrated ), the primary advantage provided the hub of the present disclosure is that it can handle a significantly larger number of rotor blades . a teeter hub pivots like a teeter - totter , and as a consequence , can incorporate only 2 rotor blades , which makes such a hub arrangement completely unsuitable for high speed , heavy lift rotorcraft . by contrast , the exemplary rotor hub described herein can incorporate six or more rotor blades . the main differences between the rotor head 10 of the present disclosure and those of the prior art are as follows : 1 ) high capacity , pivoting paddle bearings are used to transmit torque across the gimbal joint instead of drive links ; 2 ) vertical pitch arms internal to the hub are used to minimize the โ€œ ฮด3 โ€ pitch - flap coupling effect that occurs when more than three blades are used ; 3 ) a hub assembly of 6 or more blades is made possible ; and , 4 ) the instant rotor head is configured with stationary hub spindle housings for each blade , situated external to the blade &# 39 ; s movable pitch control shaft . the rotor head of the present disclosure is thus superior to the existing solutions because it can be designed to handle the very high torque demands of a large , high speed , heavy lift helicopter . it can be configured for โ€œ high solidity โ€ rotors using a large number of rotor blades , e . g ., six or more . it also incorporates a low drag hub fairing that enhances high speed performance . fig1 is a partial cross - sectional top plan view of an exemplary embodiment of a stiff in - plane , gimbaled rotor head 10 in accordance with the present disclosure , and fig2 is a partial cross - sectional elevation view of the exemplary rotor head 10 of fig1 , as seen along the lines of the section 2 - 2 taken therein . the exemplary rotor head 10 illustrated in fig1 and 2 comprises a split outer hub 12 , a splined center hub 14 and a main rotor shaft 16 having splines 18 at an upper end that are drivingly engaged with the corresponding splines of the center hub 14 in the manner of a spline gear . the center hub 14 , in turn , is coupled to the outer hub 12 through upper and lower spherical , high capacity laminated metal - and - elastomeric ( hcl ) bearings 20 and 22 described in more detail below . a plurality of blades 24 , each having an airfoil cross - section , are rigidly coupled to an outboard end of a respective pitch control shaft 26 , each of which , in turn , has an inboard end pivotally coupled to the outer hub 12 through a respective dry - lube ball - and - socket joint 28 to enable the respective pitch control shafts and blades associated therewith to rotate about the long axis 30 , i . e ., the โ€œ pitch โ€ axes , of the respective shafts and blades . an outboard end portion of each pitch control shaft 26 is concentrically supported in a pitch bearing housing 32 having an inboard end coupled to the inboard end of a corresponding one of the pitch control shafts 26 through a spherical bearing 46 . the hub 10 also incorporates a novel constant velocity joint , described in more detail below , that enables the hub to gimbal ยฑ 12 degrees in any direction relative to a vertical axis extending through the main rotor shaft 16 while maintaining a constant rotational velocity in each of the blades 24 . fig3 is an enlarged partial cross - sectional elevation view of the center hub 12 portion of the exemplary rotor head 10 . as illustrated in fig3 , the splined center hub 14 sits atop a splined drive collar 32 , which may be made of steel or titanium , located at the bottom center of the hub assembly , and which , together with the center hub , is driven rotationally by the rotor shaft 16 . the drive collar 32 is used as a hub spacer and to drive a pitch control swashplate ( not illustrated ) disposed below the hub . a hub nut and washer 34 are used to retain the hub assembly to the rotor shaft 16 . the splined center hub 14 may also be made of steel or titanium , and is used to transmit torque from the rotor shaft 16 through the paddle bearings 40 , 42 , 44 and the paddle shaft 38 to the split outer hub 12 . the center hub contains features adapted to provide limit stops for the hub &# 39 ; s gimbal joint , described below . the upper and lower spherical elastomeric set of bearings 20 and 22 are integral to the center hub and are used to support rotor thrust . this set of bearings has the capability of pivoting about a spherical center point that helps to create the constant velocity joint of the hub . the spherical elastomeric bearing set 20 and 22 comprises a main contributor to the hub &# 39 ; s gimbal spring stiffness . as illustrated in fig3 , the split outer hub 12 , referred to as such because it comprises upper and lower halves that mate with each other across a horizontal plane in the manner of a clam shell , may be made of , e . g ., aluminum or titanium , and surrounds the center hub 14 . it performs the following functions , among others : 1 ) it retains the gimbaled hub &# 39 ; s paddle bearing assemblies described below , which are used for torque drive ; 2 ) it connects the gimbaling split outer hub to the non - gimbaling inner hub through the upper and lower spherical bearing set 20 and 22 ; 3 ) it is used to connect to each rotor blade &# 39 ; s pitch bearing housing 32 and pitch shaft 26 spindle ; 4 ) it supports the centrifugal forces of each blade 24 through a corresponding pitch bearing housing 32 ; and , 5 ) it is used to attach a streamlined composite hub - fairing 36 to the rotor head 10 . as illustrated in fig1 - 3 , a plurality of paddle bearing shafts 38 are respectively located about the circumference of the outer hub 12 and between each pair of adjacent rotor blade 24 installations thereon . each paddle bearing shaft 38 is a subassembly comprising a titanium or steel center shaft integrated with three elastomeric bearing installations , described below in connection with fig7 and 8 . the center shaft and elastomeric bearings comprise an important innovation of the gimbal mechanism of the rotor head 10 described below . as illustrated in fig3 , the inboard end of each center - shaft includes a paddle bearing 40 that , acting in combination with the center hub 14 , provide limit stops of ยฑ 12 ยฐ for the gimbal joint of the rotor head 10 . following is a description of the three elastomeric bearing assemblies disposed on the paddle bearing shaft 38 . as those of skill in the art will appreciate , in order to provide stiff in - plane movement of the rotating blades 24 , i . e ., to eliminate in - plane pivoting of the rotating blades during gimbaling movement of the hub 10 , it is necessary to maintain a substantially constant angular velocity , or rotational speed , of each radial point in each of the blades during such motion . in order to achieve this , it is necessary to provide a constant velocity joint between the blades 24 and the rotor shaft 16 that applies the torque used to drive the blades . fig7 is an enlarged partial cross - sectional elevation view of the constant velocity joint of the rotor head 10 , showing details of the bearings thereof , and fig8 is an enlarged partial cross - sectional top plan view of the constant velocity joint of fig7 . as illustrated in these figures , a tapered stack , flat pack , elastomeric paddle bearing 40 shaped like a hollow disc sector is located at the inboard end of each paddle shaft 38 . the disc - sector or paddle bearing 40 is used to transmit rotor shaft 16 torque from the non - gimbaled inner or center hub 14 to the gimbaled split outer hub 12 . its disc shape follows the gimbaling motion of the set of upper and lower spherical bearings 20 and 22 described above that is part of the inner hub 14 . the combination of all of the paddle bearings 40 and the center hub &# 39 ; s spherical bearing set 20 and 22 serves as the main contributor to the ability of the rotor head 10 to engage in gimbaling movement in any direction relative to a vertical axis through the main rotor 16 and to the spring stiffness of the gimbal joint defined thereby . referring to fig7 and 8 , each paddle bearing shaft 38 is disposed above a web 39 ( shown in dashed outline in fig8 ) of the split outer hub 12 , and a main radial support bearing 42 is located on each paddle shaft 38 outboard of the paddle bearing 40 . the main radial support bearing serves as one of the pivot bearings for the paddle bearing shaft 38 . the paddle bearing shaft transmits rotor torque loads into the main radial support bearing 42 . this radial bearing also incorporates a small conical section that provides the ability to carry the centrifugal loads of the paddle bearing shaft 38 . the combination of all of the main radial support bearings 42 adds to the total spring rate of the gimbal joint . as also illustrated in fig7 and 8 , a radial tail support bearing 44 is located at the outboard end of the paddle bearing shaft 38 . this second radial bearing serves as a second pivot bearing for the paddle bearing shaft 38 . acting in cooperation with the main radial support bearing 42 , it reacts paddle shaft 38 moments generated by rotor torque . the combination of all the radial tail support bearings 44 further adds to the total spring rate of the gimbal joint . as illustrated in the top plan view fig8 , each of the main radial support and radial tail support bearings 42 and 44 may be coupled to the respective paddle bearing shaft 38 through respective anti - rotation tabs 43 . turning to fig4 , which is an enlarged partial cross - sectional elevation view of a rotor blade 24 retention and pitch control portion of the rotor head 10 , the pitch bearing housing 32 , which may be made of aluminum or titanium , is connected to the split outer hub 12 and to an inboard end of a corresponding one of the pitch control shafts 26 through a corresponding spherical elastomeric bearing 46 , and is used to retain spherical and conical elastomeric bearings 46 and 48 utilized for retention and pitch control of the rotor blades 24 . as illustrated in fig4 , the pitch bearing housing 32 also incorporates a support lug 74 on its outer diameter to mount a pitch control bell - crank 52 of another blade , as described in more detail below . the outboard end of each pitch control shaft 26 incorporates a concentric integral conical elastomeric bearing 48 required for rotor blade pitch control . the conical bearing is used to bear the very high shear loads transmitted into it from the rotor blade assembly . the taper angle of the conical bearing is arranged to provide a preload capability , together with the spherical blade retention bearing 46 located at the opposite end of the pitch control shaft 26 . the bearing &# 39 ; s taper angle also allows for a large outboard cross section on the pitch control shaft 26 where blade - induced moments are highest . a two - pin clevis joint 54 , which is used to rigidly attach the inboard end of each rotor blade 24 to the outboard end of the corresponding pitch control shaft 26 , is disposed adjacent to the conical bearing 48 at the very outboard end of the pitch control shaft 26 . the inboard end of the pitch control shaft 26 is connected with a main retention pin 56 to the spherical elastomeric bearing 46 used for blade 24 pitch control and retention . disposed adjacent to the spherical elastomeric bearing 46 at the inboard end of the shaft 26 is a spherical ball 28 that is machined , or otherwise formed , on the inboard end of the shaft , and which is used as an inboard support within the hub . the ball 28 picks up the pitch control shaft &# 39 ; s inboard shear loads and prevents that load from being transmitted into the spherical elastomeric bearing 46 . the ball 28 , which may be made of steel , also serves as a positive center pivot for the spherical elastomeric bearing 46 . the outer race of the ball is preferably lined with a dry - film bearing material and is mounted into a corresponding socket formed in the split outer hub 12 . the combination of the outboard conical bearing 48 and the inboard spherical bearing 46 provides a mechanism to preload the bearing elastomers so as to improve bearing service life . as illustrated in fig4 , the spherical blade retention bearing 46 is located at the inboard end of the pitch control shaft 26 , and is pinned to the pitch control shaft with the main retention pin 56 . the blade retention bearing 46 is also an elastomeric laminate bearing assembly that is used to transmit the very high centrifugal loading of the rotor blade 24 into the inboard end of the corresponding pitch bearing housing 32 , and thence , into the split outer hub 12 . the inboard end plate of the blade retention bearing 46 includes a pitch arm 58 that is used for controlling the pitch of the associated rotor blade 24 . the outboard end of the blade retention bearing rests on a shoulder 60 in the associated pitch bearing housing and is keyed into the shoulder with shear tabs 62 disposed on the endplate of the bearing . fig6 is an enlarged partial cross - sectional elevation view of the blade retention mechanism of the exemplary rotor head 10 illustrated in fig4 , and shows details of the main retention pin 56 and the dry - lube ball - and - socket joint 28 thereof . the main retention pin 56 , which may be made of steel , is similar to a tie - bar pin of a type used on a conventional hub , such as that used on the prior art rotor of fig9 . the annular main retention pin 56 is used to couple the spherical blade retention bearing 46 to the pitch control shaft 26 . it also functions to transmit retention loads and pitch control loads from the associated blade 24 into the spherical blade retention bearing 46 and pitch arm 58 . due to its critical function within the rotor head 10 assembly , it is configured with a fail - safe capability described below . the annular main retention pin 56 is held into the assembly with a high tensile bolt 64 extending through its center . a small amount of clearance is provided between the inside diameter of the retention pin and the bolt 64 so as to define a sealed annular chamber 66 into which a crack detection dye may be injected . in the event of a crack in the main retention pin 56 , the high tensile retention bolt 64 has the capability of carrying the full centrifugal and pitch loads . any leakage of dye from the chamber 66 serves to alert ground personnel that the main retention pin 56 has been compromised . if desired , an optional short spline ( not illustrated ) can be added to the pitch control shaft 26 and spherical retention bearing 46 joint as a secondary load path for coupling pitch control loads . fig5 is partial cross - sectional top plan view of a blade 24 and associated pitch control shaft 26 of the rotor head 10 , showing two cross - sectional detail views through the blade at two stations along the pitch , or long axis 30 thereof . as discussed above , each blade 24 is rigidly fixed to the outboard end of a corresponding one of the pitch control shafts 26 with a two - pin clevis joint 54 . the clevis pins and bolts 54 , which may be made of steel , are located at the interface of the rotor blade 24 and the outboard end of the pitch control shaft 26 . two pins are used to attach the rotor blade 24 to the pitch control shaft rigidly so as to prevent any leading / lagging movements of the blade in the plane of rotation relative to the shaft , in contradistinction to the in - plane movement of the blades in the flexible in - plane rotor hub 100 discussed above . one of the principal innovations of the exemplary gimbaled rotor head 10 disclosed herein and illustrated in fig1 - 4 and 6 - 8 is the pitch control cross links 68 used to control the pitch of the respective blades 24 . the pitch control cross links , each of which may be made of titanium , comprise a control rod assembly with spherical rod end beatings 70 located at each end thereof . by utilizing a vertical pitch arm 58 ( see fig4 ) located internal to the rotor head 10 , the pitch control cross links respectively connect to the pitch arms 58 and pass horizontally below an adjacent blade installation and over to a respective associated pitch control bell - crank 52 . the pitch control bell - cranks are then located in the hub assembly at a strategic point that ( to an acceptable level ) minimizes the pitch โ€” flap coupling , i . e ., the โ€œ ฮด3 angle ,โ€ of the vertical pitch link 72 in the rotor &# 39 ; s upper controls , which are located below the gimbaled rotor head assembly 10 . as illustrated in fig4 , the pitch control bell - cranks 52 ( shown by dotted outline ), which may be made of aluminum or titanium , are approximately 80 ยฐ bell - cranks that respectively convert vertical motion from the respective vertical pitch links 72 to nearly horizontal movement of the respective pitch control cross links 68 . in a six - bladed rotor assembly , such as the exemplary embodiment illustrated in the figures , the bell - cranks may be mounted into a machined clevis 74 that is a part of the pitch bearing housing 32 of an adjacent blade installation . as illustrated in the figures , the streamlined hub fairing assembly 36 incorporates a split fiberglass or carbon fiber honeycomb composite construction . it is a light weight assembly that comprises upper and lower clam shell portions , as well as a removable access cover for the main rotor hub nut 34 . the fairing incorporates a streamlined shape that covers the rotor hub 10 assembly and its appendages that extend out to the roots of the airfoil rotor blades 24 . the fairing enhances the performance of the host rotorcraft in high speed flight by reducing hub drag , which is a major contributor to the overall drag of such aircraft . the novel rotor hub 10 disclosed herein provides an advance in the โ€˜ state of the art โ€™ in rotor head design that enables helicopters to operate at higher speeds , higher gross weights , and higher power levels than conventional rotorcraft , such as the ch - 47 or ch - 53 rotorcraft , can operate . the stiff in - plane feature of the rotor head 10 is particularly suited for tandem helicopters with overlapping rotors . because there is no lead - lag hinge , it eliminates the lag damper , adds simplicity , allows for the installation of up to six or more rotor blades for higher speeds and gross weights , and provides good rotor - to - rotor clearance , even when the respective rotor centers are placed relatively close to each other . for both single and tandem rotor designs , the stiff in - plane gimbaling hub 10 in high speed flight reduces large pitch link loads generated by the large lead - lag excursions of advancing and retreating blades of the prior art . the novel gimbal joint of the hub 10 is also well suited for both single rotor and tandem rotor aircraft . when compared to a rigid rotor , it relieves large hub moments in high speed flight generated by the lateral thrust differential of advancing and retreating rotor blades . this overall reduction in moment and force in the rotor head thereby substantially simplifies rotor head parts and reduces part weight . one of the reasons that the rotor head 10 herein is well suited for high power and high torque applications is the novel gimbal system provided thereby . the paddle shaft and bearing arrangement of the hub thus results in a much larger bearing area then can be achieved with the rod ends of a three - drive - link installation , such as used on prior art rotor heads . in a six - bladed installation , the rotor head 10 can incorporate up to six paddle bearing assemblies , thereby providing a very high torque capability . the horizontal pitch control cross links 68 also provide an advantage over the prior art . by virtue of their passing below adjacent blade installations , the horizontal pitch control link 68 enable the use of an acceptable pitch - flap ฮด3 angle at the vertical pitch links 72 , even when six or more blades are used . the rotor head 10 also makes wide use of elastomeric rotor bearing technology that results in fewer parts and lower production , maintenance and life cycle costs . indeed , most of the parts of the rotor heads of the forward and aft rotors of a tandem rotor installation can be identical , thereby providing further production cost effectiveness . in accordance with the exemplary embodiments described herein , high speed , low drag , low maintenance , stiff in - plane , gimbaled rotor heads are provided for helicopters that enable three or more rotor blades to be used per rotor , and that also enable a compact tandem rotor blade intermesh to be achieved by eliminating the lead - lag motions and dampers of fully articulated rotor heads . as those of skill in this art will appreciate , many modifications , substitutions and variations can be made in the applications and methods of implementation of the stiff in - plane , gimbaled rotor heads of the present disclosure without departing from its spirit and scope . in light of this , the scope of the present disclosure should not be limited to that of the particular embodiments illustrated and described herein , as they are only by way of some examples thereof , but instead , should be fully commensurate with that of the claims appended hereafter and their functional equivalents .
1
preferred embodiments of the present invention will be described in detail with reference to the annexed drawings , with detailed description of known functions and configurations incorporated herein being omitted for clarity of presentation . the present invention proposes an algorithm to allow an olt to dynamically allocate bandwidth to n onus using bandwidth request information ( or queue information ) received from the onus . the olt must allocate bandwidths effectively and impartially to the onus using the queue information transmitted from the onus . the dynamic bandwidth allocation is effectively achieved through a tree - structure for the connection mechanism between the olt and onus for information transfer . the present invention defines logical dynamic - bandwidth - allocation control nodes ( dbacns ) to constitute such a tree structure , and proposes an internal algorithm based on that structure . [ 0026 ] fig3 illustrates a structural model representing an example of a dba ( dynamic bandwidth allocation ) method that employs a trga ( tree request grant algorithm ) according to a preferred embodiment of the present invention . the dba method includes a tree formation process , a request collection process , and a bandwidth allocation process , the tree formation process corresponding to an initialization process for implementing the trga . the tree structure shown in fig3 assumes that the number of onus 210 a , 210 b , . . . 210 h is 8 . the tree structure is formed to include a plurality of hierarchical stages 230 a , 230 b , 230 c , and each stage includes one or more logical dbacns ( dynamic bandwidth allocation control n odes ) 220 a , 220 b , . . . 220 g . the logical dbacns 220 a to 220 g are not nodes on a real network ; instead , each corresponds to a specific step in performing the trga ( tree request grant algorithm ) that may be executed by a computer program resident in the olt , and which may have adjustable parameters that are updated by a scheduler of the olt . specifically , the algorithm starts its operation from the second - level stage 230 b at which the olt receives bandwidth request information from the onus 210 a , 210 b , . . . 210 h . the algorithm is not confined to software implementation , but may be implemented for example in firmware , hardware or some combination thereof . the number of onus , here shown as 8 , may vary as appropriate . likewise , the number of dbacns and hierarchical tree levels may be set to any suitable value . for the embodiment shown in fig3 each of the tree - structured dbacns 220 a to 220 g determines information to be transmitted to its upper - level dbacns and its lower - level dbacns or the onus 210 a to 210 h . with respect to each of the dbacns 220 a to 220 g , its immediately higher - level dbacn can be classified as a root node , and its immediately lower - level dbacns or the onus 210 a to 210 h can be classified as branch nodes . thus , each of the dbacns 220 a to 220 g is a root node for its lower - level dbacns , and is a branch node for its upper - level dbacn . input and output values with respect to each of the dbacns 220 a to 220 g are classified into upward i / o values ( toward its immediately higher - level dbacn in the tree structure ) and downward i / o values ( toward its immediately lower - level dbacns or onus ). specifically , the upward i / o values with respect to a recipient node in the tree structure include two upward input - values bwlreq ( requested - bandwidth from left branch node ) and bwrreq ( requested - bandwidth from right branch node ) that represent bandwidth request information inputted respectively from its left and right branch nodes , and include an upward output - value bwtreq ( total requested - bandwidth ), that the recipient node outputs to its root node , that represents the sum of the two input values bwlreq and bwrreq . on the other hand , the downward i / o values with respect to the recipient node include a downward input - value bwtalloc ( total bandwidth to be allocated ) representing bandwidth allocation information inputted from its root node , and include two downward output - values bwlalloc ( bandwidth to be allocated to left branch node ) and bwralloc ( bandwidth to be allocated to right branch node ), respectively , for distributing the downward input - value bwtalloc to its left and right branch nodes in the immediately lower - level stage . in the above embodiment , a binary tree is depicted wherein each dbacn is connected from below to a respectively pre - selected two elements of the group consisting of dbacns and onus in the tree . it is , however , within the intended scope of the invention that a dbacn may connected from below so as to select from any respectively pre - selected number of dbacns or onus in the immediately lower stage . two values bwlreq and bwrreq represent bandwidth request information from left and right branch nodes , respectively . information of the sum of the two values is transmitted to their root node . this process can be expressed in c - pseudo code fragment as follows : this process is repeated until bandwidth request information from the onus 210 a to 210 h is delivered to the uppermost dbacn 220 a that constitutes the first - level stage 230 a . the uppermost dbacn 220 a compares a value bwtreq representing the total requested - bandwidth from its lower - level dbacns 220 b to 220 g with a value bwavail representing the total available allocation - bandwidth , and selects the lower one of the two values . this process can be expressed in c - pseudo code fragment as follows : bwtalloc = min ( bwtreq , bwavail ); // select the lower one of bwtreq and bwavail . thereafter , a process of distributing an allocation bandwidth received or selected from a root node to its branch nodes is sequentially performed , starting from the uppermost dbacn 220 a . in other words , dbacns 220 b to 220 g , other than the uppermost dbacn 220 a , performs a process to allocate the allocation bandwidth received from the root node to its branch nodes , and this process is repeated until the bandwidth is allocated to the onus 210 a to 210 h constituting the lowermost stage 230 c . here , a direction selector 240 functions to set the value of a parameter โ€œ direction โ€, and , according to this value , a bandwidth corresponding to the value bwtalloc is allocated to only one of the two branch nodes ( hereinafter also referred to as โ€œ two directions โ€) corresponding respectively to the two values bwlalloc and bwralloc . if the value bwtalloc has a remaining value after it is allocated to one of the โ€œ two directions โ€, a bandwidth corresponding to the remaining value is allocated to the other . the direction selector 240 switches to alternately select the two directions , using clocks of different periods , i . e . different time rates of switching , for the stages 230 a to 230 c , so as to provide the two directions with an equivalent or balanced chance to deal with their bandwidth allocation request . this process can be expressed in c - pseudo code fragment as follows : if ( direction = = left ) {// if previous direction is left direction = = right ; // current direction is set to right } else if ( direction = = right ) {// if previous direction is right direction = = left ; // current direction is set to left } if ( direction = = left ) {// if current direction is left if ( bwtalloc & lt ; bwlalloc ) {// if allocation bandwidth is less than requested bandwidth bwlalloc = bwtalloc ; bwralloc = 0 ; // bwtalloc is all allocated to left branch node } else {// if allocation bandwidth is equal to or more than requested bandwidth bwlalloc = bwlalloc ; // bandwidth equal to requested bandwidth is allocated to left branch node bwralloc = bwtalloc โˆ’ bwlalloc ; // remaining bandwidth is allocated to right branch node } } else if ( direction = = right ) {// if current direction is right if ( bwtalloc & lt ; bwralloc ) {// if allocation bandwidth is less than requested bandwidth bwralloc = bwtalloc ; bwlalloc = 0 ; // bwtalloc is all allocated to right branch node } else {// if allocation bandwidth is equal to or more than requested bandwidth bwralloc = bwralloc , // bandwidth equal to requested bandwidth is allocated to right branch node bwlalloc = bwtalloc โˆ’ bwralloc // remaining bandwidth is allocated to left branch node } } for implementations with more than two branches from a node , the directional selector 240 switches , in a manner analogous to the above implementation , alternately among the more than two branches , and may distribute remaining bandwidth first to one neighboring branch and then , if bandwidth still remains , to another and so forth . as apparent from the above description , a dba ( dynamic bandwidth allocation ) method employing a tree algorithm according to the present invention has the following advantages . firstly , a simple tree structure is employed so as to allow a complicated dba algorithm to have a high operating speed . secondly , since a bandwidth allocation chance is provided to onus in a switching fashion , it is possible to give them a balanced chance to deal with a requested bandwidth allocation . the bandwidth allocation to only one of the two directions aims to achieve an effective allocation of insufficient resources and maintain the traffic &# 39 ; s characteristics , while the switching operation for selecting the direction tends to eliminate bandwidth allocation inequality between the different directions , thereby achieving balanced distribution of chances to deal with the bandwidth allocation request . in particular , in the case of a traffic that has a bursty characteristic and thus has a large variation in the input ratio of packets to be accumulated in a queue , it is difficult to maintain the bursty characteristic because limited resources cause the amount of allocated bandwidth to be smaller than that of requested bandwidth . in such a case , the alternate provision of chance to deal with the bandwidth allocation request , according to the present invention , allows the use of a relatively large amount of resources , which makes it easy to maintain the traffic &# 39 ; s characteristics . by the same token , although bandwidth allocation chances come alternately , once in two periods , from the viewpoint of onus , causing a packet accumulated in a queue to await transmission during at least one period , such transmission delay is not problematic . a conventional bandwidth allocation method employing a general dba algorithm most often fails to allocate all the requested bandwidth on the first request , and thus another chance to request all or part of the requested bandwidth comes only after waiting more than one period . thirdly , a dbacn allows bandwidth that remains after performing bandwidth allocation to one direction ( i . e ., one of the two branch nodes or onus ) to be allocated to the other , thereby improving overall throughput . although preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .
7
fig1 is an electrical schematic diagram of a single 6t cmos sram cell modified in accordance with the present invention . the prior art portion of the 6t cell comprises transistors 18 , 20 , 22 , 24 , 26 , and 28 , along with related interconnection circuitry . lines 12 and 14 are the bit line and complementary bit line , respectively . these lines couple to all of the individual cells within the memory system which are located at the same bit position as the cell shown . to enhance performance , lines 12 and 14 would ordinarily be precharged by a separate circuit ( not shown ). during write operations , lines 12 and 14 source and sink ( or sink and source ) current as an indication of the desired state of the bit to be written into the addressed cell . for read operations , the cell sources and sinks ( or sinks and sources ) current from lines 12 and 14 to indicate the state of the bit stored within the cell . addressing is provided by word line 10 , which gates the addressed cell onto lines 12 and 14 via transistors 18 and 24 . thus a signal on line 10 indicates that the cell shown , along with all other cells within the same parallel data set ( i . e . byte , word , etc . ), are to be read from or written into . the addressing signal is generated using known circuitry by decoding the user access request . because only one cell per column can be addressed , lines 12 and 14 are coupled to but one cell at a time via transistors 18 and 24 . storage of a data bit within the cell is accomplished by setting the states of bistable transistors 26 and 28 and complementary transistors 20 and 22 . this stored bit may then be read by examining the states of bistable transistors 26 and 28 , along with complementary transistors 20 and 22 . the complementary transistor pair 20 and 26 provides a path between current source 16 and ground . transistors 22 and 28 provide a similar , parallel path . however , because transistors 20 and 26 and transistors 22 and 28 assume complementary states , the total quiescent current of the cell is only that associated with normal leakage . because bistable transistors 26 and 28 and complementary bistable transistors 20 and 22 assume opposite states , the state of transistors 26 and 22 is the same , and the state of transistors 20 and 28 is the same . according to the preferred mode of the present invention , the basic 6t memory cell circuit described above has a corresponding redundant 6t circuit comprising transistors 48 , 50 , 52 , 54 , 56 , and 58 . transistor 54 of the redundant circuit corresponds to transistor 20 of the basic circuit . similarly , transistors 56 , 50 , 52 , 58 , and 48 correspond to transistors 26 , 22 , 28 , 18 , and 24 , respectively , of the basic 6t memory cell circuit . thus in proper operation , the redundant 6t memory cell circuit functions as the mirror image of the basic 6t memory cell circuit . the state of the redundant 6t memory cell circuit is modified and read as addressed using word line 10 in the same fashion as the basic 6t memory cell circuit . transistors 48 and 58 couple transistors 50 , 52 , 54 , and 56 to bit line 12 and complementary bit line 14 in the manner discussed above . whenever both the basic and redundant 6t memory cell circuits are operating properly , all read and write functions are indistinguishable from the prior art memory systems . lines 60 and 62 provide the state of the redundant 6t memory cell circuit to permit transistors 38 and 40 to constantly compare the states of the basic and redundant 6t memory cell circuits . whenever the states do not agree , transistor 42 is switched on to pull error line 46 to ground . to minimize drive circuitry and additional pins , error line 46 may be utilized by all of the memory cells in the memory system to indicate and error . alternatively , if the added power dissipation and additional complexity are acceptable , each row and each column may have a separate error line to permit identification of the individual malfunctioning memory cell . fig2 is an electrical schematic diagram of a three cell array employing continuous memory cell checking in accordance with the preferred mode of the present invention . the three cells shown are all addressed by word line 10 providing a three - bit parallel data structure . this three - bit data structure is shown as a matter of convenience . however , those of skill in the art will readily appreciate that parallel data structures of other configurations may be easily implemented . cell 64 , cell 66 , and cell 68 comprise the three cell array . error line 46 runs parallel to word line 10 to provide an error indication which is shared for the entire row . individual rows may have separate error lines or may share error line 46 . fig3 is a block diagram of a four word memory array . a separate error line is shown for each word for clarity . the user supplies an address via address input 95 . address decoder 80 decodes this address into an enable on one of word lines 94 , 96 , 98 , or 100 . in the present example , address line 95 would contain a two bit value wherein 00 is decoded as an enable on line 94 , 01 results in an enable on line 96 , 10 produces an enable on line 98 , and 11 is decoded to produce an enable on line 100 . each of these word lines is similar to word line 10 ( see also fig1 and fig2 ). memory array 70 consists of words 72 , 74 , 76 , and 78 , wherein each word comprises a number of individual cells coupled as shown in fig2 . the individual cells of the addressed one of words 72 , 74 , 76 , and 78 are coupled to the bit lines for each bit position . for memory write functions , the parallel data is transferred via line 120 to write data buffer 86 , from which it is applied to the bit and complementary bit lines ( see also fig1 ) via write interface 118 . similarly , read functions couple the addressed cells to the bit and complementary bit lines for transfer of the data to read data buffer 84 via read interface 92 . the read data is provided to the user via read data output 90 . each individual memory cell of the system is continuously checked in accordance with the present invention ( see also fig2 ) for each of words 72 , 74 , 76 , and 78 . line 102 is the error line for word 72 and reports an error in word 72 . similarly , lines 104 , 106 , and 107 report errors in words 74 , 76 , and 78 , respectively . all error reports are received by error output circuit 82 , which can time tag error reports and / or provide error correction using column checking circuitry ( not shown ). error output circuit 82 also provides the means to disable error reports during write transients . most simply implemented , this function merely requires that errors be present for a minimum period of time before being assumed to represent an actual failure . this is easily provided by a multivibrator circuit . lines 108 , 110 , 112 , and 114 provide system level reports of the detected error . or - gate 88 provides and indication of an error in memory array 70 via line 116 . as can be readily seen by those of skill in the art , the present invention may be utilized for continuous reporting of errors at the system level , within a given column or bit position , within a word , or even at the individual memory cell level . having thus described the preferred mode of the present invention , those of skill in the art will be capable of applying the teachings found herein to yet other embodiments within the scope of the claims hereto attached .
6
referring to fig1 to 10 , there is illustrated the improved walkover seat of the invention , generally designated by reference numeral 2 . although the seat 2 is described herein as a walkover seat for passenger railroad cars , it is within the scope of the invention to use the teachings of the invention in any environment in which passenger seats are employed . as is conventional , the passenger walkover seat 2 includes a horizontal seat cushion 4 and a walkover seat back 6 supported on a seat frame 8 , which rests on suitable opposed pedestals ( not shown ). the walkover feature of seat 2 allows the conductor or passenger to move the seat back 6 to opposed positions relative to seat 4 whereby the passengers face in opposite directions . the walkover capability of passenger walkover seat 2 is best shown in fig2 - 4 . the seat walkover mechanism 12 is provided with a pair of flat walkover levers 14 and 16 . the walkover levers 14 and 16 are interconnected at their upper ends 14 a and 16 a by a link 18 pivotally attached to the lever ends by pins 19 . a seat back frame member 20 is attached to the upper portion 18 a of link 18 by a suitable technique to attain walkover movement of seat back frame member 20 on the levers 14 and 16 in conjunction with a pair of horizontal walkover tubes 22 and 24 . the walkover tubes 22 and 24 are suitably journaled at both ends on frame 8 and extend through the lower ends of levers 14 and 16 in fixed relationship and under the seat cushion 4 from the aisle side to the window side of passenger seat 2 . the opposed positions of the walkover levers 14 and 16 are shown in opposite positions of the seat back 6 in fig3 and 5 . during walkover movement from the position of fig3 to the position of fig5 the walkover tubes 22 and 24 rotate in the same directions to facilitate movement of the entire seat back 6 to the opposed position . referring now to fig6 and 7 , a locking block assembly 30 is mounted at each end of hollow walkover shafts 22 and 24 immediately inside of seat back frame levers 14 and 16 . the locking block assembly 30 includes a metal block 30 a having rear integral anchoring plate 32 which is arranged to be secured to frame 8 at both sides by bolt assemblies ( not shown ) through bolt holes 32 a . a front plate 34 ( fig7 ) is also secured to block 30 a by bolts 36 to mount the linkage assembly to be described . the block 30 a has a cavity 38 to permit solid end extensions 40 a , 40 b to be secured to the ends of walkover tubes 22 and 24 and extend through levers 14 and 16 in fixed securement by a conventional technique . the inner ends 42 of the end extensions 40 a , 40 b have flattened faces 44 for interfitting in fixed relationship respectively within the ends of hollow walkover shafts 22 , 24 having a hollow square cross - sectional configuration . a locking element 50 is journaled between end extensions shafts 40 a , 40 b for pivotal movement on a shaft 50 a carried on locking block 30 a as seen in fig6 and 7 . the locking element 50 is generally in the form of a rectangular plate having opposed cutout areas 52 disposed on opposite vertical sides of the locking element 50 and cut - off upper corners 54 . the lower portion 56 of locking element 50 extends a greater distance from the shaft 50 a than upper portion 56 a to create an imbalance to respond to deceleration and cause pivoting action of the locking element 50 about shaft 50 a dependent on the direction of the deceleration forces . in a normal vertical orientation of the locking element 50 in absence of any extraordinary forces , the walkover tubes 22 , 24 and end extensions 40 a , 40 b are free to rotate to change seat back positions . the end extension shafts 40 a and 40 b are formed with locking notches 52 a , 52 b in the periphery at two positions on each end extension shaft 40 a , 40 b . the cutout areas 52 a , 52 b are formed by two intersecting faces 54 a , 54 b whereby one face 52 a extends parallel to the axis of rotation of end extensions 40 a , 40 b . in fig6 the locking effect of the locking elements 50 and the cutout areas 52 a , 52 b can be seen . in the case of rapid deceleration , the walkover tubes 22 , 24 are rotated in opposite directions for a limited degree until the surface of a cutoff corner of the lock element 54 a engages a portion of the flat face 56 a of the end extension 40 a , 40 b at the same time the locking elements 50 contacts a respective cutout area 52 a , 52 b and the upper corner contacts the notches 52 a , 52 b of the opposite shaft . the deceleration detected by the locking element 50 is rapid in locking rotation of the walkover shafts 22 and 24 to prevent any further movement of the seat back . after the locking has occurred between the locking element 50 and walkover tubes 22 , 24 , the energy dissipation sections 60 a , 60 b formed by the thinner diameter of the end extensions 40 a , 40 b then undergo conditions of plastic deformation by which permanent twisting of the reduced diameter section occurs to the extent necessary to arrest and dissipate the force of the impact . the energy dissipation sections 60 a , 60 b can under go up to 90 ยฐ of permanent deformation under which twisting optimum energy dissipation of the impact force of the passenger with the seat back occurs because the time in dissipating the energy is significantly increased by the plastic deformation . the levers 14 , 16 are fixedly retained on the lower ends 14 b , 16 b to end portions of walkover tube extensions 40 a , 40 b . the pair of levers 14 , 16 are mounted at each shaft end in a common vertical plane . in the normal opposed seating positions of the seat backs , the adjacent edges 14 โ€ฒ, 16 โ€ฒ of the levers 16 directly abut each other ( fig2 and 5 ) to support the seat back with a high strength to strength ratio . such direct support eliminates the stops and brackets needed in the prior art and provides good strength in the stressed direction . as seen in fig4 the adjacent edges of the levers are spaced from each other in the intermediate position . as seen in fig2 - 5 , a pair of linkage assemblies 70 a , 70 b are further provided in operative relationship between the walkover tubes 22 and 24 and the lower seat cushion frame 72 . the cushion frame 72 includes a horizontal pair of elongated edge cross frame members 74 interconnected by end members 76 ( fig8 and 9 ). a pair of intermediate supports 78 further extend between the end members 76 . the pair of linkage assemblies 70 a , 70 b move the seat back frame 20 from the position shown in fig3 to the position shown in fig5 . in is normal opposed seating portions , the upper surface 80 of the end members 74 are slightly sloped downward from the seat front to the walkover seat back as seen in fig3 and 5 . each of the linkage assemblies 70 a , 70 b are operatively connected to a respective walkover tube 22 , 24 by a pair of oppositely facing pivot arms 82 a , 82 b which are affixed at one end to tube extensions 40 a , 40 b . the opposite ends of the pair of pivot arms 82 a , 82 b include a pin 86 , which extends into an elongated slot 88 formed in elements 90 of each of the pair of linkage assemblies 70 a , 70 b . the link elements 90 are flat members having a modified โ€œ l โ€ shape with a pair of straight edge portions 92 and a curved interconnecting portion 94 ( fig2 ). each link element 90 is pivotally connected to the cushion frame end members 76 at a point adjacent the intersection of the straight edge portions 92 and curved portion 94 of the link elements 90 . as the walkover seat back is moved between opposed seating positions , the pin 86 of the lever element 90 moves in the slots 88 in opposite directions of the respective link members . at the upright position during initial movement of the seat back , the respective pins 92 move to opposite ends of the slots 94 . as the seat back continues movement to opposite seat positions , the link elements 90 continue pivotal movement and alter the position of the seat cushion frame 72 . in the position of seat cushion frame 72 in fig3 the frame member 74 of the seat cushion frame 72 directly rests on cross horizontal member 90 a of the main seat frame in direct supporting contact along the width of the seat . one of the intermediate frame member 78 of the cushion frame 72 also directly contacts a second horizontal member 92 a of the main seat frame . for better support both the cushion frame members 74 and main frame members 90 a , 92 b advantageously possess a square configuration . such direct contact between the cushion frame 72 and main frame cross members 90 a , 92 b provides maximum support of the seat cushion frame and seat back without latches or locks . when walkover seat 2 is moved to the seating position of fig5 the opposite cushion cross frame 74 directly contacts the main seat cross frame 92 a . the second intermediate cross frame 78 rests on the opposite seat main frame 90 a in fig5 . at the seat back position of fig3 the lever arms 82 a , 82 b are disposed along generally parallel planes with the lever arms 82 a , 82 b directed upward and the free end of the lever arm 82 b is directed downward . in the seat back position of fig5 the pin end of the pivot arms 82 a is directed downward and the pin end of the pivot arm 82 b is directed upward in generally parallel relationship . in the intermediate position of fig5 the pin ends of lever arms 82 a , 82 b are generally directed in opposite directions along the same horizontal axis . referring to fig1 , there is illustrated the bottom of a seat cushion 100 prior to attachment to the seat cushion frame 72 . the bottom of seat cushion 100 includes a pan 102 in the form of a metal or plastic that covers the bottom of the seat cushion 100 for protection . the pan 102 includes a pair of rectangular openings 104 and is secured to the seat cushion by mechanical fasteners ( not shown ). a series of strips 106 of hooks or loops of material , such as sold under the trademark velcro hooks are secured along the front and rear portions of the pan 102 . complimentary strips 108 of loops , which adhere to strips 106 , are secured by an adhesive to cushion frame members 74 , whereby the cushion 100 is simply installed by being placed on the seat cushion frame 72 with strips 106 and 108 in contact . such a securement capability results in immediate self positioning of the cushion on the seat frame and permits ready removal of the cushion 100 for repair and replacement .
1
the acronyms in the following list are applied at various locations herein . the meaning of the terms referenced by these acronyms is more completely understood from the complete description . new techniques , including an optical code - division multiplexing ( ocdm ) system and methodology based on a passive spectral phase encoding ( spe ) scheme that is compatible with wdm networks and offers photonic layer security ( pls ) are presented . compatibility is achieved through the ability to access and modify optical phase of tightly spaced phase locked laser lines with high resolution . in wdm networks , different security levels are carried through different optical windows . however , as discussed above , wdm enabled mls is susceptible to eavesdropping through inter - window cross talk as well as to more conventional tapping . the inventive techniques offer another level of security beyond wdm by providing the proper recipient its unique ocdm code , without which inadvertently leaked or intentionally captured signals cannot be deciphered . the inventive techniques also offer a higher level of security that is robust to both exhaustive search and archival attacks through phase scrambling of the inverse multiplexed tributaries of the high data rate aggregate signal . fig5 illustratively depicts an ocdm system 500 in accordance with an aspect of the present invention . in addition to illustrating an overall system architecture , fig5 also includes a diagram that depicts signal flows through the system 500 in the time and frequency domain . the system 500 comprises a laser source 510 that generates a sequence of optical pulses that are fed to each of data modulators 520 1 . . . n . the system 500 includes n tributaries or channels that each provide data that is used to respectively modulate the sequence of optical pulses generated by laser source 510 . each of data modulators 520 1 . . . n comprises an on / off keyed data modulator wherein a โ€œ 1 โ€ symbol or bit in the digital data stream corresponds to the presence of an optical pulse and a โ€œ 0 โ€ symbol or bit corresponds to the absence of an optical pulse . in accordance with the present invention , other modulation techniques including those based on phase can be applied . in this way , each pulse represents a bit of information . for example , in a modulated digital data stream comprising a โ€œ 1010 โ€ data sequence , each time slot with the bit โ€œ 1 โ€ will result in the presence of an optical pulse whereas each time slot with a โ€œ 0 โ€ bit indicates the absence of an optical pulse . each modulated data stream is then fed to a corresponding one of spectral phase encoders 530 1 . . . n . as is discussed in further detail below , each of the spectral phase encoders 530 1 . . . n uses a phase mask to apply a phase code associated with a tributary or channel to each optical pulse in the data stream to produce an encoded data stream . the phase code operates to provide a โ€œ lock โ€ so that only a corresponding phase decoder with the appropriate โ€œ key โ€ or phase conjugate of the phase code of the spectral phase encoder may unlock the encoded data stream . typically , a spectral phase encoder is associated with a particular tributary or channel and therefore allows only another tributary or channel with the appropriate key to decode or receive information from the particular tributary or channel the information appears as noise to tributaries or channels that do not have the appropriate key . after a modulated data stream is encoded , the encoded data stream can be passively combined with other encoded data streams with bit - time synchronization , each of which have their own unique spectral phase codes but overlap completely in the frequency domain . this form of passive multiplexing distinguishes optical cdma from dense wavelength division multiplexing ( dwdm ) systems where tributaries or channels are assigned independent , non - overlapping spectral passbands . the combined encoded data streams then pass through a phase scrambler 540 which changes the phase of the aggregate signal within each frequency bin relative to other frequency bins using a random key shared with the receiving end . the scrambled data stream may then be transported over a network , such as a wdm network , to the receiving end where a descrambler 550 , using the shared random key , undoes the scrambling . scrambling the phase of aggregate signals can also be achieved by combining the spectral phase encoder 530 and the phase scrambler 540 in a single unit . this results in the use of one less coder / scrambler unit . but the more important use of this procedure enables frequency shuffling in addition to aggregate phase scrambling using monomial matrix , as illustrated in fig1 , instead of a diagonal matrix . the descrambled data stream is then fed to a spectral phase decoder 560 that , preferably , includes a phase mask that applies the phase conjugate of the phase code of the spectral phase encoder 530 , as discussed above . the spectral phase decoder 530 provides a decoded data stream to an optical time gate 570 . as is discussed in detail below , the optical time gate 570 operates to reduce multiple access interference by temporally extracting only a desired tributary from among the decoded stream . the optical time gate 570 produces a data stream , which is fed to a data demodulator 580 . where on / off keying was employed at the transmitting end , the data demodulator 580 comprises an amplitude detector that reproduces the digital data stream . implementation of the above described system is discussed in further detail below . u . s . patent application ser . no . 11 / 062 , 090 describes a wavelength - division multiplexing - compatible spectral phase encoding approach to ocdm , the contents of which are incorporated by reference in the present application . in accordance with an aspect of the present invention , the laser source 510 comprising a mode locked laser ( mll ) having a spectral content comprising a stable comb of closely spaced phase - locked frequencies . the frequency or comb spacing is determined by the pulse repetition rate of the mll . the laser source 510 may , for example , comprise a ring laser that may be formed using a semiconductor optical amplifier or erbium doped fiber amplifier . the ring laser includes , for example , a laser cavity , a modulator , a wavelength division multiplexer , and a tap point for providing an output signal , which comprises optical pulses . referring to fig5 , the mll produces as its output a stream of short optical pulses 512 in the time domain . the pulsed signal can also be shown to be equivalent to a comb of phase - locked continuous wave optical frequencies 514 equally spaced on a frequency grid determined by the laser repetition rate . as an example , the present invention uses 8 or 16 equally spaced phase - locked laser lines confined to an 80 ghz window depending on the data rate for individual channels . this 80 ghz window is considered to comprise 8 or 16 frequency bins , each bin being phase encoded using a coder , to be described below , based on an ultrahigh resolution demultiplexer . in comparison to prior art spe that use the continuous broad spectrum of an ultrashort pulse source , the technique disclosed in the present invention has the advantage of confining the data - modulated mll lines to their respective phase coded frequency bins and all frequency bins to a small tunable window . the narrower spectral extent of the coded signal also limits the impact of the transmission impairments such as dispersion and makes this system compatible with standard wdm optical networks . the output signal 512 is provided to each of data modulators 520 1 - n . n tributaries or channels in the system provides data 522 1 - n that is used to respectively modulate the pulse train or output signal 512 . data modulators 520 1 - n operate to provide on / off keying resulting in time - domain signal 524 . in time domain signal 524 , the pulses with a solid outline indicates a โ€œ 1 โ€ symbol or bit and pulses with a faint outline represents a โ€œ 0 โ€ symbol or bit , as previously discussed . the spectral content of such a signal is shown in frequency plot 526 in fig5 . each of the modulated optical pulse signals are then fed to respective spectral phase encoders 530 1 - n . encoding consists of separating each frequency bin , shifting its phase , in this case by 0 or ฯ€ , as prescribed by the choice of code , and recombining the frequency bins to produce the coded signal . when the relative phases of the frequencies are shifted , the set of frequencies is unaltered , but their recombination results in a different temporal pattern , e . g ., a pulse shifted to a different part of the bit period , multiple pulses within the bit period , or noise - like distribution of optical power . each ocdm code is desirably defined by a unique choice of phase shifts . in accordance with the present invention , a set of hadamard codes , which are orthogonal and binary , can be chosen as a coding scheme . this choice is desirable in that it can achieve relatively high spectral efficiency with minimal multi - channel interference ( mci ). specifically , this coding scheme offers orthogonality in the sense the mci is zero at the time that the decoded signal is maximum . the number of orthogonal codes is equal to the number of frequency bins ; hence , relatively high spectral efficiency is possible . binary hadamard codes are converted to phase codes by assigning to + 1 &# 39 ; s and โˆ’ 1 &# 39 ; s phase shifts of 0 and ฯ€ , respectively . to encode data , which contains a spread of frequencies , as opposed to the unmodulated pulse stream , which contains only the initial comb of frequencies produced by the mll , it is preferable to define frequency bins around the center of frequencies . encoding data then consists of applying the phase shift associated with a frequency to the entire bin . the output of the phase encoder is then a signal obtained by summing the phase - shifted frequency components of the modulated signal . applying any of these orthogonal codes ( except for the case of code 1 , which leaves all phases unchanged ) results in a temporal pattern which has zero optical power at the instant in time where the initial pulse would have had its maximum power . although this choice of orthogonal codes implies synchronicity as a system requirement , since desynchronization will move unwanted optical power into the desired signal &# 39 ; s time slot , careful code selection allows some relaxation of this requirement . for example , simulations indicate that for four tributaries transmitting at 2 . 5 gb / s and using a suitably chosen set of four codes among a set of 15 hadamard codes of length 16 , up to 15 ps of relative delay can be tolerated with a power penalty within 1 db at a ber of 10 โˆ’ 9 . better resiliency to asynchronism may be achieved by using multiphase codes . phase coding of the individual spectral components requires a demultiplexer with sufficient resolution and path length stability and a means of shifting phases independently for each frequency . in an embodiment of the present invention , ring - resonator - based photonic integrated circuits are used to perform coding / decoding functions . the use of ring - resonator - based circuits in an ocdma system based on spectral - phase encoding of phase - locked lines of a mll has been demonstrated by anjali agarwal et al . in โ€œ fully programmable ring - resonator - based integrated photonic circuit for phase coherent applications ,โ€ ieee j . of lightwave technology , vol . 24 , no . 1 , january 2006 , pp . 77 - 87 , the contents of which are incorporated by reference in the present application . below , the construction and characterization of ring - resonator - based photonic integrated circuits and how they can be used to perform coding / decoding functions are described . as illustrated in fig6 , a fourth - order micro - ring resonator filter 600 is the basic building block for a coder / decoder . it comprises four micro - rings 601 that are vertically coupled to a pair of input 602 and output 603 bus waveguides . vertical coupling allows for more precise control of the coupling strength than lateral coupling , since the vertical separation of the guides depends on the thickness of the intervening layer and is not determined by mask error , photolithography , or etching , all of which are more difficult to control with the required precision and reproducibility . in high - order micro - ring resonator ( mrr ) filters that are designed to have a maximally flat passband , the coupling between the bus waveguide 602 , 603 and the ring 601 needs to be strong , whereas the coupling between adjacent rings 601 is designed to be weak . in order to achieve strong coupling between ring and bus in lateral configuration , the gap between the two would be sub - resolution , and therefore , subject to large random deviations . vertical coupling allows the ring 601 and bus 602 , 603 to come into close proximity without the need to etch an ultranarrow coupling gap . instead the coupling is determined by well - controlled material deposition . the rings 601 support resonant travelling wave modes and the resonant condition is determined by the circumference and effective index of the rings 601 . at resonant wavelengths , optical power can be transferred completely from one bus waveguide 602 to the other 603 via the rings 601 , as shown by ฮป 1 in fig6 , while off - resonant wavelengths ฮป 2 , ฮป 3 , . . . bypass the rings 601 . the shape and bandwidth of the filter response is determined by the number of rings in the filter , the mutual coupling strength among the rings , and between the outer rings and the bus waveguides . by appropriately coupling multiple rings , the frequency response of the filters can be tailored to a desired response . as the number of coupled rings increase , the order of the filter increases , leading to a box - like filter response . fig7 illustrates an exemplary coder / decoder circuit 700 . the coder circuit 700 consists of a common input bus 701 and a common output bus 702 , with fourth - order micro - ring resonators serving as wavelength - selective cross connects between the two . a fourth - order filter cell 703 occupies an on - chip area of 100 ร— 400 ฮผm , allowing a large number of filter cells on a chip ( 64 filter cells on a 17 ร— 17 mm chip ). each filter 703 is independently tunable in wavelength and each passband represents a frequency bin . an independent heater is placed over each of the four rings and can be differentially adjusted to fine tune the optical line shape . the relative phase shift between two adjacent frequency bins is controlled by a separate thermo - optic phase heater 704 , shown in hatch marks in fig7 , and can be continuously varied between 0 and ฯ€ . hence , the micro - rings 703 provide the wavelength selectivity , and the thereto - optic heater 704 is used to control the relative phase of individual wavelengths . due to the symmetry of the above - described configuration , the optical path lengths from the input to the output are the same for all wavelengths , and hence , the original phase relationships are maintained for all wavelengths when the phase heaters are not activated . the three necessary functions , frequency demultiplexing , phase shifting , and recombining the phase - shifted frequencies , are all accomplished in the above - described single integrated device . referring back to fig5 , the encoded n tributary or channel signals are then combined prior to being passed through phase scrambler 540 and being transmitted over the fiber link and through the network . the network can comprise a wdm network that allows the signals of the system 500 to be transported transparently to the other signals that are normally carried by the wdm network . in that regard , the system 500 advantageously uses a relatively small and tunable window , which is compatible with wdm systems that are currently deployed . fig8 illustratively depicts how an ocdm system in accordance with the various aspects of the present invention may be overlaid on such a network . note , however , any other optical network may be used in accordance with this aspect of the present invention if a tunable source is used . as fig8 shows , the ocdm signals may be multiplexed into the wdm channel . after the scrambled signals traverse the network , they are descrambled by descrambler 550 and split and provided to a plurality of matching decoders 560 1 . . . n . in particular , decoding may be accomplished by using a matched , complementary code ; for the binary codes used here , the code is its own complement and consequently , the coder and decoder are identical . the decoded signal has the pulses restored to their original position within the bit period and restores the original pulse shape . decoding using an incorrect decoder results in a temporal pattern that again has zero optical power at the center of the bit period and the majority of the energy for that pulse is pushed outside the time interval where the desired pulse lies . referring to fig5 , 9 and 10 , implementation of ocdm - based photonic layer security ( pls ) in accordance with an embodiment of the present invention is described below . as stated above , since orthogonal codes are used , the maximum number of simultaneous tributaries or channels is equal to the number of frequency bins . for hadamard codes of order n of ( h n ) the number of possible orthogonal codes states so generated is n . an eavesdropper equipped with an adjustable decoder would have to guess only n possible code settings in order to tune in on any given tributary . to increase the search space available to an eavesdropper with intentional malicious attacks , the present embodiment includes a phase scrambling methodology . an orthogonal matrix w n can be generated from h n by premultiplying a diagonal or monomial matrix d n of order n with all of the on - diagonal elements being arbitrarily chosen phase shifts . in other words , when random phase settings corresponding to the scrambling code are imposed on all the conventional hadamard codes , a new set of n distinct orthogonal codes is produced , referred to here as the modified hadamard codes . fig9 illustrates the effect of scrambling on four hadamard - 32 signals . each panel is the simulated temporal intensity variation for two bit periods as might be seen by an eavesdropper . the left panel shows the result of encoding with the original hadamard - 32 codes 6 , 7 , 9 and 12 . the spiky nature of the patterns and their discrete appearance in the time domain would appear to render the codes vulnerable to detection by an eavesdropper . however , using the corresponding set of scrambled hadamard - 32 results in the substantially different time - dependent signal shown in the right panel of fig9 . the modified hadamard - 32 has been created by a scrambler using random 0 and ฯ€ phase shifts for each element . for this binary choice of phase setting and diagonal matrix , the search space is increased from e = 32 to ฮต = 2 32 , assuming all 32 codes are present . note that not only has the peak amplitude of the variation been suppressed , but the energy in a bit is now spread throughout the bit period . using monomial matrix increases the search space further to ฮต = 32 !ร— 2 32 . more importantly , in addition to shared phase scrambling , the frequency shuffling decouples the correlation between the attempted guess of the key unless about 75 % of the key has correctly been identified . this procedure ensures that exhaustive search attack is practically impossible . the application of monomial matrix to ocdm - based encryption is described by g . di crescenzo et al . in โ€œ on the security of ocdm - based encryption against key - search attacks ,โ€ presented at summer 2009 ieee / leos summer topical meeting on optical code division multiple access , july 2009 , newport beach , calif ., the contents of which are incorporated by reference in the present application . it is important to recognize that the random diagonal matrix d n can be implemented as a separate encoder similar to the same sort used to apply hadamard codes to the mll signal . this means one can physically separate the hadamard coding stages used for directing communication between end users and the diagonal matrix scrambling stages in a network . since it would be desirable to change the scrambling code with some regularity , the scrambling coders should be dynamically adjustable in synchrony and there is therefore some advantage to sharing these units to keep their number small . as a result , increased capacity has been achieved through inverse multiplexing of the tributaries of a high data rate signal and the improved security has been created through phase scrambling . this degree of signal obscuration coupled with the potentially large number of possible scrambler states and the ability to dynamically change the scrambler code setting at will all contribute to the obscurity of the composite signal . the large code space makes eavesdropping by exhaustive search for the scramble key a practical impossibility in a brute force attack . referring to fig5 and 11 , implementation of multi - channel interference ( mci ) rejection in accordance with an aspect of the present invention is described below . mci noise from undesired tributaries or channels may remain even after the signals have passed through the matched ocdm decoder . in addition , since the optical signal energy present in both the decoded and undesired channels are similar in magnitude , both will appear essentially identical from the perspective of a typical photoreceiver that is band - limited to the data bit rate , preventing the desired signal from being recovered correctly . therefore , further processing techniques are necessary in order to eliminate the interference . given the bandwidth requirements of an ocdm system , which is typically on the order of many tens or even hundreds of ghz , the removal of interference performed in the electrical domain is impractical due to the need for ultrafast electronics . as a result , mci rejection can be performed in the optical domain . one category of optical processing technique for mci rejection is optical time gating . application of optical time gating to extract the decoded ocdm signal is illustrated in fig1 . through the proper selection of an appropriate code set for a synchronous coherent ocdm system , it is possible to design the system such that the multi - channel interference energy falls outside a time interval where the properly decoded signal pulses reside . therefore , by optically gating the composite signal in order to provide low loss within the desired time window while at the same time provide for high extinction outside that window , the properly decoded signal bit stream can be extracted . the described embodiments of the present invention are intended to be illustrative rather than restrictive , and are not intended to represent every embodiment of the present invention . various modifications and variations can be made without departing from the spirit or scope of the invention as set forth in the following claims both literally and in equivalents recognized in law .
7
the aim of this invention is to make available a novel crystal form and a novel amorphous solid of aliskiren hemifumarate . more complete understanding of this invention can be obtained referring to the summary tables of certain physico - chemical characteristics of aliskiren hemifumarate provided below . the main peaks of x - ray powder diffraction , the main bands and characteristic of the ft - ir spectrum , the thermogravimetric analysis are furnished . the x - ray powder diffractogram ( xrpd ) has been obtained using the instrument x &# 39 ; pert pro panalytical with single scan , using kฮฑ1 radiation . the diffractogram is measured in reflection mode in the range 3 - 40 ยฐ 2ฮธ . the ft - ir spectrum ( fourier transform ir spectroscopy ) was recorded with the nicolet ft - ir 6700 ( thermofischer ) appliance equipped with a kbr splitter and dtgs kbr detector . the spectrum was acquired in 16 scans at a resolution of 4 cm โˆ’ 1 for the crystal form and the solvate , in 32 scans at a resolution of 4 cm โˆ’ 1 for the amorphous solid . dsc analyses were carried out using a differential scanning calorimeter dsc 200 f3 maia ยฎ. the samples were loaded in an aluminium crucible and heated at 10 ยฐ c ./ min in the temperature range from 20 to 450 ยฐ c . the thermograms were obtained using the sta 409 pc luxx ยฎ netzsch thermo - balance . the samples were loaded in an aluminium crucible and heated at 10 ยฐ c ./ min in the temperature range from 25 to 490 ยฐ c . fig1 : dissolution speed of aliskiren hemifumarate , amorphous solid ( curve a ) and aliskiren hemifumarate , amorphous solid obtained as described in wo2008 / 061622 ( curve b ). fig1 : xrpd spectrum of aliskiren hemifumarate , amorphous solid obtained as described in wo2008 / 061622 , before and after exposure for 5 days at 25 ยฐ c ., 60 % rh . fig1 : xrpd spectrum of aliskiren hemifumarate , amorphous solid , before and after exposure for 5 days at 25 ยฐ c ., 60 % rh . the crystal form of aliskiren hemifumarate claimed in this invention is preferably obtained through desolvation of aliskiren hemifumarate solvate with p - xylene and is characterised by the following physico - chemical parameters . xrpd analysis makes it possible to obtain the characteristic spectrum shown in fig1 . main peaks at 2theta +/โˆ’ 0 . 3 degrees are : 5 . 8 , 5 . 9 , 9 . 6 , 10 . 8 , 15 . 6 , 16 . 4 , 18 . 4 , 18 . 9 . table 1 below shows the significant peaks of the spectrum . the thermogram shown in fig4 highlights a continuous loss of weight on moving from about 150 to about 450 ยฐ c . the characteristic events of the weight loss measured can be observed more clearly on the dtg curve , shown in the same plot . the dtg curve represents the derivative of the thermogram and makes it possible to observe events after 150 ยฐ c ., associated with downgrading of the sample following heating . said crystal form claimed here is obtained from aliskiren hemifumarate p - xylene solvate . said solvate form is characterised as follows . xrpd analysis of aliskiren hemifumarate p - xylene solvate makes it possible to obtain the characteristic spectrum shown in fig5 . the main peaks at 2theta +/โˆ’ 0 . 3 degrees are : 5 . 5 , 9 . 2 , 10 . 5 , 18 . 6 , 19 . 7 , 21 . 2 . table 3 below shows the significant peaks of the spectrum . the thermogram shown in fig8 highlights a continuous loss of weight , on moving from about 140 to about 450 ยฐ c . the characteristic events of the weight loss measured can be observed more clearly on the dtg curve , shown in the same plot . the dtg curve makes it possible to observe a significant event with loss of weight of about 6 . 15 % between 50 ยฐ c . and 140 ยฐ c . which corresponds to the loss of solvent following melting of the sample . the other events observed after 150 ยฐ c . are associated with downgrading of the sample following heating . xrpd analysis of said aliskiren hemifumarate , amorphous solid makes it possible to obtain the characteristic spectrum shown in fig9 . the main peaks at 2theta +/โˆ’ 0 . 3 degrees are : 7 . 3 , 10 . 2 , 10 . 4 , 19 . 6 . table 5 below shows the significant peaks of the spectrum . the thermogram shown in fig1 shows a continuous loss of weight starting from about 170 ยฐ c ., loss of weight associated with decomposition of the sample after melting . another object of this invention is the process for the preparation of said crystal form of aliskiren hemifumarate . in particular , said process comprises : i ) re - suspending aliskiren hemifumarate in a suitable solvent , continuously stirred at room temperature in an oil bath ; ii ) heating to a suitable temperature until a clear solution is obtained ; iii ) cooling , continuing to stir the solution obtained in ii ), to room temperature ; iv ) stirring of the solution obtained in iii ) at a suitable temperature and for a suitable time ; v ) filtering of the mix obtained in iv ) in order to isolate the precipitate ; vi ) drying of the precipitate at a suitable temperature . in a preferred embodiment , said phase ii ) is carried out at a temperature of between 60 and 90 ยฐ c ., preferably at about 75 ยฐ c . and said solvent is selected in the group that comprises benzene , toluene , xylene , preferably p - xylene . in said phase iii ) said cooling is carried out slowly , preferably said solution reaches room temperature in about 5 hours , in oil bath . in said phase iv ), said stirring is continued for a further 10 hours or more , preferably for about 12 hours , preferably at room temperature . in said phase vi ), said drying takes place at a temperature of between 50 and 90 ยฐ c ., preferably at about 70 ยฐ c ., for about 3 hours . the product obtained is the crystal form of aliskiren hemifumarate claimed in this invention . a further object of this invention is the process for the preparation of said amorphous solid of aliskiren hemifumarate . in particular , said process comprises : i ) dissolving aliskiren hemifumarate in alcohol and heating to a suitable temperature ; ii ) cooling the solution obtained in i ) to room temperature and spiking of the same with pure aliskiren hemifumarate ; iii ) stirring the mix obtained in ii ) at a suitable temperature and for a suitable time ; iv ) further cooling the mix and continuation of stirring ; v ) filtering the mix obtained in iv ) so as to isolate the precipitate ; vi ) washing the precipitate with alcohol and drying under vacuum at a suitable temperature . in another preferred embodiment , said phase i ) is carried out at a temperature of between 35 and 55 ยฐ c ., more preferably at about 40 - 45 ยฐ c ., and said alcohol is selected in the group that comprises methanol , ethanol , propanol , butanol , isopropanol , isobutanol , preferably isopropanol . in said phase iii ), stirring is continued for 10 - 20 hours , preferably for about 15 hours , at a temperature of between about 20 and about 25 ยฐ c . in said phase iv ), cooling is carried out preferably at a temperature below 10 ยฐ c ., preferably at a t of between about 0 and about 5 ยฐ c . and said stirring is continued for a further 2 hours or more . in said phase vi ), the alcohol is selected in the group that comprises methanol , ethanol , propanol , butanol , isopropanol , isobutanol , preferably cold isopropanol preferably , said washing is repeated twice . drying under vacuum is carried out at a temperature below 50 ยฐ c ., preferably below about 40 ยฐ c . the product obtained is the amorphous form of aliskiren hemifumarate claimed in this invention . said crystal form and said amorphous solid of aliskiren hemifumarate can be applied in pharmaceutical compositions . the pharmaceutical composition that comprises said crystal form and / or said amorphous solid may contain additives such as sweeteners , aromas , coating substances , inert diluents such as lactose and talcum , binders such as starch , hydroxyethylcellulose , hydroxypropylcellulose and similar . any conventional technique can be used for preparation of pharmaceutical formulations in accordance with this invention . 500 g of aliskiren hemifumarate were re - suspended in 4 ml of p - xylene , stirring at room temperature in oil bath . the suspension was heated to 75 ยฐ c . to obtain a clear solution . the solution was then placed in an oil bath in order to bring this , over a period of 5 hours , to room temperature while continuing stirring . stirring continued for about 12 hours . after filtration , the filtrate was dried at 70 ยฐ c . for about 3 hours and analysed using xrpd . the product obtained is the crystal form of aliskiren hemifumarate claimed in this invention . 100 g of aliskiren hemifumarate were dissolved in 850 ml of isopropyl alcohol , stirring at 40 - 45 ยฐ c . after cooling to room temperature , the mix was spiked with pure aliskiren hemifumarate and stirred at 20 - 25 ยฐ c . for 15 hours . the mix was then cooled to 0 - 5 ยฐ c ., continuing stirring for another 2 hours . after filtration , the filtrate was washed twice with isopropyl alcohol , using 200 ml of cold isopropyl alcohol for each washing . the washed product was dried under vacuum at 40 ยฐ c . and analysed by means of xrpd . the product obtained is aliskiren hemifumarate amorphous form claimed in this invention . dissolution tests were carried out on aliskiren hemifumarate , amorphous solid , of this invention and aliskiren hemifumarate , amorphous solid , obtained as described in wo2008 / 061622 . kinetic tests were carried out using a hanson vision classic 6 dissolution tester combined with a varian cary 50 uv - vis spectrophotometer . the program used was โ€œ kinetic โ€ ( cary 50 winuv software v . 3 ) that continuously recorded absorbance at 280 nm of a buffer solution ( 80 ml ) continuously stirred ( 100 rpm ) at 37 ยฐ c . to which the sample had been added . fig1 shows the dissolution speed of aliskiren hemifumarate , amorphous solid of this invention ( curve a ) and aliskiren hemifumarate , amorphous solid obtained as described in wo2008 / 061622 ( curve b ). stability tests were carried out on aliskiren hemifumarate , amorphous solid of this invention and aliskiren hemifumarate , amorphous solid obtained as described in wo2008 / 061622 , maintaining the samples at 25 ยฐ c ., 75 % rh . after 2 hours in said conditions , both samples changed from solid to viscous liquid form . the same samples were exposed to 25 ยฐ c ., 60 % rh . in these conditions , the diffraction pattern assumed by aliskiren hemifumarate , amorphous solid , obtained as described in wo2008 / 061622 is shown in fig1 , in which curve a is obtained in basal conditions , curve b is obtained after exposure of the sample for 5 days to the conditions indicated . fig1 shows the diffraction pattern obtained exposing the aliskiren hemifumarate , amorphous solid of this invention to the same conditions ( curve a : basal ; curve b : 5 days at 25 ยฐ c ., 60 % rh ). a comparison of curves a and b of fig1 reveals that the typical nature of the diffractogram of aliskiren hemifumarate , amorphous solid of this invention is lost exposing this for 5 days to the conditions indicated . a set of tablets was prepared using different compression forces . a compressibility test was carried out on these . table 7 shows the data obtained compressing aliskiren hemifumarate , amorphous solid of this invention ; table 8 refers to aliskiren hemifumarate , amorphous solid obtained as described in wo2008 / 061622 . a comparison of the data obtained demonstrated that aliskiren hemifumarate , amorphous solid of this invention has a higher rupture strength than that observed in tablets of aliskiren hemifumarate , amorphous solid obtained as described in wo2008 / 061622 .
2
referring to the drawings , an embodiment of the present invention will be described below . fig1 is a perspective view of an image pick - up unit 50 according to the present embodiment , and fig2 is a view typically showing a cross - section along the optical axis of an image pick - up optical system of the image pick - up unit 50 . as shown in fig1 , the image pick - up unit 50 is provided with a cmos type picture - taking element 51 as the picture - taking element having a photo - electric conversion section 51 a , the picture - taking lens 10 for image - forming the objective image on the photo - electric conversion section 51 a of this picture - taking element 51 , a substrate 52 which holds the picture - taking element 51 , and has a terminal for the external connection ( called also an external connection terminal ) 54 ( refer to fig1 ) which conducts sending and receiving of its electrical signal , and a casing 53 which has an opening section for the ray incidence from object side , and as a lens barrel formed of the light shielding member , and they are integrally formed . as shown in fig2 , in the picture - taking element 51 , the photo - electric conversion section 51 a as the light receiving section in which pixels ( photo - electric conversion elements ) are 2 - dimensionally arranged in the central part of the plane on its light receiving side , is formed , and a signal processing circuit 51 b is formed in its periphery . such a signal processing circuit is structured by a drive circuit section by which each pixel is successively driven and signal charges are obtained , an a / d conversion section by which each signal charge is converted into a digital signal , and a signal processing section by which the image signal output is formed by using this digital signal . further , in the vicinity of outer edge of the plane on the light receiving side of the picture - taking element 51 , many number of pads ( illustration is neglected ) are arranged , and connected to the substrate 52 through wires w . the picture - taking element 51 converts the signal charge from the photo - electric conversion section 51 a into an image signal such as digital yuv signal , and outputs to a predetermined circuit on the substrate 52 through wires w . herein , y is a brightness signal , u (= r โˆ’ y ) is a color difference signal of red and the brightness signal , v (= b โˆ’ y ) is a color difference signal of blue and the brightness signal . hereupon , the picture - taking element is not limited to the cmos type image sensor , but other element such as ccd may also be used . the substrate 52 is provided with a supporting plate 52 a for supporting the picture - taking element 51 and the casing 53 on its upper surface , and a flexible substrate 52 b whose one end part is connected to the lower surface ( the reverse side surface to the picture - taking element 51 ) of the supporting plate 52 a . the supporting plate 52 a has a number of pads for signal transmission , provided on the front and rear surfaces , and on its upper surface side , it is connected to wires w of the picture - taking element 51 , and on its lower surface side , connected to the flexible substrate 52 b . in fig1 , the flexible substrate 52 b is connected in such a manner that its one end part is connected to the supporting plate 52 a as described above , and connects the supporting plate 52 a . to the external circuits ( for example , a control circuit which its epistatic apparatus in which the image pick - up unit is mounted has ) through the external connection terminal 54 provided on its other end part , and receives the supply of the voltage for driving the picture - taking element 51 , or the clock signal from the external circuit , and can output the digital yuv signal to the external circuit . further , an intermediate part in the length direction of the flexible substrate 52 b has the flexibility or deformation property , and by its deformation , the substrate gives the degree of freedom to the direction or arrangement of the external connection terminal 54 against the supporting plate 52 a . in fig2 , the casing 53 is fixed and arranged on the surface on which the picture - taking element 51 on the supporting plate 52 a of the substrate 52 is provided in the manner that it covers the picture - taking element 51 . that is , the casing 53 is formed into cylinder - shape with a flange in which a part on the picture - taking element 51 side is widely opened so that it surrounds the picture - taking element 51 and the other end part has a small opening , and the end part on the picture - taking element 51 side is contacted with and fixed on the supporting plate 52 a . hereupon , the end part on the picture - taking element 51 side of the casing 53 may also contacted with and fixed on the periphery of the photo - electric conversion section 51 a on the picture - taking element 51 . the casing 53 is used in such a manner that the other end part in which the small opening ( opening part for the ray incidence ) is provided faces the object side , and in the inside of the casing 53 , an ir ( infrared ray ) cut filter f is fixed and arranged between the picture - taking lens 10 and the picture - taking element 51 . the picture - taking lens 10 is composed of , in order from the object side , the first lens l 1 which has a positive refractive power and faces the convex surface to the object side , the aperture stop s , the second lens l 2 of the meniscus shape which has a positive refractive power and faces the convex surface to the image side , and the third lens l 3 which has a negative refractive power and faces the concave surface to the image side , and the picture - taking lens 10 has a function to image - form the object image onto the picture - taking element . hereupon , in fig1 , the upper side is made an object side , and the lower side is made an image side , and one dotted chain line in fig2 is made an optical axis common to each of lenses l 1 , l 2 , l 3 . hereupon , an illustration is neglected , but an outside light shielding mask e for reducing the incidence of unnecessary light from the outside as possible may also be provided on further object side from the first lens l 1 . further , the aperture stop s is a member for determining f - number of the whole system of the picture - taking lens . lenses l 1 , l 2 are held by a lens frame 55 , and the lens l 3 is held by a lens frame 56 . when the serially arranged lens frames 55 , 56 are brought into contact with the flange of the casing 53 under the conditional that the optical axes of these lenses coincide with the center line of the casing 53 , in the inside of the casing 53 , each of lenses l 1 , l 2 , l 3 can be positioned at a predetermined optical axis position . hereupon , the lens and the lens frame may also be integrally molded . although illustration is neglected , in these lenses l 1 , l 2 , l 3 , for example , the range from the center of them up to a predetermined range may be set to a range of the effective diameter having a function as the picture - taking lens , and the outside part from that range may also be set to the flange section which does not function as the picture - taking lens . in this case , in each of lenses l 1 , l 2 , l 3 , when the outer peripheral part of its flange section is engaged with a predetermined position of the casing 53 , it can be held inside the casing 53 . the ir cut filter f is a member which is formed into , for example , almost rectangular or circular one . recently , the size reduction of thes whole image pick - up unit 50 is made an object , and even when it is the solid picture - taking element of the same pixel number , the pixel pitch is small , as the result , an unit whose image surface size of the light receiving section ( photo - electric conversion section ) is small , is developed . in the picture - taking lens for such a solid picture - taking element whose image surface size is small , in order to secure the same angle of view , because it is necessary that the focal length of the whole system is reduced , the radius of curvature or outer diameter of each lens becomes considerably small . accordingly , in the glass lens manufactured by the polishing processing , the processing becomes difficult . accordingly , it is preferable that each of lenses l 1 , l 2 , l 3 is made of plastic material , and formed by the injection molding . hereupon , as the image pick - up unit 50 , when it is wanted that the image point position variation of the whole system of the picture - taking lens at the temperature change is suppressed small , the first lens l 1 may also be a glass - molding lens . furthermore , although the illustration is neglected , the light shielding mask may also be arranged between the second lens l 2 and the third lens l 3 , in this case , it is prevented that the unnecessary light is incident on the outside of the effective diameter of the picture - taking lens of the third lens l 3 close to the solid picture - taking element , and the generation of a ghost or flare can be suppressed . the operation of the above - described image pick - up unit 50 will be described below . fig3 shows the situation that the image pick - up unit 50 is installed in a mobile phone 100 as the hand - held device or image pick - up apparatus . further , fig4 is a control block diagram of the mobile phone 100 . the image pick - up unit 50 is provided in such a manner that , for example , the end surface on the object side of the casing 53 is provided in the rear surface ( refer to fig3 ( b )) of the mobile phone 100 , and arranged at the position corresponding to the lower part of the liquid crystal display section . the external connection terminal 54 ( an arrow mark in fig4 ) of the image pick - up unit 50 is connected to the control section 101 of the mobile phone 100 , and outputs the image signal such as the brightness signal or the color difference signal to the control section 101 side . on the one hand , the mobile phone 100 is provided with the control section ( cpu ) 101 which generally controls , as shown in fig4 , each section , and conducts programs corresponding to each processing , an input section 60 for supporting and inputting a number by keys , the liquid crystal display section 70 for displaying the image picked - up image other than the predetermined data , a wireless communication section 80 for realizing each kind of information communication to the external server , a memory section ( rom ) 91 which stores the system program of the mobile phone 100 , each kind of processing program and the necessary various data of a terminal id , and a temporary memory section ( ram ) 92 used as a working area which temporarily stores each kind of processing program which is conducted by the control section 101 , or data or processing data , or the image pick - up data by the image pick - up unit 50 . the image signal inputted from the image pick - up unit 50 is stored in the memory section 92 or displayed on the display section 70 , further , transmitted as the image information to the outside through the wireless communication section 80 , by the control system of the mobile phone 100 . examples preferable to the above - described embodiment will be shown below . the signs used for each example are as follows . f : a focal length of the whole system of the picture - taking lens , fb : a back focus , f : f - number , 2y : a diagonal line length of the image pick - up surface of the solid picture - taking element , r : a radius of curvature , d : a gap between axial surfaces , nd : a refractive index to d - line of the lens material , ฮฝd : abbe &# 39 ; s number of the lens material . the shape of the aspheric surface in each example is expressed by the following โ€œ math - 1 โ€ under the condition that a top of the surface is made the origin , and x axis is defined in the optical axis direction , and the height in the direction perpendicular to the optical axis is h . โข x = h 2 / r 1 + 1 - ( 1 + k ) โข h 2 / r 2 + โˆ‘ a i โข h i โข [ math โข - โข 1 ] lens data of the picture - taking lens according to example 1 will be shown in tables 1 , and 2 . hereupon , in the data after this ( including the lens data in tables ), it is defined to express the data by using the exponent of 10 , ( for example , 2 . 5 ร— 10 โˆ’ 02 is expressed by using e ( for example , 2 . 5 e - 02 )). fig5 is a sectional view of the picture - taking lens of example 1 . in the view , l 1 is the first lens , l 2 is the second lens , l 3 is the third lens , and s shows the aperture stop . f is a parallel plate assuming an optical low pass filter , an ir cut filter , and 51 a is a photo - electric conversion section of the picture - taking element 51 . fig6 is the aberration views ( spherical aberration ( a ), astigmatism ( b ), distortion aberration ( c ), meridional coma ( d )) relating to the picture - taking lens of example 1 . lens data of the picture - taking lens according to example 2 will be shown in tables 3 , 4 . fig7 is a sectional view of the picture - taking lens of example 2 . in the view , l 1 is the first lens , l 2 is the second lens , l 3 is the third lens , and s shows the aperture stop . further , f is a parallel plate assuming an optical low pass filter , an ir cut filter , and 52 a is a photo - electric conversion section of the picture - taking element 51 . fig8 is the aberration views ( spherical aberration ( a ), astigmatism ( b ), distortion aberration ( c ), meridional coma ( d )) of example 2 . lens data of the picture - taking lens according to example 3 will be shown in tables 5 , 6 . fig9 is a sectional view of the picture - taking lens of example 3 . in the view , l 1 is the first lens , l 2 is the second lens , l 3 is the third lens , and s shows the aperture stop . further , f is a parallel plate such as an optical low pass filter , an ir cut filter , and cg is a parallel plate assuming a seal glass of the picture - taking element 51 and 51 a is a photo - electric conversion section of the picture - taking element 51 . fig1 is the aberration views ( spherical aberration ( a ), astigmatism ( b ), distortion aberration ( c ), meridional coma ( d )) of example 3 . values of examples corresponding to each conditional expression will be shown in table 11 . lens data of the picture - taking lens according to example 4 will be shown in tables 7 , 8 . fig1 is a sectional view of the picture - taking lens of example 4 . in the view , l 1 is the first lens , l 2 is the second lens , l 3 is the third lens , and s shows the aperture stop . further , f is a parallel plate such as an optical low pass filter , an ir cut filter , and cg is a parallel plate assuming a seal glass of the picture - taking element 51 and 51 a is a photo - electric conversion section of the picture - taking element 51 . fig1 is the aberration views ( spherical aberration ( a ), astigmatism ( b ), distortion aberration ( c ), meridional coma ( d )) of example 4 . values of examples corresponding to each conditional expression will be shown in table 11 . lens data of the picture - taking lens according to example 5 will be shown in tables 9 , 10 . fig1 is a sectional view of the picture - taking lens of example 5 . in the view , l 1 is the first lens , l 2 is the second lens , l 3 is the third lens , and s shows the aperture stop . further , f is a parallel plate such as an optical low pass filter , an ir cut filter , and cg is a parallel plate assuming a seal glass of the picture - taking element 51 and 51 a is a photo - electric conversion section of the picture - taking element 51 . fig1 is the aberration views ( spherical aberration ( a ), astigmatism ( b ), distortion aberration ( c ), meridional coma ( d )) of example 5 . values of examples corresponding to each conditional expression will be shown in table 11 . in the above - described examples 1 , 2 , 3 , 4 , 5 the first lens l1 and the second lens l 2 are formed of poly - olefine plastic material , and a saturation water absorption is not larger than 0 . 01 %. the third lens l 3 is formed of poly - carbonate plastic material and saturation water absorption is not larger than 0 . 4 %. because the plastic lens is larger than the glass lens in the saturation water absorption , there is a tendency that , when there is a sudden humidity change , the unequal distribution of water absorption amount is transiently generated , and the refractive index is not uniform , and the good image formation performance can not be obtained . in order to suppress the deterioration of the performance due to the humidity change , it is preferable that all of the plastic material whose saturation water absorption are not larger than 0 . 7 %, are used . further , because the plastic material has a large refractive index change at the time of the temperature change , in the case where all of the first lens l 1 , the second lens l 2 and the third lens l 3 are composed of plastic lenses , when the peripheral temperature changes largely , there is a possibility that the image point position of the whole picture - taking lens system is varied . in the image pick - up unit of the specification in which this image point position variation can not be disregarded , for example , the positive first lens l 1 is made a lens formed of glass material ( for example , glass - mold lens ), the positive second lens l 2 and the negative third lens l 3 are made plastic lenses , and when the refractive index distribution in which the image point position variation at the time of the temperature change is canceled in some degree is made in the second lens l 2 and the third lens l 3 , the problem of this temperature characteristic can be lightened . when the glass - mold lens is used , in order to prevent as possible the consumption of the molding die , it is preferable that the glass material whose glass transition point ( tg ) is not larger than 400 ยฐ c ., is used . further , recently , it is found that , when inorganic fine particles are mixed in the plastic material , the temperature change of the refractive index of the plastic material can be suppressed small . when it is detailed , generally , when fine particles are mixed in the transparent plastic material , because the scattering of light is generated and the transmission is lowered , it is difficult that it is used as the optical material , however , when the size of the fine particle is made smaller than the wavelength of the transmission light flux , the scattering is made possible in such a manner that it is not practically generated . in the plastic material , the refractive index is lowered when the temperature rises , however , in the inorganic particle , the refractive index is increased when the temperature rises . accordingly , when by using these temperature dependency , they are made to act so that they are cancelled out each other , it is possible that the refractive index change is scarcely generated . specifically , when inorganic particles whose maximum length is not larger than 20 nm are dispersed in the plastic material as the base material , the plastic material in which the temperature dependency of the refractive index is vary low , can be obtained . for example , when fine particles of niobium oxide ( nb 2 o 5 ) are dispersed in acrylic resin , the refractive index change due to the temperature change can be reduced . in the present example , when the plastic material in which such inorganic particles are dispersed , is used for one lens of 2 positive lenses ( l 1 , l 2 ) or all lenses ( l 1 , l 2 , l 3 ), the image point position variation at the time of temperature change of the whole picture - taking lens system can be suppressed small . hereupon , in the present example , the principal ray incident angle of the light flux incident on the imaging surface of the solid picture - taking element , is not necessarily designed in such a manner that it is sufficiently small in the peripheral part of the imaging surface . however , in the recent technology , by the revision of the color filter of the solid picture - taking element or the arrangement of on - chip micro lens array , it becomes possible that shading can be lightened . specifically , when the pitch of the arrangement of the color filter or the on - chip micro lens array is set slightly small to the pixel pitch of the imaging surface of the picture - taking element , because , as it goes to the peripheral part of the imaging surface , to each pixel , the color filter or the on - chip micro lens array is shifted to the optical axis side of the picture - taking lens , the slant incident light flux can be effectively guided to the light receiving part of each pixel . hereby , the shading generated in the solid picture - taking element can be suppress small . for the amount for which the above - described requirement is softened , the present example is the designed example which aims further size reduction .
6
reference will now be made in detail to the embodiments of the present general inventive concept , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . the embodiments are described below in order to explain the present general inventive concept by referring to the figures . as illustrated in fig1 , a target system 1 includes an elongated body 10 with a flat face surface 15 adjacent to a top surface 16 , a convex rear surface 17 opposite to the face surface 15 that extends from the top surface 16 to a lower surface 18 , and a base 20 extending from the lower surface 18 . the elongated body 10 is generally tubular except for the face surface 15 that is machined therein . an intermediate portion 21 subtly connects the face surface 15 to the generally tubular elongated body 10 . a circular aperture 30 extends through the face surface 15 to the rear surface 17 and is sized and shaped to accommodate a target perimeter ring 40 . the target perimeter ring 40 has a front surface 42 and a rear surface 43 with a cavity 44 therein . the cavity 44 is opened at an end adjacent to the front surface 42 to receive a disc 50 and has an abutment surface with aperture therein . in the exemplary embodiment , the perimeter ring 40 is magnetic and the disc 50 is metal such that the two elements may be easily assembled without additional connection means . it is foreseen , however , that the perimeter ring 40 and / or disc 50 may be made of other like materials such as plastic , metal etc ., and may be assembled within aperture 30 using glue , epoxy , welding , etc . the disc 50 is circular and has a flat face surface 52 and an opposite - facing rear surface 54 . the flat face surface 52 is sized and shaped to receive a target paper 60 . the target paper 60 is circular and has a textured front surface 62 and an adhesive back surface 64 , the adhesive back surface 64 provided to facilitate attachment of the target paper 60 to the disk 50 face surface 52 . in use , the target paper 60 back surface 52 is adhered to the face surface 52 of the disc 50 . the perimeter ring 40 is inserted into the body 10 by sliding the front surface 42 through the aperture 30 from the rear surface . once the perimeter ring 40 is installed , the disc 50 is inserted into the cavity 44 by sliding the face surface 52 into the cavity 44 until the target paper 60 abuts an interior of the cavity 45 . in another embodiment , the disc 50 is inserted into the body 10 first , then glued or otherwise attached within the aperture 30 and then target paper 60 is adhered to face surface 52 of the disc 50 . the ring 40 is then installed and glued , or other wise attached , in place within the aperture 30 . in another embodiment , as illustrated by fig3 , the circular aperture 30 may be replaced with simply a recessed portion 100 such that the target paper 60 nests within the recessed portion 100 . additionally , the target paper 60 may be covered by a circular plate 110 having an aperture 120 therethrough . the circular plate 110 fits tightly within the recessed portion 100 . in this manner , the target paper 60 abuts both a rear surface of the recessed portion 100 and the circular plate 110 , and the circular plate 110 acts to secure the target paper 60 within the recessed portion 100 . while the face surface 15 of the above embodiments extends at zero degrees with respect to the base 20 , it is foreseen that the face surface 15 may extend at other various angles including but not limited to forty - five degrees , as illustrated by fig4 , or ninety degrees , as illustrated by fig5 , with respect to the base 20 . in these embodiments , the target paper 60 nests within the recessed portion 100 and may be covered by the circular plate 110 having an aperture therethrough . the circular plate 110 fits tightly within the recessed portion 100 such that the target paper 60 abuts both a rear surface of the recessed portion 100 and the circular plate 110 . in this manner , the circular plate 110 acts to secure the target paper 60 within the recessed portion 110 . referring to fig6 and 7 , another embodiment of the inventive concept is shown in which target system 1 includes a generally cylindrical body 10 with a flat face surface 15 that is also the top surface of the body 10 . the flat face surface 15 , of the embodiment shown in fig6 and 7 , is surrounded by an annular protruding lip 616 that extends upward from the surface around the perimeter of the body 10 . target paper 60 is adhered to face surface 15 . in a preferred embodiment , target paper 60 is sized to cover approximately the entire surface of face 15 . a lathe and razor blade is then used to cut a circle having a diameter less than the diameter of face surface 15 at the center of face surface 15 . the excess material of target paper 60 is removed from around the perimeter of the central circle , leaving a centered circle of target paper 60 as is shown in fig6 . it will be appreciated that although body 10 is shown in the embodiment of fig1 - 5 as generally elongated , and in the embodiment of fig6 and 7 as generally cylindrical , that the shape of the body 10 of any embodiment of the instant inventive concept may be elongated , cylindrical , or any other shape desired without departing from the spirit and scope of the instant inventive concept . although a few embodiments of the present general inventive concept have been illustrated and described , it will be appreciated by those skilled in the art that changes may be made in these exemplary embodiments without departing from the principles and spirit of the general inventive concept , the scope of which is defined in the appended claims and their equivalents .
6
the process of this invention can be used to extract an acid from a dilute solution of the acid . it is particularly suitable for extraction of acid from solutions which contain the acid in the form of its calcium salt . such solutions are obtained from acid - producing fermentation reactions in which the ph is maintained in the range of from about 4 . 5 to about 7 . 0 by the addition of calcium carbonate or calcium hydroxide . the concentration of the acid , or its calcium salt , in the solution can vary over a wide range , but is usually less than about 10 % by weight . in carrying out the process of this invention , a molar equivalent of a water - soluble tertiary amine carbonate is added to the calcium salt solution . the tertiary amine carbonate used in the process can be generated by the addition of carbon dioxide to a solution or suspension of the tertiary amine in water . it is most convenient to generate the tertiary amine carbonate in situ by first adding a molar equivalent of the tertiary amine to the calcium salt solution . then carbon dioxide is added to the mixture to generate the tertiary amine carbonate directly in the calcium salt solution . the addition of the carbon dioxide is carried out by any convenient means . either solid or gaseous carbon dioxide is added to the solution at atmospheric pressure or at higher pressures in a pressure vessel . the amines used in the process of this invention are preferably tertiary amines . primary and secondary amines tend to form amides with organic acids under the conditions of the process , and for this reason , are less satisfactory . any tertiary amine which forms a water - soluble carbonate with carbon dioxide under the conditions of the process can be used . preferred amines are those which do not form azeotropes with the acid and which distill at a temperature sufficiently different from the distillation temperature of the acid to permit separation of the acid from a mixture of the acid and the amine by fractional distillation . the amine should be sufficiently stable on heating so that it does not undergo decomposition when the trialkylammonium salt is heated in the final step of the process . the lower molecular weight tertiary amines , trimethylamine , triethylamine and tripropylamine , form carbonates which are water soluble . however , these amines may form azeotropes with some of the acids or tend to codistill with them . the higher symmetrical amines , such as trihexylamine and trioctylamine , do not form carbonates which are sufficiently soluble in water . higher molecular weight tertiary amines , in which one of the alkyl groups is methyl or ethyl , do form water - soluble carbonates , but they may tend to undergo decomposition when heated to a temperature sufficient to decompose their acid salts in the last step of the process . the tertiary amines , dicyclohexylmethylamine and tributylamine , are suitable when higher boiling amines are desired for use in this process . tributylamine is preferred . this amine dissolves readily when carbon dioxide is added to a mixture of the amine in various dilute calcium salt solutions . furthermore , tertiary butylamine has a sufficiently high boiling point so that it does not distill at a temperature at which tributylammonium salts of some of the acids readily dissociate with the organic acid distilling from the mixture . when a water - soluble tertiary amine carbonate is mixed with the calcium salt solution , a precipitate of calcium carbonate is formed . it is preferable to separate this salt before the trialkylammonium salt is extracted from the solution . separation is accomplished by standard procedures such as filtration or centrifugation . when the process is used to recover organic acids from a fermentation reaction , the calcium carbonate can be reused to maintain the ph of the fermentation medium in the desired range . by this procedure , the acid produced in the fermentation reaction is converted to its calcium salt as it is produced by the microorganism . the mixture of amine and acid , which is present in the solution , is designated herein as a trialkylammonium salt . this phrase includes the combination of amine and acid in whatever form it occurs in solution . the combination may be a salt , a complex , or mixtures of these with the free amine and free acid . in one embodiment of this invention , the trialkylammonium salt may be extracted from the solution by means of an organic solvent . polar solvents , such as esters , alcohols , ketones , ethers or chlorinated hydrocarbons may be used . the solvents should be insoluble or sparingly soluble in water and be good extractants for the trialkylammonium salt . this extraction ability is determined by measuring the amount of acid in each phase when the salt solution is extracted with an equal volume of extractant . the extraction ability is expressed as a distribution coefficient ( k d ) which is defined by the formula : ## equ1 ## the solvent should have a k d greater than about 0 . 4 and preferably greater than about 1 . the organic solvent used in this invention should be one that does not react with the acid under the conditions of the process . the solvent is preferably one having a boiling point sufficiently low so that it distills from a mixture of the solvent and trialkylammonium salt below the temperature at which the salt decomposes . furthermore , the solvent should not form an azeotrope with the acid . chloroform is the preferred organic solvent for use in the process of this invention when the amine employed is tributylamine . methods other than solvent extraction can be used to concentrate the trialkylammonium salt . these include evaporation of water from the salt solution and freeze crystallization of the salt . in the final step of the process , the trialkylammonium salt is heated to cause dissociation of the salt with liberation of the acid and the amine . the temperature at which the trialkylammonium salt decomposes depends somewhat on the tertiary amine and acid . either the tertiary amine or the acid is distilled from the mixture , depending on their relative boiling points . thus , it is apparent that there has been provided , in accordance with the invention , a process for the recovery of organic acids from a solution in which the acid is in the form of its calcium salt . it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended to include all such alternatives , modifications , and variations as set forth within the spirit and scope of the appended claims .
2
the assignment of hierarchical rights allows , for example , even greater control by an author over one or more documents . this hierarchical rights assignment further allows for greater control throughout the document distribution chain extending to , for example , distributors , secondary distributors , users , or the like . therefore , a graphical representation of the rights associated with the document could appear as a series of interconnected nodes each having an associated portion of rights . an exemplary embodiment of the systems and methods of this invention can also include a rights - on - rights scheme in which , for example , a counter or other system manages the various layers , nodes and branches to regulate , for example , the rights to change , edit , assign , revoke , transfer other rights , or the like , to one or more additional layers . since rights can be treated as an object class , for example using xml , rights can include themselves and thus refer to itself as , for example , an iteration . for example , a user can transfer the rights - on - rights for a maximum of two layers of the right assignment tree which could , for example , further limit and control the overall distribution of both the rights and the document . therefore , the rights of the user may be different from the rights a user can assign or transfer in the hierarchical structure . additionally , for example , the rights to change , edit , copy , sign , or the like , can be passed on from the owner to the user . associated with one or more of these rights can be document tracking actions . for example , using a digital signature , a document can manage and record its path of distribution , recording each user &# 39 ; s interactivity with the document , including , for example , any assignment and / or distribution action , or any other information that may be relevant . therefore , it is possible that a document will have associated therewith multiple signatures that represent , for example , a โ€œ snapshot โ€ of the document as it was available to that particular user . for example , a second user can add , subtract , modify , edit , or the like , the content of a document which has already been signed by a first user . these modifications by the second user are then โ€œ signed ,โ€ recording that user &# 39 ; s interactions with the document . both versions of the document then can be stored , for example , in a database , for reference , accounting , profiling , or the like . additionally , the right to use a document can be content - based or role - based , as is described in copending attorney docket no . 111325 . 64 , entitled โ€œ method and apparatus for assigning conditional or consequential rights to documents and documents having such rights ,โ€ filed herewith and incorporated herein by reference in its entirety . for example , the president of a company may want to be the only one authorized to use a particular document . if the present of the company changes , the new president can automatically become the right holder , assuming the president can verify , for example , their position using , for example , biometrics , a smart card , an identification card , or comparable identification device or scheme . this allows the assignment of rights to be separate from the assignment of the position . similarly , the systems and methods of this invention can be used in conjunction with rights editing tools and templates such as those discussed in u . s . provisional patent application ser . no . 60 / 261 , 753 , entitled โ€œ method and apparatus for editing and specifying the rights and conditions associated with documents or digital contents ,โ€ incorporated herein by reference in its entirety . for example , rights can be assigned through the use of templates that can aid in the assignment of rights to one or more classes of users based on , for example , a job position , a geographic location , a profile , an identifier , or the like . furthermore , this concept extends itself into the medical field . for example , where medical records are used by a doctor , the medical records can contain usage rights for a certain class or field of individuals . this can , for example , satisfy both the concerns regarding the patient &# 39 ; s safety and the patient &# 39 ; s privacy by limiting access to one or more documents . additionally , for example , the role - based or content - based rights can be used for access to movies with , for example , adult content to restrict a particular class of individuals from viewing the content . an attempt to access the restricted content can be recorded and , for example , reported to the proper party . furthermore , the parent can be viewed as a node in the hierarchical right assignment structure such that the parent can obtain a template or toolkit for right assignment , right modification and right customization , and then transfer the rights to one or more children . the parent could then update and modify , for example using an age - based right assignment scheme with or without corresponding templates , the child &# 39 ; s rights as , for example , the child grows . fig1 illustrates an exemplary document 100 . the exemplary document 100 comprises a right management module 110 , a right assignment module 120 , a tracking module 130 , a right usage determination module 140 , an interface module 150 , an accounting module 160 , and a document updating module 170 interconnected by links 5 . the document 100 can also be connected to a distributed network ( not shown ) which may or may not also be connected to one or more other documents , account processing systems , rights management systems , or other distributed networks , as well as one or more input devices and display devices ( not shown ). while the exemplary embodiment illustrated in fig1 shows the document 100 and associated components collocated , it is to be appreciated that the various components of the document 100 can be located at distant portions of a distributed network , such as a local area network , a wide area network , an intranet and / or the internet , or within a dedicated document or document system . thus , it should be appreciated that the components of the document 100 can be combined into one device or collocated on a particular node of distributed network . furthermore , it should be appreciated that for ease of illustration , the various functional components of the document 100 have been divided as illustrated in fig1 . however , any of the functional components illustrated in fig1 can be combined or further partitioned without affecting the operation of the system . as will be appreciated from the following description , and for reasons of computation efficiency , the components of the document can be arranged at any location within a distributed network without effecting the operation of the system . furthermore , it is to be appreciated that the term module as used herein includes any hardware and / or software that provide the functionality as discussed herein . likewise , the document 100 can be self contained , such as an e - book , and comprise any necessary controllers , memory , and / or i / o interfaces that may be necessary given the particular embodiment and / or implementation of the document 100 . additionally , the document 100 can be any information to which hierarchical rights are associated . furthermore , the links 5 can be a wired or wireless link or any other known or later developed element ( s ) that is capable of supplying and communicating data to and from the connected elements . additionally , the input devices can include , for example , a keyboard , a mouse , a speech to text converter , a stylus , a mouse , or the like . in general , the input device can be any device capable of communicating information to the document 100 . furthermore , the display device can be a computer monitor , a display on a pda , an e - book , or any other device capable of displaying information to one or more users . in operation , a user , such as a document creator , associates rights with the document 100 . in particular , via the interface module 150 and one or more of an input device and display device , a user inputs rights to associate with the document 100 . in cooperation with the right management module 110 and the right assignment module 120 , the rights are associated with the document 100 . in this exemplary embodiment , it is assumed that the content owner , or author , is not responsible for any type of accounting procedure , e . g ., crediting or debiting , associated with assigning rights to the document 100 . however , it is to be appreciated that for a particular embodiment , it may be desirable to credit or debit a user based on the user associating rights with a document 100 . however , as previously discussed , the association and assignment of rights can be performed by , for example , one or more external rights assignment system that associates one or more hierarchical rights with the document 100 . for example , an employee of a newspaper may be hired to write an article on a particular topic . on completion of the article , the journalist could assigned view , edit and distribution rights to the publisher . then , for example , upon assignment of these rights and distribution of the document to the publisher , the author could be credited for their work . alternatively , a user may receive a document 100 and wish to modify the rights associated with that document . thus , the right management module 110 determines the available assignable rights associated with the document 100 . then , via the interface module 150 , and one or more of the input and display devices , the rights that are to be assigned by the user are received . next , a determination is made by the right management module 110 as to whether the assignment is allowable . for example , the rights associated with the document 100 can restrict based on , for example , the user , the distribution history , another users &# 39 ; interaction with the document , or the like , whether the current user &# 39 ; s request to modify the associated rights is allowable . if the right assignment module 120 determines that the user &# 39 ; s request is not allowed , a message can be forwarded to the user indicating the like . however , if the assignment is determined allowable by the right assignment module 120 , an optional determination can be made by the accounting module 160 as to whether any accounting functions need be performed . if accounting functions need be performed , the accounting module 160 can perform any necessary crediting and / or debiting as appropriate . for example , the accounting module 160 can contact an accounting system ( not shown ) which could authorize the user &# 39 ; s transaction . alternatively , for example , the accounting module 160 can interface with a user , for example , via a smart card , a credit card interface , or the like , and correctly debit and / or credit a user &# 39 ; s account . however , it is to be appreciated that the accounting module 160 need not perform any function whatsoever if the rights associated with the document so specify , for example , in a document that is available for inspection and comment . furthermore , it is appreciated that the accounting module 160 need not perform the accounting functions in real time , but can perform them on an as needed basis , in a batch , or the like . for example , if the document 100 is an e - book , the accounting module 160 could debit every user that views the contents of the e - book as it is passed around . then , upon return of the e - book to , for example , a library , the accounting module 160 can synchronize with , for example , an accounting system that performs any necessary accounting functions . in general , if the accounting is required and is successful , the rights chosen by the user are associated with the document . however , if , for example , the accounting function is not allowed , a message can be forwarded to a user indicating that there is a problem . after the association of the updated rights with the document by the document updating module 170 , the tracking module 130 can optionally maintain a history , for example , with the use of a digital signature , of the rights updates , or any other updates , such as edits , or the like , made by this particular user . this information can then be associated with the document with the cooperation of the tracking module 130 . in use , a user receives one or more documents 100 for viewing , editing , modifying , updating , distributing , or the like . upon receipt of the document 100 , the right management module 110 determines the rights available to that user . if the user &# 39 ; s usage request corresponds to the rights available to that user , the right usage determination module 140 , in cooperation with the right management module 110 , allows the user &# 39 ; s request . furthermore , based on the user &# 39 ; s usage request , the document updating module 170 can allow the user to , for example , edit , update , or otherwise modify the document 110 . however , if the user &# 39 ; s usage request does not correspond to the usage rights available to that user , a message can be forwarded to the user requesting , for example , an alternative usage request be entered , or denying access to the document . optionally , the tracking module 130 can also maintain a log of user access attempts and rights requests for the document . fig2 illustrates an exemplary tree of documents having associated hierarchical rights at each node of the tree . in particular , a user , such as a content owner 200 , distributes one or more documents to users 210 , 220 and 230 . the documents 240 , 250 and 260 , respectively , comprise usage rights and delegation rights . the usage rights govern the extent to which the user can access the particular document . the delegation rights govern the ability for the user to assign rights , govern further distribution the document , and regulate the number of users to which the document can be distributed . in this exemplary embodiment , the content owner 200 distributes a first document to the user 210 who then distributes the document 240 to user 220 . additionally , the content owner distributes documents 250 and 260 to the user 230 . in this exemplary embodiment , the user 210 , based on the delegation rights 244 , has the ability to further distribute the rights to one or more additional users . in this example , the user 210 distributes the document 240 to user 220 . therefore , the user 220 will have a version of the document 240 that has associated usage rights 242 and delegation rights 244 . these usage rights 242 and delegation rights 244 may be a subset of , or may comprise additional rights not present in the usage rights and / or delegation rights granted to the user 210 . user 230 possesses two documents 250 and 260 . the document 250 comprises associated usage rights 252 and delegation rights 254 . likewise , the document 260 comprises usage rights 262 and delegation rights 264 . the user 230 then has the ability , based on the available rights , to modify one or more of the usage rights and / or delegation rights and forward them to one or more additional parties . in this manner , a hierarchical structure of usage rights and delegation rights extends from the content owner in a tree - like structure through one or more users . fig3 illustrates various exemplary embodiments of usage rights and delegation rights associated with an exemplary document . in particular , content owner 300 distributes six documents 310 - 360 . document 310 allows user a to have view rights and the right to delegate view rights to two additional layers . user b has view rights and the right to delegate view rights to two users on one additional layer . users c and d both have view rights granted by user b , but no delegation rights . document 320 allows user k to have view rights and the right to delegate view rights to one additional layer . upon granting of these view rights , user w has view rights to the document . for document 330 , the content owner 300 granted user v a print usage right , and no delegation rights . thus , the document 330 cannot be further delegated and may , for example , become inaccessible after v has exercised the print right . document 340 provides user e print rights , and the right to delegate view rights to two additional layers . upon delegation of these rights , user f has view rights and the right to delegate view rights to two additional users on one further layer . upon delegation of these rights , users g and h would both be able to view the document 340 . for document 350 , the content owner 300 has provided user z with full rights . thus , user z has the ability to assign any delegation and / or usage rights to the document 350 . thus , the document 350 can be further distributed and / or used based on the updated rights based on the rights user z associates with the document . document 360 allows user q to have distribution rights to unlimited users , and the ability to delegate view rights to each of these users . thus , user q can delegate view rights to one or more users x who can view the document , for example , on a pay - per - view basis . while the exemplary embodiment illustrated in fig3 shows specific usage rights and delegation rights , it is to be appreciated that any usage rights , such as editing , modifying , updating , copying , viewing , or the like , can be associated with one or more documents . furthermore , it is to be appreciated that the rights associated with a document can include accounting rights , conditional or consequential rights , return rights , tracking rights , signature requirement rights , or the like . in general , the rights associated with a document can be any right granting or restricting access to one or more users , and can encompass at least all the rights specified in the xrml โ„ข rights language and the associated usage rights and grammar . fig4 illustrates an exemplary embodiment of a method for associating rights with a document . in particular , control begins in step s 100 and continues to step s 110 . in step s 110 , a determination is made whether rights are already associated with the document . if rights are associated with the document , control continues to step s 120 where the usage and delegation rights available to the particular user are determined . control then continues to step s 130 . in step s 130 , the rights one or more users desire to have associated with the document are received . next , in step s 140 , it is determined whether the assignment of these rights is allowable . if the assignment is allowable , control continues to step s 160 . otherwise , control jumps to step s 150 . in step s 150 , a message can be forwarded to the user indicating the assignment is not available . control then optionally continues back to step s 130 . in step s 160 , an optional accounting function can be performed . if accounting is necessary , control continues to step s 170 . otherwise , control jumps to step s 200 . in step s 170 , any necessary accounting functions are attempted . then , in step s 180 , a determination is made whether the accounting , e . g ., any crediting and / or debiting , is allowed . if the accounting functions are successful , control jumps to step s 200 . otherwise , control continues to step s 190 where a message can be forwarded to the user and control returns back to step s 130 . in step s 200 , the right as chosen by the one or more users are associated with the document . then , in step s 210 , the document can be updated reflecting , for example , which usage rights were used , the effect of any of these usage rights , a signature of the user and , for example , any modifications to or assignment of delegation rights . control then continues to step s 200 where the control sequence ends . fig5 illustrates an exemplary method of using one or more of usage rights and delegation rights . in particular , control begins in step s 300 and continues to step s 310 . in step s 310 , the usage request is received . this usage request can be one or more of a usage right requests or a delegation right request . then , in step s 320 , the rights available to the particular user are determined . for example , as previously discussed , the rights can be based on the identity of the user , the position of the user , a status of the user , or the like . control then continues to step s 330 . in step s 330 , a determination is made whether the user &# 39 ; s right request is allowable . if the usage request is not allowable , control continues to step s 340 . otherwise , control jumps to step s 350 . in step s 340 , a message can be forwarded to the user indicating the requested usage , i . e ., the usage or the delegation request , is not allowable . control then optionally jumps back to step s 320 . in step s 350 , a determination is made whether an accounting function is to be performed based on , for example , the usage request or the delegation request . if accounting functions are to be performed , control continues to step s 360 . otherwise , control jumps to step s 390 . in step s 360 , the accounting functions are attempted . then , in step s 370 , a determination is made whether the accounting functions are allowed . if the accounting functions are allowed , control continues to step s 380 . otherwise , control jumps to step s 390 . in step s 380 , a message can be forwarded to the user indicating , for example , that the crediting and / or debiting authorization failed . control then can , for example , jump back to step s 320 or , optionally , the user can be prompted for additional accounting information . in step s 390 , one or more of the usage rights or delegation rights is allowed . control then continues to step s 400 , where the control sequence ends . as illustrated in fig1 , the document can be implemented either on a single programmed general purpose computer or a separate programmed general purpose computer . however , the document can also be implemented on a special purpose computer , a programmed microprocessor or microcontroller and peripheral integrated circuit element , an asic or other integrated circuit , a digital signal processor , a hardwired electronic or logic circuit such as a discrete element circuit , a programmable logic device such as a pld , pla , fpga , pal , or the like . in general , any device capable of implementing a finite state machine that is in turn capable of implementing the flowcharts in fig4 - 5 can be used to implement the document and hierarchical rights management system according to this invention . furthermore , the disclosed method may be readily implemented in software using object or object - oriented software development environments that provide portable source code that can be used on a variety of computer or workstation hardware platforms . alternatively , the disclosed document and right management system may be implemented partially or fully in hardware using standard logic circuits or vlsi design . whether hardware or software is used to implement the systems and methods in accordance with this invention is dependent on the speed and / or efficiency requirements of the system , the particular function , and a particular software and / or hardware systems or microprocessor or microcomputer systems being utilized . the document and rights management systems illustrated herein , however , can be readily implemented in hardware and / or software using any known or later - developed systems or structures , devices and / or software by those of ordinary skill in the applicable art from the functional description provided herein and with a general basic knowledge of the computer arts . moreover , the disclosed methods may be readily implemented as software executed on a programmed general purpose computer , a special purpose computer , a microprocessor or the like . in these instances , the methods and systems of this invention can be implemented as a program embedded in a personal computer , an e - book , a secure container , or the like , such as a java ยฎ or cgi script , as an xml document , as a resource residing on a server or graphics workstation , as a routine embedded in a dedicated electronic document , an electronic document viewer , or the like . the document and rights management system can also be implemented by physically incorporating the systems and methods into a hardware and / or software system , such as the hardware and software systems of a computer or dedicated electronic document . it is , therefore , apparent that there has been provided , in accordance with the present invention , systems and methods for managing electronic documents . while this invention has been described in conjunction with a number of embodiments , it is evident that many alternatives , modifications and variations would be or are apparent to those of ordinary skill in the applicable art . accordingly , applicants intend to embrace all such alternatives , modifications and variations that are within the spirit and scope of this invention .
6
embodiments of the present invention will be described below referring to the figures . fig3 is a front sectional view showing a main portion of a copying machine 1 . in the figure , a photoreceptor drum 5 is arranged rotatably at a constant circumferential speed v in the direction of the arrow ma . a heater 5a for heating photoreceptor drum 5 and a temperature sensor 51 are provided therein . on / off control of heater 5a is performed on the basis of an output signal of temperature sensor 51 , and the temperature of photoreceptor drum 5 is kept constant thereby . around photoreceptor drum 5 , for the electrophotographic process , a corona charger 6 , an eraser 10 for portions between images , a developing device 7 , a transfer charger 28 , a copy paper separation charger 29 , a cleaning device 9 , and a main eraser 8 are provided . corona charger 6 is a charger of scorotron type having a mesh - like grid 63 . between an exposure position x2 and the eraser 10 , a surface electrometer ( vo sensor ) 90 for measuring a surface potential ( vo ) of the photoreceptor drum 5 is provided . also , between the separation charger 29 and the cleaning device 9 , a reflection type photosensor ( aidc sensor 19 including an emitter element 19a and a receiving element 19b is provided for measuring the density of a reference toner image . the surface of photoreceptor drum 5 , passing under the corona charger 6 , is evenly charged and exposed by an optical system 20 at the exposure position x2 . by the exposure , the surface charge of photoreceptor drum 5 is partly removed and a latent image corresponding to an original d is formed on the surface of photoreceptor drum 5 . the surface charge except the potion of the latent image is erased by eraser 10 . optical system 20 includes an exposure lamp 21 irradiating the original d located on a platen glass 11 , mirrors 22a - d for guiding the reflected light b from the original d to the exposure position x2 , and a projecting lens 23 . in the vicinity of the projecting lens 23 , an ae sensor 25 sensing the amount of the reflected light from the original d is provided . in exposure - scanning to the original d , exposure lamp 21 and mirror 22a move at a speed of v / m ( m indicates a copying magnification ) in the direction designated by the arrow mb , and mirrors 22b , 22c are movable at a speed of v / 2m . the latent image formed on the surface of photoreceptor drum 5 is developed by developing device 7 to appear as a toner image . the developing device 7 performs so - called non - reversal development , in which a developer composed of a mixture of magnetic carrier and insulative toner is employed , and the toner sticks to a latent image ( a charge existing portion , or non - exposed portion ) passing through a developing position x3 by the well known magnetic brush system . in a developer tank 70 , there are a developing sleeve 71 having a magnetic roller 72 therein , a regulating plate 73 , a bucket roller 74 , and a screw roller 75 , and a toner concentration sensor ( atdc sensor ) 80 is provided below the screw roller 75 . when the bucket roller 74 rotates in the direction designated by the arrow mc , the developer sticks to the outer peripheral surface of the developing sleeve 71 because of the magnetic power of magnetic roller 72 , which is transported to the developing position x3 with the rotation of the developing sleeve 71 in the direction of the arrow md . the toner concentration sensor 80 measures the weight percentage t / c [ wt %] of the toner with respect to the entire developer based on the permeability of the developer . a toner tank 76 is provided above developing tank 70 and a toner supply roller 77 is provided in the bottom portion thereof . with the toner supply roller 77 rotation - driven by a supply motor 78 , the toner is supplied from toner tank 76 to screw roller 75 . the supplied toner is stirred and mixed with the developer already existing inside the developing tank 70 with the rotation of screw roller 75 to be sent to bucket roller 74 . frictional electrification is produced in the stirring and mixing , so that the magnetic carrier and the toner are charged in different polarities . the toner of negative polarity sticks to the surface of photoreceptor drum 5 at the developing position x3 because of electrostatic adsorption with the surface charge of photoreceptor drum 5 . then , in order to prevent the toner from sticking because of the residual charge ( charge remaining in the exposed portion ) on the surface of photoreceptor drum , developing bias vb of a predetermined voltage is applied to developing sleeve 71 . on the other hand , paper p are fed one by one by a paper feed roller 31 from a detachable paper feed cassette 95 , which are transported while keeping timing with rotation of photoreceptor drum 5 by a timing roller 30 to a transfer position x4 where a toner image is transferred to the paper p by transfer charger 28 . the paper p to which the toner image is transferred is separated from photoreceptor drum 5 by copy paper separation charger 29 , sent to fixing device 15 by a transporting belt 14 , and discharged out of copying machine 1 after heat - fixing of the toner image . the fixing temperature of fixing device 15 is sensed by temperature sensor 15a . subsequently , on the surface of photoreceptor drum 5 , the remaining toner is removed by a cleaning blade 9a of cleaning device 9 and residual charge is removed by main eraser 8 for the next exposure . the light amount of main eraser 8 is controlled constant on the basis of an output of a light amount sensor ( not shown ). a paper sensor 96 including a photo sensor sensing presence / absence of paper p is provided in paper feed cassette 95 . fig4 is a block diagram of a control circuit 200 of copying machine 1 . control circuit 200 includes a cpu 201 totally controlling copying machine 1 , a program memory 211 storing a control program , a memory 210 storing various kinds of data used for controlling the electrophotographic process , copying machine 1 and so forth , a communication interface 223 for communicating with external devices such as a control unit 2 or a portable maintenance device 3 which will be described later , and so forth . the cpu 201 is supplied with signals from sensors such as the above - described ae sensor 25 , atdc sensor 80 , vo sensor 90 , aidc sensor 19 , a temperature sensor 15a sensing temperature of fixing device 15 , a thermistor 54 for detecting installation circumstances of copying machine 1 , humidity sensor 55 and so forth . exposure lamp power source 50 for lighting exposure lamp 21 , power source 208 for driving supply motor 78 , output circuit 202 for setting surface potential v0 of photoreceptor drum 5 , high - voltage power source 40 for applying developing bias vb and so forth are supplied with control signals from cpu 201 . cpu 201 controls communication of transmitting the data in memory 210 to external devices according to commands from the external devices in addition to controlling the electrophotographic process . the data stored in memory 210 include reference data bd which is a reference for controlling the electrophotographic process , condition data cd indicating the past and present conditions including information of set values in each portion appropriately changed in control , such as the light amount of exposure lamp 21 , the voltage applied to grid 63 , and the bias voltage applied to the developing sleeve , of installation circumstances such as temperature and humidity , and information such as the surface potential ( vo ) of the photoreceptor , the image density measured by aidc sensor 19 and temperature of fixing device 15 , and user data ud related to operation control of a user such as management of the number of copies and consumable goods . fig5 is a block diagram showing a configuration of a control unit 2 at the service station . the control unit 2 includes a host computer 301 carrying out various kinds of processes according to the software , a display 302 for displaying , a keyboard 303 as operation input means , a printer 304 for printing , a modem 305 for communication with a plurality of copying machines provided at respective users through a telephone line 230 , and a telephone set 306 for communication between a serviceman and a user . the host computer 301 of the present embodiment is capable of data exchange with potable maintenance device 3 which is carried by a serviceman in the service visit and includes a communication interface 307 for communication with portable maintenance device 3 and a memory 308 for storing the field information fd including information of use conditions and fail occurrence portions of the copying machine 1 supplied by the portable maintenance device . fig1 is a block diagram showing a configuration of portable maintenance device 3 , and fig2 is a front view showing external appearance of portable maintenance device 3 . the portable maintenance device 3 includes a display 402 for guidance display and so forth , a group of keys 403 including various kinds of keys for operation input , a printer portion 404 , a communication interface 405 for communication with copying machine 1 or host computer 301 through a cable 316 , a memory 408 for storing guide data gd supporting field work , a memory 409 capable of reading / writing of the work data wd indicating contents of the field work by a serviceman , and a cpu 401 for controlling them . the operation keys arranged in the group of keys 403 include keys corresponding to numerals of 0 to 9 and alphabets of a to f , keys for the four rules of arithmetic , cursor keys 403a for moving a cursor in up , down , left and right directions on the screen of display 402 , and an enter ( enter ) key 403b for starting processings . in fig2 the numeral character 405a indicates a connector for connecting cable 316 . a portable maintenance device 3 configured as described above is a component of a maintenance control system of copying machine 1 , which works as an information transmitting medium connecting copying machine 1 and control unit 2 in an off - line manner and as support means for field work by a serviceman . that is to say , the portable maintenance device 3 has an information transmission function of storing the information transmitted from copying machine 1 and information supplied by a serviceman and transmitting the same to control unit 2 , and a trouble diagnosis and automatic adjusting function of displaying a guidance display instructing the work procedure on the basis of the guide data gd and transmitting a command signal for varying a set value in each portion of copying machine 1 as needed . fig6 is a diagram showing contents of the communication by potable maintenance device 3 . a serviceman connects portable maintenance device 3 and host computer 301 first at a service station in order to give the newest guide data gd to portable maintenance device 3 when he is making a visit to a user for periodical checking or for dealing with a trouble . the guide data gd is updated in order on the basis of the field information fd by control unit 2 . the serviceman arriving at a user connects the potable maintenance device 3 to copying machine 1 in order to have the condition data cd indicating conditions transmitted from memory 210 of copying machine 1 to potable maintenance device 3 . the serviceman also inputs the information about conditions detected with the sense by the serviceman himself into portable maintenance device 3 as complementary condition data hcd . the portable maintenance device 3 totally examines the condition data cd , the complementary condition data hcd , and the guide data gd to make a guidance display of the most appropriate work procedure corresponding to the conditions . the serviceman can proceed his work properly and quickly following the guidance display . at the end of the work , the serviceman inputs in the portable maintenance device 3 information indicating items actually performed in the work ( implemented items ), such as adjusted portions , cleaned portions , and replaced parts , together with a machine number specifying the copying machine 1 , a name of the serviceman and so forth . the supplied information is stored in memory 409 as the work data wd indicating contents of the work together with the condition data cd , the complementary condition data hcd , and contents of the guidance display ( diagnosis result ). the serviceman can also read a copied image using an image reader in order to have the image data stored in portable maintenance device 3 as a part of the complementary condition data hcd . the serviceman , returning to the service station , connects portable maintenance device 3 and host computer 301 again , and performs operation for have the work data wd transmitted to control unit 2 . the work data wd transmitted in this way is utilized as field information fd for production of guide data gd together with work data wd corresponding to each of a large number of copying machines 1 similarly collected . in producing the guide data gd , the work data wd can be taken in as external events for trouble diagnosis in the field of the artificial intelligence to be employed for estimating a cause of a trouble . next , the field work using potable maintenance device 3 in occurrence of a trouble related to fixing device 15 will be described as a specific example . fig7 a and 7b are diagrams showing configuration of fixing device 15 . fixing device 15 includes a heating roller 51 having a heater lamp 53 provided therein , a pressure roller 52 for pressuring paper p , a thermistor 54 sensing a surface temperature of heating roller 51 , and fixing control portion 55 . fixing control portion 55 includes a thyristor 56 as a switching element and a braker 57 packaged to a substrate 58 . an output signal s54 of thermistor 54 is supplied to cpu 201 , which provides a control signal s56 to thyristor 56 in response to the signal s54 . thus , supply of alternating current power to heater lamp 53 is controlled to keep heating roller 51 at a predetermined temperature . braker 57 is a safety device of non - return type cutting the power supply to heater lamp 53 when the circumferential temperature of heating roller 51 becomes abnormally high . a sensor ( not shown ) is provided in a supporting portion of fixing control portion 55 , so that a sense signal s55 indicating replacement of fixing control portion 55 is supplied to cpu 201 when the fixing control portion 55 is taken out of copying machine 1 . fig8 is a flow chart diagram showing the field work by a serviceman , and fig9 a - 9c are diagrams showing examples of displayed screens of display 402 . in the example of fig8 the situation of the trouble is that a so - called wait for waiting for the temperature of heating roller 51 to reach a predetermined value before starting image forming is not eliminated ( wait up ) after a predetermined timed period . a serviceman visiting a user side first connects his portable maintenance device 3 to copying machine 1 ( step # 1 ). as described - above , the newest guide data gd is already stored in portable maintenance device 3 at a service station . upon selection of a trouble diagnosis mode with key 403 by the serviceman , the portable maintenance device 3 reads the condition data cd from copying machine 1 to carry out an estimate no . 1 of a portion in which a fail is occurring , or of a cause of the trouble , on the basis of the conditions designated by the condition data cd ( step # 2 ). in this stage , a message z1 corresponding to the condition is displayed in display 402 as shown in fig9 a . the message z1 indicates that the sensed temperature by thermistor 54 is not more than 135 ยฐ c . which is not abnormally high . causes of the trouble estimated only based on the information that the sensed temperature by thermistor 54 is at the above value include a large number of items . that is , in this case , a defect of thermistor 54 , contaminants of thermistor 54 , damage of heater lamp 53 , a defect of fixing control portion 55 , inferior mounting ( inferior contact ) of fixing control portion 55 and so forth can be pointed out as causes of the trouble . next , portable maintenance device 3 displays messages z2 , z3 demanding a serviceman for input of complementary information necessary for specifying a cause of the trouble ( step # 3 ). the serviceman inputs the information which he obtained with visual confirmation or the like as complementary condition data hcd into portable maintenance device 3 according to the displayed contents ( step # 4 ). in the example of fig9 a , a question is made as to whether braker 57 is on or not as a message z3 , and an input corresponding to the same is made by selection of yes or no . after this , in an interaction system in which the next message is displayed according to an input corresponding to the previous message , the display of the messages z4 , z5 and inputs corresponding to the displays are sequentially made . when the information obtained with the sense of the serviceman is supplied , portable maintenance device 3 performs trouble cause estimate no . 2 also referring to the information newly inputted ( step # 5 ). then , a message z6 indicating it is now being estimated is displayed in display 402 . when a cause of the trouble is specified , that is , if the number of items estimated as a cause with a predetermined accuracy can be narrowed down to one or two ( step # 6 ), it proceeds to step # 8 to display the cause . for example , if heater lamp 53 lights and an output of thermistor 54 varies even just a little bit according to the lightening , a cause of the trouble can be specified as contaminants of thermistor 54 , so that a display for instructing cleaning of thermistor 54 is made in step # 8 . if braker 57 is cut - off , however , or when the power supply is shielded , the cause of the trouble can not be specified . in this case , the cause estimate no . 3 is performed on the basis of a trouble table tt indicating handling methods corresponding to conditions of the past trouble occurrence in the market included in the guide data gd ( step # 7 ). fig1 is a diagram showing contents of the trouble table tt . the trouble table tt includes information of occurrence frequency for each item pointed out as a cause of a trouble , handling methods corresponding to each item and possibility that each item is a real cause . in the example of fig1 , if the occurrence frequency of troubles caused by a defective thermistor , contaminants of a thermistor and a a thermistor and a defecte in fixing control portion 55 are 1 %, 2 % and 6 %, respectively , since the occurrence frequency of a defecte of fixing control portion 55 is high as compared to the occurrence frequencies of troubles caused by a defect or contaminants of thermistor 54 which are pointed out as causes of the present trouble , the cause of the present trouble can be specified as a defect of fixing control portion 55 . in this case , however , it is specified only with a statistical estimate . accordingly , if a cause is estimated on the basis of the trouble table tt , it is displayed that the cause is specified with not high accuracy in display 402 as shown in fig9 b , and an instruction of work to be performed is also displayed , accordingly . the serviceman works on the basis of display in display 402 ( step # 9 ), and after confirmation of repair of the trouble at the end of the work , the serviceman operates the keys for storing the work data wd into portable maintenance device 3 ( step # 10 ). if the serviceman selects a work content input mode , the message z21 is displayed for confirmation as to whether the implemented items estimated according to the above fail diagnosis have been actually practiced or not in display 402 as shown in fig9 c . the serviceman performs selecting operation of yes or no employing cursor keys 403a and an enter key 403b with respect to the displayed each practice item . if yes is selected , the implemented item is stored in memory 409 as the work data wd indicating a part of the work contents . in this way , input of work contents is performed in a confirmation operation system , so that the operation is easier than the method in which predetermined codes for respective implemented items are sequentially supplied , with the result that mistakes and oversights are not made in input . also , a message z22 instructing input of implemented items according to decision by the serviceman himself is displayed in display 402 . in the example of fig9 c , selection of large items of &# 34 ; parts replacement &# 34 ;, &# 34 ; cleaning &# 34 ; and &# 34 ; end of work &# 34 ; are instructed . if &# 34 ; parts replacement &# 34 ; or &# 34 ; cleaning &# 34 ; is selected , the display switches to a corresponding one . if there is no item to be inputted , end of work is selected . with respect to a part of which loading / unloading is reported to cpu 201 , such as fixing control portion 55 , the data indicating parts replacement is automatically supplied as work data wd from copying machine 1 to portable maintenance device 3 when it is replaced . returning to fig8 upon completion of input of work contents , the serviceman detaches the portable maintenance device 3 from copying machine 1 ( step # 11 ). during this time , portable maintenance device 3 counts a connection time with copying machine 1 through cable 316 and automatically stores the connection time as a work time into memory 409 . subsequently , the serviceman prints out the work data wd as a list showing work contents using print portion 404 as needed . if the guide data gd includes data necessary for calculating a work charge , the serviceman issues a bill of the working charge employing portable maintenance device 3 and hands it to the user . fig1 is a flow chart diagram showing updating of the guide data gd . the serviceman connects a portable maintenance device 3 to host computer 301 at a service station ( step # 101 ). the work data wd is transmitted from portable maintenance device 3 to control unit 2 ( step # 102 ). in control unit 2 , the work data wd is stored as the field information , and the guide data gd is updated on the basis of the newest field information fd ( step # 103 ). the updated guide data gd is transmitted to portable maintenance device 3 ( step # 104 ). in portable maintenance device 3 , the existing guide data gd stored in memory 408 is rewritten to the newest guide data gd newly transmitted . thus , the serviceman is supported by the newest guide data gd , which makes the field work more quick and appropriate . subsequently , portable maintenance device 3 is detached from host computer 301 for preparation of the next field work ( step # 105 ). according to the above - described embodiments , portable maintenance device 3 is configured to store the condition data cd transmitted from copying machine 1 together with other information such as complementary condition data hcd and transmit the same to control unit 2 . accordingly , even if an on - line connection is not made between copying machine 1 and control unit 2 , the condition of copying machine 1 can be controlled in control unit 2 . accordingly , a copying machine 1 of small size or low price provided with no modem for transmitting data employing a telephone line can be an object to be controlled in the maintenance control system . according to the above - described embodiment , the serviceman can proceed his work according to the display of display 402 , so that even a serviceman with less experience of the field work can properly find out a cause of a trouble to quickly repair the copying machine 1 into a normal condition . according to the present invention , in the field work by a serviceman , treatments corresponding to the operational conditions of an image forming apparatus are made more suitable , and also the serviceman can proceed his work quickly . also , according to the present invention , in addition to the above - described effects , the serviceman can proceed the field work on the basis of improved guide information , so that the suitability and quickness of the field work can be further enhanced . furthermore , according to the present invention , detailed information with respect to conditions necessary in maintenance control of image forming apparatus can be easily accumulated . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims .
6
the system and method of the present invention employs an object oriented programming methodology in order to allow for both multithreading of the processes and the decoupling of the processes into object classes . this realizes improved performance over the present technology as well as improved extensibility . according to the preferred embodiment , a java developer kit was used to develop the code for the system and method to be executed on any suitable application server computer such as an ibm personal computer , ibm rs - 6000 computer , or ibm mainframe . also , in the preferred embodiment , the java application programming interface (โ€œ api โ€) for xml parser for sax is adopted . sax is the parser module available from sun microsystems . simple api for xml (โ€œ sax โ€) is an industry standard method parsing xml documents one element at a time , instead of loading the entire xml document into system memory and processing the file completely from beginning to end . as will be seen in the following disclosure , this feature of the sax parser helps achieve the decoupling and multithreading advantage of the system and method . the database targeted by the xml loader in the preferred embodiment is the ibm db2 version 7 . 0 database . and , according to the preferred embodiment , file transfer protocol (โ€œ ftp โ€) is used to deliver xml files to the xml data loader over a computer network . however , it will be recognized by those skilled in the art that alternate programming languages , parser technologies , xml file transfer technologies and database api &# 39 ; s may be adopted without departing from the scope of the invention . turning to fig3 the system configuration of the preferred embodiment is disclosed , which comprises an application server hardware platform ( 31 ), such as an ibm personal computer , an rs - 6000 workstation , or ibm mainframe . the application server ( 30 ) preferably includes a set of user interface devices ( 32 ), such as a keyboard , monitor , and mouse . the application server ( 30 ) is also provided with system memory ( 300 ), such as random access memory (โ€œ ram โ€) and hard drive space , as well as a network interface card (โ€œ nic โ€) ( 33 ) to a computer network ( 34 ) for reception the xml files to be loaded via the file transfer protocol (โ€œ ftp โ€) ( 36 ). the application server ( 30 ) is also preferably provided with an operating system ( 35 ) such as windows nt , windows 2000 , ibm aix , or os - 2 , or other suitable multitasking multithreaded operating systems . because of the preferred implementation using java , the choice of operating systems is somewhat inconsequential as long as the operating system supports execution of java modules . additionally , the system is may be provided with any necessary non - portable application programs ( 37 ), such as a tcp / ip protocol stack or an ftp communications program , as well as a java interpreter ( 38 ) in order to allow it to run multiple java applets and / or servlets ( 39 ). the remaining architecture and implementation of the invention is accomplished in several java objects and classes , as described in more detail in the following disclosure . turning to fig4 ; the processing flow implemented by the java software executed on the application server platform is shown . in the preferred embodiment , the xml files are received via file transfer protocol through an ftp receptor ( 41 ). alternatively , these files could be loaded onto the system using computer - readable media , or through another suitable network file transmission scheme . a thread of the sax xml parser ( 42 ) is instansiated to process the recently received xml file into xml elements . the operator class ( 44 ) is called for each xml element to be processed . the operator class is used to store the attributes and child elements for the registered elements . this class returns the vector of sql statements it generates , which are later used to update the database according to the xml data . the operator class ( 44 ) may have one or more operator plugins ( 45 ) which provide code specific for parsing xml elements for specific xml document types according to their dtd files , and for generating appropriate database api commands for those data elements . for example , one operator plugin may be provided to generate sql commands for xml computer parts catalog pages . another operator plugin may be provided to generate sql commands for computer software specifications . each plugin is called according to an xml document &# 39 ; s dtd . the operator ( 44 ) generates database api commands , preferably sql commands , in response to examination of the xml elements from the xml parser ( 42 ). the vector full of sql commands is placed into an sql queue ( 46 ) for reception by the sql processor threads ( 47 ), which execute the sql commands . the sql processor threads ( 47 ) may retrieve the queued sql commands as they are ready for additional commands to execute in real - time . by executing the queued sql commands the sql processor threads ( 47 ) update the database ( 48 ). as can be seen in this diagram , the main stages of the invention , namely the sax xml parser with the operator class , and the sql processor , are separated by the sql queue ( 46 ), which allows them to run asynchronously and independently from each other . this decouples the processes in the processing timeline , which allows them to proceed at their fastest natural rate . it also allows for each process to release it &# 39 ; s allocated system resources such as system memory as soon as it can complete , even though processes or threads downstream are not yet complete . further , the adoption of the use of the sax xml parser allows for the first element found in the xml file to be immediately received the operator ( 44 ). as soon as the operator ( 44 ) generates the first sql command and places that into the sql queue ( 46 ), that command falls through the queue to be received immediately by the sql processor ( 47 ). thus , rather than in the process currently in use where the xml parsing of the entire file is completed before the sql command generation is even started , the processes of the present invention are executed simultaneously in parallel in the system . turning to fig5 the timeline associated with the completion of loading an xml file into the database according to the invention is shown . as can be seen from this figure , many of the processes run in parallel and are decoupled from each other via the queues . the parsing of the xml into elements ( 51 ) yields an element almost immediately after the beginning of the process by using the sax method . thus , when the first element is found and parsed , it is available for the sql command generator to receive . then , as the generation of the sql ( 53 ) yields the first sql command to be executed , the sql command is placed in the sql command queue ( 54 ). this sql command will immediately fall through the empty queue on the first entry , and will be received by the waiting sql execution thread where it will then be implemented ( 55 ). thus , a high degree of parallelism is achieved which minimizes the time from the very beginning of the parsing of the first element of the xml files to the completion of the execution sql commands to update the database . the system and method of the present invention achieves a fast and extendible process , having the following components : ( a ) a loader , which is adapted to parse the xml file and determine which operator extension ( s ) to call to determine the appropriate database command statements ; ( b ) an operator , which comprises extendable object classes , java classes , that generate the appropriate database command statements ; and ( c ) a database updater , which is a multi - threaded java program adapted to update a database by executing the generated database command statements . as previously mentioned , sql database command statements are generated to update an ibm db2 database in the preferred embodiment , but alternate database api &# 39 ; s and databases can be equally well adopted for the invention . the loader can parse any xml file , according to its companion dtd file . the parser technology preferably used is a sax process , such as sun microsystem &# 39 ; s sax3 , available as an object , which parses one element in the xml file at a time as opposed to the dom process of parsing the entire xml file before yielding any results . this allows for each individual element to be processed immediately by the operator , as opposed to waiting for the extire xml file to be parsed before starting the database command generation . once an xml element is read from the xml file , all of the attributes of the element are stored in a hashtable in memory . once parsed , the program can determine which operator extension to call based on the element type retrieved out of the xml file . the sql statements are input into the sql queue , where they may be retrieved by the database updater and executed in order to update the database . meanwhile , the loader is free to be processing the next element in the xml file . the operator class is used to realize an extendable architecture . whenever a new xml format is defined in a new dtd file , an appropriate operator class is created . this class will be able to read a hashtable full of the attributes associated with the xml dtd format and generate the appropriate sql statements . this allows for an unlimited number of xml file formats to be processed by the system by extending the architecture through inclusion of additional operator plugins . the database updater executes the queued sql statements in order to update and load the data into the database . since the database updater is preferably developed for a multi - threaded java environment , many updates to the database can be accruing simultaneously while the xml file is still being parsed by the parser , and while the operator is generating sql statements . during system configuration , an administrator may preferably set a maximum number of threads to be executed at any given time , in order for the application to be tailored to the environment or platform on which it is being executed . typically , platforms equipped with more powerful processors or multiple processor can support more threads since they have more memory and faster processors . it will be recognized by those skilled in the art that many variations and alternates may be adopted from the illustrative examples and preferred embodiment as disclosed herein without departing from the spirit and scope of the invention . such variations may include , but are not limited to , adoption of alternate markup language standards , alternate parsing methods , alternate programming languages , alternated hardware platforms and operating systems , and alternate databases and database api &# 39 ; s . therefore , the scope of the invention should be determined by the following claims .
8
fig1 shows a valve unit 1 provided with a drive motor 2 and a gear mechanism 3 , ( illustrated in detail in fig2 ) and with a bearing 5 disposed eccentrically on a journal 4 as a coupling , which is connected coactingly with a valve rod 6 , for moving a valve disk 7 to an open position . valve unit 1 is further provided with an outlet port 8 and an inlet port 9 constructed as the valve seat . for return of the valve disk to its closed position when the drive motor 2 is deactivated , a spring element 10 , engages a guide member 11 fixed securely on valve rod 6 to urge valve rod 6 in the direction of bearing 5 . the guide member 11 ensures that valve rod 6 can also be moved in the closing direction in response to reversal of the direction of rotation of the drive unit . in this way , valve disk 7 can be freed from a jammed or stuck position . for this purpose , guide member 11 is provided with cam elements 12 acting on the bearing , one in vertical direction and the other in horizontal direction . a housing plate 13 is disposed above drive unit 2 , for mounting an operational on - board electronic module thereon . fig2 shows in greater detail gear mechanism 3 with bearing 5 disposed eccentrically above a bearing journal 4 . gear mechanism 3 is in the form of a planetary stationary gear mechanism , in which there are driven , by an input shaft 15 , which is connected to drive motor 2 , three non - revolving planetary gears 16 , which in turn drive a ring gear 17 , on the side of which remote from drive motor 2 there is disposed bearing journal 4 with bearing 5 . a particular compact construction is achieved when ring gear 17 carries a co - rotating diametral annular magnet , which cooperates in known manner with a hall - effect sensor , so that the valve stroke can be determined in simple manner from the rotary movement of the ring gear . further illustrated is a cover 18 , which , as an alternative to the aforesaid hall - effect sensor , can be provided with a sensor 19 , which in known manner senses the linear position of the valve stroke . also provided is a connection plug 20 , to establish electrical contact between sensor 19 and motor 2 . the connecting plug 20 includes plug contact elements which are connected with drive motor 2 , so that electrical control of valve unit 1 is obtained . for simplicity of assembly , a housing 21 of valve unit 1 is constructed in the region of drive motor 2 as a tunnel housing . fig3 shows a sectional view of drive unit 2 with cover 18 in place . as already discussed hereinabove , cover 18 is provided with plug contact elements 22 , which cooperate with cover contact elements 23 of drive motor 2 . in this way , electrical contact can be established in simple manner by the mounting of cover 18 . fig4 shows a sectional view including an exhaust - gas return unit 24 according to the invention . the exhaust - gas return unit is integrated with valve unit 1 and is provided with a combustion - air intake - channel 25 and with an exhaust - gas inlet portion 26 . according to the invention , the exhaust - gas inlet 26 is equipped with a discharge portion 27 , which is disposed coaxially relative to combustion - air intake - channel 25 and which is connected via a connecting channel 28 , disposed transversely relative to discharge portion 27 , to a channel 29 in valve 1 . connecting channel 28 is provided with an outwardly projecting channel attachment 30 , which is closed by a plug insert 31 . this construction provides a space - saving arrangement as well as manufacture in one piece . it is advantageous if the valve - channel portion 29 forms a connecting nozzle 32 for an exhaust - gas return line ( not illustrated ), the connecting nozzle 32 being provided with a valve seat 33 , which cooperates with valve disk 7 fastened to valve rod 6 and disposed coaxially relative to valve - channel portion 29 . it is further provided that valve rod 6 is guided in a valve guide bushing 34 , which projects at one end into valve - channel portion 29 and at the other end into a valve spring chamber 35 , valve rod 6 being provided on the portion which projects into valve spring chamber 35 with guide member 11 , on which engages spring element 10 , whose other end is braced against wall 36 of the valve spring chamber 35 . in a particular space - saving construction , valve spring chamber 35 is sealed off from the outside by housing 21 which simultaneously forms the housing of the gear mechanism and drive unit . the valve spring chamber 35 can be connected to the atmosphere by a vent hole ( not illustrated ). advantageously the valve guide bushing 36 is equipped with a dirt chamber 37 . because valve disk 7 can be provided with a cylindrical portion ( not shown ) downstream from valve seat 33 , an advantageous characteristic of exhaust gas flow in the exhaust gas return line can be achieved and , because valve disk 7 is provided with a taper edge 38 , which cooperates with a taper portion 39 of valve seat 33 to form a diffusor portion 40 , a smaller size valve - disk can be employed , which needs smaller size positioning forces , since delivery pressure recovery is achieved in the diffusor . although the invention is disclosed with reference to particular embodiments thereof , it will become apparent to those skilled in the art that numerous modifications and variations can be made which will fall within the scope and spirit of the invention as defined by the attached claims .
5
the sawtooth oscillator shown in fig1 forms part of a semiconductor body wherein all components of the oscillator , a resistor r and a capacitor c excepted . are integrated and which is represented within a dotted line . resistor r and capacitor c constitute a series arrangement provided between the terminals of a supply voltage source v b . a terminal 1 of the semiconductor body is connected to the junction of resistor r and capacitor c whereas a terminal 2 is connected to the positive terminal and a terminal 3 to the negative terminal of source v b and also to ground . terminal 1 is connected to the base of a transistor 5 via an emitter follower transistor 4 . it should be noted that the transistors of the figures , some transistors mentioned hereafter excepted , are of the npn type . transistor 5 forms a comparison stage together with a further transistor 6 . to this end the emitters are interconnected and connected to the collector of a transistor 7 which , in conjunction with an emitter resistor 8 , operates as a constant current source . the base of this transistor is connected to the base and to the collector of a transistor 9 and also to a resistor 10 whose other end is connected to voltage v b . the emitter of transistor 9 is connected to ground via a resistor 11 . also that terminal of resistor 8 which is not connected to the emitter of transistor 7 is connected to ground . a resistor 12 is arranged in parallel with the base - emitter diode of transistor 5 to improve the turn - off properties of transistor 4 . the series arrangement of three resistors 13 , 14 and 15 is included between terminals 2 and 3 . the junction of resistors 13 and 14 which , in operation , carries a voltage v 1 is connected to the base of a transistor 16 whereas the junction of resistors 14 and 15 which , in operation , carries a voltage v 2 which is lower than voltage v 1 is connected to the base of a transistor 17 . the emitter of transistor 17 is connected directly to the base of transistor 6 and to the emitter of transistor 16 via two series - arranged resistors 18 and 19 whereas the collectors of transistors 4 , 16 and 17 are connected to voltage v b . the collector of transistor 6 is connected to the bases of two pnp transistors 20 and 21 the emitters whereof are connected to voltage v b . transistors 20 and 21 form a current mirror carrying over collector current variations of transistor 6 . in a similar manner the collector of transistor 5 is connected to the bases of two pnp transistors 22 and 23 the emitters whereof are connected to voltage v b . the collector and the base of transistors 20 and 22 , respectively , are interconnected . the collector of transistor 21 is connected to the base and to the collector of a transistor 24 and also to the base of a further transistor 25 . the emitters of transistors 24 and 25 are connected to ground . the collectors of transistors 23 and 25 are interconnected via two series - arranged resistors 26 and 27 . the collector of transistor 25 is also connected to a resistor 28 and to the base of a transistor 29 . the other terminal of resistor 28 and the emitter of transistor 29 are connected to ground , whereas a resistor 30 is included between the collector of this transistor and terminal 1 . a base resistor 31 of a transistor 32 is connected to a junction p of resistors 26 and 27 and a collector resistor 33 of transistor 32 is connected to the base of transistor 6 . the collector of a transistor 34 is also connected to point p . a resistor 35 is connected between the collector of transistor 23 ( identified as point q ) and the base of transistor 34 and the series arrangement of two resistors 37 and 38 is arranged between point q and the base of a further transistor 36 . the collector of transistor 36 is connected to the base of transistor 34 . a base resistor 39 of a transistor 40 is connected to the junction m of resistors 37 and 38 whereas a collector resistor 41 thereof is connected to the junction of resistors 18 and 19 . the emitters of transistors 32 , 34 , 36 and 40 are connected to ground . finally , point m is connected via a separating resistor 42 to a terminal 43 to which a synchronizing signal source 45 , which may also form part of the same semiconductor body as the described oscillator , can be connected via a coupling capacitor 44 . during operation a sawtooth shaped voltage v c is available at terminal 1 . to this end capacitor c is charged by a current flowing through resistor r . voltage v c increases in a substantially linear manner . the current through resistor r is assumed to be substantially constant , which is justified if the value of the resistor is comparatively high . as long as voltage v c is lower than voltage v 1 transistors 4 and 5 remain cut off , whereas transistor 6 conducts . the base current thereof is the emitter current of transistor 16 which operates as an emitter follower . because this current is small the voltage at the base of transistor 6 is substantially equal to v 1 - v be , v be being the substantially constant threshold voltage of a conducting base - emitter diode , in this case the base - emitter diode of transistor 16 . the constant collector current of transistor 7 is the emitter current of transistor 6 . transistors 20 , 21 and 24 also conduct . because transistor 5 is non - conducting , transistors 22 and 23 are also non - conducting . the base voltage of transistor 25 is low because of transistor 24 being conductive , so that also transistor 25 is cut - off . also transistors 29 and 32 are cut off . if no synchronizing signal is applied to terminal 43 the voltage at point m is too low for transistors 36 and 40 to conduct , so that transistor 34 is also non - conducting . transistor 17 , whose emitter voltage exceeds the base voltage , is cut off . at an instant which is determined , with respect to the starting instant of the charging process , by the time constant of the network formed by elements r and c , voltage v c reaches the value v 1 . this means that the voltage at the base of transistor 5 is equal to v 1 - v be and , consequently , equal to the voltage at the base of transistor 6 . in these circumstances transistors 4 and 5 start conducting , so that also transistors 22 and 23 conduct , whereas the emitter current of transistor 6 decreases . current flows through resistors 26 , 27 and 28 and the voltage at point p increases . as soon as this voltage has reached the value v be transistor 32 becomes conductive . since transistor 23 now conducts a current can flow to the base of transistor 36 through resistors 37 and 38 , which renders transistor 36 conductive while the voltage at point m is positive . the collector current of transistor 36 flows through resistor 35 so that the voltage at the collector is kept at a very low value . this collector current is much higher than the current which would flow to the base of transistor 34 through resistor 35 if this transistor would have become conductive at said instant , so that it is ensured that transistor 34 remains cut off and does not prevent transistor 32 from becoming conductive . the collector currents of transistors 20 , 21 and 24 decrease , which causes transistor 25 to conduct . this transistor maintains transistor 29 cut off . the collector current of transistor 32 flows through resistors 18 , 19 and 33 so that the voltage at the base of transistor 6 decreases , causing a further decrease of the emitter current thereof and a further increase of the emitter current of transistor 5 . from this it is apparent that the described effect is cumulative and results in a very rapid cut off of transistor 6 and , consequently , of transistors 20 , 21 , 24 and 25 . the voltage at the base of transistor 29 was substantially zero because of the fact that transistor 25 was conducting . at the instant at which this voltage , after voltage v c has reached the value v 1 , reaches the value v be transistor 29 is made conductive by a current flowing through resistor 27 . capacitor c discharges and voltage v c decreases in a substantially linear manner with a time constant which depends on the values of elements r , c and 30 , at the condition that the charging current flowing through resistor r is smaller than the collector current of transistor 29 . resistors 18 , 19 and 33 have been chosen so that the voltage at the base of transistor 6 would decrease to below the value v 2 - v be , because of the fact that transistor 32 becomes conductive . however , due to the fact that transistor 17 then becomes conductive , said voltage cannot decrease further . finally , transistor 40 is supplied with a base current through resistors 37 and 39 as a result of which the transistor remains conductive , so that its collector current causes a further decrease of the voltage at the junction of resistors 18 and 19 . because the voltage at the base of transistor 6 is clamped at the value v 2 - v be by transistor 17 the fact that transistor 40 conducts has no influence thereon . the described situation of the circuit of fig1 is maintained during discharging of the capacitor c . any positive synchronizing pulse occurring in this period of time would not have any effect since it would not change the state of transistors 36 and 40 . at the instant at which voltage v c reaches the value v 2 the voltages at the bases of transistors 5 and 6 become equal . transistor 6 , and , consequently , also transistors 20 , 21 and 25 start conducting whereas the emitter current of transistor 5 decreases . because of the fact that transistor 25 conducts transistor 29 is cut off , causing the discharge of capacitor c to stop and voltage v c to increase again . since transistor 5 conducts to a lesser extent , also transistors 22 and 23 conduct to a lesser extent so that the voltages at point p and q decrease , causing a decrease of the collector current of transistor 32 and , consequently , an increase of the voltage at the base of transistor 6 , in response to which the emitter current of transistor 6 increases still further . so this effect is cumulative and causes transistors 4 , 5 , 22 , 23 , 25 and 32 to be cut off very rapidly . because of the increasing voltage at the base of transistor 6 also transistor 17 is cut off so that said voltage assumes approximately the value v 1 - v be . also transistors 36 and 40 are cut off because of the voltage at point q becoming zero . the foregoing shows that the circuit of fig1 behaves , in the absence of a synchronizing signal , as a free - running sawtooth oscillator which generates a sawtooth shaped voltage v c at terminal 1 . this voltage which is plotted in fig2 a as a function of the time , varies between two substantially constant values v 1 and v 2 . the period t of the free oscillation and , consequently , the free - running frequency f = 1 / t is determined by the values of voltages v 1 and v 2 and by the values of the above - mentioned time constants , the nominal frequency of the synchronizing pulses being chosen for this free - running frequency , furnishing the above - mentioned advantages . if , for example , the oscillator of fig1 is the field oscillator in a television receiver 50 hz is chosen for f ( european standard ). the same circuit can be used for the line oscillator the elements being dimensioned for f = 15 , 625 hz ( european standard ). in practice both circuits will be implemented in an identical or substantially identical manner , however with the exception of the external components r and c . in spite of the fact that the oscillator has the nominal frequency it must be possible to synchronize it . this is necessary during starting - up of the receiver after actuation thereof . frequency changes may also occur , at the transmitter side , for example when switching the receiver to another transmitter , as well as at the receiver side , for example owing to tolerances , ageing of components etc . in addition , should the free - running frequency of the oscillator increase to above the nominal frequency , for example because the charging current of capacitor c has become larger and , consequently , the rising edge of the sawtooth shape in fig2 a has become steeper , it would not be possible to synchronize the oscillator as a synchronizing pulse would not be produced until after reversal of the sawtooth and could , consequently , not exert any influence . if a synchronizing signal is present at terminal 43 the voltage at point m is continuously determined after the occurrence thereof by this signal . for positive going pulses this voltage assumes a certain value during the brief occurrence thereof , whereas it assumes a lower value for the rest of the period of the synchronizing signal . the amplitude of the synchronizing pulses and the values of resistors 38 , 39 and 42 are chosen so that the lower value of the voltage at point m does not affect the state of transistors 34 , 36 and 40 whereas the higher voltage value does affect the state of these transistors . said transistors remain cut off during the rising edge of the sawtooth of fig2 a . if a synchronizing pulse occurs while voltage v c has not yet reached the value v 1 then the voltage at point m assumes its higher value . this causes transistor 40 , whose collector resistor 41 is connected to a positive voltage , to become conductive whereas transistors 34 and 36 , whose collectors do not carry a voltage , do not pass a collector current . because of the collector current of transistor 40 flowing through resistors 18 and 41 the voltage drop across resistor 18 becomes higher , so that the voltage at the junction of resistors 18 and 19 is decreased for a short period of time , namely to a value v &# 39 ; 1 which is determined by the ratio of the values of resistors 18 and 41 and is located between v 1 - v be and v 2 - v be . if this value is lower than or equal to the value of voltage v c at the same instant , reduced by v be then transistors 4 and 5 , which were cut off , become conductive so that the falling edge of the sawtooth is very rapidly initiated . if , on the contrary , voltage v &# 39 ; 1 is higher than the instantaneous value of v c - v be , the synchronizing pulse has no influence and voltage v c continues to increase . so the value v &# 39 ; 1 determines the time interval t 1 after the starting instant of the rising edge whereas and whereafter the oscillator of fig1 can be synchronized by a synchronizing pulse . fig2 b shows the case that the pulse , indicated by means of an arrow , occurs after interval t 1 but prior to the instant at which voltage v c reaches the value v 1 . in this case the repetition frequency of the synchronizing pulses is higher than the natural , free - running frequency of the oscillator . if a synchronizing signal is indeed present but a pulse has not yet occurred after interval t 1 at the instant at which voltage v c reaches the value v 1 then , as stated above , transistors 4 , 5 , 22 , 23 and 25 become conductive . the voltage at point m still has its lower value so that transistors 36 and 40 which , in the absence of the synchronizing signal , would be driven and kept conductive by a current flowing through resistor 37 will now remain in the cut off state . however , a current flows from point q to the base of transistor 34 through resistor 35 so that transistor 34 is driven into conduction . because the collector resistor 26 of this transistor is connected to the positive voltage prevailing at point q , the voltage drop across this resistor causes the voltage at point p to become substantially zero . consequently , transistors 25 , 29 and 32 remain cut off which results on the one hand in that voltage v c continues to increase and comes above the value v 1 and on the other hand that the voltage at the base of transistor 6 keeps the value v 1 - v be . at the instant at which a synchronizing pulse occurs the voltage at point m increases to above the value , i . e . approximately v be , at which transistors 36 and 40 become conductive . the voltage at the collector of transistor 36 becomes substantially zero so that transistor 34 is cut off . the voltage at point p becomes positive and transistors 29 and 32 also start conducting , which initiates the discharge of capacitor c , whereas the voltage at the base of transistor 6 assumes the value v 2 - v be . it should be noted that the voltage at the junction of resistors 18 and 19 briefly assumes the value v &# 39 ; 1 but this is of no importance as the voltage at the base of transistor 6 keeps the value v 2 - v be during the entire discharge of capacitor c . fig2 c shows the case described above , the frequency of the synchronizing pulses being lower than the free - running frequency of the oscillator . the same situation may occur if one synchronizing pulse is produced within interval t 1 and one after voltage v c has assumed the value v 1 , while the frequency of the pulses is not below the natural frequency of the oscillator . if no synchronizing pulse occurs after voltage v c has exceeded the value v 1 , voltage v c continues to increase . this is shown in fig2 c by means of a dashed line . the final value of voltage v c is voltage v b and a free change - over of the oscillator does not take place . this may be undesirable for many applications , for example for television , where the deflection would stop . this is prevented in fig1 by a capacitor 44 provided between the source 45 of the synchronizing signal and terminal 43 . owing to the presence of capacitor 44 there is present at the terminal 43 a d . c . voltage which is equal to the average value of the pulse - shaped signal generated by source 45 and which is , consequently , zero in the absence of this signal . this d . c . voltage is too low to render transistors 36 and 40 conductive . at the instant at which voltage v c reaches the value v 1 , transistor 23 starts conducting and a charging current flows to capacitor 44 via resistors 37 and 42 . this causes the voltage at terminal 43 to increase until transistor 36 becomes conductive , which causes the change - over of the oscillator . the choice of the time constant of the network formed by resistors 37 and 42 and capacitor 44 determines the instant and , consequently , the threshold value above v 1 at which this change - over is effected , whereafter the capacitor discharges via resistors 42 , 38 and 39 to the average value of the synchronizing signal . the circuit of fig3 does not require a coupling of source 45 by means of a capacitor 44 having a value chosen as explained above . a large portion of the circuit in fig3 has not been altered with respect to fig1 and the same elements have been given the same reference numerals . in fig3 the resistor 13 of fig1 has been replaced by the series arrangement of two resistors 13 &# 39 ; and 13 &# 34 ; at the junction whereof a voltage v 3 is present during operation which is higher than the voltage v 1 present at the junction of resistors 13 &# 34 ; and 14 . the first - mentioned junction is connected to the base of a transistor 46 whose collector is connected to voltage v b and whose emitter is connected to the base of a transistor 48 via a resistor 47 . transistor 48 constitutes together with a further transistor 49 a comparison stage . to this end the emitters are interconnected and connected to a current source 50 . the collector of transistor 49 is connected to voltage v b whereas the collector of transistor 48 is connected to the bases of two pnp transistors 51 and 52 whose emitters are connected to voltage v b . the collector of transistor 51 is connected to the base thereof and the collector of transistor 52 is connected to a resistor 53 and to the base of a transistor 54 . the other terminal of resistor 53 and the emitter of transistor 54 are connected to ground , while the collector thereof is connected to the emitters of transistors 34 and 36 , which are not connected to ground as is the case in fig1 . finally , the oscillator of fig3 comprises a transistor 55 whose emitter is connected to ground , whereas the collector is connected to the base of transistor 48 via a resistor 56 and the base to point m via a resistor 57 . as long as voltage v c is lower than voltage v 1 transistor 48 conducts while transistors 49 and 55 are cut off so that also transistors 51 , 52 and 54 conduct . the emitters of transistors 34 and 36 have substantially the ground potential . this is the situation already described hereinbefore in which voltage v c continues to increase . in the absence of a synchronizing signal transistor 55 becomes conductive because of a current through resistors 37 and 57 at the instant at which voltage v c reaches the level v 1 so that the voltage at the base of transistor 48 , which had substantially the value v 3 - v be , is decreased . the values for resistors 47 and 56 have been chosen so that the new value of said voltage is lower than the value v 1 - v be , so that transistors 48 , 51 , 52 and 54 are rendered non - conductive in the cumulative manner described hereinbefore , resulting in that the emitters of transistors 34 and 36 are no longer connected to ground and that these transistors are also cut off . the voltage at point p becomes positive which causes transistors 29 and 32 to become conductive and , consequently , initiates the discharge of capacitor c to voltage v 2 in the manner as was the case in fig1 . if a synchronizing signal is present at terminal 43 a pulse , produced after an interval determined in the same manner as t 1 in fig2 b and prior to voltage v c becoming equal to v 1 , causes the oscillator to change - over in the same manner as described in the preceding paragraph . if the pulse has not yet occurred at the instant at which voltage v c becomes equal to v 1 then transistors 36 and 55 remain cut off because the voltage at point m is low , while transistor 34 is rendered conductive by a base current flowing through resistor 35 . the voltage at point p is zero , which keeps transistors 29 and 32 in the cut off condition . voltage v c continues to increase until a synchronization pulse occurs or until the value v 3 is reached . in the latter case the voltages at the bases of transistors 48 and 49 become equal to one another , which causes transistor 49 to start conducting , resulting in the change - over of the oscillator . because the variant of fig3 does not require a coupling capacitor between source 45 and terminal 43 , the latter can be wholly dispensed with in the case that also source 45 , for example a synchronizing pulse separator , forms part of the semiconductor body wherein the described sawtooth oscillator is integrated . in fig1 transistor 36 has for its purpose to prevent transistor 34 from becoming conductive , which transistor would prevent the oscillator from changing - over at v c = v 1 , namely in the absence of a synchronizing signal or in the presence thereof , if a synchronizing pulse has not yet occurred at v c = v 1 . transistors 36 and 54 have the same task in fig3 . transistor 36 or transistors 36 and 54 establish the presence of the synchronizing signal and ensure that level v 1 can be exceeded if necessary . if no synchronizing signal is present at terminal 43 capacitor c is charged and voltage v c increases , as shown in fig2 a , to the value v 1 . if the signal has still not occurred at the instant that voltage v c reaches said value v 1 the oscillator changes - over . if , on the contrary , a synchronizing signal has arrived prior to that instant and if a pulse occurs the oscillator changes over as shown in fig2 b . in the nominal state of the oscillator as well as the synchronizing pulses , wherein the natural frequency of the oscillator is equal to the repetition frequency of the pulses , the subsequent change - over of the oscillator will take place as shown in fig2 a , that is to say after a period of time t . in practice this condition will be deviated from so that the subsequent change - over takes place either again as shown in fig2 b or as shown in fig2 c , in which case the value v 1 is exceeded by voltage v c . in the foregoing one of the threshold voltages is , as it were , shifted to another value in the case a synchronizing pulse could be expected from a certain instant but has not yet occurred at the instant at which v c = v 1 . this causes the amplitude of the sawtooth to be increased and , consequently , the natural frequency of the oscillator to be reduced . this reduction can be effected in the manner outlined in fig2 d . the above - mentioned amplitude , that is to say the difference between voltages v 1 and v 2 remain substantially constant in all circumstances , whereas one of the slopes , preferably the slope of the rising edge , of the sawtooth can be subjected to a change . if no synchronizing signal is present at the starting instant of a charging period then capacitor c is charged by a current having a certain value . if , during charging , the presence of a synchronizing signal , for example in the manner described with reference to fig1 and 3 , is ascertained then the charging current gets a lower value at the same instant , so that the rising edge of the sawtooth becomes less steep . this corresponds to a lower natural frequency of the oscillator . at the occurrence of the synchronizing pulse the oscillator changes over in the manner described above , whereafter a new charging period starts , the charging current having its lower value if the synchronizing signal is still present . the foregoing can be effected by replacing resistor r by , for example , the series arrangement of two resistors one of which can be short - circuited by a transisor in the situation that no synchronizing signal is present . alternatively , resistor r can be replaced by a real current source , implemented with transistors and resistors and which can assume two values . it will be clear that in the case of fig2 d the charging device of capacitor c will preferably be included in the semiconductor body . it should be noted that with this implementation , which is not further described in detail , a sawtooth is produced in accordance with fig2 d which has at least one bend . however , this need not be a drawback : such a distortion may be permissible for some applications . an example thereof is the field deflection in television receivers wherein the actual field oscillator , whose signal has a constant amplitude and is amplified by a power amplifier before it is supplied to a deflection coil , is supplied with the signal originating from a sawtooth generator synchronizable by synchronizing pulses , which generator may be the generator according to the invention . fig4 shows in broad lines another possible use of the circuit according to the invention . the figure relates to a circuit for the indirect line synchronization in a television receiver wherein received line synchronizing pulses and pulses generated by a line oscillator osc 1 are compared in a phase discriminator ฯ† 1 . discriminator ฯ† 1 converts a phase difference it has ascertained into a control voltage which , after having been smoothed by a low - pass filter f 1 is applied to oscillator osc 1 . the pulses thereof , which have approximately the proper frequency and the proper phase with respect to the line synchronizing pulses are applied to a second phase discriminator ฯ† 2 wherein they are compared with the pulses originating from the line output stage h . after having been smoothed by a second low - pass filter f 2 the output voltage of discriminator ฯ† 2 arrives at a pulse shaper imp which is supplied with the pulses originating from osc 1 . the pulses of pulse shaper imp synchronize a sawtooth oscillator osc 2 , which is implemented as shown in fig1 or fig3 and the sawtooth voltage generated thereby is applied to stage h wherein it is converted into a switching signal which is applied to a line output transformer . a deflection coil , not shown , for the horizontal deflection is connected to this transformer . the principle of such a double loop for the indirect line synchronization and the operation thereof are extensively described in the u . s . pat . no . 3 , 891 , 800 wherein the output voltage of the second phase discriminator directly influences the second oscillator while a pulse shaper to which signals of the first oscillator might be applied is fully dispensed with . the operation of the second loop ensures that the influence of variations of the load at the stage h are largely eliminated . whereas the first oscillator is controlled in dependence on the frequency and on the phase of the synchronizing pulses the second oscillator is controlled in dependence on the phase of the pulses at line frequency , produced in stage h . the second loop introduces by nature a small phase error owing to the fact its gain is not infinite . if now the second synchronization loop is implemented as shown in fig4 this error is reduced without the necessity of increasing the loop gain , which might result in instability . to this end pulse shaper imp generates pulses of the same frequency as the pulses generated by oscillator osc 1 , the phase position of one edge , for example the leading edge , of each pulse of the stage imp being controlled by the control voltage originating from filter f 2 . thereafter this edge synchronizes oscillator osc 2 . in this manner it is ensured that the sawtooth generated by oscillator osc 2 has always the proper frequency , namely the frequency of oscillator osc 1 , and the phase determined by the second loop . the only error then remaining is caused by the not - infinite sensitivity of discriminator ฯ† 2 , while oscillator osc 2 , as it is not controlled but synchronized by a pulse edge , does not introduce a phase error .
7
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . with reference to fig1 , a shifter assembly is generally indicated by reference number 10 and is illustrated in a neutral , energized position , as will be described below . the shifter assembly 10 is employed within a motor vehicle ( not shown ). the shifter assembly 10 is controlled by an operator of the motor vehicle to select one of a plurality of shift positions . each of the shift positions corresponds to an operating mode of a transmission ( not shown ) associated with the shifter assembly 10 and the motor vehicle . in the example provided , the shifter assembly 10 includes a park ( p ), reverse ( r ), neutral ( n ), and drive ( d ). it should be appreciated that the number of shift positions , as well as the associated transmission operating mode , may vary without departing from the scope of the present example . for example , the shifter assembly 10 may also include manual modes m , m +, and m โˆ’ and / or high gear and low gear operating modes . the shifter assembly 10 generally includes a shifter lever 12 having a support collar 14 . the shifter lever 12 is connectable to a shift knob ( not shown ) that is useable by an operator of the motor vehicle . the support collar 14 is pivotally mounted to a shifter housing 16 at a ball bearing or pivot point 17 . the shifter housing 16 encloses and protects the components of the shifter assembly 10 . the shifter lever 12 and support collar 14 are capable of pivoting or rotating about a pivot axis 18 at the pivot point 17 . the support collar 14 includes detent arms 14 a , 14 b that engage a plurality of detents 19 located on an inner surface 20 of the shifter housing 16 . the detents 19 are positioned in the shifter housing 16 to provide a mechanical detent to each of the plurality of shift positions of the shifter lever 12 and support collar 14 . a button lock mechanism 22 is connected to the shifter lever 12 . the button lock mechanism 22 prevents the shifter lever 12 and the support collar 14 from pivoting to the park position from the neutral position , as will be described below . the button lock mechanism 22 includes a button lock 24 disposed within the shifter lever 12 . the button lock 24 is depressible within the shifter lever 12 , i . e ., the button lock 24 is translatable along an axis 25 of the shifter lever 12 . the button lock 24 includes a first lock arm 24 a and a second lock arm 24 b . the first lock arm 24 a extends out through a first window 26 a disposed in the support collar 14 . the second lock arm 24 b extends out through a second window 26 b disposed on an opposite side of the support collar 14 than the first window 26 a . each of the first and second lock arms 24 a , 24 b are configured to selectively engage detent gates 30 ( only one of which is shown ) on each side of the shifter lever 12 . the detent gates 30 are mounted to the shifter housing 16 . the detent gates 30 have a stepped face 32 that limits movement of the shifter lever 12 from the neutral position to the park position . for example , in a rest state where the operator of the motor vehicle 12 is not depressing the lock button 24 , the lock button 24 is biased upwards by any suitable biasing member ( not shown ), such as a coil spring , to a first position . when the lock button 24 is not depressed , the lock arms 24 a , 24 b are also in the first position where each of the lock arms 24 a , 24 b engage the stepped face 32 of the detent gates 30 , thus preventing the shifter lever 12 from moving from the neutral position to the park position . when the lock button 24 is depressed , the lock arms 24 a , 24 b move downwards to a second position away from the detent gates 30 and do not engage the stepped face 32 , thus allowing the shifter lever 12 to move from the neutral position to the park position . the shifter assembly 10 further includes a pawl lock mechanism 34 . the pawl lock mechanism 34 selectively prevents the shifter lever 12 and support collar 14 from moving between the park and neutral positions while simultaneously preventing the lock button 24 from being depressed from the first position to the second position . the pawl lock mechanism 34 includes a pawl 40 actuated by an actuator 42 . turning now to fig2 , the pawl 40 includes a first end 44 and a second end 46 opposite the first end 44 . the pawl 40 is pivotally mounted to the shifter housing 16 at a pivot point 48 . the pivot point 48 is disposed between the first end 44 and the second end 46 of the pawl 40 . the pawl 40 pivots about an axis 50 . the axis 50 is perpendicular to the pivot axis 18 of the shifter lever 12 and support collar 14 . the first end 44 of the pawl 40 includes a first portion or tab 52 and a second portion or blocker 54 . the tab 52 is oriented perpendicular to the blocker 54 and extends from the blocker 54 toward the support collar 14 . the tab 52 is configured to engage a slot 56 defined in the support collar 14 and a side surface 58 on the support collar 14 , depending on the position of the shifter lever 12 and the support collar 14 . the slot 56 is disposed on a same side as the first window 26 a . the slot 56 is disposed along the axis 25 between the pivot point 17 and the first window 25 a . the side surface 58 is disposed adjacent the slot 56 . the blocker 54 includes a first surface 54 a offset from a second surface 54 b thus creating a stepped profile . the blocker 54 is configured to selectively contact or engage the first lock arm 24 a when the shifter lever 12 and support collar 14 are in different positions which changes the height of the first lock arm 24 a relative to the pawl 40 . for example , the second surface 54 b is raised with respect to the first surface 54 a and is disposed on the pawl 40 between the pivot point 48 and the first surface 54 a . returning to fig1 and with continued reference to fig2 , the actuator 42 includes an armature 60 pivotally connected to the second end 46 of the pawl 40 . the actuator 42 is preferably an on / off solenoid where , upon receipt of a control signal , the solenoid is energized and the armature 60 is translated . translation of the armature 60 in turn pivots the pawl 40 about the pivot axis 50 . however , it should be appreciated that the actuator 42 may take other forms without departing form the scope of the present example . the actuator 42 may be electronically controlled by a controller , such as a transmission control module or brake control module , etc ., and commanded to energize when the brakes of the motor vehicle are depressed . the pawl 40 is movable between an unlocked or energized position , shown in fig1 , and 4 , and a locked or de - energized position , shown in fig3 , and 6 . fig1 shows the shifter lever 12 in the neutral position with the pawl 40 in the unlocked position . in this condition , the pawl 40 does not engage the support collar 14 nor the lock button 24 . to move the shifter lever 12 to a drive position , shown in fig6 , the operator of the motor vehicle need only move the shifter lever 12 rearwards , i . e . away from the detent gate 30 . however , to move the shifter lever 12 to a reverse position ( not shown ) or a park position ( shown in fig4 and 5 ), the lock button 24 must be depressed to move the lock arms 24 a , 24 b out of alignment and engagement with the detent gate 30 before moving the shifter lever 12 forwards , i . e ., towards the detent gate 30 . fig3 shows the shifter lever 12 in the neutral position with the pawl 40 in the locked position . in this condition , the pawl 40 engages both the support collar 14 and the first lock arm 24 a . for example , the tab 52 of the pawl 40 is disposed in the slot 56 and the second surface 54 b of the blocker 54 is in contact with the first lock arm 24 a . the tab 52 prevents the shifter lever 12 from pivoting about the axis 18 while the blocker 54 blocks the lock button 24 form being depressed , thus providing extra redundancy . fig4 shows the shifter lever 12 in the park position with the pawl 40 in the unlocked position . in this condition , the pawl 40 does not engage the support collar 14 nor the lock button 24 . however , the locking arms 24 a , 24 b are disposed on an opposite side of the detent gate 30 . thus , to move the shifter lever 12 to the drive position , neutral position , or reverse position , the operator of the motor vehicle must depress the lock button 24 to move the lock arms 24 a , 24 b out of alignment and engagement with the detent gate 30 before moving the shifter lever 12 . fig5 shows the shifter lever 12 in the park position with the pawl 40 in the locked position . in this condition , the pawl 40 engages both the support collar 14 and the first lock arm 24 a . for example , the tab 52 of the pawl 40 is in contact with the side surface 58 and the first surface 54 a of the blocker 54 is in contact with the first lock arm 24 a . the tab 52 prevents the shifter lever 12 from pivoting about the axis 18 while the blocker 54 blocks the lock button 24 form being depressed , thus providing extra redundancy . finally , fig6 shows the shifter lever 12 in the drive position . in this position , the pawl 40 does not inhibit movement of the shifter lever 12 nor the lock button 24 . the description of the invention is merely exemplary in nature and variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .
5
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . referring now to the drawings in which like reference numerals designate like or corresponding parts throughout the several views , there is shown in fig1 a unique exhaust isolator system in accordance with the present invention which is secured to a vehicle and which is designated generally by the reference numeral 10 . vehicle 10 comprises an internal combustion engine ( not shown ), a body ( not shown ) and an exhaust system 16 which is attached to both the engine and the body . the internal combustion engine is designed to power one or more drive wheels of the vehicle . exhaust system 16 comprises an intermediate pipe 22 , a muffler 24 , a tailpipe 26 and a plurality of isolator assemblies 30 , 130 and 230 . intermediate pipe 22 is typically connected to a catalytic converter ( not shown ) which is attached to an exhaust pipe which is in turn attached to an exhaust manifold ( not shown ) which is one of the components of the vehicle &# 39 ; s internal combustion engine . the catalytic converter may be attached to a single exhaust pipe which leads to a single exhaust manifold or the catalytic converter can be attached to a branched exhaust pipe which leads to a plurality of exhaust manifolds . also , intermediate pipe 22 can be attached to a plurality of catalytic converters which connect together prior to reaching muffler 24 using intermediate pipe 22 or the vehicle can have a plurality of exhaust pipes , a plurality of catalytic converters , a plurality of intermediate pipes 22 and a plurality of mufflers 24 which connect together using a single tailpipe 26 . in addition , the present application is applicable to exhaust systems which are termed โ€œ dual exhaust systems โ€ in that they have two separate parallel exhaust systems extending from a single internal combustion engine . exhaust system 16 is utilized to route the exhaust gasses from the engine to the rear area of the vehicle . while traveling from the engine to the rear of the vehicle , the catalytic converter cleans the exhaust gasses and muffler 24 quiets the noise created by the combustion process in the engine . isolator assemblies 30 , 130 and 230 support exhaust system 16 underneath the vehicle and they operate to prevent engine vibrations from being transmitted to the vehicle &# 39 ; s body . in addition , isolator assemblies 30 , 130 and 230 provide superior alignment capabilities during the assembly of exhaust system 16 into the vehicle . referring now to fig2 isolator assembly 30 comprises an exterior bracket 40 , an elastomeric isolator 42 and an exhaust rod 44 . exterior bracket 40 comprises a generally u - shaped member 46 which is utilized to secure isolator assembly 30 to the vehicle . fig2 illustrates isolator assembly 30 which is designed to be secured to the front side ( in the vehicle &# 39 ; s direction ) of muffler 24 . u - shaped member 46 is illustrated having a first flange 50 and a second flange 52 . each flange 50 and 52 is adapted to be secured to the vehicle . flange 50 defines a tab 54 and flange 52 defines a through bolt hole 56 . tab 54 is designed to engage a hole 58 formed in a portion of the vehicle &# 39 ; s structure . a bolt 60 extends through bolt hole 56 for securing u - shaped member 46 of exterior bracket 40 and thus isolator assembly 30 to the vehicle by mating with a threaded member 62 attached to or formed as an integral member of a portion of the vehicle &# 39 ; s structure . elastomeric isolator 42 is disposed within the inner pocket formed by u - shaped member 46 and it is designed to mate with u - shaped member 46 by having a generally cylindrical end surface and to mate with a generally flat surface on the vehicle by having a generally planar end surface . elastomeric isolator 42 can be formed from silicone ( for high temperature applications ), epdm ( ethylene - propylene - diene monomer ) ( for moderate temperature applications ), natural rubber ( for low temperature applications ), or any other elastomer which meets the requirements of the application . elastomeric isolator 42 can be bonded to u - shaped member 46 , if desired . elastomeric isolator 42 defines a plurality of voids 64 which are engineered in size , shape and location to control the dynamic rate of isolator assembly 30 , the insertion force for isolator assembly 30 , the system durability requirements for isolator assembly 30 as well as other developmental and performance characteristics for isolator assembly 30 . elastomeric isolator 42 also defines a through bore 66 through which exhaust rod 44 is inserted . exhaust rod 44 is a formed rod which includes compound bends such that a first end 68 is positioned to axially engage bore 66 and a second end 70 is designed to mate with and be secured to a component of exhaust system 16 . in the illustrated embodiment , exhaust rod 44 is attached to the front of muffler 24 but it is within the scope of the present invention to attach exhaust rod 44 to any other component of exhaust system 16 , if desired . referring now to fig3 an isolator assembly 130 of a slightly different design is illustrated . isolator assembly 130 comprises exterior bracket 40 , elastomeric isolator 42 and an exhaust rod 144 . exterior bracket 40 comprises generally u - shaped member 46 which , as detailed above , is utilized to secure isolator assembly 130 to the vehicle . fig3 illustrates isolator assembly 130 which is designed to be secured to the rear side ( in the vehicle &# 39 ; s direction ) of muffler 24 . u - shaped member 46 is illustrated having first flange 50 and second flange 52 . each flange 50 and 52 is adapted to be secured to the vehicle . flange 50 defines tab 54 and flange 52 defines through bolt hole 56 . tab 54 is designed to engage a hole 158 formed in a portion of the vehicle &# 39 ; s structure . bolt 60 extends through bolt hole 56 for securing u - shaped member 46 of bracket 40 and thus isolator assembly 30 to the vehicle by mating with a threaded member 162 attached to or formed as an internal member of a portion of the vehicle &# 39 ; s structure . elastomeric isolator 42 is disposed within the inner pocket formed by u - shaped member 46 and it is designed to mate with u - shaped member 46 by having a generally cylindrical end surface and to mate with a generally flat surface on the vehicle by having a generally planar end surface . elastomeric isolator 42 can be formed from silicone , epdm , natural rubber or other materials as detailed above . elastomeric isolator 42 can be bonded to u - shaped member 46 if desired . elastomeric isolator 42 defines a plurality of voids 164 which are engineered in size , shape and location to control the dynamic rate of isolator assembly 130 , the insertion force for isolator assembly 130 , the durability requirements for isolator assembly 130 as well as other developmental and performance characteristics for isolator assembly 130 . voids 164 may or may not be the same as voids 64 of isolator assembly 30 . elastomeric isolator 42 also defines a through bore 166 through which exhaust rod 144 is inserted . exhaust rod 144 is a formed rod which includes compound bends such that a first end 168 is positioned to axially engage bore 166 and a second end 170 is designed to mate with and be secured to a component of exhaust system 16 . in the illustrated embodiment , exhaust rod 144 is attached to the rear of muffler 24 but it is within the scope of the present invention to attach exhaust rod 144 to any other component of exhaust system 16 if desired . referring now to fig4 an isolator assembly 230 of a slightly different design is illustrated . isolator assembly 230 comprises an exterior bracket 240 , elastomeric isolator 42 and an exhaust rod assembly 244 . exterior bracket 240 comprises a generally u - shaped member 246 which , similar to that described above for u - shaped member 46 , is utilized to secure isolator assembly 230 to the vehicle . fig4 illustrates isolator assembly 230 which is designed to be secured to tailpipe 26 . u - shaped member 246 is illustrated having a first formed end 250 and second flange 52 . formed end 250 and second flange 52 are adapted to be secured to the vehicle . formed end 250 is contoured to mate with the supporting structure of the vehicle and it defines a through bolt hole 254 . a bolt extends through bolt hole 254 for securing u - shaped member 246 of bracket 240 and thus isolator assembly 230 to the vehicle by mating with a threaded member attached to or formed as an integral member of a portion of the vehicle &# 39 ; s structure . flange 52 defines bolt hole 56 . bolt 60 extends through bolt hole 56 for securing u - shaped member 246 of bracket 240 and thus isolator assembly elastomeric isolator 42 is disposed within the inner pocket formed by u - shaped member 246 and it is designed to mate with u - shaped member 246 by having a generally cylindrical end surface and to mate with a generally flat portion on the vehicle by having a generally planar end surface . elastomeric isolator 42 can be formed from silicone , epdm , natural rubber or other materials as detailed above . elastomeric isolator 42 can be bonded to u - shaped member 246 if desired . elastomeric isolator 42 defines a plurality of voids 264 which are engineered in size , shape and location to control the dynamic rate of isolator assembly 230 , the insertion force for isolator assembly 230 , the durability requirements for isolator assembly 230 as well as other developmental and performance characteristics for isolator assembly 230 . void 264 may or may not be the same as voids 164 of isolator assembly 130 and may or may not be the same as voids 64 of isolator assembly 30 . elastomeric isolator 42 also defines a through bore 266 through which exhaust rod assembly 244 is inserted . exhaust rod assembly 244 comprises an exhaust rod 270 and a v - shaped bracket 272 . exhaust rod 270 is a generally straight rod which is positioned to axially engage bore 266 . v - shaped bracket 272 is attached to exhaust rod 270 at one end and it is designed to mate with and be secured to a component of exhaust system 16 at its opposite end . in the illustrated embodiment , v - shaped bracket 272 is attached to tailpipe 26 but it is within the scope of the present invention to attach v - shaped bracket 272 to any other component of exhaust system 16 if desired . embodiment , v - shaped bracket 272 is attached to tailpipe 26 but it is within the scope of the present invention to attach v - shaped bracket 272 to any other component of exhaust system 16 if desired . referring now to fig1 exhaust system 16 includes isolator assembly 30 located forward of muffler 24 , isolator assembly 130 located behind muffler 24 and isolator assembly 230 located on tailpipe 26 . while exhaust system 16 is illustrated with three isolator assemblies 30 , 130 and 230 being positioned at the specific locations detailed above , it is within the scope of the present invention to utilize a fewer number or a greater number of isolator assemblies located anywhere along exhaust system 16 as required by the specific application . each isolator assembly 30 , 130 or 230 provides a failsafe design by having u - shaped member 46 or 246 in connection with the mounting surface on the vehicle fully encircle exhaust rod 44 , 144 or 244 . by fully encircling exhaust rod 44 , 144 or 244 , exhaust system 16 is prevented from being unsupported at any isolator assembly should elastomeric isolator 42 deteriorate to the point of not being able to support exhaust system 16 . each isolator assembly 30 , 130 and 230 is oriented with respect to the vehicle such that bores 66 , 166 and 266 of elastomeric isolator 42 and the mating end of exhaust rods 44 , 144 and 244 extend generally parallel to the fore and aft direction of the vehicle or generally parallel to a longitudinal axis 88 defined by exhaust system 16 which is adapted to be parallel to the longitudinal axis of the vehicle which extends from the front center to the rear center of the vehicle . this unique orientation of isolator assemblies 30 , 130 and 230 allows exhaust system 16 to be aligned using only one of isolator assemblies 30 , 130 and 230 while the remaining isolator assemblies 30 , 130 or 230 can be delivered part - in - assembly with exhaust system 16 prior to being assembled to the vehicle . furthermore , once all isolator assemblies 30 , 130 and 230 are secured , exhaust system 16 is aligned in its natural or free state for noise , vibration and harshness ( nvh ) characteristics unlike the prior art exhaust isolator systems . an additional advantage to the longitudinal alignment of isolator assemblies 30 , 130 and 230 is that they will allow for thermal growth of exhaust system 16 . this longitudinal alignment of exhaust rods 44 , 144 and 244 allow the exhaust rods to individually and simultaneously slide longitudinally in elastomeric isolators 42 and thus prevent isolator assemblies 30 , 130 and 230 from over - constraining exhaust system 16 as it heats up and lengthens to its operating state . finally , the cylindrical shape of elastomeric isolator 42 allows it to be dynamically tuned in two directions using voids 64 , 164 and 264 , as opposed to the conventional prior art two rod isolators which are unidirectional . this allows for increased isolation and precise tuning to minimize localized forces which are transmitted to the vehicle . in addition , the isolator in bracket design allows for extremely high resonant frequencies as opposed to the prior art designs which significantly lower vehicle side resonance . this allows added stiffness on the exhaust side rod to increase resonant frequencies of the entire isolator system . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .
1
embodiments of the present invention will be explained in detail hereinafter in reference to the attached drawings . fig1 is a block diagram showing one embodiment of the noise reduction apparatus according to the present invention . in fig1 the same components as those shown in fig1 are assigned with the same marks . a picture signal is inputted input terminal 1 . the picture signal is applied to a memory 2 and memorized on frame units . the memory 2 reads - out the picture data on a block by block basis . each block each , for example , comprises 8 ร— 8 pixels in both horizontal and vertical directions . the picture data from the memory 2 is applied to not only a . noise reduction unit 32 via a terminal i of a switch 31 , but also to a motion detector 9 and a subtracter 37 . the switch 31 selects the terminal i and provides &# 34 ; 0 &# 34 ; to a subtracter 33 in the intra - frame compression mode , and selects a terminal p and provides the prediction error from the subtracter 37 ( described after ) to the subtracter 33 in the inter - frame compression mode . the subtracter 37 calculates the prediction error and the non - correlation component . the motion detector 9 detects the operation of the input picture signal and outputs not only the motion vector but also the signal showing the inter - frame non - correlation component . fig2 through 4 illustrate the motion detector 9 shown in fig1 . fig2 a shows the current frame picture and the fig2 b shows the reference frame picture . to the motion detector 9 , the current frame picture data from the memory 2 and the reference frame ( reference picture ) picture data from a memory 8 ( as described later ) are input . the motion detector 9 implements the motion detection in block by block base . for instance , if it is assumed that the dct block is comprised of 8 ร— 8 pixels , and four luminance dct blocks have the same size with one chrominance difference dct block by a sampling frequency difference between the luminance signal and the chrominance difference signal , the motion detector 9 implements the motion detection on the four luminance dct blocks ( equals to one chrominance difference dct block ), that is , macroblocks comprising 16 ร— 16 pixels , on block by block basis . it is assumed that the motion of the block - of - interest ( macro - block ) 53 which encodes a current frame 51 as shown in fig2 a is detected . in this case , the motion detector 9 takes the relative position relationship of the block - of - interest 53 . here , a search area 55 centering around the block 54 of a reference frame 52 is set up . fig3 shows the expansion of the search area 55 shown in fig2 a . in fig3 the search area 55 takes the dimensions of 47 ร— 47 pixels . the motion detector 9 searches the block having most resembling pattern to the pattern of the block - of - interest 53 of the current frame 51 inside of the search area 55 . that is , the motion detector 9 sets up the blocks in turns by moving them on pixel by pixel basis inside the search area 55 , and implements the matching operation for accumulating the absolute value of the difference between pixels which are correspond to each other between the block 53 and the block defined in the search area 55 , so as to make the block which has the smallest accumulating value as a reference picture block . fig4 shows the 1 pixel in the block 54 within the search area 55 . the pixel 57 is an arbitrary pixel in the block 54 . fig4 shows the area where the pixel 57 and other pixel to be carried out the matching operation therebetween are able to take in the search area 55 . that is , a matching operation is carried out between the pixel 57 and 32 ร— 32 pixels . so , there are 32 ร— 32 = 1024 blocks which are able to be set up within the search area 55 . the motion detector 9 calculates the vector 58 showing the position relationship between the block 54 and the reference picture block which is a block having the smallest accumulated value calculated by the matching operation as the motion vector . the motion detector 9 provides not only the calculated motion vector to a memory controller 11 and the encoder / decoder 39 , but also the correlation between the reference picture block which are calculated on the process of the motion vector operation and the current frame block to a correlation average calculator 35 of a noise reduction unit 32 . in the embodiment , it is using the correlation calculated on the process of the motion detection . however , it may use that calculated by other processing . by using the correlation calculated on the motion vector operation , it can make the hardware for the correlation calculation useless , and also it makes the processing time for the correlation calculation shorter . a memory controller 10 controls the read - out of the memories 2 and 8 in the motion detecting time controlled by the detector 9 . further , a memory controller 11 , to which the motion vector frame the motion detector 9 is applied , controls the read - out of the memory 8 , so as to design the blocking position of the reference block . further , the memory controller 11 outputs the controlling signal for controlling the storing and calculating process timing in the correlation average calculator 35 . the subtracter 37 , to which the current frame picture data from the memory 2 and the reference picture data from the memory 8 are applied , carries out a subtraction between the current and reference picture data so as to produce the inter - frame correlation component to be applied to a noise extractor 34 . the subtracter 37 , to which the current block data and the reference block data are applied from the memories 2 and 8 also , carries out a subtraction between the current and reference picture data so as to produce the prediction error to be applied to a terminal p of a switch 31 . the noise reduction unit 32 is comprised of the subtracter 33 , the noise extractor 34 , the correlation average calculator 35 and the coefficient calculator 36 . the picture data from the switch 31 is applied to the subtracter 33 of the noise reduction unit 32 . the inter - frame non - correlation component from the subtracter 37 is applied to the noise extractor 34 . in the noise reduction unit 32 , the noise extractor 34 extracts the noise component based on the inter - frame non - correlation component and the nr coefficient , while the subtracter 33 subtracts the noise component from the input picture data . thus the noise reduction unit 32 cancels the noise . in this embodiment , the nr coefficient is calculated not only by the correlation between the reference picture block and the current frame block which is compressing ( hereinafter referred to a block - of - interest ), but also by the correlation between the blocks on the periphery of the block - of - interest the current frame and the reference picture block which correspond to the blocks . fig5 illustrates the correlation average calculator 35 . it is assumed that the block - of - interest 61 and its peripheral blocks 62 through 65 . further , it is also assumed that the correlation which corresponds to the motion vector between the block - of - interest 61 and the reference block in the reference frames to designated as cmbo ( cmb stands for current macro block ). also , respective correlations which correspond to the motion vectors between blocks 62 through 65 and the respective reference frame blocks are designated as cmb1 through cmb4 . the correlation average calculator 35 , which has a memory storing the correlation cmb0 calculated about the block - of - interest 61 in the current frame and the correlations cmb1 through cmb4 calculated about the blocks 62 through 65 , calculates the average of these correlations and provide the average value to the coefficient calculator 36 . the average calculation implemented in the correlation average calculator 35 is not limited to the arithmetic averaging . it may be implemented by the geometrical average calculation , or filtering operation such as the weighted average . the coefficient calculator 36 calculates the nr coefficient based on the average value of the input correlation . the coefficient calculator 36 makes the nr coefficient small when the average value of the correlation is large , and makes it large when the value is small . the noise extractor 34 extracts the noise component from the non - correlation component output from the subtracter 37 using the nr coefficient so as thus applying the noise component to the subtracter 33 . for instance , the noise extractor 34 extracts the noise component by multiplying the non - correlation component with the nr coefficient . the subtracter 33 subtracts the noise component from the input picture data , and provides the picture data removed the noise component to the encoder / decoder 39 . the encoder / decoder 39 has almost the same components as the fig1 , but it does not have the nr unit 17 and the nl unit 24 . the encoder / decoder 39 implements the quantization of the input picture data by the dct processing and implements the variable - length encode so as to output the encoded data through the output terminal 7 . the encoder / decoder 39 implements the inverse - dct processing by implementing the inverse - quantization on the encoded data so as to restore the original picture data which is as the same as that before the dct processing and provide the restored picture data to the adder 5 . when the prediction error is inputted to the encoder / decoder 39 , the picture data applied to the adder is also prediction error . the output from the adder 5 is applied to the adder 5 via the memory 8 and the terminal p of the switch 38 . the memory 8 stores the output from the adder 5 as the reference picture data . the switch 38 selects the terminal i and applies o to the adder 5 in the time of the intra - frame compression mode , and selects the terminal p and applies the reference picture data read - out from the memory 8 to the adder 5 in the time of the inter - frame compression mode . in case of the inter - frame mode , the adder 5 adds the decoded data from the encoder / decoder 39 to the reference picture data so as to restore the original picture data and memorize it to the memory 8 . the operation of the embodiment comprised as described above will be explained in reference to the graphs in fig6 through 8 and the flow chart of fig9 . in fig6 the relation between the motion vector calculated for various kinds of pictures and the correlation by taking the motion vector amount of the horizontal or vertical direction on the horizontal axis , and taking the correlation on the vertical axis . in fig7 and 8 , the relation between the motion vector for the quantization and the correlation is shown . fig7 illustrates the relation in the conventional system , while fig8 illustrates the relation in the embodiment of the present invention . here , the larger the correlation , the similitude relation of the picture patterns becomes lower . while the smaller the correlation , the similitude relation of the picture patterns becomes higher . fig9 illustrates the timing chart of the various calculations . the picture signal input via the input terminal 1 is blocked in the memory 2 . after that , it is applied to not only to the terminal i of the switch 31 , but also to the subtracter 37 and the motion detector 9 . here , it is assumed that the intra - frame compression mode is specified . in this case , since the switches 31 and 38 select the terminal i , the picture data from the memory 2 is supplied to the noise reduction apparatus 32 via the switch 31 . the subtracter 37 produces the inter - frame non - correlation component by carrying out a subtraction between the current frame picture data and the picture data from the memory 8 , and provides the inter - frame non - correlation component to the noise extractor 34 . the motion detecting block 9 calculates the correlation between the reference picture block data from the memory 8 and the current frame block data and provides the correlation to the correlation average calculator 35 . the correlation average calculator 35 averages the correlation calculated for the block - of - interest in the current picture flame and the blocks on the periphery of the block - of - interest . it is assumed that the correlation average calculator 35 calculates the average of the correlation operated for the five blocks including the block - of - interest of the current frame and four blocks in either sides of the block - of - interest . fig9 shows the calculation timing of this case . fig9 a shows the calculation of the correlation , fig9 b shows the average value calculation , and fig9 c shows the compression operation . here , the numbers are showing the block numbers for processing . these blocks 1 , 2 , 3 , . . . are arranged from the left side to the right side of the screen . in fig9 it is assumed that mv1 , mv2 , mv3 , . . . are showing the correlations of the blocks 1 , 2 , 3 , . . . which form a line from left side to right side of the screen . the encode is orderly implemented from the left side block to the right side block . now , it is also assumed that the block - of - interest is designated by the reference numeral 3 . the correlation average calculator 35 stores also correlations mv1 and mv2 at the timing of inputting the correlation mv3 which is correspond to the block - of - interest 3 . the correlation average calculator 35 does not calculate the average value till the correlations mv4 and mv5 which are corresponding to the two blocks on the right side of the block - of - interest are input . the correlation average calculator 35 , which is controlled by the memory controller 11 , calculates the average value m3 among the correlations mv1 through mv5 as shown in fig9 b and provides the average value m3 to the coefficient calculator 36 when the correlations mv1 through mv5 are input thereinto . thus , the compression operation to the block - of - interest 3 is implemented at the timing of inputting the block 7 as shown in fig9 . here , since the average calculation of the correlations is completed in relatively short time , its possible to implement the average calculation in the compression processing time . in the case of selecting the blocks in the vertical sides of the block - of - interest as its on the periphery of blocks , it just causes a greater processing time delay . the average value of the correlation calculated in the correlation average calculator 35 is applied to the coefficient calculator 36 . the coefficient amount calculator 36 calculates the nr coefficient based on the average of these correlations and provides the nr coefficient to the noise extractor 34 . the noise extractor 34 multiplies the inter - frame non - correlation component from the subtracter 37 with the nr coefficient , so as to extract the noise component . the subtracter 33 cancels the noise component in the picture data applied through the switch 31 , so as to provide the data removed the noise component to the encoder / decoder 39 . the encoder / decoder 39 encodes the picture data and outputs the encoded data through the output terminal 7 . further , the encoder / decoder 39 decodes the encoded data and applies the decoded data to the adder 5 . in this case , the switch 38 is selecting the terminal i . as a result , the adder 5 passes the output of the encoder / decoder 39 therethrough as it is . the output of the adder 5 is stored in the frame memory 8 as the reference picture . it is assumed that the inter - frame compression mode is specified . in this case , the switches 31 and 38 select the terminal p . the motion detector 9m detects the motion on block by block basis by the matching operation between the current picture data from the memories 2 and 8 and the reference picture data . the motion detector 9 not only provides the calculated motion vector to the encoder / decoder 39 , but also the motion detector 9 calculates the correlation between the current frame block and the reference picture block and provides the correlation to the correlation average calculator 35 . the correlation average calculator 35 averages not only the correlations regarding to the block - of - interest , but also other four blocks of each two blocks in either back and fourth sides of the block - of - interest , so as to output the average to the coefficient calculator 36 . the coefficient calculator 36 calculates the nr coefficient based on the average value of the coefficient amounts . then , also in this case , the noise component is extracted based on the average value of the coefficient amounts calculated about the block - of - interest of the current frame and its peripheral blocks . the decreasing motion of the noise component is as the same as the intra - frame compression mode . the subtracter 37 produces the prediction error by carrying out a subtraction between the current block data and the reference picture block data , and provides the prediction error to the terminal p of the switch 31 . in the inter - frame compression mode , the subtracter 33 cancels the noise component from the prediction error applied thereto . the encoder / decoder 39 encodes the prediction error . the adder 5 restores the original picture by adding the reference picture data from the memory 8 to the decoded prediction error , and stores the restored picture data in the memory 8 as the reference picture data to be used at a next encoding operation . in fig6 the graph a shows a picture pattern of comparatively flat and stationary like a blue sky . the graph b shows a picture pattern of rapid change and motion . the graph c shows a picture pattern of moving picture having the periodically high frequency components . here , for instance , in the picture pattern which the random noises are superposed on the 50 % of the white signals , the characteristics will be fixed value in proportion to the noise amount ( not shown ). fig7 shows the difference of characteristics between the each blocks and each frames which are adjacent to in the picture pattern of graph b in fig6 ., the graphs al and b1 are showing the picture patterns of the predetermined two blocks a and b which adjoin with each other in fig7 . the graphs a2 and b2 are showing the quantized picture data of the blocks a and b in the conventional embodiment . as shown in the graphs a1 and b1 in fig7 each blocks a and b nest to have the comparatively same character in the relation between the correlations and the motion vector amounts before the quantization . however , in case of the quantization for the compassing s shown in the graphs a2 and b2 , the character between the adjoining blocks a and b has a great difference . that is , when the quantization range is relatively narrow or the quantization is not implemented , the dispersion of the correlations and the vector amounts between adjoining blocks will be great compared that the quantization range is relatively wide . this dispersion is supposed to be caused by the quantization distortion . fig8 shows the characteristics of the embodiment with the motion vector amount shown on the axis of abscissas and the correlations between the reference picture block and the current picture block on the axis of ordinates . the graphs c1 and c2 in fig8 shows the picture pattern of the blocks a and b which are nest to each other , both of which are showing the picture pattern of rapid change and motion and , the graphs c1 and c2 are showing the character when there are no noise and quantization error . at block a , as shown in graph c1 , in the relation between the motion vector and the correlation , the more the coordinates goes away from the minimum value dot h , the greater the value becomes . that is , the dot h shows the reference picture block having a minimum correlations to the block - of - interest a . at the adjacent block b , as shown in graph c2 , in the relation between the motion vector and the correlation , the more the coordinates go away from the minimum value dot i , the greater the value becomes . that is , the dot i shows the reference picture block having the minimum correlations to the block - of - interest b . here , in the motion detector 9 , the vector and scalar amounts at the dots h and i with the minimum correlations are output as their motion vectors . the correlation average calculator 35 calculates the average of the correlations at the dots h and i . the average value of the correlation value has a relationship ; the correlation at the dot i โ‰ง the average of the correlations โ‰ง the correlation at the dot h . when there are noises only , or there are both noises and the quantization errors , the coordinates of the motion vectors to the blocks a and b spread out from the centers of the dots h and i . the circles e and f in fig8 are showing the spreading areas . generally , the motion vector 5 calculated from the reference picture block to the block a and from the reference picture block to the block b has the same size . this is that when the average of the correlations is calculated over the research area in fig3 the three half of the reference picture block which can get , in the adjoining blocks . the direction of the correlations caused by the noise and the quantization is generated at random . that is , the correlations of the block a and its reference picture block can be shown by an arbitrary dot in the circle e , and the correlations of the block b and its reference picture block can be shown by an arbitrary dot on the circle f . since the dispersion becomes random , the dispersion amounts of the average value between each blocks a and b and these each reference picture blocks are highly possible to be converged in comparatively small value , which might be smaller than the dispersion amounts of each correlations between the blocks a and b and these each reference picture blocks . thus , the dispersion of the average value of the correlations between the blocks a and b and each these . reference picture blocks can be shown by circles smaller than the circles e and f . that is , by taking an average , the low - pass filter characteristics is given , and the dispersion of the average value of the correlations becomes smaller . accordingly , its better to use the average of the correlations calculated for the block - of - interest and its peripheral blocks rather than the correlation of only the block - of - interest for reducing the flickering of each block . when there is no noise , and only the quantization error is generated , the dispersion of the motion vector does not make a circle , and expand in the predetermined direction in a specific picture pattern . however , since the picture patterns themselves are not the same in the random process , it can reduce the flickering in each block by averaging the dispersion amounts to reduce them . accordingly , in the embodiment , it calculates not only the correlations between the block - of - interest of the current frame and the reference picture block , but also the correlations between the blocks on the periphery of the block - of - interest and their own reference picture blocks . as a result , it cancels the noise component based on the average value of these correlations . this average of the correlations has smaller dispersion than that between each block - of - interest and their reference picture blocks . that is , by controlling the parameter of the noise reduction using the block - of - interest and its peripheral blocks , it can make the noise reduction effects difference between blocks smaller than the case of controlling the parameter for noise reduction on block by block basis . as a result , it can prevent the flickering of each block appearing on the picture . fig1 is a block diagram showing another embodiment of the present invention . this embodiment shows the example which is appropriate to the decoding apparatus for decoding the encoded data which are encoded by adapting the predictive encoding . the encoded data from the encoding system containing the inter - frame encoding are applied to a variable length decoder 161 . the variable length decoder 161 implements the variable length decode to the input encoded data and applies them to an inverse - quantizer 162 . the inverse - quantizer 162 restores the data before the quantization by the inverse - quantization processing and provides the restored data to an inverse - dct unit 163 . the inverse - dct unit 163 restores the pixel data before the dct processing by the inverse - dct processing of the inverse - quantized output and provides the restored pixel data to an adder 164 . here , the variable length decoder 161 implements the variable length decode to the motion vector of the input encoded data to be output therefrom . the switch 165 selects the terminal i at the intra - frame compression mode and provides &# 34 ; 0 &# 34 ; to the adder 164 , and at the inter - frame compression mode , it selects the terminal p and provides the motion guaranteed reference picture block data from memories 81 and 82 ( mentioned later ) to the adder 164 . the adder 164 restores the original picture data by adding the output from the inverse - dct unit 163 with the output from the switch 165 . the output from the adder 164 is applied to a subtracter 68 via a delay memory 67 of a noise reduction unit 66 . the subtracter 68 , to which the noise component is applied from a noise extractor 74 ( mentioned later ), cancels the noise component in the decoded picture data , and provides them to the memories 81 and 82 via the switch 80 . the contents of the memories 81 and 82 are output as the decoded picture data via the switch 83 . the blocking positions of the switches 81 and 82 are controlled based on the motion vector , and the stored decoded picture data are output via the switch 84 as the motion guaranteed reference picture block data . the switches 80 , 83 , and 84 are changed by connected with each other , when the write - in is implemented in one of the memories 81 and 82 , the read - out is implemented from the other one . the reference picture block data from the memories 81 and 82 are applied to the terminal p of the switch 165 , the subtracter 69 and the correlation calculator 70 via the switch 84 . in the embodiment , the noise reduction unit 66 comprised of the subtracters 68 and 69 , the correlation calculator 70 , the delay memories 67 and 73 , the correlation average calculator 71 , the coefficient calculator 72 and the noise extractor 74 . to the correlation calculator 70 the motion vector transmitted in conjunction with the encoded data is applied . the correlation calculator 70 calculates the correlation between the current frame block data and the reference picture block data from the motion vector and provides the correlation to the correlation average calculator 71 . in this embodiment , the correlation average calculator 71 memorizes not only the correlation of the block - of - interest of the current frame , but also the correlation calculated about the blocks on the periphery of the block - of - interest , and it calculates the average value of these correlations . the correlation average calculator 71 provides the average of the correlations to the coefficient calculator 72 . the coefficient calculator 72 generates the nr coefficient based on the average of some correlations and provides the nr coefficient to the noise extractor 74 . the current frame block data and the reference picture block data are also applied to the subtracter 69 . the subtracter 69 produces the difference between these two block data as the inter - frame non - correlation component , and then provides the inter - frame non - correlation component to the noise extractor 74 via the delay memory 73 . the delay memories 67 and 73 delay input data by about the calculation time of the correlation average calculator 71 . the noise extractor 74 , for instance , extracts the noise component by multiplying the inter - frame non - correlation component with the nr coefficient and provides the noise component to the subtracter 68 . the operation of the embodiment in such arrangement as mentioned above will now be explained . the encoded data are subjected to the variable length decode in the variable length decoder 161 . the output from the variable length decoder 161 is implemented inverse - quantization in the inverse - quantizer 162 , then implemented the inverse - dct processing in the inverse - dct unit 163 so as to restore the original pixel data . when the encoded data have been implemented the predictive encoding the output from the inverse - dct unit 163 is prediction error . in this case , the adder 164 adds the reference picture block data from the memories 81 and 82 , and the output from the inverse - dct unit 163 so as to restore the original picture . the decoded picture data from the adder 164 are applied to both the subtracter 69 in the noise reduction unit 66 and the correlation calculator 70 . both the subtracter 69 in the noise reduction unit 66 and the correlation calculator 70 are also applied the outputs from the memories 81 and 82 . the subtracter 69 produces the inter - frame non - correlation component by carrying out a subtraction between the reference picture block data from the memories 81 and 82 and the current frame block data , and then provides the inter - frame non - correlation component to the noise extractor 74 via the delay memory 73 . the correlation calculator 70 calculates the correlation between the reference picture block and the current frame block and provides the correlation to the correlation average calculator 71 . the correlation average calculator 71 memorizes not only the block - of - interest , but also the correlations of the blocks on the periphery of the block - of - interest , and it calculates the average value of these correlations . the average value is applied to the coefficient calculator 72 . in the coefficient calculator 72 , the noise coefficient based on the average value of the correlations is calculated and applied to the noise extractor 74 . in the noise extractor 74 , the noise component is extracted by multiplying the non - correlation component by the nr coefficient . the subtracter 68 subtracts the noise component from the input decoded picture data and provides the difference via the delay memory 67 . the output from the noise reduction unit 66 is memorized in the memories 81 and 82 via the switch 80 . the picture data stored in the memories 81 and 82 are output as the decoded picture data via the switch 83 . if the input encoded data is resulted from the intra - frame compression , the switch 165 applies &# 34 ; 0 &# 34 ; to the adder 164 . the adder 164 applies the output of the inverse - dct unit 163 to the noise reduction unit 66 as it is . other operations are the same as that in the case that the inter - frame compression encoded data are input . as described above , in this embodiment , the correlation average calculator 71 averages the correlation of the block - of - interest of current frame block and its reference picture block and those of the blocks on the periphery of the block - of - interest and their own reference picture blocks . the coefficient calculator 72 calculates the nr coefficient based on the average of these blocks . accordingly , it can be able to reduce the flickering of each block . here , in this embodiment , the correlation calculator 70 calculates the correlation between the reference picture block and the current frame block . however , by calculating these amount at the encoding time and transmitting them , it becomes possible to omit the calculation of the correlation at the decoder section . in this case , the correlation calculator 70 is not necessary . further , in the present embodiment , the noise reducing operations are recursively implemented by allocating the noise reduction apparatus in the decoding loop . however , it is obvious that the noise reduction apparatus may also be allocated outside the decoding loop . fig1 is a block diagram showing a noise reduction unit 91 in another type according to the present invention . in fig1 the same components as those shown in fig1 are assigned with the same marks . in the embodiment , the part that the noise reduction unit 91 is substituted for the noise reduction unit 32 is different from the embodiment in fig1 . in the noise reduction unit 91 , the parts that the coefficient calculators 92 and 93 are substituted for the coefficient calculator 36 as shown in fig1 and a mixer 94 is also provided , in different from the noise reduction unit 32 in fig1 . the motion detector 9 produces the correlation between the reference picture block and the current frame block to the correlation average calculator 35 . the correlation average calculator 35 produces the correlation of the block - of - interest of the current frame to the coefficient calculator 92 . further , it calculates the average of the correlations of the blocks on the periphery of the block - of - interest and applies it to the coefficient calculator 92 . here , the correlation average calculator 35 produces the correlation and the average value at the same timing . the coefficient calculator 92 calculates the nr coefficient based on the correlation between the block - of - interest of the current picture frame and its reference block and provides it to the mixer 94 . the coefficient calculator 93 calculates the nr coefficient based on the correlations between the blocks on the periphery of the block - of - interest and their own reference picture blocks and provides them to the mixer 94 . the mixer 94 selects one of the nr coefficients output from the coefficient calculators 92 and 93 or mixes them at a fixed rate , so as to provide the selected nr coefficient to the noise extractor 34 . the operation of the embodiment in such arrangement will now be explained . the motion detector 9 applies the correlation between the reference picture block and the current frame block to the correlation average calculator 35 . the correlation average calculator 35 memorizes the input correlation and provides the average of the correlation to the blocks on the periphery of the block - of - interest in the current frame to the coefficient calculator 93 . also , the correlation average calculator 35 provides the correlation to the block - of - interest in the current frame to the coefficient calculator 92 . the coefficient calculator 92 produces the nr coefficient based on the correlation to the block - of - interest , and the correlation calculator 93 produces the nr coefficient based on the average value of the correlation to the blocks on the periphery of the block - of - interest . the mixer 94 , for instance , selects one of the nr coefficients output from the coefficient calculators 92 and 93 and applies it to the noise extractor 34 . when it selects the output of the coefficient calculator 93 , it is possible to reduce the flickering of each block . however , contrary , it selects the output of the coefficient calculator 92 it is possible to obtain a proper noise reduction effect for each block . further , the mixer 94 mixes the outputs from the coefficient calculators 92 and 93 at the proper ratio and applies it to the noise extractor 34 , so as to obtain the desirable noise reduction characteristics . as described above , in this embodiment , it can obtain the same effect as that shown in fig1 and also it can obtain the noise reduction effect which is desired by viewer . fig1 is a block diagram showing another embodiment of this invention . in fig1 , the same components as those shown in fig1 are assigned with the same marks , and the explanation of them will be omitted . in this embodiment , a part that the noise reduction unit 98 adopting a coefficient calculator 97 substituting for the coefficient calculator 92 is defined is different from the embodiment shown in fig1 . the subtracter 37 ( see fig1 ) produces the inter - frame non - correlation component by comparing the reference picture data and the current frame picture data from the memories 2 and 8 on pixel by pixel basis . the subtracter 37 provides the non - correlation component not only to the noise extractor 34 but also to the coefficient calculator 97 . the coefficient calculator 97 calculates the nr coefficient based on the average value of the single pixel non - correlation component or the plural pixels non - correlation component , so as to provide the nr coefficient to the mixer 94 . the mixer 94 provides one of the nr coefficients from the coefficient calculators 93 and 97 or the nr coefficient which is mixed at the predetermined ratio to the noise extractor 34 . the operation of the embodiment in such arrangement will now be explained . the motion detector 9 provides the correlation of the block - of - interest of the current frame and its reference picture block to the correlation average calculator 35 . the correlation average calculator 35 stores therein the correlation of the block - of - interest , and calculates the average of the correlations of the blocks on the periphery of the block - of - interest , so as to provide the average value to the coefficient calculator 93 . the coefficient calculator 93 calculates the nr coefficient based on the average value of the input plural correlations to be output therefrom . the subtracter 37 detects the non - correlation components between the reference picture data and the current frame picture data on each pixel , and provides the non - correlation components to the coefficient calculator 97 . fig1 illustrates the correlation of each pixel . the average of a difference amount or some difference amounts between the predetermined pixel ( slanting lines area ) of the block - of - interest 99 in the current frame and the pixel ( slanting lines area ) of the corresponding block 100 in the reference frame is applied to the coefficient calculator 97 as the correlation . the coefficient calculator 97 calculates the nr coefficient based on the average value of the signal pixel non - correlation component or the plural pixels non - correlation component . the mixer 94 provides , for instance , one of the nr coefficient from the coefficient calculators 93 and 97 to the noise extractor 34 . other operations are the same as those shown in fig1 . further , this embodiment is also used for the noise elimination of the chrominance signal . for instance , it is assumed that the chrominance signal and the luminance signal are input via the input terminal 1 by being time - multiplexed with each other , and each unit is possible to carry out the time - multiplexing for the luminance signal and the chrominance signal . in this case , the motion detector 9 , as the same as the explanation mentioned above , applies the correlation between the luminance signal of the reference picture block and that of the block - of - interest in the current frame to the correlation average calculator 35 . the subtracter 37 produces the non - correlation components between the current frame chrominance signal and the reference picture chrominance signal on each pixel , and provides the non - correlation components to the coefficient calculator 97 when the chrominance signal is input . the coefficient calculator 97 calculates the nr coefficient based on the average value of the chrominance signal non - correlation component . here , the subtracter 37 provides the non - correlation component about the chrominance to the coefficient calculator 97 when the chrominance signal is input . the mixer 94 applies the nr coefficient based on the outputs from the coefficient calculators 92 , 93 , and 97 to the noise extractor 34 at the time of the noise eliminating to the chrominance signal . thus , the noise extractor 34 time - diffusion extracts the noise component contained in the luminance signal and that contained in the chrominance signal using the nr coefficients which are corresponding each luminance signal input time and the chrominance signal input time . the subtracter 33 cancels the noise component contained in the luminance signal from the input luminance signal at the time of the luminance signal processing , and also cancels the noise component contained in the chrominance signal from the input chrominance signal at the time of the chrominance signal processing , and provides the noise reduced signals therefrom . accordingly , in this embodiment , the same effect as that shown in figure is obtained , and further , it can also obtain the desired noise reduction effect according to the mixing ratio of the mixer 94 . further , it an control the elimination of the noise component on the pixel - by - pixel . as a result , it is able to implement precise control than the embodiment shown in fig1 . it cancels not only the noise of the luminance signal but also the noise of the chrominance signal . and , it can omit the chrominance motion vector detection device in the noise elimination of the chrominance signal . fig1 is a block diagram showing another embodiment of the present invention . in fig1 , the same components as those shown in fig1 and 12 are assigned with the same marks , and the explanations of them will be omitted . the embodiment of fig1 is different from those as shown in fig1 and 12 in that it comprises a noise reduction unit 101 having the coefficient calculators 92 , 93 , and 97 and the mixer 94 in place of the coefficient calculator 36 shown in fig1 . the mixer 94 provides one of the nr coefficients output from the coefficient calculators 92 , 93 , and 97 or the nr coefficient which are obtained by mixing two of them at the predetermined ratio to the noise extractor 34 . in the embodiment in such arrangement , to the mixer 94 , the nr coefficient based on the correlation between the reference picture block and the block - of - interest of the current frame , the nr coefficient based on the correlations between the reference picture block and the blocks on the periphery of the block - of - interest of the current frame , and the nr coefficient based on the non - correlation component on pixel - by - pixel between the reference picture data and the current frame picture data are applied . the mixer 94 provides , for instance , a nr coefficient which is obtained by mixing these nr coefficients mentioned above at the predetermined ratio to the noise extractor 34 . it is able to obtain the desirable noise reduction characteristics by defining the mixing ratio of the mixer 94 . in this embodiment also , the luminance signal and the chrominance signal are input via the input terminal 1 by being time - multiplexed with each other . thus the subtracter 37 produces the non - correlation components of each pixel between the current frame chrominance signal and the reference picture chrominance signal and provides the non - correlation components to the coefficient calculator 97 . as a result , it is able to calculate the nr coefficient of the chrominance signal . accordingly , in this embodiment , it can also reduce the noise of the chrominance signal . as described above , in this embodiment , the same effects as those shown in fig1 and 12 are also obtained . in each embodiment , the noise reduction unit is taking the recursive arrangement . however , it is obvious that it can take either recursive or non - recursive arrangement . as described above , not only the present invention can provide an extremely preferable noise reduction apparatus which has the enough noise reduction effect , but also the present invention has the effect to prevent the visible flickering in each block . while there have been illustrated and described what are at present considered to be preferred embodiments of the present invention , it will be understood by those skilled in the art that various changes and modifications may be made , and equivalents may be substituted for elements thereof without departing from the true scope of the present invention . in addition , many modifications may be made to adapt a particular situation or material to the teaching of the present invention without departing from the central scope thereof . therefor , it is intended that the present invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out the present invention , but that the present invention includes all embodiments falling within the scope of the appended claims . the foregoing description and the drawings are regarded by the applicant as including a variety of individually inventive concepts , some of which may lie partially or wholly outside the scope of some or all of the following claims . the fact that the applicant has chosen at the time of filing of the present application to restrict the claimed scope of protection in accordance with the following claims is not to be taken as a disclaimer or alternative inventive concepts that are included in the contents of the application and could be defined by claims differing in scope from the following claims , which different claims may be adopted subsequently during prosecution , for example , for the purposes of a divisional application .
7
in the following description , reference is made to the accompanying drawings that form a part hereof , and in which is shown by way of illustration , specific embodiments which may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention , and it is to be understood that other embodiments may be utilized and that structural , logical and mechanical changes may be made without departing from the scope of the present invention . the following description of example embodiments is , therefore , not to be taken in a limited sense , and the scope of the present invention is defined by the appended claims . fig1 shows a breakboard snowboard 100 having a nose 102 , a tail 104 , a top 105 , a base 106 a running length 107 , a hip width 108 , a waist width 108 a , a sidecut 110 , a side 112 , a primary gliding surface 114 , a nose shovel 116 , a tail shovel 118 , binding mounting 120 , and an edge 124 . the breakboard snowboard ( or โ€œ board โ€) 100 includes a running length 107 extending between the nose 102 and tail 104 . the nose 102 and tail 104 may have a โ€œ shovel โ€ shape where the breakboard snowboard 100 end curves upwardly away from the gliding surface 114 , generally avoiding contact with the snow when riding on smooth terrain . the nose 102 and / or tail 104 provide an important function when gliding over uneven , curved or bumpy surfaces , as well as when riding in deep snow or powder . when gliding on such surfaces , the nose 102 and / or tail 104 can prevent an end from digging into or catching on a curve or bump , and instead allow the breakboard snowboard 100 to glide up a curve or over a bump . when riding in deep snow , the leading end of the breakboard snowboard 100 ( which could be the nose 102 or tail 104 ) is upturned and contacts the snow so that the board 100 does not dive under the snow surface . put another way , the upturned nose 102 or tail 104 forces snow under the board 100 onto the gliding surface 114 and keeps the board 100 from sinking excessively into the snow . according to one embodiment of the inventive subject matter , the board 100 is provided with a nose 102 and a tail 104 which have a respective nose shovel 116 and tail shovel 118 generally defined by the rise of the nose 102 or tail 104 above the gliding surface 114 ( or more specifically , the end of the gliding surface 114 nearest the nose 102 or tail 104 ). one of the nose shovel 116 and the tail shovel 118 is of greater height than the other . according to one embodiment of the inventive subject matter , the nose 102 is provided with a nose shovel 116 which has a greater rise above the gliding surface 114 than the rise of the tail shovel 118 above the gliding surface 114 . the benefits of having nose 102 and the tail 104 with differing nose shovel 116 and tail shovel 118 is described with respect to fig1 a . fig1 a includes two boards 100 a and 100 b . these boards are generally used as such , in pairs , with one board for each foot of the rider , in a configuration with the tail 104 a of the front board 100 a facing the nose 102 b of the rear board 100 b . by designing the boards 100 a , 100 b with a larger nose shovel than tail shovel , a benefit is provided wherein the rear board 100 b is able to travel closer to the front board 100 a before contacting . because the end of the nose 102 b of the rear board 100 b is elevated above the end of the tail 104 a of the front board 100 a , as the rear board 100 b approaches the front board 100 a it is able to overlap rather than crashing edges together . additionally , when the boards 100 a , 100 b overlap as such , any succeeding collision between the boards 100 a , 100 b would be between the base of nose 102 b the rear board 100 b and the edge of the tail 104 a of the front board 100 a . this type of collision will generally result in a sliding action , allowing the rear board 100 b to ride up onto the top of the edge of the tail 104 a of the front board 100 a . this type of interaction between the boards 100 a , 100 b is less likely to cause damage to the boards 100 a , 100 b or otherwise affect the rider in a way that would impact his or her riding experience . boards with equal height nose and tail shovels are more likely to collide edge - to - edge . these types of boards are generally configured with a circumferential metal edge . a collision between boards of equal nose and tail shovel heights would likely cause a metal - to - metal impact which has the potential to do damage to the board , and also disrupt movement one or both of the boards in a way detrimental to the riding experience . it can be advantageous for a rider to be able to bring the front board 100 a and the rear board 100 b close to each other because the rider &# 39 ; s stance is based on the separation between the boards 100 a , 100 b . while riding , a rider may want to be able to adjust stance on the fly in order to adapt to changing terrain . additionally , outside of the rider &# 39 ; s control , the terrain may cause a rider to change stance and it is advantageous for the boards to be configured in such a way to be able to smoothly adapt to such circumstances without a hard collision ( such as a metal - to - metal impact ). fig2 shows a board 200 which may be a breakboard snowboard having a minor axis 202 and a major axis 204 , a side edge 206 , a primary base 208 and a concave base 210 . according to embodiments of the inventive subject matter , the board 200 has a lateral concavity in its base shape along the major axis 204 such that any line along the surface of the base of the board 200 which is substantially parallel with the major axis 204 will be substantially straight . any line along the surface of the base of the board 200 which is substantially parallel with the minor axis 202 will have a curvature . when set on a substantially flat surface , the concave base 210 will rise up above the surface plane away from the primary base 208 which will contact the surface . assuming symmetry about the major axis 204 , the concave base 210 will rise from the primary base 208 to a certain height and return to the primary base 208 on the opposite of the major axis 204 . this symmetry is not essential to the inventive subject matter โ€” the invention will be operable where the concave base 210 curvature is not the same on either side of the major axis 204 . additionally , according to other embodiments of the inventive subject matter , the rise and fall of the concavity of the concave base 210 may vary along the major axis 204 . for example , the concavity near the tip and / or tail of the board 200 may be less dramatic than the concavity near the center of the board where the major axis 204 intersects the minor axis 202 . according to other examples , the concavity near the tip and / or tail of the board 200 may be more dramatic than the concavity near the center of the board where the major axis 204 intersects the minor axis 202 . one of the purposes of such base concavity along the major axis 204 is to allow the board to better โ€œ grab โ€ onto a terrain park element such as a rail or box edge . the concavity allows the board to better ride on such an element along its center line ( the major axis 204 )โ€” the curvature helps force the board to slide in such a manner . riding along the center line ( major axis 204 ) helps the rider better balance himself or herself on the board ( s ). another purpose of the of the base convacity is to provide some cushion and / or โ€œ snap โ€ to the board so that some energy can be absorbed by the board as it flattens when a rider lands after riding off a jump or other terrain element . other purposes are considered . according to another aspect of the inventive subject matter , the side edge 206 of the board 200 may be elevated , sloped up from or curved upwards from the primary base 208 . this vertical deviation in the side edge 202 from the plane of the primary base 208 helps allow the edge of the board 200 to ride above the gliding surface . since the edge of a gliding board may be sharp ( in a snowboard or breakboard snowboard for example ), it may be beneficial to have the side edge 206 raised to avoid catching the edge on the gliding surface . according to various embodiments , the board 200 may be a traditional snowboard or other gliding board . fig3 shows a board 300 having a first end 306 , a second end 308 , an oblique portion 302 , and an acute portion 304 . the first end 306 ( or , alternatively , the second end 308 ) may simply have a traditional curved shape according to some embodiments . according to this example embodiment of the inventive subject matter , at least one of the first end 306 and the second end 308 will have a substantially parallelogram - like shape with an oblique portion 302 and an acute portion 304 . the oblique portion 302 may generally be defined by the substantially oblique angle created by the intersection of a side edge and board end ( tip or tail ). similarly , the acute portion 304 may be defined by the substantially acute angle created by the intersection of the other side edge and board end ( tim or tail ). two boards 300 may be used in conjunction as typical for breakboard snowboards with one board attached to each foot of the rider . a first board 300 a and a second board 300 b may used in a configuration where the oblique portion 302 of the first board 300 a is near the acute portion 304 of the second board 300 b and the acute portion 304 of the first board 300 a is near the oblique portion 302 of the second board 300 b . this configuration allows the rider additional stance options , such as a reduction in the lateral distance between feet ( as measured along a board major axis or similar parallel line ). the rider may simply move the second board 300 b forward and toward the first board 300 a . the parallellogram - like shape of the adjacent edges of the board allows this movement to take place without the boards 300 a , 300 b intersecting each other . fig4 shows a board 400 having a nose 402 and a tail 404 , a concave portion 406 and one or more convex portions 408 a , 408 b . according to an embodiment of the inventive subject matter , the board 400 will have a shape ( when viewed along a major axis cross - section ) which is somewhat undulating . the undulating characteristic may be defined by a convex portion 408 a extending from the nose 402 and curving into a concave portion 406 which curves into a further convex portion 408 b which extends from the tail 404 . according to other embodiments of the invention , only one convex portion 408 a , 408 b may be present , allowing the concave portion 406 to extend into the nose 402 or alternatively into the tail 404 . according to yet another embodiment of the invention , the undulating characteristic may only exist in the base of the board , while the top surface remains substantially planar ( not including the nose 402 and tail 404 ). the concave portion 406 , according to some embodiments , may be approximately the width of a typical snowboard binding , when measured along the major axis of the board 400 . a portion of the concave portion may have a substantially planar shape ( rather than being continuously curved ) in order to provide a flat mounting surface for a binding . according to another embodiment , the shape of the convex portions 408 a , 408 b or the concave portion 406 may be defined by a substantially curved surface , or alternatively by flat an angled surfaces . fig5 shows a board 500 having a nose 502 and a tail 504 and side edges 506 extending along the perimeter of the board 200 between the nose 502 and tail 504 . according to an embodiment of the inventive subject matter , the side edges 506 may define other than straight lines . the side edges 506 may be characterized by an undulating shape whereby the side edges 506 of the board 500 make concave and convex shapes when viewed top - down as shown . side edges 506 allow for better grip on icy and hard packed snow conditions , giving the board 500 a serrated cutting edge 506 that can โ€œ bite โ€ into the terrain . in addition the concave and convex shapes increase the overall length of the side edges 506 , improving the traction of the board while carving . fig6 shows a board 600 having a nose 602 and a tail 604 and core material 606 . according to various embodiments of the inventive subject matter , the core material 606 may be comprised of several individual strips . the core material 606 may be all individual and separate strips of material with no connection between each section , or alternatively , there may be connecting points in order to adjust flexibility or make manufacturing simpler . one advantage of a core composition of this sort is that the spaces or discontinuity between the pieces of core material 606 allow the board 600 to flex more easily in the direction perpendicular to the long axis of the core material 606 segments . for example , where the core material 606 segments generally run from nose 602 to tail 604 , the board 600 is more apt to flex from side edge to side edge ( along the minor axis of the board 600 ). in another embodiment , the core material 606 segments may generally run perpendicular to the major axis of the board 600 ( e . g . from side edge to side edge between the nose 602 and tail 604 ). this arrangement will generally allow for increased flexibility along the major axis of the board between the nose 602 and tail 604 . combinations of these described embodiments , splitting the core material 606 in various directions in order to achieve desired flex along any axis of the board are considered and are part of the inventive subject matter . the core material 606 need not be full length strips of material , but rather may be sections of material patterned withing the board with separations or gaps placed to provide additional flexibility . according to yet another aspect of the inventive subject matter , the core material 606 need not be fully separated between segments , rather , variations in thickness ( or stacking of core material ) may be used to adjust flexibility in a similar fashion that one would use separations in the core material 606 . fig7 shows a board 700 having a nose 702 and tail 704 , and core sections 706 , 708 , 710 . similar to the embodiments of fig6 , the board 700 includes segmented / shaped core material in order to adjust or improve flexibility . according to this embodiment of the inventive subject matter , multiple core sections are provided , a first major axis segment 706 and a second major axis segment 708 are positioned within the board 700 running generally from nose 702 to tail 704 . a minor axis segment 710 is provided , running generally from side - edge to side - edge ( along a minor axis ) connecting the first major axis segment 706 and the second major axis segment 708 . additional major axis segments and minor axis segments may be added to adjust flex characteristics of the board 700 . fig8 shows a board 800 having a nose 802 and a tail 804 . according to various embodiments of the inventive subject matter , the board 800 is provided with varying core thicknesses . a first lateral core segment 806 is provided , running from nose 802 to tail 804 generally adjacent a one side - edge . a second lateral core segment 808 is provided , running from nose 802 to tail 804 generally adjacent to the other side - edge . a center core segment 810 is provided running from nose 802 to tail 804 generally between the first and second lateral core segments 806 , 808 . according to various embodiments , the center core segment 810 may be provided with a thickness different from the first lateral core segment 806 and the second lateral core segment 808 . in some embodiments , the center core segment 810 is thicker and in others it is thinner than the lateral core segments 806 , 808 . according to various other embodiments , the described core segments 806 , 808 , 810 may be provided running generally perpendicular to the major axis of the board 700 . in such an embodiment , a first core segment may be adjacent to the nose 802 , a second core segment may be adjacent to the tail 804 and a third core segment may be positioned between the first and second core segments . fig9 shows a board 900 having a nose 902 and a tail 904 . according to various embodiments of the inventive subject matter , the board 900 includes an ordinary board section 904 and a riser section 906 . both the ordinary board section 904 and the riser section 906 may be disposed upon a common base material and common layer of fiber / resin . the ordinary board section 904 and the riser section 906 may share a first core layer , and the riser section 906 may comprise an additional or thicker core layer allowing it to rise above the ordinary board section 904 . in this embodiment , one or more layers may substantially continuously cover the ordinary board section 904 and the riser section 906 . the additional layers may include fiber , resin , topcoat , lacquer coat , or other layers . according to other embodiments the riser section 906 may be a separate layer or series of layers set on / above the ordinary board section 904 . the riser section 906 may provide a relatively flat surface for mounting a binding , or the surface may have a contour or wedge shape in any particular direction . riser section 906 raises the binding and boot from the base of the board , reducing the chance of heel and toe drag when carving . fig1 shows a board 1000 having a nose 1002 a tail 1004 , a top surface 1006 and a base surface 1008 . according to various embodiments of the inventive subject matter , the base surface 1008 may be comprised of an uneven surface . the vase surface 1008 may include a series of elevated surfaces 1010 and valley surfaces 1012 which may alternate from side edge to side edge . the elevated surfaces 1010 and the valley surfaces 1012 may be arranged generally in parallel with the major axis of the board 1000 , stretching from the nose 1002 to the tail 1004 . the transition between elevated surfaces 1010 and valley surfaces 1012 may be abrupt or gradual . the number of elevated surfaces 1010 and valley surfaces 1012 may be as few as one each to as many as possible to fit on the board given manufacturing constraints . additionally , the number of elevated surfaces 1010 need not be equal to the number of valley surfaces 1012 , nor do the width of the elevated surfaces 1010 need to be equal or similar to the width of the valley surfaces 1012 . the elevated surfaces 1010 may have a differing surface shape ( concave , convex , pointed , flat and so on ) than the valley surface 1012 . the addition of these elevated surfaces 1010 and valley surfaces 1012 give the board greater directional control with little effort by the operator . this also aids in stiffening the board 1000 down the length of the board . fig1 shows a board 1100 having a nose 1102 and tail 1104 , a nose tip 1108 and a tail depression 1108 . according to various embodiments of the inventive subject matter , when two boards 1100 are used in conjunction with the rider feet facing approximately perpendicular to the direction of gliding ( i . e . the direction generally along the line created by the tail 1104 and nose 1102 ), the nose 1102 of a rear board may be able to cross the plane of the tail 1104 of the front board . this action happens when the nose tip 1108 of the rear board is able to maneuver into the tail depression 1108 of the front board . the tail depression 1108 may be shaped in a way to engage with the nose tip 1108 . this construction and orientation allows for the two boards , when used together to move closer together , allowing the rider to have more versatility in their stance . according to other embodiments of the inventive subject matter , the tail 1104 of the board 1100 may have a shovel which rises and flattens ( or creates a suitable engagement surface ). a first board 1100 a and a second board 1100 b may be brought together tail - to - tail and an engagement mechanism 1110 may be used to connect the boards 1100 a , 1100 b . the connection between the boards 1100 a , 1100 b may be semi - permanent , temporary or momentary according to various embodiments . the rider may utilize the engagement mechanism 1110 when ready to glide , and disengage when finished or walking ( or on a lift for example ). according to another alternative , the rider may utilize ( engage or disengage ) the engagement mechanism on the fly while riding . the engagement mechanism may comprise a mechanical latch , one or more magnets , or other mechanism to secure two boards to each other . according to various other embodiments , the engagement mechanism 1110 may not be an integral part of the first board 1100 a or the second board 1100 b , but may rather be an additional element added to the boards . it should be noted that the nose tip 1108 and / or the tail depression 1106 are not necessary for the implementation of the embodiments whereby the boards 1100 a , 1100 b are connected via an engagement mechanism 1110 . the boards described herein may be constructed in a number of ways , typical construction types are described below , although others are considered as well . a cap - type snowboard is typically constructed from several components including a core , e . g ., made of wood , top and bottom reinforcing layers that sandwich the core , a top cosmetic layer and a bottom gliding surface , or base . the top reinforcing layer typically overlaps the side edges of the core to protect the core from the environment and provide structural support to the board . since the core in a cap - type board typically extends into the nose and tail ends of the snowboard , tapering the core at the nose end results in a board having a tapered nose and improved float . another construction type of snowboard is the sidewall - type board ( also known as sandwich construction ). similar to a cap board , sidewall boards typically have a core , top and bottom reinforcing layers , a top cosmetic layer and a bottom gliding surface . however , in contrast to cap boards , the top reinforcing layer does not cover the side edges of the core . instead , a sidewall support member is positioned between the top and bottom reinforcing layers ( and / or a metal edge at the bottom of the board ). the sidewall is bonded to the top and bottom layers to protect the interior of the board , including the core , from the environment . the core in sidewall boards does not normally extend into the nose and tail ends of the board . instead , the core terminates near the transitions at the nose and tail , and a spacer made from a flat sheet material is positioned between the top and bottom reinforcing layers in the nose and tail . the spacer typically has a constant thickness and forms a significant portion of the thickness of the nose and tail ends . thus , prior sidewall - type boards have not been provided with a tapered nose or other features to improve the float of the board . to improve on the ability of a board to force a proper amount of snow under the board and keep the rider at a suitable position relative to the surface of snow , a board may have a core that has a tapered or substantially reduced thickness at the nose ( or tail ). this tapered thickness increases in flexibility from the transition or contact area toward the tip of the nose . this increased flexibility allows the nose to flex upward to a varying degree along the nose when contacted by snow , thereby increasing the frontal area on the nose and the amount of lift provided to the board . according to other embodiments , the core material may be provided with a similar material as used on the base of a board . this will result in a board that has increased flexibility due to the absence of a rigid core material . other semi - rigid or flexibile core materials may be considered as well with varying thickness / taper to increase or decrease flexibility in different areas or directions on the board . the inventive subject matter describes a device gliding on a surface , the device providing improved mobility for the rider . for example , by providing separate boards to be attached to each foot of a rider for riding sideways ( approximately perpendicular to the facing of the rider &# 39 ; s feet ), and the boards having tips and tails of differing heights , the riding experience can be substantially improved . in this example , the inventive subject matter allows the rider to have improved mobility by allowing the front and rear board to slide closer to each other and also decrease the effects of a collision between the boards . embodiments of the system for gliding on a surface with improved mobility are disclosed . one skilled in the art will appreciate that the present teachings can be practiced with embodiments other than just those disclosed . the disclosed embodiments are presented for purposes of illustration and not limitation . various components are presented for the purpose of describing example embodiments . just because a component is described with respect to an example embodiment does not require that it is a necessary component with respect to the inventive subject matter . the abstract is provided to comply with 37 c . f . r . ยง 1 . 72 ( b ) to allow the reader to quickly ascertain the nature and gist of the technical disclosure . the abstract is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims .
0
fig1 and 7 show plan view and perspective view of one embodiment of a heat generating sheet , containing flow channels 5 in a sheet core 1 consisting principally of an elastomeric material . fuel - air vapor is pumped from a fuel chamber 20 , shown in fig4 into flow channels 5 , within sheet core 1 , containing elongated catalytic heat elements 2 . the pumping action is provided by a miniature electric air pump 6 , shown in fig2 which is powered by a dry cell battery 25 . a possible alternative to using dry cell battery 25 , is to employ direct electrolytic oxidation of a fuel 22 , using a device known as a fuel cell . for instance , if the fuel in fuel chamber 20 is a primary alcohol , such as methanol , the present invention might use a portion of it to operate a miniature fuel cell structure and thus derive a small amount of electrical power ( e . g . 1 / 4 to 1 / 2 watt ) to drive air pump 6 . in this manner , all the energy required to operate this invention could be obtained from a single source of renewable energy . for certain applications , this would be both a cost effective and practical way to eliminate the need for batteries . the heat generating process begins by closing pump switch 26 , which routes current from battery 25 into electric air pump 6 , starting the flow of air . ambient air enters an input port 7 and exits through an output port 8 , which is connected by a plastic tube to a regulator interface shown in fig3 . at the regulator interface , the air stream is divided between a fuel valve 9 and a dilution valve 11 . valve 9 controls the rate of flow of air passing through a conduit located in the interface body 13 and then through a quick - connect seal 45 into a fuel chamber inlet tube 14 . fuel chamber inlet tube 14 carries the air stream directly into a fuel vapor extraction unit 23 which is immersed in liquid fuel 22 shown in fig5 . the fuel chamber is an isolated subsection of fuel module 28 which contains both fuel chamber 20 and a scrubber cell 21 . a partly cut - away perspective view of the fuel vapor extraction unit 23 is shown in fig6 . it consists of a vapor extractor base 23b with a serpentine shaped groove 23c formed into its face . vapor extractor base 23b can be made from any material compatible with the fuel . for a methanol based liquid fuel , a material such as high density polyethylene has been found suitable . a micro - porous membrane 23a is placed over the vapor extractor base 23b , covering but not filling the serpentine shaped groove 23c , and sealed to the base by use of an adhesive or by other means such as heat sealing . the result is an assembly containing a serpentine passage through which gasses are allowed to move unimpeded . air flowing into vapor extraction unit 23 remains separate from the liquid phase fuel 22 , because the membrane is chosen such that capillary forces prevent liquid fuel 22 from entering serpentine groove 23c via the pores of membrane 23a . the micro - porous membrane can be made from expanded ptfe . an internodal distances of 20 microns or less and a thickness of 1 millimeter has been found to work satisfactory . other materials , for example , polyethylene , can also be used as long as the membrane is sufficiently hydrophobic and the pore size sufficiently small . if methanol is chosen as liquid fuel 22 , a small amount of de - ionized water must be added to the methanol in order to prevent the methanol from wetting the membrane and seeping into serpentine shaped groove 23c . the complete miscibility of water in methanol , along with its highly polar nature , increases the surface tension of the fuel so that only the vapor phase of the fuel can enter the capillary - like internodal spaces of membrane 23a . it has been found that a 10 % to 15 % by volume addition of water is sufficient to insure separation of the gas and liquid phases . the use of other additives to raise the overall surface tension of the fuel should also work well . this method of vapor extraction has advantages over direct bubbling of air through the fuel . one advantage is its immunity to accidental leakage and back flow problems when the fuel module is inverted or placed in unusual attitudes . this should also be true for weightless or micro - gravity conditions . the technique of bubbling air directly through the fuel requires more complex design to avoid this problem and has the additional drawback of generating somewhat higher back pressure do to the hydraulic head of the liquid fuel . upon passing through vapor extraction unit 23 , the air stream becomes saturated with fuel vapor and exits a fuel chamber outlet tube 15 , where it is directed back to interface body 13 and mixed with air from dilution valve 11 . interface body 13 , is designed to couple and de - couple with fuel module 28 . in this manner , replacement fuel modules may be easily and quickly removed and re - inserted by means of interface body quick - connect couplings 45 . the settings for fuel valve 9 and dilution valve 11 determine the fuel / air ratio of the gas stream entering heat sheet inlet tube 3 . a fuel - air control knob 10 , mechanically links valve 9 to valve 11 such that rotating control knob 10 increases or decreases the fuel / air ratio . in this manner the thermal power generated in the heat sheet may be selected and controlled by the user . alternatively , the air pump flow rate can be adjusted by controlling the electric current into the motor that drives air pump 6 and setting the fuel / air ratio at predetermined fixed value . a combination of both methods ( i . e . fuel - to - air ratio and total flow rate control ) is most desirable since this would provide the widest range of operating conditions . in this way , it is possible to insure catalytic heat element 2 operates along the most desirable portions of the power curve . this is shown as example only , without implying limitation , in fig1 , labeled as curves c1 and c2 . these curves , described in detail below , form the upper boundary of the operational regime where condensed water vapor effects are prominent . different curves will result for each heat sheet design and are calculated by determining the channel wall temperature , under a given set of flow and power conditions , and the humidity of the flow stream due to the rate of production of the h 2 o reaction product . upon entering the heat sheet , the fuel - air flow stream is directed to a plurality of flow channels 5 containing elongated heat element 2 , where the fuel reacts with oxygen in the presence of a catalytic material to generate heat by flameless combustion . sheet core 1 of the heat sheet is sandwiched between a flexible upper sheet 30 and a lower sheet 29 that are substantially thinner than the sheet core . the purpose of the bottom sheet includes but is not limited to physical support for sheet core 1 . for instance , if the channels in the sheet core are formed by the method of embossing or molding , so that the thinnest portion of the sheet core ( occurring in the channel sections as shown in fig7 ) is sufficient to prevent fuel vapor from diffusing out to the environment during operation of the heat sheet and the physical integrity of the heat sheet is not compromised , then the bottom sheet may be considered optional . bottom sheet 29 can also be used to help spread the heat across the surface , as for instance by using a thermally conducting polymer or metal foil , or it may be added solely to adjust the overall mechanical rigidity of the whole heat sheet structure . alternatively , if sheet core 1 is constructed of individual die - cut pieces , bottom sheet 29 acts as a substrate upon which the die - cut pieces are bonded to form an integral single unit with flow channels . in this case , bottom sheet 29 actually forms the bottom of the channel . the top sheet is put in place after the catalytic heat elements are positioned and secured within the flow channels . its function includes , but is not limited to , containment of the fuel - air flow within the flow channels and must therefore also be impermeable to fuel vapor . in any case , the choice of materials for the top and bottom sheets is dependent upon the sheet core material , bonding technique , fuel vapor compatibility , overall mechanical properties and the peak operating temperature desired of the heat elements . one such embodiment of a heat sheet with dimensions , which are given by way of example and not limitation , consists of : a sheet core of rtv polyurethane 15 cm ร— 10 cm ร— 0 . 3 cm with molded channels , no bottom sheet 29 , and a top sheet b of 0 . 127 millimeter thick mylar that is aluminized on one side . heat elements 2 , are 12 cm long and 0 . 18 cm in diameter , constructed as shown in fig8 and fig9 . each heat element has a micro - porous ptfe outer - jacket 31 , purchased from international polymer engineering , with an internodal distance of less than 20 microns , a 1 mm inner diameter and 1 . 8 mm outer diameter surrounding a catalytic core 32 . the micro - porous membrane allows the fuel vapor to reach the catalyst and the reaction products to escape but prevents condensed water vapor in the flow channels from contacting the catalyst . the catalytic core composition , delineated in fig9 consists of an aluminum wire 35 with a clear anodized surface 34 and a reaction promoting catalyst outercoat 33 . the catalyst consists of 50 micrometer diameter gamma - alumina particles coated with about 40 % by weight platinum . ( gamma - alumina , coated with between 20 % to 60 % by weight platinum , will auto - ignite methanol vapor at ambient temperatures lower than 40 ยฐ f . and in relative humidity levels near 100 %). the particles are attached by using a saturated aluminum nitrate and water solution formed into a slurry with the platinized alumina particles and painted onto the surface of the wire with a brush . the wire is baked at 450 ยฐ c . for 2 hours . u . s . pat . nos . 2 , 580 , 806 , 2 , 742 , 437 and 2 , 814 , 599 describe details useful for producing a satisfactory composition of active platinum coated particles and for attaching said particles to a surface . aluminum wire 35 provides a high degree of axial thermal conductivity to heat element 2 and contributes substantially to the apparent uniformity of the flameless combustion process along the axis of the heat element . the high axial thermal conductivity further provides for a wide operating regime with a relatively small region of combustion zone contraction as shown in fig1 a . in contrast , fig1 shows a heat element construction with a catalytic core 32 consisting of minute particles ( e . g . 50 micron to 250 micron average size ) of gamma - alumina coated with 20 % to 60 % by weight platinum but without a central metal wire . this structure has significantly less axial thermal conductivity than the one shown in fig9 . fig1 b demonstrates the substantial restriction in operational performance that results . the significantly lower axial thermal conductivity value results in a substantially larger region occupied by combustion zone contraction . the combustion zone contraction boundary defines a state where the temperature at the center of the heat element just starts to equal the temperature of the heat element at the fuel - air entrance . it is arbitrarily chosen to represent the beginning of an asymmetry in the temperature profile , along the axis of the heat element , that progresses gradually toward a condition where the majority of the combustion process is occurring in a small region at the fuel - air entrance . in fig1 a and 14b , the asymmetry in the temperature profile becomes more pronounced for operating conditions going into and farther away from the upper boundary of the combustion zone contraction regime . fig1 c illustrates a typical result . the primary difficulty of operating in this region results from the high power density due to localized combustion , whereby one obtains a high temperature in a small area rather than a low temperature over a large area , as desired . to avoid operating in the combustion zone contraction regime with this type of heat element construction , it is necessary to increase flow rates and reduce the fuel / air ratio significantly , thus resulting in inefficient operation ( e . g . greater air pump power requirements , size and weight ). a heat element constructed like that of fig1 can be made to perform similar to the heat element of fig9 by attaching a high thermal conductivity strip of material , running the length of the element , to the micro - porous outer - jacket 31 , as discussed in &# 34 ; theory of heat element operation &# 34 ; below . it is preferred that the material be flexible and pliant , for instance , the use of miniature metallic - link structures , such as used in the making of very fine jewelry chains , has been found effective when attached at intervals to the outer - jacket 31 , using epoxy . the resulting heat element is very light weight , and flexible while retaining the high average axial conductivity desired to avoid combustion zone contraction . the heat elements need not have a straight geometry . for instance , the heat elements may be curved into a serpentine shape , or some other shape , in order to alter the manner in which thermal energy flows across the heat sheet . this is practical because the catalytic heat elements may be constructed with non - rigid materials when operated at the relatively low temperatures encountered in this invention . in one embodiment , the heat elements are placed into each of three parallel flow channels as shown in fig7 and secured by a drop of epoxy at each end of the heat element . the aluminized side of the mylar top sheet is bonded to sheet core 1 by applying a thin coating of uncured rtv polyurethane to the top surfaces of the sheet core followed by setting top sheet 30 onto the surface with subsequent curing . the aluminum film on the mylar sheet reduces the fuel vapor permeability to insignificant levels while spreading the heat produced and reflecting the thermal radiation back into flow channels 5 and sheet core 1 . this material combination has been found to work well with heat elements operating continuously at temperatures as high as 250 ยฐ f . in other embodiments , different material combinations are possible that will allow continuous heat element temperatures above 250 ยฐ f . ( e . g . 300 ยฐ f . to 400 ยฐ f .). for instance , high temperature polymeric materials such as , silicone rtv from dow or closed cell silicone foam sheet from rogers corporation , can be used while still maintaining a pliant and flexible physical character of the heat sheet . in addition , the use of closed cell foam as a sheet core material offers significant weight reduction over non - foamed elastomer counter parts . the total number of separate flow channels , with heat elements , contained in a heat sheet , is limited only by the air pump flow capacity and the fuel module capacity to supply saturated fuel vapor . a small flow channel cross - sectional area is preferred since it causes the flow velocity within the channel to be relatively high even though the total volume rate of flow may be relatively low . a high flow velocity reduces the ratio h 2 / v ( discussed in the section on &# 34 ; theory of heat element operation &# 34 ;) and has a strong influence on the symmetry of the temperature distribution ( combustion uniformity ) along the length of the heat element . therefore , by constructing heat elements with very small cross - sectional areas it is possible operate well outside the region of combustion zone contraction while still maintaining a low volume flow rate condition . this in turn allows effective use of miniature electric air pumps as the source of oxygen and carrier gas for the fuel vapor . a trade - off occurs between flow channel cross - sectional area and pump pressure required to achieve a particular flow rate , so that flow channel cross - sectional area may not be reduced ad - infinitum . it is therefore important to combine high axial thermal conductivity with a low h 2 / v ratio ( e . g . a ratio less than one , when h 2 has units of watts and v has units of centimeters per second ). heat elements constructed similar to those shown in fig1 a and 11b take advantage of the benefits of small flow channel cross - sectional area by being very thin in profile . the heat element is constructed by sandwiching the catalyst between a flat , thin , nonporous substrate , such as aluminum foil 39 , and a micro - porous sheet membrane 37 , resulting in a two sided structure . hydrophobic materials such as ptfe , pvdf , polyethylene , polypropylene and other may be used for micro - porous sheet membrane 37 . the use of ptfe material has the advantage that the pore structure remains unimpaired up to about 400 ยฐ f . to 450 ยฐ f . in one embodiment , a top surface 40 and bottom surface 38 of the thin profile heat element shown in fig1 a consists of anodized aluminum . top surface 40 has a thin stripe of a reaction promoting catalyst 41 running along the length of the heat element . the sheet - like micro - porous membrane is sealed at the edges , where it contacts the anodized aluminum foil , by use of a thin layer of epoxy . the attachment contact area must be sealed such that it is impervious to penetration by condensed water vapor that may occur in the flow channels . other attachment means may be utilized such as localized heat , mechanical or other types of adhesives . back surface 38 has a thin film resistor 42 deposited as shown in fig1 b . by driving current through thin film resistor 42 , a joule heating effect raises the temperature of the attached reaction promoting catalyst 41 . it has been observed that long term dormancy of the heat elements ( e . g . three to four months or more between operation ) may result in excessive auto - ignition times ( e . g . 5 minutes ) or on occasion , no auto - ignition . like - wise , start - up from temperatures well below 40 ยฐ f . may also be problematic , although generally speaking the body temperature is sufficient to warm the heat sheet above 40 ยฐ f . in most conceivable situations . to remedy this , a thin film electrical conductor 42 of suitable resistance is attached to and run along the length of the heat element . the joule heating is attained in the form of a transient heat pulse when electric current is momentarily applied . for instance , it has been found that a one second pulse of current of 1 / 3 amp into a 9 ohm thin film conductor , deposited along the length of an anodized aluminum foil strip , 4 mm wide ร— 150 mm long ร— 0 . 012 mm thick will cause the foil temperature to exceed 160 ยฐ f . this is sufficient to restart even the most inactive heat elements . in one embodiment , two aa sized batteries in series , are switched from element to element , in one second intervals . the switching from element to element may be accomplished either manually as shown in fig1 where starting battery 44 is connected sequentially by switch 43 to each thin film electrical conductor 42 . although a parallel connection is possible , a series connection reduces the demand requirements from battery 44 , allowing battery 44 to be functionally merged with battery 25 that drives air pump 6 . the switching process may be accomplished more conveniently by use of integrated circuit electronic switching means well known in the art of electronic engineering . in this way , the push of one button will operate air pump 6 and start the heat pulses to thin film electrical conductor 42 . once a catalytic heat element has been reactivated , it has been found to remain active unless once again placed into long term dormancy . therefore , the power drain on the batteries are normally negligible because the heat pulses are seldom needed . alternatively , the thin film resistor 42 could be used as a standard method of starting the heat elements . in this mode , the weight percentage of platinum used in the catalytic heat elements may be reduced substantially in order to gain a cost reduction . numerous methods are known in the art for generating a thin conductive film of a predetermined resistance . in one embodiment shown in fig1 a & amp ; 11b , the substrate is a 12 . 7 micron thick aluminum foil 39 with top side 40 anodized to a thickness of about 2 microns and bottom side 38 similarly anodized . the foil 39 is 4 mm in width by 100 mm long . the back side is coated with photoresist and exposed to a contact mask . the photoresist is developed , exposing the anodized aluminum surface in a pattern similar to that shown in fig1 b . a thin film of electroless palladium is next deposited on to the back side . this is done by dipping the foil into a palladium chloride solution and then a stannous chloride solution which reduces the palladium ions to a metallic form . the foil is then placed into an electroplating bath where the palladium film is grown . the resistance of the backside palladium conductor is checked during the deposition process until a 9 ohm value is achieved . at this point the deposition is stopped and the remaining photoresist is removed . the foil is washed in boiling de - ionized water for five minutes and dried . a slurry of platinum coated gamma - alumina particles ( 40 % by weight platinum on 50 micron particles ) is made by mixing with a saturated solution of aluminum nitrate . the top side 40 of the foil is then painted with the slurry solution and placed in an furnace at 450 ยฐ c . for two hours . the foil is removed from the furnace and cooled to room temperature . a 4 millimeter wide by 100 millimeter long strip of stretched and sintered , micro - porous ptfe , with internodal distance less than 20 microns , is laid over top side 40 , sandwiching reaction promoting catalyst 41 in between . the edges of the ptfe sheet membrane 37 are sealed to the aluminum foil with a thin coating of epoxy , being careful not to coat the catalyst , and allowed to cure . the total thickness of the completed heat element is approximately 0 . 2 millimeter . other hydrophobic porous membranes such as pvdf , polyethylene , polypropylene and the like will also work depending on the pore size and maximum operating temperature desired . the use of cvd ( chemical vapor deposition ) , pvd ( physical vapor deposition ), vacuum evaporation , silk screened conductive inks and other deposition and pattern transfer techniques are deemed suitable for the construction of thin film conductor 42 . the use of a metal foil as the substrate for receiving the reaction promoting catalyst has the advantage of providing a high axial thermal conductivity , enhancing the uniformity of the flameless combustion process along the heat element . non - porous substrates that are not intrinsically good thermal conductors , such as polyimide or peek , can be utilized if modified . for example , lamination with or deposition of metal film structures or external attachment of thermal conducting strips of material in proximity with or contiguous with the substrate will act to effectively increase the axial thermal conductivity of the substrate . thin film conductor 42 can simultaneously be used in the role as a temperature sensor . because electrically conductive materials have a temperature coefficient of resistance , it is possible to calibrate the resistance value of the conductor with its temperature . during operation of the heat sheet , the temperature of each heat element may be sensed by use of electronic circuitry , well known in the art , that can measure the resistance value and shuts down the air pump when a predetermined over - temperature condition is sensed . alternatively , the thin film conductor 42 , can be constructed by using two different metals such that the left side portion of the conductor in fig1 b is a metal composition with a different thermoelectric potential than the right side portion , so that where they meet , an overlapping junction is formed producing a thermocouple sensor . the utility and importance of a micro - porous membrane encapsulating a reaction promoting catalyst can be understood by considering fig1 . this figure shows an empirically derived relationship between total gas flow rate and two critical vapor curves for flow in a 4 millimeter diameter channel . the critical vapor curve is defined here to mean the boundary of the region where noticeable condensation can first be observed in the immediate vicinity of the heat element ( i . e . any region below the curve results in noticeable h 2 o condensation ). the straight curves radiating from the center of fig1 are the curves of constant fuel / air ratio . they are defined with respect to the fuel / air ratio that would exist in the saturated vapor state in equilibrium with liquid methanol at 25 ยฐ c ., which is arbitrarily defined as 100 %. ( the 5 % percent curve corresponds to approximately 1 % by volume of methanol vapor in air ). note that the 5 % curve delineates the condition for water condensation to occur when the average temperature of the channel wall is about 30 ยฐ c . and the flow rate is as shown in the diagram . by allowing the flow stream and heat element channel wall to reach higher average temperatures , but still well below the damage threshold for the material chosen , curves like c1 and c2 result . curve c1 illustrates a situation where the heat element is very well thermally grounded ( i . e . relatively low thermal resistance for heat flow to the ambient outside environment ) such that the average temperature of the inner channel wall surfaces is not allowed to exceed about 125 ยฐ f . curve c2 results when the operating conditions are set to allow greater average channel temperatures of perhaps 150 ยฐ f . or more . ( average channel wall temperatures of 250 ยฐ f . or more are practical if for instance the sheet core 1 is chosen to be a high temperature elastomer ). since water at atmospheric pressure changes phase at 212 ยฐ f ., wall temperatures above this value prevent condensation around the heat element regardless of fuel / air ratio . in practice , however , field conditions will arise where the heater operating point crosses into the region below the critical vapor curve boundary resulting in condensed water in the flow channels . it is also desirable to operate with low flow rate conditions , in order ( e . g . for example 50 cc / minute or less per heat element ) to reduce the air pump power consumption , size , weight and noise . maintaining high power levels under these conditions may require relatively rich mixtures , for instance , values exceeding 50 % or more . as seen in fig1 a and 14b , this tends to push the operating point into the region of combustion zone contraction . at the same time , as seen in fig1 , the operating point tends toward a critical vapor curve . therefore , the use of a micro - porous membrane , to prevent extinguishment of the catalyst reaction , combined with the methods discovered for promoting a symmetric axial temperature profile , allows the widest latitude for reliable operation , utility and optimum performance of this invention . the effect of axial thermal conductivity on the combustion process can be inferred by measuring the heat element temperature distribution profile . it is convenient to categorize the flameless combustion behavior into three broad types , as shown in fig1 a to 13c . ( for comparison purposes , total power levels were adjusted to keep the peak temperatures similar ). starting with fig1 a , the plot illustrates an operational state where the combustion zone appears nearly uniformly distributed over the length of the heat element . in the second state , the reaction zone appears to shift such that the temperature profile is less symmetric , as shown in fig1 b . this is interpreted as a shifting of the combustion process toward the fuel - air entrance , which is located at a position of zero centimeters . in the third state ( fig1 c ), the combustion zone appears to have contracted so that most of the thermal power output is occurring in a small portion of the heating element near the fuel - air entrance . in this state , the temperature at the fuel - air entrance portion of the heat element can quickly reach levels ( e . g . & gt ; 600 ยฐ f .) that will damage known elastomeric materials even at equivalent fuel - air power levels of only a few watts . the curves shown in fig1 a to 13c are derived from the solution of the differential equation shown in eq . 1 . the parameters were chosen to closely approximate empirical data from heat elements of different axial thermal conductivity . for instance , fig1 a is the solution of eq . 1 with parameters set to approximate the aluminum core heat element ( i . e . high axial thermal conductivity ) constructed as shown in fig9 . fig1 c is also a solution of eq . 1 but with parameters set to fit the data for a heat element structure like that shown in fig1 . the construction shown in fig1 significantly lowers the axial thermal conductivity by virtue of the relatively poor thermal conductivity of alumina ( aluminum oxide ) as compared to pure aluminum , as well as , the significant thermal contact resistance between particles . i have discovered that by sufficiently increasing the axial thermal conductivity ( i . e . the average thermal conductivity value for conductive heat flow along the length of the element ) it is possible to convert a heat element , operating with a contracted combustion zone , into one with a significantly more symmetric and extended reaction region . for instance , by attaching a small strip of copper foil ( 0 . 001 inch thick by 10 cm long by 0 . 4 cm wide ) to the outside of the heat element that produced the profile in fig1 c , a new profile is obtained that looks like fig1 a . the average axial thermal conductivity of the heating element shown in fig1 a is approximately 10 times the value for fig1 c . it has been further discovered that the axial temperature distribution can be induced to acquire a substantially more symmetric ( more uniform combustion process ) temperature profile by spatially modulating the effective catalytic activity along the length of the heat element . this may be done by a number of means , such as altering the porosity of the ptfe micro - porous membrane , so that it is less porous at the fuel - air entrance end and gradually increasing in porosity toward the opposite end of the heat element . for example , this could be done by selectively applying a thin film of epoxy to block specific pores in such a manner that more pores are blocked in some regions than in others . alternatively , the activity of the catalyst material ( per unit length ) itself may be altered , as for instance , by mixing inert grains of alumina with activated platinum coated grains of alumina in varying proportions along the axial direction , such that a similar spatial modulation of the catalytic activity is achieved . fig1 demonstrates the predicted effect of spatially modulating the catalytic activity such that it increases quadratically from the fuel - air entrance side to the opposite end of the heat element . the combination of high thermal conductivity and spatially modulated catalytic activity , provides a broad range for heat element performance and axial temperature distribution management . returning to the operation of the portable heat generating device ; the warm exhaust gas from each of the catalytic heat elements exits the heat - sheet from a common orifice where it is expelled through a flexible plastic heat - sheet exhaust tube 4 . exhaust tube 4 directs the exhaust gas to interface body 13 where the gas passes through a conduit within the interface body and enters diverter valve input tube 16 where it is received by a thermal diverter valve 12 . the thermal diverter valve , as shown in fig5 is a bi - directional valve that apportions the exhaust flow stream between two diverter valve output tubes , 17 and 18 , according to the temperature of fuel 22 in fuel chamber 20 . one means to accomplish this is to utilize a bi - metallic coil of metal that moves a valve stem control in response to the temperature of fuel 20 . the temperature of the fuel can be transmitted to valve 12 by way of a heat conducting ( e . g . metallic ) output tube 17 that connects to an exhaust gas heat exchanger 24 . the use of shape memory alloys that change physical shape when transitioning through a predetermined temperature could also provide an effective means to operate the diverter valve . alternatively , an electronic means for sensing fuel temperature ( e . g . thermocouple ) and switching power to an electromechanical actuator associated with the diverter valve can also be employed . when the fuel temperature is below a predetermined set point , the diverter valve directs the warm exhaust into heat exchanger 24 . the heat exchanger may consist of a coil of metal tubing or may be formed in any manner that optimizes the exchange of heat between the warm exhaust gas and the liquid fuel . the exhaust gas , after passing through heat exchanger 24 , enters into a scrubber cell 21 where it is stripped of any volatile organic compounds ( voc ) contained in the exhaust stream . the benign components of the exhaust , co 2 and h 2 o vapor , are expelled from the scrubber exhaust tube 19 directly to the ambient atmosphere . if the fuel temperature is above a predetermined set point , diverter valve 12 directs the exhaust to diverter output tube 18 . diverter output tube 18 circumvents the fuel chamber and heat exchanger , going directly into scrubber cell 21 where it is cleaned of any volatile organic compounds and released to the atmosphere . the scrubber cell contains absorbents that selectively absorbs voc &# 39 ; s while allowing the co 2 and water vapor to pass through . many techniques for cleaning exhaust gas are known in the art . use of a dry absorbent 27 , generally known as activated carbon , for example , the coconut shell base type supplied by adcoa inc ., has been found to provide acceptable performance . a combination of passing the exhaust gas through water , followed by a dry absorbent is even more effective and can absorb 25 % to 50 % of its weight in voc &# 39 ; s without releasing any detectable quantity to the atmosphere . the observation that axial thermal conductivity has an effect on combustion zone behavior and temperature profiles can be qualitatively and quantitatively approximated by modeling the phenomenon as a one dimensional differential heat flow equation . while this simplified approach does not explicitly contain all the parameters normally included in catalytic reactor design ( e . g . h . h . lee : &# 34 ; heterogeneous reactor design &# 34 ;, butterworth publishers , 1985 ), it has been discovered to have sufficient predictive power to elucidate this portion of the design scheme utilized in the present invention . h 1 = rate of heat energy lost at the surface of the heat element by forced convection of the fuel - air flow stream . for the purposes of this model , radiation loss is considered negligible and conduction loss is axial only ( x direction ). h 2 = equivalent chemical heat power carried in the fuel - air flow stream , all of which is assumed to react at the surface of the heat element where the catalyst contacts the flow stream . c = a constant proportional to the ratio of h 2 / v , where v is the velocity of the flow stream . it represents transport resistance resulting from back pressure at the heat element . alternatively , it may be viewed as a virtual counterflow term transporting heat in the direction opposite to the main stream flow . this term is primarily responsible for causing the asymmetry in the temperature profiles ( i . e . combustion zone contraction or expansion ) seen in fig1 a , 13b , 13c and fig1 a and 14b . it illustrates the need for small cross sectional flow channel area , a , in order to keep v high ( i . e . v = f / a ). for a fixed volume flow rate f , the term h 2 is proportional to the fuel / air ratio and thus explains why relatively high fuel / air ratios tend to exhibit highly non - symmetric temperature distributions unless compensated by the methods described in this invention , such as by increasing the axial thermal conductivity and / or spatially modulating the catalytic activity . the solution to this equation with constant coefficients and boundary conditions t ( 0 )= 0 and t ( 1 )= 0 , may be expressed as ; the temperature dependence of the catalyst reaction rate constant is approximated by using only the first order term of an assumed arrhenius temperature dependence . in that case we have ; h total = h 2 [ 1 + ฮฑt ]. at the relatively low temperatures and operational conditions encountered in this invention , this appears satisfactory as an approximation . furthermore , since h 2 is proportional to the chemical thermal power content of the fuel - air stream and h 1 is proportional to the flow stream velocity , the coefficient , ฮณ , may be re - written as ; p = equivalent chemical thermal power contained in the fuel - air stream , and assumes complete combustion . f = volume flow rate of the fuel - air stream ; where f = flow velocity times channel cross sectional area , a . n = nominally set to 1 . 0 but can change depending on geometry of the heat element . fig1 a and 14b were plotted by substituting eq . 2 into the solution for eq . 1 and solving for constants that best fit empirical values of p and f . physically , the s f n term relates to the cooling effect of the fuel - air stream on the heat element . the rate of cooling is dependent on such things as temperature , laminar or turbulent flow and properties of the gas itself . this cooling effect is competing with the heat producing effect of the catalytic reaction ( i . e . ap ). the effect of the k value ( axial thermal conductivity ) on combustion zone temperature profiles is plotted in fig1 a through 13c . fig1 a closely approximates actual performance data of the aluminum core heating element shown in fig9 and fig1 b typically results when heat element construction is similar to fig1 . the temperature contours shown in fig1 a & amp ; 14b are a best fit of the theoretical solution of equation 1 to the actual data obtained for these structures and match within ยฑ 15 % over the range of flow rates and equivalent thermal powers shown . the contour temperatures are the values obtained at the central axial position along the heat element and are displayed in terms of an increase above ambient temperature . for data collection purposes , the heat element was allowed to rest in a 20 cm long glass tube of 4 mm i . d ., with one end of the glass channel connected to a fuel - air supply and the other open to the atmosphere . the upper boundary of the region labeled combustion zone contraction in fig1 a , represents the points where the entrance end and middle section of the heat element reach equal temperatures , thus indicating that the temperature profile is becoming significantly asymmetric , as for instance seen in fig1 c . the boundary and size of this region will shift as the axial thermal conductivity changes . an increase in thermal conductivity pushes the contraction zone to the right in fig1 a , thus causing an apparent shrinking of the area where combustion zone contraction will occur . a decrease in average axial thermal conductivity will have the opposite affect , resulting in a condition where very lean mixtures must be used to avoid contracting the combustion zone . very lean mixtures require higher flow rates ( i . e . pump power , size and weight ) to achieve the same thermal power output . the observation regarding the effect of axial spatial modulation of catalytic activity on combustion zone behavior and temperature profiles , may be qualitatively and quantitatively approximated by modeling the phenomenon as a one dimensional differential heat flow equation of the following type . x = axial distance along heat element axis with the zero point defined at the fuel - air entrance side . this equation is similar to eq . 1 except that the coefficient of the temperature term is dependent upon the axial position along the heat element and the forcing function on the right side of the equation changes similarly . it is arrived at by substituting the relation h 2 = ฮทx - a in the equation h total = h 2 [ 1 + ฮฑt ]. a numerical solution of equation eq . 3 with n = 2 and n = 0 with suitable boundary conditions is shown in fig1 . these simple models have been found satisfactory in providing reasonable approximation for catalytic heat element temperature distribution over a wide range of input conditions and are good qualitative guides to predict general behavior . they have confirmed the surprising results obtained regarding the effects of thermal conductivity and catalytic spatial modulation on flameless combustion zone behavior . while the preferred application of the present invention has been shown and described , it should be apparent to those skilled in the art that many more modifications are possible without departing from the invention concept herein described . for example , a gaseous fuel and air mixture may be stored in one or more pressurized cylinders ( fuel sources ) and transported ( without pumping ) to the heat sheet . alternatively , a compressed and regulated air source commonly used in scuba equipment or a chemically generated source of oxygen rich gas may be substituted for the air pump and still be within the scope of this invention . also , the fuel may be other than methanol . moreover , the elastomeric body of the heat sheet may have thermally conductive layers embedded within it to further enhance the conduction and distribution of heat out of the channels and across the surface of the sheet . for example , strips of thin metal foil could be molded into the heat sheet plastic material thereby altering the manner of heat transfer between the heat elements and the body of the heat sheet without affecting the flexibility of the heat sheet . alternatively , the plastic material of the heat sheet itself could be formulated to increase heat conduction by the use of additives such as metal particles and the like . similarly , the heat sheet body could be made of a laminate of different elastomeric materials , each with its on unique heat conducting properties . therefore , the appended claims are intended to encompass within their scope all such changes and modifications which fall within the true spirit and scope of this invention and should not be determined by the embodiments illustrated , but by the appended claims and their legal equivalents .
5
before proceeding to the detailed description of the preferred and alternate embodiments , several general comments can be made about the applicability and the scope of the invention . first , the glasses with which the invention may be used may be any of the wide variety known in the art , including prescription glasses , sun glasses , safety glasses and the like . second , the illustrated techniques for attaching the protective component to the stems of the glasses are illustrative and may be interchanged without departing from the spirit and scope of the present invention . the preferred fabric for use in the present invention is a stretchable fabric . a number of fabrics and materials have been found suitable , including silicon rubber , poly / cotton knits , nylon / lycra knits and acrylic / elastic knits . this allows the pouch to be stretched to accommodate and safely protect the glasses . for some embodiments , especially one which uses a retainer snap , such stretchability may not be required . further , a wide variety of fabric colors and textures can be employed . the fabric should , of course , be one which does not damage the glasses . in addition , the fabric may have self - polishing characteristics as the glasses are inserted and removed . it is also within the scope of the present invention to employ fabrics which include a cellular construction or into which hollow plastic tubes or other hollow devices may be placed , so that the pouch retains a water buoyancy for use with such activities as boating and the like . proceeding now to a description of the preferred and alternate embodiments , a retainer and protective cover 10 for eyeglasses 12 is illustrated both in a retainer configuration , in which the device retains the glasses on the head of a user , and in a cover configuration , in which the device serves as a protective storage pouch for the glasses . as shown in the figures , eyeglasses 12 are of a common type , including lenses 14 , 16 and a pair of stems 18 , 20 . as illustrated in fig1 cover 10 is adapted for attachment to stems 18 , 20 and may be slipped over the head of a user , resting behind the head for holding eyeglasses 12 in place . cover 10 is generally hollow and tubular in construction , having open - ended retaining extensions 22 and 24 formed to be slipped over and snuggly hold stems 18 and 20 of glasses 12 as described below . cover 10 is preferably formed of a single piece of fabric that is folded along an upper edge 25 into a tubular structure and hemmed along a lower edge 26 . alternatively , cover 10 may be formed of more than one fabric pieces , such as self - similar pieces sewn together along edges 25 and 26 . as best illustrated in fig3 side fabric panels of cover 10 include a broad center portion defining a pouch 27 . lower edge 26 , preferably hemmed from open ends 22 and 24 , follows the contour of pouch 27 and terminates at corners 28 of a central opening 29 through which eyeglasses 12 may be inserted into and removed from pouch 27 . a biasing hem 30 is sewn around the periphery of pouch 27 and at about the mid - point thereof , generally continuing a line formed by lower edge 26 at the point where it intersects corners 28 of opening 29 biasing hem 30 generally defines a bead along the outer surface of pouch 27 separating a first portion 32 of pouch 27 from a second portion 34 thereof , and tending to fold second portion 34 into first portion 32 as shown in fig2 . biasing hem 30 thus forms a &# 34 ; soft hinge &# 34 ; structure along which second portion 34 is attached to first portion 32 and along which the two portions move as second portion is tucked into pouch 27 as shown in fig1 and 2 , and removed therefrom as shown in fig3 . this feature of the invention permits case profile conveniently assume a relatively narrow profile when in the retainer configuration shown in fig1 while providing an enlarged cover configuration as described more fully below . in addition to biasing hem 30 , second portion 34 of pouch 27 includes a lower border 36 formed around aperture 29 . border 36 is preferably a folded hem formed of a stretchable stitch or elastic strip tending to close or slightly constrict border 36 , and thereby aperture 29 . in the region of border 36 , at approximately a longitudinal mid - point of pouch 27 , mating closure members 38 and 40 are provided . in the preferred embodiment illustrated , closure members 38 , 40 are mating snap - type closures that lie in mutually facing relation when second portion 34 of pouch 27 is folded within first portion 32 , as discussed below with respect to fig7 . alternatively , other mating closure devices may be utilized , such as button closures and the like . from the retainer configuration illustrated in fig1 and 2 , device 10 is converted to its cover configuration as follows . first , eyeglasses 12 are folded , and closure members 38 , 40 are uncoupled from one another within the folded pouch , and second portion 34 is removed or unfolded from first portion 32 . pouch 27 is then grasped in the region of aperture 29 , and inverted ( i . e ., turned inside - out ) over eyeglasses 12 , stretching border 36 around eyeglasses 12 and thereby enveloping them within pouch 12 as shown in fig4 . as shown in fig5 once eyeglasses 12 are lodged completely within inverted pouch 27 , mating closure members 38 , 40 will again be located in mutually facing relation . members 38 , 40 are then coupled to positively close aperture 29 and prevent eyeglasses 12 from falling or otherwise being removed from case 10 . fig7 and 8 illustrate , in cross section , the orientation of the portions of case 10 described above in their retainer and cover configurations . eyeglasses 12 are not shown in fig7 and 8 for the sake of clarity . as shown in fig7 in the retainer configuration , case 10 is folded or collapsed into a relatively narrow band or strip by nesting second portion 34 of pouch 27 within first portion 32 , with biasing hem 30 located at the bottom of the band . closure members may be mated in this configuration to prevent second portion 34 from falling or unfolding from first portion 32 . as shown in fig8 when case 10 is unfolded and inverted into its cover configuration , biasing hem 30 is located within pouch 27 along with retainer ends 22 , 24 ( not shown ). it should be noted that , due to the unfolding of pouch 27 ( as shown in fig3 ) and its inversion ( as shown in fig4 and 5 ), mating closure members 38 and 40 are once again located in mutually facing relation in the cover configuration shown in fig8 . thus , closure members 38 , 40 serve both to retain pouch 27 in its collapsed position ( fig7 ) as well as to close pouch 27 and positively hold the eyeglasses within the pouch in the expanded and inverted position ( fig8 ). a second embodiment of case 10 is shown in fig9 through 12 . in this embodiment , a pouch 27 is formed of the desired fabric by folding and sewing . the pouch 27 has an opening 29 along one edge while two elongate ends 22 and 24 are provided , each containing an elastomeric tube adapted to fit over , surround and releasably secure pouch 27 to glasses 12 . such tubular connections are well - known , in and of themselves . a cord 42 is provided about opening 29 and is free to move within a seam 44 ( see fig1 ) so that opening 29 may be reduced in size by pulling on cord 42 . a cord lock 46 , or similar clamping device or a type well known in the art , may be provided over cord 42 to facilitate keeping opening 32 at a desired size . fig1 through 12 illustrate how eyeglasses 12 are progressively inserted into pouch 27 . as shown in fig1 , eyeglasses 12 are first folded , effectively flipping pouch 27 which remains coupled to stems 18 and 20 . lock 46 is then drawn away from pouch 27 to permit opening 29 to be expanded to receive the glasses . the eyeglasses 12 are then progressively inserted into pouch 27 through opening 29 as shown in fig1 . it should be noted that in this embodiment , as eyeglasses 12 are inserted into pouch 27 , the pouch is effectively wrapped around the eyeglasses and progressively turned inside - out with the eyeglasses contacting the previously outwardly - facing surface of the pouch . once the eyeglasses are completely inserted into pouch 27 , pouch 27 is closed by drawing lock 46 along cord 42 and into contact with pouch 27 to effectively close opening 29 . it should be mentioned that alternative closure devices may be used with the pouch , particularly in the embodiment illustrated in fig9 through 12 . such closure devices might include snaps , buttons , zippers and the like . while the present invention has been illustrated in connection with four separate embodiments , several features of the invention are common to the embodiments , such as the ability to insert the glasses into the retainer without detachment of the retainer cords or tubes .
0
the preferred embodiment of the present invention facilitates spooling of print jobs in a device independent format . in particular , the preferred embodiment of the present invention spools print jobs in the enhanced metafile format . print jobs are easily and quickly converted into the enhanced metafile format for spooling . the enhanced metafile format has the additional advantage that it occupies substantially less space than typical raw data formats . an enhanced metafile as used herein refers to the enhanced metafile format that is employed in the microsoft windows nt operating system , sold by microsoft corporation of redmond , wash . an enhanced metafile is a file that stores information for displaying or printing a picture in a device independent format . metafiles are typically contrasted with bitmaps in that metafiles typically hold metadata that specify how to draw the associated picture rather than bitmaps of the associated picture . before discussing how print jobs are spooled as enhanced metafiles , it is helpful to review the format of an enhanced metafile 10 ( shown in fig1 ). each enhanced metafile 10 includes a header 12 and may optionally include a description string 14 . the remainder of the enhanced metafile 10 is formed by metafile records 16 and an optional palette 18 . the enhanced metafile header 12 holds a number of different types of information , including dimension information , resolution information , version information and size information . specifically , the enhanced metafile header is defined as follows ( in c ++ code ): __________________________________________________________________________typedef struct tagenhmetaheader dword itype ; // record type emr . sub .-- header . dword nsize ; // record size in bytes . this may be greater // than the size of ( enhmetaheader ). rectl rclbounds ; // inclusive - inclusive bounds in device units . rectl rclframe ; // inclusive - inclusive picture frame of // metafile in . 01 mm units . dword dsignature ; // signature . must be enhmeta . sub .-- signature . dword nversion ; // version number . dword nbytes ; // size of the metafile in bytes . dword nrecords ; // number of records in the metafile . word nhandles ; // number of handles in the handle table . // handle index zero is reserved . word sreserved ; // reserved . must be zero . dword ndescription ; // number of chars in the unicode description string . // this is 0 if there is no description string . dword offdescription ; // offset to the metafile description record . // this is 0 if there is no description string . dword npalentries ; // number of entries in the metafile palette . sizel szldevice ; // size of the reference device in pixels . sizel szlmillimeters ; // size of the reference device in millimeters .} enhmetaheader ; __________________________________________________________________________ the optional description field 14 of the enhanced metafile 10 is used to hold a written description that identifies what is contained within the enhanced metafile . the enhanced metafile records 16 form the core of the enhanced metafile 10 . each enhanced metafile record 16 corresponds to a graphics device interface ( gdi ) function ( which will be described in more detail below ) for drawing the picture associated with the metafile . each enhanced metafile record 16 has the following format . ______________________________________typedef struct tagenhmetarecord dword itype ; // record type emr . sub .-- xxx dword nsize ; // record size in bytes dword dparm 1 ! ; // dword array of parameters } enhmetarecord ; ______________________________________ the itype field of the enhanced metafile record 16 holds a value that specifies the type of enhanced metafile record . listed below is a sampling of the types of enhanced metafile records and their corresponding itype values . __________________________________________________________________________record value record value__________________________________________________________________________emr . sub .-- abortpath 68 emr . sub .-- fillpath 62emr . sub .-- anglearc 41 emr . sub .-- fillrgn 71emr . sub .-- arc 45 emr . sub .-- flattenpath 65emr . sub .-- arcto 55 emr . sub .-- framergn 72emr . sub .-- beginpath 59 emr . sub .-- gdicomment 70emr . sub .-- bitblt 76 emr . sub .-- header 1emr . sub .-- chord 46 emr . sub .-- intersectcliprect 30emr . sub .-- closefig6 emr . sub .-- invertrgn 73emr . sub .-- createbrushindirect 39 emr . sub .-- lineto 54emr . sub .-- createdibpatternbrushpt 94 emr . sub .-- maskblt 78emr . sub .-- createmonobrush 93 emr . sub .-- modifyworldtransform 36emr . sub .-- createpalette 49 emr . sub .-- movetoex 27emr . sub .-- createpen 38 emr . sub .-- offsetcliprgn 26emr . sub .-- deleteobject 40 emr . sub .-- paintrgn 74emr . sub .-- ellipse 42 emr . sub .-- pie 47emr . sub .-- endpath 60 emr . sub .-- plgblt 79emr . sub .-- eof 14 emr . sub .-- polybezier 2emr . sub .-- excludecliprect 29 emr . sub .-- polybezier16 85emr . sub .-- extcreatefontindirecttw 82 emr . sub .-- polybezierto 5emr . sub .-- extcreatepen 95 emr . sub .-- polybezierto16 88emr . sub .-- extfloodfill 53 emr . sub .-- polydraw 56emr . sub .-- extselectcliprgn 75 emr . sub .-- polydraw16 92emr . sub .-- exttextouta 83 emr . sub .-- polygon 3emr . sub .-- exttxtoutw 84 emr . sub .-- polygon16 86emr . sub .-- polyline 4 emr . sub .-- setbrushorgex 13emr . sub .-- polyline16 87 emr . sub .-- setcoloradjustment 23emr . sub .-- polylineto 6 emr . sub .-- setdibitstodevice 80emr . sub .-- polylineto16 89 emr . sub .-- setmapmode 17emr . sub .-- polypolygon 8 emr . sub .-- setmapperflags 16emr . sub .-- polypolygon16 91 emr . sub .-- setmetargn 28emr . sub .-- polypolyline 7 emr . sub .-- setmiterlimit 58emr . sub .-- polypolyline16 90 emr . sub .-- setpaletteentries 50emr . sub .-- polytextouta 96 emr . sub .-- setpixelv 15emr . sub .-- polytextoutw 97 emr . sub .-- setpolyfillmode 19emr . sub .-- realizepalette 52 emr . sub .-- setrop2 20emr . sub .-- rectangle 43 emr . sub .-- setstretchbltmode 21emr . sub .-- resizepalette 51 emr . sub .-- settextalign 22emr . sub .-- restoredc 34 emr . sub .-- settextcolor 24emr . sub .-- roundrect 44 emr . sub .-- setviewportextex 11emr . sub .-- savedc 33 emr . sub .-- setviewportorgex 12emr . sub .-- scaleviewportextex 31 emr . sub .-- setwindowextex 9emr . sub .-- scalewindowtextex 32 emr . sub .-- setwindoworgex 10emr . sub .-- selectclippath 67 emr . sub .-- setworldtransform 35emr . sub .-- selectobject 37 emr . sub .-- stretchblt 77emr . sub .-- selectpalette 48 emr . sub .-- stretchdibits 81emr . sub .-- setarcdirection 57 emr . sub .-- strokeandfillpath 63emr . sub .-- setbkcolor 25 emr . sub .-- strokepath 64emr . sub .-- setbkmode 18 emr . sub .-- widenpath 66__________________________________________________________________________ each enhanced metafile record 16 also includes an nsize field that specifies the size of the enhanced metafile record in bytes and a dparm field that holds an array of parameters . the optional color palette field 18 of the enhanced metafile 10 holds a palette sequence for a foreground palette to be used when the picture associated with the enhanced metafile is drawn . fig2 is a block diagram of an environment suitable for practicing the preferred embodiment of the present invention . this environment includes a workstation 20 that may communicate with a print server 22 . the print server 22 is responsible for printers 24a , 24b , and 24c and includes its own secondary storage 39 . a logical port is associated with each of the printers 24a , 24b , and 24c . those skilled in the art will appreciate that the configuration shown in fig2 is merely illustrative and that the present invention may be practiced in other environments as well . the workstation 20 includes a central processing unit ( cpu ) 26 that has access to a memory 28 and a secondary storage 30 . the memory 28 holds a copy of an operating system 32 and an application program 33 that may be run on the cpu 26 . in the preferred embodiment of the present invention , the operating system 32 includes the win32 api , such as found in microsoft windows nt operating system . moreover , the operating system 32 includes code for implementing enhanced metafile spooling as described herein . the workstation further includes input / output devices , such as a mouse 34 , a keyboard 36 and a video display 38 . in the preferred embodiment of the present invention , a program , such as application program 33 , initiates a request to print a document on one of the printers 24a , 24b , or 24c . instead of the document being converted into a format specific to the selected printer , the document is converted into the enhanced metafile format and spooled . the application program 33 and the user believe the document has been printed in conventional fashion when the document has , instead , been spooled . the spooling of the document as an enhanced metafile is entirely transparent to the application program 33 and to the user . the spool file is then used to print the document as a background thread . fig3 is a block diagram showing some of the software components and structures that play a role in the preferred embodiment of the present invention . the application program 33 is the program that initiates a printing request . those skilled in the art will appreciate that the application program may be any type of program that is capable of initiating a printing request . the application program 33 initiates a printing request by making calls to functions in the graphical device interface ( gdi ) 40 . the gdi 40 is part of the operating system 32 that serves as an interface between the application program 33 and lower level functions . the gdi 40 provides functions that the application program 33 may call to display graphics and formatted text . in the preferred embodiment of the present invention , the gdi 40 includes the 16 - bit gdi and 32 - bit gdi found in the microsoft windows nt operating system , as well as additional components . the gdi interacts with a printer driver 41 during creation of a spool file and during playback of the enhanced metafile records of the spool file . the gdi 40 interacts with a spooler process 42 , that is part of the operating system 32 run on the workstation 20 . the spooler process 42 interacts with a router 44 to send print data and information to its appropriate destination . the router 44 is a printing component that locates the printer requested by the application program 33 and sends information from the workstation spooler 42 to the appropriate print server spooler . as the workstation 20 may be connected both to a local print server 22 ( as shown in fig2 ) and to other networks that include additional print servers for remote printers , the router 44 must decide where the requested printer is located . the router 44 sends information initially from the spooler 42 to the appropriate net provider 46 and 48 or local spooler process 50 . for purposes of simplicity , in the example shown in fig3 it is assumed that the information is passed to a local spooler 50 . the local spooler 50 is responsible for creating the spool file 52 that holds the enhanced metafiles that are created for the document . fig4 is a flowchart showing the steps that are performed to print a document when enhanced metafile spooling is used in the preferred embodiment of the present invention . initially , the application begins to print a document ( step 54 ). in order to print a document , the application 33 must create a device context . the device context is a data structure that holds information about a graphics output device , such as a printer . these attributes determine how the functions of the gdi 40 work on the target printer . the application program 33 must first obtain a handle to a device context for the printer to which the application wishes to print . in addition , the window manager sets the visible region to be empty so that no output is produced when a gdi function is called . the window manager is part of the operating system 32 that is responsible for managing windows and the visible region is a structure maintained by the window manager to determine what is visible to a user in a window . in step 56 , the document is converted into enhanced metafile format and stored in the spool file 52 . fig5 is a flowchart of the steps that are performed to store the document as a set of enhanced metafiles . initially , a device context for the enhanced metafile is created by calling the createenhmetafile () function . this function creates a device context for an enhanced format metafile . this function is passed a number of parameters , including a handle to a reference device for the enhanced metafile . a handle is a numerical identifier that uniquely identifies a reference device . in this case , the handle to the reference device is a handle to the device context of the target printer . the handle to the enhanced metafile device context returned by the function is then passed as a parameter to each of the gdi function calls that the application program 33 issues to print the document ( step 66 ). the operating system 32 converts each gdi function into an enhanced metafile record and appends the record to the end of the enhanced metafile ( step 68 ). the operating system 32 includes an enhanced metafile recorder for converting the gdi function calls to enhanced metafile records . each page of the document is stored as a separate enhanced metafile as will be discussed in more detail below . the operating system 32 has a means for differentiating between gdi function calls that are to be spooled in an enhanced metafile and those that are to be directly executed . fig6 shows a flowchart of the steps that are performed in the preferred embodiment of the present invention to differentiate such gdi function calls and to record function calls in enhanced metafiles as required . initially , the application program makes a gdi function call that passes the device context of the enhanced metafile as a parameter ( step 70 ). like other gdi function calls , this gdi function call is passed to a validation layer of the operating system 32 ( step 72 ). the validation layer is responsible for examining the parameters of the function call to make sure that they are correct . the preferred embodiment of the present invention embellishes the validation layer to check whether the device context passed as a parameter to the gdi function call refers to an enhanced metafile ( step 74 ). as described above , if the device context is an enhanced metafile , the enhanced metafile recorder is called to convert the gdi function call into an enhanced metafile record ( step 76 ). next , in order to maintain transparency of the enhanced metafile spooling , the preferred embodiment of the present invention is designed to call the gdi function so that the application program believes that the document is printing . the complication , however , is that the system does not desire for the gdi functions to produce output . accordingly , the visible region used by a window manager is set to be empty so that no output is produced as discussed above . in step 80 , the gdi function is called . if the device context is not for an enhanced metafile as checked in step 74 , the gdi function is simply called directly ( step 80 ). returning to fig4 step 56 involves recording the commands in the metafiles and storing the metafiles in a spool file . two separate recorders are used to create the enhancement metafiles and the spool file . in particular , the spool file recorder is used to create the spool file and the spool file records contained therein . in contrast , the second recorder is responsible for converting graphics api calls into enhanced metafile records that are stored within the enhanced metafiles . fig7 shows the format of such a spool file 82 . the spool file 82 includes an identifier 84 that is 8 bytes in length . the spool file recorder is responsible for opening a new spool file , recording the identifier 84 and creating a sf -- startdoc record in response to a startdoc command from the application program . the sf -- startdoc record 86 has the following format : ______________________________________typedef struct . sub .-- sr . sub .-- startdoculong itype ; // sf . sub .-- startdoculong cj ; // record length in bytes . ulong ioffdocname ; // offset to docname stringulong ioffoutput ; // offset to output string } sr . sub .-- startdoc , * psr . sub .-- startdoc , far * lpsr . sub .-- startdoc ; ______________________________________ the sf -- startdoc record 86 is followed by an sf -- modechange record 88 . the sf -- modechange record 88 is followed by a devmode structure that holds information such as paper orientation , paper size , paper length , paper width , color information and the like , which enables the document to properly be printed on the target printer . the spool file 82 also includes a metafile sequence 90 that is created by the recorders . fig8 shows an example of a series of records that are repeated within the metafile sequence 90 . in particular , this sequence is repeated for each page of the document to be printed . the sf -- startpage record 94 is created by the spool file recorder in response to the startpage command from the application program . an enhanced metafile is created in response to the startpage command to receive the contents of the page . the sf -- startpage record 94 designates the start of a page of the document and has the following format : ______________________________________typedef struct . sub .-- sr . sub .-- startpageulong itype ; // sf . sub .-- startpageulong cj ; // record length in bytes . ushort iphyspage ; // page number in the file . ( 1 - n ) ushort iformat ; // data format . ( sff . sub .-- journal ) ulong ilogpage ; // page number according to the app .} sr . sub .-- startpage ; ______________________________________ the sf -- startpage record 94 is followed by an sf -- metafile record 96 that holds the name of the metafile that has the information for the associated page . the metafiles are created by the second recorder , as discussed above . specifically , the gdi graphics api calls are converted into metafile records that are held within the metafiles . the sf -- metafile record 96 is followed by an sf -- endpage record that designates the end of the page . the sf -- endpage record 96 is created by the spool file recorder in response to an endpage command from the application program . the endpage command indicates that the application is done drawing . the metafile is then closed and the name of the metafile is recorded in the sf - metafile record 94 . the sr -- endpage record has the following format : the metafile sequence 90 ( fig7 ) is followed by an sf -- enddoc record that is created in response to an enddoc command for the application . this record designates the end of the document and has the following format : as shown in fig4 after the commands have been recorded in the metafiles and the metafiles stored in the spool file in step 56 , the application program 33 is advised that it is done spooling the document ( step 58 ). a background thread at the print server 22 for the port associated with the target printer is kicked off to print the spooled document ( step 60 ). the background thread queues print jobs and then causes the document to be de - spooled and printed on the target printer ( step 62 ). the operating system 32 includes functions for playing back enhanced metafiles so as to generate the picture on the printer that is associated with the enhanced metafiles . the playenhmetafile () function plays back the enhanced metafile records so as to produce the corresponding image . this function is one of those provided by the gdi . the preferred embodiments of the present invention described herein provides several benefits . first , the turnaround time experienced by application programs is much faster because the application program is told that it is done spooling more quickly than in conventional systems . as was described above , print jobs may be quickly and easily spooled as enhanced metafiles . moreover , the printing may occur asynchronously relative to the application program . the preferred embodiment of the present invention also provides device independence that allows a user to print pages at random , to print pages out of order , and to view the contents of the document on the screen without the necessity of the device driver for a target printer being installed . the device independence also allows a user to select any of a number of printers for printing a document . for example , the user may select a draft printer which is less expensive to use to print the document and proof the document . after the document has been proofed , the user may then request to print the document on a more expensive printer . while the present invention has been described with reference to a preferred embodiment thereof , those skilled in the art will appreciate that various changes in form and detail may be made without departing from the intended scope of the claims as defined in the appended claims .
6
the efficiency of a resonant microcavity inkjet printed oled device depends strongly on the thickness , more particularly on the distribution of thicknesses , of the solution processed hole injection layer ( hil ) and of the interlayer ( il ) sometimes called the hole transport layer ( htl ). the colour of an oled device with a resonant cavity is dependent on the variation of efficiency with wavelength and thus the colour point also depends on the thickness distributions of these layers . we will describe techniques which are able to accurately predict the output of a microcavity inkjet printed panel based on the hil thickness profile before the light emitting polymer ( lep ) and cathode layers are deposited . the thickness may be measured by interferometry , for example using a white light interferometer such as the zygo new view 5000 series instrument . this approach greatly speeds up the screening of hil materials and can also provide in - line pass / fail categorisation of an hil profile , for example to predict for the thickness profile of a deposited hil layer whether or not , for example , blue emitted light from the device is within colour ( intensity and hue ) tolerance . more generally , the techniques we describe are able to be used to predict / optimise one or more parameters of an hil fabrication process including but not limited to , one or more of : a number of droplets used to deposit hil material in solution into a region / well , a droplet size / volume , and hil layer drying protocol ( such as drying duration , whether one or multiple passes are used to deposit material , maximum time between passes and so forth ). this can be done without fabricating a test cell or device with the thickness profile , saving both time and cost in achieving a profile needed to hit a srgb colour point . a โ€˜ stop / go โ€™ determination may be made after deposition of the first printed layer ( the hil layer ) rather than after three printed layers and evaporation of a cathode layer . in addition , in principle an expensive substrate , bearing tfts and a pixel wall - structure , may also be re - worked by dissolving off the hil . a previous optimisation procedure for the layer thicknesses had identified a thin ito (& lt ; 10 nm ) and thick hil (& gt ; 100 nm ) structure as being advantageous but embodiments of the new techniques identified this as a local maximum and enabled a switch to thick ito (& gt ; 50 nm ) thin hil (& lt ; 50 nm ) structures for improved performance . referring to fig2 , this shows ciex and ciey parameters from a theoretical model of a blue microcavity oled device with the following structure ( where thicknesses are shown parenthetically in nanometers ): the variation shown in fig2 is for a simple dipole emitter model , assumes optically flat films , and requires precise input of many parameters such as refractive index and dielectric constant that may not be accurately known and / or may require a time - consuming characterisation study . this approach is therefore impractical for accurately predicting the output of microcavity inkjet printed devices . further , as described below , the hil layer thickness can vary by up to +/โˆ’ 50 % across a colour ( sub -) pixel in a complex manner . another approach which may be employed is to fabricate a series of oled devices in which the layers are deposited by spin coating / casting so that the edge effects , pinning and the like in display pixels are avoided . such an approach enables the thicknesses of the layers to be well defined , for example to approximately +/โˆ’ 2 nm , and fig3 shows measured variation of the ciex and ciey parameters for the same oled structure as for fig2 . the similarity between fig2 and 3 is encouraging but the results cannot readily be transferred to inkjet printed devices in which the layer thicknesses can vary significantly , for example by more than +/โˆ’ 100 nm . fig4 shows measured thicknesses of hil , il and lep layers of an inkjet printed oled pixel with varying distance across the pixel , as measured by white light interferometry . it can be seen that in this example the il and lep thickness profiles are substantially flat whereas the hil thickness profile varies by almost 150 nm . the precise profile of the thicknesses , especially the hil thickness , is a complex function of , among other things , parameters of the solution deposition process such as material concentration , droplet size , and number of droplets , deposition time and so forth . fig5 shows , on the right , a heat map of thicknesses of the hil layer in a display pixel , illustrating the variation of hil thickness in 3 dimensions . once fabrication of the pixel is complete the output luminance and colour of the pixel is measured , spatially resolved over the area of the pixel , by employing a calibrated ccd ( charge coupled device ) camera with colour filters for tristimulus x , y and z values . this allows the cie values to be determined , as described further below , and the left hand image in fig5 shows ciey , allowing the hil profile to be matched to the corresponding output luminance and colour . fig5 also illustrates meshing of the pixel area with , here , a square mesh with elements labelled 1 - 20 . . . . this facilitates linking the average hil thickness in a square with the experimentally determined colour value , here ciey , for the hil thickness . since , for the profile of fig4 , the il and lep layers are substantially flat , this provides a rapid technique for characterising the effect of varying hil thickness within a target structure . the characterisation data of fig4 and 5 enables a calibration curve of the type illustrated in fig6 to be constructed . this shows ( in this example ) the ciey value against hil thickness for a range of different hil thicknesses . to achieve a good range of thicknesses and conditions different droplet counts of inkjet printed hil material in solution were employed , for example 4 + 6 + 6 droplets denoting 3 passes a first having 4 droplets along the length of a pixel and a second and third passes having 6 droplets along the length of a pixel . the calibration curve of fig6 shows the measured tristimulus values โ€˜ viewed โ€™ through a โ€˜ ciey filter โ€™ but it will be appreciated that ciex or ciey may also be determined or a transformation into another colour space may be employed . once a calibration curve or curves of the type illustrated in fig6 has been determined the 3d hil profile of a proposed hil formulation / process may be measured and the calibration curve used to predict the resulting light colour / intensity output . this can be done by meshing the area of a pixel , determining the average hil thickness in each mesh area element and then summing the contributions from each mesh element to determine the overall light colour and / or intensity predicted to be produced from the pixel . this summing is preferably performed in the tristimulus colour space and then the summed tristimulus values may be converted to the target colour space , for example ciexyy colour space . the validity of this procedure can be demonstrated as follows , the equations below illustrating that tristimulus values from pixel area mesh elements can be summed linearly to produce an average tristimulus value for the area of a pixel : now if we consider two sources with respective intensities i 1 and i 2 the total intensity is given by i = i 1 + i 2 and it can be seen that : x =โˆซ 0 โˆž ( i 1 ( ฮป )+ i 2 ( ฮป )) x ( ฮป ) dฮป it will be appreciated that the tristimulus y and z values may similarly , validly be linearly summed . thus to obtain average x , y and z values across the pixel the contributions from each point ( mesh element ) such as squares 1 - 20 of fig5 are simply held together . once this has been done the tristimulus values may be converted to the target colour space . for example to convert to cie xyy the following conversions are employed ( where ciey is the same as the tristimulus y value ): from the foregoing it will be appreciated that calibration curves along similar lines to fig6 are needed for tristimulus x , y and z values . the spectral sensitivity curves of filters which may be employed to determine the cie tristimulus values are illustrated in fig7 ; in effect these define spectral sensitivity curves of ( linear ) light detectors which would yield the cie tristimulus values x , y and z . the skilled person will appreciate that these may be mathematically applied to , for example , a ccd camera with a broad colour spectral response . fig8 illustrates a set of 3 ciex , y and z tristimulus calibration curves obtained for blue pixels of a pixelated oled display panel ; these approximately correspond to the ciey calibration curve shown in fig6 . from a set of curves of the type illustrated in fig8 , once the 3d hil profile of an oled pixel has been measured , the tristimulus values from points / regions across the pixel may be summed and then the result converted to ciexyy colour space using the above equations . this information may then be used to directly determine whether , were the device to be fabricated to completion , the colour would be within the tolerance range of a target , typically also specified as ciex and ciey values . it has been experimentally validated that an empirical approach of this type is sufficient to determine whether the output of a pixel is within a desired specification and this approach therefore greatly improves the rate at which hil profiles / materials / processes may be screened . fig9 a shows a predicted heat map of a colour output of an oled pixel , of a similar type to the experimentally measured colour illustrated in fig5 , and likewise showing a ( predicted ) ciey level . this information may also helpfully be expressed in the form of a histogram as illustrated in fig9 b . this shows , on the y - axis , a proportion of the total light output provided by a given hil thickness , showing the hil thickness on the x - axis ( for a set of mesh elements , not shown in fig9 a ). fig9 b illustrates that there can be a substantial variation in hil thickness within the natural area of a pixel ( a uniform thickness would appear as a delta function โ€˜ spike โ€™ in fig9 b ). nonetheless embodiments of the method we have described are able accurately to predict the colour output of the pixel and using these methods it is therefore not necessary to attempt to produce a device with a precisely uniform hil ( or other ) layer thickness , which provides an additional advantage in a production process . the skilled person will appreciate that the empirical model - based approach we have described may be employed to achieve a target colour and / or efficiency for a device by determining / defining one or more of : a mean hil thickness , a median hil thickness , a mode hil thickness , a spread , for example standard deviation , of hil thickness , an hil profile or one or more parameters defining an hil profile , and one or more hil materials . although an illustrative example of the technique has been described with particular reference to the hil layer , the skilled person will appreciate that the technique may correspondingly be applied to other layers of an oled device depending on which , in a particular production process exhibit the greatest variation . in addition the technique may be applied to a combination of layers , for example to a combination of the hil and htl layers , which is appropriate because these have a similar refractive index . although a preferred embodiment of the technique has been described with particular reference to a pixel of a pixelated oled display , it will similarly be recognised that the technique is not limited to such applications and may be applied in other situations where an oled layer thickness may vary with lateral position across a device . for example when fabricating a large area device such as a lighting tile different deposition techniques may be employed , such as evaporation . in this case the hil layer thickness may be substantially constant and the thickness of one or more other layers of the device , for example the htl or lep or lep stack or an electrode may vary ; the above described techniques may then be correspondingly employed to the one or more thickness - varying layers to similarly predict a colour and / or intensity to light output from the oled device . in general the techniques may be employed to monitor / adjust the thickness of one or more organic layers deposited using a range of techniques including , but not limited to : spin coating , inkjet printing , silk screen printing , slot - die coating , gravure printing , flexographic printing and the like ; in principle embodiments of the techniques may be employed for continuous monitoring of the predicted light output quality ( for example colour / intensity ) on a roll - to - roll production line process . broadly speaking we have described techniques for monitoring an oled production process which may be employed either for an initial configuration of a process for example determining one or more layer thicknesses , or for checking / monitoring the process , for example to determine that device parameters are ( predicted to be ) within tolerance , or both . techniques are particularly useful with pixelated , inkjet printed devices where complex effects can cause difficult to predict variations in light output . however the techniques are not limited to this application and may be employed generally to measure an organic layer thickness and in particular its profile / distribution and then to predict , at an early stage , the impact on the device to be fabricated in particular whether it will have the right colour or intensity . this may be employed for a pass / fail test and / or to modify the production process to correct for a predicted error , in particular by adjusting a thickness of one or more organic layers the device . no doubt many other effective alternatives will occur to the skilled person . it will be understood that the invention is not limited to the described embodiments and encompasses modifications apparent to those skilled in the art lying within the spirit and scope of the claims appended hereto .
7
โ€œ vitamin d โ€ means either vitamin d3 ( cholecalciferol ) and / or vitamin d2 ( ergocaciferol ). humans are unable to make vitamin d2 ( ergocalciferol ), but are able to use it as a source of vitamin d . vitamin d2 can be synthesized by various plants and is often used in vitamin d in supplements as an equivalent to vitamin d . โ€œ vitamin d metabolite โ€ means any metabolite of vitamin d other than 25 - hydroxy vitamin d3 . โ€œ 25 - oh d โ€ refers to the 25 - hydroxylated metabolite of either vitamin d2 or vitamin d3 which is the major circulating form found in plasma . โ€œ prevent โ€ is meant to include amelioration of the disease , lessening of the severity of the symptoms , early intervention , and lengthening the duration of onset of the disease , and is not intended to be limited to a situation where the patient is no longer able to contract the disease nor experience any symptoms . eotaxins ( also called ccl - 11 , ccl - 24 , and ccl - 26 ) are three proteins which belong to the cc family of chemokines . they are selective recruiters of eosinophils , and also induce the aggregation of eosinophils . eosinophils play an important beneficial role in killing some invasive microbes and helminths , especially in the gut . recent studies also suggest a role in organogenesis , tissue repair , and immune regulation . however , abnormally high amounts of eosinophils in the circulation and in some tissues are characteristic of many pathologies , including allergic diseases ( including asthma , rhinitis , and atopic dematitis ), other inflammatory disorders ( including inflammatory bowel disease , eosinophilic gastroenteritis , and pneumonia ), non - allergenic inflammation ( such as that induced by ozone inhalation or foreign body granlomatous reactions ) as well as some malignancies ( such as hodgkin &# 39 ; s disease and various leukemias ). it has been surprisingly found that administration of 25 - oh d3 lowered the level of eotaxin in the serum of postmenopausal women . the group receiving 25 - oh d3 had a statistically significant lower amount compared to the group receiving vitamin d3 . both 25 - hydroxy vitamin d3 and vitamin d3 lowered eotaxin amounts compared to placebo . thus , administration of 25 - oh d3 would be beneficial for treatment and prevention of diseases and symptoms associated with high levels of eotaxin , as detailed below . as explained in pease et al , 2001 curr . opinion in pharmacol . 1 ( 3 ): 248 - 253 , which is hereby incorporated by reference , one of the characteristic features of asthma is the accumulation of eosinophils in the bronchial walls . when the eosinophils release their contents ( including major basic protein ), tissue damage and bronchial hyperreactivity , the hallmark of asthma , occur . individuals diagnosed with asthma have been found to have an increased eotaxin level , and those experiencing acute asthma have been reported to have higher levels than those with stable asthma . similarly , individuals having occupational asthma were also seen to have higher eotaxin levels . in mice models , a disruption of the eotaxin gene resulted in a reduction of eosinophil recrutiment in an asthma mode . similarly , administration of an eotaxin - neutralizing antibody also was found to reduce lung esophilila . thus another aspect of this invention is a method to decrease the symptoms of asthma by administering a eotaxin - reducing effective amount of 25 - oh d3 to a person in need of such reduction . the resulting reduction of eosinophil aggregation would lead to an observable reduction in symptoms of asthma , notably the easing of bronchial restriction . another aspect of this invention is the use of 25 - oh d3 in the method of making an asthma medicament . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known asthma medicaments and / or therapies . allergic rhinitis and sinusitis eotaxin was found to be present in epithelial and inflammatory cells in nasal passages of individuals with allergic rhinitis and sinusitis . ( see fiest et al 2006 j allergy clin immunol 118 : 536 - 8 , which is hereby incorporated by reference ). thus eotaxin is a target for reduction in these conditions . atopic asthma refers to allergic conditions such as hayfever and allergic dermatits . increased expression of eotaxin has been observed in these conditions , as well . thus another aspect of this invention is a method to decrease the symptoms of allergic rhinitis or sinusitis by administering a eotaxin - reducing effective amount of 25 - oh d3 to a person in need of such reduction . the resulting reduction of eosinophil aggregation would lead to an observable reduction in symptoms of rhinitis or sinusitis , including decrease in swelling and inflammation . another aspect of this invention is the use of 25 - oh d3 in the method of making a medicament suitable for rhinitis or sinusitis . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known rhinitis or sinusitis medicaments and / or therapies . thus another aspect of this invention is a method to decrease the symptoms of or hayfever or allergic dermatitis by administering a eotaxin - reducing effective amount of 25 - oh d3 to a person in need of such reduction . the resulting reduction of eosinophil aggregantion would lead to an observable reduction in symptoms of hayfever or allergic dermatis , including decrease in swelling and inflammation . another aspect of this invention is the use of 25 - oh d3 in the method of making a medicament suitable for hayfever or allergic dermatitis . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known hayfever or allergic dermatitis medicaments and / or therapies . chronic inflammatory diseases of the nose and sinuses can lead to the formation of nasal polyps , and this involves an up - regulation of eotaxin ( see rankin et al 2000 molecular medicine today 6 : 20 - 27 , which is hereby incorporated by reference . administration of 25 - oh d3 , and / or vitamin d3 , in accordance with this invention will decrease eotaxin levels , and thus ameliorate , prevent or treat the formation and growth of nasal polyps . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known medicaments and / or therapies for nasal polyps . normally , eosinophils are not found in the esophageal mucosa , but it some disease states , they can accumulate there , having a proinflammatory effect . there are several gastric disorders which involve the presence of eosinophils and increased eotaxin in the gut : normally , eosinophils are not found in the esophageal mucosa , but it esinophilic esophagitis , they can accumulate there , having a pro - inflammatory effect . symptoms include dysphagia , chest pain and food impaction . in children , it can include nausea and vomiting , weight loss , anemia and failure to thrive . often patients have a history of allergies , including food allergies to high protein foods such as milk , eggs , soybean , wheat , chicken and nuts . the eosinophils in the esophageal mucosa release major basic protein , which induces smooth muscle contractions , that are thought to be mechanistically similar to the broncho - constriction observed in asthma . thus , reducing the amount of eotaxins would ameliorate the symptoms of eosinophilic esophagitis . thus another aspect of this invention is a method to decrease the symptoms of eosinophilic esophagitis by administering a eotaxin - reducing effective amount of 25 - oh d3 to a person in need of such reduction . the resulting reduction of eosinophil aggregantion would lead to an observable reduction in symptoms of eosinophilic esophagitis , including decrease in smooth muscle contraction , dysphagia , chest pain , food impaction , nausea , and vomiting . another aspect of this invention is the use of 25 - oh d3 in the method of making a medicament suitable for eosinophilic esophagitis . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known eosinophilic esophagitis medicaments . eosinophils have been implicated in the pathogenesis of iba ( see wedemeyer et al 2008 best practice & amp ; res clin gastroenterol 22 ( 3 ): 537 - 549 , which is hereby incorporated by reference . active inflammation has been associated with increased eosinophils at the site of inflammation . the release of their proteins ( including eosinophil granule cationic protein ) can cause tissue damage . thus , lowering the level of eotaxin would result in a loss of eosinophil aggregation , leading to a reduction of symptoms of iba , including inflammation . thus another aspect of this invention is a method to decrease the symptoms of irritable bowel syndrome by administering a eotaxin - reducing effective amount of 25 - oh d3 to a person in need of such reduction . the resulting reduction of eosinophil aggregation would lead to an observable reduction in symptoms of iba , including a decrease in inflammation . another aspect of this invention is the use of 25 - oh d3 in the method of making a medicament suitable for iba . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known iba therapies . crohn &# 39 ; s disease and ulcerative colitis are chronic inflammatory diseases , but no specific pathogen has been identified like ibs , they are characterized by increased levels of eosinophils . it has been shown that eotaxin - deficient mice had a reduced amount of eosinophils in the colon , and exhibit a significantly attenuated colitis compared to wild - type . thus another aspect of this invention is a method to decrease the symptoms of crohn &# 39 ; s disease or ulcerative colitis by administering a eotaxin - reducing effective amount of 25 - oh d3 to a person in need of such reduction . the resulting reduction of eosinophil aggregantion would lead to an observable reduction in symptoms of crohn &# 39 ; s disease or ulcerative colitis , including decrease in swelling and inflammation . another aspect of this invention is the use of 25 - oh d3 in the method of making a medicament suitable for crohn &# 39 ; s disease or ulcerative colitis . the 25 - oh d3 may be used as an adjunct to or in co - therapy with known crohn &# 39 ; s disease or ulcerative colitis therapies . hogan et al 2004 aliment pharmacol ther 20 : 1231 - 1240 , which is hereby incorporated by reference , propose that reduction of eosinophils would be beneficial in other gastrointestinal conditions , including food allergies , parasitic infections , and gastro - esophageal reflux . food dosages : the rda which is in place at the time the food is sold is the maximum dosage of the combination of vitamin d3 + 25 - oh d3 recommended to be incorporated into a food currently , the rda for vitamin d3 is : 400 iu for infants ( 0 - 12 months ) 600 iu for children (+ 1 year ) through adolescents and adults ( 70 years ) 800 iu for adults (+ 71 years ) 600 iu for pregnant or lactating women for 25 - oh d3 alone , there is not a current rda , as in some countries , regulations do not permit it to be added to human food ; however it is considered to be approximately 3x as active as vitamin d3 . thus , for food use , the maximum dose which should be present in a food is approximately 3 ร— less than the rda of vitamin d3 . it is noted that conventionally vitamin d3 dosages are expressed in ius , whereas 25 - oh d3 dosages are expressed in ฮผg . the amounts are readily converted , as one iu vitamin d3 is equal to 40 ฮผg . daily . a composition according to this invention where the two active ingredients are to be administered separately , or alone contains vitamin d or 25 - oh d3 in an amount from about 1 ฮผg to about 50 ฮผg , preferably about 5 ฮผg and 25 ฮผg . alternatively , a single daily dosage having both vitamin d and 25 - oh d3 contains each active ingredient in an amount from about 1 ฮผg to about 50 ฮผg , preferably about 5 ฮผg and 25 ฮผg . the dosage ratio of vitamin d to 25 - oh d3 may be from about 50 : 1 to about 1 : 50 , more preferably from about 25 : 1 to about 1 : 25 , and even more preferably from about 6 : 1 to about 1 : 6 . multiple , separate dosages may be packaged in a single kit ( or container ). for example , the kit may be comprised of thirty separate daily dosages of both actives separately ( i . e . 60 separate dosages ), or combined ( i . e . 30 dosages containing both active ingredients ). instructions for administering the dosages to a human may be included in the kit . weekly . a single weekly dosage contains vitamin d or 25 - oh d3 in an amount from about 7 ฮผg to about 350 ฮผg , and preferably from about 35 to 175 ฮผg . alternatively , a single weekly dosage may contain both vitamin d and 25 - oh d3 each in an amount from about 7 ฮผg to about 350 ฮผg , and preferably from about 35 to 175 ฮผg . the dosage ratio of vitamin d to 25 - oh d3 may be from about 50 : 1 to about 1 : 50 , more preferably from about 25 : 1 to about 1 : 25 , and even more preferably from about 6 : 1 to about 1 : 6 . monthly . a single monthly dosage contains vitamin d or 25 - oh d3 in an amount from 30 ฮผg to about 1500 ฮผg , preferably about 75 ฮผg to about 500 ฮผg . alternatively , a single monthly dosage may contain both vitamin d and 25 - oh d3 each in an amount from 30 ฮผg to about 1500 ฮผg , preferably about 75 ฮผg to about 500 ฮผg . a kit may be comprised of one , two , three , four , five , six , seven , eight , nine , ten , eleven , or twelve weekly or monthly dosages . dosage ratios of vitamin d to 25 - oh d3 should range between 50 : 1 to about 1 : 50 , more preferably from about 25 : 1 to about 1 : 25 , and even more preferably from about 6 : 1 to about 1 : 6 . bolus : a single bolus dosage contains vitamin d or 25 - oh d3 in an amount from 30 ฮผg to about 7500 ฮผg , alternatively , a single bolus dosage may contain both vitamin d and 25 - oh d3 each in an amount from 100 ฮผg to about 7500 ฮผg , ( preferably about 75 ฮผg to about 3750 ฮผg ). dosage ratios of vitamin d to 25 - oh d3 should range between 50 : 1 to about 1 : 50 , more preferably from about 25 : 1 to about 1 : 25 , and even more preferably from about 6 : 1 to about 1 : 6 . bolus dose can be followed by a daily or weekly or monthly regimen as described above . there is a scarcity of data on the relationship between orally - administered 25 - hydroxyvitamin d3 and its resulting systemic concentration in humans , in comparison to orally - administered vitamin d3 . the most comprehensive analysis to date of the kinetics of vitamin d3 and 25 - hydroxyvitamin d3 was conducted by barger - lux et al . ( osteoperosis 8 : 222 - 230 , 1998 ). healthy men were administered up to 1250 ฮผg / day of vitamin d3 over a period of eight weeks , and up to 50 ฮผg / day of 25 - hydroxyvitamin d3 over a period of four weeks . curvilinear kinetics were demonstrated for the relationship of vitamin d3 and plasma 25 - hydroxyvitamin d3 , and it was suggested that this may be due to saturation of hydroxylase activity in the liver . this was supported in that dosing with 25 - hydroxyvitamin d3 was not reported as producing curvilinear kinetics ( barger - lux et al ., 1998 ). although data on 25 - hydroxyvitamin d3 does show curvilinear kinetics , it is only evident when the dose is extended past the level considered to result in maximum physiological benefit , which may indicate the activity of a homeostatic mechanism that is overwhelmed at very high doses . within the physiological range , the relationship appears linear and comparable to barger - lux et al . these data indicate that a daily dose of between 10 ฮผg and 60 ฮผg of 25 - hydroxyvitamin d is required for maximum health benefit . a study of the pharmacokinetics in humans of orally - administered spray - dried 25 - hydroxyvitamin d3 , spray - dried vitamin d3 , or both was initiated to investigate their physiological interactions . in particular , the shapes of their dose - response curves ( which indicates the concentrations of vitamin d3 and 25 - hydroxyvitamin d3 in the circulation over a set time course , not simply the average or maximum concentration achieved ) and the steady - state kinetics were of interest . in respect of the former point , it is important to investigate the change in shape of the dose - response curves when exposure is to both vitamin d3 and 25 - hydroxyvitamin d3 . in respect of the latter point , it is also necessary to investigate their steady - state kinetics when dosing is less frequent than daily because this is the preferred regimen for groups that may have low compliance with taking daily supplements ( such as the elderly ). the following non - limiting examples are presented to better illustrate the invention . healthy , postmenopausal women ( 50 to 70 years of age ) were recruited using informed consent and screened using the following criteria : serum 25 - hydroxy vitamin d3 between 20 nmol / l and 50 nmol / l , body mass index between 18 kg / m 2 and 27 kg / m 2 , blood pressure less than 146 / 95 mm hg , serum calcium less than 2 . 6 nmol / l , fasting glucose less than 100 mg / dl , no high - intensity exercise more than three times per week , no treatment for hypertension , no use of high - dose vitamin d or calcium supplement or drug affecting bone metabolism ( e . g ., biphosphonate , calcitonin , estrogen receptor modulator , hormone replacement therapy , parathyroid hormone ), and not visiting a โ€œ sunny โ€ location during the study . subjects were randomly assigned to one of seven treatment groups ( i . e ., daily , weekly , bolus as single dose , and bolus as combination dose ). each group included five subjects . they were followed for four months in zurich , switzerland during the winter . the objective was studying and comparing the pharmacokinetic characteristics of vitamin d3 and 25 - hydroxyvitamin d3 administered to humans . equimolar quantities of both substances were investigated . the regimen was based on 20 ฮผg / day ( or its equivalent on a weekly basis ) of 25 - hydroxyvitamin d3 . for comparative purposes , it was necessary to administer equimolar quantities of either vitamin d3 or 25 - hydroxyvitamin d3 . in respect to administration of vitamin d3 , the dose was considered to be sufficient to overcome background variability and provide and efficacious dose to the participants . hard gel capsules , which are packaged in bottles , contain either 20 ฮผg or 140 ฮผg of either spray - dried vitamin d3 or 25 - hydroxyvitamin d3 per capsule . each dosage was consumed orally at breakfast . the duration of the study was four months for the โ€œ daily โ€ and โ€œ weekly โ€ groups . subjects enrolled in the โ€œ bolus โ€ group consumed orally a single dosage at the second study visit . plasma concentrations of 25 - hydroxyvitamin d3 ( e . g ., peak and steady state ) were determined by obtaining samples from the subjects at various times after the dosage was ingested . for screening purposes and to establish baseline values , a blood sample was obtained prior to enrollment into the study and the clinical laboratory measured vitamin d3 , 25 - hydroxyvitamin d3 , calcium , creatinine , albumin , and fasting glucose in the serum . on monday of week 1 of the study , pharmacokinetics of serum vitamin d3 , 25 - hydroxyvitamin d3 , and 1 , 25 - dihydroxy vitamin d3 ; serum markers ( i . e ., vitamin d3 , 25 - hydroxyvitamin d3 , calcium , creatinine , albumin , pth , got , gpt , alp , triglycerides , hdl , ldl , total cholesterol , balp , and fasting glucose ); and urine markers ( i . e ., calcium , creatinine , and dpd ) were assessed over 24 hours . daily samples for the remaining days of week 1 and monday of week 2 were taken to assess serum vitamin d3 and 25 - hydroxyvitamin d3 , serum markers ( i . e ., calcium , creatinine , albumin ), and urine markers ( i . e ., calcium , creatinine ). the assessments continued on monday of weeks 3 , 5 , 7 , 9 , 11 , 13 and 15 . on monday of week 16 , samples were taken to assess pharmacokinetics of serum vitamin d3 , 25 - hydroxyvitamin d3 , and 1 , 25 - dihydroxy vitamin d3 ; serum markers ( i . e ., vitamin d3 , 25 - hydroxyvitamin d3 , calcium , creatinine , albumin , pth , got , gpt , alp , triglycerides , hdl , ldl , total cholesterol , balp , and fasting glucose ); and urine markers ( i . e ., calcium , creatinine , and dpd ). twenty healthy postmenopausal women with 25 - hydroxyvitamin d3 levels below 25 ng / ml and a mean age of 61 . 5 years ( sd ยฑ 7 . 2 ) were enrolled in this study . participants were randomized to either 20 ฮผg of oral 25 - hydroxyvitamin d3 or 20 ฮผg of vitamin d3 per day in a double - blind manner . on 14 visits over 4 months , 25 ( oh ) d levels , and 7 inflammation markers ( eotaxin , il - 8 , il - 12 , ip - 10 , mcp - 1 , mp - 1 ( 3 , rantes ) were measured . all analyses were adjusted for baseline , age and body mass index . mean 25 ( oh ) d levels increased from 13 . 7 to 69 . 5 ng / ml in the 25 - hydroxyvitamin d3 group ( not shown ). for vitamin d3 , 25 ( oh ) d levels increased from 13 . 5 to 31 . 0 ng / ml with a slow increase over time . levels of inflammatory markers were determined at baseline and the end of the follow - up period . for most of the markers baseline levels vary considerably within a population of healthy individuals ( see e . g . campell et al human immunology vol 62 , p . 668 - 678 , 2001 ). yet , they increase during periods of infection or health deteriorations . for instance eotaxin levels significantly increase in individuals during episodes of asthma or allergy ( campell et al . international immunology vol . 14 , p . 1255 - 1262 , 2002 ). while both types of vitamin d supplementation contributed to a decrease in 5 out of 7 inflammation markers , only eotaxin levels were significantly more reduced by 25 - hydroxyvitamin d3 compared to vitamin d3 ( p = 0 . 003 ) at the end of the intervention phase . it should be noted that relative changes of different inflammatory markers ought be considered to reflect a positive impact on health rather than absolute levels , since these depend on the sensitivity of the analytical methods used . the results demonstrate the selective effect of 25 - hydroxyvitamin d3 on the levels of the inflammatory marker eotaxin .
0
fig1 to 4 are extremely diagrammatic and do not conform to the proportions of the various units shown , this being to make them easier to read . in particular , all the electrical connections , which are known per se , are not shown . the rigid substrates employed for all the examples which follow are substrates made of clear 4 mm silica - soda - lime glass . ( they could also be tinted in the bulk and have different thicknesses , for example of between 3 and 6 mm ). in all the examples which follow , the unit according to the invention uses an electrochromic system in combination with a system with liquid crystals . the system with liquid crystals employed is of the type of those described in patents wo - 90 / 03593 , u . s . pat . no . 5 , 206 , 747 and ep - 0 409 442 . it is made up of a film of transparent polymer in which microdrops of a nematic liquid crystal have previously been dispersed , which constitutes the emulsion of liquid crystals of a total thickness of 25 ฮผm , and which is sandwiched between two sheets of polyethylene terephthalate ( pet ) of 175 ฮผm thickness , each coated with a transparent conductive layer made of ito of resistivity 100 ohms per square . the structure of the system with liquid crystals is therefore the following : pet / ito / liquid - crystal emulsion / ito / pet . the liquid crystal molecules have several refractive indices : two &# 34 ; ordinary &# 34 ; indices n o which are equal in the two directions perpendicular to their axes of symmetry and an &# 34 ; extraordinary &# 34 ; index n o in the axis of symmetry . the polymer is chosen so as to have a refractive index very close to the ordinary index n o . in the absence of voltage , the axes of the various drops are not mutually correlated . at each polymer - drop interface , therefore , the incident light undergoes a high refraction due to the difference in index between the polymer and the drop whose orientation is random . the light is therefore diffused in all directions . under maximum voltage ( 110 volts ) the optical axes of the various drops are aligned in the direction of the electrical field , that is perpendicularly to the glazing . the incident light , essentially normal to the glazing , now encounters only a medium of continuous index n p equal to n o and is no longer diffused . the intermediate turbidity states are accessible with voltage values of especially between 0 and 110 volts . the type of electrochromic system employed , for its part , differs according to the type of configuration of the unit , which will be made more explicit when each of the figures is described , but here it functions in all cases by reversible insertion of h + protons . either what is involved is an electrochromic system referred to below by the term of system &# 34 ; a &# 34 ;, which is an &# 34 ; all solid &# 34 ; system , and in which the stacking of functional layers is the following : an electrically conductive layer made of sno 2 : f , of 300 nm , a layer of cathodic electrochromic material made of tungsten oxide , of 380 nm , a twin - layer electrolyte made up of a layer of hydrated tantalum oxide ta 2 o 5 . nh 2 o , of 18 nm , and a layer of hydrated tungsten oxide wo 3 ยท nh 2 o , of 200 nm , a layer of anodic electrochromic material based on hydrated iridium oxide h x iro y , of 45 nm , ( it can be replaced with hydrated nickel oxide ), the system is made to function by applying a potential of - 1 . 6 v to apply the colouring and of + 0 . 6 v for causing the system to fade . alternatively , what is involved is an electrochromic system referred to below by the term of system &# 34 ; b &# 34 ;, which employs an electrolyte in the form of a polymer and in which the stacking of the functional layers is the following : ( stacking in accordance with the teaching of patent ep - 0 628 849 ): a first electrically conductive layer made of sno 2 : f , of 300 nm , a first layer of anodic electrochromic material made of hydrated iridium oxide , of 55 nm , ( it could be replaced with a layer of hydrated nickel oxide ), a layer of hydrated tantalum oxide ta 2 o 5 ยท h x , of 70 nm , functioning as protection , a layer of electrolyte made of solid solution of polyoxyethylene with phosphoric acid poe -- h 3 po 4 , of 100 micrometers , a second layer of cathodic electrochromic material based on tungsten oxide , of 350 nm , it works in the same voltage range . each of the systems &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ; is connected to a voltage generator with the aid of current leads in the form of strips placed at the opposite ends of the two electrically conductive layers . the two electrochromic systems as described make it possible to &# 34 ; scan &# 34 ; a range of light transmission values of approximately between 5 and 60 %. in the case where an attempt is made , where necessary , to attain a real hiding effect ( which is the case with applications as back projection screen working in transmission , as mentioned above ), much lower transmission values , lower than 0 . 1 %, for example of the order of 0 . 01 to 0 . 05 %, can be attained by significantly increasing the thickness of the insertion / deinsertion layers of the functional stacking . it is thus possible to &# 34 ; thicken &# 34 ; considerably the layer of cathodic electrochromic material of the wo 3 type to values of more than 500 nm and even of more than 1000 nm , for example in thicknesses of between 500 and 1500 nm . it is also possible to thicken the layer of anodic electrochromic material , for example to employ a layer of hydrated iridium oxide of more than 100 nm and even of more than 200 nm , especially in thicknesses of 100 to 300 nm . thus , if a system of &# 34 ; b &# 34 ; type is employed with a 1000 nm layer of wo 3 and a 200 nm layer of h x iro y , a t l of approximately 0 . 01 % in the coloured state can be obtained . on the other hand , in the faded state , the maximum light transmissions which can be obtained are then not very high , especially of the order of 20 to 30 %. this corresponds to the illustration of the unit given in fig1 : the glass substrate 1 is provided , on one of its faces , with the liquid - crystal system 2 through the intermediacy of an adhesive means 3 , in the form of a sheet of double - faced adhesive which ensures the bonding by pressure ( especially using a calendering - type operation ). the electrochromic system 4 of &# 34 ; a &# 34 ; type is placed on the other face of the substrate by a succession of depositions using cathodic sputtering . this corresponds to the illustration of fig2 : there is still only one glass substrate 1 . this time the liquid - crystal system 2 is superposed on the electrochromic system &# 34 ; a &# 34 ; 4 , still through the intermediacy of a pressure - sensitive adhesive 3 . this corresponds to the illustration of fig3 : there are two glass substrates 1 , 10 , between which the liquid - crystal system 2 is placed , arranged between two sheets 5 , 6 of pvb , of eva or of pu , of 0 . 76 mm thickness . the electrochromic system of &# 34 ; a &# 34 ; type is placed either between one of the pvb sheets 6 and the glass substrate 10 , or on the external face of the substrate 10 . for greater clarity , the two configurations have been shown under references 4 and 4 bis . this corresponds to the illustration of fig4 : this time the unit according to the invention includes 3 glass substrates 1 , 10 , 11 . between the substrate 1 and the substrate 10 the liquid - crystal system 2 is placed between two pvb sheets 5 , 6 of 0 . 76 mm thickness . between the substrate 10 and the substrate 11 is placed the electrochromic system of &# 34 ; b &# 34 ; type 4 . it can be seen that , especially in this configuration , if it is envisaged to employ the unit as outward - facing glazing , the electrochromic system 4 preferably faces inwards : it is then protected from certain radiations emitted by the sun which can affect its durability , especially the ultraviolet radiations , by virtue of the interposition of the pvb sheets 5 , 6 , in which a uv screening agent is advantageously incorporated . fig5 shows a graph produced with the aid of the results obtained from example 4 . in this fig5 in fact , the values of turbidity have been plotted as the ordinate ( the turbidity , expressed as a percentage , is the ratio of the diffused transmission to the light transmission at 560 nm ), as a function of the values of light transmission as the abscissa ( expressed as a percentage according to the illuminant d 65 ) which are accessible with the glazing of example 4 and represented by all the points situated within the rectangle 15 ( edges included ). the glazing according to the invention can thus combine the low t l values associated with high turbidities , which corresponds to the left upper quadrant of the frame 15 bounding the region in which the glazing can , for example , fulfil a function of a window shutter . in the region bounded by the right upper quadrant the glazing has a high t l and a high turbidity , and it can then also fulfil a &# 34 ; concealment &# 34 ; function . a low turbidity combined with a low t l makes it possible to have a glazing permitting vision while limiting the heating - up of a room or of a compartment in the case of strong sunshine . a high turbidity combined with a variable t l makes it possible to have a glazing which can be employed as a diffusing back projection screen which is adaptable as a function of the ambient lighting in order to optimize the image quality . by way of comparison , these same values of turbidity have been plotted as a function of the t l for other types of &# 34 ; intelligent &# 34 ; glazing : the straight - line segment 16 is obtained for a laminated electrochromic glazing of the type : it does not actually &# 34 ; start up &# 34 ; completely at 0 % t l but at 5 % in the most coloured state , and scans a t l range of up to 60 % in the maximum faded state . on the other hand , the glazing is nondiffusing , regardless of the state of its colouring . the straight - line segment 17 is obtained in the case of a so - called liquid - crystal laminated glazing such as that marketed under the name of &# 34 ; priva - lite &# 34 ; by saint - gobain vitrage : the turbidity of such a glazing can vary between approximately 6 % of the values higher than 95 %. on the other hand , the variations in t l are minimal , the t l value remaining at values close to 70 %, to within 3 or 4 %. the straight - line segment 18 is employed for a laminated glazing with liquid crystals of &# 34 ; priva - lite &# 34 ; type , in which has been incorporated 2 % of a mixture of black dichroic dyes , the concentration being based on mass relative to the liquid crystals . there is a complete interdependence in the changes in t l and in turbidity . the straight - line segment 19 is obtained in the case of a glazing with an optical valve system based on dichroic particles described in patent wo - 93 / 09460 , more particularly in its example 1 . here again there is a clear interdependence in the changes in t l and in turbidity , which are moreover confined to relatively narrow ranges . it should be noted , furthermore , that the axes of the graph include negative values , which , of course , has no physical reality , but which makes the graph easier to read . the following conclusions can be drawn from the description of these examples : the unit according to the invention can assume very varied configurations , depending , for example , on whether compactness ( examples 1 or 2 ) or robustness ( example 4 ) is given priority , when a liquid - crystal system is chosen which is clamped between two pvb sheets , themselves clamped between two glass substrates , a laminated glazing is formed ( examples 3 or 4 ), from the comparison made in fig5 it can be confirmed that only one unit according to the invention makes it possible to obtain the changes in turbidity and in t l in a decorrelated manner , and especially to obtain t l / turbidity &# 34 ; pairs &# 34 ; which are inaccessible with the currently available &# 34 ; intelligent &# 34 ; glazings . the priority document of the present application , french patent application no . fr 96 / 08591 , is hereby incorporated by reference .
1
the flowchart in fig1 discloses the main features of the inventive method . the boxes symbolises a source of information , such as a database , memory or sensor , the circles symbolises an event and the arrows symbolises a flow of information . the boxes a , b , c symbolises three different sources of road information data . however , the method starts in the circle d , in which information about the position of the vehicle is collected from the position sensor p , evaluated and selected . the positions sensor p is preferably a gps or corresponding device . when the position of the vehicle is determined , road information data about possible upcoming routes is collected from the road information data sources a , b , c . all road information data comprises at least information about the inclination of the road for the upcoming route . the road information data about a route is preferably divided into portions . wherein one portion comprises information about a road segment including inclination changes of the road . memory space can thereby be saved , since portions of a road without any major changes in inclination can be left out in the road information data . this can be done , because when the road does not have any changes in inclination the vehicle mostly travels in a constant speed , wherein the driveline does not need any prediction of the upcoming route . the method therefore constantly updates the position of the vehicle and collects relevant road information data from the road information sources a , b , c . since the position is constantly updated , the direction of travel for the vehicle will be known , whereby the collection of road information data can be limited to just road information data in the direction of travel of the vehicle . collected road information data that has been evaluated and deemed not be used , are discarded t . the evaluation and selection of the road information data is made based upon a quality rating of the road information data . the quality rating is based on one or several criterions , such as the source a , b , c , of the road information data , elapsed time since recording of the road information data , outcome of the use of a driveline function based on the road information data , etc . for example , if road information data from the local database c is available , this road information data has priority over road information data from the fleet database b and / or the digital map a , wherein the road information data from the fleet database b has priority over road information data from the digital map a . a further example of a possible criterion is the time since the road information data is recorded , wherein the quality rating of the road information data is decreasing with a predefined number for every time unit ( days , months or years ) that has lapsed since the recording . when the most suitable road information data is selected , in the circle d , based on the quality rating , the drive train is controlled , in the circle e , dependent on the selected , road information data . preferably , a cruise control of the vehicle is activated , whereby predefined functions f in the drive train is selected and executed dependent of the topography of the upcoming route . such functions can be : allowing a deviation from the set speed of the cruise control of the vehicle , avoid or postpone a gear shift , and avoid a breaking of the vehicle . when the functions f above and other similar functions are activated the vehicle uses the upcoming route to optimise the performance of the vehicle . the uses of these functions f are dependent of that the road information data is correct . even though the use of the road information data can be greater during an activation of a cruise control , it is not limiting , for the invention . the controlled parameter during manual driving of the vehicle can be torque limitation or activation of a generator or other system in the vehicle , when it is topographically beneficial . as a part of the enhancement process of the invention , when such a function f has been used , an evaluation of the actual outcome of the function is made and compared with an expected outcome of the function f . if , the actual outcome of the function f does not correspond to the expected outcome , the data quality rating of the road information data used is decreased . the outcome can be measured and compared as the function is executed and / or as the function has been executed . a suitable parameter for evaluation of the outcome of the function could be the expected and actual speed of the vehicle in a certain point , for example on the top of a hill . how much the data quality rating is decreased is dependent on the deviation from the expected outcome . thereby , a great deviation between the actual and expected result might have the consequence that another source of road information data is used the next time a selection of road information data is made for the same route . the invention is however not limited to the above briefly and previously known describe functions f , an evaluation of the quality of the road information data can be made with any other function f that is dependent of topographic road information data . if a comparison between an actual value and an expected value is such that a data quality rating is changed thereby , the road data with its new mad data quality rating is saved h . further , during travelling along a route , a recording g of the route is made . the recording becomes its input from the position sensor p and other input sources i , which at least comprises an elevation sensor ( inclination sensor , gps or other suitable devices ), wherein also other parameters can be recorded , such as the sensing form vehicle sensors and external devices , weather and wind sensors etc . the circle h represents an evaluation of the recorded and used road information data . a decision if a recording of road information data of a route should be saved into the local database c or discarded t is made in the circle h . the recoding is saved , if : there are no existing road information data of a route in the local database c , and the recorded road information data does not show any signs of being corrupt , or a used mean value of road information data from the local database c , have generated a deviation greater than a predetermined threshold value , between an actual outcome and an expected outcome of a function f , and / or the recorded road information data deviates less than a predetermined threshold value from a mean value saved in the local database , and / or the recorded road information data deviates more than a predetermined threshold value saved in the local database , wherein the recorded road information data in this case is saved separately . in the circle h is an evaluation of the execution of a function in f made . if it turns out that the actual outcome of a function deviates more than a predetermined threshold value , from an expected outcome , the quality rating of the used road data information can be made . a recorded road information data is just integrated in a mean value if the newly recorded road information data deviate less than a predetermined percentage from the mean value . a recording is compared with road information data already existing in the local database , wherein it can be decided if , and how the recording shall be saved . a high deviation between a recorded road information data and an existing , mean value in the local database can be caused by an erroneous recording or a change of the route . however , if a second recording deviates less than a second predetermined percentage from the first recording a new mean value is created from the these two recordings , whereby the new mean value is saved in the local database . a transmission of road information data from the local database c to the fleet database is also made . this can be made continuously over a wireless communication link , or just when the vehicle is at a service station or similar . the inventive method enriches the road information data in the describe manner . as new information is stored , the quality of the road information data in the databases ( b , c ) increases , wherein the next run of the same route can be made more effective . the road information data is enriched through new recordings as the vehicle is travelling and through updates of the quality rating of used road information data .
1
the novel copolymers including the novel comonomer of the present invention are useful in making contact lenses having many desirable attributes including oxygen permeability , machinability , and capability to exhibit good wettability in finished articles . the novel comonomer imparts these properties to the copolymer and articles made therefrom . in the preferred embodiment of the novel comonomer identified above as formula ( 3 ), each radical x is lower alkyl and more preferably methyl . in an even more preferred embodiment , a equals 1 - 3 and more preferably 2 . the monomer most preferred is tris ( trimethylsiloxy ) siloxyethyl methacrylate . the novel comonomers of the present invention can be prepared for instance by reaction of tris ( trialkylsiloxy ) chlorosilane or tris ( triphenylsiloxy ) chlorosilane with hydroxyalkyl acrylate or hydroxyalkyl methacrylate in an inert solvent . a more detailed description of the preparation of the preferred comonomer is given below . representative second comonomers useful in making the useful copolymers of the present invention include the following : methylmethacrylate ( preferred ); ethylmethacrylate ; ethylacrylate ; or propyl , isopropyl , butyl , sec - butyl , pentyl , hexyl , heptyl , octyl , 2 - ethyl hexyl , nonyl , decyl , undecyl , dodecyl , lauryl , cetyl , octadecyl , benzyl , phenyl or cycloalkyl acrylate or methacrylate . the alkyl substituent preferably has 1 to 6 carbon atoms . representative cycloalkyl groups include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , and cyclooctyl . the third comonomer in the useful copolymers of the present invention is a fluorinated or polyfluorinated ( c 1 - c 6 ) acrylate or methacrylate , preferably one in which up to 8 hydrogen atoms ( preferably 3 to 8 ) are replaced by fluorine atoms . the preferred example is trifluoro ethyl methacrylate ( cf 3 -- ch 2 -- o -- c ( o )-- c ( ch 3 )โ• ch 2 ). other comonomers which would perform the equivalent function include the following : pentafluoropropyl methacrylate , heptafluoro methylmethacrylate , hexafluoro isopropyl methacrylate and similar compounds . the copolymer of the present invention also contains a cross - linking monomer having difunctional reactive sites , such as ethylene glycol dimethacrylate ( preferred ); diethylene glycol dimethacrylate ; triethylene glycol dimethacrylate ; tetraethylene glycol dimethacrylate ; and other compounds known to those skilled in the art for use in cross - linking compounds of the type referred to herein . the copolymer of the present invention is prepared by mixing together the four components indicated above , preferably in the following ranges : about 30 to about 60 weight percent of the comonomer of formula ( 3 ); about 5 to about 25 weight percent of the second comonomer ; about 15 to about 35 weight percent of the fluorinated comonomer ; and about 5 to about 15 percent of the ethylene glycol dimethacrylate and equivalent cross - linking agent . the preferred concentration of the component of formula ( 3 ) is 45 to 60 weight percent , and more preferably about 50 weight percent . the preferred concentration of the second comonomer is about 5 to about 20 weight percent , and more preferably about 15 weight percent . the preferred concentration of the trifluoroethyl methacrylate or equivalent comonomer is about 20 to about 35 weight percent , and more preferably about 25 weight percent . the preferred concentration of the cross - linking agent is about 5 to 15 weight percent , more preferably about 10 weight percent . where it is desired that the copolymer &# 39 ; s product have the ability to absorb ultraviolet radiation , a small but effective amount ( typically up to about 5 weight percent ) of an ultraviolet absorber is mixed together with the other monomers . the preferred copolymeric ultraviolet absorber is a copolymer made by copolymerizing a monomeric ultraviolet absorber having polymerizable vinylic unsaturation with the same monomers from which the copolymeric product itself is made , thereby facilitating dissolution of the copolymeric ultraviolet absorber into the monomer mixture from which the copolymeric product is made . for instance , a macromolecular product can be formed by copolymerizing a mixture of 20 - 40 wt % of a uv absorber such as 3 -( 2 - benzotriazolyl )- 2 - hydroxy - 5 - tert - octylbenzyl methacrylamide , 20 - 40 wt % of a comonomer of formula ( 3 ) such as tris ( trimethylsiloxy ) siloxyethyl methacrylate , and 20 - 40 wt % of 2 , 2 , 2 - trifluoroethyl methacrylate , or other fluorinated comonomer as defined herein , and optionally 20 - 40 wt % of an alkyl or cycloalkyl acrylate or methacrylate as defined above . free radical copolymerization of the mixture using the initiator , amounts , and reaction conditions disclosed herein for the novel lens polymer , is preferred . an effective amount , preferably about 0 . 5 to about 0 . 2 weight , of the ultraviolet absorbing polymer ( or another uv absorber such as or about 0 . 3 to about 1 . 0 weight percent of 2 , 2 &# 39 ;, 4 , 4 &# 39 ;- tetrahydroxy benzophenone , 2 , 2 &# 39 ;- dihydroxy , 4 , 4 &# 39 ;- dimethoxy benzophenone or 2 , 2 &# 39 ; dihydroxy - 4 - methoxy benzophenone ) can be added to impart ultraviolet absorbing ability to the resulting material . the absorber preferably absorbs some or all of the radiation in the range 350 - 450 nm , or preferably 300 - 450 nm . the ultraviolet absorber becomes dispersed in the copolymer and is physically entrapped therein , thereby resisting leaching of the absorber from lenses . in making the copolymers of the present invention , a minor but effective amount such as 0 . 1 - 0 . 75 weight percent of a free radical initiator such as tert - butyl peroxyneodecanoate , tert - butyl peroctoate , or tert - butyl perbenzoate is added to the monomer mixture described above . the resulting mixture is then placed in a waterbath , or in an oven under nitrogen atmosphere . the effective polymerization temperature of from about 35 ยฐ c . to about 110 ยฐ c . is maintained for sufficient time , such as 170 hours , to permit the polymerization to proceed to completion . the resulting clear , hard solid can then be relathed to form a rod , which is cut in the conventional way into buttons which are then machined to form contact lenses using known machining techniques . the resultant lenses exhibit the properties described above to a superior degree not heretofore expected . another aspect of the present invention is the treatment of lenses made from a copolymer containing one or more siloxanyl moieties of the formula -- osid 1 d 2 d 3 wherein d 1 , d 2 and d 3 are independently c 1 - c 10 alkoxy , c 1 - c 10 alkyl , a phenyl ring , or another -- sid 1 d 2 d 3 group , pendant from a polymeric backbone of repeating acrylic or methacrylic units to render the copolymer surface more wettable by water or isotonic saline solution . the lens is treated with an aqueous solution of an agent which is a strong acid , or less preferably is a strong base . the agent cleaves siloxanyl groups from the lens surface and leaves hydroxyl groups in their place , thereby increasing the wettability of the lens surface . suitable agents for increasing the wettability include sodium , potassium and ammonium bisulfate , sulphuric acid , and arylsulfonic acids such as toluenesulfonic acid . this process increases the wettability of lenses made from the copolymers of the present invention . it is also useful with lenses containing pendant siloxanyl moieties derived from any of the siloxanyl - acrylic compounds disclosed in any of the following u . s . pat . nos . : 4 , 314 , 068 ; 4 , 152 , 508 ; 4 , 259 , 467 ; 3 , 808 , 178 ; 4 , 120 , 570 ; 4 , 139 , 513 ; 4 , 139 , 692 ; 4 , 216 , 303 ; 4 , 246 , 389 ; 4 , 330 , 383 ; 4 , 400 , 333 ; 4 , 410 , 674 ; 4 , 414 , 375 ; 4 , 419 , 505 ; 4 , 424 , 328 ; 4 , 433 , 125 ; 4 , 463 , 149 ; 4 , 500 , 695 ; 4 , 507 , 452 ; 4 , 508 , 884 ; 4 , 535 , 138 ; 4 , 581 , 184 ; 4 , 582 , 884 ; and 4 , 602 , 074 , the disclosures of which are hereby incorporated herein by reference . this process comprises reacting the surface of a lens or other material with an aqueous solution of an effective agent , such as one of those defined above , under conditions of time and temperature effective to replace pendant siloxanyl groups with hydroxyl groups on the surface of the article . typically , times of 1 to 10 hours are satisfactory , with 2 - 6 hours preferred . temperatures of typically 40 ยฐ c .- 80 ยฐ c . are effective . within these parameters , one skilled in this art can readily determine the concentration of the agent of choice which is effective to cause the desired degree of improvement in wettability . in general , higher concentrations require shorter reaction times . the following examples are included for purposes of illustration and should not be considered limiting . 2 - hydroxyethyl methacrylate ( 315 g ) and pyridine ( 286 g ) were placed in a three liter round bottom flask equipped with overhead stirrer , dropping funnel , drying tube , and thermometer . after cooling the flask in an ice - water bath to 12 ยฐ- 15 ยฐ c ., tris ( trimethylsiloxy ) chlorosilane ( 400 g ) was added with stirring over a 60 minute period while maintaining a temperature below 15 ยฐ c . after the addition was over , the contents were stirred for 16 hours at room temperature . pentane ( 150 ml ) was added to the mixture and pyridinium hydrochloride was filtered out and washed with some more pentane . the entire filtrate was extracted successively with water , 10 % aq . acetic acid solution , water , 10 % aq . sodium bicarbonate solution , and water . after drying the organic layer over anhydrous magnesium sulfate and filtering , the solvent was removed under reduced pressure . the colorless residual liquid was distilled under vacuum with 300 mm claisen vigreux distillation head and with 3 % cuprous chloride as inhibitor . the fraction boiling at 87 ยฐ- 90 ยฐ c . at about 10 m - torr pressure yielded 385 g ( 75 %) of the title monomer . it was refrigerated until used . this example illustrates the preparation of a copolymer made with the novel siloxanyl ester of example 1 . a polymerization mixture was prepared by mixing 150 parts of tris ( trimethylsiloxy ) siloxy ethyl methacrylate ( monomer of example 1 ), 15 parts methyl methacrylate , 90 parts 2 , 2 , 2 - trifluoroethylmethacrylate , 45 parts ethylene glycol dimethacrylate , 4 . 27 parts of a copolymeric uv absorber ( made from previously copolymerizing 1 . 5 parts of 3 -( 2 - benzotriazolyl )- 2 - hydroxy - 5 - tert - octylbenzyl methacrylamide with 0 . 64 parts tris ( trimethylsiloxy ) siloxy - ethyl methacrylate and 2 . 13 parts of 2 , 2 , 2 - trifluoroethyl methacrylate in toluene solution with tert - butyl peroxyneodecanoate and tert - butyl peroctoate as organic initiators ), 0 . 018 parts d & amp ; c green # 6 , and organic peroxide initiators , 0 . 45 parts t - butyl peroxyneodecanoate , 0 . 45 parts t - butyl peroctoate and 0 . 45 parts t - butyl perbenzoate . then the mixture was poured into foot - long high density polyethylene tubes ( id 5 / 8 &# 34 ;), and polymerized under nitrogen blanket . the polymerization was effected by initially heating the tubes at 35 ยฐ c . in a waterbath for 48 hours and then at 45 ยฐ c . for 24 hours . then these tubes were placed in a forced air oven and heating was continued at 85 ยฐ c . for 24 hours , 100 ยฐ c . for 56 hours and finally at 110 ยฐ c . for 12 hours . the resulting polymeric rods were cut into lens blanks . the lenses obtained by lathing the blanks had excellent mechanical properties and oxygen permeability , dk 82 barrer units at 35 ยฐ c . this example illustrates the preparation of another copolymer made with the novel siloxanyl ester of example 1 . a polymerization mixture was prepared by mixing 60 parts of tris ( trimethylsiloxy ) siloxy - ethyl methacrylate , 5 parts methylmethacrylate , 25 parts 2 , 2 , 2 &# 39 ;- trifluoroethyl methacrylate , 10 parts ethylene glycol dimethacyrylate , 1 . 42 parts of a copolymeric uv absorber ( made by previously copolymerizing 3 -( 2 - benzotriazolyl )- 2 - hydroxy - 5 - tert - octyl benzyl methacrylamide with tris ( trimethylsiloxy ) siloxyethyl methacrylate , and 2 , 2 , 2 - trifluoroethylmethacrylate as described in example 2 ), 0 . 003 parts d & amp ; c green # 6 , and organic peroxide initiators , 0 . 15 parts t - butyl peroxyneodecanoate , 0 . 15 parts t - butyl peroctoate and 0 . 15 parts t - butyl perbenzoate . the mixture was polymerized in foot - long high density polyethylene tubes ( id 5 / 8 &# 34 ;) and lenses were prepared as described in example 2 . the lenses obtained had excellent mechanical properties and oxygen permeability , dk 125 barrer units at 35 ยฐ c . this example illustrates one of the methods employed to modify the surface of finished articles to enhance their wettability . the finished lenses made from the copolymer of example 2 were treated with a 66 % solution of ammonium bisulfate in water and heated at 50 ยฐ c . for four hours . the lenses were thereafter rinsed in water , 5 % solution of sodium bicarbonate and water successively . then , these lenses were stored in wetting and soaking solution . the wettability was measured by determining the soak state wetting angle of contact lens material . the wetting angle of 65 ยฐ (ยฑ 4 ) for untreated and 30 ยฐ (ยฑ 4 ) for treated material was observed . these reported numbers are the average of ten bubbles measured left and right sides for each of the three disks employed . a lower wetting angle value indicates better wetting characteristics .
2
reference will now be made in detail to presently preferred embodiments of the invention . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . throughout the description , the term โ€œ component โ€ will be used to describe any part which can be aligned using the alignment clip of the present invention . preferably , a component includes an optical component , such as lenses and optical fibers . the present invention can also be used , however , to align a plurality of components ( i . e ., an assembly ). the inventors have discovered a novel attachment clip that can be used to hold an optical component and / or assembly . the novel design allows for coaxial attachment of components by using a more flexible and economical single side ( e . g ., top - down ) attachment system . this attachment clip is suitable for active alignment and attachment of the optical assembly ( or component ). the attachment process may include , but is not limited to soldering , epoxying , and welding . the attachment clip allows for coaxial type alignment ( i . e ., along the axis of the clip ) with a top - down configuration . furthermore , the attachment clip allows for pressure to be applied by the optical assembly in order to make contact between a plurality of feet and a package , which may be necessary for some methods of attaching the feet to the package . a first embodiment of an attachment clip 100 according to the present invention is shown in the views of fig1 - 5 . the attachment clip 100 includes two or more substantially vertical side walls 20 , a base portion 30 , and a plurality of substantially horizontal feet 10 . as shown in the various views of fig2 the attachment clip 100 allows the optical component 200 to be manipulated in the : x and roll ( fig2 a ), z and ฮธ ( fig2 b ), y and ฯ† ( fig2 c ) directions and unlimited 360 ยฐ roll . it should be appreciated that attachment of the clip 100 to the package sets the x and ฮธ parameters . as shown in fig3 the clip 100 is preferably attached to the package by laser welding 310 the substantially horizontal feet 10 to the package . however , as would be readily apparent to one of ordinary skill in the art after reading this disclosure , other attachment schemes are also possible . the y , z , ฯ† , and roll parameters can typically still be adjusted even after the clip 100 is attached to the package . as shown in fig4 the substantially vertical side walls 20 provides for increased allowable vertical translation of the optical component 200 . the design of the attachment clip 100 is such that any shifting due to movement in the attachment process can be compensated for to regain optimal position and alignment . the attachment clip 100 may be adjusted to accommodate various optical components 200 and / or assemblies . the attachment clip 100 may include any number of substantially horizontal feet 10 and substantially vertical side walls 20 . it should also be appreciated that the substantially horizontal feet 10 are preferably horizontal , but may also be positioned at an angle if desired . similarly , the substantially vertical side walls 20 are preferably vertical , but may also be angled inward or outward if desired . furthermore , the clip 100 is not limited to circular components as shown in the figures . the clip 100 as shown in fig5 has a base portion 30 with a substantially circular cross - section with radius r . however , the cross - section could be rectangular or ovular in shape . as would be readily apparent to one of ordinary skill in the art after reading this disclosure , the feet dimension ( a ) and the vertical wall dimension ( b ) depicted in fig5 can be adjusted in order to increase or decrease the absolute travel of the component . thus , the dimensions a , b , and r may vary based on the size of the component 200 and the amount of travel desired . preferably , the substantially horizontal feet 10 dimension a is in the range of about 0 . 5 mm to about 2 mm . preferably , each of the substantially vertical side walls 20 has a height b in the range of about 0 . 5 mm to about 2 mm . preferably , the base 30 has a radius in the range of about 0 . 4 mm to about 2 mm . the attachment clip 100 can be used to hold an optical component 200 . once in the clip 100 , the optical component 200 can be translated and / or rotated in order to find the optimal position . once an optimal position is achieved , the optical component can be fixed to the clip 100 . for example , the clip 100 and the optical component 200 could be laser welded in place . this would preferably utilize a two - beam - top - down laser head configuration . the two beam approach is configured to have the beams 180 ยฐ apart and the welding is done symmetrically . in such a case , the optical clip 100 should be fabricated of a weldable material , such as kovar . alternatively , the clip 100 may comprise invar , stainless steel , or nickel . the attachment clip 100 allows for a coaxial type of alignment / attachment but utilizes a top - down configuration . the dimensions , location , and number of substantially horizontal feet 10 and substantially vertical side walls 20 are adjustable to suit the needs of various optical assemblies and / or components 200 . the substantially vertical side walls 20 on the clip 100 allow for vertical movement of the optical component 200 above and below a desired plane . the substantially horizontal feet 10 provide mechanical stability for the clip 100 and also horizontal movement . the clip 100 allows for alignment and attachment without the need for additional tooling to keep the clip 100 in place during the attachment process . depending on the geometrical shape and mass of the optical components 200 that the clip 100 supports , the locations of the substantially horizontal feet 10 and substantially vertical side walls 20 can be switched and otherwise adjusted to allow for optical mechanical stability . the attachment clip 100 allows for a method of coaxial type attachment without the need for a coaxial attachment system . the foregoing description of a preferred embodiment of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention . one such exemplary variation is shown in the perspective view of fig6 . fig6 shows an optical clip 600 with vertical side walls 620 , a plurality of horizontal feet 610 , and a base portion 630 . as shown , the vertical side walls 620 have a trapezoidal shape rather than the rectangular shape of previous embodiments . alternatively , the vertical side walls 610 and / or the horizontal feet 610 may have a rounded / circular shape and / or other variations as would be readily apparent to one skilled in the art after reading this disclosure . the embodiments were chosen and described in order to explain the principles of the invention and its practical application to enable one skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined the claims appended hereto , and their equivalents .
6
referring initially to fig1 and 1a , a nmr imaging / spectroscopy system , of type well known to the art , has a room - temperature free bore 10 in which a static magnetic field b o exists . by convention , this field is positioned parallel to the z axis of a cartesian coordinate system , having the magnet bore cylinder 10 axially aligned therewith . chemical - shift spectra from a volume element ( voxel ) 10v is desired . voxel 10v is located at a position ( x , y , z ), with respect to the center point 10m of the imaging volume . voxel 10v is ideally of rectangular solid shape , having a dimension 10x in the direction parallel to the x axis , a dimension 10y in the direction parallel to the y and a dimension 10z in the direction parallel to the z axis . illustratively , motional artifacts will be produced if the desired voxel 10v moves a sufficient distance in any direction ( here limited , for purposes of illustration , to the y direction ) such that more than a preselected amount ( e . g . 50 %) of adjacent voxels 10v &# 39 ; and / or 10v &# 34 ; become located in the absolute volume defining the desired volume element . as shown in fig2 a , acquisition of a spectrum by the prior - art volume selective excitation ( vse ) method commences , at a time t o , with the localization subsequence , in which a first magnetic field gradient ( such as the g x gradient with some amplitude , e . g . + 2 ) is applied in a first direction ( here , parallel to the x axis ). the amplitude and polarity of this first gradient are selected to differentiate a first plane passing through the desired voxel . while the first spatial gradient 11 is present with non - zero value , an x - dimension selection rf signal portion 12 occurs with : a first selective 45 ยฐ rf signal pulse 12a , commencing at time t 1 ; a broadband ( non - selective ) 90 ยฐ rf signal pulse 12b , commencing at time t 2 ; and a terminating second selective 45 ยฐ rf signal pulse 12c , commencing at time t 3 and terminating at time t 4 , prior to the termination of the first direction gradient at time t 5 . a plane in a second dimension , substantially orthogonal to the first dimension and also passing through the desired voxel , is excited by the application of a second gradient pulse 14 ( here in the g y direction with a plane - designation amplitude value , e . g . - 1 ) and a subsequent rf selection signal portion 15 . thus , shortly after the application , at time t 5 , of the second direction gradient pulse 14 , the second ( y ) direction rf triple pulse portion 15 provides : a selective ฯ€ / 4 rf signal pulse 15a commencing at time t 6 ; a non - selective ฯ€ / 2 rf signal pulse 15b commencing at time t 7 ; and a final ฯ€ / 4 selective rf signal pulse 15c commencing at time t 8 and terminating at time t 9 , prior to the termination of the second gradient portion 14 at time t a . thereafter , spatial localization in the third plane , substantially orthogonal to the first two planes , occurs and fully localizes the desired voxel in all three spatial dimensions . thus , a third gradient ( the z - axis gradient g z , with a z - plane value , e . g . + 1 ) portion 17 is provided , starting at time t a ; another triple - pulse rf signal portion follows , with its first ฯ€ / 4 selective rf signal pulse 18a commencing at time t b , followed by a non - selective ฯ€ / 4 rf signal pulse 18b commencing at time t c , and ending with a final ฯ€ / 4 selective rf signal pulse 18c commencing at time t d and ending at time t e , prior to the time t f at which the third directional gradient portion 17 ends . for convenience , this entire three - dimensional localization subsequence , from time t o to time t f , is referred to as the vse localization subsequence . at some time t g after the vse localization subsequence terminates , a response readout ( or data acquisition ) subsequence commences , and the nmr response signal , evoked from the non - localized voxel , is acquired . this readout subsequence commences with a non - selective ฯ€ / 2 rf signal pulse 20 , present from time t g to time t h ; thereafter , the nmr spectromet : er receiver data gate is opened ( illustrated by gate open portion 22 ) so that the response signal 24 is received and properly processed , in a different manner well known to the art . thus , the vse procedure requires a subsequence with three consecutive localizations , each in a different one of a trio of crossing planes , prior to a readout subsequence which commences with a non - selective , volume - irradiating readout pulse 20 . referring now to fig2 b , in accordance with one presently preferred embodiment of the present invention , an improved volume excitation - selective spectroscopic sequence ( ives ) utilizes : ( 1 ) a localization subsequence in which localization planes in only a pair of orthogonal directions are established ; and ( 2 ) a subsequent readout subsequence with a spatially โ„ข selective nmr pulse to provide localization in the third orthogonal direction . here , the two - dimensional localization subsequence , which commences at time t o and terminates at time t a , utilizes first and second dimension gradient portions 11 and 14 and associated rf signal pulse portions 12a - 12c and 15a - 15c , identical to those portions utilized in the normal vse procedure of fig2 a . the third - dimension - localization readout subsequence uses a third dimension g z gradient portion 26a , present from a time t a to a new time t d &# 39 ;, during which time a ฯ€ / 2 rf signal pulse 28 is present from a commencement time t b &# 39 ;, after gradient commencement time t a , to a termination time t c &# 39 ;, itself prior to the g z gradient pulse termination time t d &# 39 ;. advantageously , to limit the voxel z direction length 10z , rf pulse 28 is of the truncated sinc form , as now well known to the art . after the termination of gradient portion 26a , a rephasing gradient portion 26b is provided in the time interval from time t d &# 39 ; to time t f &# 39 ;, with duration and amplitude such that the area of pulse 26b is substantially one - half the area of pulse 26a ; the response gate is enabled when gating signal 22 &# 39 ; occurs between time t e &# 39 ; and time t g &# 39 ; and the nmr response signal 24 &# 39 ; is acquired substantially only from the desired voxel 10v now localized in all three dimensions . the prior art spars method , shown in fig3 a , commences with its localization subsequence , from time t o to time t u . in the spars localization subsequence a first , non - selective ฯ€ / 2 rf signal pulse 31a occurs ( between t 1 and t 2 ) before a pulse 32a of the gradient in the desired localization direction ( e . g . the g x gradient in the x direction ) is provided , from time t 3 until time t 4 . thereafter , a non - selective ฯ€ rf signal pulse 31b occurs between times t 5 and t 6 . localization in the first ( e . g . x ) direction terminations with a selective ฯ€ / 2 pulse , provided by a ฯ€ / 2 rf signal 31c ( here of the sinc form ) occurring in a time interval ( from time t 8 to time t 9 ) within the time interval ( from time t 7 to time t a ) during which a gradient pulse 32b is present in the desired ( x ) first direction . for localization in the associated second ( y ) or third ( z ) direction , the sequence is repeated : thus , a non - selective ฯ€ / 2 rf pulse ( 24a or 37a ), is followed by a gradient pulse ( 35a or 38a ), in the desired direction ; after the gradient pulse ends , a non - selective ฯ€ rf pulse ( 34b or 37b ) is provided , before a spatially - selective ฯ€ / 2 rf pulse ( with sinc rf signal portions 34c or 37c occurring simultaneous with an associated gradient portion 35b or 38b ) is provided . the localization procedure ends at time t u , when the third direction gradient ( g z ) pulse 38b terminates . the data acquisition subsequence follows thereafter , with a non - spatially - selective ฯ€ / 2 rf signal pulse 40 ( from time t v to time t x ) evoking a nmr response signal from the localized voxel . the receiver data gate 42 is open from time t w through time t y , to allow acquisition of response signal 44 . referring now to fig3 b , in accordance with another presently preferred embodiment of the present invention , an improved spars sequence ( ispars ) utilizes a localization subsequence in which localization planes in only a pair of first and second ( e . g . x and y ) directions are established , with that portion of the spars sequence frcm time t o through time t k . a third - dimension - localizing readout subsequence follows , commencing at time t k ; a readout ฯ€ / 2 rf signal pulse 48 , which is spatially selective in the third ( here , z ) direction , occurs ( from time t 1 &# 39 ; to time t m &# 39 ;) while a third direction gradient g z portion 46a is present ( from time t k to time t n &# 39 ;). a rephasing gradient portion 46b is provided in the time interval from time t n &# 39 ; to time t p &# 39 ;, with the response gate signal 42 &# 39 ; being enabled between time t o &# 39 ; and time t q &# 39 ;, so that the response signal 44 &# 39 ; is acquired substantially only from the desired voxel 10v , now again localized in all three cartesian dimensions . the isis prior art sequence of fig4 a has a localization subsequence of three spatially - selective ( inverting ) ฯ€ rf signal pulses , each in a different cartesian direction . thus , localized inversion in the first ( x ) direction is carried out by impressing upon the sample a gradient g x pulse 51 in that direction , while a ฯ€ rf signal pulse 52a excites the sample ; no localization in this ( x ) direction occurs ( the selection is off ) if the gradient has a substantially zero amplitude , or if the rf pulse has a substantially zero amplitude , as in rf portion 52b . similarly , in the second ( y ) direction or in the third ( z ) direction , one of g y pulse 54a or g z pulse 57a occurs while the associated one of a ฯ€ rf signal pulse 55a or 58a is present . again , no localization in the associated second or third ( y or z ) direction occurs if that associated ( y or z ) gradient or ฯ€ rf signal pulse has a substantially zero amplitude , as in rf portion 55b or rf portion 58b . the localization subsequence ends at time t 9 , when the signal acquisition subsequence commences . as in the other prior art procedures , the readout subsequence utilizes a non - spatially - selective ฯ€ / 2 rf signal pulse 60 , with the receiver data gate 62 being enabled to acquire the voxel response signal 64 . eight different sequences are applied to the sample , with all on and off combinations of the three ฯ€ rf pulses ( or corresponding field gradient portions 51b ,/ 54b / 57b ), and with the resulting data for that sequence being added to (+ 1 ) or subtracted from (- 1 ) the total of the data of the previous sequences , in accordance with the following table : ______________________________________ total spectralsequence x y z contribution______________________________________1 off off off + 12 on off off - 13 off on off - 14 on on off + 15 off off on - 16 on off on + 17 off on on + 18 on on on - 1______________________________________ that is , a ฯ€ rf inversion pulse ( or gradient pulse ) producing selective inversion in the respective x , y or z direction is on if the respective non - zero - amplitude x , y or z selective rf portion 52a , 55a or 58a is present , while that direction pulse is off if the substantially - zero - amplitude rf pulse 52b , 55b or 58b is present , each cotemporally with the associated gradient pulse 51a , 54a or 57a . in accordance with another presently preferred embodiment of the present invention , an improved contracted isis sequence ( crisis ), as shown in fig4 b , utilizes a preliminary localization subsequence in which only two intersecting localization planes are established in the time int : erval from time t o to time t 6 . a subsequent readout subsequence , from time t 6 to time t c &# 39 ;, spatially selects the third - dimensional extent of the voxel from which a response is desired . the response acquisition subsequence thus begins with a ( z ) spatially - selective ฯ€ / 2 pulse , comprised of a third - dimension ( z axis ) field gradient ( g z ) pulse 66a from time t 6 to time t 9 &# 39 ;, during which interval a ฯ€ / 2 rf signal pulse 68 ( here , of sinc form ) occurs from time t 7 &# 39 ; to time t 8 &# 39 ;. a rephasing lobe 66b of the third gradient then is provided , from time t 9 &# 39 ; to time t b &# 39 ;; the response gate signal 62 &# 39 ; occurs from time t a &# 39 ; to time t c &# 39 ;, during which the localized spectroscopy response signal 64 &# 39 ; is received . it will be seen that this sequence has both the x and y selective inversion pulses in the on condition ; three additional sequences will be provided , with the remaining co - nbinations of one or both of x and y rf pulses or the gradients g x and g y in the off condition ( responsive to respective rf portions 52b or 53b , or respective gradient portions 51b or 54b ), in accordance with the following table : ______________________________________ total spectralsequence x y contribution______________________________________1 off off + 12 on off - 13 off on - 14 on on + 1______________________________________ there are , three advantages of the improved crisis , ives and ispars techniques with respect to isis , vse and spars . first , it will be seen that the crisis , ives and ispars sequences are typically only two - thirds the duration of the isis , vse and spars localization subsequences . since the number of applied rf signal pulses has been reduced by one - third , the rf signal power deposited in the sample is also reduced by about one - third . secondly , the number ( e . g . 4 ) of sequence cycle required for localization is only one - half that number ( e . g . 8 ) required for isis , cycled vse or cycled spars localization . since the total sequence cycle time is thus at least 50 % shorter than in conventional isis , cycled vse or cycled spars , the opportunity for production of artifacts by physiological motion is similarly reduced . third , since the inventive procedures effectively contracts the localization procedure by one dimension and the read - out pulse selectively excites only a plane of the sample ( which need not always be the z - axis direction , chosen here for illustrative purposes only ) rather than a non - selective excitation of the entire sample , any t 1 relaxation artifacts , as well as motional artifacts , are significantly reduced by the ratio of the slice thickness to the total dimension of the sample , in that third dimension . while several presently preferred embodiments of my novel method have been presented herein by way of explanation , many variations and modifications will now become apparent to those skilled in the art . it is my intent , therefore , to be limited only by the scope of the appended claims .
6
described herein are exemplary tape library architectures , and methods for recording an error in a tape drive . the methods described herein may be embodied as logic instructions on a computer - readable medium . when executed on a processor , the logic instructions cause a general purpose computing device to be programmed as a special - purpose machine that implements the described methods . the processor , when configured by the logic instructions to execute the methods recited herein , constitutes structure for performing the described methods . in exemplary embodiments , the architectures and methods may be implemented in tape storage libraries such as the tape storage libraries described in u . s . pat . nos . 5 , 926 , 341 ; 6 , 028 , 733 ; or 6 , 421 , 306 , commonly assigned to the assignee of the present application , the disclosures of which are incorporated by reference herein in their entirety . fig1 is a schematic illustration of an exemplary embodiment of a tape library 100 . the tape library 100 includes a library controller module 110 , including a processor 114 which is coupled to a memory medium 112 , and one or more tape drive controllers 120 , which are coupled to ( or contained within ) a plurality of tape drives 130 a - 130 b via one or more interface buses , such as a small computer system interface ( scsi ) bus . the library controller 110 is coupled to the tape drive controllers 120 via one or more interface buses such as , e . g ., an rs422 bus or an inter - integrated circuit ( i2c ) bus . it is noted that the library controller 110 can be embodied as a separate component ( as shown ), or can be co - located with one or more of the driver controllers 120 , or within a separate host computer 150 . the library controller 110 may be implemented as a software module that runs on a general purpose processing unit of the tape library , or as a special - purpose chipset . in some embodiments the host computer 150 may be connected to the drive controllers and the library controller by another bus . by way of example , the host computer 150 may be connected to the library and drives using scsi and the library may be connected to the drives using rs422 . the tape drive controllers 120 coordinate data transfer to and from the one or more tape drives 130 a - 130 b . in one embodiment , the library includes two tape drive controllers : a first tape drive controller 122 a and a second tape drive controller 122 b . the controllers may operate independently or may be configured to operate in parallel to enhance reliability by providing continuous backup and redundancy in the event that one controller becomes inoperable . tape drive controllers 122 a and 122 b have respective processors 128 a and 128 b and respective memories 124 a and 124 b . processors 128 a , 128 b may be implemented as general purpose processors that may be configured to execute logic instructions in the respective memories 124 a , 124 b , or as special purpose processors adapted to implement logic instructions embodied as firmware , or as asics . the memories 124 a and 124 b may be implemented as battery - backed , non - volatile rams ( nvrams ). although only two controllers 122 a and 122 b are shown and discussed generally herein , aspects of this invention can be extended to other multi - controller configurations where more than two controllers are employed . the controller &# 39 ; s memories 122 a and 122 b may be physically coupled via a communication interface 126 such as , e . g ., a pci bus or another suitable communication bus . controllers 122 a and 122 b may monitor data transfers between them to ensure that data is accurately transferred and that transaction ordering is preserved ( e . g ., read / write ordering ). in one embodiment , the tape drives 130 a , 130 b are configured to receive a tape cartridge 132 a , 132 b , respectively . input / output ( i / o ) operations requested by host computer 150 may be executed against the respective tape cartridges 132 a , 132 b . the tape cartridges 132 a , 132 b may include respective unique external identifiers 134 a , 134 b , which may be implemented as a bar code or other external identifying indicia associated with the respective tape cartridge 132 a , 132 b . the external identifiers 134 a , 134 b need not be readable by human operators . for example , a radio frequency identification ( rfid ) tag may be used as an identifier . in addition , optical identifiers such as holograms , diffraction patterns , and the like may be used as external identifiers 134 a , 134 b . fig2 is a schematic illustration of an exemplary embodiment of a tape library . referring to fig2 , the tape library includes a library controller 210 and a plurality of tape controllers 220 , 230 , 240 communicatively connected to the library controller 210 by a suitable communication bus 250 . the particular embodiment of the communication bus 250 is not critical . in one embodiment the communication bus may be implemented as a backplane and the respective tape controllers 220 , 230 , 240 may be implemented as cards that connect to the backplane . in alternate embodiments the communication bus may be implemented by a bus such as a pci bus , or by a point - to - point connection such as an rs422 connection . in one embodiment one or more of the tape controllers 220 , 230 , 240 maintain one or more event logs . among other things , errors that occur in the tape drive are recorded in the tape drive &# 39 ; s event log . in the embodiment illustrated in fig2 each tape controller 220 , 230 , 240 maintains a separate event log 222 , 232 , 242 , respectively , in a memory location associated with the controller . in addition , the library controller 210 maintains a separate tape log 224 . in alternate embodiments the separate controllers may maintain a single event log in a memory location shared between the controllers . the respective event logs 222 , 232 , 242 may include information identifying , among other things , hardware and software packages operating on the respective tape drive controllers 220 , 230 , 240 , the version number ( s ) of firmware executing on the controller , and other information associated with the controller . the event logs 222 , 232 , 242 may also log information regarding an error , including an error number 222 a , 232 a , 242 a assigned to the error , a internal identifier such as , e . g ., a tape serial number 222 b , 232 b , 242 b and an error identifier 222 c , 232 c , 242 c associated with the error . the tape serial number is not necessarily associated with a human - readable identifier on the tape cartridge . in one embodiment , tape log 224 may be stored in a suitable memory location such as , e . g ., a non - volatile memory module , associated with the library controller 210 . tape log 224 may include fields for storing information identifying , among other things , the respective internal identifiers 224 a and external identifiers 224 b associated with each tape inserted into the drive . optionally the tape log 224 may also include an identifier associated with one or more drives in which the tape was previously inserted . in an alternate embodiment , the respective event logs 222 , 232 , 242 may include a field for recording the external identifier 134 a , 134 b of a tape cartridge 132 a , 132 b that resides in a tape drive 130 a , 130 b . operations for recording errors in tape drives will be explained with reference to fig3 - 4 . fig3 is a flowchart illustrating operations in one embodiment of a method for recording an external identifier associated with a tape . referring to fig3 , at operation 310 a library controller such as library controller 210 records in memory an external identifier associated with a tape cartridge . in one embodiment the external identifier may be implemented as a bar code or other external identifying indicia associated with the tape cartridge . the library controller may read the barcode using a conventional optical scanner and associated software , for example , when the library controller is picking the cartridge for delivery to a tape drive controller . at operation 315 the library controller may verify the format of the external identifier . in one embodiment the format of the external identifier is encoded into a multi - character symbol , which may be verified by comparing the external identifier against one or more templates for external identifiers . if the format is incorrect , then an error routine may be invoked . at operation 320 the library controller transfers the tape to a tape drive , such as one of the tape drives 130 a , 130 b , depicted in fig1 . when the tape cartridge is loaded into the tape drive , the tape drive controller may read the internal identifier associated with the tape cartridge from the medium on which the internal identifier is stored . at operation 325 the library controller issues a request to the tape drive controller for the internal identifier associated with the tape . at operation 330 the tape drive controller receives the request from the library controller . optionally , at operation 335 , the tape drive controller determines whether there is a tape cartridge in the drive , and if not an error routine may be invoked , at operation 350 . in one embodiment the error routine may include transmitting a reply to the library controller , wherein the reply indicates that a tape cartridge is not properly installed in the drive . in response to the reply , the library controller may initiate a routine to locate the tape cartridge and insert the cartridge into the drive . alternatively , or in addition , the error routine may involve generating an alert to notify a user or administrator of the system of a malfunction . by contrast , if there is a tape cartridge in the drive at operation 335 , then control passes to operation 340 , in which the drive controller determines whether the format of the internal identifier is correct . in one embodiment the format of the internal identifier is encoded into a multi - character symbol , which may be verified by comparing the external identifier against one or more templates for identifiers . if the format is incorrect , then an error routine may be invoked at operation 350 . in one embodiment the error routine may include logging an error in a memory associated with the drive controller and / or transmitting a reply to the library controller , wherein the reply indicates that a received internal identifier is incorrectly formatted . in response to the reply , the library controller may record the error in a memory medium . alternatively , or in addition , the error routine may involve generating an alert to notify a user or administrator of the system of the error . by contrast , if at operation 340 the internal identifier is formatted correctly , then the drive controller transmits the internal identifier to the library controller ( operation 345 ). in one embodiment , the drive controller transmits the internal identifier to the library controller using a read_attribute command using the automation / drive interface ( adi ) protocol . the internal identifier is recorded in a suitable memory medium ( operation 355 ) associated with the library controller . in one embodiment , the internal identifier may be recorded in the tape log 224 in association with the external identifier associated with the tape cartridge . fig4 is a flowchart illustrating operations in an exemplary embodiment of a method for managing errors in a tape library . at operation 410 the library controller receives a request from a diagnostic utility for managing errors in a tape library . in one embodiment the request includes an internal identifier associated with a tape cartridge . the request may be generated by an administrator or other user of the diagnostic utility . in alternate embodiments the diagnostic utility may generate the request . the diagnostic utility may be embodied as any suitable diagnostic utility for evaluating errors in a tape library . particulars operational aspects of the diagnostic utility are beyond the scope of this disclosure . in one embodiment , the diagnostic utility may issue a scsi log sense request to the library controller . at operation 415 the library controller determines whether the internal identifier associated with the request received from the diagnostic utility is recorded in the tape log 224 . if not , then an error routine may be invoked at operation 425 . the error routine may involve communicating with the diagnostic utility and / or generating notices or warnings for users of the system . if , at operation 415 , the internal identifier is recorded in tape log 224 , then control passes to operation 420 , and the library controller reads the external identifier from tape log . at operation 430 the library controller passes the external identifier to the diagnostic utility . fig5 is a flowchart illustrating operations in an exemplary embodiment of a method for managing errors in a tape library . at operation 510 the library controller receives a request from a diagnostic utility for managing errors in a tape library . the request may be generated by an administrator or other user of the diagnostic utility . in alternate embodiments the diagnostic utility may generate the request . the diagnostic utility may be embodied as any suitable diagnostic utility for evaluating errors in a tape library . particulars operational aspects of the diagnostic utility are beyond the scope of this disclosure . in one embodiment , the diagnostic utility may issue a scsi log sense request to the library controller . at operation 515 the library controller determines whether the library controller is adapted to support a tape log function . if not , then an error routine may be invoked at operation 525 . the error routine may involve communicating with the diagnostic utility and / or generating notices or warnings for users of the system . if , at operation 515 , the library controller determines that the tape log function is supported , then control passes to operation 520 , and the library controller returns at least a portion of the tape log to the diagnostic utility . in one embodiment the library controller may transmit the entire tape log to the diagnostic utility . in an alternate embodiment , the diagnostic utility may request only a portion of the tape log , and the library controller may transmit the requested portion . at operation 530 the diagnostic utility analyzes the tape log . the operations of fig3 - 5 permit a tape library controller to manage a tape log that records an external identifier associated with tapes in the tape library . the external identifier may be provided to a diagnostic utility for error management purposes . further , specialized firmware is not required on the tape drives . not all operations depicted in fig3 - 5 are required . for example , the operations 335 and 340 may be omitted . although the described arrangements and procedures have been described in language specific to structural features and / or methodological operations , it is to be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or operations described . rather , the specific features and operations are disclosed as preferred forms of implementing the claimed present subject matter . reference in the specification to โ€œ one embodiment โ€ or โ€œ an embodiment โ€ means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least an implementation . the appearances of the phrase โ€œ in one embodiment โ€ in various places in the specification are not necessarily all referring to the same embodiment . thus , although embodiments have been described in language specific to structural features and / or methodological acts , it is to be understood that claimed subject matter may not be limited to the specific features or acts described . rather , the specific features and acts are disclosed as sample forms of implementing the claimed subject matter .
6
in the following detailed description , numerous specific details are set forth in order to provide a thorough understanding of the invention . however it will be understood by those skilled in the art that the present invention may be practiced without these specific details . in other instances , well - known methods , procedures , components and circuits have not been described in detail so as not to obscure the present invention . unless specifically stated otherwise , as apparent from the following discussions , it is appreciated that throughout the specification discussions utilizing terms such as โ€œ processing ,โ€ โ€œ computing ,โ€ โ€œ calculating ,โ€ โ€œ determining ,โ€ or the like , refer to the action and / or processes of a computer or computing system , or similar electronic computing device , that manipulate and / or transform data represented as physical , such as electronic , quantities within the computing system &# 39 ; s registers and / or memories into other data similarly represented as physical quantities within the computing system &# 39 ; s memories , registers or other such information storage , transmission or display devices . in addition , the term โ€œ plurality โ€ may be used throughout the specification to describe two or more components , devices , elements , parameters and the like . while the following detailed description may describe various embodiments of the present invention in relation to wireless networks utilizing orthogonal frequency division multiplexing ( ofdm ) modulation , the embodiments of present invention are not limited thereto and , for example , may be implemented using other modulation and / or coding schemes where suitably applicable . further , while example embodiments are described herein in relation to wireless metropolitan area networks ( wmans ), the invention is not limited thereto and can be applied to other types of wireless networks where similar advantages may be obtained . such networks specifically include , but are not limited to , wireless local area networks ( wlans ), wireless personal area networks ( wpans ), and / or wireless wide area networks ( wwans ). the following inventive embodiments may be used in a variety of applications including transmitters and receivers of a radio system , although the present invention is not limited in this respect . radio systems specifically included within the scope of the present invention include , but are not limited to , network interface cards ( nics ), network adaptors , mobile stations , base stations , access points ( aps ), gateways , bridges , hubs and cellular radiotelephones . further , the radio systems within the scope of the invention may include cellular radiotelephone systems , satellite systems , personal communication systems ( pcs ), two - way radio systems , two - way pagers , personal computers ( pcs ) and related peripherals , personal digital assistants ( pdas ), personal computing accessories and all existing and future arising systems which may be related in nature and to which the principles of the inventive embodiments could be suitably applied . reference is made to fig1 , which schematically illustrates a wireless network 100 according to an embodiment of the present invention . wireless network 100 may include provider network ( pn ) 120 , a base station ( bs ) 118 , and one or more subscriber or other stations 110 , 112 , 114 , and / or 116 , which may be for example mobile or fixed subscriber stations . in some embodiments , base station 118 , for example , in wlans , may be referred to as an access point ( ap ), terminal , and / or node , and subscriber stations 110 , 112 , 114 , and / or 116 may be referred to as a station ( sta ), terminal , and / or node . however , the terms base station and subscriber station are used merely as an example throughout this specification and their denotation in this respect is in no way intended to limit the inventive embodiments to any particular type of network or protocols . wireless network 100 may facilitate wireless access between each of subscriber stations 110 , 112 , 114 , and / or 116 and pn 120 . for example , wireless network 100 may be configured to use one or more protocols specified in by the institute of electrical and electronics engineers ( ieee ) 802 . 11 โ„ข standards (โ€œ ieee standard for wireless lan medium access control ( mac ) and physical layer ( phy ) specification . 1999 edition โ€, reaffirmed jun . 12 , 2003 ), such as ieee 802 . 11a โ„ข- 1999 ; ieee 802 . 11b โ„ข- 1999 / cor1 - 2001 ; ieee 802 . 11g โ„ข- 2003 ; and / or ieee 802 . 11n โ„ข, in the ieee 802 . 16 โ„ข standards (โ€œ ieee standard for local and metropolitan area networks โ€” part 16 : air interface for fixed broadband wireless access system โ€, oct . 1 , 2004 ), such as ieee 802 . 16 - 2004 / cor1 - 2005 or ieee std 802 . 16 - 2009 , which may herein be referred to as the โ€œ ieee std 802 . 16 - 2009 โ€ or โ€œ wimax โ€ standards , and / or in the ieee 802 . 15 . 1 โ„ข standards (โ€œ ieee standard for local and metropolitan area networks โ€” specific requirements . part 15 . 1 : wireless medium access control ( mac ) and physical layer ( phy ) specifications for wireless personal area networks ( wpans โ„ข)โ€, jun . 14 , 2005 ), although the invention is not limited in this respect and other standards may be used . in some embodiments , attributes , compatibility , and / or functionality of wireless network 100 and components thereof may be defined according to , for example , the ieee 802 . 16 standards ( e . g ., which may be referred to as a worldwide interoperability for microwave access ( wimax )). alternatively or in addition , wireless network 100 may use devices and / or protocols that may be compatible with a 3 rd generation partnership project ( 3gpp ) long term evolution ( lte ) cellular network or any protocols for wpans or wwans . embodiments of the invention may enable the next generation of mobile wimax systems ( e . g ., based on ieee 802 . 16m standard ) to efficiently support substantially high mobility and low latency applications , such as , for example , voice - over - internet protocol ( voip ), interactive gaming over the air - interface , deployment in larger cell - sizes or lower frequency bands , and / or โ€œ multi - hop โ€ relay operations , while enabling backward compatible operations and integration with reference standards ( e . g ., the legacy mobile wimax systems based on ieee std 802 . 16 - 2009 ). in some embodiments , base station 118 may manage and / or control wireless communications among subscriber stations 110 , 112 , 114 , and / or 116 and between subscriber stations 110 , 112 , 114 , and / or 116 and provider network 120 . subscriber stations 110 , 112 , 114 , and / or 116 may , in turn , facilitate various service connections of other devices ( not shown ) to wireless network 100 via a private or public local area network ( lan ), although the embodiments are not limited in this respect . reference is made to fig2 , which schematically illustrates an apparatus 130 for use in a wireless network according to an embodiment of the invention . for example , apparatus 130 may be a terminal , device , or node ( e . g ., one of subscriber stations 110 , 112 , 114 , and / or 116 , base station 118 , and / or provider network 120 , described in fig1 ) for communicating with other terminals , devices , or nodes , in a wireless network ( e . g ., wireless network 100 , described in fig1 ). apparatus 130 may include a controller or processing circuit 150 including logic ( e . g ., including hard circuitry , processor and software , or a combination thereof ) to determine the false frame detection rate and / or adjust the sensitivity of frame detection as described in one or more embodiments of the invention . in some embodiments , apparatus 130 may include a radio frequency ( rf ) interface 140 and / or a medium access controller ( mac )/ baseband processor circuit 150 . in one embodiment , rf interface 140 may include a component or combination of components adapted for transmitting and / or receiving single carrier or multi - carrier modulated signals ( e . g ., including complementary code keying ( cck ) and / or orthogonal frequency division multiplexing ( ofdm ) symbols ) although the inventive embodiments are not limited to any specific over - the - air interface or modulation scheme . rf interface 140 may include , for example , a receiver 142 , a transmitter 144 and / or a frequency synthesizer 146 . interface 140 may include bias controls , a crystal oscillator and / or one or more antennas 148 and / or 149 . in another embodiment , rf interface 140 may use external voltage - controlled oscillators ( vcos ), surface acoustic wave filters , intermediate frequency ( if ) filters and / or rf filters , as desired . due to the variety of potential rf interface designs an expansive description thereof is omitted . processing circuit 150 may communicate with rf interface 140 to process receive and / or transmit signals and may include , for example , an analog - to - digital converter 152 for down converting received signals , a digital - to - analog converter 154 for up converting signals for transmission . further , processor circuit 150 may include a baseband or physical layer ( phy ) processing circuit 156 for phy link layer processing of respective receive / transmit signals . processing circuit 150 may include , for example , a processing circuit 159 for medium access control ( mac )/ data link layer processing . processing circuit 150 may include a memory controller 158 for communicating with processing circuit 159 and / or a base station management entity 160 , for example , via interfaces 155 . in some embodiments of the present invention , phy processing circuit 156 may include a frame construction and / or detection module , in combination with additional circuitry such as a buffer memory , to construct and / or deconstruct super - frames as in the embodiments previously described . alternatively or in addition , mac processing circuit 159 may share processing for certain of these functions or perform these processes independent of phy processing circuit 156 . in some embodiments , mac and phy processing may be integrated into a single circuit if desired . apparatus 130 may be , for example , a base station , an access point , a subscriber station , a device , a terminal , a node , a hybrid coordinator , a wireless router , a nic and / or network adaptor for computing devices , a mobile station or other device suitable to implement the inventive methods , protocols and / or architectures described herein . accordingly , functions and / or specific configurations of apparatus 130 described herein , may be included or omitted in various embodiments of apparatus 130 , as suitably desired . in some embodiments , apparatus 130 may be configured to be compatible with protocols and frequencies associated one or more of the ieee 802 . 11 , 802 . 15 and / or 802 . 16 standards for wlans , wpans and / or broadband wireless networks , cited herein , although the embodiments are not limited in this respect . embodiments of apparatus 130 may be implemented using single input single output ( siso ) architectures . however , as shown in fig2 , certain implementations may include multiple antennas ( e . g ., antennas 148 and 149 ) for transmission and / or reception using adaptive antenna techniques for beamforming or spatial division multiple access ( sdma ) and / or using multiple input multiple output ( mimo ) communication techniques . the components and features of station 130 may be implemented using any combination of discrete circuitry , application specific integrated circuits ( asics ), logic gates and / or single chip architectures . further , the features of apparatus 130 may be implemented using microcontrollers , programmable logic arrays and / or microprocessors or any combination of the foregoing where suitably appropriate . it is noted that hardware , firmware and / or software elements may be collectively or individually referred to herein as โ€œ logic โ€ or โ€œ circuit .โ€ it should be appreciated that the example apparatus 130 shown in the block diagram of fig2 may represent one functionally descriptive example of many potential implementations . accordingly , division , omission or inclusion of block functions depicted in the accompanying figures does not infer that the hardware components , circuits , software and / or elements for implementing these functions would be necessarily be divided , omitted , or included in embodiments of the present invention . reference is made to fig3 , which schematically illustrates a frame 300 structure according to an embodiment of the present invention . frame 300 ( e . g ., a radio frame ) may be a portion of a transmitted and / or received communication in , for example , wireless network 100 . in some embodiments , frame 300 may describe a periodically repeating segment structure of a larger communication signal or stream . in some embodiments , repeating frame 300 may include substantially different information , for example , during substantially each separate transmission . frame 300 may be defined and may include broadband wireless access technology according to , for example , the ieee std 802 . 16 - 2009 or mobile wimax profiles . according to the mobile wimax profiles , the duration of frame 300 or transmission time interval ( tti ) may be , for example , approximately 5 ms . other frame or radio frame sizes such as for example 2 , 2 . 5 , 4 , 8 , 10 , 12 , and 20 ms may be used as for example specified in the ieee std 802 . 16 - 2009 specification . in some embodiments , frame 300 may be transmitted and / or received , for example , according to a time division duplex ( tdd ) mode or scheme . other time and / or frequency schemes may be used ( e . g ., such as a frequency division duplex ( fdd ) mode or scheme ) according to embodiments of the invention . frame 300 may include an integer number of ofdm symbols or other multiplexing symbols . the number of ofdm symbols per frame may be determined , for example , according to a choice of ofdm numerology ( e . g ., sub - carrier spacing , cyclic prefix length , sampling frequency , etc .). in some embodiments , ofdm numerologies may be determined , set , or obtained , for example , depending , on a bandwidth and sampling frequency ( e . g ., or an over - sampling factor according to the mobile wimax profiles ). in various embodiments , substantially different ofdm numerologies may be used , which may result in substantially different number of ofdm symbols in frame 300 . in some embodiments , frame 300 may include idle symbols and / or idle time slots . in one embodiment , frame 300 may include one or more switching periods 302 and / or 304 , for example , for changing between a pre - designated downlink ( dl ) transmission 306 and a pre - designated uplink ( ul ) transmission 308 when a tdd duplex mode or scheme is used . in other embodiments , for example , when an fdd duplex scheme is used , since dl transmissions 306 and ul transmissions 308 may be sent substantially at the same or overlapping times ( e . g ., over different frequencies or network channels ) frame 300 may include substantially few or no idle symbols , idle time slots , and / or switching periods 302 and / or 304 . in some embodiments , the tti or the duration of frame 300 may be , for example , approximately 5 ms . a round trip time ( rtt ) ( e . g ., the time interval between two consecutive pre - scheduled dl transmissions 306 to a specific wireless node may be , for example , approximately 10 ms . wireless networks ( e . g ., wireless network 100 ) having rapidly changing channel conditions and / or small coherence times ( e . g ., rapidly moving mobile stations or nodes , such as automobiles having vehicular speeds of , for example , in the excess of approximately 120 kilometers per hour ( km / h )) may use mechanisms for supporting substantially high mobility in varying channel conditions . embodiments of the invention may support wireless network 100 having substantially small round trip times , for example , to enable substantially fast - varying channel condition feedback between subscriber stations 110 , 112 , 114 , and / or 116 , such as a mobile station , and base station 118 . other time durations may be used . the current ieee std 802 . 16 - 2009 specification standard frame structure may include restrictions , such as substantially long ttis that are typically not suitable for supporting substantially fast feedback and low access latency ( e . g ., less than 10 ms ), which may be used by , for example , emerging radio access technologies . embodiments of the present invention may include or use a modified version of the frame 300 structure for supporting lower latency operations , while maintaining backward compatibility , for example , to the ieee std 802 . 16 - 2009 specification frame structure . frame 300 structure may be used , for example , in the next generation of mobile wimax systems and devices ( e . g ., including the ieee 802 . 16m standard ). in some embodiments , frame 300 structure or portions thereof may be transparent to the legacy terminals ( e . g ., which operate according to mobile wimax profiles and ieee std 802 . 16 - 2009 ) and may be used only for communication between bss , subscriber stations , and / or mss that both operate based on the ieee 802 . 16m standard . according to embodiments of the invention , wireless network 100 and components thereof , which may communicate using the new frame structure ( e . g ., described according to fig3 - 15 ), may be backward compatible with a reference network , which may communicate using a legacy frame structure ( e . g ., described according to the mobile wimax profiles and based on the ieee std 802 . 16 - 2009 ). in some embodiments , backward compatibility may include for example , that a legacy terminal ( e . g ., which may communicate using legacy and / or reference frame structures ) may operate in a wireless network with no significant impact on the performance and operation of the terminal relative to a legacy network . in some embodiments , a new ( e . g ., a non - legacy ) terminal or subscriber station using the new ( e . g ., a non - legacy ) frame structure may operate in a legacy network with no significant impact on the performance and operation of the terminal relative to the wireless network . for example , the new terminal may be โ€œ backward compatible โ€. in some embodiments , wireless network 100 may support both legacy and new ( e . g ., a non - legacy ) terminals , for example , at substantially the same time ( e . g ., where time division multiplexing of the new and legacy frames overlap in the same frame ). in some embodiments , wireless network 100 may enable seamless communication , mobility , and handoff between legacy terminals and new terminals . when used herein , โ€œ new โ€, โ€œ evolved โ€ or โ€œ updated ,โ€ and โ€œ next generation โ€ are merely relative to โ€œ old โ€, โ€œ legacy โ€ or โ€œ current โ€, etc . for example , a โ€œ new โ€ standard may be a standard that is in use as of the date of the filing of this application , and a โ€œ legacy โ€ system may be one that is in use both prior to the date of filing this application and for some time after the filing of this application ; a โ€œ new โ€ system is one implemented or developed after a โ€œ legacy โ€ system , typically including improvements and updates . โ€œ new โ€, โ€œ evolved โ€, โ€œ updated โ€, etc . systems are often backward compatible such that they are usable with โ€œ old โ€, โ€œ legacy โ€ or prior systems or standards . according to embodiments of the invention , the new frame structure may include new synchronization and broadcast channels to extend the capabilities of the ieee std 802 . 16 - 2009 by , for example , enhancing system acquisition and / or enhancing cell selection at low signal to interference + noise ratios ( sinr ). according to the ieee std 802 . 16 - 2009 a broadcast channel ( e . g ., and a dl channel descriptor and ul channel descriptor ) are typically not located at a pre - defined location in a frame , the mobile stations have to decode the common control channel ( e . g ., map ) for acquiring system configuration information . according to an embodiment of the present invention , the new frame structure may include for example a super - frame that includes an integer number of radio frames , which may include synchronization and / or broadcast information and / or messages , such as , system configuration information , which may simplify wireless network 100 operations and further reduce the overhead and acquisition latency of wireless network 100 . reference is made to fig4 , which schematically illustrates a super - frame 400 structure according to an embodiment of the present invention . in some embodiments , a transmission between terminals or nodes may include , for example , one or more super - frames 400 . super - frame 400 may include or be partitioned into a fixed and / or pre - determined number of frames 410 . in other embodiments , the number of frames 410 in each of two or more of super - frames 400 may be different . the number of frames , m , 410 within a super - frame 400 ( e . g ., m , may be an integer , where m = 2 , 3 , 4 . . .) may be a design parameter and may be specified in a standard specification and , for example , may be fixed for a particular profile and deployment . in some embodiments , the number of frames 410 within super - frame 400 may be determined by one or more factors , including but not limited to , for example , target system acquisition time , a maximum permissible distance between two consecutive preambles ( e . g ., synchronization channels ), the minimum number of preambles that may be averaged during system acquisition for the detection of the preamble , and / or a maximum permissible distance between two consecutive broadcast channels ( e . g ., system configuration information or paging channels ). in one embodiment , substantially each super - frame 400 may be partitioned into or include two or more ( e . g ., four ( 4 )) frames 410 . other numbers of partitions , divisions , or frames may be used . the length of each frame 410 may be for example approximately 5 ms , for example , for establishing backward compatibility with systems compliant with ieee std 802 . 16 - 2009 . other frame or radio frame lengths may be used . each of frames 410 may be further partitioned or sub - divided into two or more ( e . g ., eight ( 8 )) sub - frames 420 . other numbers of divisions may be used . the length of sub - frame 420 may determine the tti for terminals that may be compliant with the new standard and , for example , incorporate super - frame 400 and / or frame 410 structures . the beginning and end of each of the ttis may be substantially aligned or synchronized with , for example , a sub - frame boundary . each tti may contain an integer number of sub - frames ( e . g . typically one or two sub - frames ). each sub - frame 420 may be partitioned into or include a fixed number of ofdm symbols 430 . in one embodiment , each sub - frame 420 may be partitioned into or include , for example , six ( 6 ) ofdm symbols , so that the number of ofdm symbols 430 within a sub - frame ( e . g ., the length of sub - frame 420 ) may be compatible to resource block sizes ( e . g ., sub - channels ) corresponding to various permutation schemes , for example , specified in the ieee std 802 . 16 - 2009 . in other embodiments , there may be other or alternative numbers , lengths , sizes , and / or variations , of super - frames 400 , frames 410 , sub - frames 420 , and / or ofdm symbols 430 . the numbers used herein are presented for demonstrative purposes only . in another embodiment , the length of frames 410 ( e . g ., approximately 5 ms ) and the number of ofdm symbols 430 ( e . g ., six ( 6 )), may be set for establishing backward compatibility with ieee std 802 . 16 - 2009 compliant systems , devices , and / or transmissions . permutation schemes , for example , defined according to current standard specifications , may include a number , for example , from one to six , slots for transmitting signals and / or resource blocks . the boundary of physical a resource block may , for example , be aligned with a sub - frame boundary . in some embodiments , each physical resource block may be substantially contained within a single sub - frame 420 . in other embodiments , each physical resource block may be substantially contained within two consecutive sub - frames . it may be appreciated by those skilled in the art that embodiments of the invention , for example , including , super - frame 400 structures , may be applied using either of the tdd and fdd duplexing schemes or modes . in the fdd duplex mode , each of the dl and ul transmissions may be communicated , for example , concurrently , on respective frequencies or channels . in the tdd duplex mode , each of the dl and ul transmissions may be communicated , for example , at substantially non - overlapping intervals ( e . g ., according to time division multiplexing ( tdm ) scheme ) over substantially the same frequency or channel . in the tdd duplex mode of operation and within any frame 410 , sub - frames 420 may be configured to dl and ul transmissions ( e . g ., dl transmission 306 and ul transmission 308 ) for example statically in each deployment . the dl and ul transmissions may be separated by idle times and / or idle symbols for switching between dl and ul transmissions ( e . g ., during switching periods 302 and / or 304 ). in one embodiment of the invention , โ€œ legacy zones โ€ and โ€œ new zones โ€ may include periods , portions or zones , for example , of dl or ul transmission , specifically designed to substantially only communicate with legacy terminals or new terminals , respectively . in the tdd duplex mode of the ieee std 802 . 16 - 2009 , each of dl transmission 306 and ul transmission 308 may be further partitioned into two or more permutation zones . in some embodiments , the number of contiguous ofdm or other symbols 430 in a frame 410 , may be referred to as , for example , a permutation zone ( e . g ., permutation zone 310 , described in reference to fig3 ). the permutation zone may , for example , include a number of contiguous ofdm symbols ( e . g ., in dl and ul transmissions 306 and 308 , described in reference to fig3 ) that use substantially the same permutation ( e . g ., partially used sub - channel ( pusc ) to distributed allocation of sub - carriers , adaptive modulation and coding ( amc ) for localized allocation of sub - carriers , etc .). according to an embodiment of the invention , a frame may include or may be partitioned into legacy zones and new zones ( other terms may be used ). in one embodiment , legacy terminals and new terminals may communicate using legacy zones and new zones , respectively . in some embodiments , new terminals may communicate using both legacy zones and new zones . legacy terminals typically only communicate using legacy zones . in one embodiment , in the frame , each of dl transmissions may be further partitioned into two or more zones , for example , including a dl transmission legacy zones and a dl transmission new ( e . g ., non - legacy ) zones and each of ul transmissions may be further partitioned into two or more zones , for example , including ul transmission legacy zones and ul transmission new ( e . g ., non - legacy ) zones . embodiments of the invention may provide a partitioning of frames into sub - frames ( e . g ., where the boundaries of transmission blocks or zones may be synchronized with the sub - frame boundaries ). according to the ieee std 802 . 16 - 2009 , the boundaries of transmission blocks or zones may start and end at any ofdm symbol within the boundary of a frame . according to embodiments of the invention , the new zones may use a new and more efficient resource allocation and feedback mechanism . the total number of ofdm symbols within a frame may vary depending on the ofdm numerology . in order to maintain backward compatibility with the legacy mobile wimax systems , the same frame size and ofdma numerology ( e . g ., or ofdma parameters ) may be used for the ieee 802 . 16m systems and the legacy mobile wimax systems . it may be appreciated by those skilled in the art that all permissible numerologies and / or frame sizes , for example , specified by the 802 . 16e - 2005 standard , may be used in accordance with embodiments of the present invention . embodiments of the invention may provide super - frame structures that may be compatible with legacy standards , such as , the ieee std 802 . 16 - 2009 and / or other standards . for example , the super - frame structure may include or may be compatible with a subset of features , for example , as specified in the mobile wimax profile ( e . g ., and may be backwards compatible with the mobile wimax profile ). embodiments of the invention may provide a super - frame structure , which may be partitioned into a number of frames that include , for example , one or more , legacy synchronization channel ( e . g ., a ieee std 802 . 16 - 2009 preamble ), new synchronization channels ( e . g ., a ieee 802 . 16m preamble ), broadcast channel ( bch ), medium access protocol ( maps ) or common control channel ( ccch ) in the new and legacy zones corresponding to each frame or an integer number of frames . reference is made to fig5 , which schematically illustrates a super - frame 500 structure according to an embodiment of the present invention . in one embodiment , super - frame 500 may include a legacy preamble 502 , for example , which may be referred to as primary synchronization channel ( psch ). in some embodiments , super - frame 500 may include an additional or supplemental preamble 504 , for example , for improving system timing acquisition and cell selection for new terminals . supplemental preamble 504 may , for example , be referred to as secondary synchronization channel ( ssch ). the synchronization channels may include sequences , which may be used and / or deciphered by both base stations and mobile stations , for example , for acquiring frame timing and / or scheduling . in some embodiments , new preamble 504 may be effectively or partially transparent , unreadable , or undetectable to legacy terminals , while legacy preamble 502 may be detectable to both legacy and new terminals . in some embodiments , super - frame 500 may include a broadcast channel ( bch ) 506 . the broadcast channel may contain information that may for example include system configuration information , paging , and / or other broadcast type information , and may be sent by a base station to all mobile stations in the network and / or surrounding area . as shown in fig5 , supplementary or new preamble 504 ( e . g ., ssch ) may be located at a fixed position in new or legacy zones . in one embodiment of the present invention , for example , the new preamble 504 may be positioned at a fixed offset , which may be referred to as , for example , โ€œ ssch_offset โ€. the ssch_offset may be a measure of a location of the new preamble 504 , for example , relative to the location of the legacy preamble , for example , in every frame . in some embodiments , the legacy preamble in mobile wimax systems may be located in the first ofdm symbol of every frame ( as shown in fig9 ). the value of ssch_offset may be included and broadcasted as part of the system configuration information . in some embodiments , when new preamble 504 is detected by a mobile terminal , the ssch_offset may be used to locate the beginning of a frame . in one embodiment , when ssch_offset = 0 , there may be no legacy preamble 502 , which may indicate that the network does not support legacy terminals . in some embodiments , a new synchronization channel and the broadcast channel may span a minimum system bandwidth ( bw ). in some embodiments , the legacy synchronization channel typically spans the entire system bw , an example of which is shown in fig9 . the region pre - designated for communicating new preamble 504 ( e . g ., via multiple sub - carriers ) may be , for example , transparent and / or ignored by legacy terminals . a scheduler for downlink base station or terminal transmissions typically does not allocate user / system traffic / control / signaling in the region pre - designated for communicating new preamble 504 . in another embodiment of the present invention , for example , new preamble 504 may be located , for example , in the beginning of the new frame where the new frame may be located at a fixed offset relative to the legacy frame . in one embodiment , the fixed offset may be referred to as , for example , โ€œ frame_offset โ€, and may be fixed within the frame timing . in some embodiments , the value of the frame_offset may be set by a network operator or administrator ( e . g ., and not broadcast ). the new mobile terminals may detect new preamble 504 , which may indicate the beginning of the new frame and , for example , other information channels relative to the beginning of the new frame ( e . g ., as shown in fig6 ). for example , the timing or periodicity of bch 506 may be substantially aligned with the timing or periodicity of super - frame 500 transmissions . in various embodiments , super - frame 500 may have substantially different structures , which may be distinguished , for example , based on the relative position of legacy preamble 502 and / or new preamble 504 in super - frame 500 , and / or other features or design considerations for the frame structure ( e . g ., such as a dl scan latency , physical layer overhead , and other information ). it may be appreciated to those skilled in the art that although three options for the structure of super - frame 500 , including for example , options i , ii , and iii , may be described , various other structures and / or variations thereof may be used in accordance with embodiments of the present invention . the description that follows may include embodiments that may individually or collectively be referred to as option i . option i , and other โ€œ options โ€ presented herein are examples only , and are non - limiting . in some embodiments , new preamble 504 and / or bch 506 may be positioned substantially at the beginning of each super - frame 500 , for example , in the first frame of each super - frame 500 in a communication stream . in such embodiments , legacy preamble 502 and new preamble 504 may be separately positioned ( e . g ., spaced or offset along the length of super - frame 500 ). in such embodiments , the impact or visibility of new preamble 504 to legacy terminals ( e . g ., which typically only detect legacy preamble 502 ) and operations thereof , such as , system acquisition , may be minimized . new preamble 504 may be periodically repeated at any desirable frequency , for example , substantially every frame . bch 506 may contain system - configuration information , paging channels , and / or other broadcast information . in some embodiments , bch 506 may be synchronized with super - frame 500 intervals and may appear every integer number of super - frames . in some embodiments , new terminals may use new preamble 504 ( e . g ., exclusively or additionally ) to improve system timing acquisition and fast cell selection . for example , new preamble 504 may include cell identification ( id ) information or codes and may be used for acquisition of frame timing by new terminals . for example , a cell id code may include a concatenated base station group id code , base station id code , a sector id code , and / or other codes or information , for example , to simplify the detection ( e . g ., execute a structured search ) of the cell id . according to embodiments of the invention described in reference to option i , since new preamble 504 may be spaced from legacy preamble 502 , new preamble 504 may be minimally detectable by legacy terminals . in some embodiments , in order to minimize the physical layer overhead ( layer 1 overhead ), for example , which may be increased by using an ofdm symbol for transmitting new preamble 504 , new preamble 504 may be transmitted , for example , over a limited ( e . g ., minimal ) bandwidth or time , or by using additional sub - carriers corresponding to the same ofdm symbol for scheduling user traffic , for example , as shown in fig9 . the description that follows may include embodiments that may individually or collectively be referred to as option ii . reference is made to fig6 , which schematically illustrates a super - frame 600 structure according to an embodiment of the invention . in some embodiments for tdd duplex mode , super - frame 600 may be partitioned into , for example , four frames with pre - designated legacy periods , intervals or zones and new or non - legacy periods , intervals or zones . in one embodiment , legacy frame 610 may be further partitioned into sub - frames , including , for example , dl transmission legacy zones 612 and ul transmission legacy zones 616 . the new frame 620 may begin at a fixed offset ( e . g ., frame_offset ) relative to the beginning of the legacy frame . the value of the frame_offset may be an integer number of sub - frames and may be determined based on the ratio of the lengths or time of the dl to ul transmissions ( e . g ., in tdd duplex mode ). for example , when frame_offset = t offset and t sub - frame denotes the length of the sub - frame and t f denotes the frame length the value of the minimum and maximum permissible values for t offset may be determined as follows : 0 โ‰ฆ ฮฑ โ‰ฆ 1 : the fraction of frame allocated to dl example : ฮฑ = 0 . 625 for dl : ul = 5 : 3 t offset = mt sub - frame 0 โ‰ฆ m & lt ; ( number of dl sub_frames )โˆ’ n in some embodiments , legacy terminals may communicate using legacy frames 610 and new terminals may communicate using new frames 620 and / or legacy frames 610 . according to embodiments of the invention , for example , in option iii , the beginning of new frames 620 and legacy frames 610 may be offset by a fixed value , for example , by a frame offset 622 or an offset interval ( e . g ., a fixed duration of time and / or number of sub - frames ). the relative positions of new frames 620 and legacy frames 610 according to one embodiment are depicted in fig6 , for example , in tdd duplex mode . for example , in tdd duplex mode , legacy frame 610 structure may start with a dl transmission 612 and end with an ul transmission 616 . for example , new frame 610 structure may start with a dl transmission 614 , followed by a ul transmission 618 , and end with a dl transmission 614 . in some embodiments , each new frame 610 may contain a new preamble ( e . g ., ssch ), for example , in a sub - frame at the start or beginning of frame 610 . in other embodiments , each super - frame 600 may include a super - frame header ( sfh ) 624 , for example , in a sub - frame at the start or beginning of super - frame 600 . for example , sfh 624 may include a new preamble and a broadcast channel . for example , k and 6 - k , k = 1 , 2 , . . ., 6 may denote the number of ofdm symbols that are allocated to new preamble and broadcast channel , respectively . the number of ofdm symbols allocated to the new and legacy preambles may be as small as one ofdm symbol per channel . in one embodiment , the remainder of the ofdm symbols available in the sfh 624 sub - frame may be allocated , for example , for user traffic , control , and / or control and signaling information , which may minimize the system layerl overhead . sfh 624 may include a new preamble sequence and the broadcast information ( e . g ., including system configuration information and a paging channel ). in some embodiments , legacy frames and new frames may have a fixed frame offset 622 , which may be configurable by the network operator . in some embodiments of the present invention , the legacy zone and new zone may be offset by a fixed number of sub - frames . the offset value may be substantially stable or fixed within a practical deployment . due to the dynamic nature of network traffic in practice , in some frames , the legacy zone may be under - utilized while the new zone may be fully loaded or vice versa . in some embodiments , a pointer in a ieee 802 . 16m common control channel may be designed and / or used , for example , to point to or indicate a sub - frame in the legacy zone that may be unused by legacy terminals . for example , when legacy zone and / or new zone partitions are fixed , the resources ( e . g ., sub - frames ) may be dynamically allocated from frame to frame maximize the use of physical resources , which may otherwise be unused . the description that follows may include embodiments that may individually or collectively be referred to as option iii . reference is made to fig7 , which schematically illustrates a super - frame 700 structure having a new preamble 704 multiplexed with a legacy preamble 702 , according to an embodiment of the present invention . in some embodiments , a new preamble 704 may be multiplexed with a legacy preamble 702 , for example , every m frames ( e . g ., where m may be the number of frames within a super - frame 700 ). for example , the first ofdm symbol of the first frame 710 in super - frame 700 may include new preamble 704 and the m - 1 succeeding frames 710 in super - frame 700 may include legacy preamble 702 . in some embodiments , a common control channel ( e . g ., including dl and ul maps ) and / or frame control header ( fch ) 708 and a bch 706 transmission may occur , for example , at super - frame 700 and frame 710 intervals , respectively . the acquisition of legacy preamble 702 ( e . g ., by legacy terminals ) may break as a result of interruption in the reception of the periodic legacy preamble 702 . since new preamble 704 and legacy preamble 702 may share physical resources , for example , and may be transmitted at substantially the same or overlapping times or locations along super - frame 700 , there may typically be no additional physical resource needed for including the new preamble 704 into a super - frame 700 structure . additionally , in some embodiments , the position of new preamble 704 may be fixed within a periodic number ( one or more ) of frames 710 . in some embodiments , when new preamble 704 and legacy preamble 702 are code division multiplexed , for example , in substantially the same ofdm symbol , there is typically no substantial impact on the layerl overhead . in such embodiments , some legacy preambles 702 may be transmitted in succession and , for example , other legacy preambles 702 may be superimposed with new preamble 704 ( e . g ., according to multiplexing scheme discussed herein ). in some embodiments , new preamble 704 may be multiplexed with legacy preamble 702 using , for example , a code division multiplexing ( cdm ) scheme . a cdm scheme may include code division multiplexing new preamble 704 and legacy preamble 702 , for example , substantially every m frames 710 , for example , as shown in fig7 . in one embodiment , new preamble 704 and legacy preamble 702 sequences may be superimposed and transmitted ( e . g ., by a new base station or terminal ) every m frames , for example , according to the following equation : y k = u k + x k u โ€ฒ k where u k , u โ€ฒ k , x k may denote the k th primary synchronization sequence , the k th new synchronization sequence , and the k th spreading function . other ( e . g ., linear ) combinations may be used . for example , the spreading function may include a set of robust spreading functions , which may substantially cover the new synchronization sequences . other multiplexing schemes or combinations thereof may be used . in one embodiment , legacy preamble 702 and new preamble 704 may be , for example , code division multiplexed every fixed number ( e . g ., m = 1 , 2 , 3 . . .) frames . in such embodiments , legacy terminals may experience or include a small degradation in the energy of the legacy preamble every m frames . the new terminals may detect and extract new preamble 704 that may encroach or may be superimposed on legacy preamble 702 . as presented herein , new preamble may be referred to , for example , as โ€œ new preamble โ€, โ€œ new preamble โ€, โ€œ new synchronization channel โ€, โ€œ ssch โ€ and โ€œ secondary synchronization channel โ€, a new system , profile , and / or standard , may be referred to , for example , as an โ€œ evolved version โ€ of the reference system standard . reference is made to fig8 , which schematically illustrates a super - frame 800 structure having a new preamble 804 multiplexed with a legacy preamble 802 , where legacy preamble 802 may be obscured from legacy terminals , according to an embodiment of the present invention . in some embodiments , the superposition of new preamble 804 on the legacy preamble 802 may , for example , increase interference levels or , for example , an interference over thermal 820 ( iot ) value . the objective is to find the minimum signal to interference + noise ratio ( sinr ) that is required for proper detection of the legacy preamble or alternatively the maximum iot that can be tolerated by the legacy terminals ( this leads to the maximum power that can be used for the new preamble ). in one embodiment of the present invention , a signal received at the s th sub - carrier , y s , may be calculated , for example , as shown in the equations that follow . in one embodiment , new preamble 804 associated with each new base station or relay station may be substantially different , for example , for enabling a mobile station to distinguish , detect , and / or select , different base stations or relay stations in a network . in some embodiments , since the received power 822 of new preamble 804 may be determined , or be directly proportional to , the iot 820 , it may be desirable for the iot 820 to be maximized , for example , to the extent that the minimum sinr level would allow the legacy terminals to correctly detect legacy preambles 802 . in some embodiments , an optimization of the iot 820 value may be performed , for example , according to the equations that follow : other criteria for the optimization of the iot value may be used . in some embodiments , when legacy preambles 702 and 802 are code division multiplexed , transmitting new preamble 704 and 804 , respectively , may have substantially no or minimal effect on the physical layer overhead of the system in which they are transmitted . in such embodiments , superimposing new preamble 804 onto legacy preamble 802 respectively , may limit the received power 822 of new preamble 704 and may potentially interfere with or obscure system acquisitions of legacy preamble 802 by legacy terminals , for example , due to additional interference from new preambles transmitted by neighboring base stations or relay stations . the effect of additional interference may be minimized , for example , using robust preamble detection algorithms , for example , having minimal sensitivity to instantaneous degradation in the preamble power . it may be appreciated by those skilled in the art that each of three options for embodiments of the structure of a super - frame and / or partitions thereof , including for example , embodiments described in reference to each of options i , ii , and iii , may be applied to both tdd and fdd duplex schemes . the size and distribution of the new and legacy zones and their corresponding dl and ul transmissions and / or sub - frames , may depend , for example , on factors including but not limited to the distribution of the new and legacy terminals , network load and performance optimizations for new and legacy terminals . reference is made to fig1 , which schematically illustrates a frame 1000 structure in fdd duplex mode according to an embodiment of the present invention . frame 1000 may include sub - frames 1030 . in some embodiments , super - frame 1000 may include a legacy preamble 1002 , a new preamble 1004 , and a bch 1006 , which may be transmitted every integer number of super - frame transmissions . in one embodiment , legacy preamble 1002 , new preamble 1004 , and / or bch 1006 may be positioned at the beginning of frame 1000 . according to embodiments of the invention , in the fdd duplex mode , dl transmissions 1016 and ul transmissions 1018 may occur substantially simultaneously , for example , at different frequencies ( e . g ., dl frequency f 1 1024 and ul frequency f 2 1026 , respectively ). reference is made to fig1 - 13 , which schematically illustrate frame structures 1100 , 1120 , 1200 , 1220 , 1300 , and 1320 and their respective sub - frames , 1110 , 1130 , 1210 , 1230 , 1310 , and 1330 , according to various embodiments of the present invention . in fig1 , tdd frame 1100 is shown with a dl / ul ratio of 4 : 3 and fdd frame 1120 for 5 , 10 or 20 mhz channel bandwidth with a cyclic prefix of ยผ of useful ofdm symbol length . the tdd frame 1100 may consist of seven sub - frames 1110 of six ofdm symbols each and fdd frame 1120 may have the same configuration as the tdd frame to maximize commonality or may consists of six sub - frames 1110 of six ofdm symbols and one sub - frame 1130 of seven ofdm symbols . as an example , for an ofdm symbol duration of 114 . 386 microseconds ( tb ) and a cp length of ยผ tb , the length of six - symbol sub - frames 110 and seven - symbol sub - frames 1130 are 0 . 6857 ms and 0 . 80 ms , respectively . in this case , the transmit - to - receive transmission gap ( ttg ) and receive - to - transmit transmission gap ( rtg ) are 139 . 988 microseconds and 60 microseconds , respectively . in fig1 , tdd frame 1200 is shown with a dl / ul ratio of 3 : 2 and fdd frame 1220 for 7 mhz channel bandwidth with a cp of ยผ tb . the tdd frame 1200 may consist of five six - symbol sub - frames 1210 and the fdd frame 1220 may have the same structure as the tdd frame to maximize commonality or may consist of four six - symbol sub - frames 1210 and one seven - symbol sub - frame 1230 . assuming ofdm symbol duration of 160 microseconds and a cp length of ยผ tb , the length of six - symbol sub - frame 1210 and seven - symbol sub - frame 1230 are 0 . 960 ms and 1 . 120 ms , respectively . the ttg and rtg are 140 microseconds and 60 microseconds , respectively . in fig1 , tdd frame 1300 is shown with a dl / ul ratio of 4 : 2 and fdd frame 1320 for 8 . 75 mhz channel bandwidth with a cp of ยผ tb . the tdd frame 1300 has four six - symbol sub - frames 1310 and two seven - symbol sub - frames 1330 and fdd frame 1320 has three six - symbol sub - frames 1310 and three seven - symbol sub - frame 1330 . assuming ofdm symbol duration of 128 microseconds and a cp length of ยผ tb the length of six - symbol sub - frame 1310 and seven - symbol sub - frame 1330 are 0 . 768 ms and 0 . 896 ms , respectively . the number of ofdm symbols in a sub - frame may be related to , for example , the length of each ofdm symbol and / or the cyclic prefix value . however , to simplify the implementation of the system , it is desirable that all sub - frames within a frame have the same size and consists of the same number of ofdm symbols . embodiments of the invention may be used having any suitable ofdma numerology . it may be appreciated by those skilled in the art that although a variety of parameters ( e . g ., duplex modes , cyclic prefix values , ofdma numerologies , etc .) may be used according to embodiments described herein , suitable variations may be used , for example , as depicted in the variations of fig1 - 13 . reference is made to fig1 , which is a table of ofdma parameters according to embodiments of the present invention . fig1 lists parameters for a cp of ยผ . the cp length of one quarter is equal to 22 . 85 microseconds ( for bandwidths of 5 , 10 or 20 mhz ) which corresponds to a cell size of approximately 5 km . therefore , a delay spread of up to 22 . 85 microseconds can be mitigated . reference is made to fig1 , which is a flow chart of a method according to an embodiment of the present invention . in operation 1500 , a processor in a terminal may partition each frame into two or more sub - frames . the frames ( e . g ., frames 410 described in reference to fig4 , or other frames ) may be backward compatible with a reference system profile and for example , defined according to a reference standard system ( e . g ., ieee std 802 . 16 - 2009 or mobile wimax profiles ). thus , as compared with the frames from which sub - frames are partitioned , the sub - frames ( e . g ., sub - frames 420 described in reference to fig4 ) may be shorter and therefore processed and transmitted / received faster with smaller periodicity . transmitting according to the sub - frame structure may provide over the air communications having a periodicity on the scale of several sub - frames instead of the relatively longer periodicity of several frames . in operation 1505 , a transmitter may transmit one or more sub - frames during a pre - designated downlink transmission ( e . g ., pre - designated dl transmissions 306 , described in reference to fig3 ). in operation 1510 , the transmitter may transmit one or more sub - frames during a pre - designated uplink transmission ( e . g ., pre - designated ul transmissions 308 , described in reference to fig3 ) in operation 1515 , the transmitter may transmit one of the plurality of sub - frames including a legacy preamble for communicating with a legacy terminal , for example , operating according to the reference system profile during a pre - designated legacy transmission period or zone ( e . g ., legacy zone 612 and / or 616 , described in reference to fig6 ). in operation 1520 , the transmitter may transmit one of the plurality of sub - frames including a new preamble for communicating with a new ( e . g ., a non - legacy ) terminal , for example , operating according to an evolved or newer version of the reference system standard , such as , the ieee 802 . 16m standard , during a pre - designated new ( e . g ., a non - legacy ) transmission period or zone ( e . g ., new zone 614 and / or 618 , described in reference to fig6 ). in various embodiments , the first and second signals may be transmitted in a tdd duplex mode or an fdd duplex mode . in some embodiments , when the signals are transmitted in a tdd duplex mode , operations 1505 and 1510 may be executed over substantially different time intervals , or frame positions , such that the first and second signals may be transmitted separately . in other embodiments , when the when the signals are transmitted in an fdd duplex mode , operations 1505 and 1510 may be executed in substantially overlapping time periods , such that the first and second signals may be transmitted over substantially distinct frequencies and / or channels . in some embodiments , the sub - frames may be further partitioned into two or more ( e . g ., six ) information - carrying , multiplexing , and / or ofdm symbols . in some embodiments , the first and second signals may include a legacy preamble for communicating with legacy terminals operating according to the reference system profile and a new preamble for communicating with a new ( e . g ., a non - legacy ) terminal operating according to a second system standard and / or an evolved version of the reference system . in one embodiment , each of the first and second sub - frames may be pre - designated for communicating with one of a legacy terminal , a non - legacy terminal , or both a legacy and non - legacy terminal . for example , one of two or more sub - frames in operation 1510 may be pre - designated for communicating with both a legacy and a non - legacy terminal . in some embodiments , the beginning of the frames , which may be pre - designated for communicating with legacy terminals and non - legacy terminals , may be offset , for example , by a fixed number of sub - frames . in some embodiments , a super - frame may be defined . for example , the super - frame may include two or more frames ( e . g ., the frames described in operation 1500 ) that may be transmitted in succession . in one embodiment , the new preamble may be transmitted substantially once during the transmission of each super - frame . in one embodiment , the new preamble may be transmitted substantially once every frame . according to embodiments such as that of option i described herein , the legacy preamble and the new preamble may be transmitted separately , for example , at a substantially fixed distance apart along the length of the frame . in one embodiment , a process may execute operations 1500 , 1505 , and 1510 and need not execute operations 1515 and 1520 . in another embodiment , a process may execute operations 1500 , 1515 , and 1520 and need not execute operations 1505 and 1510 . in yet another embodiment , a process may execute operations 1500 , 1505 , 1510 , 1515 , and 1520 . the process may execute other sequences , orders , and / or permutations of operations described herein . while the invention has been described with respect to a limited number of embodiments , it will be appreciated that many variations , modifications and other applications of the invention may be made . embodiments of the present invention may include other apparatuses for performing the operations herein . such apparatuses may integrate the elements discussed , or may comprise alternative components to carry out the same purpose . it will be appreciated by skilled in the art that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention .
7
turning now to the drawings , there is shown an oil level sensor 11 having a main or body portion 13 , which houses the on - board electronics of the sensor , terminating on the left in a suitable connector 15 , such as the packard - type connector shown . sensor body 13 has integrally formed therewith a hexagonal wrench - engaging surface 17 to facilitate the securing of the sensor in the block or the like ( not shown ) of an internal combustion engine . adjacent hexagonal surface 17 are screw threads 19 which constitute means for mounting the sensor on the engine block . screw threads 19 are integrally formed on the outer surface of a probe 21 which extends distally from the main portion of body 13 . this outer surface is preferably integrally formed with body 13 and constitutes a first electrode 23 of a sensing capacitor described below . probe 21 is cylindrical , which makes fabrication and installation of the probe relatively easy . a plurality of holes or orifices 25 pass through electrode 23 at various locations to allow the oil whose level is being sensed to flow freely into and out of the interior of the probe . also shown in fig1 although not physically present on sensor 11 itself , is an ellipse 27 which illustrates the set points of the sensor ( see discussion in connection with fig3 - 5 ). disposed inside cylindrical electrode 23 is a second , smaller cylindrical electrode 29 ( fig2 ) which is substantially concentric with electrode 23 . a pair of ceramic ( or an alternative insulating material ) disks 31 and 33 support electrode 29 at each end and secure it against radial movement with respect to outer electrode 23 . electrode 29 has hollowed out end portions to receive shoulders 35 and 37 on disks 31 and 33 . with this method of attachment , the smaller electrode is supported solely from inside . this reduces the stray capacitance between electrodes 23 and 29 since no high dielectric material is introduced into the gap between the two electrodes . in addition , since electrode 29 is supported at both ends , the electrode is not subjected to the fatigue - inducing low - frequency vibrations which affect cantilevered electrodes . ceramic disk 33 at the distal end of the probe is held in place by crimping of the distal end of electrode 23 at shown at 39 . this , or some other simple and economical mechanical attachment , holds the inner electrode in place . a belleville washer 41 is disposed in the proximal end of the recess or hollow in electrode 23 in which electrode 29 fits . this washer allows the fabrication tolerances for sensor 11 to be increased while still preventing vibration of the inner electrode . washer 41 has a central opening through which passes a conductor 43 which makes the electrical connection between electrode 29 and the circuitry of fig7 . conductor 43 passes through a suitable seal 45 , of glass or the like , in the wall of sensor body 13 . since the seal 45 is completely separate from the supporting structure for the inner electrode , stress on conductor 43 and seal 45 are drastically reduced . sensor body 13 has a circuit board 47 mounted and potted therein . the circuit board carries the electronics of fig7 and the electrical connection to conductor 43 is made on this board . a similar conductor 49 electrically connects electrode 23 ( the outer electrode ) to circuit board 47 . four wires ( see fig6 for the corresponding pins ) connect circuit board 47 to the external control system via plug or connector 15 . electrode 29 is preferably metal with an insulated layer over nearly its entire surface area . anodized aluminum works well as the material for electrode 29 , since the insulation formed by the anodizing is durable and easy to fabricate . it has been found that various oils begin to conduct electricity to a slight , but significant degree at elevated temperatures such as are typical of internal combustion engines . as a result , the oil which functions solely as a dielectric at room temperature becomes a conductor ( albeit a poor one ) at elevated temperatures and the conductivity effects begin to mask the dielectric constant / capacitive effects which sensor 11 is designed to detect . insulating electrode 29 minimizes this problem and results in a sensor 11 with increased temperature stability . electrode 29 extends proximally a significant distance past the distal end of screw threads 19 . in fact it extends all the way past the proximal end of the threads , even though this part of probe 21 is located in the wall of and outside the block . this feature of recessing the electrodes which make up the sensing capacitor results in significantly more capacitive signal potential for the probe without increasing the sensor size . as a result sensor 11 can be used in places where the space available is constrained . in addition , since the sensor has more capacitance than it would otherwise , the gap between the electrodes can be selected from a greater possible range of values to provide an increased operating margin and reliability . for a given maximum outer electrode diameter , the gap between electrodes 23 and 29 is selected to provide an operating margin for the sensor optimized with respect to response time and electronics stability . in selecting the gap size , two primary factors must be taken into consideration . one is that the capacitance of the probe increases as the gap size decreases . since the detection of the presence or absence of oil depends on the capacitance detected by the electronic circuitry , and since these capacitances are in general very small , the gap size should be decreased as much as possible to increase the capacitance . however , the extent to which oil &# 34 ; clings &# 34 ; in the gap , even when the surrounding oil drops below the level of the oil in the probe , also increases when the gap size decreases . once the gap size is reduced to a certain point , the probe will always indicate the presence of oil , even when no oil is present around the probe , because of the cling effect . for a gap size less than the critical gap size which the working fluids cannot bridge ( typically 0 . 1 inches for most oils ), there will always be a certain amount of oil clinging to the inside of the probe . this amount results in a &# 34 ; useless &# 34 ; volume of the probe , which reduces the probe &# 39 ; s useful signal variation and makes electronic detection of the oil level a more demanding and expensive task . of course , the larger the gap size the quicker oil tends to drain out of the sensor , and the faster the response time of the sensor to falling oil level . for many applications , a response time of ten seconds is satisfactory so the gap is selected to ensure this response time or better . for the present sensor configuration , a gap of approximately 0 . 05 inch has been found to provide such a response time . note that this gap is about one - half the gap of 0 . 1 inch found in prior art sensor which have no oil clinging in the gap . but such a large prior art gap provides substantially less capacitance for a given configuration and thus requires considerably more expensive electronics to detect the smaller capacitance changes . with the smaller gap of the present invention , relatively inexpensive electronics may be used and , in addition , the operating margin of the sensor is increased at the same time . the operating margin in this sense is the capacitance of the probe having its gap filled with an oil of the minimum dielectric minus the capacitance of the probe with oil having a maximum dielectric clinging in the gap . for generally acceptable response times ( e . g . ten seconds or less ), the operating margin is a decreasing function of gap size . more importantly these acceptable response times are achievable with gap sizes which result in significant clinging of oil to the probe . as a result , operating margin is improved using gap sizes heretofore not used in capacitive probes because of clinging . the ellipse 27 ( see fig3 - 5 ) illustrates the typical set point of sensor 11 ( which is determined by the electronic circuit ). for any orientation , the ellipse should be covered for the sensor to register the presence of oil . the full / low set point is , therefore , determined by drawing a horizontal line tangent the upper extent of ellipse . the set points are illustrated for a vertical orientation of the sensor ( fig3 ), for a horizontally disposed probe ( fig4 ), and for the probe disposed at a forty - five degree angle ( fig5 ). in fig6 the four conductors 51a - d which connect the sensor electronics with the external control system are shown . as will become apparent two of these pins form the power supply for the circuitry of sensor 11 , one provides the self - test feature of the present invention , and the final pin carries the output of the circuitry to the external control system . the components on circuit board 47 are selected for their ability to withstand temperatures of 150 degrees centigrade and above . the circuit itself is designed so that component drift with temperature and age is for the most part self - compensating . for example , matched components such as a matched diode package 55 are used . additionally , the circuit provides inexpensive control over drift effects by comparing two circuit legs of similar design and construction . more particularly , pin 51a supplies a predetermined voltage from 4 . 5 to 15 volts dc to the circuitry of fig7 . pin 51d provides the circuit ground and completes the power supply for the circuitry . a 0 . 1 micro - f capacitor c1 is connected across the supply . power is supplied to an oscillator 57 which comprises a ca3290 - type comparator 59 , a 15k resistor r1 , a 1 . 5k resistor r2 , a 27k resistor r3 , a 39k resistor r4 , a 5 . 1k resistor r5 , and a 1000 pf capacitor c2 connected as shown . the output of comparator 59 is a train of pulses at a predetermined frequency determined by the values of the components listed above , which pulse train is supplied through matched diode pair 55 to the two legs of the circuit . the upper leg of the circuit of fig7 includes probe 21 , and specifically electrodes 23 and 29 of probe 21 . since the capacitance of the capacitor formed by these two electrodes varies depending upon the amount of oil ( dielectric ) in the gap between them , this leg of the circuit is the variable portion . a 0 . 1 micro - f capacitor c3 is connected between electrode 23 and the circuit ground . the pulse train from oscillator 57 , as modified by the capacitance of probe 21 , passes through a filter consisting of a 221k resistor r6 , a 0 . 01 micro - f capacitor c4 and a 200k resistor r7 to the non - inverting input of a comparator 61 . a 12 pf capacitor c5 provides positive feedback for comparator 61 and a 5 . 1k resistor ro is connected between its output and the positive voltage source . the lower leg of the circuit is similar to the upper leg , but it is connected to the inverting input of comparator 61 . instead of the capacitor made up of electrodes 23 and 29 , the lower leg of the circuit includes a 22 pf capacitor c6 in parallel with a selectively adjustable capacitor c7 having a capacitance of between two and ten pf . capacitor c7 is provided so that the set point of the sensor may be adjusted . the pulse train from oscillator 57 , as modified by capacitors c6 and c7 , passes through a filter consisting of a 200k resistor r8 , a 0 . 15 micro - f capacitor c8 , and a 200k resistor r9 to the inverting input of comparator 61 . when oil is present in the sensor at the level corresponding to the set point of sensor 11 , the signal on the non - inverting input to comparator 61 is greater than that on the inverting input , so the output of the comparator goes high . this high signal is supplied over pin 51b to the external control circuitry and indicates the presence of oil at the sensor . conversely , when the oil level is below the set point , the output of comparator 61 is low . of course shorting of electrodes 23 and 29 by water or metal particles also result in the output of the comparator going low , to indicate a possible problem condition . as is readily apparent , the circuitry of fig7 is dc - current isolated , which eliminates ground loops and enhances system reliability . the self - test signal for the circuitry of fig7 is supplied to the circuitry over pin 51c . this pin is ordinarily grounded , reducing system power requirements . when the pin goes high , it switches on an npn transistor q1 . more specifically , the signal on pin 51c is supplied through a voltage divider made up of two 10k resistors r10 and r11 to the base of transistor q1 . when transistor q1 conducts , it disables oscillator 57 . the values of the components in the two legs of the circuit discussed above have been selected so that whenever the oscillator is disabled , the output of comparator 61 goes high momentarily , followed by a stable low output so long as the self - test signal is applied . in this way regardless of the initial oil level indication of the sensor , the opposite output state can be induced , verifying the ability of the circuit to indicate both states . if the oscillator has failed before the self - test signal is applied , the comparator output stays low even after the self - test signal is removed . although the present invention has been described with reference to an oil level sensor which indicates only the presence or absence of oil , it should be appreciated that this is a feature of the switched output and that the sensor and circuitry are not inherently so limited and can , in fact , be used in a sensor which indicates the actual level of the oil as well . in view of the above , it will be seen that the objects of this invention are achieved and other advantageous results obtained . as various changes could be made in the above constructions without departing from the scope of the invention , it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .
5
as shown in the drawing fig1 - 89 , the present invention is directed to a mission - adaptable set of components forming a convertible cart / utility table . for example , the present invention may include foldable cart 1 , having a load support for carrying a load , such as a boat , such as a canoe , which can also function as a game cart or a wagon for carrying gear in outdoor field applications . fig1 shows cart 1 in a disassembled storage position with a pair of horizontal load support members 10 laid parallel adjacent to each other , supporting wheels 30 thereon . wheels 30 are secured in place by a transverse connecting rod 31 through wheel hubs 30 a and by one or more load securing straps 50 . disassembled storage cart 1 is inserted within carry bag 120 , which includes ledge 121 and fabric loops 122 for holding bracket members 60 , 70 and handle 80 outside of carry bag 120 . to transport portable cart 1 by hand carry straps 124 are attached to carry bag 120 . conversely as shown in fig2 , to transport portable cart 1 upon the back of a user , carry straps 124 are attached to carry bag 120 , which supports portable cart 1 in a weight bearing manner , or else horizontal support members 10 are inverted to support portable cart 1 in a weight bearing manner , and carry bag 120 covers portable cart 1 in a non - weight bearing manner . to be disassembled in a carry position , u - shaped bracket rails 60 , 70 , wheels 30 and axle members 32 are inversely attached to horizontal load supports 10 to comprise a folded manually transportable cart . as shown in the exploded view of fig3 , in the storage position , in a preferred embodiment , cart 1 includes a pair of parallel , spaced apart inverted horizontal load support members 10 . support members 10 each have a front - end 10 a and a rear end 10 b . the front and rear ends 10 a , 10 b each have at least one axially placed receptacle aperture 12 extending longitudinally within each load support member 10 , for holding structural components therethrough in a storage position , such as axle members 32 for wheels 30 . in this storage position , axle members 32 are also inserted within aperture of 33 of axle connector 34 . fig3 also shows horizontal load support members 10 having preferably a generally upside down u - shaped configuration when viewed in cross - section , wherein a generally flat member 10 c has downwardly extending flanges 10 d , 10 e including one or more linearly extending slots 10 f for insertion of holding straps 50 therein . although apertures 12 are shown in the drawings , it is contemplated that other configurations may be applicable to horizontal load support members 10 , so long as other members , such as rails 60 , 70 and so forth , may be attached thereto by fasteners , preferably in an axis parallel to the axis of horizontal support members 10 . while size may vary , support member 10 is preferably sixteen ( 16 ) inches long and two and a quarter ( 2 . 25 ) inches wide . each flange 10 d , 10 e extends down about one ( 1 ) inch from flat member 10 c . slots 10 f are preferably 2 . 125 inches wide and 0 . 1875 inches high , to accommodate straps 50 , such as , for example , standard 2 - inch wide fabric straps . fig3 also shows vertical struts 20 optionally having at least one small hole 22 , such as kickstand receptacle aperture 22 , for insertion of optional kickstand 40 therein . fig3 also shows horizontal load support members 10 being respectively demountably attached to a pair of vertical struts 20 , having apertures 21 and 22 . in one embodiment , horizontal load support members 10 can be demountably attached to vertical struts 20 , but in an alternate embodiment they can be permanently affixed to each other , such as in the alternate embodiments shown in fig3 a and 3b . moreover , while preferably horizontal struts are u - shaped , as in fig3 , in alternate embodiments other configurations can be used , as long as vertical strut 20 can be attached to horizontal support member 10 . for example , in fig3 a vertical strut 20 โ€ฒ is in a unified t - shaped member with horizontal support member 10 โ€ฒ. in fig3 b , vertical struts 20 โ€ฒ and horizontal support members 10 โ€ฒ are attached by weldment 20 โ€ณ. in fig3 c , vertical strut 20 โ€ฒ is inserted in hole 10 โ€ณ of horizontal support member 10 โ€ฒ, and attached by fastener 10 โ€ฒโ€ณ, such as a screw or other fastener . in these alternate embodiments shown in fig3 a , 3b or 3 c , horizontal load support members 10 โ€ฒ may be solid in cross sectional configuration . one such configuration shown in fig3 a , 3b and 3 c is that of a parallelepiped , namely a solid form , all of whose sides are parallelograms , such as rectangles , and whose opposite sides are parallel to one another . in another embodiment vertical strut 20 may be adjustable in length with a sleeve containing a telescopic shaft ( not shown ) and with a spring urging the shaft in and out of the sleeve , with a lock provided . kickstand 40 is shown deployed in fig4 . kickstand 40 is secured in place by a fastener , such as nylon set screw 37 . set screws 37 also hold axle members 32 in the storage position through vertical struts 20 . vertical struts 20 are preferably made from 1ยฝ ร— 2 - inch solid bar stock anodized aluminum , or stainless steel . vertical struts 20 are preferably about 10 . 25 inches long , 2 inches wide and 1ยฝ inches in depth . also shown in fig3 , the plurality of optional larger holes 21 , such as holes , which are 0 . 765 or 1 . 625 inches in diameter , are located on a front side of vertical strut 20 . smaller hole 22 on the bottom accommodates kickstand 40 , which is preferably a hollow aluminum tube of 0 . 75 - inch diameter and 16 inches in length . optional larger holes 21 within vertical strut 20 are provided for weight reduction of portable cart 1 . on a side 23 transverse to the front 24 of each vertical strut 20 , at a lower portion 20 a thereof , is provided a further hole 25 of about 1 - inch in diameter for insertion of each axle member 32 therethrough . hole 25 has a permanently affixed , bushing 26 therein , such as a pvc ( polyvinyl chloride ) bushing , to prevent wear and tear of each aluminum axle member 32 by the aluminum surface of hole 25 . as also shown in fig3 and 6 , each wheel 30 is demountably attached at an end , respectively , to a pair of axle members 32 , with axle members 32 extending inwardly from and demountably attached to lower portion 20 a of the respective vertical struts 20 , wherein axle members 32 are in a transverse relationship to horizontal load support members 10 . fasteners , 36 , such as cotter pins , hold each wheel 30 upon each axle 32 . each axle member 32 is received within each hole 25 , of each lower portion 20 a of each vertical strut 20 . a compression groove 27 exists from the underside of vertical strut 20 to hole 25 and continues to further through hole 27 a , providing for compression of lower portion 20 a of vertical strut 20 . to accommodate narrow or wider cargo , such as watercraft of varying widths , the distance between vertical struts 20 can be varied along the axle length by loosening and tightening the tightening member 28 and moving vertical struts 20 laterally apart or towards each other along axle members 32 . although optionally a one - piece axle may be used ( not shown ), preferably the pair of axle members 32 are held in opposite axial orientation by straight rigid axle connector 34 . axle connector 34 has tightening member 35 , and a pair of receptacles 33 at the respective two ends of axle connector 34 , so that axle members 32 respectively extend outwardly from , and are demountably attached within , the axle connector receptacle bore 33 . while the axle may be optionally a one - piece axle , such as shown as reference numeral 606 in fig3 herein , preferably the pair of connected oppositely extending axle members 32 form together an axle for wheels 30 . each axle member 32 is made of solid round stock of anodized aluminum or stainless steel , approximately 0 . 75 inches in diameter . at the wheel - supporting end 32 a , the diameter is about 0 . 59 inches in diameter with shoulders 32 b of about 0 . 08 inches in height , transverse to the axis of axle member 32 . these shoulders 32 b provide a resting surface to prevent axial movement of wheel 30 upon axle member 32 . as shown in fig7 , each wheel 30 rotates about press fit bearings 32 b , while each wheel 30 is positioned upon each respective axle member 32 of fig8 . as shown in fig6 , at the opposite end of one axle member 32 , there is provided a hollow , threaded recess 32 c of about 0 . 75 inches deep , to accommodate a connecting threaded member 32 d of other axle member 32 , to axially connect both axle members 32 together within axle connector 34 , with a wheel 30 at each end . fig8 and 9 show how axle connector 34 is compensated along groove 38 , thereby locking axle members 32 within bushing 39 , which is within receptacle bore 33 of axle connector 34 , by tightening of tightening bolt 35 a of tightening member 35 . preferably bushing 39 is a pvc ( polyvinyl chloride ) bushing . groove 38 is preferably 1 / 16 to โ…› inch , in width , which allows for the compression of axle connector 34 around axle members 32 . tightening bolt 35 a is inserted within a conventional receptacle which is a through hole at the proximal end and which is tapped with threaded grooves at the distal end , to allow for compression of axle connector 34 . fig4 and 6 also show at least one kickstand 40 , preferably a pair , respectively extending horizontally rearward from each lower portion of vertical struts 20 . each kickstand member 40 extends rearwardly from the at least one kickstand receptacle aperture 22 of respective vertical struts 20 and each kickstand 40 is demountably attached within each respective kickstand receptacle aperture 22 . each kickstand member 40 is preferably contoured so as to contact the ground to stabilize portable cart 1 is a parked position of rest . as shown in fig5 , to hold a canoe , game or cargo in place upon cart 1 , one or more adjustable load - securing straps 50 are slidably attached to both respective horizontal load supports 10 in a transverse relationship to load supports 10 . straps 50 are preferably reinforced flexible canvas straps of about 2 inches in width . to complete portable cart 1 as a canoe or boat cart , fig4 shows support cushions 13 mounted upon respective horizontal load supports 10 . support cushions 13 are flexible , such as of rubber or foam , to support the weight of boat 2 thereon . fig1 and 11 show the precision balancing of boat 2 upon cart 1 , wherein the placement of boat 2 upon cart 1 causes cart 1 to rotate from a position of rest in fig1 to a horizontal load position of fig1 , in the direction of the arrow . fig1 - 17 show another embodiment that converts portable cart 1 into a game cart . alternatively , fig1 - 20 show how to convert cart 1 into a cargo wagon with a hollow well . first , in either situation , carry frame 55 is secured to horizontal load supports 10 . although a one piece , generally rectangular frame ( not shown ) may be used , preferably frame 55 includes a pair of u - shaped brackets 60 , 70 joinable together to form frame 55 . various fasteners may be provided to horizontal load supports 10 to carry objects , such as carriers , thereon . alternatively , for example , a clamp may be provided to horizontal load supports 10 to carry a frame of a discrete transportable carrier directly thereon , as disclosed hereinafter with respect to fig2 - 24 . in that case , instead of the frame being integrally part of the portable chart , as in fig1 - 17 , in fig2 - 24 , the frame is clamped to the horizontal load supports 10 of portable cart 1 . other fasteners may include longitudinally extending channel slots , such as in fig3 - 39 described further below . meanwhile , further with respect to fig1 - 17 , u - shaped front bracket 60 extends horizontally forward from front - end receptacle apertures 12 of horizontal load supports 10 , wherein front bracket 60 is demountably attached within front - end receptacle apertures 12 at one end of horizontal load supports 10 . u - shaped rear bracket 70 extends horizontally rearward from oppositely positioned rear end receptacle apertures 12 of horizontal load supports 10 and rear bracket 70 is demountably attached within each oppositely positioned rear end receptacle aperture 12 of horizontal load supports 10 . fig1 shows how frame 55 is secured to cart 1 . each distal end of u - shaped front bracket 60 is inserted through apertures in respective ends 10 b of horizontal supports 10 until each distal end engages a corresponding hole in each vertical support 20 , where they are held in place by pins 29 . pins 29 engage lateral holes 18 in horizontal supports 10 and corresponding through holes 19 in distal ends of u shaped brackets 60 . likewise , each distal end of u - shaped rear bracket 70 is inserted through apertures in respective ends 10 a of horizontal supports 10 until each distal end engages a corresponding hole in each vertical support 20 , where it is also held in place by a pin 29 . pins 29 engage lateral holes 18 in horizontal supports 10 and corresponding through holes 19 in distal ends of u shaped brackets 60 , 70 of frame 55 . u - shaped brackets 60 , 70 are preferably of hollow , anodized aluminum tubing of about 0 . 75 inches in diameter . the length of each distally extending side member thereof is about 23 . 50 inches and the width of the cross bar connecting the distal side members is about 21 . 63 inches . about 0 . 75 inches from each distal end is a scoring , to accommodate a clamp thereon , to form frame 55 . as shown in fig1 and 15 for pulling or pushing game or cargo upon portable cart 1 , handle 80 extends rearwardly at an upward angle from joints 71 of either u - shaped rear bracket 70 for pushing portable cart 1 , or from front u - shaped bracket 60 for pulling portable cart 1 ( not shown ). furthermore , handle 80 may be permanently attached to either u - shaped bracket 60 or 70 , or handle 80 may be removable and demountably attached to either front u - shaped bracket 60 or rear u - shaped bracket 70 . handle 80 has preferably two aluminum tubing connecting members about 22 . 5 inches in length , connected by a hand accommodating transverse bar of solid aluminum , and is 17 . 5 inches in width . handle 80 includes connectors 81 , having distal sleeves , such as pvc ( polyvinyl chloride ) sleeves 82 , permanently affixed thereto , which are insertable within joints 71 by locking member 72 , having threaded member 72 a which passes through bore 71 a of joint 71 and bore 81 a of handle 80 . compression groove 73 exists in joint 71 , providing compression of joint 71 . handle 80 may optionally have an auxiliary extension member and clamp ( not shown ), so that it can be attached to the rear frame of a bicycle ( not shown ), to pull portable cart 1 . to carry game 3 , as shown in fig1 , or to carry an injured person in a rescue operation , fig1 shows portable cart 1 having fabric stretcher 100 stretched tautly between horizontal load members 10 and preferably mounted over and around front and rear u - shaped brackets 60 and 70 of frame 55 , by threading brackets 60 , 70 through fasteners such as sewn - in loops 102 of fabric stretcher 100 , which may alternatively be made of plastic or other taut load bearing material . other types of fasteners can be used . for example , fig1 shows that loop 102 a is openable , and closed by fastener , such as zipper fastener 102 b . as also shown in fig1 , handle 80 may include a pair of posts extending obliquely off of a horizontal axis of portable cart 1 , wherein a head rest cushion 85 extends between the posts to support the head and neck of an injured person being transported upon stretcher 100 . fig1 - 20 show that to carry cargo , hollow fabric cargo well 110 is attached in the same manner to frame 55 . hollow cargo well 110 may also alternatively be made of plastic or other taut load bearing material , and covered by cover 112 . fig1 and 19 also show wider wheels 130 for use on sand or granular terrain . the various embodiments of the mission adaptable multiple - purpose portable cart / utility table can be quickly and easily assembled and disassembled . for example , for making a canoe cart from the disassembled portable cart 1 , wheel - retaining members , such as cotter pins 36 , are taken out of axle members 32 in their stored position , and wheels 30 come out . axle members 32 are then removed from between vertical struts 20 . the axle members 32 are then clamped in a horizontal use position into receptacles 33 of rigid axle connector 34 . axle members are inserted between vertical struts 20 and locked in place . wheels 30 are placed upon axle members 32 and secured by cotter pins 36 . kickstand 40 is loosened from its rest position and placed in place in receptacles within vertical struts 20 . canoe supporting cushions 13 are installed upon horizontal load supports 10 to support a canoe or boat thereupon . straps 50 hold the canoe or boat installed upon cushions 13 in a secure transportable position . to convert portable cart 1 into a game cart as in fig1 or a rescue cart as in fig1 , kickstands 40 are removed and fabric stretcher 100 is installed on u - shaped frame members 60 , 70 of frame 55 frames by fasteners such as sewn loops 102 thereof . u - shaped frame members 60 , 70 are placed on horizontal load supports 10 , and kickstand members 40 are installed as braces for fabric stretcher 100 . straps 50 are then installed to securely hold game or an injured party upon stretcher 100 . then handle 80 is installed upon u - shaped bracket 60 or 70 of frame 55 to pull or push portable cart 1 . to convert portable cart 1 into a wagon to haul cargo , as in fig1 and 19 , fabric stretcher 100 is removed and hollow well 110 is installed over u - shaped members 60 , 70 of frame 55 . to make the portable chart 1 portable again , the components are disassembled in reverse into bag 120 . strap or straps 50 are used as a carry handle or for backpack shoulder loops . while the rescue stretcher shown in fig1 has its own customized stretcher 100 , in another embodiment shown in fig2 - 24 , to convert portable cart 1 to a retrofit disabled person - bearing transportable carrier cart for search and rescue operations , using conventional railed stretcher 230 , support cushions 13 are removable from horizontal load supports 10 and replaced by clamping assembly 200 . clamping assembly 200 includes lower jaw 202 , and upper jaw 204 . while different jaw configurations can be used , the embodiment shown in fig2 - 24 shows each having longitudinally extending recesses 206 and 208 therein to grip perimeter frame rails of a load supporting transportable carrier , such as conventional railed stretcher 230 therebetween , as shown in fig2 . lower jaw 202 of clamping assembly 200 includes an engaging surface 210 with threaded studs 212 which are inserted into through - holes 214 of load supports 10 , and permanently locked with nuts 216 . upper jaw 204 is provided with a pair of oblong through - slots , 218 , to allow upper jaw 204 to slide on upper surface of lower jaw 202 , when threaded t - handles 220 are loosened . as shown by the arrows in fig2 this sliding action allows for quick removal of any stretcher frame rail secured between jaw assembly 200 . fig2 and 24 are perspective views of a typical stretcher 230 , and a stokes - type rescue basket 240 , securely clamped to portable cart 1 utilizing the previously described clamping assembly 200 . as shown in fig2 in this embodiment , instead of being permanently attached to each horizontal load support 10 , removable support cushion 13 is permanently attached to removable plate 302 with an adhesive 304 . this cushion assembly is removably attachable by nuts 316 and threaded studs 312 , to each horizontal load support 10 . fig2 illustrates portable cart 1 , outfitted with a plurality of racking assemblies 400 , each comprising a rail clamp 410 , an upstanding post 424 , and a hanger clamp 430 . rack assembly 400 , when used in conjunction with additional rack assemblies 400 , allows for transportation and quick removal of essential hunting gear such as a chair stand 440 , archery equipment 441 , and rifle 442 . other related items such as knapsacks and bedrolls may be supported by rack assembly 400 , as well . rack assembly 400 is easily disassembled from cart 1 upon reaching a chosen destination , and the components are conveniently transported within cart 1 &# 39 ; s storage backpack , such as carry bag 120 shown in fig1 . also illustrated in fig2 are stabilizing assemblies 450 and 460 . assembly 450 makes use of post 420 , which is friction - fit into an inverted rail clamp 410 . assembly 460 comprises an inverted tubular sleeve 462 , optionally permanently welded to the handle assembly crosspiece . sleeve 462 accepts kickstand post 424 in a similar fashion to rail clamp 410 . these assemblies 450 460 serve to brace the cart 1 when it is parked . moreover , kickstand post 424 may be used with any embodiment having a handle , such as handle 80 of fig1 and 17 - 19 , or handle 81 of fig3 and 33 . turning to fig2 , which is highlighted in fig2 , an exploded perspective close - up detail view of rail clamp 410 is presented . clamping block 411 is provided with a bore 412 to receive post 424 , an attachment face 413 including a semi bore 414 , and notch 415 , and threaded bore 416 . plate 417 includes semi bore 418 , through hole 419 , and protruding rib 420 . as shown in fig2 , when threaded knob 422 is inserted into hole 419 of plate 417 and tightened into threaded bore 416 of block 411 , clamping is achieved against frame member 60 . rib 420 is secured within notch 415 by a camming action in the direction of arrow โ€œ a โ€. fig2 shows cantilevered hanger clamp 430 , poised to slide down upstanding post 424 . hanger clamp 430 is provided with a bore 431 , which is notched in a similar manner to clamping receptacles 71 of the handle assembly . the notch separates the body of hanger clamp 430 into two walls . threaded knob 422 will compress the walls surrounding the notch , thereby tightening bore 431 around post 424 . l - shaped region 432 is integrally formed with the body of the hanger clamp , and provides a strong and durable support for transporting hunting or other gear . fig3 is a perspective view of an anti - tipping linkage 500 , which couples cart 1 to a bicycle . linkage 500 counteracts cart rollover caused by centrifugal force as the bicycle negotiates turns . fig3 illustrates the components of linkage 500 . bicycle seat - stem compression clamp 510 is formed of a body portion 511 , and plate 512 , fastened by screws 513 . bore 514 is angled so that clamp 510 remains perpendicular when installed on a typical bicycle seat - stem . clamp 510 is provided with a bore 515 on rear face 516 , which accepts a shaft 520 . pin 517 passes through clamp and fixes shaft 520 via a through - bore . shaft 520 includes through - bore 522 at its distal end . another through - bore 523 is provided slightly proximal of aperture 522 . when shaft 520 is inserted into coil spring 530 , hooked leg 531 of the spring will fit into bore 522 . a sliding collar 524 will then extend over leg 531 to prevent pull - out , and a pin 526 will be fitted into collar hole 525 , and into bore 523 of the shaft 520 , thereby securing the collar to the shaft and preventing removal of the coil spring . a shaft 540 is provided for the opposite end of coil spring 530 . hooked leg 532 fits into bore 542 of the shaft , and collar 544 slides over and is fixed by pin 546 , fitted into collar hole 535 and shaft bore 543 . support rails 550 and 551 are fixed to handle clamps 71 of cart 1 . the rails are bent into an inverted v configuration , and permanently affixed to block 552 . block 552 is provided with bore 553 , into which the free end of shaft 540 is fitted . pin 555 is inserted into through bore 554 of block 552 , and passes through bore 547 of shaft 540 , creating the continuous , secure anti - tipping linkage 500 between cart 1 and a bicycle . it is understood that during maneuvers of the bicycle , there will be no problems associated with a typical universal or pivot joint ; the coil spring will absorb and disperse any rotational stresses , and will react as a 360 ยฐ โ€œ living hinge โ€. fig3 a - 32g , 33 and 33 a show an alternate embodiment 600 of the portable cart using four wheels 30 in an overlapped configuration . a hard molded cover 601 is illustrated although any cover or no cover can be used as well . cover 601 covers bin 602 with lower overlapping edge cap 601 a fitting over peripheral shoulder 602 a of bin 602 . bin 602 also has longitudinally extending concave channels 603 , which rest upon rails 604 of cart 600 of fig3 . downward pressure of the weight of bin 602 and its contents helps stabilize bin 602 upon rails 604 , which may be optionally covered with rubber or other resilient linearly extending cushions . although fig3 illustrates portable cart 600 with covered bin 602 , portable cart 600 can be used with other embodiments , such as , for example , boat cushions 13 shown in fig4 , framed rail stretchers 100 as in fig1 , the game cart of fig1 , the cargo cart of fig1 , the conventional rescue carriers of fig2 and 24 or the gear rack of fig2 , among others . fig3 h shows an exploded inverted view of an alternate embodiment for a ruggedized handle assembly , including handle 630 and handle shaft 626 with spring pin 628 lined up to enter the end of stanchion truss weldment 620 . stanchion truss weldment 620 has two downward extending struts 632 , which accommodate axles 624 therethrough , which axles 624 , in - turn , attach to wheels 622 . central bushing receptacle 634 accepts the end of handle shaft 626 . receptacle 634 also has a lower pushpin aperture and a pair of opposite holes for a through pin to hold handle shaft in place . fig3 h also shows kickstand 640 stowable within handle shaft 626 . fig3 i shows a close - up inverted view of receptacle 634 , showing handle shaft 626 located within truss weldment 620 , and held in place by spring pin 628 of handle shaft 626 and / or through pin 629 . fig3 j shows a four wheel cargo hauling cart with kickstand 640 attached to kickstand attachment bracket 638 , which is part of handle 630 . also shown are stacked cargo bin shell containers 634 held securely by straps 636 . fig3 j a shows bin 600 on a cargo hauling cart used as the basis for oxygen therapy in the field . oxygen concentrator 2102 can be used directly for patient oxygen supply , or it can feed into compressor 2104 to supply oxygen for filling compressed oxygen tanks for use by other patients in remote venues . oxygen therapy cart 2100 is shown in fig3 j b supplying oxygen via a face mask to a patient on a mobile stretcher converted to a surgical utility table , directly from a concentrator 2102 . in fig3 j c , cart 2100 is used in a mine , supplying oxygen from a tank to a miner . the tank was filled from oxygen supplied by concentrator 2102 and compressed air by compressor 2104 . other deployment examples of these cargo - hauling four wheel carts are illustrated in fig3 q and 32r . in fig3 q , a cart 600 with cargo bin 602 is shown being unloaded from a military or other emergency response truck , while in fig3 r a cart is shown being delivered to an emergency response pick - up site via a hovering helicopter , such as to an flooded community having no road surface access thereto . in the sequence of fig3 k , 32m , and 32 n , straps 636 have been detached from bin shell containers 634 , and the sequence of removal of top bin 634 is shown ending with a vertically oriented bin drawer cabinet 635 with a cover panel 639 removed , thereby exposing slidably openable drawers 642 on its front surface . fig3 n shows drawers 642 behind drawer retaining panel 639 in a cutaway view . fig3 n a shows a rear view of a drawer 642 with drawer slide 2110 and side drawer cover panel channels 2112 . there is also a similar front drawer channel 2114 . in the detail of fig3 n b , drawer cover panel 2116 , preferably formed of polycarbonate or other suitable strong but slightly flexible flat substrate material , is shown sliding in side channel 2112 as pulled via manually graspable member 2118 , such as , for example , elastomer grommeted finger hole 2118 . this panel 2116 must seat within the groove of channel 2114 in the secure position before drawer 642 can be closed flush within bin 635 , to permit cover panel 639 to properly seat for latching . lower bin 634 optionally contains related medical supplies for a field hospital , such as power packs , oxygen tanks , and other necessary medical supplies . fig3 o is an optional hitch assembly 644 , which replaces the handle assembly . hitch legs 646 are received into handle 630 . spring pins 651 also participate in this coupling . connector 646 , with hitch tongue 652 , form a structure engageable with receiver clevis 653 attached to all terrain vehicle 656 . fig3 p shows hitch 644 being used to pull cart 632 by all - terrain vehicle 656 . fig3 shows a perspective view of the frame of cart 600 . long axle 606 attaches front wheels 30 while short axle 605 attaches rear wheels 30 through respective vertical support pairs 20 . the use of four wheels doubles the carrying capacity of the cart of this invention while the overlapped positioning of the wheels maintains a short wheelbase for compactness and for maneuverability such as turning with fixed axles and the ability to easily climb ledges . for durability , the rails 604 may be a double pair of parallel rails . double axled cart 600 has increased maneuverability , since user pushing upon an optional handle 81 enables user to lift the farther away , distal pair of wheels 30 off the ground , and the user pulling upward of handle 81 raises the nearer proximal wheels 30 off the ground . fig3 through 39 are concerned with an alternate embodiment of the horizontal load support member 10 . the alternate embodiment 610 has an integral t - slot channel 611 in its top surface to facilitate easy installation and removal of a variety of attachments , such as cushions 615 shown in fig3 - 36 , clamps 620 , 630 , 640 , shown in fig3 - 39 , or platform 1450 shown in fig5 . load member 610 can be conveniently extruded of aluminum or magnesium ; it can be used either with the two - wheel cart 1 or the four - wheeled embodiment 600 . fig3 shows a resilient cushion 615 installed in the t - slot 611 of support member 610 . this cushion 615 can be extruded of a variety of rubber or thermoplastic elastomers and serves the same purpose as cushion member 13 described above . a perspective view of fig3 shows cushions 615 installed on a four - wheel cart 600 . as described above , clamp assembly 200 is used to convert portable cart 1 to a disabled person - bearing transportable carrier cart . three separate alternate embodiments of clamp assembly 200 are presented ; all are compatible with the use of horizontal support member 610 . fig3 shows a one - piece clamp 620 with full width top section 622 and short end pieces 621 , which mate with , and slip into the t - slot 611 of horizontal support member 610 . fig3 shows clamp 630 with a full width bottom member 631 which mates with and slides into t - slot 611 of horizontal support 610 . fig3 shows another alternate embodiment consisting of two short identical clamp members 640 , which are inserted into the t - slots 611 of member 610 at the two extreme ends . in all cases , the short clamping sections can be sized to offer spring - like gripping action on the tubular members , or fasteners , such as thumbscrews or ball plungers ( not shown ) can be used for retention . a preferred embodiment of short clamp 2122 is shown in fig3 a and 39b . it includes movable jaw 2124 separated from lower jaw 2126 by spring 2130 around a screw , with ratchet handle 2128 used to tighten onto a tubular member such as 2140 . a ratchet handle is provided to facilitate tightening in short arc strokes in confined spaces while providing high torque capability ; it also provides a means for parking the handle out of the way once tightening is accomplished . grooves 2132 facilitate sliding into the t - slot of horizontal support member 610 . knob 2138 is used to tighten plate 2134 via screw 2136 . plate 2134 presses against the side of member 610 thereby locking clamp 2122 within the t - slot , and preventing its inadvertent withdrawal . fig4 - 50 show alternate embodiments for converting a conventional hand carried , railed medical rescue stretcher to a lightweight wheeled version . for example , fig4 - 42 show shortened horizontal support members 710 with tightening members 711 . rails 713 are held either by clamps , such as shown in fig3 - 39 , or alternatively through apertures in horizontal support members 710 , as shown in fig1 . horizontal support members 710 are demountably attached to vertical struts 720 having extending therethrough transverse axles 732 supporting wheels 730 . optional pivotable kickstand 740 is attached to rails 713 by clamp 800 . as also shown in fig4 - 50 ; clamp 800 includes two jaws 801 , 802 having aperture recess 803 for insertion of rails 713 therethrough . clamp 800 is closed and tightened by fastener 804 operated by rotatable knob 805 . internal spring pins 806 , as shown in fig4 , cooperate with fastener 804 and knob 805 to tighten clamp 800 about rail 713 . internal grooves 807 , 808 accommodate kickstand 740 in the respective positions of support and rest , as shown in fig4 and fig4 respectively . fig4 shows an alternate embodiment for a military or emergency rescue carrier cart 900 with a profile set low to the ground , including shortened horizontal members 910 with tightening fasteners 911 . rails 913 are also held by clamps as in fig3 - 39 , or alternately through apertures in horizontal support members 910 , as in fig1 . horizontal support members 910 are demountably attached to shortened vertical struts 920 to keep stretcher rails 913 close to the ground . optional bent handle 945 is connected by clamps 800 disclosed in fig4 - 50 , as discussed above . fig4 - 46 show how the stretcher version shown in fig4 - 42 can be converted to a stationary medical gurney 1000 . rails 1013 are supported by horizontal support members 1010 , which hare demountably attached to vertical struts 1020 , having axles 1032 supporting wheels 1030 . to stabilize gurney 1000 , horizontally extending tie rods 1036 , 1037 are joined by threaded clamp 1038 or other fastening means . the major structural components of an alternate embodiment low profile rescue carrier are shown in fig4 a . latch clamps 1800 of stretcher bearing tube assemblies 950 support stretcher 1730 and also engage handles 630 at each end . handles 630 may be rotated into an upward locking position or downward . tube assemblies 950 include lateral spring pins 962 and upper spring pins 963 for proper placement of wheel assemblies comprising struts 920 having rail bearing clamps 910 operable by latch handles 911 . fig4 b shows an exploded view of handles 630 engageable with stretcher bearing tube assemblies 950 of fig4 a . handles 630 are attached to short handle shafts 956 with spring pins 958 ( as in detail callout fig4 c ) within . similarly , a coupling section detailed in fig4 c has spring pins 958 installed as shown . spring pins 958 include bent leaf spring section 960 which tail end impinges on the inside of tube 956 or tube 952 while the other end is attached to spring pin button 962 which protrudes through a hole in the side of tube 956 or 952 . buttons 962 couple with a tube mid sections 954 via holes near the ends of these tubes . buttons 963 function as wheel set locators and fit into wheel set clamps for proper fixturing , as shown in fig4 a . the low profile rescue carrier is also shown in the side elevational view of fig4 d , which illustrates the feature of the handles 630 rotated to the downward position and functioning as kickstands . as shown in fig4 e , the low profile rescue carrier is easily converted into a low profile transport rotating handles 630 from the kickstand support position to an upright handle position which is easily grasped by medical personnel . short handle shafts 956 are shown in the optionally extended position in fig4 e , to allow for clearance between the medic and the stretcher . the medic may drag the stretcher 1730 upon stretcher bearing assembly 950 as shown , or alternatively , push or pull the stretcher or other carrier bearing assembly 950 forward by reversing his or her orientation . fig4 f shows a reconfigurable , modular rescue carrier 1700 transporting a stretcher 1730 atop an auxiliary fabric carrier 2141 slung underneath . fig4 g through 43i show the same rescue carrier 1700 as fitted with a multi - purpose waterproof bag 2142 slung under the top frame members . it is attached via flaps at its top edge which are placed over the side rails and then zippered in place . fig4 g shows that bag 2142 does not interfere with the transportation or use of a stretcher 1730 which is placed over , and attached by clamps to horizontal parallel rails , of cart 1700 . fig4 h shows bag 2142 used to catch water and effluent from a patient washing operation facilitated by frame members , such as wood slats 2144 , on the top surface of carrier 1700 for this purpose . fig4 i shows a patient with hyperthermia upon carrier 1700 being treated in ice cubes 2146 within bag flexible 2142 . carrier 1700 of fig4 f through 43i is a free standing wheeled stretcher / litter stand which not only provides a platform for patient movement , but when utilized with the cargo carrier bins of fig3 to 32 r , assists in deployment and resupply of a mobile medical field installation system of which it is part . when accessorized , carrier 1700 is a mobile medical field facility in itself . carrier 1700 can be provided with accessories , such as a second set of wheels in lieu of a kickstand , a flexible bin stored underneath , a waterproof bath tub bag , fluid capture bags , assorted accessory clamps , medical accessories , portable such as portable x - ray or other medical imaging diagnostic equipment , intravenous fluid dispenser supports , surgical instrument trays , portable lamp assemblies , arm rests , leg stirrup and patient support stretchers with rails clampable to the horizontal support arils of carrier 1700 . a typical unit &# 39 ; s weight may vary , but is typically from about 57 pounds to about 135 pounds in weight , with a cargo carrying capacity of about 350 pounds to about 500 pounds . carrier 1700 is unique in its ability to provide a functional surgical operating table which is lightweight and compact for transportation to remote previously inaccessible areas , such as ravines , flooded areas or riverbeds inaccessible to container trailers of hirayama &# 39 ; s mobile hospital . carrier 1700 allows doctors and nurses to stabilize disaster casualties and to operate when necessary prior to evacuation transportation of a wounded patient . the carrier 1700 enables doctors and nurses to customize the utility table to the medical personnel &# 39 ; s specific needs for treatment in seconds . fig5 - 53 show a further embodiment for portable cart 1101 which folds down to a disassembled storage position as in fig5 and which unfolds to an assembled position of use as in fig5 . cart 1101 includes a pair of horizontal load support members 1110 laid parallel to each other , which rotate axially to move perpendicularly extending vertical struts 1120 outward from a position within a storage bag 1101 a , where vertical struts 1120 face each other &# 39 ; s distal ends , to a position of use 90 degrees perpendicular to the storage position , where vertical struts 1120 extend in the same plane but outward from horizontal load support members 1110 . in this embodiment shown in fig5 - 53 , the resilient rails 1178 are engaged to horizontal supports 1110 such that when in a position of storage the rails 1178 are biased to return to their normal position of use , when released from the storage position , thus causing vertical struts 1120 attached to horizontal supports 1110 to pivot upward and bow , thus increasing the strength of the cart . the same is true with other embodiments of the present invention . for example , placing a boat 2 upon cart 1 causes horizontal support members 10 and wheel axles 31 to bow , giving it the strength of an uncollapsible roman arch . the same is true with respect to stretcher or cargo hauling embodiments shown in fig1 , 17 - 19 , 40 - 45 and 58 - 66 , for example , wherein putting weight makes the carrier portion taut and bows the frame members into a position of strength . also the multiple floating overlapping rails as in fig1 , for example , bow the rails and strengthen the cart with a load supported thereon . moreover , vertical struts 1120 can be further strengthened in place to horizontal supports 1110 by connecting braces , such as v - shaped braces 1121 . wheels 1130 are held by axle 1131 , which in a storage position is placed within the storage bag 101 a . to lengthen cart 1101 , rails 1178 move away from each other within holes 1112 within horizontal supports 1110 , and are stopped from further movement by spring stop buttons 1171 . fig5 - 55 show portable cart 1201 which can be converted from a cargo hauling wagon configuration with cargo well 1290 attached to frame 1255 , to a rescue stretcher with taut rescue canvas or other stretcher 1292 when stretcher 1292 , which sits loosely above hollow well 1290 during the cargo hauling configuration , but which becomes taut when peripheral fasteners , such as zippers 1296 , snaps or the like tighten stretcher 1292 in place about frame 1255 . optional kickstand 1240 or handle 1280 may be attached to cart 1201 by joints 1271 . a further accessory arm bag 1201 b may be draped down from handle 1280 for further storage . an optional hard floor member 1294 may be provided below stretcher layer 1292 within cargo well 1290 for cargo hauling strength . fig5 shows optional ski attachments 1330 for cart 1301 , wherein ski portions 1331 are attached by braces 1332 to vertical struts 1320 . the length of braces 1332 is equal to the radius of wheels 30 in previous embodiments . fig5 shows optional platform base 1450 for supporting object such as camera tripods , cooking devices , ordnance , etc . upon cart 1401 . platform base 1450 slides within channels 1411 and is secured in place by fasteners such as recessed hex nuts . fig5 shows a portable cart frame of this invention configured as a cargo hauler or as a multi - victim stretcher . the cart includes two outer longitudinal horizontal parallel rigid load support frame members 1501 , which are preferably tubular . the cart also may include an optional center frame member 1502 , also preferably tubular , as well as optional transverse frame members 1503 , overhead tube frame 1505 , two vehicle actuators , such as wheels 30 and axle 32 . it is contemplated that in snow conditions the vehicle actuators can alternatively be skis , such as shown in fig5 herein . also as shown in fig5 , fasteners , such as cotter pins 1504 are used to attach horizontal support members 1501 and 1502 within holes , such as circular holes for tubular shaped horizontal support members in transverse members 1503 . also as in fig5 , vertical struts having the wheel subassembly with wheel 30 are attached to outer horizontal support members 1501 , such as tubes , with mechanisms 1506 which permit quick attachment and detachment . attachment clamps 1507 secure overhead handle 1505 to outer ends of horizontal support members 1501 . although not shown in the drawings , any of the embodiments herein shown in all the drawing fig1 - 70 may have vertical length adjustment means ( not shown ), such as a sleeve containing a telescoping shaft , the sleeve having a spring means for urging the shaft in a selectably extendable manner out of the sleeve and a lock for locking the telescoping shaft into a selected extended position . fig5 shows a single cargo or person hauling fabric top surface sheet 1512 , which can be made of canvas or similar material . sheet 1512 preferably has sewn longitudinal pockets at the outer edges to accept horizontal support members 1501 and a central pocket 1513 to accommodate optional central frame member 1502 when inserted in direction 1514 as shown . optional apron sections 1513 can be flipped over the side edges . fig6 shows the frame of this cargo hauling or multi - victim cart readjusted to foreshorten the distance between transverse members 1503 by securing cotter pins 1504 in holes in horizontal support members 1501 and 1502 which are located farther in from the ends . as shown in fig6 , this adjustment can be used to accommodate separate stretchers 1525 with locating extensions 1526 and handles 1527 . fig6 and 63 show end views of the quick disconnect / connect mechanisms 1506 ( in viewing direction โ€œ 62 - 62 โ€ in fig5 ) with horizontal support member 1501 shown optional as tubular in cross section . top clamping member 1532 has slot 1531 which permits it to slide from the locking position shown in fig6 to the unlocked position of fig6 thereby releasing side horizontal support member 1501 from the wheel 32 subassembly which continues below lower clamp jaw 1533 . in fig6 , spring 1534 is compressed since the locking shaft concentric with it has been threaded downward by turning handle 1530 in a clockwise direction . in fig6 , handle 1530 has been turned about 180 degrees counter - clockwise thereby permitting spring 1534 to push up on top member 1532 releasing horizontal support member 1501 . fig6 is a partial end cross section ( in plane โ€œ 64 - 64 โ€ of fig5 ) of clamp 1507 . the split 1544 in clamp body 1540 permits selective grasping of horizontal support member 1501 as per the clamping force from screw 1542 as applied through knob 1541 . stainless steel insert 1543 prevents collapse of the end of tube 1505 of the overhead assembly . fig6 shows yet another embodiment of the cart of this invention as a frame for a portable operating room table or a gurney . this portable operating room table / gurney includes side horizontal support members 1550 , such as , for example , frame tubes , auxiliary side bars 1551 , transverse frame members 1552 , vertical struts 1553 , overhead support frames 1554 , overhead rails 1555 , trolley 1556 , and attachment clamps 1557 . the portable operating room table / gurney rides on four wheels 30 with axles 32 . the fully configured gurney is shown in fig6 . additional features shown include flexible fluid capture collection sling 1562 , fluid collection tube 1563 , fluid collection tank 1564 , adjustable side clamp 1560 , side rest or surgical instrument table 1561 , wheel brakes 1558 , and overhead accessory 1569 for attaching lights or other surgical accessories . fig6 and 68 show the construction and operation of wheel brake assembly 1558 . brake frame 1570 is rigidly attached to vertical strut 1553 . upper pivot frame 1572 works in conjunction with handle / link 1574 , curved spring link 1573 , and plunger shaft 1575 to form an โ€œ over - center โ€ mechanism with two stable states , clamped or unclamped . in fig6 , handle 1574 is pushed down into a snap - locked position pushing tip 1576 into contact with wheel 32 tire 1571 thereby contacting the top surface and deforming it to prevent wheel 32 from rotating . fig6 shows the โ€œ brake - off โ€ position which is obtained by lifting handle 1574 past the center position thereby lifting tip 1576 out of contact with tire 1571 . fig6 is an end view of adjustable side clamp 1560 with side tube 1550 and auxiliary rod 1551 in cross section ( see plane โ€œ 69 - 69 โ€ in fig6 ). instrument table 1561 attached to clamp body 1580 can be moved longitudinally along tube 1561 and locked in place as desired by turning knob 1581 which impinges the end of screw 1582 against horizontal support member 1550 . fig7 shows an exploded view of attachment clamp 1557 used in a variety of locations on overhead frames 1554 . it includes main body 1590 with groove 1591 , outer clamp member 1593 with lip 1593 and screw 1596 with knob 1595 . in operation , lip 1593 pivots within groove 1591 ; tube 1554 is grasped by the concave surfaces of body 1590 and outer member 1593 as tightened by screw 1596 . a tube end 1594 which can represent a tube 1555 or an accessory 1568 is inserted in the hole in the end of body 1590 and locked . fig7 is a flow chart showing the use of the convertible cart / utility table of the present invention in a medical emergency response triage environment . for example , in disaster medical care , triage is the medical screening of patients to determine their relative priority for treatment . three groups are defined , the first is those casualties not expected to survive even with treatment , second is the group who will recover without treatment , and third the highest priority group who need treatment in order to survive . fig7 illustrates how the convertible cart / utility table ( ccut ) of this invention can be utilized in this environment . for example , as in fig7 , incoming casualties 1650 arrive at triage center 1652 by ambulance , helicopter or otherwise . here they are screened into the three categories , labeled โ€œ type 1 โ€, โ€œ type 2 โ€ and โ€œ type 3 โ€ and those who can be treated are then transported via exit path 1654 to field hospital unit 1656 by using a wheeled version of the convertible cart / utility table ( ccut ). after prep at a pre - operative station , the patient is wheeled via path 1658 to the operating room ( or ) where a table version of the convertible cart / utility table ( ccut ) is used in a utility table mode as an operating platform . patient is then wheeled upon convertible cart / utility table ( ccut ) via path 1660 to the post - operative / post recovery station for monitoring , which may be done , on either a wheeled or table version of convertible cart / utility table ( ccut ). the patient may need further surgery , which would require transporting wheeled on convertible cart / utility table ( ccut ) back via path 1666 to the pre - operative station . if patient is sufficiently recovered , he or she is transported via path 1662 upon wheeled convertible cart / utility table ( ccut ) back to triage center 1652 vicinity for further transportation merging with others from triage in the outgoing exit queue path 1664 . fig7 shows an exploded view of the major components of convertible cart / utility table ( ccut ) 1700 for supporting stretcher 1730 thereon . these include axle support struts 1712 with rail clamps 1716 at the top ends and wheels 1718 located by axle 1715 . kick stands 1704 , used with heavy duty rail clamps 1714 , convert convertible cart / utility table ( ccut ) to the stationary utility table configuration . adjustable feet 1710 provide a high friction surface and terrain adjustability . macro adjustment of leveling or height is via multiple holes 1706 , in kickstand like 1704 , which accept spring pin 1713 attached near the end of foot extension 1708 . side rails 1702 complete the basic structure . fig7 shows side rails 1702 , which are mounted to kickstands 1704 by clamps 1714 , which engage tubing rails 1702 . tubing rails 1702 have middle connecting tube 1723 and side tubes 1722 , connected by connectors , such as , for example , spring pins and holes . fig7 shows convertible cart / utility table ( ccut ) 1700 configured as a utility table with auxiliary power pack 1732 and stretcher 1730 . fig7 shows the feature , which tilts the table top by adjusting the height of kickstands 1704 on different ends at different heights . fig7 also shows an optional body fluid capture collector 1760 such as a concave sling connected to a medical waste collector 1762 . fig7 shows details of kickstand foot 1710 . threshold shaft 1752 is screwed into nut 1754 and into foot extension 1713 thereby providing a micro adjustment of height up to about one inch . high friction pad 1756 and tilt adjustment ball and socket joint 1754 complete foot 1710 . fig7 shows reversible clamp 1800 , as in fig4 a , which is used with convertible cart / utility table ( ccut ) 1700 . it includes housing block 1802 , with rail aperture 1812 , which clamps onto tubing 1722 via lever screw 1814 . groove 1816 receives tubing rail 1730 , such as that from a stretcher , which rail 1730 is locked in place via over - center clamp 1804 with jaw 1808 , operable by actuator lever 1810 . the opposite grooves 1818 , 1820 and 1822 are spaced laterally to accommodate stretchers of different widths . these can be optionally locked via a clamp 1806 having a jaw similar to jaw 1808 , which is moved to the desired groove 1818 , 1820 or 1822 . fig7 shows reversible clamp 1800 inverted to use the multiple width grooves 1818 , 1820 or 1822 . fig7 and 80 show details of heavy duty clamp 1900 , which has upper block 1902 with groove 1904 to receive a stretcher side tube 1730 . over - center latch 1906 locks stretcher tube via jaw 1910 and actuator lever 1908 . lower block 1912 has side rail groove 1920 , holding rail 1722 , which groove 1920 is lockable via latch 1914 with jaw 1918 and lever 1916 . lower extension 1922 accommodates either stretcher tube or fluid drape in groove 1924 . a preferred embodiment of heavy duty stretcher clamp 2150 is illustrated in fig8 a - 80e . clamp 2150 has body 2152 with a lower extension with a transverse hole to receive side tube 1722 ( or its equivalent ) which is locked via a fastener , such as a nylon tipped knob screw 2158 . the upper section of body 2152 has a groove to accept blade 1902 ( or similarly shaped elements ). blade tightening panel 2154 uses a mechanical incremental moving device , such as a ratchet handle 2156 , for tightening blade 1902 in its appropriate position . lower stretcher tube holder 2160 is used , for example , in a trendelenberg maneuver ; it is screwed to rectangular crossection cross member 2162 , which is also screwed into the bottom of body 2152 . fig8 a and 80b show blade 1902 in the extended position supporting stretcher 1730 tube at the upper position , and retracted with stretcher tube resting on holder 2162 respectively . the view of fig8 c shows the two accessory pole support holes 2164 which can be used for iv poles . fig8 d and 80e show details of the stretcher pole hook 1904 . the inner hook surface is preferably chamfered on each side 2168 of a central region 2170 to provide flat bearing surfaces to a stretcher tube in either tilt position as well as the flat position . the end view of clamp 1900 in fig8 shows that upper retaining latch block 1932 can pivot to permit stretcher tube 1930 to tilt relative to side rail 1722 . in the more complete perspective view of fig8 , it can be seen that the lower ( foot ) end of stretcher rail 1731 of stretcher 1730 is then supported by recess or groove 1924 in the lower extension 1922 of the second clamp 1900 . a kit 2180 of components for the attachment of stirrups using the preferred embodiment stretcher clamp 2150 is shown in fig8 a - 82c . the kit includes two stirrups ( or foot supports ) 2182 with attached stirrup support rods 2184 , two bent stirrup support bars 2192 with attached rod clamps 2186 , stretcher clamp tightening plate with stretcher bar access hole 2196 , and stirrup blade extension 2200 . in operation , hole 2190 in stirrup rod clamp 2186 accepts rod 2184 which is then tightened by clamping screw with knob 2188 . tightening plate 2196 with accessory pole support holes 2197 is substituted for part 2154 of stretcher clamp 2150 . then stirrup blade 2200 is used in a second 2150 clamp spaced away from the end stretcher clamp . the distal end of bent stirrup support bar 2192 is then passed through both bar access holes 2198 in plate 2196 and 2200 respectively . blade 2200 has two holes , 2204 and 2208 , in blade end 2200 to provide two positions of lateral support in clamp body 2152 . the detail drawing of fig8 c shows this arrangement with support bar fastener , such as , for example , retaining screw 2206 in blade 2200 ( it can be used in addition or instead in hole 2199 of plate 2196 ). note that blade 2200 is retained in body 2152 with a simple knob screw instead of a tightening plate . fig8 b shows in schematic form two different positions of stirrups 2182 as provided by the bent angle of support bars 2192 . if angled inward as shown on the left , there is a smaller distance between the stirrups as for a gynecological exam . the larger distance between the stirrups can be used for more major abdominal surgery for both male and female patients . fig8 depicts auxiliary pivotable medical support platform assembly 2000 including base 2001 , clamp insert 2002 and platform 2003 . this versatile mechanism clamps onto a side rail of the convertible cart / utility table ( ccut ). body limb member support 2004 holds a limb . assembly 2000 has movable hinge section can swivel relative to clamp base 2016 . fig8 shows medical support platform assembly 2000 with pole 2022 used to support intravenous ( iv ) bag 2026 with infusion line 2028 . extension rod 2024 provides more height for proper infusion gravity head . tray 2030 is similarly supported . fig8 shows medical support assembly 2000 used to support gooseneck examination / surgical lamp 2040 attached to flexible neck conduit 2042 held in and movable arm support 2046 . fig8 shows another use of medical support assembled 2000 to support multiple instrument trays 2050 . a universal accessory clamp 2250 is illustrated in fig8 a - 87f . the parts of clamp 2250 can be understood by reference to fig8 a , which shows a closed configuration and fig8 b which shows the open jaw position . clamp frame 2252 has a recess to accept a portion of a structural tube , threaded holes 2262 provide for other attachments . dual accessory pole clamp 2256 is attached to frame 2252 and provides accessory pole clamping holes 2258 which are clamped via fasteners , such as clamping screws with knobs 2260 . swinging jaw 2254 is pivoted on spring pin axle 2266 and locked via swinging locking screw with knob 2270 , which pivots on spring pin axle 2264 and locks within clearance groove 2272 . hole 2268 is provided for clearance of any protruding snap spring tips that may be used on tubing assemblies . fig8 c and 87d illustrate clamping around tube 1722 shown in crossection . note gap 2274 which remains in the tightened clamped configuration to insure proper grip force on tube 1722 . fig8 e shows clamp 2250 in use supporting two accessory poles 2166 . fig8 f shows an exploded view of the use of clamp 2250 with arm support 2280 . arm support panel 2282 is attached to arm support bracket 2284 which engages pole 2166 in hole 2286 and locking screw 2288 . the distal end of pole 2166 is then adjusted and clamped in one side of clamp 2256 . fig8 g and 87h show details of an improved surgical lamp 2281 incorporating a feature that mechanically precludes drop - down of lamp over accessory pole 2166 . flange bracket 2285 is attached to gooseneck 2042 which is then attached to pole bracket 2287 with a blind hole at its lower end to accept accessory pole 2166 . the blind hole prevents drop - down . transverse pin 2291 in pole 2166 fits in recess 2293 at the entrance of the blind hole to prevent lamp 2281 assembly from rotating on pole 2166 ; this gives lamp 2281 more stability and resistance to movement when lightly brushed against personnel . pole 2166 supporting lamp 2281 is attached via pole clamp 2256 of clamp 2250 . yet another application of universal accessory clamp 2250 is shown in fig8 i . when a convenient flat table top exists , it can be converted into a base for a stretcher for holding or operating on a patient . this is accomplished by using a flat crossbar 2162 which is attached to a pair of clamps 2250 using threaded screw holes 2262 . the width of the crossbar is such that stretcher poles 1730 are conveniently gripped at the correct position . one such crossbar with attached clamps 2250 and short legs with feet 2295 is used at the front and at the rear of the stretcher . each clamp 2250 has two accessory pole clamps which can be used to support one or more intravenous fluid dispensers ( iv &# 39 ; s ) or transfusion bags as needed . a preferred embodiment of lower leg clamp 2300 is shown in fig8 a - 88b . clamp 2300 includes frame 2302 , which is pinned by pin 2312 to the end of lower tube 2316 . it has swinging clamping screw 2306 pinned at 2310 and swinging jaw 2304 pinned at 2314 . swinging jaw 2304 has a clearance groove 2308 for locking screw 2306 . clamp 2300 is simply placed at the desired position on leg 2318 and clamped around leg 2318 and tightened . this provides quick attachment or detachment or adjustment of the distance from foot 2320 . pin 2330 facilitates up or down movement of leg 2318 . note , all elements of clamp 2300 are permanently attached . fig8 shows a portable medical utility table 2400 with many of the features and accessories described in the earlier drawings . it is an example of a โ€œ bed โ€ serving one patient that can be one of many in a reconfigurable , modular , expandable , transportable , mobile , medical critical care point of need field installation system . it is further noted that other modifications may be made to the present invention , without departing from the scope of the invention .
0
the present invention provides a heat lamp assembly that can include a heating lamp mounted onto a thermally conductive block that provides efficient reflection of radiation generated by the lamp onto a selected surface , for example , a surface of a semiconductor wafer disposed in an ion implantation chamber . the block can include a plurality of openings that allow ingress / egress of one or more cooling fluids to / from inner passageways allowing for removal of heat from the block . the block can also include further openings that allow a cooling fluid , e . g ., a gas , to flow over the lamp to facilitate removal of heat from the lamp . these , and other features , are described herein . fig1 illustrates an exemplary ion implantation apparatus 10 in which a heating assembly 12 coupled with a mount 40 according to the teachings of the invention is used . the ion implantation system 10 includes a beam delivery assembly 14 , a beam - forming device 16 , and an end - station 28 . the beam delivery assembly 14 can include an ion source 18 that generates a beam of ions 24 . the beam delivery assembly 14 can further include an ion analyzer 20 , such as a magnetic analyzer , that selects appropriately charged ions . an accelerator 22 accelerates the selected ions to a desired energy , e . g ., about 200 kev , and a beam - forming device 16 shapes the accelerated ions into an ion beam 24 having a selected cross - sectional shape and area . the beam 24 is directed to a plurality of targets , e . g ., semiconductor wafers 26 , to implant a selected dose of ions therein . in this exemplary embodiment , the targets are disposed in the end - station 28 with a rotating support structure 30 . a drive mechanism ( not shown ) can rotate the support structure 30 to sequentially expose one or more of the wafers 26 to the ion beam 24 . during ion implantation , one or more vacuum pumps 34 evacuate the chambers , e . g ., the ion source 18 , accelerator assembly 22 , and end - station 28 . the heating assembly 12 formed according to the teachings of the invention is disposed in the end - station 28 to heat the wafers 26 during ion implantation and / or subsequent annealing steps . the assembly is preferably positioned so as not to interfere with the ion beam 24 . in the illustrated embodiment , the assembly 12 is attached to a mount 40 which provides for placement of the assembly 12 within the end - station 28 . the mount 40 also provides for electrical coupling of the assembly 12 via electrical connectors 32 . cooling fluids can be circulated within the assembly 12 via fluid couplings 36 , 38 provided by the mount 40 for the removal of heat from the assembly 12 and / or mount 40 . the fluids can be , for example , water or air , or other fluids suitable for dissipating heat from the assembly . multiple assemblies 12 can be placed within the end - station 28 , and be coupled to a single mount 40 . in some embodiments , multiple mounts 40 can be placed within the end - station 28 . fig2 shows the assembly 12 , with fig3 depicting major components of the assembly 12 according to one embodiment of the invention . the exemplary assembly 12 includes , among other elements , a heating lamp 42 , a thermally conductive block 44 to which the heating lamp is mounted , and a cover 46 . the cover 46 insulates the lamp 42 and block 44 from an external environment , for example , a vacuum environment of the ion implantation chamber . in this embodiment , the cover 46 is in the form of a tube that surrounds the block 44 allowing operation of the heating assembly 12 within the vacuum of the ion implantation device , but the cover can be of different shapes and / or materials that are suitable depending on the external environment . seals 68 located on end portions 57 , 56 of the block 44 function with the cover 46 to separate the internal environment of the assembly 12 from the exterior environment . the illustrated seals are of a conventional โ€œ o - ring โ€ configuration , but they can be labyrinth or other designs known in the art . the heating lamp 42 has a central portion containing a heat producing material 48 , providing heat upon electrical stimulation . the heating material 48 can be tungsten , quartz or any other material that produces sufficient heat upon electrical simulation for a desired application . in one embodiment , the heating lamp 42 can be approximately 10 - 12 inches long . in other embodiments , the length of the lamp 42 can vary according to the heating application and / or physical size limitations of a device in which the heat lamp assembly is disposed . two end portions 50 , 52 provide electrical coupling of the heat producing material 48 to a source of electrical power , and farther allow physical mounting of the heating lamp 42 to the block 44 via heat - isolation pads 58 a - 58 d ( collectively , 58 ). the heat - isolation pads 58 a , 58 b , 58 c , and 58 d , ( fig3 a ) are mounted to the block 44 by utilizing , for example , a plurality of fasteners , such as , screws 60 . the heat - isolation pads 58 are preferably positioned in proximity of the end portions 56 , 57 to enhance isolation of heat generated by the lamp from these end portions , e . g ., in proximity with high - temperature gradients , and consequently from the seals 68 , thereby ensuring proper operation of the seals . the heat - isolation pads 58 can be formed of any material having a high coefficient of thermal conductivity . for example , the pads can be formed of aluminum . the pads can have a non - reflective surface facing the lamp to maximize heat transfer from the heating assembly . in some embodiments , the pads have a reflective surface on faces not receiving radiated energy from the heating assembly to increase cooling characteristics of the pads . the thermally conductive block 44 includes a central portion 54 and two end portions 56 and 57 . the end portions 56 , 57 ( fig2 , 5 , 6 and 7 ) allow physical mounting of the lamp 42 to the block 44 , and further allow electrical coupling of the lamp to a source of electrical power ( not shown ). in addition , the end portions 56 , 57 include elements for coupling of the heat lamp assembly 12 to a mounting block as described in detail below with reference to fig7 and fig8 . in particular , each end portion 56 , 57 includes a tab , e . g ., 62 , or other coupling element , that can physically and electrically couple with an end portion 50 , 52 of the heating lamp 42 . in the illustrated embodiment , the lamp end portion , e . g ., 52 , is extruded or otherwise placed within a channel along a longitudinal axis of a block end portion 56 , and coupled with the tab 62 . fig3 and fig4 depict two reflective sloping surfaces 55 a , 55 b which reflect light and heat generated by the lamp 42 onto a desired location , for example , a surface of a semi - conductor wafer 26 ( fig1 ). the reflective surfaces 55 a , 55 b can have a coating of a high reflectivity material , e . g ., gold , that is deposited on the material forming the block 44 , e . g ., aluminum , via an intermediate primer layer , e . g ., nickel . the primer layer advantageously enhances adhesion of the gold layer to the material forming the block 44 . a plurality of openings 66 formed in the reflective surfaces 55 a and 55 b allow flowing a cooling gas , for example , air , introduced into the block 44 via an inner passageway as described below , over the lamp 48 in order to remove heat therefrom . the cooling gas can be nitrogen or other compressible or non - compressible fluids suitable for contact with the heating lamp 48 . in one illustrated embodiment ( fig3 ) the openings are arranged in two rows such that the openings in one row are offset relative to those in the other row to maximize an area of the lamp that will be in contact with the flowing gas . in other embodiments ( e . g ., fig4 and 6 a ), there can be a single row 66 . with further reference to fig4 ( see also fig5 b - 7 c ) the thermally conductive block 44 further includes networks of inner passageways 70 , 72 , and 74 that extend along a longitudinal axis of the block and provide conduits for flow of fluids , such as , air and water . in this illustrated embodiment , cooling water is circulated through the block via passageways 70 and 72 , for example , by introducing water into the block via passageway 70 and removing water from the block via the passageway 72 , or vice versa . the flow of the cooling water advantageously cools the block to ensure proper operation of various seals , for example seal 68 . other cooling fluids , such as , ethylene glycol , or other heat - removing fluid suitable for circulation through the block can also be employed . in this embodiment , the inner passageway 74 is in fluid communication with the openings 66 to allow flow of a cooling fluid , e . g ., air , introduced via the passageway 74 under pressure , over the lamp 48 . the cooling air is then extracted from the area between the lamp 48 and the interior of the cover 46 via a central coupling of one or both of the end portions 56 , 57 . with reference to fig2 , 4 and 7 a - 7 c , each end portion 57 includes openings that provide ingress and egress of fluids into and out of the inner passageways 70 , 72 , and 74 . more particularly , cooling water ( or other heat - removing fluid ) can be introduced and extracted via ports 64 and 84 , and cooling air ( or other gaseous fluids ) can be introduced into the inner passageway 70 via an inlet port 86 and removed via an outlet port 88 . a variety of materials can be employed to manufacture the thermally conductive block 44 . for example , in one preferred embodiment , aluminum is utilized to form the block 44 as a unibody structure . the use of aluminum is particularly advantageous because it readily allows machining , e . g ., boring a network of inner passageways and seal seats in the block . the manufacture can utilize , for example , so - called gun - drilling techniques to generate inner passageways in a unitary block of aluminum instead of braise - joining multiple machined pieces . as described above , a primer coating , e . g ., nickel , can be applied to the aluminum surfaces of the block , and a coating of a highly reflective material , such as , gold , can subsequently be applied to the primer so as to generate highly reflective surfaces for directing radiation generated by the lamp to a desired location . with reference to fig8 the heat lamp assembly 90 can be coupled to a mount 92 that allows positioning the heat lamp assembly within an ion implantation chamber . the mount 92 provides electrical couplings 94 cooling water couplings 96 and cooling air couplings 98 , 100 . the couplings can have a variety of different configurations . for example , the air inlet coupling 98 can be a flange coupling , a nipple coupling , or any other coupling known in the art . multiple heating lamp assemblies of the invention can be coupled to a single mount , thus enabling a variety of configurations depending on physical shape and dimensions of an ion chamber and desired wafer temperatures to be achieved . in some embodiments , sensors can be attached to the heating assembly and / or mount to control the heat output , cooling water and air flow , and other characteristics of operational parameters . further , the block can be connected to anti - static or other voltage differential detection / correction equipment to protect the mount and coupled assemblies from electrical damage . in some embodiments , sensors capable of detecting the temperature of a wafer 26 can be used , such as a thermocouple , infrared sensor , or other temperature - sensing device . those of ordinary skill in the art will appreciate that various modifications can be made to the above embodiments without departing from the scope of the claimed invention as described by claims . for example , the size of the heating assembly can vary , the heating capacity can vary , and the cooling fluids can vary , depending on the requirements of the application .
7
an engine for an automotive vehicle is generally indicated at 10 in fig1 . the engine 10 includes a crankshaft 12 driving an endless serpentine belt 14 , as commonly known by those having ordinary skill in the art . the engine 10 also includes a belt driven accessory 16 driven by the belt 14 . described in greater detail below , a decoupler assembly 20 is operatively assembled between the belt 14 and the belt driven accessory 16 for automatically decoupling the belt driven accessory 16 from the belt 14 when the belt 14 decelerates relative to the belt driven accessory 16 and allowing the speed of the belt 14 to oscillate relative to the belt driven accessory 16 . additionally , a detailed description of the structure and function of a decoupler assembly can be found in applicant &# 39 ; s u . s . pat . no . 6 , 083 , 130 , which issued on jul . 4 , 2000 and pct application no . wo 2004 / 011818 , the contents of which are incorporated herein by reference . referring to fig2 and 3 , the decoupler assembly 20 generally includes a hub 22 , a pulley 50 , a clutch assembly 70 , a torsion spring 90 and a torque limiter 110 . in the first embodiment , the torque limiter 110 is preferably a sleeve . hub 22 has a generally cylindrical body 28 having an axially extending bore 24 and a flange 26 at one end thereof . flange 26 has a generally helical first slot 46 on an inner face thereof . since the slot 46 is helical , the slot 46 will have a step . the bore 24 is configured for fixedly securing the hub 22 to a drive shaft extending from the belt driven accessory 16 . a pulley 50 is rotatably journaled to the hub 22 . a ball bearing assembly 57 is coupled between the pulley 50 and the hub 22 at a distal end while a bushing journal 102 mounts the pulley 50 on the circumferential face of flange 26 . the bearing assembly 57 is conventional comprising an inner race , an outer race and a plurality of ball bearings rollingly engaged therebetween . the pulley 50 typically includes a plurality of v - shaped grooves 66 formed on the outer periphery for engaging and guiding the belt 14 . other belt or chain profiles may be utilized to facilitate other drive configurations , well known in the art . a one - way clutch assembly 70 is operatively coupled between the hub 22 and the pulley 50 . the clutch assembly 70 includes a clutch spring 71 and a carrier 75 . the clutch spring 71 includes a plurality of helical coils 72 . preferably , the clutch spring 71 is formed from an uncoated , spring steel material and has a non - circular cross - section to improve frictional contact . most preferably , the cross - section of clutch spring 71 is rectangular or square . the clutch spring 71 is press fitted into frictional engagement with the inner surface 56 of the pulley 50 . preferably , a lubricant similar or compatible with grease used in the ball bearing assembly 57 is applied to minimize wear between the clutch spring 71 and the inner surface 56 of the pulley 50 . the carrier 75 is rotatably mounted on the hub 22 . the carrier 75 is generally ring shaped and has an inner face 78 , a bore 80 and an outer circumferential surface 82 . a slot 84 is formed on the inner face 78 and is configured to retain an end of the clutch spring 71 . a generally helical second slot 86 is also formed on the inner face 78 and inside of slot 84 , defining a second locating surface 88 and a step . an annular thrust washer 39 is seated against the end of the carrier 75 and abuts against the inner bearing race of bearing assembly 57 . the outer periphery of the thrust washer 39 is circular with a step 41 to complementarily fit with a tab . thrust washer 39 has one or more radial or circumferential serrations 43 to engage hub 22 and mechanically lock the thrust washer 39 to the hub 22 to prevent relative motion therebetween . a helical torsion spring 90 is axially compressed between the hub 22 and the carrier 75 . the torsion spring 90 and the clutch spring 71 are co - axial and typically coiled in opposite directions . in certain applications , the torsion spring 90 and clutch spring 71 can be wound in the same sense to produce a desired decoupling action . one end of the torsion spring 90 is retained in the first slot 46 of the hub 22 and the other end is retained in the slot 86 of the carrier 75 . axial forces due to the compression of the torsion spring 90 retain the carrier 75 in abutting engagement with the thrust washer 39 . typically , the shaft of the hub 22 has an area of reduced diameter 23 to provide clearance between the torsion spring 90 and the shaft 28 of hub 22 to prevent uncontrolled contact and friction wear at the interface between shaft 28 and torsion spring 90 . thus , the torsion spring 90 allows relative movement between the carrier 75 and the hub 22 to accommodate minor variations in the speed of the pulley 50 due to oscillations in the operating speed of the engine . the oscillations are not sufficient to activate the clutch assembly 70 . a torque limiter 110 is wrapped about the torsion spring 90 in a surrounding relation . preferably , torque limiter 110 has a split or opening 112 and a circumferentially extending shoulder step 114 . shoulder step 114 configures the torque limiter 110 to complementarily fit with bushing 102 mounted on the flange 26 of hub 22 . in a first preferred embodiment , torque limiter 110 is an organic resinous material , preferably a nylon โ„ข material , with or without reinforcement material such as glass fibres , etc . torque limiter 110 has a thickness selected to take up the play between the torsion spring 90 , the clutch spring 71 and the inside diameter of the pulley 50 . as torque increases , the torsional spring 90 expands outwardly until physically constrained by the torque limiter 110 against the clutch spring 71 and the inside diameter of bore 56 . when the radial clearance between the torsion spring 90 , torque limiter 110 , the clutch spring 71 and the inside bore 56 of the pulley 50 is closed , the spring 90 is prevented from further expanding , locking the decoupler 10 , coupling the hub 22 with the pulley 50 . in other words , the torque limiter 110 limits the amount of outward expansion of the torsion spring 90 , preventing overloading of the torsion spring 90 . the amount of radial expansion of the torsion spring 90 can be calculated and the torque limiter 110 can be designed to ensure that the torque transferred through the torsion spring 90 is maintained below a predetermined torque value . a second embodiment of the sleeve is illustrated in fig8 . torque limiter 110 โ€ฒ is a closed metal ring . the metal ring would only expand to a relatively small degree , directly limiting outward expansion of the torsion spring 90 . a third embodiment of the sleeve is illustrated in fig9 a . torque limiter 110 โ€ณ has a plurality of axially elongate openings 116 spaced circumferentially spaced about the torque limiter 110 โ€ณ. the openings 116 enable the grease lubricant to travel outwardly to the clutch spring 71 . an alternative third embodiment of the sleeve is illustrated in fig9 b . the torque limiter 110 * has a series of circumferentially spaced openings 116 * and 117 . preferably , openings 116 * are elongate and openings 117 are circular and spaced in a regular pattern , resembling dimples on a golf ball . additionally , torque limiter 110 * has an integrally extending radial flange 119 that acts a thrust bearing . a cap 100 is attached to the end of pulley 50 for preventing contaminants from entering the decoupler assembly 20 and for retaining the lubricant within the decoupler assembly 20 . in operation , the engine 10 is started and the pulley 50 is accelerated and rotated in a driven direction by the belt 14 driven by the engine 10 . acceleration and rotation of the pulley 50 in the driven direction relative to the hub 22 creates friction between the inner surface 56 of the pulley 50 and preferably all of the coils 72 of the clutch spring 71 . it should be appreciated that the clutch spring 71 will function even where at the onset at least one of the coils 72 of the clutch spring 71 is frictionally engaged with the inner surface 56 of the pulley 50 . the clutch spring 71 is helically coiled such that the friction between the inner surface 56 of the pulley 50 and at least one of the coils 72 would cause the clutch spring 71 to expand radially outwardly toward and grip the inner surface 56 of the pulley 50 . continued rotation of the pulley 50 in the driven direction relative to the hub 22 would cause a generally exponential increase in the outwardly radial force applied by the coils 72 against the inner surface 56 until all of the coils 72 of the clutch spring 71 become fully brakingly engaged with the pulley 50 . when the clutch spring 71 is fully engaged with the inner surface 56 , the rotation of the pulley 50 is fully directed toward rotation of the drive shaft 15 ( fig1 ) of the belt driven accessory 16 . additionally , centrifugal forces help to retain the clutch spring 71 in braking engagement with the inner surface 56 of the pulley 50 . the rotational movement of the carrier 75 in the driven direction is transferred to the hub 22 by the torsional spring 90 such that the carrier 75 , thrust washer 39 , hub 22 , and the drive shaft 15 ( fig1 ) from the belt driven accessory 16 rotate together with the pulley 50 . additionally , the torsional spring 90 resiliently allows relative movement between the carrier 75 and the hub 22 to accommodate oscillations in the speed of the pulley 50 due to corresponding oscillations in the operating speed of the engine 10 . when the pulley 50 decelerates , the hub 22 driven by the inertia associated with the rotating drive shaft 15 ( fig1 ) and the rotating mass within the belt driven accessory 16 will initially โ€œ overrun โ€ or continue to rotate in the driven direction at a higher speed than the pulley 50 . more specifically , the higher rotational speed of the hub 22 relative to the pulley 50 causes the clutch spring 71 to contract radially relative to the inner surface 56 of the pulley 50 . the braking engagement between the clutch spring 71 and the pulley 50 is relieved , thereby allowing overrunning of the hub 22 and drive shaft 15 ( fig1 ) from the belt driven accessory 16 relative to the pulley 50 . the coils 72 may remain frictionally engaged with the inner surface 56 while the pulley 50 decelerates relative to the clutch assembly 70 and the hub 22 . the coils 72 of the clutch spring 71 begin to brakingly reengage the inner surface 56 as the pulley 50 accelerates beyond the speed of the hub 22 . in conditions of high loading , such as a fast engine start profile and / or rapid acceleration during a wide open throttle shift , the coils of the torsion spring 90 will be urged to expand outwardly , due to relative rotation between the hub 22 and the pulley 50 . the torsion spring 90 will expand , frictionally engaging the torque limiter 110 which will then engage the clutch spring 71 . full frictionally engagement is selected to occur at a predetermined torque value by selecting the thickness of the torque limiter 110 . once fully engaged , the hub 22 will be locked with the pulley 50 and torques above a predetermined torque value will be transmitted directly therebetween . thus , the higher torques do not overstress the torsion spring 90 and ultimately improving durability of the decoupler assembly 10 . referring to fig1 to 14 , a fourth embodiment of the torque limiter 110 is illustrated . elements common with the embodiment of fig2 and 3 retain the same reference number . in this embodiment , the torque limiter 110 โ€ฒโ€ณ is in the form of a wire coil spring . torque limiter 110 โ€ฒโ€ณ is positioned about the torsion spring 90 . preferably , torque limiter 110 โ€ณ is formed of a small gauge wire , compared to torque spring 90 , with a square or rectangular cross - section . the gauge and dimensions of torque limiter 110 โ€ฒโ€ณ are selected such that any play which would otherwise be present between torsion spring 90 , clutch spring 71 and the inside surface 56 of pulley 50 is substantially removed , while still allowing relative motion between torsion spring 90 and clutch spring 71 . further , the coils of torque limiter 110 โ€ฒโ€ณ allow grease , or any other lubricant , to travel outwardly to the clutch spring 71 . it is presently preferred that the coils of torque limiter 110 โ€ฒโ€ณ be wound in the same sense of the coils of clutch spring 71 , although this is not essential to proper operation of decoupler 20 . as torque to pulley 50 increases , torsional spring 90 expands outwardly until physically constrained by torque limiter 110 โ€ฒโ€ณ. when the radial clearance between torsion spring 90 , torque limiter 110 โ€ฒโ€ณ, clutch spring 71 and the inside surface 56 of pulley 50 is closed , spring 90 is prevented from further expanding , locking decoupler 20 , coupling the hub 22 with the pulley 50 . in other words , torque limiter 110 โ€ณ limits the amount of outward expansion of the torsion spring 90 , preventing overloading of torsion spring 90 . the amount of radial expansion of torsion spring 90 can be pre - determined and torque limiter 110 โ€ฒโ€ณ can be designed to ensure that the torque transferred through torsion spring 90 is maintained below a preselected torque value . referring to fig1 to 14 , a second variant of the clutch assembly 70 is illustrated . the clutch assembly 70 includes clutch spring 71 โ€ฒ, comprising a helical coil , and a carrier 75 โ€ฒ. preferably , clutch spring 71 โ€ฒ is formed from an uncoated , spring - steel material and the material forming the helical windings 72 has a non - circular cross - section to improve frictional contact . most preferably , the cross - section of the helical winding material is rectangular or square . clutch spring 71 โ€ฒ is press - fitted into frictional engagement with the inner surface 56 of the pulley 50 . preferably a lubricant , similar or compatible with the grease used in the ball bearing assembly 57 , is applied to minimize wear between the clutch spring 71 โ€ฒ and inner surface 56 of the pulley 50 . carrier 75 โ€ฒ is rotatably mounted on the hub 22 and carrier 75 โ€ฒ is generally ring shaped , with an inner face 78 , a bore 80 and an outer circumferential surface 82 . a slot 84 โ€ฒ is formed on inner face 78 and is configured to retain an end of the clutch spring 71 โ€ฒ. a generally helical second slot 86 is also formed on the inner face 78 and inside of slot 84 , defining a second locating surface 88 and a step . in this variant , the end of clutch spring 71 โ€ฒ is bent at 73 and 77 . slot 84 โ€ฒ is complementarily configured to receive the end of the clutch spring 71 โ€ฒ and frictionally engage with the bends 73 and 77 . the bore 80 of carrier 75 โ€ฒ has a keyway 81 and a series of axially extending dimples . the decoupler illustrated in fig1 to 14 operates in the same fashion as described with respect to the decoupler illustrated in fig1 to 9 . in conditions of high loading , such as a fast engine start profile and / or rapid acceleration during a wide open throttle shift , the coils of the torsion spring 90 will be urged to expand outwardly , due to relative rotation between hub 22 and pulley 50 . the torsion spring 90 will expand , expanding torque limiter 110 โ€ฒโ€ณ in turn , which will then frictionally engage the clutch spring 71 . full frictional engagement is selected to occur at a predetermined toque value by selecting the thickness of the windings of torque limiter 110 . preferably , decoupler 20 further includes an adapter 104 which is press fit into the inner race of bearing 57 and which allows decoupler 20 to be fit to belt driven accessories with drive shafts of different sizes and / or to position decoupler 20 on the driven shaft to ensure correct alignment of grooves 66 with the serpentine belt . however , adapter 104 is not necessary and decoupler 20 can be installed directly onto the drive shaft of a belt driven accessory if the diameter of that drive shaft will properly engage the inner race surface of bearing 57 and / or if grooves 66 will be properly aligned with the serpentine belt . the invention has been described in an illustrative manner , and it is to be understood that the terminology , which has been used , is intended to be in the nature of words of description rather than of limitation . many modification and variations of the present invention are possible in light of the above teachings . it is , therefore , to be understood that within the scope of the appended claims , the invention may be practiced other than as specifically described .
4
a propellant magazine according to the present invention , which is shown in fig1 through 3 , has a plurality of spaced from each other pockets 2 for receiving each a propellant 3 and an initiating composition 4 for igniting the propellant 3 . the pockets 2 are formed by a pocket foil 1 . a cover foil 5 , which is unreleasably glued to the pocket foil 2 , closes the separate pockets 2 . in the region of each pocket 2 , between the cover and pocket foils 1 , 5 , a conducting strip 7 extends . the conducting strip 7 is interrupted in the region of the initiating composition and forms two contact points 8 and 9 which are arranged , in the radial direction outside of the pocket 2 . the propellant is formed as a pellet . however , the propellant 3 can be in form of powder filling a pocket 2 . the pocket foil 1 and the cover foil 5 are formed each of a strip - shaped , thin - walled foil formed , e . g ., of a plastic material that conducts no current . it is also possible to form the pocket foil 1 and the cover foil 5 circular , so that separate pockets 2 are arranged not after one another but rather next to each other . as show in fig1 , both the pocket foil 1 and the cover foil 5 are provided , along their longitudinal edges , with a plurality of recesses 10 in form of indentations in which during the displacement of the propellant magazine , a displacing pawl ( not shown ) of a setting tool ( which is likewise not shown ) can formlockingly engage . the separate , spaced from each other pockets 2 are arranged between the respective recesses 10 . the recesses 10 can also be formed as through - openings which extend in the central region of the propellant magazine between two pockets 2 through both the pocket foil 1 and the cover foil 5 . the conducting strip 7 , which is connected with the initiating composition 4 , extends , as it has already been discussed previously , between the pocket foil 1 and the cover foil 5 and is interrupted to provide for a spark discharge in the ignition region 6 of the initiating composition 4 upon application of a voltage to the conducting strip 7 . instead of the interrupted conducting strip 7 , it is possible to provide , in the region 6 of the initiating composition 4 , a conducting strip having a reduced cross - section where a spark discharge can take place . as it has also been discussed above , the end regions of the conducting strips 7 lie , in the radial direction , outside of respective pockets 2 and have each two contact points 8 , 9 connectable with respective electrodes 35 . an electrode 35 , which extends through the cover foil 5 and the conducting strip 7 is shown in fig3 . the electrode 35 forms part of non - shown setting tool and has a sharp tip . the conducting strip 7 is glued to a side of the cover foil 5 facing the pocket foil 1 . it is also possible to press the conducting strip 7 into the cover foil 5 or to roll it into the cover foil 5 . fig4 shows a propellant magazine in which the cover foil 15 is formed of an electroconductive material , whereas the pocket foil 11 is formed of a nonconductive material . a glue layer 20 extends between the cover foil 15 and the pocket foil 11 . within each pocket 12 , a propellant 13 in form of a pellet is located . between the pellet and the cover foil 15 , a initiating composition 14 is provided . between the glue layer 20 and the pocket foil 11 , a conducting strip 17 with two contact points 18 , 19 extends . the conducting strip 16 extends up to the initiating composition 14 . for igniting the propellant 13 , which is located in a pocket 12 of the propellant magazine , two electrodes of a setting tool ( not shown ) are used to which voltage is applied . before the voltage is applied , one of the electrodes is pressed against the cover foil . the other electrode is pushed through the cover foil 15 and forms contact with the conducting strip 17 . the voltage applied to the two electrodes generates a spark discharge in the ignition region 16 . a pocket 22 of a further embodiment of a propellant magazine according to the present invention , which is shown in fig5 , is designed for receiving a propellant 23 formed as a pellet provided , in the region adjacent to the cover foil 25 with electroconductive particles 24 . the cover foil 25 and the pocket foil 21 are formed both of a non - electroconductive material and are glued to each other . between the cover foil 25 and the pocket foil 21 , a conducting strip 27 extends . the conducting strip 27 in interrupted in each of its region associated with a respective electroconductive particle 24 in the propellant pellet . the conducting strip 27 has two contact points 28 , 29 through which voltage is applied to the conducting strip 27 . the spark discharge takes place in the ignition region 26 . a cover foil 25 , which is shown in fig6 , has , at its side adjacent to the pocket foil ( not shown in fig6 ), a continuous conducting strip 27 . both sections of the conducting strip 27 have two or more contact points 28 , 31 ; 29 , 32 which serve for coding of the propellant magazine . generally , there are provided two pairs of two located opposite each other contact points 28 , 31 and 29 , 32 . the contact points 28 , 29 , 31 , 32 lie on a common circle 33 . for the displacement of the propellant magazine , recesses 30 in form of side indentations provided in the longitudinal edges of the cover foil 25 , are used . fig7 show another embodiment of a propellant magazine according to the present invention in form of a magazine strip 47 located in a strip guide 41 of a setting tool ( not shown in detail ). the magazine strip has a plurality of pockets 42 , 42 โ€ฒ with a propellant charge , with the pocket 42 โ€ฒ being located in a cartridge chamber 45 of the setting tool . the magazine strip 47 has a conducting strip 37 interrupted above the pockets 42 , 42 โ€ฒ. the free space , which is formed between two halves of the conducting strip 37 , serves as a spark track for a to - be - generated ignition spark . in the embodiment of a propellant magazine shown in fig7 , the conducting strip 37 extends on both sides of the magazine strip 47 from a front , in the displacement direction of the magazine strip 47 , pocket 42 โ€ฒ toward the following pocket 42 . the contact points 38 , 39 of the conducting strip 37 are provided in the region of the following pocket 42 on opposite sides of the magazine strip 47 . the contact points 38 , 39 cooperate with electrical contact elements 43 , 44 of the setting tool . the electrical contact elements 43 , 44 are formed as sliding contacts spring - biased toward the magazine strip 47 in directions shown with arrows 46 . the contact elements 43 , 44 contact following each other contact points 38 , 39 as the magazine strip 47 is advanced . as soon as the setting tool control initiates ignition , the current flows via slide contact elements 43 , 44 and contact points 38 , 39 to the conducting strip 37 , generating an ignition spark at the interruption of the contacting strip 37 . though the present invention was shown and described with references to the preferred embodiments , such are merely illustrative of the present invention and are not to be construed as a limitation thereof , and various modifications of the present invention will be apparent to those skilled in the art . it is , therefore , not intended that the present invention be limited to the disclosed embodiments or details thereof , and the present invention includes all variations and / or alternative embodiments within the spirit and scope of the present invention as defined by the appended claims .
1
referring more particularly to the drawings , fig1 is illustrative of an automatic ball return 10 in which the present invention is intended to be used . as will be understood by those skilled in the art , bowling pins ( not shown ) and bowling balls ( not shown ) drop into pit 11 from alley a and are carried rearward by conveyor 12 . located beneath the upper lap 12a of conveyor 12 are bounce boards 13 which extend transversely across pit 11 and are supported on the resilient blocks 14 secured to channels 15 which , in turn are attached to brackets 16 ( only one shown ) mounted on the sides or &# 34 ; kickback &# 34 ; 17 of pit 11 . a plate 18 is provided between bounce boards 13 to provide a groove into which a ball may depress upper lap 12a as the ball moves thereover to allow the ball to roll off lap 12a and through ball door 20 in kickback 17 . as a ball exits pit 11 through door 19 , it comes into contact with kicker wheel roller 20c which is affixed to shaft 21 which , in turn , is continuously rotated by belt 22 . rotating kicker wheel roller 20c frictionally engages the ball and directs or &# 34 ; kicks &# 34 ; the ball into ball elevating mechanism 24 which , in turn , is comprised of conveyor belt 26 and ball track 27 . the spacing between conveyor belt 26 and track 27 decreases upwardly so that the ball will be frictionally carried upward on track 27 to a return chute ( not shown ) by conveyor belt 26 when a ball is trapped therebetween . ball return mechanisms of the type described are well known in the art and are in widespread use in commercial bowling houses . examples of such a return mechanism are automatic pin setters , models 8230 and 8270 , distributed by american machine & amp ; foundry company ( amf ) and which are basically disclosed and described in u . s . pat . no . 3 , 297 , 322 which is incorporated herein by reference . the kicker wheel roller 20 of the present invention is adpated to replace roller 20c of the ball return mechanism 10 shown in fig1 and described above . roller 20 is comprised of a permanent hub member 25 and a replaceable contact surface member 26 . hub member 25 is formed from a durable material , e . g . aluminum , steel , hard rubber , or the like and has bore 27 therethrough of a proper diameter to fit over shaft 21 of ball return mechanism 10 . as illustrated , hub member 25 has an upper portion 29 and an integrally formed lower , driving portion 30 . driving section 30 has a non - circular , outer periphery , e . g . square as shown in fig2 ; splined as shown in fig5 ; triangular ( not shown ), rectangular ( not shown ); or the like , for a purpose discussed below . a shoulder 31 is provided on hub member 25 to insure the proper longitudinal positioning of contact surface member 26 on hub member 25 . as shown , upper portion 29 is rounded and has a diameter greater than the length of a side of the square driving portion 30 that portion 29 projects at least partially outward above the periphery of the driving portion 30 to form shoulder 31 . however , it should be understood that shoulder 31 can be formed in other ways without departing from the present invention . for example , although not shown , upper 29 and lower 30 portions of hub member 25 can be integral and of the same dimensions throughout their combined length ( e . g . square from top to bottom ). a groove is provided around the periphery of hub 25 to thereby define upper and lower portions 29 , 30 so . a snap ring or the like is inserted in this groove and extends outward from hub 25 to provide a shoulder thereon . replaceable contact surface member 26 comprises a cylindrical element 35 which is molded or otherwise formed form any suitable elastomeric resilient frictional material , e . g . polyurethane , natural or synthetic rubber , or the like . the thickness t ( fig2 ) of element 35 is approximately the same as the length of driving portion 30 of hub member 25 . the outer surface 36 of cylindrical element 26 provides the surface which engages the bowling balls when roller 30 is in an operating position in the ball return mechanism 10 . where a large number of light bowling balls ( e . g . 9 - 10 pounds ) are routinely encountered , an annular groove 34 ( e . g . 3 / 8 inch deep , see fig3 b ) can be provided in and around outer peripheral surface 36 thereby providing a better gripping surface or &# 34 ; thread &# 34 ; for these light weight balls . cylindrical element 35 has a non - circular opening 37 ( e . g . square in fig2 splined in fig5 etc .) through the center . opening 37 has an inner periphery configuration and dimensions substantially identical to those of the outer periphery of driving portion 30 of hub member 25 so that member 26 can easily be forced onto driving portion 30 and held there only by the resiliency of element 35 . preferably , wear indicating groove 38 is provided in the upper surface of element 35 to warn a user when control surface member 26 wears to point where it should be replaced . in operation , kicker wheel roller 20 ( i . e . assembled hub member 25 and replaceable contact surface member 26 ) is positioned on shaft 21 of ball return mechanism 10 and is held thereon by set screw 28 or the like . it should be understood that normally , kicker wheel roller 20 of the present invention will replace the single unit kicker wheel 20c that is commonly in use today . to aid in installation in some ball return mechanisms , the upper surface 39 of element 35 may be formed with a tapered surface 39 as shown in fig3 a and 3b . when contact surface member 26 wears out , a new member 26 is now installed on permanent hub 25 which , in turn , is continuously reused . the savings which result from only having to replace contact surface member 26 are substantial . a modified hub member 25a is shown in fig3 a , 3b , and 4 which is useful where contact surface member 26 may wear down to the driving portion of the hub before it is detected by a user . hub 25a has an upper portion 29a and an integral shaft 29b depending thereform . a driving portion 30a having a non - circular outer configuration is bonded or otherwise permanently affixed to shaft 29b . driving portion 30a is formed of a material , e . g . polyurethane , which has a hardness less than that of the materials used in forming bowling balls . if contact surface member 26 wears completely out before it is detected , bowling balls will contact the softer driving portion 30a and will not be damaged or marred thereby . to be more specific , the dimensions of a typical kicker wheel roller assembly are as follows . cylindrical element 35 which may be formed of molded polyurethane has a diameter of 3 inches and a thickness t of 1 inch . opening 37 is a 11 / 2 inch square . hub 25 which may be formed of aluminum is 11 / 2 inch long with driving portion 30 being 1 inch long and having a 11 / 2 inch square periphery . bore 27 has a 3 / 8 inch diameter . while these dimensions are given to illustrate a typical roller assembly , it should be understood that any or all of these dimensions may be changed to meet the requirements of a particular ball return mechanism without departing from the present invention .
8
in a first aspect , the present invention relates to a topical composition for the treatment of diabetic neuropathy . the composition includes a compound that promotes synthesis of nerve growth factor , an aldose reductase inhibitor and an antioxidant formulated in a pharmaceutically acceptable carrier for a topical composition . the compound that promotes synthesis of nerve growth factor may be selected from suitable compounds that have been shown to have this activity . suitable compounds that promote synthesis of nerve growth factor are those that do not induce significant , adverse side effects when topically applied to a patient in amounts that promote synthesis of nerve growth factor , and which do not react with one or more of the ingredients of the topical composition resulting in a substantial loss of activity of one or more active ingredients . preferred compounds for promoting synthesis of nerve growth factor are those that occur naturally in the human body and / or materials obtained from plants or animal which may be ingested or topically applied by humans without significant , adverse side effects in the amounts used or derivatives thereof exemplary compounds that promote synthesis of nerve growth factor are vitamin d 3 , vitamin d 3 derivatives such as 1 ( s ), 3 ( r )- dihydroxy - 20 ( r )-( 1 - ethoxy - 5 - ethyl - 5 - hydroxy - 2 - heptyn - 1 - yl )- 9 , 10 - seco - pregna - 5 ( z ), 7 ( e ), 10 ( 19 )- triene . the preferred nerve growth factor used in the topical composition is vitamin d 3 . also , pharmaceutically acceptable salts of the compounds that promote synthesis of nerve growth factor may be employed . the compound that promotes synthesis of nerve growth factor is used in an amount effective to promote the synthesis of nerve growth factor of about 10 , 000 to about 3 million iu . per kg of the composition . more preferably , the compound that promotes synthesis of nerve growth factor is employed in an amount of about 50 , 000 to about 2 million iu per kg of the composition , and most preferably an amount of 100 , 000 to about 1 million iu is used per kg of the composition . the preferred compounds that induce synthesis of nerve growth factor may , in addition to this activity , also function to prevent neurotrophic deficits . this additional effect of the preferred compounds may also contribute to the overall beneficial effect of the topical composition of the present invention . in order to formulate the compound that promotes synthesis of nerve growth factor in the topical composition of the present invention , it may be necessary to use a dispersant . suitable dispersant materials are known to persons skilled in the art . a particularly suitable dispersant for the compounds that promote synthesis of nerve growth factor is corn oil . corn oil also has the advantage that it is a natural product . the amount of corn oil used is an amount sufficient to disperse the compound that promotes synthesis of nerve growth factor . the second active ingredient of the topical composition of the present invention is an aldose reductase inhibitor . numerous suitable aldose reductase inhibitors are known to persons skilled in the art . again , suitable aldose reductase inhibitors are those that do not induce significant , adverse side effects when topically applied to a patient in an amount effective for aldose reductase inhibition , and which do not react with one or more of the ingredients of the topical composition resulting in a substantial loss of activity of one or more active ingredients of the composition . preferred aldose reductase inhibitors are those that occur naturally in the human body and / or materials obtained from plants or animal which may be ingested or topically applied by humans without significant , adverse side effects in the amounts used or derivatives thereof as mentioned above , numerous aldose reductase inhibitors are known to persons skilled in the art . however , significant adverse side effects are associated with the use of many aldose reductase inhibitors in humans . thus , it is important to select one or more aldose reductase inhibitors for use in the topical composition of the present invention based on minimizing the risk associated with use of the aldose reductase inhibitor taking into account the amount of that particular inhibitor that must be employed to achieve the desired level of aldose reductase inhibition . different aldose reductase inhibitors exhibit different levels of inhibition . with this in mind , the preferred aldose reductase inhibitors for use in the topical compositions of the present invention are flavonoids and flavonoid derivatives . exemplary aldose reductase inhibitors include (โˆ’)- epigallocatechin ; (โˆ’)- epigallocatechin - gallate ; 1 , 2 , 3 , 6 - tetra - o - gallyol - ฮฒ - d - glucose ; 2 โ€ฒ o - acetylacetoside ; 3 , 3 โ€ฒ, 4 - tri - o - methyl - ellagic acid ; 6 , 3 โ€ฒ, 4 โ€ฒ- trihydroxy - 5 , 7 , 8 - trimethoxyflavone ; 6 - hydroxy - luteolin ; 6 - hydroxykaempferol - 3 , 6 - dimethyl ether ; 7 - o - acetyl - 8 - epi - loganic acid ; acacetin ; acetoside ; acetyl trisulfate quercetin ; amentoflavone ; apiin ; astragalin ; avicularin ; axillarin ; baicalein ; brazilin ; brevifolin carboxylic acid ; caryophyllene ; chrysin - 5 , 7 - dihydroxyflavone ; chrysoeriol ; chrysosplenol ; chrysosplenoside - a ; chrysosplenoside - d ; cosmosiin ; ฮด - cadinene ; dimethylmussaenoside ; diacerylcirsimaritin ; diosmetin ; dosmetin ; ellagic acid ; ebinin ; ethyl brevifolin carboxylate ; flavocannibiside ; flavosativaside ; genistein ; gossypetin - 8 - glucoside ; haematoxylin ; hispiduloside ; hyperin ; indole ; iridine ; isoliquiritigenin ; isoliquiritin ; isoquercitrin ; jionoside ; juglanin ; kaempferol - 3 - rhamnoside ; kaempferol - 3 - neohesperidoside ; kolaviron ; licuraside ; linariin ; linarin ; lonicerin ; luteolin ; luetolin - 7 - glucoside ; luteolin - 7 - glucoside ; luetolin - 7 - glucoronide ; macrocarpal - a ; macrocarpal - b ; macrocarpal - d ; macrocarpal - g ; maniflavone ; methy scutellarein , naringenin ; naringin ; nelumboside ; nepetin ; nepetrin ; nerolidol ; oxyayanin - a ; pectolinarigenin ; pectolinarin ; quercetagetin ; quercetin ; quercimertrin ; quercitrin ; quercitryl - 2 โ€ณ acetate ; reynoutrin ; rhamnetin ; rhoifolin ; rutin ; soutellarein ; sideritoflavone ; sophoricoside ; sorbarin ; spiraeoside ; trifolin ; vitexin ; and wogonin . the most preferred flavonoid and / or flavonoid derivative aldose reductase inhibitors are quercetin , quercetrin , myricetin , kaempferol and myrecetrin since these compounds exhibit a high level of aldose reductase inhibition in combination with a relatively low toxicity . also , pharmaceutically acceptable salts of these aldose reductase inhibitors may be employed . the flavonoids and flavonoid derivatives are also preferred since some of these compounds may provide additional beneficial effects in the composition of the present invention . for example , quercetin may act as a chelator for transition metals that some studies have linked to certain symptoms of diabetic neuropathy . flavonoids may also have some anti - inflammatory activity and / or may help stabilize cell membranes , both of which activities may be beneficial in the treatment of diabetic neuropathy . the aldose reductase inhibitor is used in an amount of about 2 to about 40 grams per kg of the composition . more preferably , the aldose reductase inhibitor is employed in an amount of about 5 to about 30 grams and most preferably an amount of 8 to about 20 grams per kg of the composition . another active ingredient in the composition of the present invention is the antioxidant . the antioxidant may be a single compound or a mixture of two or more compounds . also , the antioxidant may include one or more compounds that provide additional beneficial effects beyond the antioxidant activity , such as aldose reductase inhibition , compounds which may be used as antioxidants are those which exhibit antioxidant activity when administered topically without causing any severe adverse side affect when used in an amount effective to provide sufficient antioxidant activity , and which do not react with one or more of the ingredients of the topical composition resulting in a substantial loss of activity of one or more active ingredients . preferred antioxidants are those that occur naturally in the human body and / or materials obtained from plants or animal which may be ingested or topically applied by humans without significant , adverse side effects in the amounts used or derivatives thereof more preferred antioxidants are selected from ascorbyl palmitate , ascorbic acid ( vitamin c ), vitamin a , vitamin e acetate , ฮฑ - lipoic acid , especially dl - ฮฑ - lipoic acid , coenzyme q10 , glutathione , catechin , glangin , rutin , luteolin , morin , fisetin , silymerin , apigenin , gingkolides , hesperitin , cyanidin , citrin and derivatives thereof which exhibit antioxidant activity . even more preferably , mixtures of two or more antioxidants are employed in the composition of the present invention . particularly preferred antioxidant mixtures are ascorbyl palmitate with one or both of vitamin a and vitamin e acetate . the antioxidants may also be used in the form of their pharmaceutically acceptable salts and this may be preferred in some cases to increase solubility or dispersability , to reduce adverse side effects , etc . the antioxidant is used in an amount of about 1 to about 50 grams per kg of the composition . more preferably , the antioxidant is employed in an amount of about 2 to about 30 grams , and most preferably an amount of about 5 to about 20 grams per kg of the composition . the antioxidants used in the composition of the present invention are preferably selected not only for their antioxidant activity , but also based on other beneficial effects that particular compounds may provide . for example , ascorbyl palmitate not only has antioxidant activity , but also may act as an aldose reductase inhibitor and may help prevent degradation of nitric oxide ( no ) and thus is a particularly preferred antioxidant for the present invention . similarly , vitamin e may also help prevent degradation of nitric oxide and is thus a preferred antioxidant . vitamin a is a fat - soluble material and thus is preferred for use due to this additional beneficial property . however , due to its solubility characteristics , vitamin a may need to be formulated in a suitable dispersant such as corn oil in much the same manner as vitamin d 3 as described above , suitable additional beneficial properties for compounds useful in the compositions of the present invention include absorbability when applied topically , aldose reductase inhibition , antioxidant properties , free radical scavenging , transition metal chelation , nitric oxide stabilization , and anti - inflamatory activity . the compositions in accordance with the present invention may provide one or more of the following beneficial effects to a patient when topically applied in effective amounts ; relief of pain , burning , tingling , electrical sensations and / or hyperalgesia , increased microcirculation , nitric oxide stabilization , promotes healing of skin ulcers and lesions , protein kinase c inhibition , decreased oxidative stress , anti - inflammation , protection against radiation damage , particularly ultraviolet radiation , blockage of the formation of leukotrienes , stabilization of cell membranes , and promotion of the synthesis of nerve growth factor . the method of the present invention involves the topical application of a composition of the present invention to areas of the skin in the vicinity of tissue that suffers from diabetic neuropathy . in particular , the present invention is useful on the patients &# 39 ; extremities such as the fingers , toes , hands and feet where diabetic neuropathy is often the most pervasive . in the method , a suitable amount of the composition of the invention is applied one to six times daily as needed to relieve pain and other symptoms of the diabetic neuropathy . preferably , the composition is applied two to four times daily , as needed for pain . a sufficient amount should be applied to cover the area afflicted with the diabetic neuropathy with a thin layer of the composition and the composition should be rubbed into the skin until little or no residue remains on the skin . treatment begins initially to treat acute symptoms but may be continued indefinitely to relieve pain , prevent symptoms of diabetic neuropathy from returning and possibly restore some nerve and / or skin function . the method of the present invention may provide one or more of the beneficial effects described above for the compositions of the invention . in addition , the method of the present invention may provide some additional beneficial effects due to one or more of the ingredients contained in the pharmaceutically acceptable carrier as described in more detail below , the pharmaceutically acceptable carrier of the present invention is suitable for use as a carrier for topical compositions wherein the active ingredients are dissolved , dispersed and / or suspended in the composition . the carrier of the present invention contains at least a hydrophilic ointment base , panthenol or a panthenol derivative and a dispersant if needed to disperse one or more insoluble or partially insoluble active ingredients in the carrier . suitable hydrophilic ointment bases are known to persons skilled in the art . exemplary hydrophilic ointment bases suitable for use in the present invention are non - u . s . p . hydrophilic ointment bases such as those made by fougera , inc . sufficient hydrophilic ointment base is employed to act as a garrier for the active ingredients of the composition . typically the hydrophilic ointment base will make up more than about 80 % of the total composition and more preferably about 80 - 90 % of the composition is the hydrophilic ointment base . the hydrophilic ointment base functions as a carrier and enhances penetration into the skin . the panthenol or panthenol derivatives useful in the present invention include at least d - panthenol , dl - panthenol and mixtures hereof this component of the carrier has skin moisturizing properties and acts as a quick , deep penetrating component of the carrier that helps deliver the active ingredients through the skin to the area to be treated and imparts a healing effect to damaged tissue . the amount of panthenol or panthenol derivative to be employed is from about 0 . 25 to about 10 weight percent , more preferably from about 0 . 5 to about 5 weight percent and most preferably from about 1 to about 2 weight percent , based on the total weight of the composition . the carrier of the present invention may also include additional ingredients such as other carriers , moisturizers , humectants , emollients dispersants , radiation blocking compounds , particularly uv - blockers , as well as other suitable materials that do not have a significant adverse effect on the activity of the topical composition . preferred additional ingredients for inclusion in the carrier are sodium acid phosphate moisturizer , witch hazel extract carrier , glycerine humectant , apricot kernal oil emollient , and corn oil dispersant . other materials which may optionally be included in the topical compositions of the present invention include inositol , other b - complex vitamins , and anti - inflammatory agents . the composition of the present invention may also be employed to facilitate wound healing , for the treatment of skin cancer and / or one or more symptoms thereof or as a composition for protecting skin from the harmful effects of radiation such as radiation breakdown . the composition of the present invention is made by cold compounding . this is an important feature of the invention since one or more of the compounds employed in the topical composition are sensitive to heat or other types of energy and thus the activity of the composition may be detrimentally affected as a result of the formulation of the compositions in other manners . thus , the ingredients of the topical composition the present invention are merely mixed together , without heating using a sufficient amount of the carrier to provide a substantially homogeneous cream or ointment . it may be necessary to dissolve , disperse or suspend one or more of the ingredients prior to cold compounding in order to ensure substantially homogeneous distribution of the active ingredients in the composition . a preferred composition of the invention can be made using the following ingredients , all based on use of one pound of hydrophilic ointment base . 25 - 35 cc of a 50 % aqueous solution of sodium acid phosphate moisturizing agent , 5 - 10 cc of d - or dl - panthenol , 5 - 10 cc of glycerine , 1 - 3 cc of apricot kernal oil , 3 - 5 cc of a dispersion of vitamins a and d 3 in a corn oil base , 10 - 20 cc of witch hazel extract , 0 . 5 - 2 cc of vitamin e acetate , 2 - 4 grams of ascorbyl palpitate and 4 - 8 grams of quercetin powder . optionally , one or more of the glycerin , witch hazel extract , vitamins a and e and / or the ascorbyl palmitate can be reduced or eliminate from a particular composition , if desirable or larger amounts of one type of component , i . e . antioxidant , can be employed while reducing the amount of another component of the same type or having a similar type of activity , the invention will now be further illustrated by the following example . a topical composition including a mixture of an hydrophilic ointment base , sodium acid phosphate moisturizing agent , a witch hazel extract carrier , glycerine , apricot kernal oil and dl - panthenol as the pharmaceutically acceptable carrier and vitamins a and d 3 , ascorbyl palmitate , quercetin and vitamin e acetate was prepared by cold compounding . the formulation of the composition is given in table 1 . the composition was prepared by first placing the hydrophilic ointment base in a stainless steel bowl and mixing briskly until the ointment becomes creamy . then , the sodium acid phosphate , panthenol , ascorbyl palmitate , glycerine , apricot kernal oil , vitamins a and d 3 , witch hazel extract , vitamin e acetate and quercetin are added in that order . after each ingredient is added , mixing is continued until all traces of dry ingredients have disappeared and a substantially homogeneous mixture is obtained . the final color should be a consistent yellow and the cream should have the consistency of cake frosting . the mixture is then placed in a sterile container . all containers which contact the composition during mixing must also be sterilized with , for example , zephiran choride or a chlorox solution such as betadine . this composition was topically administered , under the supervision of a physician , to several patients diagnosed with the most difficult cases of diabetic peripheral neuropathy . the topical composition was applied twice daily in the morning and afternoon , except that patients were permitted to apply the composition up to six times daily , as needed for pain relief over a period of a few days . all of the eight patients treated experienced immediate positive results that lasted up to a day or two after treatment was discontinued . the effects noted by the patients included the relief of burning pain , tingling , healing of damaged skin , and reversal of skin discoloration due to impaired circulation . the foregoing detailed description of the invention and examples are not intended to limit the scope of the invention in any way and should not be construed as limiting the scope of the invention . the scope of the invention is to be determined from the claims appended hereto .
0
referring now to the drawings , like elements are represented by like numerals throughout the several views . fig1 illustrates schematically a key reader which may be constructed as shown in the said prior patent . the housing 10 has a key slot 11 for receiving key 18 ( fig2 ). a pair of reading pins 12 and 13 are urged outwardly by resilient means 14 into key slot 11 . when key 18 is inserted into slot 11 , all of its reading positions will pass by pins 12 and 13 and be read before the key reaches its fully inserted position . control means 15 senses the code being read , wherein the presence of any code conveys to means 15 the fact that a reading position is in location at the pins and is being read . referring primarily to fig2 the key 18 comprises two parallel rows of reading positions which are identified in fig3 as 41 - 50 in the right row and 51 - 60 in the left row , respectively . each reading position has a matched pair in the other row , the two together forming a cooperating pair , there being ten pairs as indicated by the roman numerals i - x in fig2 . at each reading position , there may be provided two recesses such as recesses 41 and 51 at position i , or only a recess in the left row , such as at 52 in position ii , or only a recess in the right row , such as at 44 or 45 in positions iv and v . hence , at any of the ten positions , three conditions are possible . many modifications and variations of the key codes will be evident . in the preferred arrangement only recesses are used so that in any given position the key will include either a flat surface or a recess . alternatively , raised projections can be used so that at any given position the key will have either a flat surface or a raised projection . for purposes of economics , recesses are far preferable to raised projections . further , since each reading pin only requires two positions , there is no need to mix on a given key three different levels by mixing the flat surface , recesses and raised projections . however , if it were desired to provide three different positions for the reading key , this could be accomplished . also , while the present invention illustrates only two rows of codes with a total of ten reading positions , it will be apparent that if desired , a third or more rows could be provided and more or less then ten reading positions could be provided . as merely one example , if in a given situation the length of the key had to be severely reduced but slightly more horizontal space was possible , and the apparatus and the key were constructed with four reading positions i - iv with four code positions at each reading position to cooperate with four different reading pins , then fifteen different conditions would be possible at each of the reading positions i - iv , ( i . e . all combinations except the absence of any indentations or projections since this combination would not create a clock pulse signal ) so that the total number of combinations for this key would be fifteen to the fourth power , or 50 , 625 . if a fifth reading position v were added , this would increase the number of combinations to 759 , 375 . there is shown schematically in fig1 a box 15 which represents means for sensing the positions of the pins at each reading position and transmitting a signal to the unit 16 which is representative of a virtually unlimited number of kinds of devices which can utilize this information , examples being means for identifying the person having possession of the key , permitting access to a door or other security area , manufacturing a key which will duplicate the inserted key , etc . diagrammatic element 15 would also include a clock line means , the details of which are known per se and need not be described herein , which would sense and distinguish each time that a new key reading position was cooperating with the pins . since each key reading position contains at least one depression , then the sensing of one or two depressions at the key reading position would provide the signal for the clock line means . the operation of the invention will be apparent from the preceding discussion . however , briefly by way of summary , the present invention would operate as follows , using as an example the specific key 18 shown herein . as the key 18 is inserted , its bevelled tip 35 would engage both pin tips 12 and 13 and move them rearwardly until they rode up onto the flat leading edge area 61 just behind the bevelled front 35 . position x would then engage the two reading pins . during this reading the clock line means associated with element 15 would sense that the first position is being read . a change from the no key position to the leading edge position would have alerted sensor 15 to the fact that a reading position will now commence . as the key 18 is moved farther into the slot , position ix would engage the pins , both of which would move into the respective recesses 49 and 59 . again , the clock line means would sense that the key has now brought the next reading position to the pins . this sequence would continue until the last position , namely position i , has been read after which the pin tips 12 and 13 would ride up on rear flat area 62 . in practice , these readings can be made so rapidly that the operator would simply insert the key rapidly without discerning the individual positions . specifically , each reading can be made in no more than seventy milliseconds . in the present example , assuming that a recess in the left row is read as &# 34 ; one &# 34 ;, a dimple in the right row is read as &# 34 ; two &# 34 ; and a dimple in both rows is read as &# 34 ; three &# 34 ;, then the code of key 18 , reading from position i to x , would be 3 , 1 , 3 , 2 , 2 , 1 , 3 , 2 , 3 and 2 , just one out of 59 , 049 combinations . although the invention has been described in considerable detail with respect to preferred embodiments thereof , it will be apparent that the invention is capable of numerous modifications and variations , apparent to those skilled in the art , without departing from the spirit and scope of the invention .
4
the above described developer solution of the invention for a positive - type photoresist has been developed as a result of the extensive investigations undertaken by the inventors with an object to provide a novel developer solution free from the problem of the temperature dependency on the sensitivity of the photoresist , which led to a discovery that , when an aqueous solution of a tetraalkyl ammonium hydroxide and an aqueous solution of a triakyl hydroxyalkyl ammonium hydroxide are used each alone as a developer solution of a positive type photoresist , the temperature dependency on the sensitivity of the photoresist when using one of them is reversed to that when using the other . the present invention has been completed on the basis of this discovery . the alkyl group in the tetraalkyl ammonium hydroxide has preferably from 1 to 3 carbon atoms and , more preferably , the alkyl group is a methyl group . accordingly , the tetraalkyl ammonium hydroxide is preferably tetramethyl ammonium hydroxide , which is referred to as tmah hereinbelow . the alkyl group in the trialkyl hydroxyalkyl ammonium hydroxide , on the other hand , also should have from 1 to 3 carbon atoms and should preferably be a methyl group . the hydroxyalkyl group also should have from 1 to 3 carbon atoms , but the most preferably hydroxyalkyl group is a hydroxyethyl group . accordingly , the preferable trialkyl hydroxyalkyl ammonium hydroxide is trimethyl hydroxyethyl ammonium hydroxide , which is referred to as thah hereinbelow . when an aqueous solution of tmah is used as a developer solution of a positive type photoresist , its sensitivity is highest at a temperature in the range from 20 ยฐ to 25 ยฐ c . and decreases as the temperature of the developer solution is increased above or decreased below this temperature range . when an aqueous solution of thah is used as the developer solution , on the other hand , higher temperatures of the solution always result in higher sensitivity . in connection with the relationship between the temperature of the developer solution and the thickness reduction of the photoresist layer in the unexposed areas , it has been found that an increase in the temperature of the developer solution has an effect of decreasing the thickness reduction , when the developer solution is an aqueous solution of tmah , but increasing the thickness reduction when an aqueous solution of thah is used in the developer solution . the principle of the advantages obtained with the inventive developer solution result from the combination of the different characteristics possessed by tmah and thah when each is used singly in the form of an aqueous solution as a developer solution ; and the combined use thereof mixed together in an aqueous solution provides a novel developer solution for a positive - type photoresist with which the temperature dependencies can be minimized with respect to the sensitivity of the photoresist and the solubility of the photoresist in the unexposed areas . a preferable formulation of the inventive developer solution should contain from 0 . 5 to 3 . 0 % by weight or , preferably , from 1 . 0 to 2 . 0 % by weight of the tetraalkyl ammonium hydroxide , e . g ., tmah , and from 1 . 0 to 4 . 0 % by weight or , preferably , from 2 . 0 to 3 . 0 % by weight of the trialkyl hydroxyalkyl ammonium hydroxide , e . g ., thah , in the solution , the balance being water . when the concentrations of these components are lower than the above ranges , the sensitivity of the photoresist is unduly decreased . when the concentrations thereof are excessively high , on the other hand , a disadvantage is caused in the increase of the thickness reduction of the photoresist layer in the unexposed areas . owing to the very small dependencies on temperature of the developer solution of the present invention , in the development treatment with respect to the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas by dissolution in the developer solution , the temperature of the developer solution in the course of the development is relatively free from limitation . it is , however , recommendable that the development should be performed with the inventive developer solution at a temperature in the range from 20 ยฐ to 40 ยฐ c ., since the sensitivity of the photoresist is too small to be practical at a temperature below 20 ยฐ c . the manner in which the inventive developer solution is used for development is not particularly limited and any conventional method is applicable , including dipping and spraying , which provide quite satisfactory results . in addition , it is of course optional to add small amounts of additives such as coloring inhibitor , surface active agent and the like , if so desired to obtain further improvements . the positive - type photoresist compositions which can be subjected to development treatment by use of the developer solution of the present invention include those containing a quinone diazide type compound as the photosensitive component such as o - benzoquinone diazide , o - naphthoquinone diazide and o - anthraquinone diazide as well as nucleus - substituted derivatives thereof , e . g ., esters of o - naphthoquinone diazide sulfonic acid . furthermore , the photosensitive component in the photoresist can be a reaction product of o - quinone diazide sulfonyl chloride and a compound having a hydroxy or amino group in the molecule such as phenol , 4 - methoxyphenol , dimethyl phenol , hydroquinone , bisphenol a , naphthol , trihydroxy benzophenone , pyrocatechol , pyrogallol , pyrogallol monomethyl ether , gallic acid , esterified or etherified gallic acid leaving one or two of the hydroxy groups in the molecule , aniline , 4 - aminodiphenyl amine and the like . the film - forming component in the photoresist composition is an alkali - soluble resin exemplified by novolac resins , polyvinyl alcohols , polyvinyl alkyl ethers , copolymers of styrene and acrylic acid , copolymers of acrylic acid and an alkyl methacrylate , polymers of hydroxystyrene , polyvinyl hydroxybenzoate , polyvinyl hydroxybenzal and the like . several grades of positive - type photoresist compositions are commercially available on the market , of which preferable ones include the microposit - series products manufactured by shipley co ., az - series products manufactured by hoechst co ., hpr - series products manufactured by hunt chemical co ., ofpr - series products manufactured by tokyo ohka kogyo co ., ltd ., and the like . particularly preferable positive type photoresist compositions are those comprising a novolac resin and an esterification product obtained by the condensation reaction between naphthoquinone -( 1 , 2 )- diazido -( 2 )- 5 - sulfonyl chloride and 2 , 3 , 4 - trihydroxy benzophenone described in japanese patent publication no . 37 - 18015 . these commercially available positive - type photoresists can also be used with the developer solution of the presently claimed invention . when a positive - type photoresist layer of the composition of the above - described type is subjected to the development treatment after pattern - wise exposure to light by use of the inventive developer solution , changes in the temperature of the developer solution only have very small influences on the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas , so that the temperature control of the developer solution in the development treatment need not be so exact as in the use of a conventional developer solution . accordingly , this aspect of the present invention greatly facilitates the line width control of the patterned photoresist layer . in particular , development treatment by spraying of the developer solution can be easily performed with good line width control by use of the inventive developer solution , in contrast to what it has been generally understood by those in the art ; namely , that the spraying development is not suitable when exactness is desired in the line width control due to the uncontrollable temperature decrease of the solution by the evaporation of the solvent by spraying . thus , the developer solution of the present invention is very advantageous because a pattern - wise photoresist layer of high resolving power can readily be obtained with very little fluctuation in the line width of the pattern . in the following , the present invention is described in more detail by way of examples . an aqueous developer solution wa prepared by dissolving in water , tetramethyl ammonium hydroxide and trimethyl hydroxyethyl ammonium hydroxide in amounts to give concentrations of 1 . 4 % by weight and 2 . 1 % by weight , respectively , in the resulting developer solution . a positive - type photoresist composition was prepared by dissolving 3 . 2 parts by weight of an esterification product obtained by the condensation reaction , according to the disclosure in japanese patent publication no . 37 , 18015 , between 1 mole of 2 , 3 , 4 - trihydroxy benzophenone and 2 moles of naphthoquinone -( 1 , 2 )- diazido -( 2 )- 5 - sulfonyl chloride and 12 . 8 parts by weight of a cresol formaldehyde resin in 84 parts by weight of ethyleneglycol monoethyl ether acetate . a substrate plate was uniformly coated with this positive - type photoresist composition to give a film thickness of 1 . 3 ฮผm after drying by a heat treatment . this was followed by exposure to light , and then developed by dipping for 60 seconds or 180 seconds in the above prepared developer solution . the temperature of the developer solution was varied to 20 ยฐ, 25 ยฐ, 30 ยฐ and 40 ยฐ c . the results obtained by the determination of the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas are shown in table 1 . as is clear from the results , the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas are only slightly dependent on the temperature of the developer solution . the experimental procedure as in example 1 was repeated except that the developer solution used in this case was an aqueous solution of tetramethyl ammonium hydroxide alone in a concentration of 2 . 5 % by weight . the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas are also shown in table 1 . as is clear from the table , the temperature dependencies of the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas are considerably large , with decrease in the sensitivity and decrease in the thickness reduction as the temperature of the developer solution is increased . the same experimental procedure as in example 1 was repeated , except that the developer solution used in this case was an aqueous solution containing trimethyl hydroxyethyl ammonium hydroxide alone in a concentration of 4 . 5 % by weight . the sensitivity of the photoresist and the thickness reduction of the photoresist layer in the unexposed areas are shown in table 1 for each of the temperatures of the developer solution . as is clear from the table , the temperature dependencies of the photosensitivity of the photoresist and the thickness reduction of the photoresist layer are considerably large with increase in the sensitivity and increase in the thickness reduction as the temperature of the developer solution increases . further , comparison of the data of the thickness reduction in example 1 and comparative examples 1 and 2 between the development time of 60 seconds and 180 seconds indicates that the increase of the thickness reduction is relatively small when the inventive developer solution is used even when the developing time is unduly extended so that the inventive developer solution can be used without exact control of the developing time . table 1______________________________________tempera - thickness reduction , nmture of sensi - 60 second 180 secondsdeveloper tivity develop - develop - solution ,. seconds ment ment ยฐ c . (* 1 ) ( a ) ( b ) ( b )/( a ) ______________________________________example 20 4 . 1 110 220 2 . 01 25 3 . 7 130 260 2 . 0 30 3 . 7 130 270 2 . 1 40 3 . 7 130 300 2 . 3compa - 20 3 . 3 120 400 3 . 3rative 25 3 . 5 90 310 3 . 4example 30 3 . 9 70 240 3 . 41 40 5 . 3 50 170 3 . 4compa - 20 4 . 2 80 310 3 . 9rative 25 3 . 7 90 420 4 . 7example 30 3 . 4 100 520 5 . 22 40 2 . 6 140 1050 7 . 5______________________________________ (* 1 ) sensitivity is given by the minimum exposure time in seconds require for the image reproduction with fidelity of the pattern on the photomask . a substrate plate was coated uniformly with the same photoresist composition as used in example 1 , followed by a heat treatment , and the resulting photoresist layer was exposed to light through a photomask having a line pattern of 3 . 0 ฮผm line width to give a predetermined irradiation dose . the thus pattern - wise exposed photoresist layer on the substrate was developed by respectively dipping for 60 seconds in the developer solution prepared in example 1 , comparative example 1 and comparative example 2 at different temperatures , as shown below and the width of the line pattern of the photoresist layer as developed was measured to give the results shown in table 2 below for each of the developer solutions at each of the temperatures of the solution . as is clear from the table , the line width obtained by use of the inventive developer solution had higher fidelity and higher reproducibility than those obtained by use of the comparative developer solutions . in particular , the line width obtained by use of the developer solution of the present invention varies little with respect to temperature of the developer solution . table 2______________________________________ developer solutiontemper - comparative comparativeature example 1 example 1 example 2______________________________________20 ยฐ c . 2 . 9 ฮผm 2 . 85 ฮผm 3 . 17 ฮผm25 3 . 0 3 . 0 3 . 030 3 . 05 3 . 18 2 . 75______________________________________
6
please refer to fig1 a , which is a schematic diagram of an integrated circuit 10 according to an embodiment of the present invention . as shown in fig1 a , the integrated circuit 10 comprises a housing 100 , a plurality of first signal ends 102 , a plurality of second signal ends 104 and an electronic signal transmitting device 106 . the first signal ends 102 are configured at a side ( e . g . the left side ) of the housing 100 and the second signal ends 104 are configured at another side ( e . g . the right side ) of the housing 100 . please note that a number of the first signal ends 102 and a number of second signal ends 104 can be appropriately changed according to different system requirements and design concepts . the electronic signal transmitting device 106 is configured in the housing 100 and comprises a plurality of electromagnetic transmitting units 108 and an electromagnetic insulating layer 110 . the electronic signal transmitting device 106 is utilized for transmitting an electronic signal es between the plurality of first signal ends 102 and the plurality of second signal ends 104 . through the electromagnetic insulation characteristic of the electromagnetic insulating layer 110 , the effect of the electro - static discharge ( esd ) and electromagnetic interference ( emi ) toward the integrated circuit 10 can be reduced . the electronic signal es can therefore be steadily transmitted . please refer to fig1 b , which is a cross - sectional view of the integrated circuit 10 shown in fig1 a . please note that fig1 b only shows a first signal end 102 , a second signal end 104 and an electromagnetic transmitting unit 108 as an example . as shown in fig1 b , the electromagnetic transmitting unit 108 comprises a magnetizer eb and a magnetic coil ec twining round the magnetizer eb . when the integrated circuit 10 wants to transmits the electronic signal es , the magnetizer eb and the magnetic coil ec form an electromagnetic transmitting state , for performing the transmission of the electronic signal es . the electromagnetic insulating layer 110 is realized by electromagnetic insulation materials , such as varnish and insulating coating , and covers the magnetizer eb and the magnetic coil ec . via the electromagnetic insulating layer 110 , the magnetizer eb and the magnetic ec can be fixed . moreover , a capacitance between the first signal end 102 and the second signal end 104 can be increased via using the electromagnetic insulating layer 110 to cover the magnetizer eb and the magnetic coil ec . the resistance of the electro - static discharge and the electromagnetic interference can thereby be improved . please refer to fig2 , which is an equivalent circuit diagram of the integrated circuit 10 shown in fig1 b . as shown in fig2 , the electromagnetic transmitting unit 108 comprises the magnetic coil ec and an electronic signal transmitting capacitor estc . the magnetic coil ec is utilized for performing transmission of the electronic signal es . the electronic signal transmitting capacitor estc represents an equivalent capacitor between the first signal end 102 and the second signal end 104 . since the space between the first signal end 102 and the second signal end 104 is fully filled by the electromagnetic insulation material ( i . e . the electromagnetic insulating layer 110 ), the capacitance of the electronic signal transmitting capacitor estc is increased . as a result , the electro - static protection ability can be effectively improved . in other words , both the electromagnetic interference resistance and the electro - static protection ability can be improved . please refer to fig3 a and fig3 b , which are schematic diagrams of an integrated circuit 30 according to an embodiment of the present invention . the integrated circuit 30 shown in fig3 a and fig3 b is similar to the integrated circuit 10 shown in fig1 a and fig1 b , thus the signals and the components with similar functions use the same symbols . unlike the integrated circuit 10 shown in fig1 a and fig1 b , the integrated circuit 30 further stacks an electromagnetic heat - conducting layer 300 , coupling to a plurality of cooling holes ch of the housing 100 , on the electromagnetic insulating layer 110 . the electromagnetic heat - conducting layer 300 can be a thermal grease layer , which can radiate heat rapidly through the cooling holes ch . in such a condition , the electromagnetic insulating layer 110 not only can fix the magnetizer eb and the magnetic coil ec , but also can conduct heat generated when the electromagnetic transmitting unit 108 transmits the electronic signal es to the electromagnetic heat - conducting layer 300 , so as to radiate the heat via the electromagnetic heat - conducting layer 300 and the cooling holes ch . this prevents the integrated circuit 30 from overheating and functioning abnormally . noticeably , the integrated circuit of the above embodiments utilizes the electromagnetic insulating layer made by electromagnetic insulation material to cover the electromagnetic transmitting unit , for increasing the equivalent capacitance between the first signal ends and the second signal ends . the resistance of the electro - static discharge and the electromagnetic interference of the electronic signal transmitting device can therefore be improved . in another embodiment , the integrated circuit radiates the heat generated when the electronic signal transmitting device transmits the electronic signal via the electromagnetic heat - conducting layer configured in the housing of the integrated circuit and the cooling holes of the housing , for preventing the integrated circuit from working abnormally due to overheating . according to different applications and requirements , those with ordinary skill in the art may observe appropriate alternations and modifications . for example , the electronic signal transmitting device may further comprise a waveform filter unit for filtering the noise of the electronic signal . please refer to fig4 , which is another equivalent circuit diagram of the integrated circuit 10 shown in fig1 b . the integrated circuit 10 shown in fig4 is similar to the integrated circuit 10 shown in fig2 , thus the components and signals with the similar functions use the same symbols . unlike fig2 , the equivalent circuit shown in fig4 further comprises a waveform filter unit 400 electrically connected between the first signal end 102 and the magnetic coil ec ., respectively . the waveform filter unit 400 is utilized for filtering the noise of the electronic signal es so that the noise of the electronic signal es can be reduced . to sum up , the electronic signal transmitting device and the integrated circuit of the above embodiments improve the resistance of electro - static discharge and the electromagnetic interference between the first signal ends and the second signal ends via covering the electromagnetic insulating layer . furthermore , the electronic signal transmitting device and the integrated circuit of the above embodiments can also improve the heat - radiating ability via adding the electromagnetic heat conducting layer coupled to the cooling holes of the housing , to prevent abnormal functioning of the integrated circuit due to overheating . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims .
7
the embodiments of the invention and the various features and advantageous details thereof are explained more fully with reference to the non - limiting embodiments and examples that are described and / or illustrated in the accompanying drawings and detailed in the following description . it should be noted that the features illustrated in the drawings are not necessarily drawn to scale , and features of one embodiment may be employed with other embodiments as the skilled artisan would recognize , even if not explicitly stated herein . descriptions of well - known components and processing techniques may be omitted so as to not unnecessarily obscure the embodiments of the invention . the examples used herein are intended merely to facilitate an understanding of ways in which the invention may be practiced and to further enable those of skill in the art to practice the embodiments of the invention . accordingly , the examples and embodiments herein should not be construed as limiting the scope of the invention , which is defined solely by the appended claims and applicable law . moreover , it is noted that like reference numerals represent similar parts throughout the several views of the drawings . the invention provides an enhanced decoding scheme , such as roi ( region of interest ) decoding for jpeg images . a decoder application of the invention may provide a unified application programming interface ( api ) and configuration parameter to execute various functions such as jpeg decoding , generating thumbnail images , rotating , moving and zooming in / out images , decoding roi and the like . these functions may be useful in handheld devices , for example , such as monahans lv โ„ข processor based handheld devices and the like , running on operating systems for such devices . examples of such operating systems include microsoft windows โ„ข mobile 5 . 0 for pocketpc โ„ข, eabi linux โ„ข or a nucleus โ„ข operating system used in a handheld device and so on . in particular , fig1 illustrates a flow chart for an image processing process of a decoder application from a usage standpoint . specifically , the flow chart illustrates an example of the steps taken by a decoder application to process a jpeg image in response to one or more user selections . once a user starts the decoder application and selects a jpeg image to be processed , the selected jpeg image may be decoded at step 100 . the user may select to rotate , zoom or move the image . if the user selects to rotate the image at step 102 , the decoder application processes the image to rotate the yuv data of the decoded image at step 104 and may display the rotated image . if the user selects to save the rotation of the image at step 106 , the decoder application calls a rotate engine application from an application library at step 108 . upon completing step 108 , if the user does not select to rotate the image at step 102 or to save the rotated change at step 106 , the user may select to zoom or move the image at step 110 . if the user selects move or zoom , the decoder application calls a roi decode routine or algorithm from a jpeg library at step 112 . if the user further selects to zoom or move the image at step 114 ( e . g ., move the image after zooming ), step 112 may be repeated . when the user no longer selects zoom or move the image at step 114 or the user selects not to zoom or move the image at step 110 , the image processing for that image is completed . if the user selects to process another image at step 116 , the image processing process may start over again from step 100 . otherwise , the image processing process may be terminated . in particular , fig2 illustrates a flow chart for the image processing process from a codec standpoint . specifically , this flow chart illustrates an example of pulling and executing routines in a library in response to one or more user selections for manipulating an image . at step 200 , the decoder initiates an input / output ( i / o ) buffer allocation for a jpeg image , such as in the form of a โ€œ decoderinitalloc_jpeg ( )โ€ routine . this allocation routine may be provided from a library and initializes the device for decoding one or more jpeg images . the initialization may include allocating space in a buffer for image data . at step 202 , space may be allocated in the buffer based on user selections . at step 204 , the decoder application parameters are set based on the users &# 39 ; selection . at step 206 , the jpeg information may be decoded . the decoding routine may be provided from a jpeg library , such as in the form of a โ€œ decode_jpeg ( )โ€ routine . the jpeg information may be decoded using known techniques for jpeg data decoding . at step 208 , a determination is made if the input stream is decoded . if the input stream is decoded , the user may select to manipulate the image , such as to zoom , move or rotate , at step 210 . the process may be redirected to set the user decoding parameter at step 204 . decoding parameters may be set by a user when selecting what portions of an image to display and how the image should be displayed . thus , decoding parameters may change when a user rotates an image , or zooms in on a specified area of an image . if the input stream is not decoded at step 208 ( partial jpeg decoding ), the process may be directed to perform decoding at step 206 . if the user does not select to zoom , move or rotate the image at step 210 , the viewer ends the jpeg initiation . a routine ( e . g . โ€œ decoderfree_jpeg ( )โ€) to end the image processing is executed at step 214 , such as from a routine from the jpeg library . the i / o buffer allocation may be freed by the user at step 216 . the invention further improves a handheld device &# 39 ; s viewing performance by providing a high quality roi decoding feature , enhanced performance for larger jpeg images and an optimized codec from the usage model standpoint . an image may be subject to a dct domain low - pass filter , direct down sampling and small size bilinear resizing for a high quality but lower computation large image resizing . this provides a handheld device with higher quality images , while reducing the computation requirements when resizing , zooming and moving images , including larger images . to achieve this aspect , a jpeg roi decoding algorithm according to the invention decodes an roe region in the original image and rescales the roi of the image into a smaller size . this results in higher quality , lower computation and more accurate roi decoding . the roe decoding may be performed by subjecting the image data to a dct domain low - pass filter . after the filtering , the image data is subject to direct down sampling . smaller size bilinear resizing may then be applied to the data to create the image . as described above , the image data may be passed through a low - pass filter . the low - pass filter may be applied first to eliminate frequency aliasing . the jpeg dct coefficient may serve as the frequency analysis target . fig3 illustrates a graph of a frequency of a jpeg dct coefficient . a cutting frequency may be calculated from the resizing factor . the low pass filter is applied directly by setting the target dct coefficient to zero . next , a particular down sample approach is discussed . in an embodiment , the direct down sampling may be performed for row and column independently by a factor of โ…› , ยผ and ยฝ , for each mcu tile ( such as a 16 pixel by 16 pixel tile ) or an 8 ร— 8 dct block according to a row and column resizing factor , as shown in fig4 ( a ) , 4 ( b ) and 4 ( c ), respectively . while the invention uses a direct down sampling technique , it is understood that other down sampling techniques may also be used . fig5 ( a ) illustrates a graph of a frequency of a jpeg dct coefficient after down - sampling with no filtering . as illustrated , aliasing may occur at regions 510 and 520 . fig5 ( b ) illustrates a graph of a frequency of a jpeg dct coefficient after down sampling with filtering , generated according to the principles of the invention . when filtering is used prior to direct down sampling , aliasing may be reduced or avoided , thereby improving the image displayed . for each mcu , the direct down sampling may also require a resizing ratio , as the combination of passing the image data through a low pass filter and a direct down sampling may result in a value of half the dct coefficient . after the direct down sampling , the image size may be one or two times larger in one direction than the ultimate size . therefore , a bilinear interpolation or the like may be applied to resize the image to the ultimate image size . according to another embodiment of the invention , it is also desirable to avoid abrupt changes at boundaries of mcu tiles . this may be particularly important when padding or joining adjacent mcu tiles . fig6 illustrates a method of avoiding boundary break in padding delta regions of a new roi according to the principles of the invention . for each interpolating pixel , such as pixel 612 , an x offset and y offset may be the offsets to the nearest source integer pixel position , such as pixel 614 . this may be calculated from the original image , not from roi image . thus , the boundary interpolation factor may be continuous as the interpolation occurs based on the overall image and may not be hindered by mcu tile boundaries , such as the boundary 618 between mcu tiles 616 a and 616 b . according to an embodiment of the invention , to support an arbitrary move , a minimum destination roi region 620 may be 1 pixel by one pixel ( 1 ร— 1 ) in the proposed roi decoding method of the invention . fig7 illustrates how the decoder application adjusts or moves an roi of an image according to the principles of the invention . an initial roi 710 for a larger image ( not shown ) is defined . this roi may be calculated using principles of the invention based on instructions from a user , such as the selection of an roi of an image . the user defines a new roi 720 for an image . in this example , the new roi 720 partially overlaps with the initial roi 710 . the user may define a new roi 720 by , for example , manipulating controls of the hand held device to move a portion of the image being displayed . as shown , region b of the new roi 720 overlaps the initial roi 710 , while regions a and c of the new roi 720 are new . therefore , for the new roi 720 , the regions a and b may need to be decoded . the decoded information for the overlapped initial roi 710 is used along with the decoded information for the regions a and b within the new roi 720 . regions a and b then are padded or joined together , as discussed above , with the overlapping region c to form the new roi 720 . the invention provides for decoding an roi and then , upon moving or rotating the image and / or roi , maintains the information common to both the initial roi and the new roi and only processes the new areas . this reduces the processing required when changing the roi . by reducing processing , a roi image may be displayed with greater speed and less delay . thus , the invention may further enhance the decoder application &# 39 ; s performance for larger jpeg images . this may include optimizing codec usage for displaying the jpeg image . in addition , the invention may provide an improved , more user - friendly interface for the hand held device and ease code maintenance . to achieve this , an internal huffman index tree may be re - used for roi decoding , as well as for rotating images and thumbnails . in addition , this huffman index tree may be used for generating a thumbnail image to optimize the decoder application usage model . also , the invention may provide a more user - friendly api , as one code base may be needed to be maintained for all these jpeg processing features . the huffman tree index may use huffman coding . huffman coding is an entropy encoding algorithm used for lossless data compression . huffman coding may use a specific method for choosing the representation for each symbol , resulting in a prefix - free code that may express the most common characters using shorter strings of bits than are used for less common source symbols . a simple example of huffman coding is shown in fig9 which codes two reds and three blues 902 to generate a huffman tree 904 according to an embodiment of the invention , the decoder application usage model may perform image rotation only on a full image to speed rotation . image rotation may be first performed on the decoded raw yuv data . the rotate engine may be called when the user chooses to save the change . for faster zoom and movement of an image , a huffman tree may be built when a zoom , move or rotate function is to be applied to an image . future processing , such as when a further zoom , move , or rotate function is called , may be based on the already - built tree thereby improving performance by reducing processing . as described above , only a delta roi may be decoded during the image move . three directional moves ( i . e ., horizontal , vertical and diagonal moves ) may be supported during moving an roi for an image . when rotating an roi of a jpeg image according to the invention , the absolute value of a dct coefficient may remain unchanged after rotation , while the coefficient sign and location may change . the rotation algorithm may be carried out by building the huffman index tree from the input jpeg stream using known methods . then , for each destination minimum coding unit ( mcu ) tile a source mcu index is located according to the rotating pattern . the source mcu index provides information on how each mcu is rotated from its original position . for example , fig1 shows an exemplary mcu index that will associate a particular mcu with the amount of rotation from the original position of that mcu . thus , the coefficient of each position may be changed , thereby avoiding the need to perform an inverse dct calculation . the dct coefficient in an mcu tile may be changed according to a rotating pattern , and written to the destination jpeg stream . when the source image is rotated , the first pixel column becomes the first in the destination image . when the image is rotated , the huffman index tree is accessed to obtain the information for the first column . the coefficient is transposed in the first mcu , thereby rotating the image without needing to perform a dct calculation . for an image that includes partial mcu tiles i . e . when the image width or height is not aligned to the mcu boundary , it may not be possible to rotate in a lossless manner as the first data in the jpeg image is specified as unused . in such a case , the image may need to be cropped into the mcu boundary . for example , fig8 ( a ) , 8 ( b ), 8 ( c ) illustrate an image in fig8 ( a ) being rotated 90 degrees in the clockwise direction in fig8 ( b ) . the age is cropped in fig8 ( c ) to fit the mage to the mcu tile boundary . the processes described above may also be used in thumbnail image generation for the roi decoding with some modification . according to the invention , an image with a large number of pixels , e . g ., 1 , 000 ร— 1000 pixels , may be processed to create a thumbnail image . the output of the thumbnail image may be ycbcr raw data , and a typical thumbnail image size may be 80 ร— 80 . in such a situation , only a dc value is needed for each mcu . this dc value is used to form the smaller image , thereby reducing the processing needed . in addition , the resulting dc values may be subject to bilinear resizing to create the thumbnail image from the original image . although reference is made to a specific image data protocol , any image data protocol is within the scope of the invention . moreover , any future enhancement of a current protocol or any future protocol is contemplated for use with the invention . in accordance with various embodiments of the invention , the methods described herein are intended for operation with dedicated hardware implementations including , but not limited to , semiconductors , application specific integrated circuits , programmable logic arrays , and other hardware devices constructed to implement the methods and modules described herein . moreover , various embodiments of the invention described herein are intended for operation as software programs running on a computer processor . furthermore , alternative software implementations including , but not limited to , distributed processing , component / object distributed processing , parallel processing , virtual machine processing , any future enhancements , or any future protocol can also be used to implement the methods described herein . it should also be noted that the software implementations of the invention as described herein are optionally stored on a tangible storage medium , such as : a magnetic medium such as a disk or tape ; a magneto - optical or optical medium such as a disk ; or a solid state medium such as a memory card or other package that houses one or more read - only ( non - volatile ) memories , random access memories , or other re - writable ( volatile ) memories . a digital file attachment to email or other self - contained information archive or set of archives is considered a distribution medium equivalent to a tangible storage medium . accordingly , the invention is considered to include a tangible storage medium or distribution medium , as listed herein and including art - recognized equivalents and successor media , in which the software implementations herein are stored . while the invention has been described in terms of exemplary embodiments , those skilled in the art will recognize that the invention can be practiced with modifications in the spirit and scope of the appended claims . these examples given above are merely illustrative and are not meant to be an exhaustive list of all possible designs , embodiments , applications or modifications of the invention .
7
in accordance with the foregoing summary of the invention , the following presents the preferred embodiments of the present invention , which are considered to be the best mode thereof . fig1 is an elevation view of a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the lumbar reinforcement portion in an open , extended configuration . fig1 shows base outer base portion 1 and relatively flexible inner portion 2 , the inner portion moveably fixed to the outer base portion 1 so as to be able to be bowed away from the outer base portion as shown in this view . fig1 also shows inflatable air bladder 3 positioned between the inner portion 2 and the outer base portion 1 , and having an air conduit 4 adapted to reverseably inflate and deflate the air bladder 3 . fig1 also shows slots 5 and 6 through which pass bolts or screws 7 and 8 respectively with corresponding plastic washers 9 and 10 , to slidingly hold the outer base portion 1 and relatively flexible inner portion 2 in position . as bladder 3 inflates to expand along direction line a , the relatively flexible inner portion 2 bows so as to be drawn along direction line b . fig2 is an elevation view of the opposite side of a lumbar reinforcement portion shown in fig1 , in accordance with one embodiment of the present invention , again showing the lumbar reinforcement portion in an open , extended configuration with the same reference numerals used to indicate the parts thereof . fig3 is a front perspective view of a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the lumbar reinforcement portion in an open , extended configuration , with the same reference numerals used to indicate the parts thereof . fig4 is a side perspective view of a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the lumbar reinforcement portion in a closed configuration with the air bladder removed , with the same reference numerals used to indicate the parts thereof . if desired , the bladder 3 may be provided with a hook and loop pad 11 to hold it in place between the outer base portion 1 and the relatively flexible inner portion 2 , such as by providing a corresponding hook and loop pad ( not seen in the figure ) on the base portion 1 , to allow the bladder 3 to be inflated while the relatively flexible inner portion 2 may move freely with respect to the bladder 3 . fig5 is a side perspective view of a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the lumbar reinforcement portion in a closed configuration with the air bladder inserted , with the same reference numerals used to indicate the parts thereof . fig6 is a bottom plan view of a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the lumbar reinforcement portion in a closed configuration with the air bladder inserted , and with the same reference numerals used to indicate the parts thereof . this view also shows additional plastic washers 12 and 13 that may be used to secure bolts 7 and 8 to the outer base portion 1 . fig7 is a side perspective view of an air bladder 3 , as used in conjunction with a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the air bladder deflated . fig8 is a side perspective view of an air bladder 3 with hook and loop fastener 11 and hand pump bulb 14 that may be used in conjunction with a lumbar reinforcement portion in accordance with one embodiment of the present invention , showing the air bladder inflated . the conduit 4 typically is long enough to reach around the torso of the wearer to provide a convenient pumping of the bladder 3 while the brace is being worn . the hand pump bulb 14 may be removable with a valve at the end of the conduit , so that the hand pump bulb 14 may be removed from the brace after adjustment . fig9 is a representative view of a lumbar reinforcement portion 15 and a lumbal - sacral orthosis 16 having a pocket 17 into which a lumbar reinforcement portion may be inserted in accordance with one embodiment of the present invention . fig9 further shows lumbal - sacral orthosis 16 having a frontal portion 18 , strap 19 , and a pocket 17 adapted to receive lumbar reinforcement portion 15 . fig1 is representative view of a lumbal - sacral orthosis having a lumbar reinforcement portion in accordance with one embodiment of the present invention . fig1 shows lumbal - sacral orthosis 16 having a lumbar reinforcement portion 15 inserted into pocket 17 of lumbal - sacral orthosis 16 . fig1 further shows a lumbal - sacral orthosis having frontal portion 18 and strap 19 . the relatively rigid base portion may be made of a rigid plastic such as abs plastic , typically of a thickness greater than โ…› inch . the relatively flexible inner portion is typically made of a plastic more flexible than the relatively rigid base portion , such as ldpe and is preferably of a thickness less than or equal to that of the relatively rigid base portion , typically about 1 / 16 inch . some of the advantages of the present invention are that the brace provides several of the advantages of prior art braces , while also offering infinite customized adjustment of the brace within a range of movement of the device as provided by the dimensions of the outer base portion 1 and the relatively flexible inner portion 2 . the lumbar reinforcement of the present invention has the ability to provide lumbar support that is adjustable in terms of snugness and the degree of support to the lumbar portion of an orthotic brace . while the invention may be rendered in embodiments in many different forms , there have been shown in the drawings and described herein , in detail , the preferred embodiments of the present invention . it should be understood , however , that the present disclosure is to be considered an exemplification of the principles of the invention and is not intended to limit the spirit or scope of the invention and / or claims of the embodiments illustrated .
0
the disclosed methods and systems below may be described generally , as well as in terms of specific examples and / or specific embodiments . for instances where references are made to detailed examples and / or embodiments , it should be appreciated that any of the underlying principals described are not to be limited to a single embodiment , but may be expanded for use with any of the other methods and systems described herein as will be understood by one of ordinary skill in the art unless otherwise stated specifically . fig1 shows a schematic diagram 100 according to an embodiment of the present subject matter . a pressurized pipe 105 , which could be a water line or sewer line , or other type of transmission line including oil or gas , carries liquid under pressure through the pipe 105 . a pump 110 ( or also a series of pumps ) provides pressure at one end of the pipe to force the liquid through the pipe 105 . one or a multiple of pressure sensors 120 are placed at various positions along the pipe 105 , contact the liquid in the pipe 105 either directly or through a pressure - loss free connector , and continuously or periodically measure instantaneous pressure in the pipe 105 . the locations may be along the pipe , around the pipe , or both , and may create a functional form of location that optimizes the pattern recognition measurements from the sensors 120 . each pressure sensor 120 is has a communications connection 130 ( wired or wireless ) to an instrumentation unit 140 . while fig1 shows communications connection 130 in a wired configuration , the present disclosure also contemplate the communication connection in a wireless configuration . the instrumentation unit 140 may contain some or all of the following items : a power supply ; a ( micro ) processor ; an analog to digital ( a / d ) converter ; a digital clock ; a two - way wireless communications means such as a pager ; cell phone or other communications device ; software ; environmental packaging ( e . g . nema 6p ) and communications ports . of course , more or less items may be part of the instrument unit 140 , according to design preference . in certain embodiments , this instrumentation unit 140 has a power supply which for example without limitation may be a replaceable primary battery , as a non - limiting example , a lithium thionyl chloride battery package with long shelf life , connected to a separate environmental enclosure that contains the power electronics , the microprocessor , the a / d converter , and the wireless radio . the battery package may also be environmental , and may include circuitry that limits rapid discharge of the batteries in order to minimize or eliminate sparks if the battery is short - circuited , and may also include โ€œ smart - battery โ€ circuitry that continuously measures the effective discharge of the battery package and enables the lifetime of the batteries to be determined externally and remotely . the connection between the battery package and the electronics enclosure may be achieved through a rugged waterproof connector , typically one that is used , for example , in the automobile industry . other power sources may also be ac power , solar power , fuel cells , electromechanical power sources , or other power supplies . referring again to fig1 , data collection , data processing , and two - data communications processing takes place in the instrumentation unit 140 . communications means 150 is a two - way link between instrumentation unit 140 and a larger , more global communications network 160 , which may be a wireless network such as a cell phone or two - way pager network . communications means 170 is a two - way link between the communications network 160 and a local communications device 180 that typically would sit with a user , for example , a cell phone , two way pager , personal data assistant ( pda ), personal computer , or other capable one way or two way communications devices . the communications means 150 and 170 may comprise any form of wireless or wired communication protocol , device , mechanism , system , and so forth . thus , digital and / or analog transmissions can be used via the communications means 15 and 170 according the design implementation . depending on the resources available to the managing entity , various frequencies ( either singly or multiply ) may be used for communication information between the instrumentation unit 140 , communications network 160 and local communications device 180 . instrumentation unit 140 may operate in one or more of several modes . a first mode is an โ€œ alarm โ€ mode , in which the microprocessor in the instrumentation unit 140 makes a determination that the pressure profile from the single or multiple sensors has generated a unique signature indicating that a leak has occurred . in this mode , an alarm is sent through wired or wireless means 150 to a communications network 160 , which then further processes the data , for example determining the location from where the alarm originated and to where the alarm is to be sent , and sends this data via wired or wireless means 170 to a local two - way communications device 180 that allows the action to be taken to respond to a leak . it should be noted that the communications network 160 may be connected to the internet or other network resource . similarly , the communications device 180 may be connected to the internet or other network resource . connection to the communications network 160 and communications device 180 may also be facilitated via a host or local server , according to design implementation . in this instance , the server may act as a central server and may parse information from the various devices attached to the network . based on the โ€œ type โ€ of device communicating to the server , the server may forward different status or different priority messages or use a different communication means to forward information to the communications device 180 . accordingly , information warranting a rapid response may be sent via a page , versus information that does not require a rapid response , for example . in certain embodiments , the instrumentation unit 140 sends messages though a two - way paging network 150 , such as those operated by skytel ( clinton , mo . ), usa mobility ( plano , tex .) or space data ( chandler , ariz . ), as non - limiting examples of commercial / private providers , to a dedicated server 160 , which sends data through the internet to portable devices 180 such as pagers , cell phones , pdas , and so forth , and also posts this data on a secure web site to be viewed by users of the system , in which the communications devices 180 are computers with internet access . a second mode is a โ€œ reporting โ€ mode , in which pressure data is taken on a periodic basis from each of the pressure sensors 120 and stored in the instrumentation unit 140 . on a periodic basis , the instrumentation unit 140 spontaneously transmits the stored data through communication means 150 to the communications network 160 and finally through communications means 170 , to a user communications device 180 . a third mode is a โ€œ control โ€ mode in which commands may be sent in the โ€œ reverse โ€ direction from communications device 180 through the communications means 170 and network 160 to instrumentation unit 140 . these commands are processed by the microprocessor in instrumentation unit 140 and cause the instrumentation unit to modify some aspect of operations . examples of a control mode could include , without limitation : turning sensors on or off ; changing the frequency at which the sensors take pressure measurements ; changing the internal operating software of the instrumentation unit ; changing the frequency at which the instrumentation package sends historical data ; changing the algorithms that determine if a leak has occurred ; and changing the content of the data that is sent from the instrumentation unit periodically . a fourth mode is a โ€œ maintenance โ€ mode in which maintenance data representing environmental parameters such as , for example , temperature and humidity or operating parameters of the system , including , for example , pressure sensor 120 operations , power supply voltage , communications level ( e . g . received signal strength indicator ); and other diagnostic operation parameters are sent from the instrumentation unit 140 to the user communication device 180 on either an alarm basis or a periodic basis . a fifth mode is a โ€œ request โ€ mode in which a user , through the communications device 180 , may request current pressure , environmental , operational performance and / or maintenance parameter values or other data in the โ€œ reverse โ€ direction through communications means 170 to the communications network 160 , through another communications means 150 , finally to the instrumentation unit 140 . software in the instrumentation unit 140 can cause a real - time measurement of requested parameters and sends the results immediately back through the communications means to the data collection / reception device 180 . since indication that a leak has occurred or is occurring is one of the most important aspects , the means by which a leak is detected is a critical part in addressing this issue . two cases are considered : a static case in which the fluid in the pipe is quiescent ( not pumped ), and a second in which the fluid in the pipe is experiencing normal or typical pumping conditions . fig2 shows an example 200 of data generated by pressure sensors in a quiescent condition that may be used by instrumentation unit 140 to process pressure data received to make a determination that a leak has occurred in a pressurized pipe , such as a force main in a sewer system . consider pressured pipe 105 in fig1 that has a natural upward slope from the pump 110 . if the pump 110 were turned off for a period of time , the pressure as a function of time can be measured at various locations along the pipe , generating a graph 200 like that shown in fig2 . a pressure profile like that shown in 210 in fig2 indicates that there are no leaks , as the static pressure in the pipe stays constant over time . pressure profiles 220 and 230 could occur is there is a leak along the section of the pipe between the pressure sensors and the top of the pipe . in the case of pressure profile 200 , a leak is farther from the pressure sensors and higher on the pipe than a leak indicated by pressure profile 300 . by combining measurements from several pressure sensors , a small leak at a specific location can be identified . in addition , in some embodiments when the pumps are turned off , an active acoustic signal can be generated , and the signal analyzed using methods listed below to determine whether or not a leak exists in the pipe . fig3 shows an example 300 of data generated by a pressure sensor at a specific location on a pressurized pipe during periods of pumping . curve 310 corresponds to an example of how the pressure may vary over time under normal operating conditions , with no leak in the pipe . the maximum pressure is indicated by the horizontal line 315 . under leak conditions , a pipe will not be able to maintain the same pressure profile , and the leak will manifest itself in a pressure profile signature that is different than normal operating conditions . this signature will vary depending upon the location of the pressure sensor , the location of the leak , the pump ( s ) operational performance , and the hydrodynamic details of the pipe and hole causing the leak . as one simple example , the maximum pressure would drop under a leak condition . for example , curve 320 corresponds to a leak condition as measured by a pressure sensor . in this case , the curve has a somewhat different profile , but most markedly , does not have the same maximum value 325 as the non - leaking case . fig4 shows a schematic diagram 400 of how certain embodiments use multiple pressure sensors to make a decision about whether or not a leak is present . the pressure sensors 120 , per fig1 , are placed at various locations along the pipe 105 . baseline ( normal , non - leak ) measurements are made to determine the โ€œ pressure signature โ€ of the pipe 105 as a function of time , operating parameters and location along the pipe . the variability of these signatures is captured in the data collected by sensors 410 in fig4 . when a leak occurs , it creates a signature that is determined by the algorithm 420 to be significantly different enough from the baseline that an alarm is generated 460 and sent to a user , per the system shown in fig1 . various signal processing and pattern recognition techniques can be applied to this problem , including , but not limited to the following : least mean squares analysis of variance ( anova ) multiple analysis of variance ( manova ) matched filter ( s ) numenta neural networks bayesian analysis rules engine fourier / frequency analysis kalman filtering hamming filtering auto - correlation cross - correlation heuristic algorithms analysis of the dynamic pressure conditions may also include contemporary data collected directly from the pumps used to pressurize the pipe , in order to minimize false positives and increase the fidelity of the decision - making process . optimization of an applicable algorithm can be performed to reduce the number of false positives or false negatives . it should therefore be appreciated that given the teachings provided herein , one of ordinary skill may be able to monitor the integrity of a sealed transport systems , such as pressurized pipes , for example . as such , methods and systems have been disclosed that enable the described embodiments to be applicable for fluid conveying systems as well as gas conveying systems , or a combination of the two . also , while the context of the embodiments are described in terms of pipes , other vessels or conveying constructs may be used according to design preference . it should also be noted that while fig2 - 3 shown a certain pressure โ€œ profile ,โ€ other profiles may be relevant according to design . additionally , the methods and systems may be implemented by various devices . for example , the identification algorithm 420 of fig4 may be processed by a computer or hardware or analogy thereof . stand alone or distributed systems may be configured . single or multiple types of processing engines may be used , such as application specific integrated circuits ( asics ), digital signal processors ( dsps ), programmable logic devices ( plds ), microcontrollers , microprocessors and other forms of electronic or electrical devices capable of operating as a decision or execution engine . further , networking of such systems or hardware may be envisioned according to design implementation . in some embodiments , software for operation of the exemplary methods and systems may be integrated into the hardware platform , or may be distributed . accordingly , serial or parallel or a combination of the two , including neural or cloud computing approaches may be used . thus , communication between various aspects of the embodiments described herein may be hardwired or wireless , or combinations of the two . additionally , each or several of the various elements of the embodiments described may be contained in an environmentally secure enclosure . in some instances , the embodiments may have selective elements within the enclosure and selective elements outside the enclosure . for example , the pressure sensors may be exterior to the enclosure while the instrumentation unit 140 and / or the communications means 150 may be interior to the enclosure , for example . thus , elements that need to be protected can be protected via the environmental enclosure . as varied as the hardware implementation can be , modifications or variations of the software algorithm 420 may be similarly performed without departing from the spirit and scope . therefore , improvements to or combinations of the listed signal processing and pattern recognition techniques may be used , according to design implementation . as the listed techniques are not intended to exhaustive , but to illustrate the breath of applicable techniques , other techniques not described herein can also be used . what has been described above includes examples of one or more embodiments . it is , of course , not possible to describe every conceivable combination of components or methodologies for purposes of describing the aforementioned embodiments , but one of ordinary skill in the art may recognize that many further combinations and permutations of various embodiments are possible . accordingly , the described embodiments are intended to embrace all such alterations , modifications and variations that fall within the spirit and scope of the appended claims . furthermore , to the extent that the term โ€œ includes โ€ is used in either the detailed description or the claims , such term is intended to be inclusive in a manner similar to the term โ€œ comprising โ€ as โ€œ comprising โ€ is interpreted when employed as a transitional word in a claim .
6
turning to fig1 the device 11 for preparing hot beverages in a microwave oven shown therein has a lower coffee or tea carafe 10 . carafe 10 collects the finished brewed hot beverage , such as coffee or tea , and is preferably a pot with a handle 12 . a fresh water holder or reservoir 13 having a bottom 14 is attached on top of carafe 10 in a form - locking manner . reservoir 13 has a siphoning overflow pipe 15 which has an entry opening 16 located in the interior of reservoir 13 and which has an outlet opening 17 opening to the exterior through bottom 14 . siphoning overflow pipe 15 can function as an overflow or as a siphon . there is also a removable lid 18 on top of reservoir 13 . reservoir 13 is open to the atmosphere , and is ventilated by a vent in lid 18 or , alternatively , lid 18 can be placed on top of reservoir 13 in a manner which allows air to enter . in the preferred embodiment of fig1 outlet opening 17 of pipe 15 opens into an attached nozzle 19 which extends outwardly from bottom 14 of reservoir 13 . there is a filter holder 20 removably attached to the outwardly extending regions of nozzle 19 . the attachment can be made by a bayonet - or screw - type member . nozzle 19 includes a sieve 21 for spreading out the heated water from outlet opening 17 and for releasing the water into filter holder 20 . the bottom of filter holder 20 also has a plurality of outlet openings 22 . reservoir 13 rests , with a circumferential flange 23 , on top of an upper rim 24 of carafe 10 , preferably with an encircling seal 25 therebetween . in the supporting regions between reservoir 13 and carafe 10 there is at least one ventilation opening 26 in the form of a one - way valve through which air is vented to the exterior of carafe 10 , and into which no air can enter when reservoir 13 is in place on top of carafe 10 . at least one very small drip opening 27 is provided in bottom 14 of reservoir 13 in an area outside of the region of inlet opening 17 of pipe 15 and outside of the region of nozzle 19 . in use , the operation of the embodiment of fig1 is as follows . reservoir 13 is filled with the desired amount of fresh water . filter holder 20 is filled with an aromatics carrier or flavor - containing substance such as coffee or tea . conventionally , a paper filter can be placed in filter holder 20 which is then attached to nozzle 19 and reservoir 13 is placed on top of carafe 10 . the entire apparatus 11 is then placed in a microwave oven , which is turned on to heat the water in reservoir 13 . at the same time , the air in carafe 10 is warmed and , accordingly , expands . the warming of the air is chiefly a result of radiant heat from the walls of reservoir 13 . a small amount of water drips through drip opening 27 during the heating of the fresh water , and this small amount of water now in carafe 10 is also heated and vaporized by action of the microwaves . accordingly , in conjunction with the warming of the air , some of the air within carafe 10 escapes through ventilation valve 26 . the operating time of the microwave oven is selected so that the water in reservoir 13 is brought to the boil . after the microwave oven is turned off , a partial vacuum develops in carafe 10 , owing to the cooling down within carafe 10 and owing , in particular , to the condensation of the water vapor therein . in that manner , a pressure difference results between carafe 10 and reservoir 13 , with the pressure in carafe 10 being the lower of the two . given this pressure difference , the lower pressure in carafe 10 causes the heated water in reservoir 13 to be drawn over the highest point of pipe 15 into nozzle 19 and thus flow into filter holder 20 . the water - dividing sieve 21 ensures that the hot water is spread out evenly over the aromatics carrier received in filter holder 20 . after extraction of the aromatics , the heated water flows into carafe 10 as the finished hot beverage . reservoir 13 is almost entirely emptied of water through pipe 15 thanks to the action of the low pressure developed in carafe 10 . the hot beverage collected in carafe 10 can be consumed immediately after taking off reservoir 13 . after the brewing step , filter holder 20 can be removed from nozzle 19 and easily taken care of and cleaned . to shield the interior of filter holder 20 from the microwaves , filter carrier 20 is preferably made of metal or a metal - containing substance such as plastic . turning now to fig2 another preferred embodiment of the invention will be described . the preferred embodiment of fig2 differs from the preferred embodiment of fig1 chiefly in that reservoir 13 is constructed in an airtight manner . this airtight sealing is achieved by the provision of a seal 28 in the region of covering lid 28 on reservoir 13 . furthermore , the filter holder 20 is sealed off by a sealing ring 29 provided around the periphery of the nozzle 19 . an additional characterizing difference between the preferred embodiments of fig2 and fig1 is that the carafe 10 of fig2 can be filled with and emptied of air by means of , for example , a ventilating opening 26a in the upper region of the rim of carafe 10 for communicating the interior of carafe 10 with the atmosphere . in other respects the construction of the apparatus of fig2 is identical to that of fig1 . the operation of the preferred embodiment of fig2 differs from the operation of the embodiment of fig1 . as the reservoir 13 has an airtight seal , when the entire device with a full reservoir 13 is in an operating microwave oven , the water vapor derived from the heated water creates a pressure rise in reservoir 13 . this pressure causes the heated water to be forced through pipe 15 . as the heated water is forced out , the ever increasing space between the water surface and lid 18 is constantly completely filled with water vapor which supplies the necessary pressure for forcing the heated water out of reservoir 13 . the heated water is rapidly forced out of reservoir 13 thanks to the high pressure developed in reservoir 13 . however , the aromatics carrier placed in filter holder 20 gives rise to a certain amount of back pressure which acts against the flow of water streaming out of outlet 17 , by which the filter holder and the space above the filter holder in the area of nozzle 19 fills completely with water . in that manner , the hot water is continually forced back through the aromatics carrier to a certain extent , such being particularly useful for the brewing of coffee . since , owing to the use of pipe 15 , a complete emptying of reservoir 13 is practically impossible , there will always be water vapor present in reservoir 13 as long as the water dwelling in the reservoir 13 is being heated by microwaves . when the useful volume of water has been forced out of reservoir 13 , the microwave oven is shut off . the water vapor remaining in reservoir 13 then cools off very quickly and condenses , thus giving rise to a partial vacuum . as there is no longer water filling pipe 15 , air can be drawn back into reservoir 13 from vented carafe 10 until the pressure is the same as atmospheric pressure . a still further preferred embodiment is shown in fig3 . the operating principle of the fig3 embodiment is similar to that of the embodiment of fig2 . one difference between the embodiments of fig2 and 3 is the provision of an intermediate reservoir 30 between carafe 10 and reservoir 13 . intermediate reservoir 30 rests on carafe 10 , while reservoir 13 rests on intermediate reservoir 30 . intermediate reservoir 30 has an extension 19a to which a filter holder 20 is attached . reservoir 13 has an airtight seal in the region of lid 18 by means of a seal 28 in a manner analogous to the embodiment of fig2 . the volume of intermediate reservoir 30 is at least as large as the volume of reservoir 13 . in use , the heated water in the embodiment of fig3 is forced through pipe 15 as a result of the higher pressure developed in reservoir 13 when the device is heated in a microwave oven similarly to the embodiment of fig2 . the resulting hot water then collects within intermediate reservoir 30 at substantially atmospheric pressure thanks to the presence of the aromatics carrier in filter holder 20 that keeps the water from flowing out as quickly as it flows in . accordingly , the hot beverage is produced in a manner similar to the way in which manually operated devices work . it will be understood that the above description of the present invention is susceptible to various modifications , changes , and adaptations , and the same are intended to be comprehended within the meaning and range of equivalents of the appended claims .
8
fig1 is a perspective view of a system 10 for vibratory separating materials of different sizes and fig2 is a top view of system 10 . system 10 includes a stand 12 for supporting a hopper 11 for receiving the material to be separated and a vibratory screener 14 that is supported from stand 12 by a set of four cables and springs 16 that permit vibration of vibratory screener 14 while maintaining the vibratory screener 14 in a position to continually receive material from hopper 11 . a vibratory motor 15 is mounted on top of vibratory screen 14 to provide the necessary vibration forces to vibratory screener 14 . fig3 shows an isolated perspective view of the vibratory screener 14 and fig5 shows an end view of the vibratory screener 14 with the vibratory screener having a housing 21 comprising a trough or channel like shape and a top member 22 with the top member secured to housing 21 by bolts or the like to form an elongated channel 25 for dispensing materials there through . located on top of member 22 is a conventional vibratory motor 15 powered from a source ( not shown ). vibratory motors typically comprise a motor and a shaft with offset weights on the end of the shaft so that rotation of the shaft produces vibration . located in one end of top member 22 is an inlet 23 that allows material from hopper 11 to fall under the influence of gravity onto a receiving region in vibratory plate screen 30 . the receiving region 30 d is shown in fig6 and generally comprises a region that is void of screen openings and preferably extends a distance x so that as the material falls on to the screen from the hopper 11 it does not fall directly onto the screen openings , which could cause material compacting in the openings . however , if material compacting is not a problem in the delivery of materials to the vibratory screener 14 the receiving region could also contain screen openings . located on the opposite end of vibratory screener 14 is an outlet 24 for unscreened material and located at the bottom of vibratory screener 14 is an outlet 39 for material that has been screened by virtue of having fallen through a set of screen openings 30 e in vibratory plate screen 30 . fig4 shows an isolated view of vibratory screener 14 with the top member 22 removed in order to show the vibratory plate screen 30 mounted in an operational mode : fig6 shows an isolated top view of the vibratory plate screen 30 which is mounted in housing 21 . fig6 shows a vibratory plate screen 30 comprising a metal plate having a top wear surface 30 a , a first end 30 b for restraining in one end of housing 21 , a second end 30 c for fixedly securing to the opposite end of housing 21 and an intermediate section therebetween including a receiving region 30 d and a set of openings 30 e therein for screening material there through . a set of holes 30 g allows for insertion of a stud bolt or the like there through to allow vibratory screen 30 to be fixedly mounted in vibratory screener 14 . fig7 shows an alternate embodiment of a portion of a plate screen 33 that includes a set of openings 33 b with the openings 33 a extending to the edge of the plate screen . by having the openings extend to the edge of the plate screen 33 it ensures that materials will not flow along the sides of the screen and thus avoid the screening process . fig3 a shows an isolated view of a portion of the vibratory plate screen 30 to show a stud bolt 35 extending through screen opening 30 g in screen second end 30 c to fixedly hold the vibratory screen 30 in housing 21 . in operation the operator secures stud bolt to member 37 to hold the end of vibratory screen 30 in position . although a stud bolt is shown other means of fixedly fastening the vibratory plate screen can be used . in the embodiment shown in fig4 the first end 30 b is restrained in vibrator housing 21 through coaction of a set of rails and the sidewalls 21 a and 21 b of housing 21 . fig4 shows the housing sidewalls 21 a and 21 b and one rail 29 . rail 29 comprises a cross rail that extends from side to side of housing 21 to restrain vibratory plate screen end 30 b from vertical displacement . the second end 30 c of vibratory plate screen 30 is fixedly secured to a cross member 37 ( see fig4 ) by stud bolts 35 . to illustrate the underside peripheral rail support for vibratory plate screen 14 reference should be made to fig8 to fig1 b . fig8 shows a top view of vibratory screen housing 21 without the top member 22 and without the vibratory plate screen 30 . located along side 21 a of housing 21 is a curved side rail 40 and located along the opposite side 21 b of housing 21 is a second curved side rail 41 . rail 40 and 41 extend along the sides of housing 21 and are fixedly secured thereto to become side peripheral rail supports for the under side of vibratory plate screen 30 . the top cross rail 29 which extends along the end of housing 21 and side rails 40 and 41 comprise a set of rails for restraining vibratory plate screen 30 . to fixedly secure the end 30 c of vibratory plate screen 30 housing 21 includes a cross member 37 having threaded openings 37 a therein for receiving a stud bolt or the like . fig1 shows a sectional view taken along lines 10 - 10 if fig8 to show support rail 40 secured to housing 21 with the rail 40 having a top rail support surface 40 b with a set of recesses 40 a therein . rail 40 provides peripheral side support for one side of vibratory screen 30 . similarly , the rail 41 , which is secured to the opposite side of housing 21 , provides a peripheral side support for the opposite side of vibratory screen 30 . fig1 shows an isolated side view of rail 40 showing that rail 40 is provided with a curvature r and a top surface 40 b with a set of recess 40 a located along at least a portion of the top surface . similarly , fig1 a shows an isolated top view of rail 40 which has a planer side 40 c for securement to the inside side of the vibratory n housing 21 as shown in fig1 . as the rail 41 for the opposite side of housing 21 is identical it is not shown in detail . fig9 shows the positioning of the rail recess 40 a with respect to openings 30 e in the vibratory screen 30 in a position that inhibits material from adhering to the vibrator housing 21 . in the embodiment shown the recess 40 a on the rails are aligned with openings 30 e in the screen so that material that falls through screen 30 will have a passageway to the discharge chute 39 . the support for vibratory plate screen 30 allows vibratory plate screen 30 to be made with openings that extend from side to side of the vibratory plate screen 30 . one of the features of the invention is the quick mounting of the vibratory plate screen 30 . since vibratory screens are subject to wear as the materials are vibrated thereon the vibratory screens needs to be replaced from time to time . in the present invention one can quickly remove an old vibratory screen and replace it with a new vibratory screen . fig1 a shows how end 30 b of vibratory plate screen 30 is inserted or slid beneath a top cross rail 29 that extends from side to side of housing 21 while using the side rails 40 and 41 as guides . fig1 b shows the end 30 b of vibratory plate screen 30 supported vertically by rail 40 and top rail 29 . while the end 30 b can be slid in or out of the spacing between rails 29 a the screen 30 is restrained from lateral movement by the sides of housing 21 and from vertical movement by the rail 29 . a further feature of the invention is the rail support of vibratory plate screen 30 that allows removable fasteners on end 30 c to secure the vibratory plate screen in fixed position during vibratory screener . the rails allow for removal and replacement of the vibratory plate screen 30 through the open end or outlet 24 of housing 21 . that is , the stud bolts 35 are located at a discharge outlet 24 and are accessible to an operator . once the stud bolts 35 are removed one can slide the vibratory plate screen 30 out of the housing 21 since the set of rails do not longitudinally restrain vibratory plate screen therein . a further feature of the invention is the stress mounting of the vibratory plate screen 30 to ensure that the vibratory plate screen dynamically moves back and forth with the vibrations induced in the vibratory housing 21 . a reference to fig1 shows a curvature r to the rail 40 and a reference to fig6 a shows a side view of vibratory plate screen 30 in a planar or flat condition with essentially an infinite radius of curvature . thus there exists a difference in the radius of curvature of the side rail supports and the vibratory plate screen 30 . in the stress installation mounting of the end 30 b of vibratory plate screen 30 , which has a first radius of curvature that is different from the radius of curvature of the rails , the end 30 b is inserted beneath rails 29 as shown in fig1 a . next , the operator grasps the end 30 c of vibratory plate screen 30 and with a downward force on the topside of vibratory screen 30 forces screen 30 against cross member 37 ( see fig8 ) bringing the radius of curvature of the vibratory plate substantially equal to the radius of curvature of the side rails . this produces stress in vibratory plate screen causing the cross rail 29 and the side rails to vertical restrain the vibratory plate screen . once in the stress mounting position the side rails 40 and 41 provide vertical peripheral side support and the sides of housing 21 namely , 21 a and 21 b can assist in laterally restraining screen 30 . when the vibratory screen 30 is in forced to conform to the curvature of side rails 40 and 41 the stud bolts 35 are inserted through openings 30 g ( see fig6 ) and into the member 37 a ( see fig8 ) to secure the vibratory plate screen 30 in a flexed or curved condition in housing 21 . while a stress mounting of the vibratory plate screen 30 has been shown it should be understood that the vibratory plate screen could also be secured without stress mounting . thus with the use of removable fasteners on only one end of the vibratory screen 30 the vibratory screen can be brought into a fixed support in housing 21 . that is , as the vibratory screen is subject to vibration and shaking it is necessary to hold the screen firmly in position in the housing . by use of a rail on one end and on the sides , which combined with the stress , mounting of the screen 30 allows the screen 30 to be firmly held in position by fasteners located only at the discharge end of the screen 30 . once the screen is in position the vibratory motor 15 shakes or vibrates the vibratory screener 14 thus causing materials to flow along the vibrator 25 in the vibratory screener 14 with the smaller sized materials falling through screen 30 and the larger materials flowing along the screen 30 and discharge from the outlet 24 . thus the invention includes a two phase method of mounting a vibratory plate screen in a vibratory housing comprising the steps of slideably positioning a first end 30 b of the vibratory plate screen 30 into engagement with a set of rails 29 , 40 and 41 on the vibratory screener housing 21 ; and fixedly securing a second end 30 c of the vibratory plate screen 30 to the vibratory screen housing 21 . in addition by applying a face force i . e . a force perpendicular to the second end 30 c of the vibratory plate screen while restraining the first end 30 a with the set of rails one can bring the second end into a securable position . to provide for ease installing the vibratory plate screen the step of restraining the first end includes inserting the first end beneath an end rail 29 which is spaced sufficiently far apart from the side rails 40 and 41 so as to form a snug but non - interference fit there between . thus in one embodiment the vibratory plate screen comprises a plate having a top wear surface 30 a , a first end 30 b , a second end 30 c and an intermediate region with openings 30 e therein for screening material therethrough with the first end 30 b slideably engageable with a vibratory housing rail 29 and the second end 30 c fixedly securable to a vibrator housing 21 to thereby secure the vibratory plate screen 30 in an operational mode . by forming the screen from a flat metal plate the vibratory plate screen can include a top surface 30 a of the vibratory plate screen which lies in a single plane with the vibratory plate screen free of protrusions . thus , the vibratory plate screen has a first radius of curvature but is sufficiently flexible so as to flex into a second radius of curvature when secured to a vibratory housing .
1
it should be understood that occasional reference herein to the optically functional layer as a &# 34 ; top coat &# 34 ; or the like , is for ease of discussion and understanding , especially taken in conjunction with the drawings wherein the optically functional layer is illustrated as a mono - film in a &# 34 ; top &# 34 ; position . it is not intended , however , to limit the optically functional layer to one exposed to the atmosphere or otherwise necessarily occupying a &# 34 ; top &# 34 ; position . thus , for example , in certain embodiments of the invention additional layers , for example protective layers , may cover the optically functional layer . in other embodiments the coated surface may be laminated to a second ply of the glazing article . anti - iridescence undercoats of the present invention are applicable both to provide a colorless appearance for a coated substrate , and , in the alternative , to provide a single , substantially uniform , muted , perceptible color in the glazing article . based on the present disclosure , selection of refractive indices and film thicknesses to achieve one or the other of these results , along with determining other optical features and properties of the finished product can be readily determined empirically by those skilled in the art or , for example , by employing a commercially available optics prediction software program . such programs , typically run on commercially available computer systems , are well known to greatly facilitate close approximation of an optimized final commercial product . typically , a graphic presentation of the optical properties of a given glazing article , sorted by individual layer thickness and refractive index , can be used to determine the regions of optimum film stack design . in particular , such graphic representation can assist in readily identifying industrially robust film stack designs of the present invention . that is , designs in which performance is tolerant of variations in film thickness , refractive index and other parameters normal during industrial production of coated glazing articles . referring specifically to fig1 a substantially transparent glazing article 10 is seen to comprise a glass substrate 12 having coating 14 carried on its upper surface 16 . the glass substrate 12 preferably is soda - lime glass having a refractive index of about 1 . 5 . the glazing article may , for example , be adapted for use in an architectural glazing application or the like . those skilled in the art will recognize that substrates alternative to glass will be suitable , although certain methods of forming coating 14 , such as pyrolytic deposition , may be unsuitable for certain alternative substrate materials , for example , certain plastic substrates . the coating 14 comprises an optically functional layer 18 having a higher refractive index than the substrate . layer 18 is exposed to the atmosphere . according to the preferred embodiment of fig1 the coating provides optical functionality including low emissivity and infrared and ultraviolet reflectivity . preferably , optically functional layer 18 is about 2 , 000 to 10 , 000 angstroms thick . more preferably the optically functional layer is about 2 , 000 to 5 , 000 angstroms thick , most preferably about 3 , 500 to 4 , 000 angstroms thick , having an average refractive index ( over the visible wavelength range ) of about 1 . 7 to 2 . 5 , more preferably about 1 . 9 to 2 . 1 , most preferably about 1 . 9 ( measured at 550 nm wavelength ). such preferred materials for the optically functional layer 18 include , for example , tin oxide , fluorine doped tin oxide and other metal oxides of suitable refractive index . according to a most preferred embodiment , layer 18 consists essentially of fluorine doped tin oxide having a refractive index ( average ) of 1 . 9 . in such embodiment layer 18 is substantially transparent , that is , it is substantially transparent ( within the context of its intended use ) to visible light . it also provides infrared reflectivity and ultraviolet reflectivity for solar load control . in addition , it has good electrical conductivity and could be used , therefore , for applications including electrical resistance heating , etc . the high / low / high refractive index sandwiching feature of the invention is especially effective in use under an optically functional layer consisting of fluorinated tin oxide in certain distinct thickness ranges : 2500 - 3000 angstroms , 3500 - 4000 angstroms and 4800 - 5200 angstroms . tolerance to thickness variations is especially good for fluorinated tin oxide in the first two ranges . approximately the same preferred thickness ranges apply to unfluorinated tin oxide . in general , the terms &# 34 ; tin oxide &# 34 ; and &# 34 ; sno 2 ,&# 34 ; as used hereinafter , mean both fluorinated and unfluorinated tin oxide , unless otherwise specified . such preferred embodiments of the invention are particularly advantageous for use in insulated glazing units and like applications . insulated glazing units include those with multiple panes having an air gap between adjacent panes . in a two pane glazing unit , taking the outside surface of the outer pane as the no . 1 surface , its inside surface ( i . e ., the surface facing the air gap ) as the no . 2 surface , the outside surface of the inner pane ( again , facing the air gap ) as surface no . 3 , and the inside surface of the inner pane as the no . 4 surface , a coating of the invention according to such preferred embodiments would preferably be on the no . 3 surface in a colder climate ( such as northern u . s .) and on the no . 2 surface in a warmer climate ( such as southern u . s .). in a triple glazed unit , the coating preferably is on the no . 2 surface in a warmer climate and on the no . 5 surface ( the air gap side of the innermost pane ) in a colder climate . according to another highly preferred embodiment of the invention , glazing article 10 is adapted for architectural glazing purposes and the coating 14 is a low emissivity coating in which layer 18 consists essentially of fluorinated tin oxide , having a thickness between about 3 , 500 and 4 , 000 angstroms . in conjunction with the preferred anti - iridescence layer described below , the resulting glazing article is substantially colorless in both reflected and transmitted light . that is , the visible iridescence which would otherwise be shown by such glazing article is eliminated without substantially impairing the optical properties of the coating . specifically , the low emissivity property of the tin oxide or fluorine - doped tin oxide layer is not significantly reduced or impeded by the anti - iridescence layer . it is a significant advantage of preferred embodiments of the invention that anti - iridescence is achieved with such thin optically functional films . as noted above , certain prior art teaching has recommended the use of thicker films to avoid iridescence , although this involves several disadvantages , including a greater tendency toward thermal stress cracking , longer ( and , hence , more costly ) deposition periods , greater loss of transparency , etc . it will be recognized by those skilled in the art in view of the present disclosure that numerous alternative optically functional layers can be employed in lieu of , or together with , the tin oxide layer 18 of the above discussed preferred embodiment of the invention . particularly advantageous alternative materials include , for example , zinc oxide , titanium oxide , indium tin oxide , antimony doped tin oxide , and tungsten oxide . the optically functional layer 18 also may be a composite of multiple films and may not be exposed to the atmosphere , as noted above . thus , for example , the aforesaid low emissivity film may be provided with an overcoating of protective material , such as silicon dioxide , etc . those skilled in the art will recognize innumerable additional and alternative films which may be used together with the main film of the optically functional layer 18 including adjunct films such as , for example , abrasion resistant films , color imparting films , and the like . with respect to coating 14 not being exposed to the atmosphere , it may be positioned at an interface between laminated plies of a glazing article . alternatively , it may be employed on an inside surface of a transparent substrate used in a double glazing article , such that the coating is exposed to a vacuum or air gap between two spaced plies . coating 14 further comprises anti - iridescence layer 20 which substantially eliminates the visible iridescence which would otherwise show , particularly in viewing sunlight reflected from the coated surface . the anti - iridescence layer 20 eliminates visible iridescence while not significantly impairing the optically functional film &# 39 ; s desirable properties discussed above , including most notably its visible transparency , infrared reflectivity , ultraviolet reflectivity and low emissivity . layer 20 is less thick than the optically functional layer 18 , preferably being about 400 to 1 , 300 angstroms thick , more preferably about 700 to 1 , 000 angstroms . in the preferred embodiment of fig1 it consists essentially of a low refractive index zone sandwiched between two high refractive index zones . high refractive index zone 22 is deposited directly on surface 16 of glass substrate 12 . it should be understood that description of a layer or zone as being deposited &# 34 ; directly &# 34 ; on or over another surface or another layer is intended to mean that it forms an interface with such layer or surface without any other layer of zone intervening between them . in the preferred embodiment illustrated , anti - iridescence layer 20 is positioned directly on surface 16 and directly under layer 18 . as used herein , this is intended to mean there is no thin film coating or the like mediate the anti - iridescence layer 20 and the substrate 12 . thus , surface 16 is a surface of the bulk material of substrate 12 , rather than of some other coating material deposited onto substrate 12 prior to deposition of coating 14 . similarly , anti - iridescence layer 20 is positioned directly under optically functional layer 18 in the sense that there is no mediate film or coating between them . high refractive index zone 22 preferably is about 100 to 500 angstroms thick , more preferably 100 to 300 angstroms thick . it is a significant feature of the embodiment of fig1 in accordance with general principles of the invention discussed above , that first zone 22 has a refractive index higher than that of the substrate 12 . for a substrate of soda - lime glass or other material having a refractive index about 1 . 5 , the refractive index of zone 22 is higher than that of glass substrate 12 . the refractive index of zone 22 preferably is between about 1 . 6 and 2 . 5 , more preferably 1 . 9 to 2 . 1 , most preferably about 1 . 9 . suitable materials for high refractive index zone 22 are readily commercially available and will be apparent to those skilled in the art in view of the present disclosure . tin oxide , having a refractive index of 1 . 9 , is most preferred for zone 22 in the above mentioned low emissivity embodiment of the invention employing a glass substrate 12 and a tin oxide ( optionally fluorinated ) optically functional layer 18 . suitable materials for high refractive index zone 22 are listed in table a below . table a______________________________________coating materials with high refractive index refractivematerial formula index______________________________________tin oxide sno . sub . 2 1 . 9silicon nitride si . sub . 3 n . sub . 4 2 . 0silicon monoxide sio about 2 . 0zinc oxide zno 2 . 0indium oxide in . sub . 2 o . sub . 3 2 . 0vanadium oxide v . sub . 2 o . sub . 5 about 2 . 0tungsten oxide wo . sub . 3 about 2 . 0niobium oxide nb . sub . 2 o . sub . 5 2 . 1tantalum oxide ta . sub . 2 o . sub . 5 2 . 1zirconium oxide zro . sub . 2 2 . 1cerium oxide ceo . sub . 2 2 . 2zinc sulfide zns 2 . 3titanium oxide tio . sub . 2 2 . 5______________________________________ in the preferred embodiment of the invention illustrated in fig1 a first gradient step zone above high refractive index zone 22 is low refractive index zone 24 positioned directly on high refractive index zone 22 . a second gradient step zone , high refractive index zone 26 , is positioned directly on low refractive index zone 24 , directly under optically functional film 18 . thus , low refractive index zone 24 is sandwiched between higher refractive index zones 22 and 26 . zones 24 and 26 together preferably have a thickness in the range of about 300 to 800 angstroms . in the preferred embodiment illustrated in fig1 each of zones 24 and 26 most preferably is about 100 to 400 angstroms thick . the refractive index of low refractive index zone 24 preferably is between about 1 . 0 and 1 . 9 , more preferably between about 1 . 4 and 1 . 7 . it need only be sufficiently below that of high refractive index zone 22 to establish an optically functional refractive index gradient step . thus , in the preferred low emissivity embodiment referred to above , it need only be sufficiently below the refractive index 1 . 9 of the tin oxide preferably used in zone 22 . preferably , however , the refractive index of zone 24 also is lower than that of the substrate . this is found to provide in the finished product excellent anti - iridescence functionality even with the extremely thin zone thicknesses recited above . in the preferred low emissivity embodiment referred to above , low refractive index zone 24 consists essentially of silicon dioxide , sio 2 , having a refractive index of about 1 . 44 . alternative materials are readily commercially available and will be apparent to those skilled in the art in view of the present disclosure . materials suitable for low refractive index zone 24 are listed in table b below . table b______________________________________coating materials with low refractive index refractivematerial formula index______________________________________aluminum oxide al . sub . 2 o . sub . 3 1 . 65silicon dioxide sio . sub . 2 1 . 44silicone polymer [( ch . sub . 3 ). sub . 2 sio ]. sub . n 1 . 4magnesium fluoride mgf . sub . 2 1 . 38cryolite na . sub . 3 alf . sub . 6 1 . 33______________________________________ the change in the value of the refractive index from each gradient step zone to the next should be at least about 0 . 1 , more preferably at least about 0 . 2 . in addition , the step must involve a zone or film thickness sufficient to function as a substantially discrete film . preferably , each such step or change involves a film thickness of at least about 100 angstroms . those skilled in the art will recognize that all industrial deposition methods involve the creation of a region of some thickness wherein the change from one zone to the next occurs . the change or step in the context of the present invention from one gradient step zone to the next is sufficiently sharp , taking the refractive index change in conjunction with the thickness of the film , that the optical properties of a substantially discrete refractive index step ( either from high to low or low to high , as the case may be ) is achieved . preferably , the refractive index of zone 26 is between about 1 . 55 and 1 . 75 . most preferably it is about 1 . 65 . suitable materials for high refractive index zone 26 are readily commercially available and will be apparent to those skilled in the art in view of the present disclosure . according to the highly preferred low emissivity embodiment referred to above , having a glass substrate and employing tin oxide for layer 14 and zone 22 , zone 24 is about 100 to 400 angstroms consisting essentially of silicon dioxide having a refractive index of about 1 . 44 , and zone 26 is about 100 to 400 angstroms consisting essentially of either aluminum oxide , al 2 o3 , or an homogenous composition of silicon dioxide and tin dioxide , sio 2 / sno 2 , having a refractive index of about 1 . 65 . additional suitable materials include , for example , blends of materials listed in table a and table b , above . it will be apparent to those skilled in the art in view of the present disclosure that if a material having a relatively higher refractive index is employed for the low refractive index film , i . e ., the first gradient step zone , such as aluminum oxide having a refractive index of about 1 . 65 , then a material having an even higher refractive index must , of course , be selected for zone 26 . it will be appreciated from the above description that in at least one preferred embodiment of the invention , as illustrated in fig1 all layers of coating 14 are formed of tin oxide , silicon dioxide , or a mixture of the two . significant processing advantage can be achieved employing so few materials in the formation of the coating . several processes for forming the coatings of the present invention are readily commercially available and are well known to those skilled in the art . preferred processes for depositing the anti - iridescence layer 20 and the optically functional layer 18 , include , for example , vacuum sputtering , sol - gel , and pyrolytic deposition , including spray pyrolysis and chemical vapor deposition . it should be recognized that the refractive index of the materials employed in the layers of the coating of the present invention may vary slightly depending on the method used in their deposition . referring now to fig2 a second preferred embodiment of the invention is illustrated . specifically , substantially transparent glazing article 50 comprises a substantially transparent glass substrate 52 . substantially transparent coating 54 is carried on surface 56 of glass substrate 52 . the coating 54 comprises an optically functional layer 58 exposed to the atmosphere and an anti - iridescence layer 60 mediate the substrate 52 and the optically functional layer 58 . as in the case of the embodiment of fig1 the anti - iridescence layer 60 can be employed to eliminate visible iridescence from the thin film coating , resulting in either a colorless appearance or providing a single , substantially uniform , muted , slightly perceptible color . in either case , the anti - iridescence layer performs such function without substantially impeding or preventing the desirable optical properties of the optically functional layer 58 , including visible transparency , infrared reflectivity , ultraviolet reflectivity , low emissivity , and / or electrical conductivity , depending on the particular optically functional layer employed in the coating . preferably the optically functional layer 58 is a low emissivity layer of tin oxide or the like having a thickness of about 0 . 7 microns . according to certain preferred embodiments , coating 54 is a substantially transparent , low emissivity coating wherein optically functional layer 58 is about 2 , 000 to 10 , 000 angstroms thick , more preferably between about 2 , 000 and 5 , 000 , most preferably between about 3 , 500 and 4 , 000 angstroms thick , having a refractive index ( over the visible wavelength range ) between about 1 . 7 and 2 . 5 , most preferably about 1 . 9 ( measured at 550 nm wavelength ). suitable materials for layer 58 include those described above for optically functional layer 18 of the embodiment of fig1 . most preferred is a tin oxide layer having a refractive index of about 1 . 9 and a substantially uniform thickness of about 3 , 500 to 4 , 000 angstroms . layer 60 in the embodiment of fig2 consists essentially of a high refractive index zone 62 directly on surface 56 of glass substrate 52 followed by four gradient step zones . layer 60 is less thick than low emissivity layer 58 . the refractive index of zone 62 is higher than that of the substrate 52 , preferably being between about 1 . 6 and 2 . 5 , most preferably being about 1 . 9 . materials described above for high refractive index zone 22 in the embodiment of fig1 are suitable also for high refractive index zone 62 in the embodiment of fig2 . the preferred thickness of high refractive index zone 62 is between about 100 and 500 angstroms , more preferably between about 100 and 300 angstroms . tin oxide is highly preferred for zone 62 in view of its high refractive index of about 1 . 9 , its transparency , ease of uniform deposition , environmental stability , and compatibility with other preferred materials of the glazing article . a first gradient step zone , low refractive index zone 64 , is deposited directly on high refractive index zone 62 . suitable materials for low refractive index zone 64 include those described above for low refractive index zone 24 of the embodiment of fig1 . preferably zone 64 has a refractive index between about 1 . 0 and 1 . 9 , more preferably between 1 . 4 and 1 . 5 , most preferably being about 1 . 44 . the thickness of zone 64 preferably is between about 100 and 400 angstroms . most preferred is a layer of silicon dioxide having a refractive index of about 1 . 44 and a substantially uniform thickness between about 100 and 400 angstroms . low refractive index zone 64 is sandwiched directly between high refractive index zone 62 and a second high refractive index zone , second step gradient zone 66 . the second high refractive index zone in the embodiment of fig2 is followed by two additional gradient step zones 68 and 70 , each having a refractive index higher than the preceding zone . specifically , zone 66 is deposited directly on low refractive index zone 64 and has a refractive index higher than that of zone 64 . thus , in the preferred embodiment wherein low refractive index zone 64 has a refractive index of about 1 . 44 , zone 66 has a refractive index between about 1 . 5 and 1 . 6 , most preferably having a refractive index of about 1 . 55 . suitable materials for zone 66 include any of numerous blends of materials from table a and table b above . preferably the thickness of sub - zone 66 is between about 100 and 400 angstroms in thickness . the next gradient step zone , zone 68 , is deposited directly on zone 66 and has a refractive index higher than that of zone 66 . preferably , the refractive index of zone 68 is between about 1 . 6 and 1 . 7 , most preferably being about 1 . 65 . the thickness of sub - zone 66 is preferably between about 100 and 400 angstroms . suitable materials include those recited above for second high refractive index zone 26 of the embodiment of fig1 including aluminum oxide and a blend of silicon dioxide and tin oxide , the latter being preferred in view of its ease of deposition , transparency , compatibility with other materials in the preferred embodiment , and commonality of materials . finally , the last gradient step zone , zone 70 , is deposited directly on zone 68 and is directly under optically functional layer 58 . it has a refractive index higher than zone 68 and lower than layer 58 , preferably being between about 1 . 7 and 1 . 8 , most preferably being about 1 . 75 . suitable materials are readily commercially available and will be apparent to those skilled in the art in view of the present disclosure . preferred materials include blends of materials listed in table a and table b , above . as in the case of the embodiment of fig1 coating 54 can be formed by any of various commercially known and used deposition methods , including sputtering , spray pyrolysis , sol - gel , and chemical vapor deposition . the following example illustrates production of a preferred embodiment of the invention . soda - lime float glass is heated to about 600 ยฐ c . in a laboratory belt furnace . a gaseous mixture consisting of 7 . 0 % difluoroethane , 0 . 4 % water , 0 . 4 % tin tetrachloride and the balance nitrogen is passed over the heated glass resulting in deposition of a tin oxide film approximately 270 angstroms thick . the tin tetrachloride and water vapor are kept separated until just prior to reaction . a second film of silicon dioxide is deposited over the tin oxide film by passing a gaseous mixture consisting of 0 . 4 % silane , 60 % oxygen and the balance nitrogen over the heated glass . the second film is approximately 140 angstroms thick . a third film of aluminum oxide is formed by passing a gaseous mixture of 0 . 1 % diethylaluminum chloride , 10 % nitrous oxide and the balance nitrogen over the heated glass . the reactants are kept separate until just prior to reaction . the thickness of this layer is approximately 170 angstroms . a thick layer of tin oxide , approximately 3 , 500 angstroms thick , is formed by passing a gaseous mixture over the glass which has the same composition as the gaseous mixture used for the first tin oxide film . the resulting product has a color purity of about 3 % and an infrared emissivity of about 0 . 2 . it will be understood by those skilled in the art in view of the present disclosure that the foregoing discussion of certain preferred embodiments is intended for purposes of illustration , rather than limitation . various modifications will be readily apparent in view of the present disclosure and the following claims are intended to cover the full scope of the invention , including all such apparent modifications .
8
fig1 shows an overhead view of a base plate 10 of a carbon brush holding device , which may be made , for example , of plastic , such as a thermoplastic . the base plate 10 is equipped with a disc - shaped ground wall 12 with a partition wall 14 that projects from this base , and a margin or side wall 16 that extends around the circumference of the base , with an inner step 17 that extends along the edge . on the side wall 16 , centered over the step 17 , an element such as a centering element 18 of a motor casing 80 , for example , can be placed upon the base plate 10 , which in this case is pot - shaped ; this centering element is connected to or extends from a motor casing , or is a part of the motor casing . this serves to protect the elements taken up in the base plate 10 and the motor casing 80 . the centering element 18 is also equipped with a centering notch 19 . the base plate 10 is equipped with a central boring 20 , through which an armature shaft that is equipped with a commutator , not illustrated here , can be inserted . in the exemplary embodiment , a total of four carbon brushes 22 are directed toward this , which can be connected via electrical conductors 24 to a voltage supply . in addition , the circuitry for the carbon brushes 22 may be connected as desired , in accordance with the prior art . this will be limited , however , to sufficiently known - in - the - art constructions and designs . in order to mount the carbon brush holder or the brush holders , and to direct the carbon brushes 22 toward the commutator bars of a commutator or a slip ring , the carbon brushes 22 are first pulled back to a retracted position , each in its own carbon brush guide 28 , via a retaining element 26 . this serves to ensure that when the base plate 10 is pushed over to the armature shaft , the carbon brushes 22 will not collide with the commutator or the slip rings . as the detailed diagrams in fig4 and 5 show , the retaining element 26 is comprised of an element that can be shifted within a guide that is formed from two parallel partitions 30 , 32 that extend outward from the ground wall 12 ; this element โ€” as is clearly shown in the overhead view in fig1 โ€” is rectangular in its cross - section , and , as is shown in the side view of fig4 and 5 , comprises a base section 36 from which extend a first section 40 that reaches to the upper , open edge 38 of the side wall 16 , and a cylindrical or pin - shaped extension 42 that extends parallel to the first section ; the cross - section of this extension corresponds to that of a recess 44 at the back of the carbon brush 22 . this provides the possibility that when the pin - shaped extension 42 is engaged in the recess 44 in the carbon brush 22 , in the manner of a pocket hole , the carbon brush 22 will be retracted against a spring element that is exerting pressure on the brush in the direction of the commutator or slip ring , like a scroll spring 46 . opposite the first section 40 and the pin - shaped extension 42 there extends from the base section 36 a second leg 47 that is rectangular in its cross - section , and that extends within the guide 34 , which runs perpendicular to the flat piece that is mounted on the ground wall 12 . within the guide 34 , in other words between the ground wall 12 and the second section or leg 47 of the retaining element 26 , is a spring element 48 , via which the retaining element 26 exerts a force in the direction of the upper , open edge 38 , that is , in the direction of the carbon brush 22 . if , in keeping with the illustration in fig4 the pin - shaped extension 42 is engaged in the recess 44 , which is designed as a pocket hole , then the carbon brush 22 is held in a retracted position within the carbon brush guide 28 . at the same time , the retaining element , with its upper , open edge 50 , extends to the area of the upper , open edge 38 of the side wall 16 . now when , following the successful positioning of the armature shaft and the commutator , the brush holder , in other words the base plate 10 with its centering element 18 or the motor casing 80 , is closed , then โ€” as is shown by a comparison of fig4 and 5 โ€” in closing , in other words by moving the motor casing 80 in the direction of the arrow 52 , the retaining element 26 is pressed into the guide 34 , against the spring element 48 . this causes the extension 42 to become disengaged from the recess 44 in the carbon brush 22 , thus releasing the brush . in this manner , the carbon brush 22 is pushed in the direction of the commutator or slip ring within the carbon brush guide 28 , via the spring elements , which in the exemplary embodiment are designed as scroll springs 46 . according to an alternative proposal as illustrated in fig1 and 13 , it is not absolutely necessary in mounting the carbon brush 22 for the spring element 48 to exert force against the retaining element 26 . rather , it is possible for the retaining element 26 to become wedged , specifically when the adjustment forces acting against the carbon brush 22 and created by the spring element 46 , such as a scroll spring , are sufficient . thus it is provided that sections of the side walls or parallel partition 30 , 32 can interlock with the retaining element 26 . to this end , the retaining element 26 may be provided with grooves 98 , into which ridges 99 protruding from the side walls or parallel partition 30 , 32 become engaged . other designs are also possible . in other words , a wedging takes place between the retaining element 26 and the carbon brush with the extension 42 that is positioned within the pocket hole or recess 44 , without the danger of an unintended release of the carbon brush 22 in the case of insufficient force in the lengthwise direction of the retaining element 26 . furthermore , the combined action of the grooves 98 and the ridges 99 at the same time causes an axial guidance of the retaining element 26 . the carbon brush guide 28 itself may be comprised of a u - shaped metal element 54 , whose side legs 56 , 58 extend along opposite sides 60 , 62 of the carbon brush 22 . the center leg 64 extends along the top 66 of the carbon brush 22 . the side legs 56 , 58 are bent outward , with the corresponding outer sections 68 , 70 extending parallel to the ground wall 12 or the partition wall 14 , to which , in the exemplary embodiment , the carbon brush guide 28 is fastened . the knee - shaped outer sections 68 , 70 of the u - shaped metal element 54 extend along a metal element 74 that is positioned on the surface 72 of the partition wall 14 that faces the carbon brush ; the carbon brush 22 is supported against this metal element such that it can slide . the metal element 74 and the outer sections 68 , 70 of the side legs 56 , 58 can be connected or riveted to one another , which also connects them at the same time to the partition wall 14 . alternatively , in accordance with fig1 , the sections 68 , 70 which extend parallel to the base or partition wall 14 , may be omitted , so that the u - shaped or folded section that encompasses the carbon brush 22 , in other words its side legs 56 , 58 , protrude directly through the wall 14 . in order to enable a secure mounting or fastening of the carbon brush guide 28 , the outer sections 68 , 70 of the side legs 56 , 58 may also be bent , so that they extend with an end section 76 through the metal element 74 and through the partition wall 14 , as is shown in fig7 through 10 . thus , as is shown in fig8 the end section can be bent in the direction of the underside 78 of the partition wall 14 that lies opposite the carbon brush . the section 76 may also be bent , as is shown in fig9 . it is also possible for the open end of the section 76 to be t - shaped , thus securing it to the underside 78 of the partition wall 14 .
7
the invention is useful in a near infrared quantitative analysis instrument of the type disclosed in the rosenthal et al application , ser . no . 73 , 965 , filed sept . 10 , 1979 . such instrument utilizes a plurality of pulsed infrared emitting diodes ( ireds ) with narrow bandpass filters to direct radiant energy through a grain sample toward a detector . the energy is detected , and depending on the absorption at particular wavelengths , the chemical constituents can be measured and the measurements displayed . it is in the environment of such instrument , which is now commercially available on the market as the trebor 90 from trebor industries , inc . in gaithersburg , md ., that the present invention applies . as shown in fig1 there is an instrument with a plurality of ireds 10a , 10b , 10c , etc . which as shown in fig2 are positioned in a four by three matrix . these individual ireds are separated light - wise from each other by baffles 12 and their radiation is directed to the right as viewed in fig1 through individual narrow bandpass filters 14 . a sample chamber 16 containing a sample s , for example grain , has windows 18 and 20 which are transparent to the radiation . a stop gate , not shown , holds the sample in the chamber during measurement . on the side of the sample chamber opposite the ireds there is a photodetector means 22 to detect the radiation passing through the sample in the sample chamber . the photodetection means is connected to a means 24 for calculating and displaying the result of the quantitative analysis . the foregoing is more fully disclosed in the application of rosenthal et al . ser . no . 73 , 965 , filed sept . 10 , 1979 . fig3 a and 3b show the ideal ired and the practical ired . typically ireds have collimating lenses 10 &# 39 ; built into them . the purposes of such lenses is to provide a light beam that is as parallel as possible . however , because of practical limitations in optics the light emitted is not truly parallel and typically emanates from the ireds at angles of up to 8 degrees off of a parallel path as shown schematically in fig3 b . fig4 illustrates the practical problem which occurs when the light beams from the ireds are not truly parallel . this shows the sample chamber 16 and window 18 with schematic illustrations , for example of a light pattern from ired 10a , p10a and a light pattern from ired 10c , p10c . it is seen that the light emitting from the lens 10 &# 39 ; of the ired 10 tends to have a large scattering pattern near the focal plane . that is , the pattern of light from the individual ireds because of the nonparallel nature of such light tends to be scattered over an area considerably larger than is needed from a measurement standpoint . one solution to the problem which is within the scope of the invention but not the preferred embodiment is shown in fig1 . in that case there is a large convex converging lens 26 which converges the light from the matrix m of ireds and a smaller lens 28 to provide parallel light exiting from that lens which passes toward the window 18 . the preferred embodiment of the overall invention is illustrated in fig5 . in this embodiment there is the same matrix m of ireds , baffles and narrow bandpass filters as in fig1 and 2 . in place of the dual lens system of fig1 however , the preferred embodiment utilizes a fresnel lens 30 to direct the light from the ireds on a focal plane diffuser 32 . that is , the fresnel lens directs the radiation from each of the ireds and focuses it at a focal plane . in the focal plane there is positioned a diffusing plate 32 . the plate 32 is of a diffusing material , for example a matte surface , and the result is that such diffusing material causes light to be emitted in all directions essentially with uniform energy . this is schematically illustrated in fig6 . in fig5 between the diffusing plate 32 and the sample chamber 16 there is an opaque material or sheet 34 with a single small aperture 36 positioned in front of , but smaller than the window 18 . the material of diffusing plate 32 can be , for example , a translucent plexiglass where the surface has been rough - sanded to provide a diffuser , i . e ., a matte finish . the pattern of light because of the nonparallel nature of the ired light tends to be scattered over an area considerably larger than is needed from a measurement standpoint . to minimize this problem the opaque plate 34 having aperture 36 in it , is placed on the side of the diffusing plate adjacent the sample . this aperture 36 limits the amount of light that the sample can &# 34 ; see &# 34 ; and thus , tends to only let the light from the same direction contact the sample . a preferred embodiment of the diffuser means is a pair of diffuser plates as shown in fig7 . in this figure there is a diffuser plate 35 closest to the ireds and a spaced - apart diffuser plate 37 closest to the apertured plate 34 . a spacer 40 , for example 1 / 16th inch thick , spaces the two diffusers . in this embodiment the scattered light from the diffuser 35 is spread more evenly by the diffuser 37 , and thus , the light emitting from the second diffuser through the aperture 36 is essentially uniform in nature and can be used for exacting measurement requirements in the field of near infrared quantitative analysis . a nonlimiting example of the invention in the preferred embodiment has been implemented in a commercially available trebor 90 grain tester implement first sold in december 1980 , with the following details . 12 ge 1n6264 ireds are mounted in a three by four array , one - half inch on center . in front of each ired is a narrow bandpass filter that only allows a specific wavelength of light to pass . a fresnel lens from edmund scientific no . 30389 is placed in the light beam so that the light from all 12 sequentially illuminated ireds passes through the fresnel lens . the fresnel lens bends the light so that the light from each of the 12 ireds comes close to a theoretical focal point of the lens . at this focal point two diffuser plates ( each one a sanded piece of plexiglass from rohm & amp ; haas no . 7204 ) are separated by 1 / 16th inch spacer . a 5 / 8th inch aperture is provided so that only light through that aperture can exit from the optical arrangement . a test sample in a sample chamber can be placed essentially at any distance including extremely small distances from the aperture . in the trebor 90 the distance of a test sample is approximately 1 / 16th inch away from the aperture plate . although the above invention has been described in connection with pulsed infrared light emitting diodes , the invention has also applicability for other radiation - emitting diodes used in such instruments , such as light - emitting diodes ( leds ).
6
the interferometer system is shown fig1 in an embodiment that most easily illustrates the essence of the idea , but is not necessarily the preferred embodiment or the only embodiment . it consists of four main parts : the beam conditioning optics ; the interferometer ; the detection system ; and the computer system . the major components of the beam conditioning optics are the light source , intensity and contrast controls , and the phase shifting module . referring to fig1 a linearly polarized collimated beam 10 from a light source 12 ( e . g ., a laser ) passes through a variable neutral density filter 14 which is used to control the light level to the interferometer . the beam 10 then passes through a half - wave retardation plate 16 which produces two orthogonally polarized beams , beam 18 having vertical ( out of plane ) polarization and beam 20 having horizontal ( in plane ) polarization , both beams within beam 10 . the angular orientation of the half - wave retardation plate 16 is used to adjust the relative intensity between the vertical and horizontal components of polarization . beams 18 and 20 having these two polarization components are then split by a polarization beamsplitter 22 so that the horizontal polarization ( beam 20 ) is transmitted while the vertical polarization ( beam 18 ) is reflected . the transmitted beam 20 is then reflected by a fixed retroreflector 24 back through the polarization beamsplitter 22 to a turning mirror 26 . the reflected beam 18 is reflected by a retroreflector 28 , mounted on a piezoelectric translator ( pzt ) 30 , back through the polarization beamsplitter 22 to the same turning mirror 26 so that is it parallel to the other beam but laterally displaced from it . applying a voltage to the pzt 30 translates the retroreflector 28 thus shifting the relative phase between the two orthogonally polarized beams . the two beams pass through a polarizer 32 ( axis at 45 ยฐ) to give them the same polarization and are brought to focus , with a microscope objective 34 , on the interferometer plate 36 . referring to fig2 a , the interferometer plate 36 comprises a glass substrate 38 coated with a highly reflecting , low transmission , metallic film 40 , through which a circular aperture 42 has been etched . the diameter of the aperture 42 is on the order of the wavelength of the source 12 . metallic film 40 may typically comprises aluminum having a thickness of 65 nanometers . in the embodiment shown in fig2 b , the interferometer plate 36 comprises a glass substrate 38 coated with a highly reflecting , low transmission , metallic film 40 , through which a circular aperture 42 has been etched , and over which a second partially transmitting metallic film 44 has been coated . the diameter of the aperture 42 is on the order of the wavelength of the source 12 . metallic film 40 may typically comprises aluminum having a thickness of 65 nanometers and metallic film 44 may typically comprises aluminum having a thickness of 26 nanometers . in both embodiments of the interferometer plate 36 , the metallic film 40 and the second metallic film 44 may comprise materials other than aluminum , for example , materials selected from a group consisting of chromium , gold , nickel , silicon and silver . the thicknesses of the film would vary depending on the material used . this plate serves to generate the point source measurement beam , using one of the beams focused on the plate , to illuminate the optic under test . it simultaneously serves to generate the point source reference beam , using the other focused beam . beams 18 and 20 are focused on the interferometer plate 36 so that they are both incident on the aperture 42 in the metallic film 40 . both beams are diffracted by the aperture 42 , producing two spherical wavefronts that diverge as they leave the aperture . each wavefront is perfectly spherical over a finite angular range ( defined by the diameter of the aperture relative to the wavelength ) centered about the illumination direction defined by the lateral separation of the beams as they entered the microscope objective . the measurement beam 46 illuminates the optic 50 under test . this optic typically comprises a concave mirror and is adjusted to focus the measurement beam 46 back onto the interferometer plate 36 . due to the finite extent of the optic 50 and aberrations therein , the focused measurement beam 46 is much larger than the aperture 42 in the metallic film 40 , so nearly all of the focused measurement beam 46 is reflected by the film 40 in the embodiment of the interferometer plate 36 shown in fig2 a . in embodiment of the interferometer plate 36 shown in fig2 b , focused measurement beam 46 is reflected by the film 44 . it diverges and is coincident with the reference beam 48 which was diffracted by the aperture 42 . the measurement beam 46 and the reference beam 48 interfere to produce a fringe pattern that represents a contour map of optical path difference between the wavefront from the optic 50 and a perfect spherical wavefront . the detection system consists of an imaging system to image the optic under test onto a ccd array camera . the imaging system comprises a lens 52 , an aperture 54 for spatially filtering the interfering beams , and a lens 56 . the aperture 54 is large enough so that it does not diffract the beam focused through it . a typical size is micrometers . the size of the lenses 52 , 56 , depends on the size of the optic under test . the coincident measurement beam 46 and reference beam 48 , diverging from the interferometer plate , are collected by a spatial filter imaging system which images the surface of the optic 50 under test onto a screen ( not shown ) or onto a charge coupled device ( ccd ) camera 58 . this guarantees that the phase of the interfering wavefronts at each pixel in the ccd camera 58 has a one - to - one correspondence with a unique point on the optic 50 . it also minimizes effects of edge diffraction from the optic . aperture 54 , at the intermediate focus of the interfering beams , is used to filter out any light not coming from the immediate area around the aperture in the interferometer plate 36 . the ccd camera 58 captures a series of interference patterns and transfers them to the computer system 60 . the computer system consists of a computer having a monitor and software to control the light level and contrast of the interference pattern , software to translate the pzt and thus shift the relative phase between the measurement and reference beams , software to calculate the phase at each pixel using the transferred interference patterns , and software to display the resultant phase map . this software for analyzing the interference pattern read into the computer can presently be supplied by several companies . zygo corporation produces &# 34 ; metro pro &# 34 ; software . phase shift technology produces &# 34 ; optic code analysis software &# 34 ;. wyko corporation produces &# 34 ; wisp &# 34 ; software . the series of interference patterns that are transferred to the computer are captured as the pzt shifts the relative phase of the interfering beams by 2 ฯ€ radians . the interference patterns are analyzed to determine the proper settings for the light level and contrast of the interference fringes . this information is used by the computer to adjust the position of the neutral density filter 14 and half - wave retardation plate 16 . a second series of interference patterns are then captured and analyzed to determine the phase at each pixel . this is typically displayed as a contour or 3d plot of the phase . this phase map corresponds to the deviation of the surface of the optic from a perfect sphere . a . the measurement beam is generated by diffraction and is a perfect spherical wave over some finite solid angle . the solid angle is defined by the size of the aperture in the interferometer plate relative to the wavelength of light from the source . smaller apertures produce larger solid angles . b . the reference beam is generated by diffraction and is a perfect spherical wave over the same solid angle as the measurement beam . c . no reference surface is required for this interferometer . reference surfaces are a major source of error in interferometry and ultimately limit the accuracy that can be achieved . d . the measurement beam reflected from the optic under test is imaged back onto the aperture of the interferometer plate , giving exact coincidence with the reference beam . this is the ideal condition for achieving the highest degree of accuracy . e . the relative phase between the measurement and reference beams can be shifted in a controlled way . this permits a series of interference patterns to be analyzed to determine the phase at each pixel position with the highest degree of accuracy . f . the relative intensities of the measurement and reference beams can be adjusted ( with the half - wave retardation plate ) to give maximum possible contrast . this produces the greatest signal - to - noise , necessary for achieving the highest degree of accuracy . referring to fig3 interferometer plate 37 may be useful in certain circumstances depending on the optic under test . here beams 18 and 20 each pass through a prism 17 , 19 respectively , and are focused by lens 34 onto two distinct apertures : aperture 41 and aperture 43 in the interferometer plate 37 . a tilt is introduced between beam 20 and beam 18 by the prisms . the usable metallic films are the same as described for interferometer plate 36 . apertures 41 and 43 are typically separated from each other by 10 to 500 micrometers . the typical angle between the two focused beams is in the range of 10 to 60 degrees . in the embodiment shown on fig3 beam 18 passes through prism 17 and is focused by lens 34 onto aperture 43 in interferometer plate 37 . the resulting diffracted measurement beam 47 is then reflected from test optic 51 to the reflective area surrounding aperture 41 of interferometer plate 37 . this beam is reflected along the same path as reference beam 49 to produce an interference pattern therebetween . this embodiment is used to test optical surfaces that are concave with respect to the interferometer plate 37 . another distinctive form of this interferometer system , based on fiber optic technology , operates on the principles described supra . referring to fig4 light source 12 is focused by lens 62 onto the end of a single mode fiber 64 . a variable fiber coupler 66 splits the beam into two fibers : fiber 68 and fiber 72 . the ratio of light split into each fiber is chosen for maximum fringe contrast . fiber 68 is used for the measurement beam 70 . fiber 72 , transmitting reference beam 74 , is wrapped around a pzt cylinder 76 that expands with an applied voltage . this stresses the fiber 72 , changing its refractive index , and introduces a phase shift relative to the measurement beam 70 from fiber 68 . the measurement beam 70 leaving the end of the fiber is diffracted , producing a perfect spherical wavefront over some finite solid angle . the solid angle is defined by the size of the fiber core relative to the wavelength of light from the source 12 . this spherical measurement beam 70 illuminates the optic 78 under test , which focuses the beam onto the end of the fiber for the reference beam . fig5 shows a magnified view of the exit portion of fiber 72 . measurement beam 70 is focused onto reflective metallic film 73 on the end of fiber 72 , and is reflected along the same path as reference beam 74 . this embodiment is used to test positive lenses . referring to fig6 it may be necessary to shrink the core diameter of fibers 68 and 72 to match the aperture size for the interferometer . this is accomplished by heating and pulling the fiber . for example , fiber 72 , having cladding 84 and core 80 is heated and pulled to produced a stretched portion 82 with a core 81 having a diameter that is smaller than the unstretched core portion 80 . metallic film 73 is coated after heating and stretching and can comprise any of the films described supra . one embodiment of the metallic film comprises aluminum having a thickness of 26 nanometers . single mode fibers typically have core diameters of about 4 micrometers . the measurement beam is reflected from the end of the fiber while the reference beam is transmitted through the film and diffracted , giving a perfect spherical wavefront over the same finite solid angle as the measurement wavefront . the solid angle is defined by the size of the fiber core relative to the wavelength of light from the source 12 . the imaging , computer systems , data acquisition and analysis are the same as described above . this fiber optic approach has all the advantages of the system described above as well as the flexibility to independently move the measurement and reference fibers to any positions to suit the interferometric measurement configuration . if light source 12 comprises a short coherence length , the fiber lengths 68 and 72 must be adjusted so that the optical path lengths from variable fiber coupler 66 to the end of fiber 72 for both the measurement beam 70 and reference beam 74 are equal . another embodiment of the invention is shown in fig7 . in this embodiment light source 12 comprises a short coherence length and beams 18 and 20 are reflected back through the polarization beamsplitter 22 so they are coincident and collinear . retroreflector 24 is positioned such that optical path length acd is equal to optical path length abded . in other word , retroreflector 24 is moved to a position where the round - trip beam path difference between the two retroreflectors is equal to the round - trip path between the interferometer plate and the optic under test . the optical path lengths of the interfering measurement and reference beams are then the same . in this configuration , the light source is spatially coherent but temporally incoherent . examples are : a white light source , a light emitting diode , a tungsten lamp and a multimode laser . as in fig1 pzt 30 can be attached to either retroreflector . this condition produces high contrast fringes in the interference pattern and eliminates any extraneous interference due to light from the measurement beam spreading into the reference beam . this configuration also eliminates any extraneous interference due to light from the reference beam spreading into the measurement beam . although only those embodiments for the measurement of concave mirrors and positive lenses were described , other embodiments exist for measurement of convex mirrors and negative lenses . changes and modifications in the specifically described embodiments can be carried out without departing from the scope of the invention , which is intended to be limited by the scope of the appended claims .
6
as mentioned above , fig1 illustrates , in block diagram form , a data processing system which includes a plurality of data transmitting / receiving devices 11 , 12 , 13 and a plurality of primary computers 21 , 22 and 23 which can communicate with each other and / or with a larger computer 3 by way of the data transmitting / receiving devices 11 , 12 and 13 . the first data transmitting / receiving device 11 is connected to the larger computer 3 by way of a first modem connection line . the third data transmitting / receiving device 13 is likewise connected to the larger computer 3 by way of a second modem connection line . the three data transmitting / receiving devices 11 , 12 and 13 illustrated in the exemplary embodiment of fig1 are connected to one another in the manner specified by way of their respectively remaining first and / or second modem connection lines , so that a data exchange between each of the three primary computers 21 , 22 and 23 provided with every other primary computer and / or with the larger computer 3 can be carried out . as already explained , fig2 illustrates the block diagram of a data transmitting / receiving device 10 having the various devices arranged therein and the connection lines provided for connection to external devices . data can be transmitted to and from a further local device , i . e . a further device situated at the location of the data transmitting / receiving device such as , for example , a primary computer , by way of a double - directed local data exchange line 112 and a parallel character interface 105 , and can optionally be converted and justified for transmission by a microprocessor 101 in cooperation with a process store 102 , oriented bit - wise or character - wise , by means of correspondingly input switching commands which can , in turn , be a component of the information received or exist as a component of the program information of the data transmitting / receiving device in question . given bit - oriented data messages , the sdlc method , known per se , or the hdlc method , also known per se , can be carried out . the data messages which can be transmitted or received by way of the first or , respectively , second modem connection line 113 or 114 , comprises serial characters . the editing of out - going data messages to be undertaken for the known hdlc or sdlc methods or , respectively , functions required for processing incoming data messages , are carried out by a module 108 , in particular , a z80 - sio , a sdlc / hdlc module . this module emits information to the input / output device 109 or receives information therefrom . the data to be transmitted or to be received are supplied to or taken from the sdlc / hdlc module 108 by way of a data bus 111 . in addition to the microprocessor 101 and the process store 102 , the parallel character interface 105 , a timer 106 , an interrupt control 107 and a parallel interface 103 are also connected to the data bus 111 . such arrangements are known per se , as illustrated and discussed , for example , in &# 34 ; microprocessor devices data book 1976 / 77 &# 34 ;, system sab 8080 , published by siemens ag , components area , pp , 63 - 79 : &# 34 ; interfacing the sab 8080 with other microcomputer devices &# 34 ;. this parallel interface 103 is connected by way of a character channel to a driver 104 whose output can be connected by way of a modem control line 115 to a modem which is constructed , for example , as an automatic selection device for data transmission awd . dial connections within a private telephone network , or within the public telephone network , to other data processing devices such as , for example , a large computer , can be completed by way of such an automatic selection device for data transmission awd . for completing such a dial connection , corresponding dial information are transmitted from the microprocessor 101 by way of the data bus 111 to the parallel interface 103 and , therefore , to the driver 104 . the data messages to be transmitted or to be received are transmitted by way of the telephone network , for example , in multi - frequency code ( mfc ). the individual devices of a transmitting / receiving device constructed in accordance with the present invention , namely the device 10 connected to the data bus 111 , are addressable by way of an address bus 110 . the interrupt control 107 has the task of interrupting respectively cycling procedures due to procedure requests of higher priority . the timer 106 has the task of monitoring chronological sequences of running procedures . moreover , by means of , it the baud rates are controlled , i . e . the character transmission speeds are controlled . the parallel character interface 105 is organized interface - specific and mechanically constructed in such a manner that a simple interchangeability is provided . a further development of the invention provides that a parallel character interface 105 is programmably constructed so that an adaptation to a local data exchange line 112 , designed as may be desired , is rendered possible . another further development of the invention provides that a plurality of data transmitting / receiving devices 10 are connected to the local data exchange line 112 . in a further development of the invention , a plurality of local data processing systems can likewise be connected to the local data exchange line 112 . another further development of the invention provides that a plurality of data transmitting / receiving devices 10 and a plurality of local data processing systems are connected to the local data exchange line 112 . in addition to the task of storing process information , the process store 102 , which is usually executed as a read only memory ( rom ) or random access memory ( ram ) also has the job of operating as a communication buffer for the data to be transmitted or to be received . as already set forth above , fig3 illustrates an exemplary embodiment of a data processing system arranged in a concentrator structure with a plurality of transmitting / receiving devices 11 , 12 and 13 constructed in accordance with the present invention , a plurality of data terminals 41 - 46 and a primary computer 20 . the data transmitting / receiving devices 11 , 12 and 13 are respectively connected to the primary computer 20 by way of their local data exchange line and are connected to an individual data terminal , for example the terminal 41 , by way of their first or , respectively , second modem connection line 113 or , respectively , 114 . the further development of the invention illustrated in fig3 offers the advantage that a multitude of data terminals have access to a central data processing system such as , for example , the primary computer 20 , without the exchange - oriented devices which are otherwise necessary . fig4 as likewise already discussed above , illustrates an exemplary embodiment of a data processing system arranged in a tree structure having a plurality of data transmitting / receiving devices 1001 - 1013 constructed in accordance with the present invention , a primary computer 20 , a first front - end computer 51 , a second front - end computer 52 , and third , fourth , fifth and sixth front - end computers 53 - 56 . it can be derived from this illustration of a further development of the invention that the primary computer 20 is connected to an input computer 51 by way of the appropriate local data exchange line , the data transmitting / receiving device 1001 assigned thereto and the appropriate first or , respectively , second modem connection line and is connected to a second front - end computer 52 by way of the data transmitting / receiving device 1002 or , respectively , 1003 respectively individually assigned to the front - end computers 51 , 52 , whereby each front - end computer 51 , 52 is connected to the first or second modem connection line of the data transmitting / receiving device 1002 or , respectively , 1003 assigned thereto . these two data transmitting / receiving devices 1002 and 1003 are connected to one another by way of respective first or , second modem connection lines . a third front - end computer 53 and a fourth front - end computer 54 are , respectively , a fifth front - end computer 55 and a sixth front - end computer 56 are respectively post - connected to the first and second front - end computers 51 and 52 by means of further data transmitting / receiving devices 1004 , 1006 , 1007 or 1005 , 1008 , 1009 in the same manner as the first and second front - end computers 51 and 52 are post - connected to the primary computer 20 . a branched , multi - level system structure thereby arises which allows flexibility and time - saving data processing in that partial problems of an entire processing operation are carried out in front - computers specifically provided and programmed for this purpose or , respectively , time - saving partial processing operations to be developed chronologically parallel can be implemented . fig5 illustrates an exemplary embodiment of a data processing system arranged in a mesh network structure having a plurality of data transmitting / receiving devices 1020 - 1029 and a plurality of primary computers 24 - 28 . two individual data transmitting / receiving devices 1020 , 1021 ; 1022 , 1023 ; 1024 , 1025 ; 1026 , 1027 ; and 1028 , 1029 are assigned to each of these five primary computers 24 - 28 . the first and second modem connection lines of all data transmitting / receiving devices 1020 - 1029 are interconnected in such a manner with the first and second modem connection lines of the further data transmitting / receiving devices that each of the five primary computers 24 - 28 can communicate with each of the further primary computers . such a meshed system structure represents a so - called fault - tolerant system when it is assumed that each of the five main computers can respectively perform the task of any one of the further main computers of the five main computers . the system structures illustrated in fig1 , 4 and 5 are only exemplary embodiments of the system application of data transmitting / receiving devices constructed in accordance with the present invention . in accordance with the properties of data transmitting / receiving devices of the present invention , further examples of applications not shown herein can be realized . therefore , for example , a plurality of main computers 20 can be provided , of which respectively two main computers 20 are connected by way of respective data transmitting / receiving devices 10 individually assigned thereto . another further development of the invention provides that three main computers are provided , that an individual data transmitting / receiving device 10 is assigned to each of the three main computers , and that each data transmitting / receiving device 10 is connected to every further data transmitting / receiving device 10 by way of its first or , respectively , second modem connection line 113 or , respectively , 114 , so that every main computer can correspond or communicate with every further main computer . the relief of the internal data processing device respectively concerned which is attainable by means of practicing the present invention permits the advantageous employment of the arrangements constructed in accordance with the present invention , particularly in data processing systems which work in real - time operation . included here are , among others , process controls and program - controlled telephone or data communication systems . although we have described our invention by reference to particular illustrative embodiments thereof , many changes and modifications thereof may become apparent to those skilled in the art without departing from the spirit and scope of the invention . we therefore intend to include within the patent warranted hereon all such changes and modifications as may reasonably and properly be included within the scope of our contribution to the art .
6
while the invention is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the invention to the specific form disclosed , but , on the contrary , the invention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention as defined in the claims . the compounds and a variety of other compounds of formulas i and ii of the present invention may be formed and utilized within the scope of the present invention . the following tables 1 and 2 set forth various compounds of formulas i and ii which are considered a part of the present invention . the compounds of the present invention have been shown to provide various smooth muscle relaxant activities . recently some reports have stated that theophyllline has an adenosine acceptor antagonist and phosphodiesterase ( pde ) inhibitor function . some of these derivatives of the present invention have been demonstrated to function as tracheal relaxation activity mechanism and provide for reduced heart rate functions . some synthesized xanthine derivatives were observed to have their affinity and selective effect on adenosine a 1 and a 2 receptors . fig4 a illustrates the experimental results and the effects of compound 14 on phenylphrine precontracted rabbit corpus cavemosal in the absence and presence of l - name , methylene blue , odq . fig4 b illustrates the experimental results and the effects of compound 14 on phenylphrine precontracted rabbit corpus cavernosal in absence and presence of potassium channel blockers . fig5 illustrates the additive effects of compound 14 and ibmx ( 3 - isobutyl - 1 - methylxanthine ) on phenylephrine precontracted rabbit carvernosal strips . please refer to fig2 in which two embodiments of processes for the preparation of a compound of formula ii are disclosed . in a reaction a , the reactant of a compound of formula iii is reacted with 1 - 2 - di - bromoethane to produce a monobromo compound of formula iv . then , in a first embodiment of the processes , by a reaction b , the monobromo compound of formula iv is reacted with an n - substituted piperazine of formula piperazinyl - r2 to produce a compound of formula ii . in a second embodiment of the processes , after the reaction a is carried out to obtain the monobromo compound of formula iv , the monobromo compound of formula iv is reacted with piperazine according to a reaction c to produce a compound of formula v . then , the compound of formula is reacted with a compound of formula r2 - x to produce a compound of formula ii according to a reaction d . please refer to fig3 . the compound of formula iii is reacted with 1 , 2 - di - bromoethane as shown in the reaction a to produce a monobromo compound of formula iv . then , the monobromo compound of formula iv is reacted with piperazinyl ring which is a secondary amine , and naoh is added to precipitate nabr to obtain the product which contains the piperazinyl ring of formula i . the compounds shown in fig2 and 3 have their main structures shown as formulas i and ii . in these compounds , various substitutions of the two bases lead to changes in the various intermediate products so that different serial preparing processes were developed . the preparing process for formula ii , comprises the steps of dissolving 3 - isobutyl - 1mehtylxanthine ( ibmx ) into halogenated ethylamine solution , for example 2 - bromoethylamine solution and stirring while heating the mixture until the solid is completely dissolved . then naoh is added to react with this mixture at a temperature of less than 150 ยฐ c . over night . this is then concentrated under a reduced pressure to obtain a white coarse crystal which was re - crystallized to obtain a compound d ( n7 - bromoethyl 3 - isobutyl - 1 - methylxanthine ) which appears as a white crystal powder . into a three neck round bottom flask equipped with a mechanical stirrer , a thermometer , and a reflux condenser , there were added 210 g of chlorosulfonic acid and 20 g of para - hydroxyl sulfonate sodium . this mixture is then heated and stirred at 65 ยฐ to 67 ยฐ c ., and then poured onto crushed ice . the precipitate is then separated by filtration . the precipitate is then washed with cold water and dried at 20 - 25 degrees c . under a reduced pressure . the precipitate is then purified by dissolution in 200 ml of acetone and precipitated again in cold distilled water , then filtered and dried in vacuum . this precipitate is then reacted with 10 ml of methylpiperazine for 1 hours to obtain a precipitate . this precipitate is then recrystallized in acetone to obtain a white crystal . this is then dissolved in a mixture of methanol , formalin ( 5 ml 37 %), acetic acid 1 ml , and 10 g compound d ( n7 - bromoethyl 3 - isobutyl - 1 - methyl - xanthine ), then followed by mixing overnight at 75 degrees c ., purification by column chromatography and eluted by a solvent system containing ethyl acetate and methanol . the eluate is then recrystallized from methanol to obtain compound 39 . this compound 39 is dissolved in 50 ml methanol together with 1 g naoh and 10 ml ethyl bromide , heated at 75 c for 2 hours and concentrated under a reduced pressure , dissolved and recrystallized in 50 ml methanol to obtain compound 40 . under the same rule , compound 41 can be obtained by replacing ethyl bromide with propyl bromide . compound 42 , 43 or 44 were also obtained when replacing theophylline with ibmx , separately . parahydroxybenzoic acid ethyl ester is dissolved in methanol , added with formalin and acetic acid to react overnight , added to nh 3 ( aq ) to obtain para - hydroxy benzoic amide . this product was added with formalin , acetic acid and n7 - bromoethyl 3 - isobutyl - 1 - methylxanthine processed through a mannich reaction to obtain compound 33 . through purification and then dissolution into methanol , add naoh and ethyl bromide to gain compound 34 . various substitutions can be made to produce other desired compounds . for example , by replacing ethyl bromide with propyl bromide , compound 35 can be obtained . by replacing theophylline with ibmx , compounds 36 , 37 , and / or 38 can be obtained . the process of preparing the compound of formula i comprises the steps of dissolving 3 - isobutyl - 1 - methylxanthine ( ibmx ) into methanol and stirring with 2 - bromoethylamine upon a mantle heater , reacting this mixture with naoh and then recrystallizing this mixture with methanol to obtain n7 - bromoehtyl 3 - isobutyl - 1 - methylxanthine . to produce the serial compounds 1 - 8 , which have different substitutes on a major structure , the preparing methods are as follows : refluxing compound a with methanol and added with one of the following compounds : 1 - phenylpiperazine , 1 -( 2 - pyrimidyl ) piperazine , 1 -( 2 - pyridyl ) piperazine , 1 -( 2 - chlorophenyl ) piperazine , and 1 -( 4 - chlorophenyl ) piperazine . compounds 11 หœ 18 were obtained by substituting the theophylline base with ibmx . a solution of benzenesulfonyl chloride , piperazine and methanol allows us to obtain benzenesulfonyl piperazine . this product is dissolved into methanol and replaced with compound a ( n - 7 - bromoethyl 3 - isobutyl - 1 - methylxanthine ) to obtain compound 21 . by replacing the ethyl bromide with propyl bromide , compounds 22 and 23 can be produced . by replacing p - toluene - sulfonyl chloride or o - toluenesulfonyl chloride with benzenesulfonyl chloride , compounds 24 , 25 , or 26 may be produced . dissolving theophylline with methanol , added with 1 , 2 - di - bromoethane and naoh , heated under reflux conditions , concentrated under a reduced pressure and purified through silica gel column chromatography , we can obtain compound a . dissolving compound a into methanol and combining with piperazine , we can obtain compound b . then steps of dissolving compound b in methanol , adding 2 - furoyl chloride or 4 - chloronitrobenzene and proceeding under reflux conditions allow for the formation of compounds 9 and 10 . adding 4 - chlorobenzene sulfonyl chloride and methylpiperazine into methanol and then refluxing , dissolving the product compound and n7 - bromoethyl 3 - isobutyl - 1 - methylxanthine in methanol , and then refluxing this solution , compound 45 is produced . according to the same rule , steps of replacing ethyl bromide with propyl bromide and replacing theophylline with ibmx allow the parties to obtain compound 46 . after purification and crystallization , the products are individually tested for their physio - chemical information including element analysis , ms , ir , h - nmr ( cdcl 3 ), and uv etc as shown table 3 . appropriate experimental models may also be utilized to evaluate their pharmacological activities , and examples of the experiments are shown in tables 4 - 6 and in the following portions of the specification . the compound of this invention includes various carriers , diluents and pharmacologically approved salts to provide desired therapeutic efficacy . such pharmaceutical preparation could be in solid form for oral or rectal administration , liquid form for non - intestinal injection or ointment form for direct application on an affected part . such forms are manufactured according to common pharmaceutical preparation methods and combined with common carriers such as starch , glycerine , carboxy methylcellulose , lactose , magnesium and similar materials . the general dosage of the compound could be varied . however , a normal person could utilize 50 to 300 mg , approximately three times a day .
2
the present invention provides for a 3 - d imaging system and method of obtaining 3 - d images adapted for remote information acquisition . an embodiment of the present invention comprises a platform for supporting and conveying the imaging system , an illumination source affixed to the platform which transmits light to an object being scanned a light detector affixed to the platform adapted to collect light reflected back from the object being scanned and a data processing system in communication with the light detector for compiling data obtained from the reflected light to produce an image therefrom . the present invention further provides for detecting the change in wavelength associated with light received from the object being scanned . the illumination source for use with the present invention can be any light emitting device . it , however , is preferred in this invention to use a laser , and more preferably to use a laser with a planar geometry . the laser used by this invention can have a wavelength in the range of 400 to 630 nm , preferably in the range of 450 to 600 nm , and most preferably in the range of 500 to 575 nm . the present invention can analyze and scan a variety of objects . for example , the present invention can analyze and scan sea floor , objects resting on the sea floor , tethered objects , ship &# 39 ; s hulls , seawalls , and floating objects . the data processing system compiles the data obtained from the reflected light which can be stored for later use or transmitted to a remote location in real time for projection of the image on a display . the present invention can be used with a navigational sensor system in order to facilitate locating an object being scanned . referring now to fig1 , the instant system 10 includes a platform 11 which contains an illumination source 12 which is directed a object 13 , which is in turn recorded by virtue of a light detector 14 . the platform 11 may be of any design for conveying the imaging apparatus , these including auvs , rovs , and other underwater conveying means . in addition , boats or ships may be outfitted with the apparatus of the instant invention . the imaging may occur below , above , on the surface of a body of water or as a side - scanning function with respect to the horizontal axis of the platform . in addition , if aerial observation is intended as the use , any form of manned or unmanned vehicle may be used as the supporting and impelling means . also contemplated is the use of stationary underwater platforms geared to image ships or other water vessels as they pass over it . for the purposes of the preferred embodiments of this application , however , rovs or auvs are the preferred platforms . the illumination source 12 may also be any suitable illumination means known to one of ordinary skill in the art , but for the purposes of the preferred embodiment , is a laser source . this source may be selected as a narrow wavelength source as desired for the fluorescence embodiment of the instant invention , or may be of a broader range of wavelengths for more general illumination . in addition , a single source may be used or a plurality or sources , including use of a multiplicity of different types of illumination devices as known to those of ordinary skill in the art . the source or sources are preferably movably mounted to provide flexibility in changing the source to detector separation as desired . it is considered preferable to use a very high intensity laser source so that a high degree of illumination is achieved from this source . in addition , various filter mechanisms may be used in combination with the light source to screen out or isolate certain wavelengths . it is preferred that the source should have a narrow field of view in the along - track direction such as provided by a spot or cross - track - dispersed fan beam . object 13 may be any object desired for inspection . some of these include , but are not limited to , sea floor , ship &# 39 ; s hulls , seawalls , and objects resting on the sea floor or tethered to it and floating objects . it is understood for the purposes of this application that the term โ€œ sea โ€ encompasses any body of water , fresh or salt in nature and of any size . in the case of ship &# 39 ; s hulls , the instant invention is arranged so that the illumination is directed to a side - facing surface or even an upwardly facing surface , such as the actual bottom of a ship . in addition , in the above in - water embodiments , the apparatus may be used to image tops , sides , or bottoms of objects of interest . the light detector 14 may comprise any type of known device to those of ordinary skill in the art such as still cameras , video cameras , computer digitization , and graphic representations . in addition , it is contemplated that a plurality of these means may be used jointly either solely or in combination to provide information storage and display means . the recording or detection device is preferably also movably mounted to allow for adjustments in the source - to - detector - separation and the viewing angle of the detector as desired . both real time imaging and data storage are the recording or detection device of choice in certain preferred embodiments . in addition , any known camera enhancement systems may be employed , these including filters and focusing means โ€” such systems are readily known and available to one of ordinary skill in the art . fig2 is a more detailed representation of the imaging system of the instant invention . in this embodiment , the illumination source 12 is directed downward toward the object 13 with the detector 14 . by virtue of their fixed relationship to one another , the height and geometric features of the object 13 can be represented both visually by the camera and digitally by virtue of the digital image generated by the calculations made by the equation : totalrows = total # of vertical imaging elements or pixels row #= current row where line is detected r = the distance between the source and the object being scanned s = the distance between the source and the detector f . o . v .= the field of view as seen by the detector in relation to the object ฯ† = the vertical angle between the illumination beam and the center of the field of view of the camera because the illumination source 12 and recorder or detector 14 are separated and not coaxial , backscatter effects from the illumination source due to the presence of particulates in the water are reduced . in addition , the calculated digital image offers a graphic representation of the image either in combination with the visual image or as a sole product of the imaging apparatus 10 . it will be understood that a total visual image is also possible without digitization . thus , when an illumination beam is fanned out across the vehicle path and viewed with a camera , the above equation can be developed in 3 - dimensions for each point where the fan beam hits a solid object . the 3 - d image of the object is calculated as the distribution of the progression in the values of r as each sequential line is recorded and assessed according to the equation above and the removal or subtraction of the height of the background , such as the actual sea floor . because the emitted light from the illumination source 12 can be adjusted to be a fine thin line for calculation purposes , the resultant image obtained can actually be a compilation of a large plurality of sequential lines calculated back to the r value with adjustments made for variation in intensity , these being a function of both the r value and a compensated value obtained algorithmetically . due to the fact that light within the water milieu is subject to varying amounts of scattering , the algorithmic adjustment is necessary to compensate for these scattering effects in the aqueous environment . an additional adjustment can also be made to incorporate navigational and / or vehicle speed data into the final positional equation so that a more accurate location is assigned to the object . this can be achieved by incorporation of navigational sensors or sensor systems which are attuned to respond to gsp , compass , gyro navigational systems , or others such systems as known to those of ordinary skill in the art . in addition , compensation for the pitching and rolling of the platform can also be taken into account so that the accuracy of the depiction of the image obtained is increased . by use of compensation , a more exact location is achieved with respect to a fixed object as well as the ability to locate objects on a moving surface also being possible . this could enable scanning of ship hulls for foreign objects relative to fixed positions along their extent while they are underway or drifting . in a further embodiment of the instant invention , as depicted in fig3 , a fluorescent analysis system or other alternative systems can be used either solely or in combination with the primary system . in this embodiment the camera or other detection means is replaced with a fluorescent detection means . this enables analysis of organic material present on the surface of the object . this particular knowledge is useful when a determination is necessary to ascertain the amount of time a particular surface has been in the aqueous environment with respect to other surfaces in the environment . for example , if an object has been recently added to a ship &# 39 ; s hull , the amount of organic material present in that portion of the hull will be less than on the surrounding surfaces , and if that object is not otherwise accounted for by recent repair activities , then its presence may be of a suspicious nature . this type of knowledge is very helpful when it is desired that ships entering a possible port be free of possible terrorist - connected problems or when a ship may have been in some other way compromised in its integrity . in order to effect the fluorescent embodiment of the instant invention , it is desired that the illumination source 12 illuminate at the desired wavelength . as known to those of ordinary skill in the art , for example , the use of a green light illumination at 532 nm is absorbed by organic material and fluoresced at 685 nm in the red range . thus , if a scanning system is used where a combination of green and red detectors are reading the backscattered light , a change in the concentration of the organic material changes the ratio of the green / red returned signals . in this application , as the surface is scanned , if a new object has been recently added , then the amount of red given off by that object goes to zero and the ratio instantly signals that a surface change is present . the illumination means itself may be tuned to a specific wavelength or wavelengths , or an appropriate filtering means may be used in concert with the source to tune the emitted light . this is also true of the detection or sensor means which may also have attenuating means connected with it to aid in selection of the desired wavelength . of course , to maximize sensitivity with less costly illumination sources and detectors , it is preferable to use filtering means at both the source and detection portions of the analytical equipment . this choice as well as the choice of the specific source , detector , and filtering means are well within the scope of ordinary skill in the art . it is further contemplated that the illumination source may also be a pulsed , strobe , or other โ€œ time - gating โ€ source as known to one of ordinary skill in the art . this time - gating enables synchronization of the source with the detection means so that effects of outside interference are minimized . by collecting light only during the appropriate positive pulses of the time - gates , appropriate speed of light in water , and appropriate distance to the surface of interest , the effects of ambient light on the system are reduced . motion blur effects can also be reduced in a time - gated system . it is also contemplated that a simpler version of the fluorescence system may be used without the dual ratio calculating capacity . thus a green - green system , a red - red system , a green - red system , a red - green system , or even multi - source illumination in the blue and green regions are possible with a red receiver / sensor . this would allow discrimination of the type of organism involved in bio - fouling which results in fluorescence . in addition a broad wavelength system may also be used for material analysis of the surface , excluding the presence of organic material and instead directed to the presence of foreign materials on the surface of the scanning target . it is further contemplated that any analytical system based on reflected light known to one of ordinary skill in the art may be incorporated into the instant system . these may be used for metals , plastics , fibrous materials , or other light detectable materials as desired by one of ordinary skill in the art . in addition to the single illumination source and single camera system of fig1 - 3 , a plurality of sources , cameras and / or detectors and , indeed , the combination of both a plurality of detection means and sources is also contemplated by the instant invention . the addition of a plurality of analysis systems in a multiple sensing system allows for the simultaneous assessment of a variety of surfaces or for the performance of multiple types of analysis at one time . this is particularly helpful when it is desired to scan the entire surface of an object without changing the direction of movement of the platform . an embodiment of a multiple sensing system is shown in fig4 . here , a single illumination source 12 supplies the light incident on object 13 which is reflected back to the two cameras 14 and 41 through lenses 42 and 43 . it is also contemplated that a dual source , single detection system may also be used . by use of this geometry , it is possible to examine a plurality of surfaces with the platform moving only once over the object &# 39 ; s location . this is particularly useful when the object or desired feature for study is then calculated back to a specific position or position on a an object . thus the need for a multiplicity of passes over the object is obviated and the inherent problems of having to compensate for the new directional parameters are not present . this affords the user a simpler method of not only performing the scan , but also allows for analyses to be made under a wider variety of conditions such as rough water or on free - floating ship &# 39 ; s surfaces . because a single set of operating parameters is presented for calculation purposes , the resultant system is easier to handle and the data thus obtained are more reliable . in addition , by use of a single scan over a multiple direction scan , the optimum single direction whether it is chosen due to water conditions or because of its relation to another feature or surface , may be examined without having to gather performance data multiple times with respect to direction . in the embodiment depicted in fig5 , an additional beam - splitting device 55 is inserted into the system . this device serves to physically divide the reflected signal into a plurality of equal components which are then conveyed into separate detectors such as 14 a and 14 b . this device may be a mirror type of device or any other reflective type of device available to one of ordinary skill in the art , such as an optical switch . this embodiment shows two detectors , but it is considered within the scope of the invention that any number of detection means may be chosen as desired by the particular application . if desired , each detector may be tuned to a different frequency or wavelength for simultaneous , multispectral imaging . in this fashion , 3 - d and fluorescent imaging can occur simultaneously . in addition , the location or locations of the cameras or detection means and the illumination source or sources may be moved to any desired location along the extent of the platform . this enables the artisan to stabilize the analysis system with respect to the movement of the platform and serves to reduce the effects of motion on the camera and illumination equipment . also , by selectively locating the camera with respect to the body of the platform , the effects of pitch and yaw in rough conditions can be minimized by using the platform body as a stabilizer . it is also contemplated that a plurality of geometries for the actual target of the illumination source 12 may be used . thus , the system 10 may be configured with respect to the platform for scanning not only under the platform as shown in fig1 , but also configurations for scanning above and sideways with respect to the longitudinal axis of the platform are contemplated . indeed , when a plurality of illumination and detection / camera systems are used , a plurality of combination of configurations is possible . the ability to locate the proper scanning system or systems , and subsequent configuration , is considered within the scope of ordinary skill in the art and can be chosen for the desired application . it is also contemplated that additional types of analysis systems may be added to the platform in order to vary the type of analyses made by the instant system . some of these include , but are not limited to , sonar systems , fluorescence systems , and other sensor based systems which may be used to monitor a variety of additional parameters simultaneously as chosen by one of ordinary skill in the art . in addition , when it is desired , other spectroscopic systems may also be used , including those operating in the uv , ir , and visible ranges . in order to effect the fluorescent or other spectroscopic embodiments of the instant invention , it may be desired that the illumination source 12 be tuned to give a desired wavelength . in addition , the detection system may also be tuned to screen out undesired backscattered light in order to optimize the readout of the system . also , any combination of tuned and untuned detectors and sources are considered within the scope of the instant invention and are a matter of choice as desired for particular applications . the tuning means may be an optical filter system or other means as known to those of skill in the art . indeed , if a laser source is used , the laser itself may be tuned or , in the interest of economy , a separate tuning means may be used in conjunction with the laser . as known to those of ordinary skill in the art , as discussed before , the use of a green light illumination at 532 nm is reflected back at 685 nm in the red range due to the presence of organic material . thus , if a scanning system is used where a combination of green and red detectors are reading the backscattered light , then a change in the concentration of the organic material changes the ratio of the green / red returned signals . in this way , as the surface is scanned , if a new object has been recently added , then the amount of red given off by that object goes to zero and the ratio instantly signals that a surface change is present . by use of appropriate optical filters and tuning means , the source and detectors may be optimized for a specific set of wavelengths . modification and variation can be made to the disclosed embodiments of the instant invention without departing from the scope of the invention as described . those skilled in the art will appreciate that the applications of the present invention herein are varied , and that the invention is described in the preferred embodiment . accordingly , additions and modifications can be made without departing from the principles of the invention . particularly with respect to the claims it should be understood that changes may be made without departing from the essence of this invention . in this regard it is intended that such changes would still fall within the scope of the present invention . therefore , this invention is not limited to the particular embodiments disclosed , but is intended to cover modifications within the spirit and scope of the present invention as defined in the appended claims .
6
referring to fig1 a tape cartridge 10 has a rectangular boxlike enclosure 11 consisting of a baseplate 12 and a cover 13 . journalled on shafts projecting from the baseplate are a pair of identical fixed reel hubs 15 and 16 and a fixed belt - driving roller 17 that is positioned between the reel hubs adjacent a first cutaway portion 18 of a first edge 19 of the enclosure . the first cutaway portion 18 allows the capstan of a recording device to contact the belt - driving roller . a length of magnetic recording tape 20 is convolutely wound on the reel hubs in opposite directions to provide two tape packs and is drawn past a pair of pins 21 and 22 and over three tape guide pins 23 , 23a , and 24 to extend along the first edge 19 across said first cutaway portion 18 and a second cutaway portion 25 at which the tape can be contacted by a recording head ( not shown ) of a tape recorder . near corners of the cartridge at either end of a second edge 27 that extends parallel to the first edge 19 of the enclosure 11 , first and second idler rollers 29 and 30 are journalled on fixed pins projecting from the baseplate 12 . near corners at either end of the first edge 19 are third and fourth idler rollers 31 and 32 that are identical to the first and second except that the third idler roller 31 is of slightly reduced diameter because of space constraints deemed necessary to make the tape cartridge of fig1 interchangeable with the 1 / 4 inch ( 6 . 35 mm ) von behren tape cartridge now on the market as mentioned above . an elastic , preferably polyurethane , belt 34 is stretchably entrained around the tape packs , the belt - driving roller 17 , and the idler rollers 29 , 30 , 31 , and 32 , the positions of which , as there shown , give the belt an angle of wrap of from about 170 to 230 degrees at the periphery of each of the tape packs . the pins on which the idler rollers are journalled are lubricated to maintain a predetermined drag on the elastic belt 34 . like that in the tape cartridge of the von behren patent , the belt - driving roller 17 has a larger diameter portion that extends over the tape path between the guide pins 23 and 24 to be contacted by a capstan ( not shown ) of a tape recorder . the bearing surface of each idler roller and each belt - driving roller is crowned to keep the belt centered without edge guides . a prototype of the belt - driven tape cartridge shown in fig1 had the following significant features : ______________________________________baseplate 12 aluminumthickness 2 . 5 mmcover 13 polycarbonate resinreel hubs 15 , 16 glass - filled polycarbonate resindiameter 40 mmmagnetic recording tape 20length 300 mwidth 6 . 35 mmmaximum tape pack diameter 73 mmbelt - driving roller 17diameter 17 . 4 mmlarger diameter portion 22 . 6 mmidler rollers 29 , 30 , 31 , 32 acetal resindiameter of 29 , 30 , 32 10 mmdiameter of 31 8 . 5 mmpins hardened steeldiameter 2 mmelastic belt 34 polyurethanelength 73 . 7 cmwidth 3 . 5 mmthickness 0 . 1 mm______________________________________ the installed elastic belt had a pre - tension of 3 . 3 nt and minimum and maximum angles of wrap at the reel hubs of about 170 and 230 degrees , respectively . the cartridge was operated at tape speeds up to 200 ips ( 5 . 1 m / sec ) and at start / stop accelerations up to 75 m / sec 2 while maintaining a tape tension of at least 0 . 17 nt throughout a large number of test cycles . at all times , both the belt and tape tracked precisely , thus producing a mirror - like appearance at the faces of the tape packs . the motor force to attain a tape speed of 2 . 3 m / sec was 0 . 7 nt . tested for comparison was a belt - driven tape cartridge of the von behren patent of the same size . its elastic belt had a pre - tension of 4 . 4 nt , because a pre - tension of at least about 4 . 4 nt was required to prevent failure in start / stop operation at tape speeds up to 90 ips ( 2 . 3 m / sec ). even at this higher belt pre - tension ( as compared to that of the cartridge of example 1 ), the tape tension dropped below zero at a speed of 3 . 4 m / sec . the motor force to attain a tape speed of 2 . 3 m / sec was 0 . 9 nt . after being driven at tape speeds up to 90 ips ( 2 . 3 m / se ), the tape packs had a mirror - like appearance , but not after being driven at tape speeds above 120 ips ( 3 m / sec ) which resulted in tape edges protruding from the faces of the tape packs , thus evidencing scatterwind . as compared to a belt - driven tape cartridge of the von behren patent , it is believed that the novel tape cartridge can be operated at lower belt tension because the greater wrap angles better guard against slippage . in fig2 line 50 charts the driving force and line 51 charts the tape tension while driving the tape of the cartridge of the example from one reel hub to the other at 2 . 3 m / sec . for comparison , line 54 charts the driving force and line 55 charts the tape tension of the cartridge of the von behren patent at the same tape speed . this comparison shows that the tape cartridge of the example as compared to that of the von behren patent , attains higher tape tension at significantly less driving force . to maintain uniform tape tension at the recording head , the tape tension ideally remains constant from bot to eot and back . comparison of lines 50 and 54 shows that the tape cartridge of the example came closer to this ideal than did the cartridge of the von behren patent . various changes and modifications to the embodiments of the invention as described will be readily apparent to one of ordinary skill in the art . the present invention therefore is intended to be limited only by the following claims .
6
the preferred embodiment is best described by summarizing generally its cooperating elements and providing details of certain elements as require for understanding . the stoker 10 of the present invention has a rearward upright mounted hopper 12 made of sheet metal , whose furnace side consists of a mounting flange 14 . the hopper accepts and stores coal ; typically rice - sized anthracite . at the bottom of the hopper is a covered pusher assembly 16 , cf . fig2 which is designed so as to be protected from the generally acidic atmosphere of combustion , particularly if lower grade or wet coal is used . the pusher has a variable stroke ( see fig6 of u . s . pat . no . 4 , 662 , 290 ), and is intermittently slidingly reciprocated ( see the &# 39 ; 290 fig3 a with pusher advanced ). by this means , the amount of infed coal is regulated and is squeezed compressingly through a port 18 ( fig3 ) in the flange , and into a restricting passageway 20 defined by an upper grate cover 22 roofing over the passage by bolt means 24 . the passageway whose sides are formed by upright sidewalls 26 of side rails 28 . the top of a planar fire grate 30 , which is projected horizontally , ensures that the coal will not heap or run away over the fire grate 30 , which grate has a multiplicity of air holes 32 ( fig2 ) disposed therethrough . the fire grate forms the top ( fig1 ) of an air box 36 ( fig3 ), which is forced air fed typically with a 100 cfm squirrel cage , blower ( fig1 ), whose air intake is made variable by a sidewall , swivel cover plate 40 . the blower is sealed at its output end to the intake of the air box 36 by a gasket 42 . the pusher assembly ( fig3 ) is a rectangular box - shaped component which has an upper casting 44 forming a top 46 . this assembly is described in relation to fig4 of potts u . s . pat . no . 4 , 662 , 290 , which is incorporated here by reference . cam 64 is attached to a gear motor 65 which typically turns at about 0 . 75 rpm . the rotation of cam 64 imparts a reciprocal sliding motion to the pusher assembly 58 , which , when installed , necessarily gives a vibratory motion to the hopper . an angle bar ( not seen ) when adjusted in its angle by the adjusting screw , regulates the length of the stroke of the pusher assembly and thereby regulates the amount of infed coal into the passage . the foregoing features are in the art . referring now to fig4 there is seen schematically , a partial longitudinal vertical section of a stoker 10 . stoker 10 is illustrated to include a highly perforated , planar grate 66 , bottom plate 68 , and upright sidewall 16 . coal advances from the hopper ( not seen ), through a lower sloped passage 18 , onto fire grate 66 . the action of a pusher plate through the earlier described camming action , enhances the progressive flow of rice coal in an even manner onto the fire grate 66 . with the forced air draft from the blower 38 , a substantially complete combustion of infed coal is accomplished . i have determined the enshrouded coal pusher ancillary feature of the potts patent &# 39 ; 290 works more effectively with the modified fire grate 66 of the present invention ( fig4 ). the compacted coal strips traverse grate 66 by a lateral pressure of successive coal feed strips from the described pusher mechanism . the resulting powder - like ash , with minimal unburned coal , drops off the distal transverse edge of the fire grate 66 to the ash pan ( not seen ). as depicted in fig2 the modules 33 a / b , forming the perforated grate 66 , may be fabricated in rectangular planar form , with the serial perforations already inscribed . by use of this variable dimension grate modules , the range of fire grate planar dimensions can be readily developed . in the end vertical view of fig5 taken along lines 5 โ€” 5 of fig4 the steeper trough defined by sidewalls 16 abutting the grate component is better seen . the resulting deeper fire bed effects improved combustion of the coal . in operation , at the start , after a fire is started on the grate , a defined quantity of rice coal is found on the step in front of the pusher which quantity is squeezed compressingly into the passage and held by its restriction . successive quantities of coal are deposited into the passage with each reciprocation cycle pushing the previous deposit further into the passage . the result of successive deposits is the ejection from the passage of a continuous strip of compressed coal of rectangular cross - section , which works its way across the plane of the fire grate , between the side rails . in this way , as combustion takes place on the grate , clinkers cannot form and ash is continuously cleared from the grate . as may be understood , the amount of coal delivered for burning can be varied from zero , to typically six 6 pounds , per hour based on cam size , at a maximum and forced air flow regulated accordingly to ensure complete burning . stack temperature measurements tend to show that up to 85 % use of generated btu &# 39 ; s is quite possible , demonstrating a high degree of efficiency . of course , the principles involved in the current invention would allow for the construction of a much larger capacity stoker than the one disclosed . comparative performance of coal combustion was conducted using a prior art stoker which provides a prior art inclined fire grate . such prior art stoker is depicted in fig3 a of potts &# 39 ; 290 patent and more graphically , in the prior art stoker of fig1 and 2 of the instant set of drawings . this is being compared with the substantially horizontal fire grate 30 a as described in the present inventive embodiment . the modified grate configuration is sold commercially as the model flat grate by keystone manufacturing co . of schuylkill haven , pa . 17972 . two successive runs of rice coal were loaded into respective hoppers , 12 and 12 a , with the initial coal weight load and total ash weight determined per each run . the burning of 40 lb . of rice anthracite in each stoker was so effected . the weight of collected ash from operation of the prior art pott stoker slant grate was 6 . 5 lb ., or 13 % by weight . a similar run was conducted for the presently taught horizontal grate with the same two weight measurements being made . the weight of ash was just 4 . 0 lb , or 8 % by weight of the coal charge . this is a 38 % reduction in the amount of disposable ash from the prior art stoker with the same amount of starting coal . this also indicates that 2 . 5 lb . more of rice coal were combusted in the stoker of the present invention . a second comparative run of the two stokers ( 50 lb . coal charge to each hopper ) produced comparable data , to 7 . 29 lb . for the prior art stoker , vs . 4 . 47 lb . of ash for the inventive stoker . the second run showed that that 2 . 82 lbs more ( 7 . 29 - 4 . 47 ) was combusted on the horizontal vs . the slant grate . the reduction in the ash amount was 38 . 5 % for the second run . qualitatively , the ash from the flat grate stoker was markedly more dense than the ash collected from the horizontal grate unit . a quality control expert concluded that the anthracite coal was burned more completely in the inventive stoker of the present invention . this was confirmed by the marked variance in the measurable ash from each run , confirming fuller coal combustion . since many modifications , variations , and changes in detail may be made to the presently described embodiments , it is intended that all matter in the foregoing description , accompanying drawings , and formal claims being interpreted as illustrative and not by way of limitation .
5
embodiments of the present invention relate to structure and operation of a current dissipation circuit . for example , referring to fig1 , a circuit 100 includes two circuit nodes 101 and 102 , and a current dissipation circuit 110 interposed therebetween to induce a current idiss . if the induced current idiss is positive , then the current dissipation circuit 100 draws current from the first circuit node 101 into one or more second circuit node ( s ) 102 . if the induced current idiss is negative , then the current dissipation circuit 100 provides current from the one or more second circuit nodes 102 into the first circuit node 101 . fig2 a and 2b each illustrate one example use of the current dissipation circuit 100 of fig1 . in each case of fig2 a and 2b , the first circuit node 201 ( corresponding to first circuit node 101 of fig1 ) is coupled to second circuit node ( s ) 202 ( corresponding to second circuit node ( s ) 102 of fig1 ) through the current dissipation circuit 210 ( corresponding to the current dissipation circuit 110 of fig1 ). in addition , protected circuit 220 is shown coupled to the first circuit node 201 . if excessive current 231 a is provided to the first circuit node 201 as illustrated in the case of fig2 a , then the current dissipation circuit 210 may draw current 232 a from the first circuit node 201 , thereby leaving a more manageable current 233 a to be dissipated within the protected circuit 220 . on the other hand , if excessive current 231 b is drawn from the first circuit node 201 as illustrated in the case of fig2 b , the current dissipation provides current 232 b to the first circuit node 201 , thereby once again leaving a more manageable current 233 b that is dissipated within the protected circuit 220 . excessive current may be provided to or drawn from the first circuit node 201 in cases of electrical overstress ( eos ) such as , for example , electrostatic discharge ( esd ) being applied to the first circuit node 201 or to a component electrically close to the first circuit node 201 . thus , the amount of current that passes through the current dissipation circuit is different depending on the state of the circuit , where the state is defined as controlled by a voltage applied at the first circuit node 101 , or at least by a voltage differential between the first and second circuit nodes 101 and 102 . in the case of fig2 a and 2b , the voltage at the first circuit node 201 controls how the current dissipation circuit 210 acts . accordingly , in the case of fig2 a and 2b , the first circuit node 201 may also be referred to in this description as a โ€œ monitored โ€ circuit node . conventional current dissipation circuits often come in the form of silicon or semiconductor controlled rectifiers ( scrs ). such scrs often operate in one of two states , often referred to as a โ€œ non - regenerative mode โ€ and โ€œ regenerative mode โ€. so long as the voltage at the monitored circuit node ( e . g ., circuit node 201 ) is within a safe range , the current dissipation circuit is in non - regenerative mode in which it draws or provides little , if any , current , and thus has little effect on the protected circuitry . if the monitored circuit node has a voltage that is outside of that safe range , the current dissipation circuit is triggered into the regenerative mode thus drawing or providing ( as appropriate ) substantial amounts of current . thus , when the voltage applied at the monitored circuit node transitions from within the safe range to outside the safe range , the current dissipation circuit begins immediately to dissipate relatively large amounts of current , thereby preserving the protected circuitry . this triggering can be relatively abrupt . the level of voltage required for such triggering can differ significantly depending on the application , since it is the application that will define the safe and unsafe ranges . accordingly , any mention of specific trigger voltages made herein is strictly for example purposes only , and not to restrict the scope of the invention . in accordance with one embodiment of the present invention , however , there may be an additional state in which a reverse voltage is applied between the first and second circuit nodes 101 and 102 . such a condition might be realistic in many applications . for instance , in battery powered circuitry , the battery may simply be applied with an unintentionally reversed electrical polarity . in those situations , the protected circuitry may be designed to provide some limited functionality given the reverse applied voltage . fig3 illustrates a current dissipation circuit 300 manufactured on a semiconductor substrate that may be used to protect circuitry from eos while permitting operation in a reverse voltage condition . for clarity , portions of the protection circuit 300 are illustrated in cross - section as they might be processed on a semiconductor substrate , while other portions are illustrated using simple circuit symbols . in addition to providing reverse voltage protection without triggering the current dissipation circuit 300 , the current dissipation circuit 300 may also be processed using a single - well technology in which all wells are manufactured of the same polarity ( i . e ., all n - type or all p - type ). in the illustrated case of fig3 , all of the wells are n - type . in this description and in the claims , an โ€œ n - type โ€ region or โ€œ n - region โ€ of a semiconductor material is said to have an n - type polarity and is a region in which there are more n - type dopants than p - type dopants , if there are any p - type dopants at all . on the other hand , a โ€œ p - type โ€ region or โ€œ p - region โ€ of a semiconductor material is said to have a p - type polarity and is a region in which there are more p - type dopants than n - type dopants , if there are any n - type dopants . generally , the p - type polarity is considered to be the opposite of the n - type polarity . the current dissipation circuit 300 includes two autonomous n - well regions 311 and 312 within a p - type semiconductor substrate 305 . an โ€œ n - well โ€ region is a well that is formed as an n - type region within a larger p - type region , as opposed to a โ€œ p - well โ€ region which is formed as a p - type region within a larger n - type region . techniques for forming n - well and p - well regions in a substrate are well known in the art and thus will not be discussed here . it will be understood that a p - type semiconductor region in contact with an n - type semiconductor region will cause a diode effect , with current being permitted to pass from the p - type region to the n - type region if the voltage at the p - type region is higher than the voltage at the n - type region . however , current is not permitted to flow from the n - type region to the p - type region absent a significantly high voltage at the n - type region with respect to the p - type region . this higher voltage is often referred to as a diode &# 39 ; s โ€œ breakdown โ€ voltage or โ€œ reverse breakdown โ€ voltage . occasionally , while describing the operation of the current dissipation circuit 300 of fig3 , reference will be made to the pnpnp stack 700 a of fig7 a , which illustrates the relationship of the p - type and n - type junctions of fig3 . likewise , fig8 a illustrates the relationship in the form of interconnected bipolar transistors 800 a . since fig7 a is used to describe only the principles of operation , the size of the n - type and p - type regions of fig7 a are not drawn to scale when compared to the corresponding components of fig3 . in fig7 a , the n - region 702 a corresponds to the n - well 311 of fig3 , and the n - region 704 a corresponds to the n - well 312 of fig3 . the p - region 703 a corresponds to the p - type substrate 305 of fig3 . note that in fig3 , there may be an n - channel field 314 surrounding the n - well 311 . the thickness of this n - channel field 314 may be controlled at the time of circuit manufacture to thereby control the breakdown voltage between the diode defined by the n - well 311 and the p - type substrate 305 . mechanisms for forming such an n - channel field of a specific width are known in the art and thus will not be described here . although not shown , an n - tub of higher n - type dopant density than the n - well 311 may be used internal to the n - well 311 to provide a further adjustment to the breakdown voltage . referring to fig7 a and 8a , the n - region 702 a of fig7 a corresponds to the n - type base terminal of the pnp bipolar transistor 801 a and the n - type collector terminal of the npn bipolar transistor 802 a , which are shown coupled together in fig8 a since the terminals are both formed using the same n - type region 702 a . also , the n - region 704 a of fig7 a corresponds to the n - type emitter terminal of the npn bipolar transistor 802 a and corresponds to the n - type base terminal of the pnp bipolar transistor 803 a . once again , these terminals are coupled together since they are formed of the same n - type region 704 a the p - region 703 a of fig7 a corresponds to the p - type collector terminal of pnp bipolar transistor 801 a , the p - type emitter terminal of pnp bipolar transistor 803 a , and the p - type base terminal of npn bipolar transistor 802 a , which are shown coupled together . referring back to fig3 , the n - well 311 is coupled to a first circuit node 301 through a first parallel combination of a p - type contact region 331 and an n - type contact region 332 . the net dopant density of each of the p - type contact region 331 and the n - type contact region 332 is greater than the net dopant density of the n - well 311 . this higher net dopant density is expressed in fig3 by the p - type contact region 331 being designated as โ€œ p +โ€, and the n - type contact region 332 being designated as โ€œ n +โ€. the โ€œ net dopant density โ€ is the concentration per unit volume of dominant dopant species ( n - type dopants if an n - type region , and p - type dopants if a p - type region ) minus the concentration per unit volume of minority dopant species ( p - type dopants if an n - type region , and n - type dopants if a p - type region ). referring to fig3 and 7a , the p + contact region 331 of fig3 corresponds to the p - region 701 a of fig7 a . the p - region 701 a is coupled to one terminal 721 a of the pnpnp stack 700 a . the terminal 301 of fig3 corresponds to the terminal 721 a of fig7 a . the resistor 303 of fig3 corresponds to the resistor 711 a of fig7 a having resistance r . referring to fig3 and 8a , the p + contact region 331 of fig3 corresponds to the p - type emitter terminal of the pnp bipolar transistor 801 a . the terminal 301 of fig3 corresponds to terminal 821 a of fig8 a . the resistor 303 of fig3 corresponds to the resistor 811 a of fig8 a . referring back to the illustrated embodiment of fig3 , the n + contact region 332 is coupled to the first circuit node 301 through a resistor circuit element 303 . in this description and in the claims , a โ€œ resistor circuit element โ€ is a resistor that is specifically formed as a desired portion of a circuit pattern . the p + contact region 331 is coupled to the first circuit node 301 without an intervening resistor circuit element in h the illustrated embodiment . a second n - well 312 is coupled to the second circuit node 302 through a parallel combination of a p + contact region 321 and an n + contact region 322 . in the illustrated embodiment , the third and fourth contact regions 321 and 322 are coupled to the second circuit node 302 without an intervening resistor element . in one embodiment , the first circuit node 301 is an i / o pad in which input and / or output signals may be applied . the second circuit node 302 may be a substantially fixed voltage supply such as , for example , ground . the substrate 305 may also be connected to ground . the remaining circuit elements 323 serve to reduce the breakdown voltage of the diode defined by the interface between the n - well 311 to p - type substrate 305 . referring to fig3 and 7a , the p + contact region 321 of fig3 corresponds to the p - region 705 a of fig7 a . the second circuit node 302 of fig3 corresponds to the circuit node 722 a of fig7 a . since the n - well 312 is connected through the n + region 322 to the circuit node 302 with some resistance , fig7 a shows a small resistor 712 a having resistance r 1 coupled between the n - region 704 a and the second circuit node 722 a . furthermore , since p - type substrate 305 may well be grounded , and the second circuit node 302 is grounded , the p - region 703 a is shown coupled to the second circuit node 722 a ( which may be grounded ) through resistor 713 a having resistance r 2 . the resistors r 1 and r 2 may be parasitic , as opposed to an expressed resistor circuit element in the design . however , the resistors may also be expressed design elements . referring to fig3 and 8a , the p + contact region 321 of fig3 corresponds to the p - type collector terminal of pnp bipolar transistor 803 a of fig8 a . the second circuit node 302 of fig3 corresponds to the circuit node 822 a of fig8 a . since the n - well 312 is connected through the n + region 322 to the circuit node 302 with some resistance , fig8 a shows a small resistor 812 a having resistance r 1 coupled between the n - type base terminal of pnp bipolar transistor 803 a and the second circuit node 822 a . furthermore , since p - type substrate 305 may well be grounded , and the second circuit node 302 may well be grounded , the p - type base terminal of npn bipolar transistor 802 a is shown coupled to the second circuit node 822 a through resistor 813 a having resistance r 2 . referring back to fig3 , in normal operation mode , the first circuit node 301 will carry a moderately higher voltage than the second circuit node 302 . in one secondary operation mode ( referred to hereinafter as โ€œ moderate reverse voltage mode โ€), the first circuit node 301 may carry a moderately negative voltage as compared to the second circuit node 302 . this might occur , for example , if the circuit was battery - connected , and the battery was incorrectly configured in reverse . in a third operating mode ( referred to herein as a โ€œ positive excessive voltage mode โ€), the first circuit node 301 has an excessive positive voltage as compared to the second circuit node 302 . in a fourth operating mode ( referred to herein as a โ€œ negative excessive voltage mode โ€), the first circuit node 301 has an excessive negative voltage as compared to the second circuit node 302 . these third and fourth operating modes might be characteristic of some electrical overstress ( eos ) condition such as , for example , electrostatic discharge ( esd ) occurring at the first circuit node 301 . referring to the voltage - current characteristic graph 600 of fig6 , the evaluation begins with the current applied through the current dissipation circuit being negligible . when the first circuit node 301 is driven to a voltage below that of the substrate 305 as in the moderate reverse voltage mode , the parasitic diode junction defined by the pn junction at the interface of the substrate 305 and n - well 311 becomes forward - biased . the negative voltage at the first circuit node 301 is not yet sufficient at this stage to overcome with breakdown voltage of the pn junction between n - well 311 and p + contact region 331 . however , after some amount of capacitive pre - charging , the current is free to flow from the p - type substrate 305 to the n - well 311 , through the n + contact region 332 , through the resistor 303 and to the first circuit node 301 . the presence of the resistor 303 , however , serves to limit the amount of current that flows through the resistor 303 . referring to fig7 a , in this moderate reverse voltage mode , current may flow from the p - type region 703 a to the n - type region 702 a , and through the resistor 711 a . referring to fig6 , in this moderate reverse voltage mode in which the voltage transitions from zero to somewhere below approximate 37 volts , the current remains still relatively small ( below 1 amp ) within region 601 . if the protected circuitry has functionality for operating under this moderate reverse voltage condition , the circuitry may continue to thus operate , since the current dissipation circuit is not dissipating significant amounts of current . if the reverse voltage were to increase , however , to the triggering voltage ( approximately 37 volts in the case of fig6 ), the current dissipation circuit would enter excessive negative voltage mode . in this case , the current through ( and the voltage across ) the resistor 303 becomes sufficiently large , that the diode defined by the p + region 331 and the n - well 311 enters avalanche breakdown . in this case , the current flowing from n - well 311 through p + contact region 331 and to the first circuit node 301 increased dramatically thereby causing the voltage at circuit node 301 to drop . this transition is represented in fig6 by region 602 . this avalanche breakdown voltage may be adjusted as needed for the application , as will be apparent to one of ordinary skill in the art after having reviewed this description . for instance , the dopant profile of the p + contact region 331 may be made less abrupt to increase the breakdown voltage , or more abrupt to decrease the breakdown voltage . furthermore , the n - channel field 314 thickness , and the n + region 323 position may be altered to adjust the breakdown voltage . there may be other parameters that may be adjusted at design time to control the breakdown voltage , as will be known to those of ordinary skill in the art after having reviewed this invention . for instance , the distance between n + region 323 and either the n - well 311 or the n - channel field 314 may be adjusted during the design to thereby move the breakdown voltage to a desired tolerance . once the current rises above a particular level , the current dissipation circuit enters a positive feedback mode in which more and more current is dissipated with only minor voltage changes present at the first circuit node 301 . this positive feedback mode will be further explained with respect to fig7 a and 8a and is represented in fig6 by region 603 . in negative excessive voltage mode , the current passing from p - region 703 a to n - region 702 a through resistor 711 a becomes large enough that the voltage drop across resistor 711 a exceeds the reverse breakdown voltage of the pn junction defined by the n - region 702 a and p - region 701 a . accordingly , significant current passes from the n - region 702 a through the p - region 701 a and to the first circuit node 721 a . referring to fig8 a , this means that the bipolar transistor 801 a activates , thereby permitting more and more current to pass between circuit nodes 821 a and 821 b as the negative voltage differential increases . accordingly , in excessive negative voltage mode , the current dissipation circuit 300 provides significant current to the first voltage node 301 , such that the current drawn from the first circuit node 301 does not cause excessive current to be drawn from the protected circuit itself as in the case of fig2 b . fig5 , on the other hand , illustrates one example of voltage - current characteristics of the current dissipation circuit 300 of fig3 in the case in which a positive voltage is applied on the first circuit node 301 as compared to the second current node 302 . so long as this positive voltage remains below a certain positive trigger voltage ( about 16 volts in the example of fig5 ), the current drawn by the current dissipation circuit 300 remains negligible due to the reverse bias of the parasitic diode between the n - well 311 and the p - type substrate 305 . referring to fig7 a , the reverse bias voltage at the pn junction defined by the n - region 702 a and the p - region 703 a is not sufficient to allow significant current to flow from n - region 702 a to p - region 703 a . accordingly , negligible current would pass through the current dissipation circuit 300 . when the positive voltage rises above the positive trigger voltage due to , for example , an eos event applied on the first circuit node 301 , the n - well 311 is charged up by the first circuit node 301 through the p + contact region 332 . referring to fig7 a , the n - region 702 a would charge up through p - region 701 a . in fig8 a , the current would flow from the emitter terminal into the base terminal of the bipolar transistor 801 a . this serves to activate the flow of current through the current dissipation circuit 300 into the second circuit node 300 . as represented by fig5 , for example , with this increasing current , the voltage at the first circuit node 301 drops significantly , thereby protecting the protected circuitry from excessive current flow in the same way as shown in fig2 b . as will be apparent to those of ordinary skill in the art , the polarities of each of the regions of fig3 , 7 a and 8 a , may be reversed . in other words , p - type regions may be replaced by n - type regions , and vice verse . fig7 b illustrates a stack 700 b which shows a series of npnpn regions 701 b through 705 b , which applies this principles to fig7 a , with resistors 711 b through 713 b corresponding to resistors 711 a through 713 a . fig8 b illustrates a bipolar transistor configuration 800 b that includes bipolar transistors 801 b through 803 b and resistors 811 b through 813 b , that applies this principle to fig8 a . fig4 illustrates a dual reference mode form of the current dissipation circuit 300 of fig3 . while the current dissipation circuit 300 of fig3 uses a single reference node 302 as a current source or sink , the current dissipation circuit 400 of fig4 includes two references nodes 402 and 404 to source current to or sink current from the circuit node 401 . the operation of the components 401 , 402 , 403 , 405 , 411 , 412 , 421 , 422 , 423 , 431 and 432 of fig4 will operate much as described above for the components 311 , 312 , 321 , 322 , 323 , 331 and 332 described with respect to fig3 in sourcing or sinking current to or sinking current from circuit node 401 using reference node 402 . however , the reference node 404 will operate using regions 441 , 442 and 443 within n - well 413 much as described above for the reference node 302 operating using regions 321 , 322 and 323 within n - well 312 . accordingly , dual reference node current dissipation is achieved . therefore , a current dissipation circuit is described that permits for proper and adjustable current dissipation while permitted normal reverse voltage operation . furthermore , this is achieved by using single well technology thereby simplifying the fabrication of the current dissipation circuit . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .
7
the present invention will be described in the following in connection with one embodiment thereof with reference to fig1 ( a ) and 1 ( b ). a digitized speech 13 coming from an input unit 1 is converted by a spectral analysis unit 2 into a feature pattern expressing the feature of the speech at a predetermined time interval so that it is outputted as a time series of feature pattern 14 . a candidates selection unit 3 receives the time series of feature pattern 14 to output an n - number ( e . g ., n = 5 ) of more significant candidates of the speech category thought to exist in the input . the n - number of candidates selected by the candidates selection unit 3 are sent to a pair generation unit 4 so that a n c 2 - number of pairs ( e . g ., n c 2 = 10 for n = 5 ) to be subjected to pair discrimination are generated and sent to a pair discrimination unit 5 . this pair discrimination unit 5 discriminates each of the n c 2 - number of pairs sent from the pair generation unit 4 , but the operations of only one pair will be described . if two candidates are categories a and b , the pair discrimination unit 5 first refers to a second memory 7 to examine what is the feature ( e . g ., plosiveness , fricativeness or buzzbar ) intrinsic to the phoneme acting as a cue for discriminating the categories a and b . now , if there are a k - number of the features ( as will be referred to as &# 34 ; acoustic cues &# 34 ;) intrinsic to the phoneme for cueing the discrimination of the categories a and b , it is examined whether or not each of the k - number of acoustic cues exists in the time series of feature pattern inputted . in accordance with the present invention , this processing is realized by a neural network . for the acoustic cue extraction processing , a first memory 6 stores in advance the name of each of the acoustic cues , the type of the neural network for extracting the acoustic cue , and connection coefficients . if it is found , as described above , with reference to the second memory 7 that there are k - number of acoustic cues for discriminating the categories a and b , the types of the neural networks and the connection coefficients are sequentially sent for the k - number of acoustic cues from the first memory 6 to a neural network calculation unit 51 to extract the acoustic cues . thus , a result of the extractions of the k - number of acoustic cues is obtained . this extraction result is sent to a membership function calculation unit 52 so that it is transformed into a membership function value . the calculation of this membership function value is accomplished by referring to a transformation table which is prepared in advance for each pair of each category in the second memory 7 for transforming the extracted values of the acoustic cues into the membership functional values . if the extracted value of the k - th acoustic cue is designated at o k and if the membership function value of the corresponding category a is designated at ฮผ a / b , k while the membership function value of the category b is designated at ฮผ b / a , k &# 39 ; the processings to be accomplished by the membership function calculation unit 52 can be expressed by : here , t a / b , k and t b / a , k designate transformation tables . thus , the k - number of membership function values for the speech categories a and b , respectively , are sent to a fuzzy logic or device 53 so that the certainties of the categories a and b are calculated considering their contrasts . if the certainties of the categories a and b considering their contrasts are expressed by ฮผ a / b and ฮผ b / a &# 39 ; the processings at the fuzzy logic or device 53 can be expressed by : ## equ1 ## by these processings , the certainties ฮผ a / b and ฮผ b / a of the categories a and b are determined to end the pair discriminations of the categories a and b . the pair discriminations of all the remaining pairs are accomplished by similar procedures . thus , the discriminated results 11 of the n c 2 - number of pairs are obtained from the pair discrimination unit 5 and are summarized in a decision unit 8 . on the basis of this summation , the n - number of candidates are ranked and outputted as a final result 12 . the input unit 1 is constructed , as customary , of a microphone , an analog amplifier and an analog / digital converter and will not need an additional explanation . the spectral analysis unit 2 may be effected by a filter bank analysis unit or a linear prediction ( lpc ) device , the former of which is used in the present embodiment , as will be specifically described with reference to fig2 . an input speech x n is inputted to a group of band pass filters ( bpfs ) 21 and 22 having different center frequencies and band widths . in the present embodiment , the bpf group has a two - stage structure so as to perform a frequency resolution . the bpfs 21 and 22 are made of quadratic butterworth type filters , which are constructed of two adders , four multipliers and two delays . the waveform of the bpf results is rectified by an absolute value transformer ( abs ) 23 and has its high - frequency components cut by an low pass filter lpf 24 , a re - sampling device 25 and an lpf 26 so that an output pattern x i is obtained . the lpfs are made to have a two - stage structure for effecting a frequency resolution like the bpf , and the lpfs 24 and 26 are of the butterworth type having a processing scale like the bpfs . in the present embodiment , the filter bank is exemplified by 16 channels , in which bands of 100 hz to 6 khz are logarithmically arranged . the bands and the arrangements of the filters could naturally be modified in various way . next , the candidates selection unit 3 will be described in the following . the candidates selection unit 3 can be exemplified by several methods , but the present embodiment employs the template matching of the prior art , by which the more significant candidates ( e . g ., an n - number of candidates having the shorter distances ) are outputted . the template matching may be exemplified by the method which is disclosed in &# 34 ; minimum prediction residual principle applied to speech recognition &# 34 ; by f . itakura et al ., ieee trans on acoustics , speech and signal processing , vol . assp - 23 , pp . 57 to 72 , feb . 1975 . in this disclosure , the likelihood ratio is used as distance measure , which may by exemplified in the present embodiment by the euclidean distance between the feature ( or spectral ) pattern . for the n - number of candidates obtained from the candidates selection part 3 , the pair generation unit 4 generates an n c 2 - number of all pairs of combinations considered . this is such a simple combinatorial algorithm that it can be easily realized by software , as specifically shown as a flow chart in fig3 . in fig3 the n - number of speech categories enumerated as the candidates are designated at c 1 , c 2 , - - - , and c n . according to this flow chart , the pairs of the speech categories are generated in the total number of n c 2 in the order of ( c 1 , c 2 ), ( c 1 , c 3 ), - - - , ( c 1 , c n ), ( c 2 , c 3 ), - - - , and ( c n - 1 , c n ). next , the specific structure of the pair discrimination unit 5 shown in fig1 ( b ) will be described in the following with reference to fig4 . the digitized speech 13 has its frequency analyzed by the spectral analysis unit 2 so that its output channels 10 - 1 to 10 - 16 are inputted to the pair discrimination unit 5 . in this pair discrimination unit 5 , the output of the spectral analysis 2 is added to a group of acoustic cue extraction processors 51 . these acoustic cue extraction processors 51 are exemplified by twenty kinds , as shown in fig5 to extract the various cues for expressing the features of the individual phonemes of the speech . other kinds can be conceived for the cues , and all the cues need not be used but can naturally be combined in various ways for the performances demanded and the languages to be analyzed . it also goes without saying that the outputs of the acoustic cue extraction processors may be fed as features to the input of the candidates selection unit 3 . the output of each acoustic cue processor 51 - i ( 1 โ‰ฆ i โ‰ฆ n ) is added through a transformation unit 52 - j - k ( 1 โ‰ฆ j โ‰ฆ m , 1 โ‰ฆ k โ‰ฆ n ) to a group of pair discrimination units 53 - l ( 1 โ‰ฆ l โ‰ฆ n ). each pair discrimination unit 53 - l ( 1 โ‰ฆ l โ‰ฆ n ) discriminates which of the phoneme pairs ai and bi the input speech may possibly be , and is prepared for each of the various kinds of pairs . the transformation unit 52 is used to transform the output result of the acoustic cue processor , which is stored in the transformation table in the second memory 7 of fig1 into a value optimum for discriminating each pair discrimination unit 53 . the transformation unit 52 can naturally be eliminated if the acoustic cue processor is provided especially for optimizing each pair discrimination unit . if , on the other hand , the discrimination performance of each pair discrimination unit can be slightly dropped , another modification can naturally be made by eliminating the transformation unit 52 . the outputs 11 - a , 11 - b , - - - , 11 - a m , and 11 - b m of the individual pair discrimination unit 53 are inputted to the decision unit 8 ( as shown in fig1 ). next , the structure of the acoustic cue processor will be described in more detail . letters a to e appearing in the &# 34 ; type &# 34 ; column of fig5 designate the types of the characteristics of the acoustic cue . the type a has steady characteristics ( i . e ., type 1 ). of the types b , c and d which are featured ( type 2 ) to have timely changes within a constant time width : the type b has a transition , the type c has a discontinuity , and the type d has a temporary feature . the type e is characterized ( type 3 ) in the timely order relations . in the present embodiment , the structures of the acoustic cue extraction processors are classified according to three types and are constructed of neural networks having respectively suitable basic structures . since the acoustic cues to be extracted are different even for the common type , the individual networks are so independently learned as to produce respectively proper values and naturally have different characteristics . the acoustic cue extraction processor of the type 1 is constructed of a hierarchical neural network such as shown in fig6 . this network has two hidden layers between the input layer i and the output layer o . this hierarchical neural network is described in detail together with its learning method in &# 34 ; parallel distributted processing &# 34 ; by d . e . rumelhart et al ., mit press , cambridge ( 1986 ). the connection coefficient between an input unit i i and the hidden first layer unit h ij is designated at w 1ji ; the connection coefficient between each unit h 1j of the hidden first layer and the each unit h 2k of the second layer is designated at w 2kj ; and the connection coefficient between each unit h 2k of the hidden second layer and the unit o of the output unit is designated at w 3k . moreover , each unit of each layer has its output o constructed , as follows : ## equ2 ## here , for i = 0 , j = 0 and k = 0 , the unit receives the constant 1 at the righthand end of each layer of fig6 and the threshold values of the individual units are equivalently obtained at w 1j0 , w 2k0 and w 30 . this acoustic cue extraction processor outputs , if it is learned to detect the fricativeness , for example , a value at or near 1 , when it receives a fricative , but a value at or near 0 in response to other inputs . next , the learning procedures will be described in the following . the learning may be accomplished either ( 1 ) by constructing the neural network having another but similar structure in advance on a computer or the like , and by extracting a connection coefficient after the learning and introducing it into the corresponding acoustic cue extraction processor ; or ( 2 ) by disposing such a structure in the apparatus as can perform the following learning procedures . this structure per se can be easily realized by those skilled in the art . generally speaking , however , long processing periods and mass data have to be prepared for the learning of the neural network so that the data may be inputted for the learning . it is , therefore , more economical to construct the neural network separately on a computer system , as has been described above , than to prepare the structure for each apparatus . even if the fundamental portion is separately learned in advance , the learning function has to be realized on the apparatus in case it is desired to provide a function to correct the characteristics for each speaker . ( of course , it is more general and desirable to realize the studying function on a general - purpose processor for the control of the apparatus and by software rather than by the use of the same portion as the acoustic cue extraction processor of the apparatus and to load down each acoustic cue extraction processor after the learning . the general procedures of the learning are described in detail on pp . 318 to 362 , vol . 1 , sec . 8 , the aforementioned publication of d . e . rumelhart . the present embodiment is devised to match the present object with reference to the procedures . for simplifying the following descriptions , the characteristics of the units of the individual layers expressed by ( 3 ) to ( 5 ) are equalized without losing the generalities , and the following formulas are made : here the letter p designates the layer number ( p = 1 , 2 , 3 and 4 ) from the input ; the letter q designates the unit number of the p - th layer ; and the letter r designates the unit number of the ( p - 1 ) th layer . moreover , the letters t 0 designate the target value of the learning . here , a number of learning sample speeches are prepared , and outputs through the filter bank 2 ( as shown in fig4 ) are extracted every ten milliseconds , at which the acoustic cues of fig5 are visually featured or not . now , in case the acoustic cue extraction processor for detecting the third fricativeness is to be studied , for example , the output of the filter bank 2 is added from the input of the same processor by using the speech thus prepared , and the learning target value t . sub . ฮธ is presented from the output side by &# 34 ; 1 &# 34 ; for the fricative and by &# 34 ; 0 &# 34 ; for the others . if an error between the output by the input signal of each unit and the target value given from the learning target is designated at ฮด , it is determined according to the aforementioned literature by : likewise , the error ฮด is determined up to the input layer . the correction ฮดw of the weight of each coupled portion is determined in the following manner by using that error : the value ฮฑ may be set by examining the converging rate experimentally . other acoustic cue extraction processors are also constructed to output the existence of the feature of each cue as a value within the range of [ 0 , 1 ] by a similar learning of the cue . thus , the acoustic cue extraction processors output the value &# 34 ; 1 &# 34 ; for complete features , the value &# 34 ; 0 &# 34 ; for incomplete features , and an intermediate value for other cases . the acoustic cue extraction processors of the types 2 and 3 are provided with the hierarchic neural networks having the structures shown in fig7 and 8 , respectively . the difference between the types 2 and 1 resides in that the structure of each layer of the neural network is apparently two - dimensional . although this two - dimensional arrangement is simply expressed in a plane for feasible illustration in fig7 the units are arranged two - dimensionally in each plane . the connections of the individual layers are identical to those of the case of the type 1 if the units in each layer are sequentially numbered from the end and are arranged in the same order in a row . thus , the interlayer processings and the learning procedures are identical to those of the type 1 . the difference inbetween resides in that the data inputs to the input layers are different . in fig7 more specifically , the oblique sixteen units are connected directly with the outputs of the filter bank 2 , and the data of the outputs of the filter bank of 10 , 20 , - - - , and 40 milliseconds before are inputted in the transverse direction . thus , the outputs of the individual channels of the filter bank are connected to five - stage shift registers , the outputs of which are inputted to the first - layer unit . since , however , the connections in the neural network are all equally coupled and since the degree of coupling is determined by the learning , the neural network has substantially the same structure as that of the type 1 from the standpoint that all the outputs of 16 ร— 5 = 80 data of the filter bank of 40 milliseconds before are inputted . the type 3 is similar in the structure of the input data to the type 2 but is different in the restrictions upon the coupling in the neural network . in order to illustrate this difference , fig8 presents a portion of the section of a predetermined one - channel output portion of the filter bank output . as seen from fig8 sixteen channels are arranged depthwise two - dimensionally . what is different from the type 2 is the restriction on the connections of the layers . for example , a unit h1 2 is connected not to a unit i 1 but to units i 2 to i 5 . a unit hi 3 is connected not to the units i 1 and i 2 but to the units i 3 to i 6 . the units i 1 , i 2 , - - - , and so on are shifted from the outputs of the channels of the filter bank for every ten milliseconds so that only the data of the timely - shifted portion is coupled to the more significant layers . except for this point , the type 3 is absolutely similar to the types 1 and 2 . the learning procedures can be realized absolutely irrespective of the result of the formula ( 10 ) except that the uncoupled units are always set at 0 . incidentally , the indications of the constant units for automatically learning the threshold values of the individual units are omitted from the illustrations of the types 2 and 3 , which can naturally be constructed like the type 1 . for convenience of explanation , the pair discrimination units 53 will be described in the following prior to the transformation units 52 . the pair discrimination units 53 use the outputs of the grouped acoustic cue extraction processors to discriminate how likely the input speech is one of two phonemes &# 34 ; ai &# 34 ; and &# 34 ; bi &# 34 ; if it is assumed to be either / p / or / k /. the information of using which acoustic cue is stored in the second memory 7 shown in fig1 . in case , therefore , the kinds of the phonemes contained in the speech of a language to be recognized are n , it is necessary to consider the pair discrimination units in the number of n = n c 2 of the combination of all pairs . it is , however , needless to say that the combination of the phonemes will raise few errors practically or the pairs containing the phonemes having a low frequency of appearance will raise few problems so that the errors can be ignored . in accordance with the information in the second memory 7 of fig1 which one of the acoustic cue extraction processors j is to be used is perceived ( by making the couplings of fig4 in advance ) to obtain the output o j of the acoustic cue used . in accordance with the table values of the transformation unit 52 of the second memory 7 , as conceptionally shown in fig9 all the acoustic cues using the values ฮผ ai / bi , j and ฮผ bi / ai , j indicating the certainties of the phonemes ai and bi are extracted to decide the fuzzy logic or for each of the phonemes ai and bi so that the decided fussy logic or is outputted as the pair decided result ฮผ ai / bj and ฮผ bj / ai of the phonemes ai and bi . these values are stored in related positions shown as the object positions in the table of fig1 . the fuzzy logic or is a processing for taking the maximum of the related membership functions and resorts to a method of selecting the most certain one of the related several acoustic cues . if all the phonemic pairs are thus examined , there can be created a two - dimensional table of the membership functions shown in fig1 . these values are the outputs of the pair discrimination unit 5 . in this table , the value ฮผ p / t is the membership function value expressing the certainty of the phoneme / p / in case the input is assumed to be the phoneme / p / or / t /. next , the result collection ( or final decision ) unit 8 shown in fig1 will be described in the following . the result collection unit 8 accomplishes the processing of deciding which of the input phonemes is the most certain from the values tabulated in fig1 . in the present embodiment , the fuzzy logic or is taken from the individual rows of the matrix shown in fig1 and is defined as a certainty corresponding to each row so that its maximum may decide the input phoneme . if the certainty of each phoneme is designated at ฮผ ai , the present processing can be expressed by : ## equ3 ## the category ( or phoneme ) giving the n - th value is accepted as the n - th recognition result . the fuzzy logic or is identical to the processor for determining the minimum of the membership functions so that the processing selects the value which is judged for each pair to be the phoneme to some extent at the worst . as has been described hereinbefore , according to the present embodiment , the processings of the pair discrimination pairs and the result collection unit 8 may be accomplished by remarkably simple algorithms and can be coped with using simple software . next , a second embodiment will be described in the following . the second embodiment has an overall structure similar to that of the first embodiment such that the pair discrimination units 53 of the first embodiment shown in fig4 are constructed of a neural network but do not include fuzzy processing . this neural network is shown in fig1 . if the outputs of the grouped acoustic cue extraction processors 51 or the transformation units 52 are inputted to input layers 111 - 1 to 111 - n , the pair discrimination outputs ( as designated at 11 - ai and 11 - bi in fig4 ) are outputted from output layer units 114 - 1 and 114 - 2 . the fundamental structure of the neural network is absolutely the same as that of the case of fig6 but is different in that the output layers are constructed of two units corresponding to the pair discrimination performances . in case the phoneme ai is inputted as the study input , the study target value t ai of the output layer unit at the ai side is set at 1 whereas the study target value of the other output unit is set at 0 . if the study input phoneme is bi , on the other hand , the setting is reversed . for either of the inputs ai and bi , the value 0 is set so that they may be studied like the case in which the neural network of fig6 is studied . in case the input phonemes are the best match , a value near 1 is outputted from the outputs of the incident side . in the non - coincident case , a value near 0 is outputted . fig1 shows a diagram for explaining a third embodiment . this embodiment is similar in its basic overall structure to the first embodiment but is different in that the result collection unit 8 of fig1 ( a ) is constructed of a neural network . the neural network of the present embodiment has each of its layers constructed apparently two - dimensionally such that an output layer 124 is composed of units corresponding to the number of the phonemes . to the individual units of an input layer 121 , there is inputted the two - dimensional data of fig1 or the outputs coming from the pair discrimination units of fig4 . since all the units of the input layer 121 are coupled to the individual units of the second layer , the data can be substantially deemed as one - dimensional data like the first layer of fig1 . likewise , the second and third layers are substantially made as a one - dimensional structure . for the study , the pair discrimination results of the input speech are inputted to the individual units of the input layer 121 so that the study target value of the units of the output layer 124 corresponding to the phonemes of the input speech may be set at 1 whereas the target value of the other units may be set at 0 . thus , the coupling weight may be studied in the procedures like those of the case in which the neural net of fig6 is studied . when the study is completed , the output of the output unit to be presumed as the phoneme of the input speech , if any , is as close as 1 . the category name corresponding to the unit for giving an n - th value near 1 can be deemed as the n - th recognition result . since the present invention has been constructed as described hereinbefore , it can attain the following effects . since the processing by the neural network or fuzzy processing is used , the ambiguity of the speech can be flexibly eliminated by the present invention to achieve a high recognition . since , moreover , these processings are used in the logic structure of the pair discrimination type , the causes for an error can be easily discovered and coped with to accumulate improvements in the performances . since , still moreover , an automatic studying function of the neural network is utilized , the processing suitable for each category can be automatically set to achieve a high recognition . since , furthermore , each portion is constructed in advance in a structurally divided manner , it can be assembled and studied stably and easily to eliminate the difficulty in the study of the large - scaled neural network system .
8
high boiling isocyanate compounds a ) are compounds and mixtures having isocyanate groups and boiling points of above 180 ยฐ c ., preferably above 250 ยฐ c . and more preferably above 300 ยฐ c . under standard conditions . under the reaction conditions the boiling temperature of isocyan ate component a ) must be at least 10 ยฐ c ., preferably 20 ยฐ c . and more preferably 40 ยฐ c . above the adjusted reaction temperature . suitable isocyanate compounds a ) are known and include compounds having aliphatically , cycloaliphatically , araliphatically or aromatically bound isocyanate groups . examples include monoisocyanates such as stearyl isocyanate and naphthyl isocyanate ; diisocyanates such as 1 , 4 - diisocyanatobutane , 1 , 6 - diisocyanatohexane ( hdi ), 2 - methyl - 1 , 5 - diisocyanatopentane , 1 , 5 - diisocyanato - 2 , 2 - dimethylpentane , 2 , 2 , 4 - or 2 , 4 , 4 - trimethyl - 1 , 6 - diisocyanatohexane , 1 , 10 - diisocyanatodecane , 1 , 3 - and 1 , 4 - diisocyanatocyclohexane , 1 , 3 - and 1 , 4 - bis ( isocyanatomethyl ) cyclohexane , 1 - isocyanato - 3 , 3 , 5 - trimethyl - 5 - isocyanatomethyl cyclohexane ( isophorone diisocyanate , ipdi ), 4 , 4 โ€ฒ- diisocyanatodicyclohexyl methane , 1 - isocyanato - 1 - methyl - 4 ( 3 )- isocyanatomethyl cyclohexane ( imci ), bis ( isocyanatomethyl ) norbornane , 2 , 4 - and / or 2 , 6 - diisocyanatotoluene ( tdi ), 2 , 4 โ€ฒ- and / or 4 , 4 โ€ฒ- diisocyanatodiphenylmethane and higher homologs , 1 , 5 - diisocyanatonapbthalene and dipropylene glycol duisocyanate ; truisocyanates and / or higher functional isocyanates such as 4 - isocyanatomethyl - 1 , 8 - octane diisocyanate ( nonane truisocyanate ), 1 , 6 , 11 - undecane truisocyanate ; and mixtures of these isocyanate compounds . modified isocyanate compounds prepared from the preceding duisocyanates and triisocyanates by oligomerization reactions , such as trimerization , are also usable . mixtures of the modified and unmodified isocyanates may also be used . compounds containing aromatically bound isocyanate groups are preferably used . polyisocyanates of the diphenylmethane series having a bicyclic content ( total of 2 , 2 -, 2 , 4 - and 4 , 4 - diphenylmethane diisocyanate ) of at least 85 wt . %, based on the total weight of the isocyanate component a ), are preferably used as the isocyanate component a ). it is essential that the isocyanate component a ) has an hc content ( hydrolyzable chlorine compounds content ) of at least 50 ppm , preferably at least 150 ppm and more preferably at least 300 ppm . this can be ensured either by an existing sufficiently high chlorine content of the isocyanate component a ) due to its method of preparation , or by the addition of compounds which contain hydrolyzable chlorine . examples of such compounds are benzoyl chloride , terephthaloyl dichloride and isophthaloyl chloride . the hydrolyzable chlorine content of the isocyanate component a ) may be determined by known methods . any aliphatic , cycloaliphatic or aromatic compounds having a primary amino group and where the monoisocyanates forming as reaction products can be removed by distillation from the reaction mixture under the reaction conditions , may be used as low molecular weight monoamines b ). the monoamines may contain , in addition to the amino group , other functional groups that are inert to isocyanate groups under the reaction conditions . the monoamines may be directly used at the purity available industrially without special purification . examples of suitable monoamines include c 3 - c 18 - alkylamines such as the isomeric butylamines , pentylamines , hexylamines ,. heptylamines , octylamines , nonylamines , decylamines and dodecylamines ; c 3 - c 18 - alkylene amines such as alkylamine ; monoamines based on optionally unsaturated , long - chain fatty acids ; c 5 - c 18 - cycloalkylamines such as cyclohexylamine ; aromatic amines such as phenylamine , ortho - and parafluorophenylamine , ortho - and para - chlorophenylamine and naphthylamine ; alkyl phenylamines ; and alkyl phenylamines containing halogen atoms . the carbon chains of the amines may be contain oxygen and / or sulfur atoms in the form of ether or thioether groups . monoamines containing an aromatically bound amino group are preferably used . anilines containing halogen are especially preferred . monoisocyanates c ) prepared according to the invention are derived from monoamines b ) and must be distillable under the specified reaction conditions . they have a boiling point of at least 70 ยฐ c ., preferably at least 110 ยฐ c . and at most 320 ยฐ c ., preferably at most 240 ยฐ c ., at standard pressure . the molecular weight of these monoisocyanates is generally 83 to 270 . in the process according to the invention high boiling isocyanate component a ) and monoamine component b ) are reacted at a molar ratio of isocyanate groups to primary amino groups of at least 4 : 1 , preferably 5 : 1 to 20 : 1 and more preferably from 6 : 1 to 8 : 1 , and at a maximum temperature of 180 ยฐ c ., preferably 80 ยฐ c . to 160 ยฐ c . and more preferably 120 ยฐ c . to 140 ยฐ c . monoamine component b ) may be incorporated in pure form or in a blend with other non - reactive compounds . the monoamine is preferably incorporated as a solution in a solvent that does not boil under the process conditions . the solution preferably has a concentration of 10 to 90 %, more preferably 40 to 60 %. examples of suitable solvents include high boiling trialkyl phosphates or tritoluyl phosphates . the reaction temperature and bottom temperature in the reaction vessel is limited to a maximum of 180 ยฐ c . working is preferably at reaction temperatures of from 100 ยฐ c . to 170 ยฐ c . and particularly preferably from 120 ยฐ c . to 160 ยฐ c . the removal by distillation of monoisocyanate c ) may take place under ambient pressure or at reduced pressure , preferably at reduced pressure and more preferably at a pressure of 5 to 200 mbar . the process according to the invention enables monoisocyanates to be industrially prepared simply and at yields of over 70 %. the bottom product that forms may be handled without difficulty . the purity of monoisocyanates c ) is preferably over 90 %, more preferably over 99 %. therefore , monoisocyanate c ) may be used directly in modification reactions and as intermediates without further purification . the invention is further illustrated but is not intended to be limited by the following examples in which all parts and percentages are by weight unless otherwise specified . the hydrolyzable chlorine content was determined by potentiometric titration . methanol was added to the sample for analysis and the urethane reaction was carried out under reflux for 10 minutes . after dilution with water , the resulting mixture was then hydrolyzed by boiling under reflux . after acidification with nitric acid and addition of a known amount of sodium chloride , the ionic chlorine formed was titrated argentometrically with a silver nitrate standard solution . the titration was carried out with incremental reagent addition and automatic end point evaluation with drift control ( equilibrium titration ). 420 kg of a technical grade polyisocyanate of the diphenylmethane series having a bicyclic content of 90 wt . % ( desmodur mdi 90 / 10 , commercial product of bayer ag , nco content 32 %, viscosity 13 mpa . s , hc content 357 ppm , determined potentiometrically ) were drawn under vacuum at room temperature into a reaction vessel with a distillation unit , and were heated to 130 ยฐ c . after purging with nitrogen . at this temperature 53 . 7 kg of n - hexylamine were incorporated from a supply into the reactor such that the reactor internal temperature did not rise above 150 ยฐ c . ( clearly exothermic reaction , cooling essential ). when the hexylamine addition was finished the boiler internal temperature was adjusted to 160 ยฐ c ., and careful evacuation took place until a reflux was clearly observed . the reflux divider of the distillation unit was then adjusted to 5 parts take - off and 1 part reflux . the hexyl isocyanate that formed was distilled off . based on the amount of distillate formed , the boiler internal pressure was carefully reduced to 20 mbar during the distillation . towards the end of the distillation the reflux ratio was adjusted to full take - off . after approx . 10 hours the reaction / distillation was complete , and after purging with nitrogen , the bottom product was cooled to 120 ยฐ c . at this temperature the bottom still flowed well and was removed by the application of a slight over - pressure and filled into containers . 2 , 100 g of 4 , 4 โ€ฒ- diisocyanatodiphenylmethane ( hc content & lt ; 10 ppm , determined potentiometrically ) were charged into a 4 , 000 ml four - necked flask ( equipped with a stirrer , internal thermometer and distillation bridge ), melted and heated to approx . 130 ยฐ c . at this temperature 270 g of n - hexylamine were incorporated . the temperature increased to 160 ยฐ c . when the addition was finished careful evacuation took place , and the monoisocyanate obtained was removed by distillation . the reaction temperature was increased to 190 to 195 ยฐ c . after a reaction time of 5 hours the reaction batch was so highly viscous that it could not be removed from the four - necked flask . despite these severe conditions the yield of hexyl isocyanate removed by distillation was 83 %, which is less than the production trial ( see example 1 ). the reaction flask could not be cleaned after the trial was over and was discarded with its contents . although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims .
2
explanation will be given below on embodiments of the present invention with reference to drawings . it should be noted that , โ€œ outgoing power โ€ hereafter represents the power of laser light outwent from an objective lens . in addition , โ€œ emission power โ€ represents the power of laser light which a laser diode emits . fig1 a is a block configuration diagram showing one embodiment of an optical disc apparatus according to the present invention . here , descriptions on blocks not participating directly to the present embodiment were omitted . a microcomputer 101 performs communication with a host apparatus such as a pc through an interface such as atapi not shown . in addition , the microcomputer 101 performs emission control for a laser driver 102 , and the laser driver 102 outputs current to drive a laser diode 103 corresponding to a control of the microcomputer 101 . the laser diode 103 emits an emission power corresponding to a drive current of the laser driver 102 . a power monitor 105 detects an emission power of the laser diode 103 via a beam splitter 104 , converts the detected power to a voltage value , and outputs it to the microcomputer 101 . the emission power detected here is a total light intensity before splitting the laser light using a diffraction grating 106 . the diffraction grating 106 switches the laser light to one beam and three beams corresponding to a control of a diffraction grating driver 107 . as a method for switching the one beam and the three beams , for example , it is considered a method for inserting and pulling out the diffraction grating 106 in a laser light path . an element to switch the laser light to the one beam and the three - beams is not especially limited to by the inserting and pulling out the diffraction grating mechanically in this way , but the laser light may be switched to the one beam and the three - beams by switching characteristics of an optical element by an optical element or an electrical element . an objective lens 108 focuses the laser light onto an optical disc 109 . the laser light reflected at the optical disc 109 retains disc information as a light intensity . in performing reproduction , the laser light is reflected by a polarizing beam splitter 110 , and focused onto the detector 111 . the detector 111 detects the laser light focused , and outputs a signal corresponding to the intensity of the laser light to a waveform equalizer 112 . the waveform equalizer 112 performs a processing such as equalization , amplification for a signal waveform detected by the detector 111 , and outputs the signal waveform to a signal processor 113 . the signal processor 113 performs a signal processing such as analogue / digital conversion , equalization , and decoding , for the signal waveform output by the waveform equalizer 112 , and outputs a data thus decoded to the microcomputer 101 . in an example of fig1 a , blocks 102 to 108 , 110 and 111 within a frame indicated by a dotted line shall be mounted on an optical pickup . it should be noted that , although fig1 a showed an example of mounting the laser diode 103 and the power monitor 105 in a separated way , a power monitor may be packaged , and a laser diode which outputs the detected power to the microcomputer 101 may be used . in addition , in the present specification , an example of controlling the diffraction grating 106 by the diffraction grating driver 107 was shown , however , the diffraction grating 106 may be driven by the microcomputer 101 without using the diffraction grating driver 107 . in addition , although an example of the diffraction grating 106 was shown as an element to split the laser light , however , the laser light may be split using a liquid crystal element or the like . fig1 b is an example representing the detector 111 in detail . the detector 111 is provided with a main detector 114 which receives reflected light of the main beam , and a sub - detector 115 which receives reflected light of the sub - beams . fig2 a shows a schematic view of a light spot focused onto an optical disc when the function of the diffraction grating was made effective . on the optical disc , a groove 201 and a land 202 are engraved , and they function as guides to make the optical spot followed . 203 and 204 each represents the optical spot of the main beam and the sub - beams split using the diffraction grating , and the light intensity ratio of both is typically about 15 : 1 . reflected light of the main beam is received at the main detector 114 of fig1 b , and reflected light of the sub - beams is received at the sub - detector 115 . because a reproduced signal is generated only at the main - detector 114 , when the light intensity ratio of the main beam to the sub - beams is smaller than a designed value , reduction of reproduction performance is incurred . on the other hand , when the light intensity ratio of the main beam is higher than a designed value , data which has been recorded on the optical disc could be erased . the sub - detector generates a sub - push - pull signal in the case of the dpp method , and in the case of the three - beam method , it generates a tracking error signal . because only one beam outwent from the objective lens , when the function of the diffraction grating was made ineffective , only the spot 203 by the main beam is light - focused on the optical disc . here , although an example in which data is recorded in the groove 201 was shown in the present specification , it may be recorded in the land 202 , or it may be recorded in both of the groove and the land . in addition , although fig2 a represented an example of a recording - type optical disc , in the case of a read - only compact disc , pits 205 function as a guide as represented in fig2 b . fig3 represents an example of a flow chart from inserting an optical disc into the optical disc apparatus according to the present invention to starting reproduction . here , descriptions on actions not directly participating to the present embodiment were omitted . in a step 301 , a disc is loaded . in a step 302 , laser light is emitted . in a step 303 , the function of the diffraction grating is made ineffective , and one beam outgoes from the objective lens . the outgoing power in this case can be adjusted to a desired power of , for example , 0 . 3 mw or the like , by monitoring with the power monitor 105 in fig1 a . after starting servo - control such as focus or tracking in a step 304 , an amplitude of a reproduced signal is measured in a step 305 . in a step 306 , the function of the diffraction grating is made effective to form the three beams . in a step 307 , the reproduced signal amplitude is measured , while maintaining the emission power of the laser in the step 302 as it is . by comparing the reproduced signal amplitude in this case and the reproduced signal amplitude measured in the step 305 , the light intensity ratio of the main beam and the sub - beams can be obtained . for example , when the reproduced signal amplitude measured in the step 305 was 300 mv , and the reproduced signal amplitude measured in the step 307 was 250 mv , it is understood that the light intensity ratio of the main beam and the sub - beams ( sub : main : sub ) is 1 : 10 : 1 . in a step 308 , the outgoing power of the laser light is adjusted , based on the light intensity ratio thus obtained . as described above , when the light intensity ratio of the main beam and the sub - beams is 1 : 10 : 1 , for example , in order to outgo the main beam at an intensity of 0 . 3 mw , the total outgoing power may be adjusted so as to be 0 . 36 mw . after performing the above adjustment , reproduction is started in a step 309 . here , a place for measuring the reproduced signal amplitude may be a user data region , or may be a place where a signal for test has been recorded in advance such as an opc region or a pre - write region . as described above , the light intensity ratio of the main beam and the sub - beams can be obtained by switching the function of effective - ineffective of the diffraction grating and reproduction at the desired reproduction power is possible , so that the quality or the reliability of reproduction can be improved . in addition , a data reproduced by switching the one beam and the three beams may be a user data in the user data region , or may be a data in a trial writing region used in the adjustment of the recording power or the like . fig4 shows an example of a flow chart representing actions of the optical disc apparatus according to the present invention , when temperature varies from starting reproduction . in a step 401 , reproduction is started . in a step 402 , an internal temperature of the optical disc apparatus is measured , for example , with a sensor installed inside a drive , or a sensor installed at the optical pickup . a specific portion for measuring the temperature comprises the peripherals of an element with high temperature dependency , such as the laser diode , the diffraction grating , the liquid crystal element . when the temperature measured in the step 402 has changed equal to or more than a specified value of temperature measured at the previous measurement time , the diffraction grating is made ineffective in a step 403 , and the reproduced signal amplitude is measured in a step 404 . in a step 405 , the diffraction grating is made effective , and the reproduced signal amplitude is measured in a step 406 . by comparing the reproduced signal amplitude in this case and the reproduced signal amplitude measured in the step 404 , a light intensity ratio of the main beam and the sub - beams can be obtained . in a step 407 , outgoing power of the laser light is adjusted , based on the light intensity ratio obtained , and the reproduction is started in a step 408 . for the measurement of the reproduced signal amplitude , the user data region may be used , or it may be performed by transferring it to a place where a signal for testing has been recorded in advance , such as the opc region , or the pre - write region . in addition , before making the diffraction grating ineffective in the step 403 , the emission power of the laser diode may be decreased to a predetermined value . this is because of the prevention of deterioration of the signal recorded in the disc due to an increased outgoing power by outgoing in one beam . although , in the present specification , an example of adjusting the outgoing laser power when the temperature changed was shown , the adjustment may be performed also when the action was changed from recording to reproduction . this is because the recording is considered to increase the temperature of the laser diode and change the emission characteristics . it should be noted that , the present invention should not be limited to the above embodiments , and should contain various modified embodiments . for example , the above embodiments are those for explaining the invention in detail so as to explain the present invention for easy - understanding , and therefore , the present invention should not necessarily be limited to the one provided with all configurations explained . in addition , it is possible to substitute a part of a configuration of a certain embodiment with a configuration of other embodiment , and it is also possible to add a configuration of other embodiment to a configuration of a certain embodiment . in addition , it is possible to add , delete or substitute other configurations for a part of a configuration of each embodiment .
6
monoolefins suitable for the practice of this invention include c 2 to c 20 hydrocarbons and halohydrocarbons which may be type i olefins and haloolefins having the general formula r - ch โ• ch 2 and type iii olefins and haloolefins having the general formula ## str2 ## wherein r and r &# 39 ; are independently selected from the group consisting of halogen ; hydrogen ; straight and branched - chain alkyl radicals ; aryl ; alkylaryl ; aralkyl and cycloalkyl radicals having from 1 to 18 carbon atoms and halo substituents of said radicals . non - limiting examples of suitable type i olefins and haloolefins include : ethylene ; propylene ; 1 - butene ; 1 - pentene ; 1 - hexene ; 4 - methyl - 1 - pentene ; 1 - heptene ; 4 , 4 - dimethyl - 1 - pentene ; 1 - octene ; 1 - nonene ; 1decene ; 3 , 7 - dimethyl - 1 - octene ; 1 - dodecene ; 1 - tridecene ; 1 - tetradecene ; 1 - octadecene ; styrene ; 4 - methyl styrene ; vinyl cyclohexane ; 2 - vinyl norbornene ; vinyl naphthalene ; vinyl chloride ; allyl chloride ; 4 - chloro - 1 - butene ; 4 - chlorostyrene ; 4 - chlorovinyl cyclohexane ; and 4 - chloroallyl benzene . non - limiting examples of suitable type iii olefins and haloolefins include : isobutylene ; 2 , 3 - dimethyl - 1 - butene , 2 , 4 , 4 - trimethyl - 1 - pentene ; 2 , 6 - dimethyl - 1 - octene ; 4 - isopropenyl toluene ; isopropenyl cyclohexane ; ฮฑ - methylstyrene ; ฮฑ - chlorostyrene ; 4 - chloro - ฮฑ - methylstyrene ; and vinylidene chloride . the general formulae used to illustrate the types of olefins suitable for the practice of this invention are based on the boord classification described by schmidt and boord in j . a . c . s . 54 , 751 ( 1932 ). c 1 to c 20 acyclic or alicyclic esters of acrylic acid in which the ester radical moiety is free of olefinic unsaturation may be illustrated by the general formula ch 2 โ• ch - coor wherein r is selected from the group consisting of straight or branched chain primary alkyl radicals , arylalkyl radicals and cycloalkyl alkylene radicals . non - limiting examples are : methyl ; ethyl ; propyl ; n - butyl ; isobutyl ; n - amyl ; hexyl ; 2 - ethylhexyl ; n - octyl ; isooctyl ; derived from the oxonation of mixed heptenes followed by hydrogenation ; isodecyl ; 3 , 5 , 5 - trimethyl hexyl ; n - dodecyl ; tridecyl ; tetradecyl ; heptadecyl ; octadecyl ; benzyl ; and hexahydrobenzyl radicals . c 4 to c 10 acylic conjugated diolefins include 1 , 3 - butadiene ; isoprene ; cis and trans piperylene ; 1 , 3 - hexadiene ; 2 , 3 - dimethyl - 1 , 3 - butadiene ; 3 , 7 - dimethyl - 1 , 3 - octadiene and 3 -( 4 - methylpentyl )- 1 , 3 - butadiene . catalyst compositions suitable for the practice of this invention comprise , in combination , a lewis acid , a vanadium compound and a free - radical source . while a variety of lewis acids may be used , preferred are organoaluminum halides having the general formula al r m x n wherein r is a monovalent hydrocarbon radical selected from the group consisting of c 1 to c 12 alkyl , aryl , alkylaryl , arylalkyl and cycloalkyl radicals , m is a number from 1 to 3 , x is a halogen selected from the group consisting of chlorine , bromine and iodine and the sum of m and n is equal to three . non - limiting examples of useful organoaluminum halides include et 2 al cl , et al cl 2 , et 1 . 5 al cl 1 . 5 used either alone or in admixture with one another . useful vanadium compounds have the general formula vo z x t wherein z has a value of zero or one ; t has a value of 2 to 4 ; and x is independently selected from the group consisting of chlorine , bromine , iodine , acetylacetonates , haloacetylacetonates , alkoxides and haloalkoxides . non - limiting examples include vcl 4 ; vocl 3 ; vo ( oet ) 3 ; vocl 2 ( obu ); v ( acac ) 3 ; vo ( acac ) 2 ; and vocl 2 ( acac ) where ( acac ) is an acetylacetonate unit . while free - radical generators such as ultra - violet light and high - energy radiation may be used as the source of free - radicals in the catalyst system of this invention , preferred are organic peroxides , hydroperoxides , peracids , peroxyesters and certain azo compounds . non - limiting examples include benzoyl peroxide ; lauroyl peroxide ; acetyl peroxide , t - butyl peroxide , t - butyl peracetate . t - butyl peroxypivalate , cumene hydroperoxide , 2 - methyl pentanoyl peroxide , dicumyl peroxide and 2 , 2 &# 39 ; azo bis ( isobutyronitrile ). the concentration of the individual catalyst components may be varied over a wide range depending on the reactivity of the individual monomers . suitable mole ratios of acrylate ester per mole of organoaluminum compound may range from 1 to 2000 or higher . preferred is a ratio of from 5 to 1500 . most preferred is a ratio of from about 10 to 1000 mols of acrylate ester per mol of organoaluminum halide compound . the molar ratio of the organoaluminum compound to the vanadium compound may also be varied over a wide range . usable molar ratios are from 1 to 100 mols of organoaluminum compound per mol of vanadium compound . preferred is a range of from about 2 to 50 . most preferred is a molar ratio of from 3 to about 30 mols of organoaluminum compound per mol of vanadium compound . the peroxide component is similarly variable over a wide range of mol ratios . suitable ratios range from 10 to 2000 mols of acrylate ester per mol of peroxide . preferred is a ratio of from about 20 to 1000 . most preferred is a ratio of from 30 to 500 mols of acrylate ester per mol of peroxide . suitable media for dissolving or dispersing the catalyst components and polymeric reaction products include the general group of aliphatic and aromatic petroleum hydrocarbons and halogenated hydrocarbons . acyclic c 8 or lower straight or branched chain saturated hydrocarbons may be used with certain olefins and acrylate esters but c 5 to c 9 alicyclic or aromatic hydrocarbons are preferred . halogenated hydrocarbons having from one to six carbon atoms are also useful . choice of a particular solvent or mixture of solvents will depend on the process conditions , e . g . whether a homogeneous solution process , suspension or slurry process or cement suspension process is used . in a homogeneous solution process for the production of a high - molecular weight interpolymer , the concentration of polymer in the cement is usually limited to a range of 5 to 10 weight percent since higher concentrations require excessive power input to insure good mixing , efficient heat exchange is difficult to achieve and the high viscosity of the solution at the temperatures which are employed causes sticking and fouling of the reactor . in a slurry process in which the monomers and catalyst components are soluble in the solvent but in which the polymer is not , higher concentrations of polymer in the range of 10 to 20 wt . percent may be attained . similar concentrations may be attained in a cement - suspension process in which a mixture of solvents is chosen which yields two phases ; a cement phase of polymer swollen with monomers and solvent dispersed in a continuous second phase of essentially pure solvent containing a small amount of monomers . any of the above solvent systems may be used in batch , semi - continuous of fully continuous processes . non - limiting examples of suitable solvents include : butane ; pentane ; cyclopentane ; hexane ; heptane ; isooctane ; benzene ; cyclohexane ; toluene ; mixed xylenes ; cumene ; methylene chloride ; dichloroethane ; orthodichlorobenzene and fluorinated or chlorofluorinated c 2 to c 4 acyclic hydrocarbons . solvents which are known to form stable complexes with any of the catalyst components , particularly the lewis acid or the vanadium compound are undesirable and should be avoided . the interpolymers of this invention may be prepared in batch , semi - continuous or fully continuous processes in which homogeneous solution , slurry , or cement - suspension systems are utilized . in a typical batch process , a reactor fitted with efficient agitation means , and means for heat exchange , is purged of air by displacement with oxygen - free nitrogen , argon or low - boiling saturated hydrocarbon vapors such as methane , ethane or propane and charged with a solvent or mixture of solvents . in all process versions monomers and catalyst components , pre - diluted with solvent if desired , may be introduced into the stirred reactor , either simultaneously or sequentially , at a rate consistent with the means used for heat - exchange to maintain the desired temperature range . pressure on the reactor is maintained at a level sufficient to keep the reactants in the liquid phase . the catalyst components may be mixed in line in the absence of monomers before they are added to the reactor , or they may be added directly to the reactor in the presence of unreacted monomers . temperatures at which polymerization may be conducted may range from - 100 ยฐ c . to 100 ยฐ c . preferred are temperatures in the range of - 80 ยฐ c . to 50 ยฐ c . most preferred are temperatures in the range of - 40 ยฐ c to 40 ยฐ c . the temperature may be varied during the time required for optimum yield and polymer properties , with for example a low temperature during the initial phase of the reaction and a higher temperature during the final phase . reaction time may vary widely , depending on the reactivity of the particular monomers , catalyst concentration and temperature of the reaction . generally , reaction times are shorter at higher monomer , organoaluminum and peroxide concentrations and at higher polymerization temperatures . accordingly , polymerization times may vary from as little as two minutes to 200 hours . preferred are reaction times in the range of from 10 minutes to 24 hours . most preferred are reaction times in the range of 15 minutes to 10 hours . isolation of the interpolymer at the completion of the reaction may be accomplished in a variety of ways . in a preferred embodiment , the homogeneous polymer cement solution , or polymer suspension , or polymer cement suspension is fed from the reactor in the case of a batch process , or final reactor or holding drum in the case of a semi - continuous or fully continuous process to a mixing drum where the reaction mixture has been mixed either in line or is mixed in the drum with a quantity of a lower alcohol such as methanol , ethanol or isopropanol in order to inactivate the catalyst mixture . the alcohol may optionally contain a sequestering reagent such ethylene diamine tetra acetic acid or its disodium salt or acetylacetone . while inactivation of the catalyst in the manner indicated is preferred it is not essential and may be omitted if desired . the polymer solution or suspension , with or without catalyst inactivation is fed to an agitated wash drum where it is mixed with a dilute aqueous solution of an acid such as hydrochloric or sulfuric acid in order to deash the polymer . acid treatment followed by thorough water washing under efficient agitation is repeated if necessary so as to obtain a polymer with a minimal ash content . final isolation of the polymer in crumb form is accomplished by feeding the polymer solution or suspension to a slurry flash drum where it is treated with steam and hot water to precipitate the polymer and vaporize the solvent . typically , antioxidants , stabilizers and slurry aids are added to the polymer solution or suspension before slurrying and removal of solvent . the water slurry of polymer is finally fed to dewatering and drying extruders before packaging in bale or crumb form . solvent and unreacted monomers , vaporized in the slurry flash drums are purified and recycled to the polymerization reactors . in the case of interpolymers which have been prepared from substantially straight - chain c 12 to c 20 alpha - olefins or from substantially straight - chain c 12 to c 20 alkyl acrylates , or both , the deashed solution or suspension of the interpolymer intended for use as a dispersant or viscosity - index improver may be mixed with a solvent extracted , low - pour neutral oil and a solution of the polymer in the oil obtained by solvent exchange . concentrates prepared in this manner may be compounded with other additives such as antioxidants , pour depressants , oiliness agents and the like . the preparation of the interpolymers of this invention and the advance over the prior art is more clearly demonstrated in the following examples . the polymerization was carried out in a pressure vessel which had been fabricated from a cylinder of polypropylene which had been bored to create a cylindrical cavity of 800 ml . the vessel was sealed by means of a threaded cap and oil - resistant o - ring fashioned from an acrylonitrile rubber . the polymerization vessel , contained in a dry - box from which air was excluded by means of a positive internal pressure of oxygen - free nitrogen , was charged with 200 ml . of toluene which had been purified by percolation through a column of linde 5a molecular sieves , and 50 grams ( 0 . 5 mol ) of a commercial grade of ethyl acrylate containing 15 ppm of 4 - methoxyphenol as a stabilizer . the pressure vessel was then immersed in a freon 11 ( trichlorofluoromethane ) bath , maintained at - 20 ยฐ c ., located in the dry - box and after the solution had reached the lower temperature there was then added in succession to the solution 20 ml . of a 1 . 5 molar solution of al et cl 2 in purified n - hexane ; 2 . 0 ml . of a 1 molar solution of vocl 3 in purified hexane ; 56 grams ( 1 . 0 mol ) of liquified isobutylene ; 3 . 5 grams ( 0 . 065 mol ) of liquified 1 , 3 - butadiene and 1 mmol of lauroyl peroxide dissolved in 20 ml . of purified toluene . the vessel was sealed , removed from the freon bath and allowed to warm to room temperature , which required about 1 hour . the reaction vessel was then placed in a tumbling water bath maintained at 32 ยฐ c . and tumbled at that temperature for a period of 90 hours . the contents were transferred to a flask , treated with efficient agitation with 15 ml . of isopropyl alcohol and 10 ml . of methanol , followed by agitation in a waring blender with 100 ml . of 0 . 5 wt . % h 2 so 4 . after washing the polymer solution free of acid with distilled water the polymer cement was stripped with steam and hot water to remove the solvent and any unreacted monomers . the polymer was collected and dried under vacuum at a pressure of 20 torr . for 6 hours at a temperature of 60 ยฐ c . the yield of interpolymer was 66 grams . the inherent viscosity ( n inh ) of the polymer measured in benzene at 25 ยฐ c . at a concentration of 0 . 1 g / dl was 1 . 04 . no insoluble gel was observed in the solution used for the determination of the inherent viscosity . samples of the polymer were examined by proton nmr at 100 mhz in c 6 d 6 solution at 80 ยฐ c . and in cdcl 3 solution at 32 ยฐ c . the molar composition was determined using the chemical shift at 4 . 1 ppm due to the -- och 2 -- group of the ethyl acrylate units , the chemical shift at 0 . 8 ppm due to the gem - dimethyl groups of the isobutylene units , and the olefinic residue at 5 . 3 ppm due to the 1 , 4 - enchained butadiene units , in the cdcl 3 solvent . the molar composition calculated from these data was 55 mol percent of ethyl acrylate , 39 mol percent of isobutylene and 6 mol percent of butadiene . the sum of the isobutylene and butadiene units in the polymer was 45 mol percent which is indistinguishable within the accuracy and precision of the method from 50 percent . based on nmr examination of ethyl acrylate - isobutylene alternating copolymers and holopolymers of the individual monomers comprising the interpolymer of this example , the detailed spectra observed for the above product of this invention are consistent with a polymer structure consisting mainly of ethyl acrylate monomer units alternating with either isobutylene units or randomly disposed butadiene units . an infrared spectrum of the interpolymer , obtained between rock - salt plates , indicated the main structural feature as absorption in the olefin region at 970 cm - 1 due to the ch out of plane bending mode of the ## str3 ## units derived from butadiene . no absorption is evident at 910 cm - 1 which would indicate ch 2 out of plane mode of a pendant vinyl group , nor is significant absorption evident in the 690 - 730 cm - 1 region which would be due to a cis - 1 , 4 - butadiene enchainment . for a discussion of infrared analysis of polybutadienes and band assignments reference may be had to j . l . binder , j . poly . sci . pta , 47 ( 1963 ) and r . r . hampton , anal . chem . 21 , 923 ( 1949 ). the conclusion from the infrared analysis is that the butadiene in the interpolymer is enchained predominantly in the 1 , 4 - trans fashion . the interpolymer product of example 1 was formulated on a 3 ร— 7 inch rubber mill with the following recipe : interpolymer 100 ; stearic acid 2 ; phenyl - ฮฒ - naphthylamine 0 . 5 ; 2 , 2 - methylene bis ( 4 - methyl - 5 - tert - butyl phenol ) 0 . 5 ; zinc oxide 5 ; sulfur 2 ; tetramethyl thiuram disulfide 1 . 5 ; and benzothiazyl disulfide 0 . 5 . pads measuring 2 . 5 ร— 1 . 75 ร— 0 . 025 inches were vulcanized in aluminum molds at 135 ยฐ c . for 5 hours in a steam heated press under a pressure of 1200 psi on the mold . dumbbell shaped specimens were prepared from the sheet with a 0 . 1 inch wide test area and tested at a 20 inch per minute strain rate on an instron machine . the vulcanized sample showed a tensile at break of 1500 psi , an elongation at break of 245 %, a modulus of 235 psi at 100 % extension , and a modulus of 1045 psi at 200 % extension . in order to illustrate the advance of this invention over the prior art a series of runs were made in an attempt to prepare essentially the same interpolymer by the methods taught by the prior art and by the improved process of the instant invention . the same equipment , temperature and sequence of catalyst component addition and temperature for the reaction , except as noted , as was used in the preparation of the interpolymer of example 1 was followed . the details of the experimental runs are given in table 1 . isolation and deashing of the polymers was the same as was used for the polymer made in example 1 . table i__________________________________________________________________________exp . type prior art this inventionexp . no .. sup . ( a ) 3a 3b 3c 3d 3e__________________________________________________________________________butadiene - mols none 0 . 065 0 . 065 0 . 065 noneisoprene - mols 0 . 05 none none none 0 . 05 . sup . ( c ) et al cl . sub . 2 - mols 0 . 02 0 . 02 none 0 . 03 0 . 03et . sub . 1 . 5 al cl . sub . 1 . 5 - mols none none 0 . 02 none nonevocl . sub . 3 - mols none none none 0 . 002 0 . 002lauroyl peroxide - mmols 1 1 1 1 0 . 5reaction time - hrs . 65 88 88 90 112reaction temp .- ยฐ c . 32 32 32 32 26polymer yield - gms . 73 . 5 71 . 2 75 . 3 70 80inherent viscosity . sup . ( b ) 1 . 19 1 . 18 0 . 90 1 . 04 0 . 77__________________________________________________________________________ . sup . ( a ) all experimental runs contained 200 ml . of toluene . 0 . 5 mol of ethyl acrylate and 1 . 0 mol of isobutylene . . sup . ( b ) determined in benzene at 25 ยฐ c . at a concentration of 0 . 1 g / dl . . sup . ( c ) the isoprene was added in 5 equal portions over the course of 3 . 75 hours in order to simulate a continuous process . samples of the polymers were formulated on a 3 ร— 7 inch rubber mill with the same recipe as was used in example 2 and vulcanized at 135 ยฐ c . for 420 minutes under a pressure of 1200 psi on the mold . dumbbells were cut from the pads and used for the following tests . sample 3a . this sample was very fragile and could not be evaluated for tensile on the instron machine . further testing showed the &# 34 ; vulcanized &# 34 ; sample to be soluble to the extent of 80 % in toluene at room temperature , thereby indicating the absence of a cross - linked structure . sample 3b . the vulcanized sample was 47 % soluble in toluene at room temperature and in the tensile test showed a yield type failure ( the modulus decreased with increasing extension ) indicating the absence of an elastomeric network . sample 3c . the vulcanized sample was 44 % soluble in toluene at room temperature and in the tensile test exhibited a tensile of 545 psi at break under an extension of 310 %. the modulus at 200 % extension was 315 psi . table ii gives the results obtained with samples 3d and 3e . table ii______________________________________ sample samplevulcanizate from : 3d 3e______________________________________tensile , psi atbreak 2265 1710elongation , % 300 405modulus (% extension ) 955 ( 200 ) 1140 ( 300 ) ______________________________________ the results obtained in the tensile tests on the vulcanizates of examples 2 , 3d and 3e show that commercially acceptable vulcanizates can be obtained with the elastomeric products of this invention when they are vulcanized with sulfur and sulfur compounds . the stress - strain behavior of increasing modulus with increasing strain is characteristic of a true elastomer and is evidence that the extensive network structure has been achieved . comparison of the products prepared according to this invention with the products prepared according to the teachings of the prior art suggest that the diolefin residues are more nearly distributed at random along the macromolecule chain in the products of this invention , which leads to their effectiveness in the vulcanization reaction to yield a three dimensional network system . the same equipment and experimental procedure , except as noted , was used for the preparation of the following elastomeric interpolymer as was used for the preparation of the polymer in example 1 . the reactor contained in an oxygen - free dry - box was charged with 200 ml of purified toluene , cooled in the freon bath to - 20 ยฐ c . and then fed in successive order : 0 . 5 mol of ethyl acrylate ; 30 mmols of et al cl 2 ; 2 mmols , vocl 3 ; 1 . 0 mol of isobutylene ; 1 . 0 mmol of lauroyl peroxide , and 6 . 5 mmols of 1 , 3 - butadiene , added in 5 equal portions over the course of 3 . 3 hours . the reactor was sealed , allowed to come to room temperature and then tumbled in a water bath for 90 hours at 32 ยฐ c . the polymer was deashed and isolated in crumb form in the same manner as in example 1 . the yield of polymer was 69 grams ; it had an inherent viscosity of 0 . 86 and a glass transition temperature ( tg ) of - 17 ยฐ c . the interpolymer product of example 4 was formulated on a 3 ร— 7 inch rubber mill with the following recipe : interpolymer 100 ; haf carbon black 50 ; stearic acid 2 ; phenyl - ฮฒ - naphthylamine 0 . 5 ; 2 , 2 &# 39 ; methylene bis ( 4 - methyl - 5 - tert - butyl phenol ) 0 . 5 ; zinc oxide 5 ; sulfur 2 ; tetramethyl thiuram disulfide 1 . 5 ; and benzothiazyl disulfide 0 . 5 . pads were cured at 307 ยฐ f . for 45 minutes , and post - cured for 16 hours at 300 ยฐ f . under a pressure of 1200 psi on the mold . tensile tests on dumbbells cut from the pad showed the following : tensile 940 psi ; elongation 200 %; modulus at 100 % extension , 890 psi . the above shows that acceptable products containing carbon black may be formulated from the interpolymers of this invention . many variations may be introduced in the processes used to synthesize the interpolymers of this invention , particularly in a continuous process . all of the monomers and catalyst components may be fed to a first reactor which then overflows to an agitated time tank . alternately , some of the ingredients may be blended in line before entering the reactor , or one or more of the catalyst ingredients may be mixed with one or more of the monomers in a separate vessel at a different temperature before being fed to the main reactor . other variations with the scope of this invention will be apparent to those having skill in the art .
2
as an example we selected a pattern device which is provided on large circular knitting machines and which effects there the election of the needles . the pattern device comprises cam controlled selector elements which cooperate with the pattern feet of jacks which in turn and conventionally , cooperate with the needle butts to effect the knitting operation . the pattern device consists of stacks 2 of selector elements 3 guided in a frame 1 . these selector elements 3 carry on their inner side a cam 4 which each act on a plane of the pattern selector butts ( not shown ). at their outer end the selector elements 3 are equipped with a lug 5 which is engaged selectively by the cams 6 of a pattern drum 7 . the selector elements 3 are each held in the extreme position by a spring 8 . the pattern drum 7 is stepped up from one switching position into the other by means of a drive ( not shown ). the pattern drum 7 consists of a plurality of disks 10 , 11 on an axle 9 . these disks 10 , 11 are divided into two groups , one disk 10 of one group always alternating with a disk 11 of the other group . one group of the disks are guide disks 10 , whose outside diameter corresponds to the diameter of the pattern drum 7 ( fig5 ). they have for each switching position a bore 12 in a distance from the outer surface of the guide disk . radially outside the bore 12 , a recess 13 is formed in the outer circumference of the guide disk 10 . the second group of the disks are the so - called spacer disks 11 . they are arranged each between two guide disks 10 and have a substantially v - shaped recess 14 in the range of each switching position ( fig6 ). when assembling the disks 10 , 11 the cams 6 represented in fig7 which have a bore 15 at one end and a second bore 16 substantially in the center ( see fig7 ), are inserted from the outside into the v - shaped recess 14 and held by a bolt 17 passing through the bores 12 of the guide disk 10 and the bores 15 of the cams 6 . a rod 18 inserted , from the outside parallel to the axle 9 of the pattern drum 7 , passes through the second bore 16 of the cam 6 and is held in the recess 13 of the guide disk 10 . for selecting the patterns , the cams 6 which control the selector elements 3 are brought into the radial position and are held by rods 18 in that position . before insertion of bolt 18 , the cams 6 which are not to act on selector elements 3 are turned about bolt 17 through an acute angle to an inoperative position in which they abut the right hand boundary of recesses 14 . upon insertion of bolt 18 through bore 16 of those cams in the operative or radial position , the cams in the inoperative position are held between the bolt 18 and the boundary of recess 14 . the selector elements 3 , particularly their lugs 5 opposite the cam 6 , are so designed that no pattern selection movement is caused by the swung - out , i . e ., those not in the radial position , cams 6 . it is necessary to remove the selector elements 3 out of the range of the cams 6 during the stepping of the drum so that they are not contacted by those cams during that stepping operation . this is effected by a device as represented in fig1 . on the frame 1 , which guides the selector elements 3 , is mounted a rail 20 which is vertically immovable but which can be displaced parallel to itself in the direction of motion of the selector elements 3 . the outside of this rail bears on the lugs or projections 21 of the selector elements 3 . this rail 20 has two stops 22 , 23 , which are connected to two camming surfaces 24 , 25 of a vertically displaceable strip 26 . the strip 26 is not displaceable horizontally . at the bottom end of the strip 26 is arranged a two - arm lever 27 whose fulcrum 28 is rotatably mounted on the frame 1 of the pattern device and whose left end 29 ( fig1 ) engages a recess 30 of the strip 26 . the right arm 31 of the lever 27 bears on a plunger 32 which is guided for vertical movement in the lock carrier plate 33 . below the lock carrier plate 33 is arranged the driving wheel 34 on which is secured the switching element 35 for the plunger 32 . the switching element 35 consists of a cam whose rising leg is formed by a roller 36 . the bottom end of the plunger 32 is curved . the roller 36 strikes longitudinally against the cam 37 of the plunger 32 and pushes the latter upward so that the strip 26 is lowered and the rail 20 moves the selector elements 3 away from the pattern drum . it will of course be appreciated that the movement of strip 26 is effected by means of the cam and plunger arrangement and lever 31 from the drive of the needle cylinder or alternatively that movement is effected manually through lever 40 . after the stroke is completed , the roller 36 places the plunger 32 on the upper surface 38 of the switching element 35 so that the plunger 32 remains in the top position . when the switching process of the pattern drum 7 is completed , the plunger 32 slides again off the surface 38 , due to the pull of the spring 39 which keeps the strip 26 in its top position . the rail 20 returns to its original position and releases again the selector elements 3 , so that their lugs rest either on the operative cams 6 of the pattern drum , i . e ., the cams in the radial position or against the outside diameter of the pattern drum 7 as shown in chain line in fig4 . it is also possible to displace the selector elements 3 manually , to which end a slide or lever 40 is provided on the frame 1 which can displace the strip 26 downward over a cam 41 and thus move the rail 20 toward the needle cylinder . the stepping mechanism is known and could be that , for example , illustrated in u . s . pat . no . 3 , 759 , 069 issued july 31 , 1973 to ludwig et al . it is to be noted that the elements 35 and 36 of the present invention are connected non - rotatably with the rotating cylinder of the circular knitting machine as are the switching elements 17 through 20 of u . s . pat . no . 3 , 759 , 069 and the elements are arranged on a common drive element . referring now to the present invention , the roller 36 and the surface 38 of the switching element 35 causes the plunger 32 to be lifted before switching elements begin to act on the star wheel . the length of the surface 38 is so selected that the cam 37 of the plunger 32 slides off the latter only when the switching elements 17 and 19 , respectively , have passed over the star wheel 12 of the u . s . patent aforementioned . alternatively , rather than the rods 18 being positioned to pass through the cams 6 which are to be held in an operative position ( fig4 ), the rods 18 may be positioned to pass through the cams 6 which are to be in an inoperative position and the edge of those rods 18 abut other cams 6 in an operative position ( fig4 a ).
3
the following description is of the best - contemplated mode of carrying out the invention . this description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . one embodiment discloses a fabrication method for a dynamic random access memory stack capacitor according to the invention . as shown in fig2 , an etching stop layer 3 and a sacrificial dielectric layer 4 having an opening 10 is formed on a semiconductor substrate 1 in sequence . typically , the semiconductor substrate 1 is made up of a silicon wafer including metal layers ( not shown ), interlayer dielectric layers ( not shown ) and other elements ( for example , a metal oxide semiconductor field effect transistor ). the etching stop layer 3 uses materials such as silicon nitride . the sacrificial dielectric layer 4 uses materials such as silicon dioxide . the formation of the etching stop layer 3 includes typical deposition processes . the sacrificial dielectric layer 4 having an opening 10 is formed , for example , by typical photolithography processes . the etching stop layer 3 has a conductive region 2 which is exposed via the opening 10 , and the conductive region 2 is typically made up of tisi x , cosi x , nisi x , or doped semiconductor materials . as shown in fig3 , a layer 12 of semi - spherical grains is then formed covering the sacrificial dielectric layer 4 and the sidewalls and bottom of the opening 10 . the layer 12 of semi - spherical grains uses materials such as silicon , and the formation thereof includes a typical epitaxy processes . as shown in fig4 , a typical photolithograph process or an etching process is performed on the layer 12 of semi - spherical grains to leave a pattern 12 โ€ฒ of semi - spherical grains on the sidewalls of the opening 10 . for example , a photoresist material ( not shown ) is used to fill the opening 10 and to cover the surface of the sacrificial . dielectric layer 4 . thereafter , the photoresist material is patterned , and the photoresist material outside the opening 10 is then removed . next , the layer 12 of semi - spherical grains is partly removed except for the part remaining on the sidewalls of the opening 10 i . e . the pattern 12 โ€ฒ of semi - spherical grains . each semi - spherical grain of the pattern 12 โ€ฒ has a diameter between 5 and 50 nm . as shown in fig5 , a conductive material 14 is utilized to fill the opening 10 and to cover the surface of the sacrificial dielectric layer 4 . the conductive material 14 , for example , is conductive carbon . due to the deposition process of the conductive material 14 , a void 16 is thus formed within the opening 10 . a recess etching process is performed to open the void 16 within the opening 10 and to remove the conductive material from the surface of the sacrificial dielectric layer 4 , thus , the residual conductive material covering the pattern 12 โ€ฒ of semi - spherical grains and the bottom of the opening 10 serves as a first capacitor electrode 14 โ€ฒ ( i . e . the lower electrode ). the recess etching process is performed using oxygen or argon plasma , for example . as shown in fig7 , the sacrificial dielectric layer 4 is removed to expose the surface ( i . e . the outer surface ) of the first capacitor electrode 14 โ€ฒ possessing the pattern 12 โ€ฒ of semi - spherical grains and a portion of the surface of the etching stop layer 3 . the removal of the sacrificial dielectric layer 4 includes an etching process . as shown in fig8 , the pattern 12 โ€ฒ of semi - spherical grains on the outer surface of the first capacitor electrode 14 โ€ฒ is then removed , thus , leaving a wavy surface on the outer surface of the first capacitor electrode 14 โ€ฒ. that is , arc - shaped cavities are formed on the outer surface of the first capacitor electrode 14 โ€ฒ. the formation increases the effective area of the outer surface of the first capacitor electrode 14 โ€ฒ, thus , leading to increased capacitance . as shown in fig9 , a capacitor dielectric layer and a second capacitor electrode 18 ( i . e . the upper capacitor ) are formed on the exposed surfaces of the first capacitor electrode 14 โ€ฒ and the etching stop layer 3 in sequence . the first capacitor electrode 14 โ€ฒ, the capacitor dielectric layer and the second capacitor electrode 18 constitute a capacitor . the capacitor dielectric layer can be high dielectric constant materials , such as al 2 o 3 , ta 2 o 5 , tio 2 or ferroelectrics , and the formation thereof can be by chemical vapor deposition . the second capacitor electrode 18 can use materials such as metal or conductive carbon , and the metal materials can be pt , ir , ru , or pd . the formation of the second capacitor electrode 18 includes chemical vapor deposition , physical vapor deposition or reactive ion sputtering . in other embodiments , the second capacitor electrode 18 can use metal oxide such as iro 2 or ruo 2 . while the invention has been described by way of example and in terms of the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements .
7
below , an embodiment of the present invention applied to a refrigerant condenser of a car air - conditioner is described with reference to fig1 to fig7 . fig2 shows an mf type refrigerant condenser . in fig2 a pair of headers 11 and 12 are connected by a core 13 . the core 13 is comprised of a plurality of tubes 13a comprised of flat tubes between which are welded corrugated fins 13b . separators 14 are disposed at predetermined positions in the headers 11 and 12 . it is possible to set the number of turns of the refrigerant passage to any number as shown in fig3 by the position of disposition of the separators 14 . that is , when there are 32 tubes 13a , with 0 turns , all the 32 tubes 13a form a refrigerant passage oriented in one direction . in this case , the condensation distance l becomes w . here , w is the distance between the headers 11 and 12 and matches with the lateral width of the core 13 . with 1 turn , it is possible to set the tubes 13a to a combination of 16 and 16 , a combination of 24 and 8 , etc . in this case , the condensation distance l becomes 2w . further , with 2 turns , it is possible to set the tubes 13a to a combination of 11 , 11 , and 10 , a combination of 16 , 12 , and 4 , etc . in this case , the condensation distance l becomes 3w . fig3 shows an example of a combination of the tubes 13a , but is possible to set any combination . fig4 and fig5 show the trend in the number of turns of the refrigerant passage when the core size is set to various dimensions in the case of an equivalent hydraulic diameter de of the inside of the tubes 13a of 0 . 67 mm . that is , fig4 shows the ratio of performance with respect to 0 turns when setting the core width w to from 300 mm to 700 mm in 100 mm increments and setting the number of turns of the refrigerant passage from 1 to 5 in a heat exchanger with 24 tubes 13a , a core height h of 235 . 8 mm , and a core thickness d of 16 mm ( fig2 ). fig5 shows the ratio of performance with respect to 0 turns when setting the core width w to from 300 mm to 700 mm in 100 mm increments and setting the number of turns of the refrigerant passage from 1 to 6 in a heat exchanger with 40 tubes 13a , a core height h of 387 . 8 mm , and a core thickness d of 16 mm . the dots on the curves in fig4 and fig5 show the optimal performance points of each . the &# 34 ; equivalent diameter de &# 34 ; indicates the hydraulic diameter corresponding to the total sectional area of combined bores of a single tube 13a , since the shape of the tubes 13a is at a section of the tube 13a , usually the sectional shapes shown in fig6 a and 6b . that is , it is defined as de ( equivalent diameter )= 4 ร—( total hydraulic sectional area )/( total wet edge length ). here , various combinations of numbers of tube 13a are considered for various numbers of turns , but fig4 and fig5 show the ones with the optimal performance obtained as a result of calculation . that is , the performance of a condenser is determined by the balance of the improvement of the heat exchange rate and the pressure loss . the two have effects on each other , so it is possible to derive this by converting the relationship between the two to a numerical equation . using this , it becomes possible to find the efficiencies of various heat exchangers . further , for this calculation , detailed heat transmission rate characteristics and pressure loss characteristics were found by experiment and the results were used to prepare a simulation program and perform analysis . for the settings of the parameters at this time , the heaviest load conditions in the refrigeration cycle of a car air - conditioner were envisioned and use was made of an air temperature at the condenser inlet of 35 ยฐ c ., a condenser inlet pressure of 1 . 74 mpa , a superheating of the condenser inlet of 20 ยฐ c ., a subcooling of the condenser outlet of 0 ยฐ c ., an air flow of the condenser inlet of 2 m / s , and a refrigerant of hfc - 134a . the analysis and the experimental findings were compared . as a result , the present inventor confirmed that the results of analysis and the experimental values substantially matched in the range of an equivalent diameter of the tubes 13a of 0 . 6 mm to 1 . 15 mm . further , the inventor confirmed that the number of turns giving the optimal performance shown in fig4 and fig5 ( optimal number of turns ) is substantially the same even if the pitch of the fins differs or the core thickness d differs . from fig4 and fig5 it is learned that so long as the core width w is the same , the optimal number of turns is the same even if the number of tubes 13a differs . this means if the core width is the same , the optimal number of turns is the same regardless of the combination of the numbers of tubes 13a . fig7 shows the results of the above calculation for tubes 13a of different equivalent diameters de to find the optimal number of turns for different core widths w . in this case , while there are only whole numbers of turns in actuality , regions other than those of integers are also shown so as to illustrate the trends . now then , in fig7 looking at the tubes 13a with a de of 0 . 67 mm for example , the condensation distance l at the optimal number of turns is 3 when w = 300 mm , so l =( 3 ( turns )+ 1 )ร— 300 = 1200 mm . when w = 400 mm , it becomes 2 turns , so l =( 2 + 1 )ร— 400 = 1200 mm . when w = 500 mm , it becomes 2 turns , so l =( 2 + 1 )ร— 500 = 1500 mm . when w = 600 mm , it becomes 1 turn , so l =( 1 + 1 )ร— 600 = 1200 mm . when w = 700 mm , it becomes 1 turn , so l =( 1 + 1 )ร— 700 = 1400 mm . further , when the equivalent diameter de of the tubes 13a is 0 . 9 mm , the condensation distance l becomes 1500 mm when w = 300 mm , 1600 mm when w = 400 mm , 1500 mm when w = 500 mm , 1800 mm when w = 600 mm , and 1400 mm when w = 700 mm . further , when the equivalent diameter of the tubes 13a is 1 . 15 mm , the condensation distance l becomes 1800 when w = 300 mm , 2000 mm when w = 400 mm , 2000 mm when w = 500 mm , 1800 mm when w = 600 mm , and 2100 mm when w = 700 mm . usually , the core width w of a refrigerant condenser used for a car air - conditioner is about 300 mm to 800 mm , so from the results of the above calculations , it is learned that when the equivalent diameters de of the tubes 13a are the same , there is not that much effect on the core width w and the optimal condensation distance l lies in a certain range . therefore , it is possible to specify the optimal condensation distance l for an equivalent diameter de of tubes 13a . fig1 shows the results when changing the equivalent diameters de and finding by the above analysis the range of the optimal condensation distances l for those de . linear approximation of the data obtained enables the optimal condensation distance l to be set as therefore , if the equivalent diameter de of the tubes 13a of the core 13 of the heat exchanger is known , it is possible to find the optimal condensation distance l from equation ( 1 ), so it becomes possible to set the optimal number of turns ( n ) by finding the number of turns matching that condensation distance from the following equation ( 2 ): further , since the number of turns must be an integer , it is necessary to round off the number of turns found from equation ( 2 ). in recent years , advances in the manufacturing technology for tubes of refrigerant condensers have made possible the production of tubes with extremely small equivalent diameters . if the above equation ( 1 ) is applied to such very small tubes , the number of turns is set to 0 . for example , fig9 shows the results obtained by using the above - mentioned simulation program to find the optimal condensation distance at an idle high load ( a ) and a 40 km / h constant load ( b ) for tubes with an equivalent diameter de of less than 0 . 60 mm . looking at just the line of the idle high load ( a ), when the equivalent diameter is 0 . 18 mm to 0 . 5 mm , the optimal condensation distance l becomes 300 to 800 mm , so as mentioned above , 0 number of turns is the optimal specification when the core width w is 300 mm to 800 mm . in this way , by making the tubes ones with an equivalent diameter of 0 . 18 mm to 0 . 5 mm , it is possible to provide a refrigerant condenser with a good efficiency with 0 number of turns . a condenser with 0 number of turns does not require any separators for dividing the headers , so the work of inserting the separators and the process of detecting leakage of refrigerant from the separator portions become unnecessary . further , it becomes possible to simplify and standardize the shape of the header portions . further , compared with the case of use of tubes with a large equivalent diameter as shown in fig9 the fluctuation in the optimal condensation distance due to load fluctuations becomes smaller , so it is possible to maintain the optimal state for the load conditions even if the load conditions fluctuate . as explained above , in the present invention , the optimal condensation distance l is determined from the equivalent diameter de of the tubes 13a of the core 13 of the heat exchanger and the optimal number of turns of the refrigerant passage is found from the condensation distance l , so the present invention differs from the related art , which only suggested that an increase of the number of turns or a decrease of the sectional area of the passage contributed to an improvement of the heat exchange rate and therefore it is possible to design a heat exchanger with a high heat exchange rate .
8
fig2 shows an embodiment of an integrated humidity sensor 1 fabricated using a hcmos ( high speed cmos ) technology , with the sensor 1 formed in a backend manufacturing step . in detail , the sensor 1 is formed in a chip 2 , including a semiconductor substrate 3 , e . g ., of silicon , and an insulating structure 4 , overlying the substrate 3 . specifically , the sensor 1 is formed in a sensing portion 50 of the chip 2 . a processing portion 60 may also be provided , laterally to the sensing portion 50 , in a per se known manner , to integrate reading and processing circuitry components 61 . in turn , the sensing portion 50 includes a sensing capacitor area 51 and a reference capacitor area 52 . the insulating structure 4 is typically formed by a plurality of superimposed insulating layers , not separately shown , accommodating a plurality of metal regions 8 formed in a plurality of metal levels ( here four ), indicated by m 1 ( lower metal level ), m 2 ( first intermediate metal level ) and m 3 ( second intermediate metal level ) and m 4 ( upper metal level ) mutually connected through vias 7 . the metal regions 8 may be of aluminum . in addition , the metal regions 8 of the lower metal level m 1 may be connected to conductive regions 9 on the substrate 3 and / or to conductive regions 30 in the substrate 3 . the metal regions 8 of the upper metal level m 4 form , for example , first and second electrodes 12 , 13 of a sensing capacitor 10 and of a reference capacitor 11 arranged respectively in the sensing capacitor area 51 and in the reference capacitor area 52 . as visible in the top view of fig3 , the capacitors 10 , 11 are of a multifingered , interdigitated type , with the first electrodes 12 connected together by a conductive line 15 and biased at a first potential ( e . g ., a higher potential ), and the second electrodes 13 connected together by a conductive line 14 and biased at a second potential ( e . g ., a lower potential ). referring again to fig2 , protection layer 16 , e . g ., of nitride , extends on the entire upper surface of the insulating structure 4 to protect the electrodes 12 , 13 from water molecules of the environment that may cause any oxidation thereof and a dielectric layer 17 , e . g ., of oxide (โ€œ padopen oxide โ€), extends on the protection layer 16 , except for in the sensing capacitor area 51 . in particular , the dielectric layer 17 extends in the reference capacitor area 52 . a conductive shielding layer 18 extends on the dielectric layer 17 , except for on the sensing capacitor area 51 . the conductive shielding layer 18 is of a good electric conductive material , with a resistivity lower than 50 mฯ‰ /โ–ก, such as a metal , for example aluminum , that is impervious to water molecules and may have a thickness of about 1 ฮผm . therefore , in the reference capacitor area 52 , the conductive shielding layer 18 forms an electrical shield 22 . a passivation layer 19 of insulating material , for example a double layer of psg ( phosphorous silicon glass ) and nitride , extends on the conductive shielding layer 18 , except for in the sensing capacitor area 51 and , here , on the reference capacitor area 52 . a hygroscopic layer 25 extends on the entire surface of the sensing portion 50 of chip 1 , over the passivation layer 19 , where present , and directly on the protection layer 16 , in the sensing capacitor area 51 , or on the electrical shield 22 , in the reference capacitor area 52 . the hygroscopic layer 25 is a thick layer , compared with the other layers ; for example its thickness may be less than 10 ฮผm . the hygroscopic layer 25 may be the so called โ€œ pix โ€, that is an aqueous positive polyimide , which can be defined with high resolution and has storage and room temperature stability that is used in the semiconductor industry , or another polyimide material or another polymeric material . in addition , also porous low - k silicon dioxide may be used . fig4 shows a different embodiment , wherein the shielding layer is covered by a further protection layer 26 , e . g ., of nitride , acting as a humidity barrier for protecting the electrical shield 22 from any water molecules reaching it . the further protection layer 26 has a thickness lower than 0 . 5 ฮผm , for example 0 . 1 - 0 . 2 ฮผm , to avoid a loss of sensitivity of the sensing capacitor 10 . in the alternative , the further protection layer 26 may be removed from the sensing capacitor area 51 . according to another embodiment , the passivation layer 19 is not removed from the reference capacitor area 52 , as shown in fig5 . in all the above embodiments , by virtue of the conductive shielding layer 18 that covers the reference capacitor 11 , the electric field lines extending between the first and second electrodes 12 , 13 are bent and constrained to pass along the conductive shielding layer 18 , as shown in the enlarged detail of fig6 . thereby , the electric field lines cannot reach the hygroscopic layer 25 in the reference capacitor area 52 so that the reference capacitor 11 is insensitive to the humidity content of the hygroscopic layer 25 . thus , the reference capacitor 11 does not change its electric property , in particular its capacity , as a function of the humidity of the external environment . fig7 - 9 show subsequent manufacturing steps for the integrated humidity sensor 1 . in particular , an upper portion of the chip 2 is shown , including the two upper metal levels m 3 , m 4 , the upper portion of the insulating structure 4 and the overlying layers . in particular , fig7 - 9 show the sensing capacitor area 51 , the reference capacitor area 52 and a pad area 53 . initially , after forming the integrated electronic components 61 in the substrate 3 ( fig2 ), the insulating structure 4 is formed by depositing alternating silicon nitride and silicon dioxide layers and forming conductive regions 8 of metal and respective vias 7 . in particular , when the fourth or upper metal layer m 4 is formed , the electrodes 12 , 13 and the conductive lines 14 , 15 of the sensing and reference capacitors 10 , 11 are also formed . the protection layer 16 and the dielectric layer 17 are deposited ; and the conductive shielding layer 18 is formed on the dielectric layer 17 . to this end , a metal layer ( such as aluminum ) is deposited on the entire surface of the dielectric layer 17 and etched away from the sensing capacitor area 51 or selected portions of metal are formed , e . g ., grown on the dielectric layer 17 . in any case , the conductive shielding layer 18 extends on the reference capacitor area 52 , where it forms the electrical shield 22 , and on the pad area 53 , where it forms pads 23 . thereafter , the passivation layer 19 is deposited on the entire surface of the chip 2 , obtaining the structure of fig7 . as shown in fig8 , a resist mask 40 is formed . here , the resist mask 40 covers the reference capacitor area 52 and has openings or windows 41 over the sensing capacitor area 51 and the pad area 53 . using the resist mask 40 , the exposed portion of the passivation layer 19 is etched from the pad area 53 ; in addition , the exposed portions of the passivation layer 19 and then of the protection layer 16 are removed from the sensing capacitor area 51 . thereby , the structure of fig8 is obtained . after removing the resist mask 40 , fig9 , the hygroscopic layer 25 is deposited and removed from the pad area 53 . thereby , the final structure of fig9 is obtained . according to a different embodiment , during the etching of the passivation layer 17 from the pad area 53 and the sensing capacitor area 51 , the passivation layer 17 may also be removed from the reference capacitor area 52 . the sensor 1 may be integrated together with a processing circuitry , as shown in fig1 , where the processing circuitry components 60 ( fig2 ) are integrated in a specific area of the chip 2 . in particular , the processing circuitry components 60 may form a bridge 70 , together with the sensing capacitor 10 , the reference capacitor 11 and standard capacitors 71 . the capacity variation of the bridge 70 is then converted into an output voltage signal through for example a switched - capacitor operational amplifier 72 having an input coupled to the bridge 70 . the advantages of the present disclosure are clear from the above . in particular , it is emphasized that the present sensor is able to measure the environmental humidity in a reliable way through a differential technique , due to the reference capacitor 11 that is substantially unaffected by moisture , even at high levels of the latter . the sensing and the reference capacitors are matched so that the thermal behavior and the ageing effect may be compensated in a differential reading ; thereby the humidity sensor is unaffected by variations in environmental condition ( except humidity ) or over time . the sensor may be manufactured in a simple and economic way , since no critical patterning operations are needed for the hygroscopic material . if a polyimide layer is used , the manufacture is quite simple and economic , since this material is routinely used as a mechanical environmental protection in standard silicon cmos processes . the humidity sensor disclosed therein may be used in weather stations ; hvacs ( heating , ventilation and air conditioning systems ); respiratory equipment ; humidifiers ; gas sensors measurement correction ; condensation level monitoring ; air density monitoring ; multiple type interfaces . finally , it is clear that numerous variations and modifications may be made to the humidity sensor described and illustrated herein . for example , the conductive shielding layer 18 may be of a different conductive material that has high conductivity ( typically , a resistivity lower than 50 mฯ‰ /โ–ก) and is substantially impervious to water molecules . moreover , the conductive shielding region 22 may be arranged over the hygroscopic layer 25 . in addition , if the hygroscopic layer 25 ha as sufficient thickness to avoid the captured molecules to reach the electrodes 12 , 13 , the protection layer 16 may be omitted . the various embodiments described above can be combined to provide further embodiments . these and other changes can be made to the embodiments in light of the above - detailed description . in general , in the following claims , the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims , but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled . accordingly , the claims are not limited by the disclosure .
6
referring now to the drawings , a dynamoelectric machine 9 according to the invention is an electric generator . the generator comprises a rotor 11 which is rotatable about the axis b -- b as shown in fig1 . a stator 13 is located radially outward from the rotor 11 and secured within a housing 15 of the apparatus . the housing 15 is preferably formed of a metal , for example of aluminum or magnesium alloy . the generator components shown in fig1 are generally symmetric about the axis b -- b but only that portion to the lower side of the axis b -- b as illustrated in fig1 are depicted . the stator 13 includes a laminated stator core 28 formed of a plurality of slacked laminates of a magnetic material , e . g . steel laminations 17 , and stator windings 19 with end turns 21 which extend beyond both axial ends of the stator core 28 as depicted in fig1 , 3 and 4 . the stator windings 19 extend through openings 23 ( fig5 ) in the laminations 17 of the stator core 28 . the cooling fluid channels or grooves 25 in the radially inner surface of the housing 15 adjacent the outer periphery of the stator core 28 extend about the circumference of the stator core 28 for cooling the radially outer portion or back iron of the stator core 28 . the configuration of the fluid channels 25 in the housing 15 for cooling the stator can be like that shown in u . s . pat . no . 4 , 578 , 962 , for example . according to the invention , the dynamoelectric machine 9 further comprises axially extending fluid coolant passages 27 which communicate with the channels 25 for conveying fluid coolant to fluid coolant exit ports 37 ( fig2 - 4 ) located adjacent the stator winding end turns 21 via transfer channels 35 which are integrally formed within the stator core 28 ( see fig2 and fig4 ), or alternatively within the housing 15 ( see fig3 ). the coolant passages 27 are formed by grooves 29 formed in the outer periphery of the laminations 17 of the stator core 28 located adjacent the housing 15 between the end laminations 31 and 33 , see fig5 . in the preferred embodiment the fluid coolant from the axially extending fluid coolant passages 27 flows through a plurality of circumferentially spaced , linear radial transfer bores 39 which communicate radially inwardly from the outer periphery of the stator core 28 with a like number of axial transfer bores 41 extending from the point of communication internal of the stator core 28 to the end laminations 31 , 33 allowing the fluid coolant to reach the fluid coolant exit ports 37 defined thereby . a plurality of these two perpendicularly communicating bores 39 , 41 form the transfer channels 35 allowing fluid coolant to be channeled to the exit ports 37 so that fluid coolant can be sprayed in the direction of the end turns 21 to cool the end turns 21 . in an alternate embodiment illustrated in fig3 the fluid coolant from the axially extending fluid coolant passages 27 flows through a plurality of circumferentially spaced axial fluid transfer passages 43 being formed between the radially outer periphery of the stator core 28 and the housing 15 and extending beyond the axial end of the stator core 28 thus defining radially directed fluid coolant exit ports 37 allowing fluid coolant to be sprayed in the direction of the end turns 21 to cool the end turns 21 . in a third embodiment fluid coolant from the axially extending fluid coolant passages 27 flows along annular passages 47 , formed as a result of the end laminations 31 , 33 having a diameter d 1 which is smaller than the diameter d 2 of the laminations 17 intermediate the end laminations 31 , 33 , to a plurality of circumferentially spaced slots 45 formed in the end laminations so as to extend radially inwardly from the outer periphery of the end laminations as shown in fig7 . these slots 45 in the end laminations 31 , 33 together with the adjacent housing 15 and the stator core laminations 17 adjacent the end laminations define radially inwardly extending fluid coolant passages 46 for conveying the fluid coolant to a location adjacent the stator winding end turns 21 . radially inwardly of the inner surface 49 of housing 15 the slots 45 are open on the side of each end lamination adjacent end turns 21 so that the coolant oil can be sprayed from the slots in the direction of the end turns , shown by the arrows 50 in fig4 to cool the end turns . to facilitate this spraying , the radially inner ends of the slots 45 are defined by surfaces 51 which are angled in the direction of the end turns for deflecting the fluid coolant toward the end turns . the end laminations 31 and 33 in the disclosed embodiment are formed of an insulating material , for example insulating material commercially sold and marketed as nomex ยฎ, with the end laminations being glued or epoxied to the stator core 28 . alternatively , the end laminations 31 , 33 could also be formed of the same or another magnetic material as the intermediate laminations of the stator core . an annular collar 53 ( fig1 ) of the housing 15 is releasably fastened to one axial end of the housing by bolts 55 for clamping the radially outer portion of the stator core 28 in position in the housing 15 . the collar 53 also forms part of the annular passage 47 adjacent end lamination 31 for retaining coolant in the passage in the third embodiment discussed above . the dynamoelectric machine 9 shown in fig1 also carries a generator differential current transformer 57 on end turns 21 at one end of the stator 13 . the transformer 57 may be attached to the end turns using a glass tie or cord formed of another insulating material , such as that commercially sold and marketed as nomex ยฎ or other insulating cord which is epoxied in place after attachment . the outside diameter of the stator 13 is typically six inches in the illustrated embodiments , for the two - pole generator with the rotor 11 having an outside diameter of three inches . for a four - pole generator , the outside diameter of the stator is typically eight inches , for example . the laminations 17 of the laminated stator core 28 preferably each have a thickness within the range 0 . 006 - 0 . 020 inch . the laminations 17 in the preferred embodiment are 0 . 014 inch thick . the radial and axial transfer bores 39 and 41 in the preferred embodiment may be drilled into the assembled stator core 28 or may be formed by punching the laminations during manufacture prior to assembly . the axial fluid passages are machined into the housing 15 during the manufacture process at the same time as the fluid channels 25 . the width of the slots 45 in the end lamination 31 and 33 for the third embodiment is preferably 0 . 020 - 0 . 030 inch with the radially inner edge of the slots being angled in the direction of the adjacent stator winding end turns as seen in the drawings of fig4 and 7 . the slots are open , through slots extending from one side of the end laminations to the other . as a result of this construction , the slots 45 and also the grooves 29 in the other periphery of the end lamination 31 and 33 can be formed during manufacturing by punching . while we have shown and described only three embodiments in accordance with the present invention , it is understood that the present invention is not limited thereto but is susceptible to variations as will be understood by the skilled artisan . for example , the dynamoelectric machine of the invention can be used in other types of apparatus than a generator , such as in an induction motor or other electrical apparatus wherein stator winding end turns must be cooled . therefore , we do not wish to be limited to the details shown and described therein , but intend to cover all such changes and modifications as are encompassed by the scope of the appended claims .
7