Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Write the same code in Go as shown below in Java.
import java.util.*; public class SortComp1 { public static void main(String[] args) { List<String> items = Arrays.asList("violet", "red", "green", "indigo", "blue", "yellow", "orange"); List<String> sortedItems = new ArrayList<>(); Comparator<String> interactiveCompare = new Comparator<String>() { int count = 0; Scanner s = new Scanner(System.in); public int compare(String s1, String s2) { System.out.printf("(%d) Is %s <, =, or > %s. Answer -1, 0, or 1: ", ++count, s1, s2); return s.nextInt(); } }; for (String item : items) { System.out.printf("Inserting '%s' into %s\n", item, sortedItems); int spotToInsert = Collections.binarySearch(sortedItems, item, interactiveCompare); if (spotToInsert < 0) spotToInsert = ~spotToInsert; sortedItems.add(spotToInsert, item); } System.out.println(sortedItems); } }
package main import ( "fmt" "sort" "strings" ) var count int = 0 func interactiveCompare(s1, s2 string) bool { count++ fmt.Printf("(%d) Is %s < %s? ", count, s1, s2) var response string _, err := fmt.Scanln(&response) return err == nil && strings.HasPrefix(response, "y") } func main() { items := []string{"violet", "red", "green", "indigo", "blue", "yellow", "orange"} var sortedItems []string for _, item := range items { fmt.Printf("Inserting '%s' into %s\n", item, sortedItems) spotToInsert := sort.Search(len(sortedItems), func(i int) bool { return interactiveCompare(item, sortedItems[i]) }) sortedItems = append(sortedItems[:spotToInsert], append([]string{item}, sortedItems[spotToInsert:]...)...) } fmt.Println(sortedItems) }
Keep all operations the same but rewrite the snippet in Go.
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
package main import ( "fmt" "math" ) func Fib1000() []float64 { a, b, r := 0., 1., [1000]float64{} for i := range r { r[i], a, b = b, b, b+a } return r[:] } func main() { show(Fib1000(), "First 1000 Fibonacci numbers") } func show(c []float64, title string) { var f [9]int for _, v := range c { f[fmt.Sprintf("%g", v)[0]-'1']++ } fmt.Println(title) fmt.Println("Digit Observed Predicted") for i, n := range f { fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)), math.Log10(1+1/float64(i+1))) } }
Ensure the translated Go code behaves exactly like the original Java snippet.
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
package main import ( "fmt" "math" ) func Fib1000() []float64 { a, b, r := 0., 1., [1000]float64{} for i := range r { r[i], a, b = b, b, b+a } return r[:] } func main() { show(Fib1000(), "First 1000 Fibonacci numbers") } func show(c []float64, title string) { var f [9]int for _, v := range c { f[fmt.Sprintf("%g", v)[0]-'1']++ } fmt.Println(title) fmt.Println("Digit Observed Predicted") for i, n := range f { fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)), math.Log10(1+1/float64(i+1))) } }
Rewrite the snippet below in Go so it works the same as the original Java code.
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
Write the same algorithm in Go as shown in this Java implementation.
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
Change the following Java code into Go without altering its purpose.
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
package main import "fmt" func main() { for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} { f, ok := arFib(n) if ok { fmt.Printf("fib %d = %d\n", n, f) } else { fmt.Println("fib undefined for negative numbers") } } } func arFib(n int) (int, bool) { switch { case n < 0: return 0, false case n < 2: return n, true } return yc(func(recurse fn) fn { return func(left, term1, term2 int) int { if left == 0 { return term1+term2 } return recurse(left-1, term1+term2, term1) } })(n-2, 1, 0), true } type fn func(int, int, int) int type ff func(fn) fn type fx func(fx) fn func yc(f ff) fn { return func(x fx) fn { return x(x) }(func(x fx) fn { return f(func(a1, a2, a3 int) int { return x(x)(a1, a2, a3) }) }) }
Produce a functionally identical Go code for the snippet given in Java.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Produce a language-to-language conversion: from Java to Go, same semantics.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Translate the given Java code snippet into Go without altering its behavior.
import java.util.*; public class LegendrePrimeCounter { public static void main(String[] args) { LegendrePrimeCounter counter = new LegendrePrimeCounter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) System.out.printf("10^%d\t%d\n", i, counter.primeCount((n))); } private List<Integer> primes; public LegendrePrimeCounter(int limit) { primes = generatePrimes((int)Math.sqrt((double)limit)); } public int primeCount(int n) { if (n < 2) return 0; int a = primeCount((int)Math.sqrt((double)n)); return phi(n, a) + a - 1; } private int phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes.get(a - 1); if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } private static List<Integer> generatePrimes(int limit) { boolean[] sieve = new boolean[limit >> 1]; Arrays.fill(sieve, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } List<Integer> primes = new ArrayList<>(); if (limit > 2) primes.add(2); for (int i = 1; i < sieve.length; ++i) { if (sieve[i]) primes.add((i << 1) + 1); } return primes; } }
package main import ( "fmt" "log" "math" "rcu" ) func cantorPair(x, y int) int { if x < 0 || y < 0 { log.Fatal("Arguments must be non-negative integers.") } return (x*x + 3*x + 2*x*y + y + y*y) / 2 } func pi(n int) int { if n < 2 { return 0 } if n == 2 { return 1 } primes := rcu.Primes(int(math.Sqrt(float64(n)))) a := len(primes) memoPhi := make(map[int]int) var phi func(x, a int) int phi = func(x, a int) int { if a < 1 { return x } if a == 1 { return x - (x >> 1) } pa := primes[a-1] if x <= pa { return 1 } key := cantorPair(x, a) if v, ok := memoPhi[key]; ok { return v } memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1) return memoPhi[key] } return phi(n, a) + a - 1 } func main() { for i, n := 0, 1; i <= 9; i, n = i+1, n*10 { fmt.Printf("10^%d %d\n", i, pi(n)) } }
Generate an equivalent Go version of this Java code.
public class Query { public static boolean call(byte[] data, int[] length) throws java.io.UnsupportedEncodingException { String message = "Here am I"; byte[] mb = message.getBytes("utf-8"); if (length[0] < mb.length) return false; length[0] = mb.length; System.arraycopy(mb, 0, data, 0, mb.length); return true; } }
package main import "C" import "unsafe" func main() { C.Run() } const msg = "Here am I" func Query(cbuf *C.char, csiz *C.size_t) C.int { if int(*csiz) <= len(msg) { return 0 } pbuf := uintptr(unsafe.Pointer(cbuf)) for i := 0; i < len(msg); i++ { *((*byte)(unsafe.Pointer(pbuf))) = msg[i] pbuf++ } *((*byte)(unsafe.Pointer(pbuf))) = 0 *csiz = C.size_t(len(msg) + 1) return 1 }
Generate an equivalent Go version of this Java code.
import java.io.File; import java.util.Scanner; public class LongestStringChallenge { public static void main(String[] args) throws Exception { String lines = "", longest = ""; try (Scanner sc = new Scanner(new File("lines.txt"))) { while(sc.hasNext()) { String line = sc.nextLine(); if (longer(longest, line)) lines = longest = line; else if (!longer(line, longest)) lines = lines.concat("\n").concat(line); } } System.out.println(lines); } static boolean longer(String a, String b) { try { String dummy = a.substring(b.length()); } catch (StringIndexOutOfBoundsException e) { return true; } return false; } }
package main import ( "bufio" "os" ) func main() { in := bufio.NewReader(os.Stdin) var blankLine = "\n" var printLongest func(string) string printLongest = func(candidate string) (longest string) { longest = candidate s, err := in.ReadString('\n') defer func() { recover() defer func() { recover() }() _ = blankLine[0] func() { defer func() { recover() }() _ = s[len(longest)] longest = s }() longest = printLongest(longest) func() { defer func() { recover() os.Stdout.WriteString(s) }() _ = longest[len(s)] s = "" }() }() _ = err.(error) os.Stdout.WriteString(blankLine) blankLine = "" return } printLongest("") }
Transform the following Java implementation into Go, maintaining the same output and logic.
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Rewrite this program in Go while keeping its functionality equivalent to the Java version.
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Can you help me rewrite this code in Go instead of Java, keeping it the same logically?
import java.io.*; public class CreateFileTest { public static void main(String args[]) { try { new File("output.txt").createNewFile(); new File(File.separator + "output.txt").createNewFile(); new File("docs").mkdir(); new File(File.separator + "docs").mkdir(); } catch (IOException e) { System.err.println(e.getMessage()); } } }
package main import ( "fmt" "os" ) func createFile(fn string) { f, err := os.Create(fn) if err != nil { fmt.Println(err) return } fmt.Println("file", fn, "created!") f.Close() } func createDir(dn string) { err := os.Mkdir(dn, 0666) if err != nil { fmt.Println(err) return } fmt.Println("directory", dn, "created!") } func main() { createFile("input.txt") createFile("/input.txt") createDir("docs") createDir("/docs") }
Convert this Java block to Go, preserving its control flow and logic.
public class UnprimeableNumbers { private static int MAX = 10_000_000; private static boolean[] primes = new boolean[MAX]; public static void main(String[] args) { sieve(); System.out.println("First 35 unprimeable numbers:"); displayUnprimeableNumbers(35); int n = 600; System.out.printf("%nThe %dth unprimeable number = %,d%n%n", n, nthUnprimeableNumber(n)); int[] lowest = genLowest(); System.out.println("Least unprimeable number that ends in:"); for ( int i = 0 ; i <= 9 ; i++ ) { System.out.printf(" %d is %,d%n", i, lowest[i]); } } private static int[] genLowest() { int[] lowest = new int[10]; int count = 0; int test = 1; while ( count < 10 ) { test++; if ( unPrimable(test) && lowest[test % 10] == 0 ) { lowest[test % 10] = test; count++; } } return lowest; } private static int nthUnprimeableNumber(int maxCount) { int test = 1; int count = 0; int result = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; result = test; } } return result; } private static void displayUnprimeableNumbers(int maxCount) { int test = 1; int count = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; System.out.printf("%d ", test); } } System.out.println(); } private static boolean unPrimable(int test) { if ( primes[test] ) { return false; } String s = test + ""; for ( int i = 0 ; i < s.length() ; i++ ) { for ( int j = 0 ; j <= 9 ; j++ ) { if ( primes[Integer.parseInt(replace(s, i, j))] ) { return false; } } } return true; } private static String replace(String str, int position, int value) { char[] sChar = str.toCharArray(); sChar[position] = (char) value; return str.substring(0, position) + value + str.substring(position + 1); } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } }
package main import ( "fmt" "strconv" ) func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func commatize(n int) string { s := fmt.Sprintf("%d", n) le := len(s) for i := le - 3; i >= 1; i -= 3 { s = s[0:i] + "," + s[i:] } return s } func main() { fmt.Println("The first 35 unprimeable numbers are:") count := 0 var firstNum [10]int outer: for i, countFirst := 100, 0; countFirst < 10; i++ { if isPrime(i) { continue } s := strconv.Itoa(i) le := len(s) b := []byte(s) for j := 0; j < le; j++ { for k := byte('0'); k <= '9'; k++ { if s[j] == k { continue } b[j] = k n, _ := strconv.Atoi(string(b)) if isPrime(n) { continue outer } } b[j] = s[j] } lastDigit := s[le-1] - '0' if firstNum[lastDigit] == 0 { firstNum[lastDigit] = i countFirst++ } count++ if count <= 35 { fmt.Printf("%d ", i) } if count == 35 { fmt.Print("\n\nThe 600th unprimeable number is: ") } if count == 600 { fmt.Printf("%s\n\n", commatize(i)) } } fmt.Println("The first unprimeable number that ends in:") for i := 0; i < 10; i++ { fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i])) } }
Port the provided Java code into Go while preserving the original functionality.
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
Transform the following Java implementation into Go, maintaining the same output and logic.
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
Please provide an equivalent version of this Java code in Go.
import java.math.BigInteger; import java.util.ArrayList; import java.util.List; public class ChernicksCarmichaelNumbers { public static void main(String[] args) { for ( long n = 3 ; n < 10 ; n++ ) { long m = 0; boolean foundComposite = true; List<Long> factors = null; while ( foundComposite ) { m += (n <= 4 ? 1 : (long) Math.pow(2, n-4) * 5); factors = U(n, m); foundComposite = false; for ( long factor : factors ) { if ( ! isPrime(factor) ) { foundComposite = true; break; } } } System.out.printf("U(%d, %d) = %s = %s %n", n, m, display(factors), multiply(factors)); } } private static String display(List<Long> factors) { return factors.toString().replace("[", "").replace("]", "").replaceAll(", ", " * "); } private static BigInteger multiply(List<Long> factors) { BigInteger result = BigInteger.ONE; for ( long factor : factors ) { result = result.multiply(BigInteger.valueOf(factor)); } return result; } private static List<Long> U(long n, long m) { List<Long> factors = new ArrayList<>(); factors.add(6*m + 1); factors.add(12*m + 1); for ( int i = 1 ; i <= n-2 ; i++ ) { factors.add(((long)Math.pow(2, i)) * 9 * m + 1); } return factors; } private static final int MAX = 100_000; private static final boolean[] primes = new boolean[MAX]; private static boolean SIEVE_COMPLETE = false; private static final boolean isPrimeTrivial(long test) { if ( ! SIEVE_COMPLETE ) { sieve(); SIEVE_COMPLETE = true; } return primes[(int) test]; } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } public static final boolean isPrime(long testValue) { if ( testValue == 2 ) return true; if ( testValue % 2 == 0 ) return false; if ( testValue <= MAX ) return isPrimeTrivial(testValue); long d = testValue-1; int s = 0; while ( d % 2 == 0 ) { s += 1; d /= 2; } if ( testValue < 1373565L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(3, s, d, testValue) ) { return false; } return true; } if ( testValue < 4759123141L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(7, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } return true; } if ( testValue < 10000000000000000L ) { if ( ! aSrp(3, s, d, testValue) ) { return false; } if ( ! aSrp(24251, s, d, testValue) ) { return false; } return true; } if ( ! aSrp(37, s, d, testValue) ) { return false; } if ( ! aSrp(47, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } if ( ! aSrp(73, s, d, testValue) ) { return false; } if ( ! aSrp(83, s, d, testValue) ) { return false; } return true; } private static final boolean aSrp(int a, int s, long d, long n) { long modPow = modPow(a, d, n); if ( modPow == 1 ) { return true; } int twoExpR = 1; for ( int r = 0 ; r < s ; r++ ) { if ( modPow(modPow, twoExpR, n) == n-1 ) { return true; } twoExpR *= 2; } return false; } private static final long SQRT = (long) Math.sqrt(Long.MAX_VALUE); public static final long modPow(long base, long exponent, long modulus) { long result = 1; while ( exponent > 0 ) { if ( exponent % 2 == 1 ) { if ( result > SQRT || base > SQRT ) { result = multiply(result, base, modulus); } else { result = (result * base) % modulus; } } exponent >>= 1; if ( base > SQRT ) { base = multiply(base, base, modulus); } else { base = (base * base) % modulus; } } return result; } public static final long multiply(long a, long b, long modulus) { long x = 0; long y = a % modulus; long t; while ( b > 0 ) { if ( b % 2 == 1 ) { t = x + y; x = (t > modulus ? t-modulus : t); } t = y << 1; y = (t > modulus ? t-modulus : t); b >>= 1; } return x % modulus; } }
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
Port the provided Java code into Go while preserving the original functionality.
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Maintain the same structure and functionality when rewriting this code in Go.
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Change the following Java code into Go without altering its purpose.
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Keep all operations the same but rewrite the snippet in Go.
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
Convert this Java snippet to Go and keep its semantics consistent.
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
Write the same algorithm in Go as shown in this Java implementation.
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
package main import ( "fmt" "math/big" ) func main() { one := big.NewInt(1) pm := big.NewInt(1) var px, nx int var pb big.Int primes(4000, func(p int64) bool { pm.Mul(pm, pb.SetInt64(p)) px++ if pb.Add(pm, one).ProbablyPrime(0) || pb.Sub(pm, one).ProbablyPrime(0) { fmt.Print(px, " ") nx++ if nx == 20 { fmt.Println() return false } } return true }) } func primes(limit int, f func(int64) bool) { c := make([]bool, limit) c[0] = true c[1] = true lm := int64(limit) p := int64(2) for { f(p) p2 := p * p if p2 >= lm { break } for i := p2; i < lm; i += p { c[i] = true } for { p++ if !c[p] { break } } } for p++; p < lm; p++ { if !c[p] && !f(p) { break } } }
Write the same code in Go as shown below in Java.
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Generate a Go translation of this Java snippet without changing its computational steps.
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Write the same code in Go as shown below in Java.
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
Preserve the algorithm and functionality while converting the code from Java to Go.
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
Port the following code from Java to Go with equivalent syntax and logic.
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Change the following Java code into Go without altering its purpose.
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Please provide an equivalent version of this Java code in Go.
import java.util.List; import java.util.function.Function; public class LogisticCurveFitting { private static final double K = 7.8e9; private static final int N0 = 27; private static final List<Double> ACTUAL = List.of( 27.0, 27.0, 27.0, 44.0, 44.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 60.0, 60.0, 61.0, 61.0, 66.0, 83.0, 219.0, 239.0, 392.0, 534.0, 631.0, 897.0, 1350.0, 2023.0, 2820.0, 4587.0, 6067.0, 7823.0, 9826.0, 11946.0, 14554.0, 17372.0, 20615.0, 24522.0, 28273.0, 31491.0, 34933.0, 37552.0, 40540.0, 43105.0, 45177.0, 60328.0, 64543.0, 67103.0, 69265.0, 71332.0, 73327.0, 75191.0, 75723.0, 76719.0, 77804.0, 78812.0, 79339.0, 80132.0, 80995.0, 82101.0, 83365.0, 85203.0, 87024.0, 89068.0, 90664.0, 93077.0, 95316.0, 98172.0, 102133.0, 105824.0, 109695.0, 114232.0, 118610.0, 125497.0, 133852.0, 143227.0, 151367.0, 167418.0, 180096.0, 194836.0, 213150.0, 242364.0, 271106.0, 305117.0, 338133.0, 377918.0, 416845.0, 468049.0, 527767.0, 591704.0, 656866.0, 715353.0, 777796.0, 851308.0, 928436.0, 1000249.0, 1082054.0, 1174652.0 ); private static double f(double r) { var sq = 0.0; var len = ACTUAL.size(); for (int i = 0; i < len; i++) { var eri = Math.exp(r * i); var guess = (N0 * eri) / (1.0 + N0 * (eri - 1.0) / K); var diff = guess - ACTUAL.get(i); sq += diff * diff; } return sq; } private static double solve(Function<Double, Double> fn) { return solve(fn, 0.5, 0.0); } private static double solve(Function<Double, Double> fn, double guess, double epsilon) { double delta; if (guess != 0.0) { delta = guess; } else { delta = 1.0; } var f0 = fn.apply(guess); var factor = 2.0; while (delta > epsilon && guess != guess - delta) { var nf = fn.apply(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn.apply(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } delta *= factor; } return guess; } public static void main(String[] args) { var r = solve(LogisticCurveFitting::f); var r0 = Math.exp(12.0 * r); System.out.printf("r = %.16f, R0 = %.16f\n", r, r0); } }
package main import ( "fmt" "github.com/maorshutman/lm" "log" "math" ) const ( K = 7_800_000_000 n0 = 27 ) var y = []float64{ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, } func f(dst, p []float64) { for i := 0; i < len(y); i++ { t := float64(i) dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i] } } func main() { j := lm.NumJac{Func: f} prob := lm.LMProblem{ Dim: 1, Size: len(y), Func: f, Jac: j.Jac, InitParams: []float64{0.5}, Tau: 1e-6, Eps1: 1e-8, Eps2: 1e-8, } res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16}) if err != nil { log.Fatal(err) } r := res.X[0] fmt.Printf("The logistic curve r for the world data is %.8f\n", r) fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r)) }
Please provide an equivalent version of this Java code in Go.
import java.util.Arrays; import java.util.LinkedList; public class Strand{ public static <E extends Comparable<? super E>> LinkedList<E> strandSort(LinkedList<E> list){ if(list.size() <= 1) return list; LinkedList<E> result = new LinkedList<E>(); while(list.size() > 0){ LinkedList<E> sorted = new LinkedList<E>(); sorted.add(list.removeFirst()); for(Iterator<E> it = list.iterator(); it.hasNext(); ){ E elem = it.next(); if(sorted.peekLast().compareTo(elem) <= 0){ sorted.addLast(elem); it.remove(); } } result = merge(sorted, result); } return result; } private static <E extends Comparable<? super E>> LinkedList<E> merge(LinkedList<E> left, LinkedList<E> right){ LinkedList<E> result = new LinkedList<E>(); while(!left.isEmpty() && !right.isEmpty()){ if(left.peek().compareTo(right.peek()) <= 0) result.add(left.remove()); else result.add(right.remove()); } result.addAll(left); result.addAll(right); return result; } public static void main(String[] args){ System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,3,5,6)))); } }
package main import "fmt" type link struct { int next *link } func linkInts(s []int) *link { if len(s) == 0 { return nil } return &link{s[0], linkInts(s[1:])} } func (l *link) String() string { if l == nil { return "nil" } r := fmt.Sprintf("[%d", l.int) for l = l.next; l != nil; l = l.next { r = fmt.Sprintf("%s %d", r, l.int) } return r + "]" } func main() { a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66}) fmt.Println("before:", a) b := strandSort(a) fmt.Println("after: ", b) } func strandSort(a *link) (result *link) { for a != nil { sublist := a a = a.next sTail := sublist for p, pPrev := a, a; p != nil; p = p.next { if p.int > sTail.int { sTail.next = p sTail = p if p == a { a = p.next } else { pPrev.next = p.next } } else { pPrev = p } } sTail.next = nil if result == nil { result = sublist continue } var m, rr *link if sublist.int < result.int { m = sublist sublist = m.next rr = result } else { m = result rr = m.next } result = m for { if sublist == nil { m.next = rr break } if rr == nil { m.next = sublist break } if sublist.int < rr.int { m.next = sublist m = sublist sublist = m.next } else { m.next = rr m = rr rr = m.next } } } return }
Keep all operations the same but rewrite the snippet in Go.
public class additivePrimes { public static void main(String[] args) { int additive_primes = 0; for (int i = 2; i < 500; i++) { if(isPrime(i) && isPrime(digitSum(i))){ additive_primes++; System.out.print(i + " "); } } System.out.print("\nFound " + additive_primes + " additive primes less than 500"); } static boolean isPrime(int n) { int counter = 1; if (n < 2 || (n != 2 && n % 2 == 0) || (n != 3 && n % 3 == 0)) { return false; } while (counter * 6 - 1 <= Math.sqrt(n)) { if (n % (counter * 6 - 1) == 0 || n % (counter * 6 + 1) == 0) { return false; } else { counter++; } } return true; } static int digitSum(int n) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } }
package main import "fmt" func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func sumDigits(n int) int { sum := 0 for n > 0 { sum += n % 10 n /= 10 } return sum } func main() { fmt.Println("Additive primes less than 500:") i := 2 count := 0 for { if isPrime(i) && isPrime(sumDigits(i)) { count++ fmt.Printf("%3d ", i) if count%10 == 0 { fmt.Println() } } if i > 2 { i += 2 } else { i++ } if i > 499 { break } } fmt.Printf("\n\n%d additive primes found.\n", count) }
Rewrite the snippet below in Go so it works the same as the original Java code.
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Convert the following code from Java to Go, ensuring the logic remains intact.
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Write a version of this Java function in Go with identical behavior.
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Maintain the same structure and functionality when rewriting this code in Go.
interface Thingable { String thing(); } class Delegator { public Thingable delegate; public String operation() { if (delegate == null) return "default implementation"; else return delegate.thing(); } } class Delegate implements Thingable { public String thing() { return "delegate implementation"; } } public class DelegateExample { public static void main(String[] args) { Delegator a = new Delegator(); assert a.operation().equals("default implementation"); Delegate d = new Delegate(); a.delegate = d; assert a.operation().equals("delegate implementation"); a.delegate = new Thingable() { public String thing() { return "anonymous delegate implementation"; } }; assert a.operation().equals("anonymous delegate implementation"); } }
package main import "fmt" type Delegator struct { delegate interface{} } type Thingable interface { thing() string } func (self Delegator) operation() string { if v, ok := self.delegate.(Thingable); ok { return v.thing() } return "default implementation" } type Delegate int func (Delegate) thing() string { return "delegate implementation" } func main() { a := Delegator{} fmt.Println(a.operation()) a.delegate = "A delegate may be any object" fmt.Println(a.operation()) var d Delegate a.delegate = d fmt.Println(a.operation()) }
Maintain the same structure and functionality when rewriting this code in Go.
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Can you help me rewrite this code in Go instead of Java, keeping it the same logically?
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Maintain the same structure and functionality when rewriting this code in Go.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Preserve the algorithm and functionality while converting the code from Java to Go.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Produce a language-to-language conversion: from Java to Go, same semantics.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Change the following Java code into Go without altering its purpose.
final int immutableInt = 4; int mutableInt = 4; mutableInt = 6; immutableInt = 6;
package main func main() { s := "immutable" s[0] = 'a' }
Generate an equivalent Go version of this Java code.
import java.awt.*; import java.awt.geom.Line2D; import java.util.*; import java.util.List; import javax.swing.*; public class SutherlandHodgman extends JFrame { SutherlandHodgmanPanel panel; public static void main(String[] args) { JFrame f = new SutherlandHodgman(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); } public SutherlandHodgman() { Container content = getContentPane(); content.setLayout(new BorderLayout()); panel = new SutherlandHodgmanPanel(); content.add(panel, BorderLayout.CENTER); setTitle("SutherlandHodgman"); pack(); setLocationRelativeTo(null); } } class SutherlandHodgmanPanel extends JPanel { List<double[]> subject, clipper, result; public SutherlandHodgmanPanel() { setPreferredSize(new Dimension(600, 500)); double[][] subjPoints = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; double[][] clipPoints = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; subject = new ArrayList<>(Arrays.asList(subjPoints)); result = new ArrayList<>(subject); clipper = new ArrayList<>(Arrays.asList(clipPoints)); clipPolygon(); } private void clipPolygon() { int len = clipper.size(); for (int i = 0; i < len; i++) { int len2 = result.size(); List<double[]> input = result; result = new ArrayList<>(len2); double[] A = clipper.get((i + len - 1) % len); double[] B = clipper.get(i); for (int j = 0; j < len2; j++) { double[] P = input.get((j + len2 - 1) % len2); double[] Q = input.get(j); if (isInside(A, B, Q)) { if (!isInside(A, B, P)) result.add(intersection(A, B, P, Q)); result.add(Q); } else if (isInside(A, B, P)) result.add(intersection(A, B, P, Q)); } } } private boolean isInside(double[] a, double[] b, double[] c) { return (a[0] - c[0]) * (b[1] - c[1]) > (a[1] - c[1]) * (b[0] - c[0]); } private double[] intersection(double[] a, double[] b, double[] p, double[] q) { double A1 = b[1] - a[1]; double B1 = a[0] - b[0]; double C1 = A1 * a[0] + B1 * a[1]; double A2 = q[1] - p[1]; double B2 = p[0] - q[0]; double C2 = A2 * p[0] + B2 * p[1]; double det = A1 * B2 - A2 * B1; double x = (B2 * C1 - B1 * C2) / det; double y = (A1 * C2 - A2 * C1) / det; return new double[]{x, y}; } @Override public void paintComponent(Graphics g) { super.paintComponent(g); Graphics2D g2 = (Graphics2D) g; g2.translate(80, 60); g2.setStroke(new BasicStroke(3)); g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); drawPolygon(g2, subject, Color.blue); drawPolygon(g2, clipper, Color.red); drawPolygon(g2, result, Color.green); } private void drawPolygon(Graphics2D g2, List<double[]> points, Color color) { g2.setColor(color); int len = points.size(); Line2D line = new Line2D.Double(); for (int i = 0; i < len; i++) { double[] p1 = points.get(i); double[] p2 = points.get((i + 1) % len); line.setLine(p1[0], p1[1], p2[0], p2[1]); g2.draw(line); } } }
package main import "fmt" type point struct { x, y float32 } var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}} var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}} func main() { var cp1, cp2, s, e point inside := func(p point) bool { return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x) } intersection := func() (p point) { dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y dpx, dpy := s.x-e.x, s.y-e.y n1 := cp1.x*cp2.y - cp1.y*cp2.x n2 := s.x*e.y - s.y*e.x n3 := 1 / (dcx*dpy - dcy*dpx) p.x = (n1*dpx - n2*dcx) * n3 p.y = (n1*dpy - n2*dcy) * n3 return } outputList := subjectPolygon cp1 = clipPolygon[len(clipPolygon)-1] for _, cp2 = range clipPolygon { inputList := outputList outputList = nil s = inputList[len(inputList)-1] for _, e = range inputList { if inside(e) { if !inside(s) { outputList = append(outputList, intersection()) } outputList = append(outputList, e) } else if inside(s) { outputList = append(outputList, intersection()) } s = e } cp1 = cp2 } fmt.Println(outputList) }
Port the provided Java code into Go while preserving the original functionality.
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Change the following Java code into Go without altering its purpose.
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Port the provided Java code into Go while preserving the original functionality.
public class Blah { public static void main(String[] args) { print2dArray(getSpiralArray(5)); } public static int[][] getSpiralArray(int dimension) { int[][] spiralArray = new int[dimension][dimension]; int numConcentricSquares = (int) Math.ceil((dimension) / 2.0); int j; int sideLen = dimension; int currNum = 0; for (int i = 0; i < numConcentricSquares; i++) { for (j = 0; j < sideLen; j++) { spiralArray[i][i + j] = currNum++; } for (j = 1; j < sideLen; j++) { spiralArray[i + j][dimension - 1 - i] = currNum++; } for (j = sideLen - 2; j > -1; j--) { spiralArray[dimension - 1 - i][i + j] = currNum++; } for (j = sideLen - 2; j > 0; j--) { spiralArray[i + j][i] = currNum++; } sideLen -= 2; } return spiralArray; } public static void print2dArray(int[][] array) { for (int[] row : array) { for (int elem : row) { System.out.printf("%3d", elem); } System.out.println(); } } }
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
Rewrite this program in Go while keeping its functionality equivalent to the Java version.
module OptionalParameters { typedef Type<String >.Orderer as ColumnOrderer; typedef Type<String[]>.Orderer as RowOrderer; static String[][] sort(String[][] table, ColumnOrderer? orderer = Null, Int column = 0, Boolean reverse = False, ) { orderer ?:= (s1, s2) -> s1 <=> s2; ColumnOrderer byString = reverse ? ((s1, s2) -> orderer(s1, s2).reversed) : orderer; RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]); return table.sorted(byColumn); } void run() { String[][] table = [ ["c", "x", "i"], ["a", "y", "p"], ["b", "z", "a"], ]; show("original input", table); show("by default sort on column 0", sort(table)); show("by column 2", sort(table, column=2)); show("by column 2 reversed", sort(table, column=2, reverse=True)); } void show(String title, String[][] table) { @Inject Console console; console.print($"{title}:"); for (val row : table) { console.print($" {row}"); } console.print(); } }
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
Port the provided Java code into Go while preserving the original functionality.
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Port the following code from Java to Go with equivalent syntax and logic.
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Write the same algorithm in Go as shown in this Java implementation.
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Produce a language-to-language conversion: from Java to Go, same semantics.
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
Translate the given Java code snippet into Go without altering its behavior.
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
Change the programming language of this snippet from Java to Go without modifying what it does.
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
Change the following Java code into Go without altering its purpose.
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
Ensure the translated Go code behaves exactly like the original Java snippet.
import java.math.BigDecimal; import java.math.MathContext; import java.util.Arrays; import java.util.stream.LongStream; public class FaulhabersTriangle { private static final MathContext MC = new MathContext(256); private static long gcd(long a, long b) { if (b == 0) { return a; } return gcd(b, a % b); } private static class Frac implements Comparable<Frac> { private long num; private long denom; public static final Frac ZERO = new Frac(0, 1); public Frac(long n, long d) { if (d == 0) throw new IllegalArgumentException("d must not be zero"); long nn = n; long dd = d; if (nn == 0) { dd = 1; } else if (dd < 0) { nn = -nn; dd = -dd; } long g = Math.abs(gcd(nn, dd)); if (g > 1) { nn /= g; dd /= g; } num = nn; denom = dd; } public Frac plus(Frac rhs) { return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom); } public Frac unaryMinus() { return new Frac(-num, denom); } public Frac minus(Frac rhs) { return this.plus(rhs.unaryMinus()); } public Frac times(Frac rhs) { return new Frac(this.num * rhs.num, this.denom * rhs.denom); } @Override public int compareTo(Frac o) { double diff = toDouble() - o.toDouble(); return Double.compare(diff, 0.0); } @Override public boolean equals(Object obj) { return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0; } @Override public String toString() { if (denom == 1) { return Long.toString(num); } return String.format("%d/%d", num, denom); } public double toDouble() { return (double) num / denom; } public BigDecimal toBigDecimal() { return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC); } } private static Frac bernoulli(int n) { if (n < 0) throw new IllegalArgumentException("n may not be negative or zero"); Frac[] a = new Frac[n + 1]; Arrays.fill(a, Frac.ZERO); for (int m = 0; m <= n; ++m) { a[m] = new Frac(1, m + 1); for (int j = m; j >= 1; --j) { a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1)); } } if (n != 1) return a[0]; return a[0].unaryMinus(); } private static long binomial(int n, int k) { if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException(); if (n == 0 || k == 0) return 1; long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b); long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i); return num / den; } private static Frac[] faulhaberTriangle(int p) { Frac[] coeffs = new Frac[p + 1]; Arrays.fill(coeffs, Frac.ZERO); Frac q = new Frac(1, p + 1); int sign = -1; for (int j = 0; j <= p; ++j) { sign *= -1; coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j)); } return coeffs; } public static void main(String[] args) { for (int i = 0; i <= 9; ++i) { Frac[] coeffs = faulhaberTriangle(i); for (Frac coeff : coeffs) { System.out.printf("%5s ", coeff); } System.out.println(); } System.out.println(); int k = 17; Frac[] cc = faulhaberTriangle(k); int n = 1000; BigDecimal nn = BigDecimal.valueOf(n); BigDecimal np = BigDecimal.ONE; BigDecimal sum = BigDecimal.ZERO; for (Frac c : cc) { np = np.multiply(nn); sum = sum.add(np.multiply(c.toBigDecimal())); } System.out.println(sum.toBigInteger()); } }
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
Write the same code in Go as shown below in Java.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Convert the following code from Java to Go, ensuring the logic remains intact.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Transform the following Java implementation into Go, maintaining the same output and logic.
String[] fruits = ["apples", "oranges"]; String[] grains = ["wheat", "corn"]; String[] all = fruits + grains;
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
Produce a language-to-language conversion: from Java to Go, same semantics.
import java.util.Scanner; public class GetInput { public static void main(String[] args) throws Exception { Scanner s = new Scanner(System.in); System.out.print("Enter a string: "); String str = s.nextLine(); System.out.print("Enter an integer: "); int i = Integer.parseInt(s.next()); } }
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
Convert this Java snippet to Go and keep its semantics consistent.
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Write the same algorithm in Go as shown in this Java implementation.
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Convert this Java snippet to Go and keep its semantics consistent.
package hu.pj.alg.test; import hu.pj.alg.ZeroOneKnapsack; import hu.pj.obj.Item; import java.util.*; import java.text.*; public class ZeroOneKnapsackForTourists { public ZeroOneKnapsackForTourists() { ZeroOneKnapsack zok = new ZeroOneKnapsack(400); zok.add("map", 9, 150); zok.add("compass", 13, 35); zok.add("water", 153, 200); zok.add("sandwich", 50, 160); zok.add("glucose", 15, 60); zok.add("tin", 68, 45); zok.add("banana", 27, 60); zok.add("apple", 39, 40); zok.add("cheese", 23, 30); zok.add("beer", 52, 10); zok.add("suntan cream", 11, 70); zok.add("camera", 32, 30); zok.add("t-shirt", 24, 15); zok.add("trousers", 48, 10); zok.add("umbrella", 73, 40); zok.add("waterproof trousers", 42, 70); zok.add("waterproof overclothes", 43, 75); zok.add("note-case", 22, 80); zok.add("sunglasses", 7, 20); zok.add("towel", 18, 12); zok.add("socks", 4, 50); zok.add("book", 30, 10); List<Item> itemList = zok.calcSolution(); if (zok.isCalculated()) { NumberFormat nf = NumberFormat.getInstance(); System.out.println( "Maximal weight = " + nf.format(zok.getMaxWeight() / 100.0) + " kg" ); System.out.println( "Total weight of solution = " + nf.format(zok.getSolutionWeight() / 100.0) + " kg" ); System.out.println( "Total value = " + zok.getProfit() ); System.out.println(); System.out.println( "You can carry the following materials " + "in the knapsack:" ); for (Item item : itemList) { if (item.getInKnapsack() == 1) { System.out.format( "%1$-23s %2$-3s %3$-5s %4$-15s \n", item.getName(), item.getWeight(), "dag ", "(value = " + item.getValue() + ")" ); } } } else { System.out.println( "The problem is not solved. " + "Maybe you gave wrong data." ); } } public static void main(String[] args) { new ZeroOneKnapsackForTourists(); } }
package main import "fmt" type item struct { string w, v int } var wants = []item{ {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, } const maxWt = 400 func main() { items, w, v := m(len(wants)-1, maxWt) fmt.Println(items) fmt.Println("weight:", w) fmt.Println("value:", v) } func m(i, w int) ([]string, int, int) { if i < 0 || w == 0 { return nil, 0, 0 } else if wants[i].w > w { return m(i-1, w) } i0, w0, v0 := m(i-1, w) i1, w1, v1 := m(i-1, w-wants[i].w) v1 += wants[i].v if v1 > v0 { return append(i1, wants[i].string), w1 + wants[i].w, v1 } return i0, w0, v0 }
Transform the following Java implementation into Go, maintaining the same output and logic.
import java.io.*; import java.util.*; public class PrimeDescendants { public static void main(String[] args) { try (Writer writer = new BufferedWriter(new OutputStreamWriter(System.out))) { printPrimeDesc(writer, 100); } catch (IOException ex) { ex.printStackTrace(); } } private static void printPrimeDesc(Writer writer, int limit) throws IOException { List<Long> primes = findPrimes(limit); List<Long> ancestor = new ArrayList<>(limit); List<List<Long>> descendants = new ArrayList<>(limit); for (int i = 0; i < limit; ++i) { ancestor.add(Long.valueOf(0)); descendants.add(new ArrayList<Long>()); } for (Long prime : primes) { int p = prime.intValue(); descendants.get(p).add(prime); for (int i = 0; i + p < limit; ++i) { int s = i + p; for (Long n : descendants.get(i)) { Long prod = n * p; descendants.get(s).add(prod); if (prod < limit) ancestor.set(prod.intValue(), Long.valueOf(s)); } } } int totalDescendants = 0; for (int i = 1; i < limit; ++i) { List<Long> ancestors = getAncestors(ancestor, i); writer.write("[" + i + "] Level: " + ancestors.size() + "\n"); writer.write("Ancestors: "); Collections.sort(ancestors); print(writer, ancestors); writer.write("Descendants: "); List<Long> desc = descendants.get(i); if (!desc.isEmpty()) { Collections.sort(desc); if (desc.get(0) == i) desc.remove(0); } writer.write(desc.size() + "\n"); totalDescendants += desc.size(); if (!desc.isEmpty()) print(writer, desc); writer.write("\n"); } writer.write("Total descendants: " + totalDescendants + "\n"); } private static List<Long> findPrimes(int limit) { boolean[] isprime = new boolean[limit]; Arrays.fill(isprime, true); isprime[0] = isprime[1] = false; for (int p = 2; p * p < limit; ++p) { if (isprime[p]) { for (int i = p * p; i < limit; i += p) isprime[i] = false; } } List<Long> primes = new ArrayList<>(); for (int p = 2; p < limit; ++p) { if (isprime[p]) primes.add(Long.valueOf(p)); } return primes; } private static List<Long> getAncestors(List<Long> ancestor, int n) { List<Long> result = new ArrayList<>(); for (Long a = ancestor.get(n); a != 0 && a != n; ) { n = a.intValue(); a = ancestor.get(n); result.add(Long.valueOf(n)); } return result; } private static void print(Writer writer, List<Long> list) throws IOException { if (list.isEmpty()) { writer.write("none\n"); return; } int i = 0; writer.write(String.valueOf(list.get(i++))); for (; i != list.size(); ++i) writer.write(", " + list.get(i)); writer.write("\n"); } }
package main import ( "fmt" "sort" ) func getPrimes(max int) []int { if max < 2 { return []int{} } lprimes := []int{2} outer: for x := 3; x <= max; x += 2 { for _, p := range lprimes { if x%p == 0 { continue outer } } lprimes = append(lprimes, x) } return lprimes } func main() { const maxSum = 99 descendants := make([][]int64, maxSum+1) ancestors := make([][]int, maxSum+1) for i := 0; i <= maxSum; i++ { descendants[i] = []int64{} ancestors[i] = []int{} } primes := getPrimes(maxSum) for _, p := range primes { descendants[p] = append(descendants[p], int64(p)) for s := 1; s < len(descendants)-p; s++ { temp := make([]int64, len(descendants[s])) for i := 0; i < len(descendants[s]); i++ { temp[i] = int64(p) * descendants[s][i] } descendants[s+p] = append(descendants[s+p], temp...) } } for _, p := range append(primes, 4) { le := len(descendants[p]) if le == 0 { continue } descendants[p][le-1] = 0 descendants[p] = descendants[p][:le-1] } total := 0 for s := 1; s <= maxSum; s++ { x := descendants[s] sort.Slice(x, func(i, j int) bool { return x[i] < x[j] }) total += len(descendants[s]) index := 0 for ; index < len(descendants[s]); index++ { if descendants[s][index] > int64(maxSum) { break } } for _, d := range descendants[s][:index] { ancestors[d] = append(ancestors[s], s) } if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) { continue } temp := fmt.Sprintf("%v", ancestors[s]) fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp) le := len(descendants[s]) if le <= 10 { fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s]) } else { fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10]) } } fmt.Println("\nTotal descendants", total) }
Convert this Java block to Go, preserving its control flow and logic.
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Change the programming language of this snippet from Java to Go without modifying what it does.
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Can you help me rewrite this code in Go instead of Java, keeping it the same logically?
import java.util.ArrayList; public class FirstClass{ public interface Function<A,B>{ B apply(A x); } public static <A,B,C> Function<A, C> compose( final Function<B, C> f, final Function<A, B> g) { return new Function<A, C>() { @Override public C apply(A x) { return f.apply(g.apply(x)); } }; } public static void main(String[] args){ ArrayList<Function<Double, Double>> functions = new ArrayList<Function<Double,Double>>(); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.cos(x); } }); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.tan(x); } }); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return x * x; } }); ArrayList<Function<Double, Double>> inverse = new ArrayList<Function<Double,Double>>(); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.acos(x); } }); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.atan(x); } }); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.sqrt(x); } }); System.out.println("Compositions:"); for(int i = 0; i < functions.size(); i++){ System.out.println(compose(functions.get(i), inverse.get(i)).apply(0.5)); } System.out.println("Hard-coded compositions:"); System.out.println(Math.cos(Math.acos(0.5))); System.out.println(Math.tan(Math.atan(0.5))); System.out.println(Math.pow(Math.sqrt(0.5), 2)); } }
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
Convert the following code from Java to Go, ensuring the logic remains intact.
import java.util.Collections; import java.util.LinkedList; import java.util.List; public class Proper{ public static List<Integer> properDivs(int n){ List<Integer> divs = new LinkedList<Integer>(); if(n == 1) return divs; divs.add(1); for(int x = 2; x < n; x++){ if(n % x == 0) divs.add(x); } Collections.sort(divs); return divs; } public static void main(String[] args){ for(int x = 1; x <= 10; x++){ System.out.println(x + ": " + properDivs(x)); } int x = 0, count = 0; for(int n = 1; n <= 20000; n++){ if(properDivs(n).size() > count){ x = n; count = properDivs(n).size(); } } System.out.println(x + ": " + count); } }
package main import ( "fmt" "strconv" ) func listProperDivisors(limit int) { if limit < 1 { return } width := len(strconv.Itoa(limit)) for i := 1; i <= limit; i++ { fmt.Printf("%*d -> ", width, i) if i == 1 { fmt.Println("(None)") continue } for j := 1; j <= i/2; j++ { if i%j == 0 { fmt.Printf(" %d", j) } } fmt.Println() } } func countProperDivisors(n int) int { if n < 2 { return 0 } count := 0 for i := 1; i <= n/2; i++ { if n%i == 0 { count++ } } return count } func main() { fmt.Println("The proper divisors of the following numbers are :\n") listProperDivisors(10) fmt.Println() maxCount := 0 most := []int{1} for n := 2; n <= 20000; n++ { count := countProperDivisors(n) if count == maxCount { most = append(most, n) } else if count > maxCount { maxCount = count most = most[0:1] most[0] = n } } fmt.Print("The following number(s) <= 20000 have the most proper divisors, ") fmt.Println("namely", maxCount, "\b\n") for _, n := range most { fmt.Println(n) } }
Ensure the translated Go code behaves exactly like the original Java snippet.
import java.io.StringWriter; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.Result; import javax.xml.transform.Source; import javax.xml.transform.Transformer; import javax.xml.transform.TransformerFactory; import javax.xml.transform.dom.DOMSource; import javax.xml.transform.stream.StreamResult; import org.w3c.dom.Document; import org.w3c.dom.Element; public class XmlCreation { private static final String[] names = {"April", "Tam O'Shanter", "Emily"}; private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift"}; public static void main(String[] args) { try { final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument(); final Element root = doc.createElement("CharacterRemarks"); doc.appendChild(root); for(int i = 0; i < names.length; i++) { final Element character = doc.createElement("Character"); root.appendChild(character); character.setAttribute("name", names[i]); character.appendChild(doc.createTextNode(remarks[i])); } final Source source = new DOMSource(doc); final StringWriter buffer = new StringWriter(); final Result result = new StreamResult(buffer); final Transformer transformer = TransformerFactory.newInstance().newTransformer(); transformer.setOutputProperty("indent", "yes"); transformer.transform(source, result); System.out.println(buffer.toString()); } catch (Exception e) { e.printStackTrace(); } } }
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
Generate an equivalent Go version of this Java code.
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Convert this Java snippet to Go and keep its semantics consistent.
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Rewrite this program in Go while keeping its functionality equivalent to the Java version.
String str = "I am a string"; if (str.matches(".*string")) { System.out.println("ends with 'string'"); }
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
Translate this program into Go but keep the logic exactly as in Java.
import java.util.AbstractList; import java.util.Collections; import java.util.Scanner; public class GuessNumber { public static final int LOWER = 0, UPPER = 100; public static void main(String[] args) { System.out.printf("Instructions:\n" + "Think of integer number from %d (inclusive) to %d (exclusive) and\n" + "I will guess it. After each guess, you respond with L, H, or C depending\n" + "on if my guess was too low, too high, or correct.\n", LOWER, UPPER); int result = Collections.binarySearch(new AbstractList<Integer>() { private final Scanner in = new Scanner(System.in); public int size() { return UPPER - LOWER; } public Integer get(int i) { System.out.printf("My guess is: %d. Is it too high, too low, or correct? (H/L/C) ", LOWER+i); String s = in.nextLine(); assert s.length() > 0; switch (Character.toLowerCase(s.charAt(0))) { case 'l': return -1; case 'h': return 1; case 'c': return 0; } return -1; } }, 0); if (result < 0) System.out.println("That is impossible."); else System.out.printf("Your number is %d.\n", result); } }
package main import ( "fmt" "sort" ) func main() { lower, upper := 0, 100 fmt.Printf(`Instructions: Think of integer number from %d (inclusive) to %d (exclusive) and I will guess it. After each guess, I will ask you if it is less than or equal to some number, and you will respond with "yes" or "no". `, lower, upper) answer := sort.Search(upper-lower, func (i int) bool { fmt.Printf("Is your number less than or equal to %d? ", lower+i) s := "" fmt.Scanf("%s", &s) return s != "" && s[0] == 'y' }) fmt.Printf("Your number is %d.\n", lower+answer) }
Convert the following code from Java to Go, ensuring the logic remains intact.
import java.util.HashMap; public static void main(String[] args){ String[] keys= {"a", "b", "c"}; int[] vals= {1, 2, 3}; HashMap<String, Integer> hash= new HashMap<String, Integer>(); for(int i= 0; i < keys.length; i++){ hash.put(keys[i], vals[i]); } }
package main import "fmt" func main() { keys := []string{"a", "b", "c"} vals := []int{1, 2, 3} hash := map[string]int{} for i, key := range keys { hash[key] = vals[i] } fmt.Println(hash) }
Translate this program into Go but keep the logic exactly as in Java.
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
Maintain the same structure and functionality when rewriting this code in Go.
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
Translate the given Java code snippet into Go without altering its behavior.
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
Convert this Java snippet to Go and keep its semantics consistent.
import java.awt.Color; import java.awt.Graphics; import javax.swing.JFrame; public class FractalTree extends JFrame { public FractalTree() { super("Fractal Tree"); setBounds(100, 100, 800, 600); setResizable(false); setDefaultCloseOperation(EXIT_ON_CLOSE); } private void drawTree(Graphics g, int x1, int y1, double angle, int depth) { if (depth == 0) return; int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0); int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0); g.drawLine(x1, y1, x2, y2); drawTree(g, x2, y2, angle - 20, depth - 1); drawTree(g, x2, y2, angle + 20, depth - 1); } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); drawTree(g, 400, 500, -90, 9); } public static void main(String[] args) { new FractalTree().setVisible(true); } }
package main import ( "math" "raster" ) const ( width = 400 height = 300 depth = 8 angle = 12 length = 50 frac = .8 ) func main() { g := raster.NewGrmap(width, height) ftree(g, width/2, height*9/10, length, 0, depth) g.Bitmap().WritePpmFile("ftree.ppm") } func ftree(g *raster.Grmap, x, y, distance, direction float64, depth int) { x2 := x + distance*math.Sin(direction*math.Pi/180) y2 := y - distance*math.Cos(direction*math.Pi/180) g.AaLine(x, y, x2, y2) if depth > 0 { ftree(g, x2, y2, distance*frac, direction-angle, depth-1) ftree(g, x2, y2, distance*frac, direction+angle, depth-1) } }
Port the provided Java code into Go while preserving the original functionality.
import java.awt.*; import static java.awt.Color.*; import javax.swing.*; public class ColourPinstripeDisplay extends JPanel { final static Color[] palette = {black, red, green, blue, magenta,cyan, yellow, white}; final int bands = 4; public ColourPinstripeDisplay() { setPreferredSize(new Dimension(900, 600)); } @Override public void paintComponent(Graphics g) { super.paintComponent(g); int h = getHeight(); for (int b = 1; b <= bands; b++) { for (int x = 0, colIndex = 0; x < getWidth(); x += b, colIndex++) { g.setColor(palette[colIndex % palette.length]); g.fillRect(x, (b - 1) * (h / bands), x + b, b * (h / bands)); } } } public static void main(String[] args) { SwingUtilities.invokeLater(() -> { JFrame f = new JFrame(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setTitle("ColourPinstripeDisplay"); f.add(new ColourPinstripeDisplay(), BorderLayout.CENTER); f.pack(); f.setLocationRelativeTo(null); f.setVisible(true); }); } }
package main import "github.com/fogleman/gg" var palette = [8]string{ "000000", "FF0000", "00FF00", "0000FF", "FF00FF", "00FFFF", "FFFF00", "FFFFFF", } func pinstripe(dc *gg.Context) { w := dc.Width() h := dc.Height() / 4 for b := 1; b <= 4; b++ { for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 { dc.SetHexColor(palette[ci%8]) y := h * (b - 1) dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h)) dc.Fill() } } } func main() { dc := gg.NewContext(900, 600) pinstripe(dc) dc.SavePNG("color_pinstripe.png") }
Write a version of this Java function in Go with identical behavior.
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
Keep all operations the same but rewrite the snippet in Go.
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
Convert this Java block to Go, preserving its control flow and logic.
import java.util.*; public class CocktailSort { public static void main(String[] args) { Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 }; System.out.println("before: " + Arrays.toString(array)); cocktailSort(array); System.out.println("after: " + Arrays.toString(array)); } public static void cocktailSort(Object[] array) { int begin = 0; int end = array.length; if (end == 0) return; for (--end; begin < end; ) { int new_begin = end; int new_end = begin; for (int i = begin; i < end; ++i) { Comparable c1 = (Comparable)array[i]; Comparable c2 = (Comparable)array[i + 1]; if (c1.compareTo(c2) > 0) { swap(array, i, i + 1); new_end = i; } } end = new_end; for (int i = end; i > begin; --i) { Comparable c1 = (Comparable)array[i - 1]; Comparable c2 = (Comparable)array[i]; if (c1.compareTo(c2) > 0) { swap(array, i, i - 1); new_begin = i; } } begin = new_begin; } } private static void swap(Object[] array, int i, int j) { Object tmp = array[i]; array[i] = array[j]; array[j] = tmp; } }
package main import ( "fmt" "math/rand" "time" ) func cocktailShakerSort(a []int) { var begin = 0 var end = len(a) - 2 for begin <= end { newBegin := end newEnd := begin for i := begin; i <= end; i++ { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newEnd = i } } end = newEnd - 1 for i := end; i >= begin; i-- { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newBegin = i } } begin = newBegin + 1 } } func cocktailSort(a []int) { last := len(a) - 1 for { swapped := false for i := 0; i < last; i++ { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } swapped = false for i := last - 1; i >= 0; i-- { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } } } func main() { a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170} fmt.Println("Original array:", a) b := make([]int, len(a)) copy(b, a) cocktailSort(a) fmt.Println("Cocktail sort :", a) cocktailShakerSort(b) fmt.Println("C/Shaker sort :", b) rand.Seed(time.Now().UnixNano()) fmt.Println("\nRelative speed of the two sorts") fmt.Println(" N x faster (CSS v CS)") fmt.Println("----- -------------------") const runs = 10 for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} { sum := 0.0 for i := 1; i <= runs; i++ { nums := make([]int, n) for i := 0; i < n; i++ { rn := rand.Intn(100000) if i%2 == 1 { rn = -rn } nums[i] = rn } nums2 := make([]int, n) copy(nums2, nums) start := time.Now() cocktailSort(nums) elapsed := time.Since(start) start2 := time.Now() cocktailShakerSort(nums2) elapsed2 := time.Since(start2) sum += float64(elapsed) / float64(elapsed2) } fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs) } }
Transform the following Java implementation into Go, maintaining the same output and logic.
import java.awt.*; import javax.swing.*; public class Pendulum extends JPanel implements Runnable { private double angle = Math.PI / 2; private int length; public Pendulum(int length) { this.length = length; setDoubleBuffered(true); } @Override public void paint(Graphics g) { g.setColor(Color.WHITE); g.fillRect(0, 0, getWidth(), getHeight()); g.setColor(Color.BLACK); int anchorX = getWidth() / 2, anchorY = getHeight() / 4; int ballX = anchorX + (int) (Math.sin(angle) * length); int ballY = anchorY + (int) (Math.cos(angle) * length); g.drawLine(anchorX, anchorY, ballX, ballY); g.fillOval(anchorX - 3, anchorY - 4, 7, 7); g.fillOval(ballX - 7, ballY - 7, 14, 14); } public void run() { double angleAccel, angleVelocity = 0, dt = 0.1; while (true) { angleAccel = -9.81 / length * Math.sin(angle); angleVelocity += angleAccel * dt; angle += angleVelocity * dt; repaint(); try { Thread.sleep(15); } catch (InterruptedException ex) {} } } @Override public Dimension getPreferredSize() { return new Dimension(2 * length + 50, length / 2 * 3); } public static void main(String[] args) { JFrame f = new JFrame("Pendulum"); Pendulum p = new Pendulum(200); f.add(p); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.pack(); f.setVisible(true); new Thread(p).start(); } }
package main import ( "github.com/google/gxui" "github.com/google/gxui/drivers/gl" "github.com/google/gxui/math" "github.com/google/gxui/themes/dark" omath "math" "time" ) const ( ANIMATION_WIDTH int = 480 ANIMATION_HEIGHT int = 320 BALL_RADIUS float32 = 25.0 METER_PER_PIXEL float64 = 1.0 / 20.0 PHI_ZERO float64 = omath.Pi * 0.5 ) var ( l float64 = float64(ANIMATION_HEIGHT) * 0.5 freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL)) ) type Pendulum interface { GetPhi() float64 } type mathematicalPendulum struct { start time.Time } func (p *mathematicalPendulum) GetPhi() float64 { if (p.start == time.Time{}) { p.start = time.Now() } t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9) return PHI_ZERO * omath.Cos(t*freq) } type numericalPendulum struct { currentPhi float64 angAcc float64 angVel float64 lastTime time.Time } func (p *numericalPendulum) GetPhi() float64 { dt := 0.0 if (p.lastTime != time.Time{}) { dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9) } p.lastTime = time.Now() p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi) p.angVel += p.angAcc * dt p.currentPhi += p.angVel * dt return p.currentPhi } func draw(p Pendulum, canvas gxui.Canvas, x, y int) { attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y} phi := p.GetPhi() ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))} line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}} canvas.DrawLines(line, gxui.DefaultPen) m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)} rect := math.Rect{ball.Sub(m), ball.Add(m)} canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow)) } func appMain(driver gxui.Driver) { theme := dark.CreateTheme(driver) window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum") window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50)) image := theme.CreateImage() ticker := time.NewTicker(time.Millisecond * 15) pendulum := &mathematicalPendulum{} pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}} go func() { for _ = range ticker.C { canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT}) canvas.Clear(gxui.White) draw(pendulum, canvas, 0, 0) draw(pendulum2, canvas, 0, ANIMATION_HEIGHT) canvas.Complete() driver.Call(func() { image.SetCanvas(canvas) }) } }() window.AddChild(image) window.OnClose(ticker.Stop) window.OnClose(driver.Terminate) } func main() { gl.StartDriver(appMain) }
Change the programming language of this snippet from Java to Go without modifying what it does.
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Change the following Java code into Go without altering its purpose.
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Change the following Java code into Go without altering its purpose.
import java.io.IOException; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; import java.util.Collections; public class CreateFile { public static void main(String[] args) throws IOException { String os = System.getProperty("os.name"); if (os.contains("Windows")) { Path path = Paths.get("tape.file"); Files.write(path, Collections.singletonList("Hello World!")); } else { Path path = Paths.get("/dev/tape"); Files.write(path, Collections.singletonList("Hello World!")); } } }
package main import ( "archive/tar" "compress/gzip" "flag" "io" "log" "os" "time" ) func main() { filename := flag.String("file", "TAPE.FILE", "filename within TAR") data := flag.String("data", "", "data for file") outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)") gzipFlag := flag.Bool("gzip", false, "use gzip compression") flag.Parse() var w io.Writer = os.Stdout if *outfile != "" { f, err := os.Create(*outfile) if err != nil { log.Fatalf("opening/creating %q: %v", *outfile, err) } defer f.Close() w = f } if *gzipFlag { zw := gzip.NewWriter(w) defer zw.Close() w = zw } tw := tar.NewWriter(w) defer tw.Close() w = tw tw.WriteHeader(&tar.Header{ Name: *filename, Mode: 0660, Size: int64(len(*data)), ModTime: time.Now(), Typeflag: tar.TypeReg, Uname: "guest", Gname: "guest", }) _, err := w.Write([]byte(*data)) if err != nil { log.Fatal("writing data:", err) } }
Produce a language-to-language conversion: from Java to Go, same semantics.
public static void heapSort(int[] a){ int count = a.length; heapify(a, count); int end = count - 1; while(end > 0){ int tmp = a[end]; a[end] = a[0]; a[0] = tmp; siftDown(a, 0, end - 1); end--; } } public static void heapify(int[] a, int count){ int start = (count - 2) / 2; while(start >= 0){ siftDown(a, start, count - 1); start--; } } public static void siftDown(int[] a, int start, int end){ int root = start; while((root * 2 + 1) <= end){ int child = root * 2 + 1; if(child + 1 <= end && a[child] < a[child + 1]) child = child + 1; if(a[root] < a[child]){ int tmp = a[root]; a[root] = a[child]; a[child] = tmp; root = child; }else return; } }
package main import ( "sort" "container/heap" "fmt" ) type HeapHelper struct { container sort.Interface length int } func (self HeapHelper) Len() int { return self.length } func (self HeapHelper) Less(i, j int) bool { return self.container.Less(j, i) } func (self HeapHelper) Swap(i, j int) { self.container.Swap(i, j) } func (self *HeapHelper) Push(x interface{}) { panic("impossible") } func (self *HeapHelper) Pop() interface{} { self.length-- return nil } func heapSort(a sort.Interface) { helper := HeapHelper{ a, a.Len() } heap.Init(&helper) for helper.length > 0 { heap.Pop(&helper) } } func main() { a := []int{170, 45, 75, -90, -802, 24, 2, 66} fmt.Println("before:", a) heapSort(sort.IntSlice(a)) fmt.Println("after: ", a) }
Change the programming language of this snippet from Java to Go without modifying what it does.
public enum Pip { Two, Three, Four, Five, Six, Seven, Eight, Nine, Ten, Jack, Queen, King, Ace }
package cards import ( "math/rand" ) type Suit uint8 const ( Spade Suit = 3 Heart Suit = 2 Diamond Suit = 1 Club Suit = 0 ) func (s Suit) String() string { const suites = "CDHS" return suites[s : s+1] } type Rank uint8 const ( Ace Rank = 1 Two Rank = 2 Three Rank = 3 Four Rank = 4 Five Rank = 5 Six Rank = 6 Seven Rank = 7 Eight Rank = 8 Nine Rank = 9 Ten Rank = 10 Jack Rank = 11 Queen Rank = 12 King Rank = 13 ) func (r Rank) String() string { const ranks = "A23456789TJQK" return ranks[r-1 : r] } type Card uint8 func NewCard(r Rank, s Suit) Card { return Card(13*uint8(s) + uint8(r-1)) } func (c Card) RankSuit() (Rank, Suit) { return Rank(c%13 + 1), Suit(c / 13) } func (c Card) Rank() Rank { return Rank(c%13 + 1) } func (c Card) Suit() Suit { return Suit(c / 13) } func (c Card) String() string { return c.Rank().String() + c.Suit().String() } type Deck []Card func NewDeck() Deck { d := make(Deck, 52) for i := range d { d[i] = Card(i) } return d } func (d Deck) String() string { s := "" for i, c := range d { switch { case i == 0: case i%13 == 0: s += "\n" default: s += " " } s += c.String() } return s } func (d Deck) Shuffle() { for i := range d { j := rand.Intn(i + 1) d[i], d[j] = d[j], d[i] } } func (d Deck) Contains(tc Card) bool { for _, c := range d { if c == tc { return true } } return false } func (d *Deck) AddDeck(decks ...Deck) { for _, o := range decks { *d = append(*d, o...) } } func (d *Deck) AddCard(c Card) { *d = append(*d, c) } func (d *Deck) Draw(n int) Deck { old := *d *d = old[n:] return old[:n:n] } func (d *Deck) DrawCard() (Card, bool) { if len(*d) == 0 { return 0, false } old := *d *d = old[1:] return old[0], true } func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) { for i := 0; i < cards; i++ { for j := range hands { if len(*d) == 0 { return hands, false } hands[j] = append(hands[j], (*d)[0]) *d = (*d)[1:] } } return hands, true }
Translate the given Java code snippet into Go without altering its behavior.
Int[] literalArray = [1,2,3]; Int[] fixedLengthArray = new Int[10]; Int[] variableArray = new Int[]; assert literalArray.size == 3; Int n = literalArray[2]; fixedLengthArray[4] = 12345; fixedLengthArray += 6789; variableArray += 6789;
package main import ( "fmt" ) func main() { var a [5]int fmt.Println("len(a) =", len(a)) fmt.Println("a =", a) a[0] = 3 fmt.Println("a =", a) fmt.Println("a[0] =", a[0]) s := a[:4] fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) s = s[:5] fmt.Println("s =", s) a[0] = 22 fmt.Println("a =", a) fmt.Println("s =", s) s = append(s, 4, 5, 6) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) a[4] = -1 fmt.Println("a =", a) fmt.Println("s =", s) s = make([]int, 8) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) }
Port the following code from Java to Go with equivalent syntax and logic.
public static boolean inCarpet(long x, long y) { while (x!=0 && y!=0) { if (x % 3 == 1 && y % 3 == 1) return false; x /= 3; y /= 3; } return true; } public static void carpet(final int n) { final double power = Math.pow(3,n); for(long i = 0; i < power; i++) { for(long j = 0; j < power; j++) { System.out.print(inCarpet(i, j) ? "*" : " "); } System.out.println(); } }
package main import ( "fmt" "strings" "unicode/utf8" ) var order = 3 var grain = "#" func main() { carpet := []string{grain} for ; order > 0; order-- { hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0])) middle := make([]string, len(carpet)) for i, s := range carpet { middle[i] = s + hole + s carpet[i] = strings.Repeat(s, 3) } carpet = append(append(carpet, middle...), carpet...) } for _, r := range carpet { fmt.Println(r) } }
Convert this Java block to Go, preserving its control flow and logic.
public class BogoSort { public static void main(String[] args) { int[] arr={4,5,6,0,7,8,9,1,2,3}; BogoSort now=new BogoSort(); System.out.print("Unsorted: "); now.display1D(arr); now.bogo(arr); System.out.print("Sorted: "); now.display1D(arr); } void bogo(int[] arr) { int shuffle=1; for(;!isSorted(arr);shuffle++) shuffle(arr); System.out.println("This took "+shuffle+" shuffles."); } void shuffle(int[] arr) { int i=arr.length-1; while(i>0) swap(arr,i--,(int)(Math.random()*i)); } void swap(int[] arr,int i,int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } boolean isSorted(int[] arr) { for(int i=1;i<arr.length;i++) if(arr[i]<arr[i-1]) return false; return true; } void display1D(int[] arr) { for(int i=0;i<arr.length;i++) System.out.print(arr[i]+" "); System.out.println(); } }
package main import ( "fmt" "math/rand" "sort" "time" ) func main() { list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84} rand.Seed(time.Now().UnixNano()) fmt.Println("unsorted:", list) temp := make([]int, len(list)) copy(temp, list) for !sort.IntsAreSorted(temp) { for i, v := range rand.Perm(len(list)) { temp[i] = list[v] } } fmt.Println("sorted! ", temp) }
Port the provided Java code into Go while preserving the original functionality.
public class Euler { private static void euler (Callable f, double y0, int a, int b, int h) { int t = a; double y = y0; while (t < b) { System.out.println ("" + t + " " + y); t += h; y += h * f.compute (t, y); } System.out.println ("DONE"); } public static void main (String[] args) { Callable cooling = new Cooling (); int[] steps = {2, 5, 10}; for (int stepSize : steps) { System.out.println ("Step size: " + stepSize); euler (cooling, 100.0, 0, 100, stepSize); } } } interface Callable { public double compute (int time, double t); } class Cooling implements Callable { public double compute (int time, double t) { return -0.07 * (t - 20); } }
package main import ( "fmt" "math" ) type fdy func(float64, float64) float64 func eulerStep(f fdy, x, y, h float64) float64 { return y + h*f(x, y) } func newCoolingRate(k float64) func(float64) float64 { return func(deltaTemp float64) float64 { return -k * deltaTemp } } func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 { return func(time float64) float64 { return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time) } } func newCoolingRateDy(k, ambientTemp float64) fdy { crf := newCoolingRate(k) return func(_, objectTemp float64) float64 { return crf(objectTemp - ambientTemp) } } func main() { k := .07 tempRoom := 20. tempObject := 100. fcr := newCoolingRateDy(k, tempRoom) analytic := newTempFunc(k, tempRoom, tempObject) for _, deltaTime := range []float64{2, 5, 10} { fmt.Printf("Step size = %.1f\n", deltaTime) fmt.Println(" Time Euler's Analytic") temp := tempObject for time := 0.; time <= 100; time += deltaTime { fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time)) temp = eulerStep(fcr, time, temp, deltaTime) } fmt.Println() } }
Preserve the algorithm and functionality while converting the code from Java to Go.
public class SeqNonSquares { public static int nonsqr(int n) { return n + (int)Math.round(Math.sqrt(n)); } public static void main(String[] args) { for (int i = 1; i < 23; i++) System.out.print(nonsqr(i) + " "); System.out.println(); for (int i = 1; i < 1000000; i++) { double j = Math.sqrt(nonsqr(i)); assert j != Math.floor(j); } } }
package main import ( "fmt" "math" ) func remarkable(n int) int { return n + int(.5+math.Sqrt(float64(n))) } func main() { fmt.Println(" n r(n)") fmt.Println("--- ---") for n := 1; n <= 22; n++ { fmt.Printf("%3d %3d\n", n, remarkable(n)) } const limit = 1e6 fmt.Println("\nChecking for squares for n <", limit) next := 2 nextSq := 4 for n := 1; n < limit; n++ { r := remarkable(n) switch { case r == nextSq: panic(n) case r > nextSq: fmt.Println(nextSq, "didn't occur") next++ nextSq = next * next } } fmt.Println("No squares occur for n <", limit) }
Rewrite the snippet below in Go so it works the same as the original Java code.
public static String Substring(String str, int n, int m){ return str.substring(n, n+m); } public static String Substring(String str, int n){ return str.substring(n); } public static String Substring(String str){ return str.substring(0, str.length()-1); } public static String Substring(String str, char c, int m){ return str.substring(str.indexOf(c), str.indexOf(c)+m+1); } public static String Substring(String str, String sub, int m){ return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1); }
package main import ( "fmt" "strings" ) func main() { s := "ABCDEFGH" n, m := 2, 3 fmt.Println("Index: ", "01234567") fmt.Println("String:", s) fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m]) fmt.Printf("Start %d, to end: %s\n", n, s[n:]) fmt.Printf("All but last: %s\n", s[:len(s)-1]) dx := strings.IndexByte(s, 'D') fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m]) sx := strings.Index(s, "DE") fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m]) }
Change the following Java code into Go without altering its purpose.
public class JortSort { public static void main(String[] args) { System.out.println(jortSort(new int[]{1, 2, 3})); } static boolean jortSort(int[] arr) { return true; } }
package main import ( "log" "sort" ) func main() { log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4})) log.Println(jortSort([]int{0, 1, 0, 0, 0, 0})) log.Println(jortSort([]int{1, 2, 4, 11, 22, 22})) log.Println(jortSort([]int{0, 0, 0, 1, 2, 2})) } func jortSort(a []int) bool { c := make([]int, len(a)) copy(c, a) sort.Ints(a) for k, v := range c { if v == a[k] { continue } else { return false } } return true }
Generate an equivalent Go version of this Java code.
import java.util.GregorianCalendar; import java.text.MessageFormat; public class Leapyear{ public static void main(String[] argv){ int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100}; GregorianCalendar cal = new GregorianCalendar(); for(int year : yrs){ System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.", year, cal.isLeapYear(year), isLeapYear(year))); } } public static boolean isLeapYear(int year){ return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0); } }
func isLeap(year int) bool { return year%400 == 0 || year%4 == 0 && year%100 != 0 }
Can you help me rewrite this code in Go instead of Java, keeping it the same logically?
import java.math.BigInteger; public class CombinationsAndPermutations { public static void main(String[] args) { System.out.println(Double.MAX_VALUE); System.out.println("A sample of permutations from 1 to 12 with exact Integer arithmetic:"); for ( int n = 1 ; n <= 12 ; n++ ) { int k = n / 2; System.out.printf("%d P %d = %s%n", n, k, permutation(n, k)); } System.out.println(); System.out.println("A sample of combinations from 10 to 60 with exact Integer arithmetic:"); for ( int n = 10 ; n <= 60 ; n += 5 ) { int k = n / 2; System.out.printf("%d C %d = %s%n", n, k, combination(n, k)); } System.out.println(); System.out.println("A sample of permutations from 5 to 15000 displayed in floating point arithmetic:"); System.out.printf("%d P %d = %s%n", 5, 2, display(permutation(5, 2), 50)); for ( int n = 1000 ; n <= 15000 ; n += 1000 ) { int k = n / 2; System.out.printf("%d P %d = %s%n", n, k, display(permutation(n, k), 50)); } System.out.println(); System.out.println("A sample of combinations from 100 to 1000 displayed in floating point arithmetic:"); for ( int n = 100 ; n <= 1000 ; n += 100 ) { int k = n / 2; System.out.printf("%d C %d = %s%n", n, k, display(combination(n, k), 50)); } } private static String display(BigInteger val, int precision) { String s = val.toString(); precision = Math.min(precision, s.length()); StringBuilder sb = new StringBuilder(); sb.append(s.substring(0, 1)); sb.append("."); sb.append(s.substring(1, precision)); sb.append(" * 10^"); sb.append(s.length()-1); return sb.toString(); } public static BigInteger combination(int n, int k) { if ( n-k < k ) { k = n-k; } BigInteger result = permutation(n, k); while ( k > 0 ) { result = result.divide(BigInteger.valueOf(k)); k--; } return result; } public static BigInteger permutation(int n, int k) { BigInteger result = BigInteger.ONE; for ( int i = n ; i >= n-k+1 ; i-- ) { result = result.multiply(BigInteger.valueOf(i)); } return result; } }
package main import ( "fmt" "math/big" ) func main() { var n, p int64 fmt.Printf("A sample of permutations from 1 to 12:\n") for n = 1; n < 13; n++ { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 10 to 60:\n") for n = 10; n < 61; n += 10 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of permutations from 5 to 15000:\n") nArr := [...]int64{5, 50, 500, 1000, 5000, 15000} for _, n = range nArr { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 100 to 1000:\n") for n = 100; n < 1001; n += 100 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } } func fact(n *big.Int) *big.Int { if n.Sign() < 1 { return big.NewInt(0) } r := big.NewInt(1) i := big.NewInt(2) for i.Cmp(n) < 1 { r.Mul(r, i) i.Add(i, big.NewInt(1)) } return r } func perm(n, k *big.Int) *big.Int { r := fact(n) r.Div(r, fact(n.Sub(n, k))) return r } func comb(n, r *big.Int) *big.Int { if r.Cmp(n) == 1 { return big.NewInt(0) } if r.Cmp(n) == 0 { return big.NewInt(1) } c := fact(n) den := fact(n.Sub(n, r)) den.Mul(den, fact(r)) c.Div(c, den) return c }
Please provide an equivalent version of this Java code in Go.
import java.util.List; import java.util.stream.*; public class LexicographicalNumbers { static List<Integer> lexOrder(int n) { int first = 1, last = n; if (n < 1) { first = n; last = 1; } return IntStream.rangeClosed(first, last) .mapToObj(Integer::toString) .sorted() .map(Integer::valueOf) .collect(Collectors.toList()); } public static void main(String[] args) { System.out.println("In lexicographical order:\n"); int[] ints = {0, 5, 13, 21, -22}; for (int n : ints) { System.out.printf("%3d: %s\n", n, lexOrder(n)); } } }
package main import ( "fmt" "sort" "strconv" ) func lexOrder(n int) []int { first, last, k := 1, n, n if n < 1 { first, last, k = n, 1, 2-n } strs := make([]string, k) for i := first; i <= last; i++ { strs[i-first] = strconv.Itoa(i) } sort.Strings(strs) ints := make([]int, k) for i := 0; i < k; i++ { ints[i], _ = strconv.Atoi(strs[i]) } return ints } func main() { fmt.Println("In lexicographical order:\n") for _, n := range []int{0, 5, 13, 21, -22} { fmt.Printf("%3d: %v\n", n, lexOrder(n)) } }
Rewrite this program in Go while keeping its functionality equivalent to the Java version.
module NumberNames { void run() { @Inject Console console; Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000, 123456789000, 0x123456789ABCDEF]; for (Int test : tests) { console.print($"{test} = {toEnglish(test)}"); } } static String[] digits = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine"]; static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"]; static String[] tens = ["zero", "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"]; static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion", "quadrillion", "quintillion"]; static String toEnglish(Int n) { StringBuffer buf = new StringBuffer(); if (n < 0) { "negative ".appendTo(buf); n = -n; } format3digits(n, buf); return buf.toString(); } static void format3digits(Int n, StringBuffer buf, Int nested=0) { (Int left, Int right) = n /% 1000; if (left != 0) { format3digits(left, buf, nested+1); } if (right != 0 || (left == 0 && nested==0)) { if (right >= 100) { (left, right) = (right /% 100); digits[left].appendTo(buf); " hundred ".appendTo(buf); if (right != 0) { format2digits(right, buf); } } else { format2digits(right, buf); } if (nested > 0) { ten3rd[nested].appendTo(buf).add(' '); } } } static void format2digits(Int n, StringBuffer buf) { switch (n) { case 0..9: digits[n].appendTo(buf).add(' '); break; case 10..19: teens[n-10].appendTo(buf).add(' '); break; default: (Int left, Int right) = n /% 10; tens[left].appendTo(buf); if (right == 0) { buf.add(' '); } else { buf.add('-'); digits[right].appendTo(buf).add(' '); } break; } } }
package main import "fmt" func main() { for _, n := range []int64{12, 1048576, 9e18, -2, 0} { fmt.Println(say(n)) } } var small = [...]string{"zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"} var tens = [...]string{"", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"} var illions = [...]string{"", " thousand", " million", " billion", " trillion", " quadrillion", " quintillion"} func say(n int64) string { var t string if n < 0 { t = "negative " n = -n } switch { case n < 20: t += small[n] case n < 100: t += tens[n/10] s := n % 10 if s > 0 { t += "-" + small[s] } case n < 1000: t += small[n/100] + " hundred" s := n % 100 if s > 0 { t += " " + say(s) } default: sx := "" for i := 0; n > 0; i++ { p := n % 1000 n /= 1000 if p > 0 { ix := say(p) + illions[i] if sx != "" { ix += " " + sx } sx = ix } } t += sx } return t }
Transform the following Java implementation into Go, maintaining the same output and logic.
package stringlensort; import java.io.PrintStream; import java.util.Arrays; import java.util.Comparator; public class ReportStringLengths { public static void main(String[] args) { String[] list = {"abcd", "123456789", "abcdef", "1234567"}; String[] strings = args.length > 0 ? args : list; compareAndReportStringsLength(strings); } public static void compareAndReportStringsLength(String[] strings) { compareAndReportStringsLength(strings, System.out); } public static void compareAndReportStringsLength(String[] strings, PrintStream stream) { if (strings.length > 0) { strings = strings.clone(); final String QUOTE = "\""; Arrays.sort(strings, Comparator.comparing(String::length)); int min = strings[0].length(); int max = strings[strings.length - 1].length(); for (int i = strings.length - 1; i >= 0; i--) { int length = strings[i].length(); String predicate; if (length == max) { predicate = "is the longest string"; } else if (length == min) { predicate = "is the shortest string"; } else { predicate = "is neither the longest nor the shortest string"; } stream.println(QUOTE + strings[i] + QUOTE + " has length " + length + " and " + predicate); } } } }
package main import ( "fmt" "os" "sort" ) func main() { if len(os.Args) == 1 { compareStrings("abcd", "123456789", "abcdef", "1234567") } else { strings := os.Args[1:] compareStrings(strings...) } } func compareStrings(strings ...string) { sort.SliceStable(strings, func(i, j int) bool { return len(strings[i]) > len(strings[j]) }) for _, s := range strings { fmt.Printf("%d: %s\n", len(s), s) } }