Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Write the same code in Go as shown below in Java. | import java.util.*;
public class SortComp1 {
public static void main(String[] args) {
List<String> items = Arrays.asList("violet", "red", "green", "indigo", "blue", "yellow", "orange");
List<String> sortedItems = new ArrayList<>();
Comparator<String> interactiveCompare = new Comparator<String>() {
int count = 0;
Scanner s = new Scanner(System.in);
public int compare(String s1, String s2) {
System.out.printf("(%d) Is %s <, =, or > %s. Answer -1, 0, or 1: ", ++count, s1, s2);
return s.nextInt();
}
};
for (String item : items) {
System.out.printf("Inserting '%s' into %s\n", item, sortedItems);
int spotToInsert = Collections.binarySearch(sortedItems, item, interactiveCompare);
if (spotToInsert < 0) spotToInsert = ~spotToInsert;
sortedItems.add(spotToInsert, item);
}
System.out.println(sortedItems);
}
}
| package main
import (
"fmt"
"sort"
"strings"
)
var count int = 0
func interactiveCompare(s1, s2 string) bool {
count++
fmt.Printf("(%d) Is %s < %s? ", count, s1, s2)
var response string
_, err := fmt.Scanln(&response)
return err == nil && strings.HasPrefix(response, "y")
}
func main() {
items := []string{"violet", "red", "green", "indigo", "blue", "yellow", "orange"}
var sortedItems []string
for _, item := range items {
fmt.Printf("Inserting '%s' into %s\n", item, sortedItems)
spotToInsert := sort.Search(len(sortedItems), func(i int) bool {
return interactiveCompare(item, sortedItems[i])
})
sortedItems = append(sortedItems[:spotToInsert],
append([]string{item}, sortedItems[spotToInsert:]...)...)
}
fmt.Println(sortedItems)
}
|
Keep all operations the same but rewrite the snippet in Go. | import java.math.BigInteger;
import java.util.Locale;
public class BenfordsLaw {
private static BigInteger[] generateFibonacci(int n) {
BigInteger[] fib = new BigInteger[n];
fib[0] = BigInteger.ONE;
fib[1] = BigInteger.ONE;
for (int i = 2; i < fib.length; i++) {
fib[i] = fib[i - 2].add(fib[i - 1]);
}
return fib;
}
public static void main(String[] args) {
BigInteger[] numbers = generateFibonacci(1000);
int[] firstDigits = new int[10];
for (BigInteger number : numbers) {
firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++;
}
for (int i = 1; i < firstDigits.length; i++) {
System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n",
i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i));
}
}
}
| package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
|
Ensure the translated Go code behaves exactly like the original Java snippet. | import java.math.BigInteger;
import java.util.Locale;
public class BenfordsLaw {
private static BigInteger[] generateFibonacci(int n) {
BigInteger[] fib = new BigInteger[n];
fib[0] = BigInteger.ONE;
fib[1] = BigInteger.ONE;
for (int i = 2; i < fib.length; i++) {
fib[i] = fib[i - 2].add(fib[i - 1]);
}
return fib;
}
public static void main(String[] args) {
BigInteger[] numbers = generateFibonacci(1000);
int[] firstDigits = new int[10];
for (BigInteger number : numbers) {
firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++;
}
for (int i = 1; i < firstDigits.length; i++) {
System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n",
i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i));
}
}
}
| package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
|
Rewrite the snippet below in Go so it works the same as the original Java code. | import java.text.DateFormat;
import java.text.SimpleDateFormat;
import java.util.TimeZone;
public class NauticalBell extends Thread {
public static void main(String[] args) {
NauticalBell bells = new NauticalBell();
bells.setDaemon(true);
bells.start();
try {
bells.join();
} catch (InterruptedException e) {
System.out.println(e);
}
}
@Override
public void run() {
DateFormat sdf = new SimpleDateFormat("HH:mm:ss");
sdf.setTimeZone(TimeZone.getTimeZone("UTC"));
int numBells = 0;
long time = System.currentTimeMillis();
long next = time - (time % (24 * 60 * 60 * 1000));
while (next < time) {
next += 30 * 60 * 1000;
numBells = 1 + (numBells % 8);
}
while (true) {
long wait = 100L;
time = System.currentTimeMillis();
if (time - next >= 0) {
String bells = numBells == 1 ? "bell" : "bells";
String timeString = sdf.format(time);
System.out.printf("%s : %d %s\n", timeString, numBells, bells);
next += 30 * 60 * 1000;
wait = next - time;
numBells = 1 + (numBells % 8);
}
try {
Thread.sleep(wait);
} catch (InterruptedException e) {
return;
}
}
}
}
| package main
import (
"fmt"
"strings"
"time"
)
func main() {
watches := []string{
"First", "Middle", "Morning", "Forenoon",
"Afternoon", "Dog", "First",
}
for {
t := time.Now()
h := t.Hour()
m := t.Minute()
s := t.Second()
if (m == 0 || m == 30) && s == 0 {
bell := 0
if m == 30 {
bell = 1
}
bells := (h*2 + bell) % 8
watch := h/4 + 1
if bells == 0 {
bells = 8
watch--
}
sound := strings.Repeat("\a", bells)
pl := "s"
if bells == 1 {
pl = " "
}
w := watches[watch] + " watch"
if watch == 5 {
if bells < 5 {
w = "First " + w
} else {
w = "Last " + w
}
}
fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w)
}
time.Sleep(1 * time.Second)
}
}
|
Write the same algorithm in Go as shown in this Java implementation. | import java.text.DateFormat;
import java.text.SimpleDateFormat;
import java.util.TimeZone;
public class NauticalBell extends Thread {
public static void main(String[] args) {
NauticalBell bells = new NauticalBell();
bells.setDaemon(true);
bells.start();
try {
bells.join();
} catch (InterruptedException e) {
System.out.println(e);
}
}
@Override
public void run() {
DateFormat sdf = new SimpleDateFormat("HH:mm:ss");
sdf.setTimeZone(TimeZone.getTimeZone("UTC"));
int numBells = 0;
long time = System.currentTimeMillis();
long next = time - (time % (24 * 60 * 60 * 1000));
while (next < time) {
next += 30 * 60 * 1000;
numBells = 1 + (numBells % 8);
}
while (true) {
long wait = 100L;
time = System.currentTimeMillis();
if (time - next >= 0) {
String bells = numBells == 1 ? "bell" : "bells";
String timeString = sdf.format(time);
System.out.printf("%s : %d %s\n", timeString, numBells, bells);
next += 30 * 60 * 1000;
wait = next - time;
numBells = 1 + (numBells % 8);
}
try {
Thread.sleep(wait);
} catch (InterruptedException e) {
return;
}
}
}
}
| package main
import (
"fmt"
"strings"
"time"
)
func main() {
watches := []string{
"First", "Middle", "Morning", "Forenoon",
"Afternoon", "Dog", "First",
}
for {
t := time.Now()
h := t.Hour()
m := t.Minute()
s := t.Second()
if (m == 0 || m == 30) && s == 0 {
bell := 0
if m == 30 {
bell = 1
}
bells := (h*2 + bell) % 8
watch := h/4 + 1
if bells == 0 {
bells = 8
watch--
}
sound := strings.Repeat("\a", bells)
pl := "s"
if bells == 1 {
pl = " "
}
w := watches[watch] + " watch"
if watch == 5 {
if bells < 5 {
w = "First " + w
} else {
w = "Last " + w
}
}
fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w)
}
time.Sleep(1 * time.Second)
}
}
|
Change the following Java code into Go without altering its purpose. | public static long fib(int n) {
if (n < 0)
throw new IllegalArgumentException("n can not be a negative number");
return new Object() {
private long fibInner(int n) {
return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2));
}
}.fibInner(n);
}
| package main
import "fmt"
func main() {
for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} {
f, ok := arFib(n)
if ok {
fmt.Printf("fib %d = %d\n", n, f)
} else {
fmt.Println("fib undefined for negative numbers")
}
}
}
func arFib(n int) (int, bool) {
switch {
case n < 0:
return 0, false
case n < 2:
return n, true
}
return yc(func(recurse fn) fn {
return func(left, term1, term2 int) int {
if left == 0 {
return term1+term2
}
return recurse(left-1, term1+term2, term1)
}
})(n-2, 1, 0), true
}
type fn func(int, int, int) int
type ff func(fn) fn
type fx func(fx) fn
func yc(f ff) fn {
return func(x fx) fn {
return x(x)
}(func(x fx) fn {
return f(func(a1, a2, a3 int) int {
return x(x)(a1, a2, a3)
})
})
}
|
Produce a functionally identical Go code for the snippet given in Java. | String strOrig = 'brooms';
String str1 = strOrig.substring(1, strOrig.length());
system.debug(str1);
String str2 = strOrig.substring(0, strOrig.length()-1);
system.debug(str2);
String str3 = strOrig.substring(1, strOrig.length()-1);
system.debug(str3);
String strOrig = 'brooms';
String str1 = strOrig.replaceAll( '^.', '' );
system.debug(str1);
String str2 = strOrig.replaceAll( '.$', '' ) ;
system.debug(str2);
String str3 = strOrig.replaceAll( '^.|.$', '' );
system.debug(str3);
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Produce a language-to-language conversion: from Java to Go, same semantics. | String strOrig = 'brooms';
String str1 = strOrig.substring(1, strOrig.length());
system.debug(str1);
String str2 = strOrig.substring(0, strOrig.length()-1);
system.debug(str2);
String str3 = strOrig.substring(1, strOrig.length()-1);
system.debug(str3);
String strOrig = 'brooms';
String str1 = strOrig.replaceAll( '^.', '' );
system.debug(str1);
String str2 = strOrig.replaceAll( '.$', '' ) ;
system.debug(str2);
String str3 = strOrig.replaceAll( '^.|.$', '' );
system.debug(str3);
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Translate the given Java code snippet into Go without altering its behavior. | import java.util.*;
public class LegendrePrimeCounter {
public static void main(String[] args) {
LegendrePrimeCounter counter = new LegendrePrimeCounter(1000000000);
for (int i = 0, n = 1; i < 10; ++i, n *= 10)
System.out.printf("10^%d\t%d\n", i, counter.primeCount((n)));
}
private List<Integer> primes;
public LegendrePrimeCounter(int limit) {
primes = generatePrimes((int)Math.sqrt((double)limit));
}
public int primeCount(int n) {
if (n < 2)
return 0;
int a = primeCount((int)Math.sqrt((double)n));
return phi(n, a) + a - 1;
}
private int phi(int x, int a) {
if (a == 0)
return x;
if (a == 1)
return x - (x >> 1);
int pa = primes.get(a - 1);
if (x <= pa)
return 1;
return phi(x, a - 1) - phi(x / pa, a - 1);
}
private static List<Integer> generatePrimes(int limit) {
boolean[] sieve = new boolean[limit >> 1];
Arrays.fill(sieve, true);
for (int p = 3, s = 9; s < limit; p += 2) {
if (sieve[p >> 1]) {
for (int q = s; q < limit; q += p << 1)
sieve[q >> 1] = false;
}
s += (p + 1) << 2;
}
List<Integer> primes = new ArrayList<>();
if (limit > 2)
primes.add(2);
for (int i = 1; i < sieve.length; ++i) {
if (sieve[i])
primes.add((i << 1) + 1);
}
return primes;
}
}
| package main
import (
"fmt"
"log"
"math"
"rcu"
)
func cantorPair(x, y int) int {
if x < 0 || y < 0 {
log.Fatal("Arguments must be non-negative integers.")
}
return (x*x + 3*x + 2*x*y + y + y*y) / 2
}
func pi(n int) int {
if n < 2 {
return 0
}
if n == 2 {
return 1
}
primes := rcu.Primes(int(math.Sqrt(float64(n))))
a := len(primes)
memoPhi := make(map[int]int)
var phi func(x, a int) int
phi = func(x, a int) int {
if a < 1 {
return x
}
if a == 1 {
return x - (x >> 1)
}
pa := primes[a-1]
if x <= pa {
return 1
}
key := cantorPair(x, a)
if v, ok := memoPhi[key]; ok {
return v
}
memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1)
return memoPhi[key]
}
return phi(n, a) + a - 1
}
func main() {
for i, n := 0, 1; i <= 9; i, n = i+1, n*10 {
fmt.Printf("10^%d %d\n", i, pi(n))
}
}
|
Generate an equivalent Go version of this Java code. |
public class Query {
public static boolean call(byte[] data, int[] length)
throws java.io.UnsupportedEncodingException
{
String message = "Here am I";
byte[] mb = message.getBytes("utf-8");
if (length[0] < mb.length)
return false;
length[0] = mb.length;
System.arraycopy(mb, 0, data, 0, mb.length);
return true;
}
}
| package main
import "C"
import "unsafe"
func main() {
C.Run()
}
const msg = "Here am I"
func Query(cbuf *C.char, csiz *C.size_t) C.int {
if int(*csiz) <= len(msg) {
return 0
}
pbuf := uintptr(unsafe.Pointer(cbuf))
for i := 0; i < len(msg); i++ {
*((*byte)(unsafe.Pointer(pbuf))) = msg[i]
pbuf++
}
*((*byte)(unsafe.Pointer(pbuf))) = 0
*csiz = C.size_t(len(msg) + 1)
return 1
}
|
Generate an equivalent Go version of this Java code. | import java.io.File;
import java.util.Scanner;
public class LongestStringChallenge {
public static void main(String[] args) throws Exception {
String lines = "", longest = "";
try (Scanner sc = new Scanner(new File("lines.txt"))) {
while(sc.hasNext()) {
String line = sc.nextLine();
if (longer(longest, line))
lines = longest = line;
else if (!longer(line, longest))
lines = lines.concat("\n").concat(line);
}
}
System.out.println(lines);
}
static boolean longer(String a, String b) {
try {
String dummy = a.substring(b.length());
} catch (StringIndexOutOfBoundsException e) {
return true;
}
return false;
}
}
| package main
import (
"bufio"
"os"
)
func main() {
in := bufio.NewReader(os.Stdin)
var blankLine = "\n"
var printLongest func(string) string
printLongest = func(candidate string) (longest string) {
longest = candidate
s, err := in.ReadString('\n')
defer func() {
recover()
defer func() {
recover()
}()
_ = blankLine[0]
func() {
defer func() {
recover()
}()
_ = s[len(longest)]
longest = s
}()
longest = printLongest(longest)
func() {
defer func() {
recover()
os.Stdout.WriteString(s)
}()
_ = longest[len(s)]
s = ""
}()
}()
_ = err.(error)
os.Stdout.WriteString(blankLine)
blankLine = ""
return
}
printLongest("")
}
|
Transform the following Java implementation into Go, maintaining the same output and logic. | import java.util.HashMap;
import java.util.HashSet;
import java.util.LinkedList;
import java.util.ListIterator;
import java.util.List;
import java.util.Set;
import java.util.Map;
public class UTM {
private List<String> tape;
private String blankSymbol;
private ListIterator<String> head;
private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>();
private Set<String> terminalStates;
private String initialState;
public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) {
this.blankSymbol = blankSymbol;
for (Transition t : transitions) {
this.transitions.put(t.from, t);
}
this.terminalStates = terminalStates;
this.initialState = initialState;
}
public static class StateTapeSymbolPair {
private String state;
private String tapeSymbol;
public StateTapeSymbolPair(String state, String tapeSymbol) {
this.state = state;
this.tapeSymbol = tapeSymbol;
}
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result
+ ((state == null) ? 0 : state.hashCode());
result = prime
* result
+ ((tapeSymbol == null) ? 0 : tapeSymbol
.hashCode());
return result;
}
@Override
public boolean equals(Object obj) {
if (this == obj)
return true;
if (obj == null)
return false;
if (getClass() != obj.getClass())
return false;
StateTapeSymbolPair other = (StateTapeSymbolPair) obj;
if (state == null) {
if (other.state != null)
return false;
} else if (!state.equals(other.state))
return false;
if (tapeSymbol == null) {
if (other.tapeSymbol != null)
return false;
} else if (!tapeSymbol.equals(other.tapeSymbol))
return false;
return true;
}
@Override
public String toString() {
return "(" + state + "," + tapeSymbol + ")";
}
}
public static class Transition {
private StateTapeSymbolPair from;
private StateTapeSymbolPair to;
private int direction;
public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) {
this.from = from;
this.to = to;
this.direction = direction;
}
@Override
public String toString() {
return from + "=>" + to + "/" + direction;
}
}
public void initializeTape(List<String> input) {
tape = input;
}
public void initializeTape(String input) {
tape = new LinkedList<String>();
for (int i = 0; i < input.length(); i++) {
tape.add(input.charAt(i) + "");
}
}
public List<String> runTM() {
if (tape.size() == 0) {
tape.add(blankSymbol);
}
head = tape.listIterator();
head.next();
head.previous();
StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0));
while (transitions.containsKey(tsp)) {
System.out.println(this + " --- " + transitions.get(tsp));
Transition trans = transitions.get(tsp);
head.set(trans.to.tapeSymbol);
tsp.state = trans.to.state;
if (trans.direction == -1) {
if (!head.hasPrevious()) {
head.add(blankSymbol);
}
tsp.tapeSymbol = head.previous();
} else if (trans.direction == 1) {
head.next();
if (!head.hasNext()) {
head.add(blankSymbol);
head.previous();
}
tsp.tapeSymbol = head.next();
head.previous();
} else {
tsp.tapeSymbol = trans.to.tapeSymbol;
}
}
System.out.println(this + " --- " + tsp);
if (terminalStates.contains(tsp.state)) {
return tape;
} else {
return null;
}
}
@Override
public String toString() {
try {
int headPos = head.previousIndex();
String s = "[ ";
for (int i = 0; i <= headPos; i++) {
s += tape.get(i) + " ";
}
s += "[H] ";
for (int i = headPos + 1; i < tape.size(); i++) {
s += tape.get(i) + " ";
}
return s + "]";
} catch (Exception e) {
return "";
}
}
public static void main(String[] args) {
String init = "q0";
String blank = "b";
Set<String> term = new HashSet<String>();
term.add("qf");
Set<Transition> trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0));
UTM machine = new UTM(trans, term, init, blank);
machine.initializeTape("111");
System.out.println("Output (si): " + machine.runTM() + "\n");
init = "a";
term.clear();
term.add("halt");
blank = "0";
trans.clear();
trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("");
System.out.println("Output (bb): " + machine.runTM());
init = "s0";
blank = "*";
term = new HashSet<String>();
term.add("see");
trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("babbababaa");
System.out.println("Output (sort): " + machine.runTM() + "\n");
}
}
| package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
|
Rewrite this program in Go while keeping its functionality equivalent to the Java version. | import java.util.HashMap;
import java.util.HashSet;
import java.util.LinkedList;
import java.util.ListIterator;
import java.util.List;
import java.util.Set;
import java.util.Map;
public class UTM {
private List<String> tape;
private String blankSymbol;
private ListIterator<String> head;
private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>();
private Set<String> terminalStates;
private String initialState;
public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) {
this.blankSymbol = blankSymbol;
for (Transition t : transitions) {
this.transitions.put(t.from, t);
}
this.terminalStates = terminalStates;
this.initialState = initialState;
}
public static class StateTapeSymbolPair {
private String state;
private String tapeSymbol;
public StateTapeSymbolPair(String state, String tapeSymbol) {
this.state = state;
this.tapeSymbol = tapeSymbol;
}
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result
+ ((state == null) ? 0 : state.hashCode());
result = prime
* result
+ ((tapeSymbol == null) ? 0 : tapeSymbol
.hashCode());
return result;
}
@Override
public boolean equals(Object obj) {
if (this == obj)
return true;
if (obj == null)
return false;
if (getClass() != obj.getClass())
return false;
StateTapeSymbolPair other = (StateTapeSymbolPair) obj;
if (state == null) {
if (other.state != null)
return false;
} else if (!state.equals(other.state))
return false;
if (tapeSymbol == null) {
if (other.tapeSymbol != null)
return false;
} else if (!tapeSymbol.equals(other.tapeSymbol))
return false;
return true;
}
@Override
public String toString() {
return "(" + state + "," + tapeSymbol + ")";
}
}
public static class Transition {
private StateTapeSymbolPair from;
private StateTapeSymbolPair to;
private int direction;
public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) {
this.from = from;
this.to = to;
this.direction = direction;
}
@Override
public String toString() {
return from + "=>" + to + "/" + direction;
}
}
public void initializeTape(List<String> input) {
tape = input;
}
public void initializeTape(String input) {
tape = new LinkedList<String>();
for (int i = 0; i < input.length(); i++) {
tape.add(input.charAt(i) + "");
}
}
public List<String> runTM() {
if (tape.size() == 0) {
tape.add(blankSymbol);
}
head = tape.listIterator();
head.next();
head.previous();
StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0));
while (transitions.containsKey(tsp)) {
System.out.println(this + " --- " + transitions.get(tsp));
Transition trans = transitions.get(tsp);
head.set(trans.to.tapeSymbol);
tsp.state = trans.to.state;
if (trans.direction == -1) {
if (!head.hasPrevious()) {
head.add(blankSymbol);
}
tsp.tapeSymbol = head.previous();
} else if (trans.direction == 1) {
head.next();
if (!head.hasNext()) {
head.add(blankSymbol);
head.previous();
}
tsp.tapeSymbol = head.next();
head.previous();
} else {
tsp.tapeSymbol = trans.to.tapeSymbol;
}
}
System.out.println(this + " --- " + tsp);
if (terminalStates.contains(tsp.state)) {
return tape;
} else {
return null;
}
}
@Override
public String toString() {
try {
int headPos = head.previousIndex();
String s = "[ ";
for (int i = 0; i <= headPos; i++) {
s += tape.get(i) + " ";
}
s += "[H] ";
for (int i = headPos + 1; i < tape.size(); i++) {
s += tape.get(i) + " ";
}
return s + "]";
} catch (Exception e) {
return "";
}
}
public static void main(String[] args) {
String init = "q0";
String blank = "b";
Set<String> term = new HashSet<String>();
term.add("qf");
Set<Transition> trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0));
UTM machine = new UTM(trans, term, init, blank);
machine.initializeTape("111");
System.out.println("Output (si): " + machine.runTM() + "\n");
init = "a";
term.clear();
term.add("halt");
blank = "0";
trans.clear();
trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("");
System.out.println("Output (bb): " + machine.runTM());
init = "s0";
blank = "*";
term = new HashSet<String>();
term.add("see");
trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("babbababaa");
System.out.println("Output (sort): " + machine.runTM() + "\n");
}
}
| package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
|
Can you help me rewrite this code in Go instead of Java, keeping it the same logically? | import java.io.*;
public class CreateFileTest {
public static void main(String args[]) {
try {
new File("output.txt").createNewFile();
new File(File.separator + "output.txt").createNewFile();
new File("docs").mkdir();
new File(File.separator + "docs").mkdir();
} catch (IOException e) {
System.err.println(e.getMessage());
}
}
}
| package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
|
Convert this Java block to Go, preserving its control flow and logic. | public class UnprimeableNumbers {
private static int MAX = 10_000_000;
private static boolean[] primes = new boolean[MAX];
public static void main(String[] args) {
sieve();
System.out.println("First 35 unprimeable numbers:");
displayUnprimeableNumbers(35);
int n = 600;
System.out.printf("%nThe %dth unprimeable number = %,d%n%n", n, nthUnprimeableNumber(n));
int[] lowest = genLowest();
System.out.println("Least unprimeable number that ends in:");
for ( int i = 0 ; i <= 9 ; i++ ) {
System.out.printf(" %d is %,d%n", i, lowest[i]);
}
}
private static int[] genLowest() {
int[] lowest = new int[10];
int count = 0;
int test = 1;
while ( count < 10 ) {
test++;
if ( unPrimable(test) && lowest[test % 10] == 0 ) {
lowest[test % 10] = test;
count++;
}
}
return lowest;
}
private static int nthUnprimeableNumber(int maxCount) {
int test = 1;
int count = 0;
int result = 0;
while ( count < maxCount ) {
test++;
if ( unPrimable(test) ) {
count++;
result = test;
}
}
return result;
}
private static void displayUnprimeableNumbers(int maxCount) {
int test = 1;
int count = 0;
while ( count < maxCount ) {
test++;
if ( unPrimable(test) ) {
count++;
System.out.printf("%d ", test);
}
}
System.out.println();
}
private static boolean unPrimable(int test) {
if ( primes[test] ) {
return false;
}
String s = test + "";
for ( int i = 0 ; i < s.length() ; i++ ) {
for ( int j = 0 ; j <= 9 ; j++ ) {
if ( primes[Integer.parseInt(replace(s, i, j))] ) {
return false;
}
}
}
return true;
}
private static String replace(String str, int position, int value) {
char[] sChar = str.toCharArray();
sChar[position] = (char) value;
return str.substring(0, position) + value + str.substring(position + 1);
}
private static final void sieve() {
for ( int i = 2 ; i < MAX ; i++ ) {
primes[i] = true;
}
for ( int i = 2 ; i < MAX ; i++ ) {
if ( primes[i] ) {
for ( int j = 2*i ; j < MAX ; j += i ) {
primes[j] = false;
}
}
}
}
}
| package main
import (
"fmt"
"strconv"
)
func isPrime(n int) bool {
switch {
case n < 2:
return false
case n%2 == 0:
return n == 2
case n%3 == 0:
return n == 3
default:
d := 5
for d*d <= n {
if n%d == 0 {
return false
}
d += 2
if n%d == 0 {
return false
}
d += 4
}
return true
}
}
func commatize(n int) string {
s := fmt.Sprintf("%d", n)
le := len(s)
for i := le - 3; i >= 1; i -= 3 {
s = s[0:i] + "," + s[i:]
}
return s
}
func main() {
fmt.Println("The first 35 unprimeable numbers are:")
count := 0
var firstNum [10]int
outer:
for i, countFirst := 100, 0; countFirst < 10; i++ {
if isPrime(i) {
continue
}
s := strconv.Itoa(i)
le := len(s)
b := []byte(s)
for j := 0; j < le; j++ {
for k := byte('0'); k <= '9'; k++ {
if s[j] == k {
continue
}
b[j] = k
n, _ := strconv.Atoi(string(b))
if isPrime(n) {
continue outer
}
}
b[j] = s[j]
}
lastDigit := s[le-1] - '0'
if firstNum[lastDigit] == 0 {
firstNum[lastDigit] = i
countFirst++
}
count++
if count <= 35 {
fmt.Printf("%d ", i)
}
if count == 35 {
fmt.Print("\n\nThe 600th unprimeable number is: ")
}
if count == 600 {
fmt.Printf("%s\n\n", commatize(i))
}
}
fmt.Println("The first unprimeable number that ends in:")
for i := 0; i < 10; i++ {
fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i]))
}
}
|
Port the provided Java code into Go while preserving the original functionality. | import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
public class PascalsTrianglePuzzle {
public static void main(String[] args) {
Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d),
Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d),
Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d),
Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d),
Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d));
List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d);
List<Double> solution = cramersRule(mat, b);
System.out.println("Solution = " + cramersRule(mat, b));
System.out.printf("X = %.2f%n", solution.get(8));
System.out.printf("Y = %.2f%n", solution.get(9));
System.out.printf("Z = %.2f%n", solution.get(10));
}
private static List<Double> cramersRule(Matrix matrix, List<Double> b) {
double denominator = matrix.determinant();
List<Double> result = new ArrayList<>();
for ( int i = 0 ; i < b.size() ; i++ ) {
result.add(matrix.replaceColumn(b, i).determinant() / denominator);
}
return result;
}
private static class Matrix {
private List<List<Double>> matrix;
@Override
public String toString() {
return matrix.toString();
}
@SafeVarargs
public Matrix(List<Double> ... lists) {
matrix = new ArrayList<>();
for ( List<Double> list : lists) {
matrix.add(list);
}
}
public Matrix(List<List<Double>> mat) {
matrix = mat;
}
public double determinant() {
if ( matrix.size() == 1 ) {
return get(0, 0);
}
if ( matrix.size() == 2 ) {
return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0);
}
double sum = 0;
double sign = 1;
for ( int i = 0 ; i < matrix.size() ; i++ ) {
sum += sign * get(0, i) * coFactor(0, i).determinant();
sign *= -1;
}
return sum;
}
private Matrix coFactor(int row, int col) {
List<List<Double>> mat = new ArrayList<>();
for ( int i = 0 ; i < matrix.size() ; i++ ) {
if ( i == row ) {
continue;
}
List<Double> list = new ArrayList<>();
for ( int j = 0 ; j < matrix.size() ; j++ ) {
if ( j == col ) {
continue;
}
list.add(get(i, j));
}
mat.add(list);
}
return new Matrix(mat);
}
private Matrix replaceColumn(List<Double> b, int column) {
List<List<Double>> mat = new ArrayList<>();
for ( int row = 0 ; row < matrix.size() ; row++ ) {
List<Double> list = new ArrayList<>();
for ( int col = 0 ; col < matrix.size() ; col++ ) {
double value = get(row, col);
if ( col == column ) {
value = b.get(row);
}
list.add(value);
}
mat.add(list);
}
return new Matrix(mat);
}
private double get(int row, int col) {
return matrix.get(row).get(col);
}
}
}
| package main
import "fmt"
type expr struct {
x, y, z float64
c float64
}
func addExpr(a, b expr) expr {
return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c}
}
func subExpr(a, b expr) expr {
return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c}
}
func mulExpr(a expr, c float64) expr {
return expr{a.x * c, a.y * c, a.z * c, a.c * c}
}
func addRow(l []expr) []expr {
if len(l) == 0 {
panic("wrong")
}
r := make([]expr, len(l)-1)
for i := range r {
r[i] = addExpr(l[i], l[i+1])
}
return r
}
func substX(a, b expr) expr {
if b.x == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.x/b.x))
}
func substY(a, b expr) expr {
if b.y == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.y/b.y))
}
func substZ(a, b expr) expr {
if b.z == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.z/b.z))
}
func solveX(a expr) float64 {
if a.x == 0 || a.y != 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.x
}
func solveY(a expr) float64 {
if a.x != 0 || a.y == 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.y
}
func solveZ(a expr) float64 {
if a.x != 0 || a.y != 0 || a.z == 0 {
panic("wrong")
}
return -a.c / a.z
}
func main() {
r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}}
fmt.Println("bottom row:", r5)
r4 := addRow(r5)
fmt.Println("next row up:", r4)
r3 := addRow(r4)
fmt.Println("middle row:", r3)
xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1})
fmt.Println("xyz relation:", xyz)
r3[2] = substZ(r3[2], xyz)
fmt.Println("middle row after substituting for z:", r3)
b := expr{c: 40}
xy := subExpr(r3[0], b)
fmt.Println("xy relation:", xy)
r3[0] = b
r3[2] = substX(r3[2], xy)
fmt.Println("middle row after substituting for x:", r3)
r2 := addRow(r3)
fmt.Println("next row up:", r2)
r1 := addRow(r2)
fmt.Println("top row:", r1)
y := subExpr(r1[0], expr{c: 151})
fmt.Println("y relation:", y)
x := substY(xy, y)
fmt.Println("x relation:", x)
z := substX(substY(xyz, y), x)
fmt.Println("z relation:", z)
fmt.Println("x =", solveX(x))
fmt.Println("y =", solveY(y))
fmt.Println("z =", solveZ(z))
}
|
Transform the following Java implementation into Go, maintaining the same output and logic. | import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
public class PascalsTrianglePuzzle {
public static void main(String[] args) {
Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d),
Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d),
Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d),
Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d),
Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d),
Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d));
List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d);
List<Double> solution = cramersRule(mat, b);
System.out.println("Solution = " + cramersRule(mat, b));
System.out.printf("X = %.2f%n", solution.get(8));
System.out.printf("Y = %.2f%n", solution.get(9));
System.out.printf("Z = %.2f%n", solution.get(10));
}
private static List<Double> cramersRule(Matrix matrix, List<Double> b) {
double denominator = matrix.determinant();
List<Double> result = new ArrayList<>();
for ( int i = 0 ; i < b.size() ; i++ ) {
result.add(matrix.replaceColumn(b, i).determinant() / denominator);
}
return result;
}
private static class Matrix {
private List<List<Double>> matrix;
@Override
public String toString() {
return matrix.toString();
}
@SafeVarargs
public Matrix(List<Double> ... lists) {
matrix = new ArrayList<>();
for ( List<Double> list : lists) {
matrix.add(list);
}
}
public Matrix(List<List<Double>> mat) {
matrix = mat;
}
public double determinant() {
if ( matrix.size() == 1 ) {
return get(0, 0);
}
if ( matrix.size() == 2 ) {
return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0);
}
double sum = 0;
double sign = 1;
for ( int i = 0 ; i < matrix.size() ; i++ ) {
sum += sign * get(0, i) * coFactor(0, i).determinant();
sign *= -1;
}
return sum;
}
private Matrix coFactor(int row, int col) {
List<List<Double>> mat = new ArrayList<>();
for ( int i = 0 ; i < matrix.size() ; i++ ) {
if ( i == row ) {
continue;
}
List<Double> list = new ArrayList<>();
for ( int j = 0 ; j < matrix.size() ; j++ ) {
if ( j == col ) {
continue;
}
list.add(get(i, j));
}
mat.add(list);
}
return new Matrix(mat);
}
private Matrix replaceColumn(List<Double> b, int column) {
List<List<Double>> mat = new ArrayList<>();
for ( int row = 0 ; row < matrix.size() ; row++ ) {
List<Double> list = new ArrayList<>();
for ( int col = 0 ; col < matrix.size() ; col++ ) {
double value = get(row, col);
if ( col == column ) {
value = b.get(row);
}
list.add(value);
}
mat.add(list);
}
return new Matrix(mat);
}
private double get(int row, int col) {
return matrix.get(row).get(col);
}
}
}
| package main
import "fmt"
type expr struct {
x, y, z float64
c float64
}
func addExpr(a, b expr) expr {
return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c}
}
func subExpr(a, b expr) expr {
return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c}
}
func mulExpr(a expr, c float64) expr {
return expr{a.x * c, a.y * c, a.z * c, a.c * c}
}
func addRow(l []expr) []expr {
if len(l) == 0 {
panic("wrong")
}
r := make([]expr, len(l)-1)
for i := range r {
r[i] = addExpr(l[i], l[i+1])
}
return r
}
func substX(a, b expr) expr {
if b.x == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.x/b.x))
}
func substY(a, b expr) expr {
if b.y == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.y/b.y))
}
func substZ(a, b expr) expr {
if b.z == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.z/b.z))
}
func solveX(a expr) float64 {
if a.x == 0 || a.y != 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.x
}
func solveY(a expr) float64 {
if a.x != 0 || a.y == 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.y
}
func solveZ(a expr) float64 {
if a.x != 0 || a.y != 0 || a.z == 0 {
panic("wrong")
}
return -a.c / a.z
}
func main() {
r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}}
fmt.Println("bottom row:", r5)
r4 := addRow(r5)
fmt.Println("next row up:", r4)
r3 := addRow(r4)
fmt.Println("middle row:", r3)
xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1})
fmt.Println("xyz relation:", xyz)
r3[2] = substZ(r3[2], xyz)
fmt.Println("middle row after substituting for z:", r3)
b := expr{c: 40}
xy := subExpr(r3[0], b)
fmt.Println("xy relation:", xy)
r3[0] = b
r3[2] = substX(r3[2], xy)
fmt.Println("middle row after substituting for x:", r3)
r2 := addRow(r3)
fmt.Println("next row up:", r2)
r1 := addRow(r2)
fmt.Println("top row:", r1)
y := subExpr(r1[0], expr{c: 151})
fmt.Println("y relation:", y)
x := substY(xy, y)
fmt.Println("x relation:", x)
z := substX(substY(xyz, y), x)
fmt.Println("z relation:", z)
fmt.Println("x =", solveX(x))
fmt.Println("y =", solveY(y))
fmt.Println("z =", solveZ(z))
}
|
Please provide an equivalent version of this Java code in Go. | import java.math.BigInteger;
import java.util.ArrayList;
import java.util.List;
public class ChernicksCarmichaelNumbers {
public static void main(String[] args) {
for ( long n = 3 ; n < 10 ; n++ ) {
long m = 0;
boolean foundComposite = true;
List<Long> factors = null;
while ( foundComposite ) {
m += (n <= 4 ? 1 : (long) Math.pow(2, n-4) * 5);
factors = U(n, m);
foundComposite = false;
for ( long factor : factors ) {
if ( ! isPrime(factor) ) {
foundComposite = true;
break;
}
}
}
System.out.printf("U(%d, %d) = %s = %s %n", n, m, display(factors), multiply(factors));
}
}
private static String display(List<Long> factors) {
return factors.toString().replace("[", "").replace("]", "").replaceAll(", ", " * ");
}
private static BigInteger multiply(List<Long> factors) {
BigInteger result = BigInteger.ONE;
for ( long factor : factors ) {
result = result.multiply(BigInteger.valueOf(factor));
}
return result;
}
private static List<Long> U(long n, long m) {
List<Long> factors = new ArrayList<>();
factors.add(6*m + 1);
factors.add(12*m + 1);
for ( int i = 1 ; i <= n-2 ; i++ ) {
factors.add(((long)Math.pow(2, i)) * 9 * m + 1);
}
return factors;
}
private static final int MAX = 100_000;
private static final boolean[] primes = new boolean[MAX];
private static boolean SIEVE_COMPLETE = false;
private static final boolean isPrimeTrivial(long test) {
if ( ! SIEVE_COMPLETE ) {
sieve();
SIEVE_COMPLETE = true;
}
return primes[(int) test];
}
private static final void sieve() {
for ( int i = 2 ; i < MAX ; i++ ) {
primes[i] = true;
}
for ( int i = 2 ; i < MAX ; i++ ) {
if ( primes[i] ) {
for ( int j = 2*i ; j < MAX ; j += i ) {
primes[j] = false;
}
}
}
}
public static final boolean isPrime(long testValue) {
if ( testValue == 2 ) return true;
if ( testValue % 2 == 0 ) return false;
if ( testValue <= MAX ) return isPrimeTrivial(testValue);
long d = testValue-1;
int s = 0;
while ( d % 2 == 0 ) {
s += 1;
d /= 2;
}
if ( testValue < 1373565L ) {
if ( ! aSrp(2, s, d, testValue) ) {
return false;
}
if ( ! aSrp(3, s, d, testValue) ) {
return false;
}
return true;
}
if ( testValue < 4759123141L ) {
if ( ! aSrp(2, s, d, testValue) ) {
return false;
}
if ( ! aSrp(7, s, d, testValue) ) {
return false;
}
if ( ! aSrp(61, s, d, testValue) ) {
return false;
}
return true;
}
if ( testValue < 10000000000000000L ) {
if ( ! aSrp(3, s, d, testValue) ) {
return false;
}
if ( ! aSrp(24251, s, d, testValue) ) {
return false;
}
return true;
}
if ( ! aSrp(37, s, d, testValue) ) {
return false;
}
if ( ! aSrp(47, s, d, testValue) ) {
return false;
}
if ( ! aSrp(61, s, d, testValue) ) {
return false;
}
if ( ! aSrp(73, s, d, testValue) ) {
return false;
}
if ( ! aSrp(83, s, d, testValue) ) {
return false;
}
return true;
}
private static final boolean aSrp(int a, int s, long d, long n) {
long modPow = modPow(a, d, n);
if ( modPow == 1 ) {
return true;
}
int twoExpR = 1;
for ( int r = 0 ; r < s ; r++ ) {
if ( modPow(modPow, twoExpR, n) == n-1 ) {
return true;
}
twoExpR *= 2;
}
return false;
}
private static final long SQRT = (long) Math.sqrt(Long.MAX_VALUE);
public static final long modPow(long base, long exponent, long modulus) {
long result = 1;
while ( exponent > 0 ) {
if ( exponent % 2 == 1 ) {
if ( result > SQRT || base > SQRT ) {
result = multiply(result, base, modulus);
}
else {
result = (result * base) % modulus;
}
}
exponent >>= 1;
if ( base > SQRT ) {
base = multiply(base, base, modulus);
}
else {
base = (base * base) % modulus;
}
}
return result;
}
public static final long multiply(long a, long b, long modulus) {
long x = 0;
long y = a % modulus;
long t;
while ( b > 0 ) {
if ( b % 2 == 1 ) {
t = x + y;
x = (t > modulus ? t-modulus : t);
}
t = y << 1;
y = (t > modulus ? t-modulus : t);
b >>= 1;
}
return x % modulus;
}
}
| package main
import (
"fmt"
"math/big"
)
var (
zero = new(big.Int)
prod = new(big.Int)
fact = new(big.Int)
)
func ccFactors(n, m uint64) (*big.Int, bool) {
prod.SetUint64(6*m + 1)
if !prod.ProbablyPrime(0) {
return zero, false
}
fact.SetUint64(12*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
for i := uint64(1); i <= n-2; i++ {
fact.SetUint64((1<<i)*9*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
}
return prod, true
}
func ccNumbers(start, end uint64) {
for n := start; n <= end; n++ {
m := uint64(1)
if n > 4 {
m = 1 << (n - 4)
}
for {
num, ok := ccFactors(n, m)
if ok {
fmt.Printf("a(%d) = %d\n", n, num)
break
}
if n <= 4 {
m++
} else {
m += 1 << (n - 4)
}
}
}
}
func main() {
ccNumbers(3, 9)
}
|
Port the provided Java code into Go while preserving the original functionality. | import java.util.Objects;
public class FindTriangle {
private static final double EPS = 0.001;
private static final double EPS_SQUARE = EPS * EPS;
public static class Point {
private final double x, y;
public Point(double x, double y) {
this.x = x;
this.y = y;
}
public double getX() {
return x;
}
public double getY() {
return y;
}
@Override
public String toString() {
return String.format("(%f, %f)", x, y);
}
}
public static class Triangle {
private final Point p1, p2, p3;
public Triangle(Point p1, Point p2, Point p3) {
this.p1 = Objects.requireNonNull(p1);
this.p2 = Objects.requireNonNull(p2);
this.p3 = Objects.requireNonNull(p3);
}
public Point getP1() {
return p1;
}
public Point getP2() {
return p2;
}
public Point getP3() {
return p3;
}
private boolean pointInTriangleBoundingBox(Point p) {
var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS;
var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS;
var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS;
var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS;
return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY());
}
private static double side(Point p1, Point p2, Point p) {
return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY());
}
private boolean nativePointInTriangle(Point p) {
boolean checkSide1 = side(p1, p2, p) >= 0;
boolean checkSide2 = side(p2, p3, p) >= 0;
boolean checkSide3 = side(p3, p1, p) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
private double distanceSquarePointToSegment(Point p1, Point p2, Point p) {
double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY());
double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength;
if (dotProduct < 0) {
return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY());
}
if (dotProduct <= 1) {
double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY());
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
}
return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY());
}
private boolean accuratePointInTriangle(Point p) {
if (!pointInTriangleBoundingBox(p)) {
return false;
}
if (nativePointInTriangle(p)) {
return true;
}
if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) {
return true;
}
return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE;
}
public boolean within(Point p) {
Objects.requireNonNull(p);
return accuratePointInTriangle(p);
}
@Override
public String toString() {
return String.format("Triangle[%s, %s, %s]", p1, p2, p3);
}
}
private static void test(Triangle t, Point p) {
System.out.println(t);
System.out.printf("Point %s is within triangle? %s\n", p, t.within(p));
}
public static void main(String[] args) {
var p1 = new Point(1.5, 2.4);
var p2 = new Point(5.1, -3.1);
var p3 = new Point(-3.8, 1.2);
var tri = new Triangle(p1, p2, p3);
test(tri, new Point(0, 0));
test(tri, new Point(0, 1));
test(tri, new Point(3, 1));
System.out.println();
p1 = new Point(1.0 / 10, 1.0 / 9);
p2 = new Point(100.0 / 8, 100.0 / 3);
p3 = new Point(100.0 / 4, 100.0 / 9);
tri = new Triangle(p1, p2, p3);
var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY()));
test(tri, pt);
System.out.println();
p3 = new Point(-100.0 / 8, 100.0 / 6);
tri = new Triangle(p1, p2, p3);
test(tri, pt);
}
}
| package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
Maintain the same structure and functionality when rewriting this code in Go. | import java.util.Objects;
public class FindTriangle {
private static final double EPS = 0.001;
private static final double EPS_SQUARE = EPS * EPS;
public static class Point {
private final double x, y;
public Point(double x, double y) {
this.x = x;
this.y = y;
}
public double getX() {
return x;
}
public double getY() {
return y;
}
@Override
public String toString() {
return String.format("(%f, %f)", x, y);
}
}
public static class Triangle {
private final Point p1, p2, p3;
public Triangle(Point p1, Point p2, Point p3) {
this.p1 = Objects.requireNonNull(p1);
this.p2 = Objects.requireNonNull(p2);
this.p3 = Objects.requireNonNull(p3);
}
public Point getP1() {
return p1;
}
public Point getP2() {
return p2;
}
public Point getP3() {
return p3;
}
private boolean pointInTriangleBoundingBox(Point p) {
var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS;
var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS;
var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS;
var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS;
return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY());
}
private static double side(Point p1, Point p2, Point p) {
return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY());
}
private boolean nativePointInTriangle(Point p) {
boolean checkSide1 = side(p1, p2, p) >= 0;
boolean checkSide2 = side(p2, p3, p) >= 0;
boolean checkSide3 = side(p3, p1, p) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
private double distanceSquarePointToSegment(Point p1, Point p2, Point p) {
double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY());
double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength;
if (dotProduct < 0) {
return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY());
}
if (dotProduct <= 1) {
double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY());
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
}
return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY());
}
private boolean accuratePointInTriangle(Point p) {
if (!pointInTriangleBoundingBox(p)) {
return false;
}
if (nativePointInTriangle(p)) {
return true;
}
if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) {
return true;
}
return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE;
}
public boolean within(Point p) {
Objects.requireNonNull(p);
return accuratePointInTriangle(p);
}
@Override
public String toString() {
return String.format("Triangle[%s, %s, %s]", p1, p2, p3);
}
}
private static void test(Triangle t, Point p) {
System.out.println(t);
System.out.printf("Point %s is within triangle? %s\n", p, t.within(p));
}
public static void main(String[] args) {
var p1 = new Point(1.5, 2.4);
var p2 = new Point(5.1, -3.1);
var p3 = new Point(-3.8, 1.2);
var tri = new Triangle(p1, p2, p3);
test(tri, new Point(0, 0));
test(tri, new Point(0, 1));
test(tri, new Point(3, 1));
System.out.println();
p1 = new Point(1.0 / 10, 1.0 / 9);
p2 = new Point(100.0 / 8, 100.0 / 3);
p3 = new Point(100.0 / 4, 100.0 / 9);
tri = new Triangle(p1, p2, p3);
var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY()));
test(tri, pt);
System.out.println();
p3 = new Point(-100.0 / 8, 100.0 / 6);
tri = new Triangle(p1, p2, p3);
test(tri, pt);
}
}
| package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
Change the following Java code into Go without altering its purpose. | import java.util.Objects;
public class FindTriangle {
private static final double EPS = 0.001;
private static final double EPS_SQUARE = EPS * EPS;
public static class Point {
private final double x, y;
public Point(double x, double y) {
this.x = x;
this.y = y;
}
public double getX() {
return x;
}
public double getY() {
return y;
}
@Override
public String toString() {
return String.format("(%f, %f)", x, y);
}
}
public static class Triangle {
private final Point p1, p2, p3;
public Triangle(Point p1, Point p2, Point p3) {
this.p1 = Objects.requireNonNull(p1);
this.p2 = Objects.requireNonNull(p2);
this.p3 = Objects.requireNonNull(p3);
}
public Point getP1() {
return p1;
}
public Point getP2() {
return p2;
}
public Point getP3() {
return p3;
}
private boolean pointInTriangleBoundingBox(Point p) {
var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS;
var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS;
var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS;
var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS;
return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY());
}
private static double side(Point p1, Point p2, Point p) {
return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY());
}
private boolean nativePointInTriangle(Point p) {
boolean checkSide1 = side(p1, p2, p) >= 0;
boolean checkSide2 = side(p2, p3, p) >= 0;
boolean checkSide3 = side(p3, p1, p) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
private double distanceSquarePointToSegment(Point p1, Point p2, Point p) {
double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY());
double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength;
if (dotProduct < 0) {
return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY());
}
if (dotProduct <= 1) {
double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY());
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
}
return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY());
}
private boolean accuratePointInTriangle(Point p) {
if (!pointInTriangleBoundingBox(p)) {
return false;
}
if (nativePointInTriangle(p)) {
return true;
}
if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) {
return true;
}
return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE;
}
public boolean within(Point p) {
Objects.requireNonNull(p);
return accuratePointInTriangle(p);
}
@Override
public String toString() {
return String.format("Triangle[%s, %s, %s]", p1, p2, p3);
}
}
private static void test(Triangle t, Point p) {
System.out.println(t);
System.out.printf("Point %s is within triangle? %s\n", p, t.within(p));
}
public static void main(String[] args) {
var p1 = new Point(1.5, 2.4);
var p2 = new Point(5.1, -3.1);
var p3 = new Point(-3.8, 1.2);
var tri = new Triangle(p1, p2, p3);
test(tri, new Point(0, 0));
test(tri, new Point(0, 1));
test(tri, new Point(3, 1));
System.out.println();
p1 = new Point(1.0 / 10, 1.0 / 9);
p2 = new Point(100.0 / 8, 100.0 / 3);
p3 = new Point(100.0 / 4, 100.0 / 9);
tri = new Triangle(p1, p2, p3);
var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY()));
test(tri, pt);
System.out.println();
p3 = new Point(-100.0 / 8, 100.0 / 6);
tri = new Triangle(p1, p2, p3);
test(tri, pt);
}
}
| package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
Keep all operations the same but rewrite the snippet in Go. | public class TauFunction {
private static long divisorCount(long n) {
long total = 1;
for (; (n & 1) == 0; n >>= 1) {
++total;
}
for (long p = 3; p * p <= n; p += 2) {
long count = 1;
for (; n % p == 0; n /= p) {
++count;
}
total *= count;
}
if (n > 1) {
total *= 2;
}
return total;
}
public static void main(String[] args) {
final int limit = 100;
System.out.printf("Count of divisors for the first %d positive integers:\n", limit);
for (long n = 1; n <= limit; ++n) {
System.out.printf("%3d", divisorCount(n));
if (n % 20 == 0) {
System.out.println();
}
}
}
}
| package main
import "fmt"
func countDivisors(n int) int {
count := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
count++
j := n / i
if j != i {
count++
}
}
i += k
}
return count
}
func main() {
fmt.Println("The tau functions for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%2d ", countDivisors(i))
if i%20 == 0 {
fmt.Println()
}
}
}
|
Convert this Java snippet to Go and keep its semantics consistent. | public class TauFunction {
private static long divisorCount(long n) {
long total = 1;
for (; (n & 1) == 0; n >>= 1) {
++total;
}
for (long p = 3; p * p <= n; p += 2) {
long count = 1;
for (; n % p == 0; n /= p) {
++count;
}
total *= count;
}
if (n > 1) {
total *= 2;
}
return total;
}
public static void main(String[] args) {
final int limit = 100;
System.out.printf("Count of divisors for the first %d positive integers:\n", limit);
for (long n = 1; n <= limit; ++n) {
System.out.printf("%3d", divisorCount(n));
if (n % 20 == 0) {
System.out.println();
}
}
}
}
| package main
import "fmt"
func countDivisors(n int) int {
count := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
count++
j := n / i
if j != i {
count++
}
}
i += k
}
return count
}
func main() {
fmt.Println("The tau functions for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%2d ", countDivisors(i))
if i%20 == 0 {
fmt.Println()
}
}
}
|
Write the same algorithm in Go as shown in this Java implementation. | import java.math.BigInteger;
public class PrimorialPrimes {
final static int sieveLimit = 1550_000;
static boolean[] notPrime = sieve(sieveLimit);
public static void main(String[] args) {
int count = 0;
for (int i = 1; i < 1000_000 && count < 20; i++) {
BigInteger b = primorial(i);
if (b.add(BigInteger.ONE).isProbablePrime(1)
|| b.subtract(BigInteger.ONE).isProbablePrime(1)) {
System.out.printf("%d ", i);
count++;
}
}
}
static BigInteger primorial(int n) {
if (n == 0)
return BigInteger.ONE;
BigInteger result = BigInteger.ONE;
for (int i = 0; i < sieveLimit && n > 0; i++) {
if (notPrime[i])
continue;
result = result.multiply(BigInteger.valueOf(i));
n--;
}
return result;
}
public static boolean[] sieve(int limit) {
boolean[] composite = new boolean[limit];
composite[0] = composite[1] = true;
int max = (int) Math.sqrt(limit);
for (int n = 2; n <= max; n++) {
if (!composite[n]) {
for (int k = n * n; k < limit; k += n) {
composite[k] = true;
}
}
}
return composite;
}
}
| package main
import (
"fmt"
"math/big"
)
func main() {
one := big.NewInt(1)
pm := big.NewInt(1)
var px, nx int
var pb big.Int
primes(4000, func(p int64) bool {
pm.Mul(pm, pb.SetInt64(p))
px++
if pb.Add(pm, one).ProbablyPrime(0) ||
pb.Sub(pm, one).ProbablyPrime(0) {
fmt.Print(px, " ")
nx++
if nx == 20 {
fmt.Println()
return false
}
}
return true
})
}
func primes(limit int, f func(int64) bool) {
c := make([]bool, limit)
c[0] = true
c[1] = true
lm := int64(limit)
p := int64(2)
for {
f(p)
p2 := p * p
if p2 >= lm {
break
}
for i := p2; i < lm; i += p {
c[i] = true
}
for {
p++
if !c[p] {
break
}
}
}
for p++; p < lm; p++ {
if !c[p] && !f(p) {
break
}
}
}
|
Write the same code in Go as shown below in Java. | import java.util.HashMap;
import java.util.Map;
public class orderedSequence {
public static void main(String[] args) {
Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT");
gene.runSequence();
}
}
public class Sequence {
private final String seq;
public Sequence(String sq) {
this.seq = sq;
}
public void prettyPrint() {
System.out.println("Sequence:");
int i = 0;
for ( ; i < seq.length() - 50 ; i += 50) {
System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50));
}
System.out.printf("%5s : %s\n", seq.length(), seq.substring(i));
}
public void displayCount() {
Map<Character, Integer> counter = new HashMap<>();
for (int i = 0 ; i < seq.length() ; ++i) {
counter.merge(seq.charAt(i), 1, Integer::sum);
}
System.out.println("Base vs. Count:");
counter.forEach(
key, value -> System.out.printf("%5s : %s\n", key, value));
System.out.printf("%5s: %s\n", "SUM", seq.length());
}
public void runSequence() {
this.prettyPrint();
this.displayCount();
}
}
| package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
|
Generate a Go translation of this Java snippet without changing its computational steps. | import java.util.HashMap;
import java.util.Map;
public class orderedSequence {
public static void main(String[] args) {
Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT");
gene.runSequence();
}
}
public class Sequence {
private final String seq;
public Sequence(String sq) {
this.seq = sq;
}
public void prettyPrint() {
System.out.println("Sequence:");
int i = 0;
for ( ; i < seq.length() - 50 ; i += 50) {
System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50));
}
System.out.printf("%5s : %s\n", seq.length(), seq.substring(i));
}
public void displayCount() {
Map<Character, Integer> counter = new HashMap<>();
for (int i = 0 ; i < seq.length() ; ++i) {
counter.merge(seq.charAt(i), 1, Integer::sum);
}
System.out.println("Base vs. Count:");
counter.forEach(
key, value -> System.out.printf("%5s : %s\n", key, value));
System.out.printf("%5s: %s\n", "SUM", seq.length());
}
public void runSequence() {
this.prettyPrint();
this.displayCount();
}
}
| package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
|
Write the same code in Go as shown below in Java. | package diningphilosophers;
import java.util.ArrayList;
import java.util.Random;
import java.util.concurrent.atomic.AtomicBoolean;
import java.util.concurrent.atomic.AtomicInteger;
enum PhilosopherState { Get, Eat, Pon }
class Fork {
public static final int ON_TABLE = -1;
static int instances = 0;
public int id;
public AtomicInteger holder = new AtomicInteger(ON_TABLE);
Fork() { id = instances++; }
}
class Philosopher implements Runnable {
static final int maxWaitMs = 100;
static AtomicInteger token = new AtomicInteger(0);
static int instances = 0;
static Random rand = new Random();
AtomicBoolean end = new AtomicBoolean(false);
int id;
PhilosopherState state = PhilosopherState.Get;
Fork left;
Fork right;
int timesEaten = 0;
Philosopher() {
id = instances++;
left = Main.forks.get(id);
right = Main.forks.get((id+1)%Main.philosopherCount);
}
void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); }
catch (InterruptedException ex) {} }
void waitForFork(Fork fork) {
do {
if (fork.holder.get() == Fork.ON_TABLE) {
fork.holder.set(id);
return;
} else {
sleep();
}
} while (true);
}
public void run() {
do {
if (state == PhilosopherState.Pon) {
state = PhilosopherState.Get;
} else {
if (token.get() == id) {
waitForFork(left);
waitForFork(right);
token.set((id+2)% Main.philosopherCount);
state = PhilosopherState.Eat;
timesEaten++;
sleep();
left.holder.set(Fork.ON_TABLE);
right.holder.set(Fork.ON_TABLE);
state = PhilosopherState.Pon;
sleep();
} else {
sleep();
}
}
} while (!end.get());
}
}
public class Main {
static final int philosopherCount = 5;
static final int runSeconds = 15;
static ArrayList<Fork> forks = new ArrayList<Fork>();
static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>();
public static void main(String[] args) {
for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork());
for (int i = 0 ; i < philosopherCount ; i++)
philosophers.add(new Philosopher());
for (Philosopher p : philosophers) new Thread(p).start();
long endTime = System.currentTimeMillis() + (runSeconds * 1000);
do {
StringBuilder sb = new StringBuilder("|");
for (Philosopher p : philosophers) {
sb.append(p.state.toString());
sb.append("|");
}
sb.append(" |");
for (Fork f : forks) {
int holder = f.holder.get();
sb.append(holder==-1?" ":String.format("P%02d",holder));
sb.append("|");
}
System.out.println(sb.toString());
try {Thread.sleep(1000);} catch (Exception ex) {}
} while (System.currentTimeMillis() < endTime);
for (Philosopher p : philosophers) p.end.set(true);
for (Philosopher p : philosophers)
System.out.printf("P%02d: ate %,d times, %,d/sec\n",
p.id, p.timesEaten, p.timesEaten/runSeconds);
}
}
| package main
import (
"hash/fnv"
"log"
"math/rand"
"os"
"time"
)
var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"}
const hunger = 3
const think = time.Second / 100
const eat = time.Second / 100
var fmt = log.New(os.Stdout, "", 0)
var done = make(chan bool)
type fork byte
func philosopher(phName string,
dominantHand, otherHand chan fork, done chan bool) {
fmt.Println(phName, "seated")
h := fnv.New64a()
h.Write([]byte(phName))
rg := rand.New(rand.NewSource(int64(h.Sum64())))
rSleep := func(t time.Duration) {
time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t))))
}
for h := hunger; h > 0; h-- {
fmt.Println(phName, "hungry")
<-dominantHand
<-otherHand
fmt.Println(phName, "eating")
rSleep(eat)
dominantHand <- 'f'
otherHand <- 'f'
fmt.Println(phName, "thinking")
rSleep(think)
}
fmt.Println(phName, "satisfied")
done <- true
fmt.Println(phName, "left the table")
}
func main() {
fmt.Println("table empty")
place0 := make(chan fork, 1)
place0 <- 'f'
placeLeft := place0
for i := 1; i < len(ph); i++ {
placeRight := make(chan fork, 1)
placeRight <- 'f'
go philosopher(ph[i], placeLeft, placeRight, done)
placeLeft = placeRight
}
go philosopher(ph[0], place0, placeLeft, done)
for range ph {
<-done
}
fmt.Println("table empty")
}
|
Preserve the algorithm and functionality while converting the code from Java to Go. | package diningphilosophers;
import java.util.ArrayList;
import java.util.Random;
import java.util.concurrent.atomic.AtomicBoolean;
import java.util.concurrent.atomic.AtomicInteger;
enum PhilosopherState { Get, Eat, Pon }
class Fork {
public static final int ON_TABLE = -1;
static int instances = 0;
public int id;
public AtomicInteger holder = new AtomicInteger(ON_TABLE);
Fork() { id = instances++; }
}
class Philosopher implements Runnable {
static final int maxWaitMs = 100;
static AtomicInteger token = new AtomicInteger(0);
static int instances = 0;
static Random rand = new Random();
AtomicBoolean end = new AtomicBoolean(false);
int id;
PhilosopherState state = PhilosopherState.Get;
Fork left;
Fork right;
int timesEaten = 0;
Philosopher() {
id = instances++;
left = Main.forks.get(id);
right = Main.forks.get((id+1)%Main.philosopherCount);
}
void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); }
catch (InterruptedException ex) {} }
void waitForFork(Fork fork) {
do {
if (fork.holder.get() == Fork.ON_TABLE) {
fork.holder.set(id);
return;
} else {
sleep();
}
} while (true);
}
public void run() {
do {
if (state == PhilosopherState.Pon) {
state = PhilosopherState.Get;
} else {
if (token.get() == id) {
waitForFork(left);
waitForFork(right);
token.set((id+2)% Main.philosopherCount);
state = PhilosopherState.Eat;
timesEaten++;
sleep();
left.holder.set(Fork.ON_TABLE);
right.holder.set(Fork.ON_TABLE);
state = PhilosopherState.Pon;
sleep();
} else {
sleep();
}
}
} while (!end.get());
}
}
public class Main {
static final int philosopherCount = 5;
static final int runSeconds = 15;
static ArrayList<Fork> forks = new ArrayList<Fork>();
static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>();
public static void main(String[] args) {
for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork());
for (int i = 0 ; i < philosopherCount ; i++)
philosophers.add(new Philosopher());
for (Philosopher p : philosophers) new Thread(p).start();
long endTime = System.currentTimeMillis() + (runSeconds * 1000);
do {
StringBuilder sb = new StringBuilder("|");
for (Philosopher p : philosophers) {
sb.append(p.state.toString());
sb.append("|");
}
sb.append(" |");
for (Fork f : forks) {
int holder = f.holder.get();
sb.append(holder==-1?" ":String.format("P%02d",holder));
sb.append("|");
}
System.out.println(sb.toString());
try {Thread.sleep(1000);} catch (Exception ex) {}
} while (System.currentTimeMillis() < endTime);
for (Philosopher p : philosophers) p.end.set(true);
for (Philosopher p : philosophers)
System.out.printf("P%02d: ate %,d times, %,d/sec\n",
p.id, p.timesEaten, p.timesEaten/runSeconds);
}
}
| package main
import (
"hash/fnv"
"log"
"math/rand"
"os"
"time"
)
var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"}
const hunger = 3
const think = time.Second / 100
const eat = time.Second / 100
var fmt = log.New(os.Stdout, "", 0)
var done = make(chan bool)
type fork byte
func philosopher(phName string,
dominantHand, otherHand chan fork, done chan bool) {
fmt.Println(phName, "seated")
h := fnv.New64a()
h.Write([]byte(phName))
rg := rand.New(rand.NewSource(int64(h.Sum64())))
rSleep := func(t time.Duration) {
time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t))))
}
for h := hunger; h > 0; h-- {
fmt.Println(phName, "hungry")
<-dominantHand
<-otherHand
fmt.Println(phName, "eating")
rSleep(eat)
dominantHand <- 'f'
otherHand <- 'f'
fmt.Println(phName, "thinking")
rSleep(think)
}
fmt.Println(phName, "satisfied")
done <- true
fmt.Println(phName, "left the table")
}
func main() {
fmt.Println("table empty")
place0 := make(chan fork, 1)
place0 <- 'f'
placeLeft := place0
for i := 1; i < len(ph); i++ {
placeRight := make(chan fork, 1)
placeRight <- 'f'
go philosopher(ph[i], placeLeft, placeRight, done)
placeLeft = placeRight
}
go philosopher(ph[0], place0, placeLeft, done)
for range ph {
<-done
}
fmt.Println("table empty")
}
|
Port the following code from Java to Go with equivalent syntax and logic. | public class Factorion {
public static void main(String [] args){
System.out.println("Base 9:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,9);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 10:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,10);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 11:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,11);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 12:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,12);
if(multiplied == i){
System.out.print(i + "\t");
}
}
}
public static int factorialRec(int n){
int result = 1;
return n == 0 ? result : result * n * factorialRec(n-1);
}
public static int operate(String s, int base){
int sum = 0;
String strx = fromDeci(base, Integer.parseInt(s));
for(int i = 0; i < strx.length(); i++){
if(strx.charAt(i) == 'A'){
sum += factorialRec(10);
}else if(strx.charAt(i) == 'B') {
sum += factorialRec(11);
}else if(strx.charAt(i) == 'C') {
sum += factorialRec(12);
}else {
sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base));
}
}
return sum;
}
static char reVal(int num) {
if (num >= 0 && num <= 9)
return (char)(num + 48);
else
return (char)(num - 10 + 65);
}
static String fromDeci(int base, int num){
StringBuilder s = new StringBuilder();
while (num > 0) {
s.append(reVal(num % base));
num /= base;
}
return new String(new StringBuilder(s).reverse());
}
}
| package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Change the following Java code into Go without altering its purpose. | public class Factorion {
public static void main(String [] args){
System.out.println("Base 9:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,9);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 10:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,10);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 11:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,11);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 12:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,12);
if(multiplied == i){
System.out.print(i + "\t");
}
}
}
public static int factorialRec(int n){
int result = 1;
return n == 0 ? result : result * n * factorialRec(n-1);
}
public static int operate(String s, int base){
int sum = 0;
String strx = fromDeci(base, Integer.parseInt(s));
for(int i = 0; i < strx.length(); i++){
if(strx.charAt(i) == 'A'){
sum += factorialRec(10);
}else if(strx.charAt(i) == 'B') {
sum += factorialRec(11);
}else if(strx.charAt(i) == 'C') {
sum += factorialRec(12);
}else {
sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base));
}
}
return sum;
}
static char reVal(int num) {
if (num >= 0 && num <= 9)
return (char)(num + 48);
else
return (char)(num - 10 + 65);
}
static String fromDeci(int base, int num){
StringBuilder s = new StringBuilder();
while (num > 0) {
s.append(reVal(num % base));
num /= base;
}
return new String(new StringBuilder(s).reverse());
}
}
| package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Please provide an equivalent version of this Java code in Go. | import java.util.List;
import java.util.function.Function;
public class LogisticCurveFitting {
private static final double K = 7.8e9;
private static final int N0 = 27;
private static final List<Double> ACTUAL = List.of(
27.0, 27.0, 27.0, 44.0, 44.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 60.0, 60.0,
61.0, 61.0, 66.0, 83.0, 219.0, 239.0, 392.0, 534.0, 631.0, 897.0, 1350.0, 2023.0, 2820.0,
4587.0, 6067.0, 7823.0, 9826.0, 11946.0, 14554.0, 17372.0, 20615.0, 24522.0, 28273.0,
31491.0, 34933.0, 37552.0, 40540.0, 43105.0, 45177.0, 60328.0, 64543.0, 67103.0,
69265.0, 71332.0, 73327.0, 75191.0, 75723.0, 76719.0, 77804.0, 78812.0, 79339.0,
80132.0, 80995.0, 82101.0, 83365.0, 85203.0, 87024.0, 89068.0, 90664.0, 93077.0,
95316.0, 98172.0, 102133.0, 105824.0, 109695.0, 114232.0, 118610.0, 125497.0,
133852.0, 143227.0, 151367.0, 167418.0, 180096.0, 194836.0, 213150.0, 242364.0,
271106.0, 305117.0, 338133.0, 377918.0, 416845.0, 468049.0, 527767.0, 591704.0,
656866.0, 715353.0, 777796.0, 851308.0, 928436.0, 1000249.0, 1082054.0, 1174652.0
);
private static double f(double r) {
var sq = 0.0;
var len = ACTUAL.size();
for (int i = 0; i < len; i++) {
var eri = Math.exp(r * i);
var guess = (N0 * eri) / (1.0 + N0 * (eri - 1.0) / K);
var diff = guess - ACTUAL.get(i);
sq += diff * diff;
}
return sq;
}
private static double solve(Function<Double, Double> fn) {
return solve(fn, 0.5, 0.0);
}
private static double solve(Function<Double, Double> fn, double guess, double epsilon) {
double delta;
if (guess != 0.0) {
delta = guess;
} else {
delta = 1.0;
}
var f0 = fn.apply(guess);
var factor = 2.0;
while (delta > epsilon && guess != guess - delta) {
var nf = fn.apply(guess - delta);
if (nf < f0) {
f0 = nf;
guess -= delta;
} else {
nf = fn.apply(guess + delta);
if (nf < f0) {
f0 = nf;
guess += delta;
} else {
factor = 0.5;
}
}
delta *= factor;
}
return guess;
}
public static void main(String[] args) {
var r = solve(LogisticCurveFitting::f);
var r0 = Math.exp(12.0 * r);
System.out.printf("r = %.16f, R0 = %.16f\n", r, r0);
}
}
| package main
import (
"fmt"
"github.com/maorshutman/lm"
"log"
"math"
)
const (
K = 7_800_000_000
n0 = 27
)
var y = []float64{
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023,
2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615,
24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177,
60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723,
76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365,
85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133,
105824, 109695, 114232, 118610, 125497, 133852, 143227,
151367, 167418, 180096, 194836, 213150, 242364, 271106,
305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054,
1174652,
}
func f(dst, p []float64) {
for i := 0; i < len(y); i++ {
t := float64(i)
dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i]
}
}
func main() {
j := lm.NumJac{Func: f}
prob := lm.LMProblem{
Dim: 1,
Size: len(y),
Func: f,
Jac: j.Jac,
InitParams: []float64{0.5},
Tau: 1e-6,
Eps1: 1e-8,
Eps2: 1e-8,
}
res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16})
if err != nil {
log.Fatal(err)
}
r := res.X[0]
fmt.Printf("The logistic curve r for the world data is %.8f\n", r)
fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r))
}
|
Please provide an equivalent version of this Java code in Go. | import java.util.Arrays;
import java.util.LinkedList;
public class Strand{
public static <E extends Comparable<? super E>>
LinkedList<E> strandSort(LinkedList<E> list){
if(list.size() <= 1) return list;
LinkedList<E> result = new LinkedList<E>();
while(list.size() > 0){
LinkedList<E> sorted = new LinkedList<E>();
sorted.add(list.removeFirst());
for(Iterator<E> it = list.iterator(); it.hasNext(); ){
E elem = it.next();
if(sorted.peekLast().compareTo(elem) <= 0){
sorted.addLast(elem);
it.remove();
}
}
result = merge(sorted, result);
}
return result;
}
private static <E extends Comparable<? super E>>
LinkedList<E> merge(LinkedList<E> left, LinkedList<E> right){
LinkedList<E> result = new LinkedList<E>();
while(!left.isEmpty() && !right.isEmpty()){
if(left.peek().compareTo(right.peek()) <= 0)
result.add(left.remove());
else
result.add(right.remove());
}
result.addAll(left);
result.addAll(right);
return result;
}
public static void main(String[] args){
System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,1,2,4,5))));
System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,5))));
System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,3,5,6))));
}
}
| package main
import "fmt"
type link struct {
int
next *link
}
func linkInts(s []int) *link {
if len(s) == 0 {
return nil
}
return &link{s[0], linkInts(s[1:])}
}
func (l *link) String() string {
if l == nil {
return "nil"
}
r := fmt.Sprintf("[%d", l.int)
for l = l.next; l != nil; l = l.next {
r = fmt.Sprintf("%s %d", r, l.int)
}
return r + "]"
}
func main() {
a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66})
fmt.Println("before:", a)
b := strandSort(a)
fmt.Println("after: ", b)
}
func strandSort(a *link) (result *link) {
for a != nil {
sublist := a
a = a.next
sTail := sublist
for p, pPrev := a, a; p != nil; p = p.next {
if p.int > sTail.int {
sTail.next = p
sTail = p
if p == a {
a = p.next
} else {
pPrev.next = p.next
}
} else {
pPrev = p
}
}
sTail.next = nil
if result == nil {
result = sublist
continue
}
var m, rr *link
if sublist.int < result.int {
m = sublist
sublist = m.next
rr = result
} else {
m = result
rr = m.next
}
result = m
for {
if sublist == nil {
m.next = rr
break
}
if rr == nil {
m.next = sublist
break
}
if sublist.int < rr.int {
m.next = sublist
m = sublist
sublist = m.next
} else {
m.next = rr
m = rr
rr = m.next
}
}
}
return
}
|
Keep all operations the same but rewrite the snippet in Go. | public class additivePrimes {
public static void main(String[] args) {
int additive_primes = 0;
for (int i = 2; i < 500; i++) {
if(isPrime(i) && isPrime(digitSum(i))){
additive_primes++;
System.out.print(i + " ");
}
}
System.out.print("\nFound " + additive_primes + " additive primes less than 500");
}
static boolean isPrime(int n) {
int counter = 1;
if (n < 2 || (n != 2 && n % 2 == 0) || (n != 3 && n % 3 == 0)) {
return false;
}
while (counter * 6 - 1 <= Math.sqrt(n)) {
if (n % (counter * 6 - 1) == 0 || n % (counter * 6 + 1) == 0) {
return false;
} else {
counter++;
}
}
return true;
}
static int digitSum(int n) {
int sum = 0;
while (n > 0) {
sum += n % 10;
n /= 10;
}
return sum;
}
}
| package main
import "fmt"
func isPrime(n int) bool {
switch {
case n < 2:
return false
case n%2 == 0:
return n == 2
case n%3 == 0:
return n == 3
default:
d := 5
for d*d <= n {
if n%d == 0 {
return false
}
d += 2
if n%d == 0 {
return false
}
d += 4
}
return true
}
}
func sumDigits(n int) int {
sum := 0
for n > 0 {
sum += n % 10
n /= 10
}
return sum
}
func main() {
fmt.Println("Additive primes less than 500:")
i := 2
count := 0
for {
if isPrime(i) && isPrime(sumDigits(i)) {
count++
fmt.Printf("%3d ", i)
if count%10 == 0 {
fmt.Println()
}
}
if i > 2 {
i += 2
} else {
i++
}
if i > 499 {
break
}
}
fmt.Printf("\n\n%d additive primes found.\n", count)
}
|
Rewrite the snippet below in Go so it works the same as the original Java code. | import java.util.ArrayList;
import java.util.List;
public class PerfectTotientNumbers {
public static void main(String[] args) {
computePhi();
int n = 20;
System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n));
}
private static final List<Integer> perfectTotient(int n) {
int test = 2;
List<Integer> results = new ArrayList<Integer>();
for ( int i = 0 ; i < n ; test++ ) {
int phiLoop = test;
int sum = 0;
do {
phiLoop = phi[phiLoop];
sum += phiLoop;
} while ( phiLoop > 1);
if ( sum == test ) {
i++;
results.add(test);
}
}
return results;
}
private static final int max = 100000;
private static final int[] phi = new int[max+1];
private static final void computePhi() {
for ( int i = 1 ; i <= max ; i++ ) {
phi[i] = i;
}
for ( int i = 2 ; i <= max ; i++ ) {
if (phi[i] < i) continue;
for ( int j = i ; j <= max ; j += i ) {
phi[j] -= phi[j] / i;
}
}
}
}
| package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
|
Convert the following code from Java to Go, ensuring the logic remains intact. | import java.util.ArrayList;
import java.util.List;
public class PerfectTotientNumbers {
public static void main(String[] args) {
computePhi();
int n = 20;
System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n));
}
private static final List<Integer> perfectTotient(int n) {
int test = 2;
List<Integer> results = new ArrayList<Integer>();
for ( int i = 0 ; i < n ; test++ ) {
int phiLoop = test;
int sum = 0;
do {
phiLoop = phi[phiLoop];
sum += phiLoop;
} while ( phiLoop > 1);
if ( sum == test ) {
i++;
results.add(test);
}
}
return results;
}
private static final int max = 100000;
private static final int[] phi = new int[max+1];
private static final void computePhi() {
for ( int i = 1 ; i <= max ; i++ ) {
phi[i] = i;
}
for ( int i = 2 ; i <= max ; i++ ) {
if (phi[i] < i) continue;
for ( int j = i ; j <= max ; j += i ) {
phi[j] -= phi[j] / i;
}
}
}
}
| package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
|
Write a version of this Java function in Go with identical behavior. | import java.util.ArrayList;
import java.util.List;
public class PerfectTotientNumbers {
public static void main(String[] args) {
computePhi();
int n = 20;
System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n));
}
private static final List<Integer> perfectTotient(int n) {
int test = 2;
List<Integer> results = new ArrayList<Integer>();
for ( int i = 0 ; i < n ; test++ ) {
int phiLoop = test;
int sum = 0;
do {
phiLoop = phi[phiLoop];
sum += phiLoop;
} while ( phiLoop > 1);
if ( sum == test ) {
i++;
results.add(test);
}
}
return results;
}
private static final int max = 100000;
private static final int[] phi = new int[max+1];
private static final void computePhi() {
for ( int i = 1 ; i <= max ; i++ ) {
phi[i] = i;
}
for ( int i = 2 ; i <= max ; i++ ) {
if (phi[i] < i) continue;
for ( int j = i ; j <= max ; j += i ) {
phi[j] -= phi[j] / i;
}
}
}
}
| package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
|
Maintain the same structure and functionality when rewriting this code in Go. | interface Thingable {
String thing();
}
class Delegator {
public Thingable delegate;
public String operation() {
if (delegate == null)
return "default implementation";
else
return delegate.thing();
}
}
class Delegate implements Thingable {
public String thing() {
return "delegate implementation";
}
}
public class DelegateExample {
public static void main(String[] args) {
Delegator a = new Delegator();
assert a.operation().equals("default implementation");
Delegate d = new Delegate();
a.delegate = d;
assert a.operation().equals("delegate implementation");
a.delegate = new Thingable() {
public String thing() {
return "anonymous delegate implementation";
}
};
assert a.operation().equals("anonymous delegate implementation");
}
}
| package main
import "fmt"
type Delegator struct {
delegate interface{}
}
type Thingable interface {
thing() string
}
func (self Delegator) operation() string {
if v, ok := self.delegate.(Thingable); ok {
return v.thing()
}
return "default implementation"
}
type Delegate int
func (Delegate) thing() string {
return "delegate implementation"
}
func main() {
a := Delegator{}
fmt.Println(a.operation())
a.delegate = "A delegate may be any object"
fmt.Println(a.operation())
var d Delegate
a.delegate = d
fmt.Println(a.operation())
}
|
Maintain the same structure and functionality when rewriting this code in Go. | public class DivisorSum {
private static long divisorSum(long n) {
var total = 1L;
var power = 2L;
for (; (n & 1) == 0; power <<= 1, n >>= 1) {
total += power;
}
for (long p = 3; p * p <= n; p += 2) {
long sum = 1;
for (power = p; n % p == 0; power *= p, n /= p) {
sum += power;
}
total *= sum;
}
if (n > 1) {
total *= n + 1;
}
return total;
}
public static void main(String[] args) {
final long limit = 100;
System.out.printf("Sum of divisors for the first %d positive integers:%n", limit);
for (long n = 1; n <= limit; ++n) {
System.out.printf("%4d", divisorSum(n));
if (n % 10 == 0) {
System.out.println();
}
}
}
}
| package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
|
Can you help me rewrite this code in Go instead of Java, keeping it the same logically? | public class DivisorSum {
private static long divisorSum(long n) {
var total = 1L;
var power = 2L;
for (; (n & 1) == 0; power <<= 1, n >>= 1) {
total += power;
}
for (long p = 3; p * p <= n; p += 2) {
long sum = 1;
for (power = p; n % p == 0; power *= p, n /= p) {
sum += power;
}
total *= sum;
}
if (n > 1) {
total *= n + 1;
}
return total;
}
public static void main(String[] args) {
final long limit = 100;
System.out.printf("Sum of divisors for the first %d positive integers:%n", limit);
for (long n = 1; n <= limit; ++n) {
System.out.printf("%4d", divisorSum(n));
if (n % 10 == 0) {
System.out.println();
}
}
}
}
| package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
|
Maintain the same structure and functionality when rewriting this code in Go. | import java.util.HashMap;
import java.util.Map;
import java.util.Scanner;
public class AbbreviationsEasy {
private static final Scanner input = new Scanner(System.in);
private static final String COMMAND_TABLE
= " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" +
" COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" +
" NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" +
" Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" +
" MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" +
" READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" +
" RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
public static void main(String[] args) {
String[] cmdTableArr = COMMAND_TABLE.split("\\s+");
Map<String, Integer> cmd_table = new HashMap<String, Integer>();
for (String word : cmdTableArr) {
cmd_table.put(word, countCaps(word));
}
System.out.print("Please enter your command to verify: ");
String userInput = input.nextLine();
String[] user_input = userInput.split("\\s+");
for (String s : user_input) {
boolean match = false;
for (String cmd : cmd_table.keySet()) {
if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) {
String temp = cmd.toUpperCase();
if (temp.startsWith(s.toUpperCase())) {
System.out.print(temp + " ");
match = true;
}
}
}
if (!match) {
System.out.print("*error* ");
}
}
}
private static int countCaps(String word) {
int numCaps = 0;
for (int i = 0; i < word.length(); i++) {
if (Character.isUpperCase(word.charAt(i))) {
numCaps++;
}
}
return numCaps;
}
}
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Preserve the algorithm and functionality while converting the code from Java to Go. | import java.util.HashMap;
import java.util.Map;
import java.util.Scanner;
public class AbbreviationsEasy {
private static final Scanner input = new Scanner(System.in);
private static final String COMMAND_TABLE
= " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" +
" COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" +
" NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" +
" Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" +
" MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" +
" READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" +
" RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
public static void main(String[] args) {
String[] cmdTableArr = COMMAND_TABLE.split("\\s+");
Map<String, Integer> cmd_table = new HashMap<String, Integer>();
for (String word : cmdTableArr) {
cmd_table.put(word, countCaps(word));
}
System.out.print("Please enter your command to verify: ");
String userInput = input.nextLine();
String[] user_input = userInput.split("\\s+");
for (String s : user_input) {
boolean match = false;
for (String cmd : cmd_table.keySet()) {
if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) {
String temp = cmd.toUpperCase();
if (temp.startsWith(s.toUpperCase())) {
System.out.print(temp + " ");
match = true;
}
}
}
if (!match) {
System.out.print("*error* ");
}
}
}
private static int countCaps(String word) {
int numCaps = 0;
for (int i = 0; i < word.length(); i++) {
if (Character.isUpperCase(word.charAt(i))) {
numCaps++;
}
}
return numCaps;
}
}
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Produce a language-to-language conversion: from Java to Go, same semantics. | import java.util.HashMap;
import java.util.Map;
import java.util.Scanner;
public class AbbreviationsEasy {
private static final Scanner input = new Scanner(System.in);
private static final String COMMAND_TABLE
= " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" +
" COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" +
" NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" +
" Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" +
" MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" +
" READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" +
" RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
public static void main(String[] args) {
String[] cmdTableArr = COMMAND_TABLE.split("\\s+");
Map<String, Integer> cmd_table = new HashMap<String, Integer>();
for (String word : cmdTableArr) {
cmd_table.put(word, countCaps(word));
}
System.out.print("Please enter your command to verify: ");
String userInput = input.nextLine();
String[] user_input = userInput.split("\\s+");
for (String s : user_input) {
boolean match = false;
for (String cmd : cmd_table.keySet()) {
if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) {
String temp = cmd.toUpperCase();
if (temp.startsWith(s.toUpperCase())) {
System.out.print(temp + " ");
match = true;
}
}
}
if (!match) {
System.out.print("*error* ");
}
}
}
private static int countCaps(String word) {
int numCaps = 0;
for (int i = 0; i < word.length(); i++) {
if (Character.isUpperCase(word.charAt(i))) {
numCaps++;
}
}
return numCaps;
}
}
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Change the following Java code into Go without altering its purpose. | final int immutableInt = 4;
int mutableInt = 4;
mutableInt = 6;
immutableInt = 6;
| package main
func main() {
s := "immutable"
s[0] = 'a'
}
|
Generate an equivalent Go version of this Java code. | import java.awt.*;
import java.awt.geom.Line2D;
import java.util.*;
import java.util.List;
import javax.swing.*;
public class SutherlandHodgman extends JFrame {
SutherlandHodgmanPanel panel;
public static void main(String[] args) {
JFrame f = new SutherlandHodgman();
f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
f.setVisible(true);
}
public SutherlandHodgman() {
Container content = getContentPane();
content.setLayout(new BorderLayout());
panel = new SutherlandHodgmanPanel();
content.add(panel, BorderLayout.CENTER);
setTitle("SutherlandHodgman");
pack();
setLocationRelativeTo(null);
}
}
class SutherlandHodgmanPanel extends JPanel {
List<double[]> subject, clipper, result;
public SutherlandHodgmanPanel() {
setPreferredSize(new Dimension(600, 500));
double[][] subjPoints = {{50, 150}, {200, 50}, {350, 150}, {350, 300},
{250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}};
double[][] clipPoints = {{100, 100}, {300, 100}, {300, 300}, {100, 300}};
subject = new ArrayList<>(Arrays.asList(subjPoints));
result = new ArrayList<>(subject);
clipper = new ArrayList<>(Arrays.asList(clipPoints));
clipPolygon();
}
private void clipPolygon() {
int len = clipper.size();
for (int i = 0; i < len; i++) {
int len2 = result.size();
List<double[]> input = result;
result = new ArrayList<>(len2);
double[] A = clipper.get((i + len - 1) % len);
double[] B = clipper.get(i);
for (int j = 0; j < len2; j++) {
double[] P = input.get((j + len2 - 1) % len2);
double[] Q = input.get(j);
if (isInside(A, B, Q)) {
if (!isInside(A, B, P))
result.add(intersection(A, B, P, Q));
result.add(Q);
} else if (isInside(A, B, P))
result.add(intersection(A, B, P, Q));
}
}
}
private boolean isInside(double[] a, double[] b, double[] c) {
return (a[0] - c[0]) * (b[1] - c[1]) > (a[1] - c[1]) * (b[0] - c[0]);
}
private double[] intersection(double[] a, double[] b, double[] p, double[] q) {
double A1 = b[1] - a[1];
double B1 = a[0] - b[0];
double C1 = A1 * a[0] + B1 * a[1];
double A2 = q[1] - p[1];
double B2 = p[0] - q[0];
double C2 = A2 * p[0] + B2 * p[1];
double det = A1 * B2 - A2 * B1;
double x = (B2 * C1 - B1 * C2) / det;
double y = (A1 * C2 - A2 * C1) / det;
return new double[]{x, y};
}
@Override
public void paintComponent(Graphics g) {
super.paintComponent(g);
Graphics2D g2 = (Graphics2D) g;
g2.translate(80, 60);
g2.setStroke(new BasicStroke(3));
g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
RenderingHints.VALUE_ANTIALIAS_ON);
drawPolygon(g2, subject, Color.blue);
drawPolygon(g2, clipper, Color.red);
drawPolygon(g2, result, Color.green);
}
private void drawPolygon(Graphics2D g2, List<double[]> points, Color color) {
g2.setColor(color);
int len = points.size();
Line2D line = new Line2D.Double();
for (int i = 0; i < len; i++) {
double[] p1 = points.get(i);
double[] p2 = points.get((i + 1) % len);
line.setLine(p1[0], p1[1], p2[0], p2[1]);
g2.draw(line);
}
}
}
| package main
import "fmt"
type point struct {
x, y float32
}
var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300},
{250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}
var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}}
func main() {
var cp1, cp2, s, e point
inside := func(p point) bool {
return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x)
}
intersection := func() (p point) {
dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y
dpx, dpy := s.x-e.x, s.y-e.y
n1 := cp1.x*cp2.y - cp1.y*cp2.x
n2 := s.x*e.y - s.y*e.x
n3 := 1 / (dcx*dpy - dcy*dpx)
p.x = (n1*dpx - n2*dcx) * n3
p.y = (n1*dpy - n2*dcy) * n3
return
}
outputList := subjectPolygon
cp1 = clipPolygon[len(clipPolygon)-1]
for _, cp2 = range clipPolygon {
inputList := outputList
outputList = nil
s = inputList[len(inputList)-1]
for _, e = range inputList {
if inside(e) {
if !inside(s) {
outputList = append(outputList, intersection())
}
outputList = append(outputList, e)
} else if inside(s) {
outputList = append(outputList, intersection())
}
s = e
}
cp1 = cp2
}
fmt.Println(outputList)
}
|
Port the provided Java code into Go while preserving the original functionality. | import java.util.HashMap;
import java.util.Map;
import java.util.Objects;
public class BaconCipher {
private static final Map<Character, String> codes;
static {
codes = new HashMap<>();
codes.putAll(Map.of(
'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA",
'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB"
));
codes.putAll(Map.of(
'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA",
'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB"
));
codes.putAll(Map.of(
'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA",
'z', "BBAAB", ' ', "BBBAA"
));
}
private static String encode(String plainText, String message) {
String pt = plainText.toLowerCase();
StringBuilder sb = new StringBuilder();
for (char c : pt.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append(codes.get(c));
else sb.append(codes.get(' '));
}
String et = sb.toString();
String mg = message.toLowerCase();
sb.setLength(0);
int count = 0;
for (char c : mg.toCharArray()) {
if ('a' <= c && c <= 'z') {
if (et.charAt(count) == 'A') sb.append(c);
else sb.append(((char) (c - 32)));
count++;
if (count == et.length()) break;
} else sb.append(c);
}
return sb.toString();
}
private static String decode(String message) {
StringBuilder sb = new StringBuilder();
for (char c : message.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append('A');
if ('A' <= c && c <= 'Z') sb.append('B');
}
String et = sb.toString();
sb.setLength(0);
for (int i = 0; i < et.length(); i += 5) {
String quintet = et.substring(i, i + 5);
Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null);
sb.append(key);
}
return sb.toString();
}
public static void main(String[] args) {
String plainText = "the quick brown fox jumps over the lazy dog";
String message = "bacon's cipher is a method of steganography created by francis bacon. " +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space.";
String cipherText = encode(plainText, message);
System.out.printf("Cipher text ->\n\n%s\n", cipherText);
String decodedText = decode(cipherText);
System.out.printf("\nHidden text ->\n\n%s\n", decodedText);
}
}
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Change the following Java code into Go without altering its purpose. | import java.util.HashMap;
import java.util.Map;
import java.util.Objects;
public class BaconCipher {
private static final Map<Character, String> codes;
static {
codes = new HashMap<>();
codes.putAll(Map.of(
'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA",
'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB"
));
codes.putAll(Map.of(
'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA",
'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB"
));
codes.putAll(Map.of(
'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA",
'z', "BBAAB", ' ', "BBBAA"
));
}
private static String encode(String plainText, String message) {
String pt = plainText.toLowerCase();
StringBuilder sb = new StringBuilder();
for (char c : pt.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append(codes.get(c));
else sb.append(codes.get(' '));
}
String et = sb.toString();
String mg = message.toLowerCase();
sb.setLength(0);
int count = 0;
for (char c : mg.toCharArray()) {
if ('a' <= c && c <= 'z') {
if (et.charAt(count) == 'A') sb.append(c);
else sb.append(((char) (c - 32)));
count++;
if (count == et.length()) break;
} else sb.append(c);
}
return sb.toString();
}
private static String decode(String message) {
StringBuilder sb = new StringBuilder();
for (char c : message.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append('A');
if ('A' <= c && c <= 'Z') sb.append('B');
}
String et = sb.toString();
sb.setLength(0);
for (int i = 0; i < et.length(); i += 5) {
String quintet = et.substring(i, i + 5);
Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null);
sb.append(key);
}
return sb.toString();
}
public static void main(String[] args) {
String plainText = "the quick brown fox jumps over the lazy dog";
String message = "bacon's cipher is a method of steganography created by francis bacon. " +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space.";
String cipherText = encode(plainText, message);
System.out.printf("Cipher text ->\n\n%s\n", cipherText);
String decodedText = decode(cipherText);
System.out.printf("\nHidden text ->\n\n%s\n", decodedText);
}
}
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Port the provided Java code into Go while preserving the original functionality. | public class Blah {
public static void main(String[] args) {
print2dArray(getSpiralArray(5));
}
public static int[][] getSpiralArray(int dimension) {
int[][] spiralArray = new int[dimension][dimension];
int numConcentricSquares = (int) Math.ceil((dimension) / 2.0);
int j;
int sideLen = dimension;
int currNum = 0;
for (int i = 0; i < numConcentricSquares; i++) {
for (j = 0; j < sideLen; j++) {
spiralArray[i][i + j] = currNum++;
}
for (j = 1; j < sideLen; j++) {
spiralArray[i + j][dimension - 1 - i] = currNum++;
}
for (j = sideLen - 2; j > -1; j--) {
spiralArray[dimension - 1 - i][i + j] = currNum++;
}
for (j = sideLen - 2; j > 0; j--) {
spiralArray[i + j][i] = currNum++;
}
sideLen -= 2;
}
return spiralArray;
}
public static void print2dArray(int[][] array) {
for (int[] row : array) {
for (int elem : row) {
System.out.printf("%3d", elem);
}
System.out.println();
}
}
}
| package main
import (
"fmt"
"strconv"
)
var n = 5
func main() {
if n < 1 {
return
}
top, left, bottom, right := 0, 0, n-1, n-1
sz := n * n
a := make([]int, sz)
i := 0
for left < right {
for c := left; c <= right; c++ {
a[top*n+c] = i
i++
}
top++
for r := top; r <= bottom; r++ {
a[r*n+right] = i
i++
}
right--
if top == bottom {
break
}
for c := right; c >= left; c-- {
a[bottom*n+c] = i
i++
}
bottom--
for r := bottom; r >= top; r-- {
a[r*n+left] = i
i++
}
left++
}
a[top*n+left] = i
w := len(strconv.Itoa(n*n - 1))
for i, e := range a {
fmt.Printf("%*d ", w, e)
if i%n == n-1 {
fmt.Println("")
}
}
}
|
Rewrite this program in Go while keeping its functionality equivalent to the Java version. | module OptionalParameters
{
typedef Type<String >.Orderer as ColumnOrderer;
typedef Type<String[]>.Orderer as RowOrderer;
static String[][] sort(String[][] table,
ColumnOrderer? orderer = Null,
Int column = 0,
Boolean reverse = False,
)
{
orderer ?:= (s1, s2) -> s1 <=> s2;
ColumnOrderer byString = reverse
? ((s1, s2) -> orderer(s1, s2).reversed)
: orderer;
RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]);
return table.sorted(byColumn);
}
void run()
{
String[][] table =
[
["c", "x", "i"],
["a", "y", "p"],
["b", "z", "a"],
];
show("original input", table);
show("by default sort on column 0", sort(table));
show("by column 2", sort(table, column=2));
show("by column 2 reversed", sort(table, column=2, reverse=True));
}
void show(String title, String[][] table)
{
@Inject Console console;
console.print($"{title}:");
for (val row : table)
{
console.print($" {row}");
}
console.print();
}
}
| type cell string
type spec struct {
less func(cell, cell) bool
column int
reverse bool
}
func newSpec() (s spec) {
return
}
t.sort(newSpec())
s := newSpec
s.reverse = true
t.sort(s)
|
Port the provided Java code into Go while preserving the original functionality. | import java.awt.Color;
import java.awt.Graphics;
import java.awt.Graphics2D;
import java.awt.geom.Ellipse2D;
import java.awt.image.BufferedImage;
import java.io.File;
import java.io.IOException;
import java.util.Random;
import javax.imageio.ImageIO;
import javax.swing.JFrame;
public class Voronoi extends JFrame {
static double p = 3;
static BufferedImage I;
static int px[], py[], color[], cells = 100, size = 1000;
public Voronoi() {
super("Voronoi Diagram");
setBounds(0, 0, size, size);
setDefaultCloseOperation(EXIT_ON_CLOSE);
int n = 0;
Random rand = new Random();
I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB);
px = new int[cells];
py = new int[cells];
color = new int[cells];
for (int i = 0; i < cells; i++) {
px[i] = rand.nextInt(size);
py[i] = rand.nextInt(size);
color[i] = rand.nextInt(16777215);
}
for (int x = 0; x < size; x++) {
for (int y = 0; y < size; y++) {
n = 0;
for (byte i = 0; i < cells; i++) {
if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) {
n = i;
}
}
I.setRGB(x, y, color[n]);
}
}
Graphics2D g = I.createGraphics();
g.setColor(Color.BLACK);
for (int i = 0; i < cells; i++) {
g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5));
}
try {
ImageIO.write(I, "png", new File("voronoi.png"));
} catch (IOException e) {
}
}
public void paint(Graphics g) {
g.drawImage(I, 0, 0, this);
}
static double distance(int x1, int x2, int y1, int y2) {
double d;
d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2));
return d;
}
public static void main(String[] args) {
new Voronoi().setVisible(true);
}
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
|
Port the following code from Java to Go with equivalent syntax and logic. | import java.awt.Color;
import java.awt.Graphics;
import java.awt.Graphics2D;
import java.awt.geom.Ellipse2D;
import java.awt.image.BufferedImage;
import java.io.File;
import java.io.IOException;
import java.util.Random;
import javax.imageio.ImageIO;
import javax.swing.JFrame;
public class Voronoi extends JFrame {
static double p = 3;
static BufferedImage I;
static int px[], py[], color[], cells = 100, size = 1000;
public Voronoi() {
super("Voronoi Diagram");
setBounds(0, 0, size, size);
setDefaultCloseOperation(EXIT_ON_CLOSE);
int n = 0;
Random rand = new Random();
I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB);
px = new int[cells];
py = new int[cells];
color = new int[cells];
for (int i = 0; i < cells; i++) {
px[i] = rand.nextInt(size);
py[i] = rand.nextInt(size);
color[i] = rand.nextInt(16777215);
}
for (int x = 0; x < size; x++) {
for (int y = 0; y < size; y++) {
n = 0;
for (byte i = 0; i < cells; i++) {
if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) {
n = i;
}
}
I.setRGB(x, y, color[n]);
}
}
Graphics2D g = I.createGraphics();
g.setColor(Color.BLACK);
for (int i = 0; i < cells; i++) {
g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5));
}
try {
ImageIO.write(I, "png", new File("voronoi.png"));
} catch (IOException e) {
}
}
public void paint(Graphics g) {
g.drawImage(I, 0, 0, this);
}
static double distance(int x1, int x2, int y1, int y2) {
double d;
d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2));
return d;
}
public static void main(String[] args) {
new Voronoi().setVisible(true);
}
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
|
Write the same algorithm in Go as shown in this Java implementation. | import java.awt.Color;
import java.awt.Graphics;
import java.awt.Graphics2D;
import java.awt.geom.Ellipse2D;
import java.awt.image.BufferedImage;
import java.io.File;
import java.io.IOException;
import java.util.Random;
import javax.imageio.ImageIO;
import javax.swing.JFrame;
public class Voronoi extends JFrame {
static double p = 3;
static BufferedImage I;
static int px[], py[], color[], cells = 100, size = 1000;
public Voronoi() {
super("Voronoi Diagram");
setBounds(0, 0, size, size);
setDefaultCloseOperation(EXIT_ON_CLOSE);
int n = 0;
Random rand = new Random();
I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB);
px = new int[cells];
py = new int[cells];
color = new int[cells];
for (int i = 0; i < cells; i++) {
px[i] = rand.nextInt(size);
py[i] = rand.nextInt(size);
color[i] = rand.nextInt(16777215);
}
for (int x = 0; x < size; x++) {
for (int y = 0; y < size; y++) {
n = 0;
for (byte i = 0; i < cells; i++) {
if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) {
n = i;
}
}
I.setRGB(x, y, color[n]);
}
}
Graphics2D g = I.createGraphics();
g.setColor(Color.BLACK);
for (int i = 0; i < cells; i++) {
g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5));
}
try {
ImageIO.write(I, "png", new File("voronoi.png"));
} catch (IOException e) {
}
}
public void paint(Graphics g) {
g.drawImage(I, 0, 0, this);
}
static double distance(int x1, int x2, int y1, int y2) {
double d;
d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2));
return d;
}
public static void main(String[] args) {
new Voronoi().setVisible(true);
}
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
|
Produce a language-to-language conversion: from Java to Go, same semantics. | public class JNIDemo
{
static
{ System.loadLibrary("JNIDemo"); }
public static void main(String[] args)
{
System.out.println(callStrdup("Hello World!"));
}
private static native String callStrdup(String s);
}
| package main
import "C"
import (
"fmt"
"unsafe"
)
func main() {
go1 := "hello C"
c1 := C.CString(go1)
go1 = ""
c2 := C.strdup(c1)
C.free(unsafe.Pointer(c1))
go2 := C.GoString(c2)
C.free(unsafe.Pointer(c2))
fmt.Println(go2)
}
|
Translate the given Java code snippet into Go without altering its behavior. | public class JNIDemo
{
static
{ System.loadLibrary("JNIDemo"); }
public static void main(String[] args)
{
System.out.println(callStrdup("Hello World!"));
}
private static native String callStrdup(String s);
}
| package main
import "C"
import (
"fmt"
"unsafe"
)
func main() {
go1 := "hello C"
c1 := C.CString(go1)
go1 = ""
c2 := C.strdup(c1)
C.free(unsafe.Pointer(c1))
go2 := C.GoString(c2)
C.free(unsafe.Pointer(c2))
fmt.Println(go2)
}
|
Change the programming language of this snippet from Java to Go without modifying what it does. | import java.util.*;
class SOfN<T> {
private static final Random rand = new Random();
private List<T> sample;
private int i = 0;
private int n;
public SOfN(int _n) {
n = _n;
sample = new ArrayList<T>(n);
}
public List<T> process(T item) {
if (++i <= n) {
sample.add(item);
} else if (rand.nextInt(i) < n) {
sample.set(rand.nextInt(n), item);
}
return sample;
}
}
public class AlgorithmS {
public static void main(String[] args) {
int[] bin = new int[10];
for (int trial = 0; trial < 100000; trial++) {
SOfN<Integer> s_of_n = new SOfN<Integer>(3);
for (int i = 0; i < 9; i++) s_of_n.process(i);
for (int s : s_of_n.process(9)) bin[s]++;
}
System.out.println(Arrays.toString(bin));
}
}
| package main
import (
"fmt"
"math/rand"
"time"
)
func sOfNCreator(n int) func(byte) []byte {
s := make([]byte, 0, n)
m := n
return func(item byte) []byte {
if len(s) < n {
s = append(s, item)
} else {
m++
if rand.Intn(m) < n {
s[rand.Intn(n)] = item
}
}
return s
}
}
func main() {
rand.Seed(time.Now().UnixNano())
var freq [10]int
for r := 0; r < 1e5; r++ {
sOfN := sOfNCreator(3)
for d := byte('0'); d < '9'; d++ {
sOfN(d)
}
for _, d := range sOfN('9') {
freq[d-'0']++
}
}
fmt.Println(freq)
}
|
Change the following Java code into Go without altering its purpose. | import java.util.*;
class SOfN<T> {
private static final Random rand = new Random();
private List<T> sample;
private int i = 0;
private int n;
public SOfN(int _n) {
n = _n;
sample = new ArrayList<T>(n);
}
public List<T> process(T item) {
if (++i <= n) {
sample.add(item);
} else if (rand.nextInt(i) < n) {
sample.set(rand.nextInt(n), item);
}
return sample;
}
}
public class AlgorithmS {
public static void main(String[] args) {
int[] bin = new int[10];
for (int trial = 0; trial < 100000; trial++) {
SOfN<Integer> s_of_n = new SOfN<Integer>(3);
for (int i = 0; i < 9; i++) s_of_n.process(i);
for (int s : s_of_n.process(9)) bin[s]++;
}
System.out.println(Arrays.toString(bin));
}
}
| package main
import (
"fmt"
"math/rand"
"time"
)
func sOfNCreator(n int) func(byte) []byte {
s := make([]byte, 0, n)
m := n
return func(item byte) []byte {
if len(s) < n {
s = append(s, item)
} else {
m++
if rand.Intn(m) < n {
s[rand.Intn(n)] = item
}
}
return s
}
}
func main() {
rand.Seed(time.Now().UnixNano())
var freq [10]int
for r := 0; r < 1e5; r++ {
sOfN := sOfNCreator(3)
for d := byte('0'); d < '9'; d++ {
sOfN(d)
}
for _, d := range sOfN('9') {
freq[d-'0']++
}
}
fmt.Println(freq)
}
|
Ensure the translated Go code behaves exactly like the original Java snippet. | import java.math.BigDecimal;
import java.math.MathContext;
import java.util.Arrays;
import java.util.stream.LongStream;
public class FaulhabersTriangle {
private static final MathContext MC = new MathContext(256);
private static long gcd(long a, long b) {
if (b == 0) {
return a;
}
return gcd(b, a % b);
}
private static class Frac implements Comparable<Frac> {
private long num;
private long denom;
public static final Frac ZERO = new Frac(0, 1);
public Frac(long n, long d) {
if (d == 0) throw new IllegalArgumentException("d must not be zero");
long nn = n;
long dd = d;
if (nn == 0) {
dd = 1;
} else if (dd < 0) {
nn = -nn;
dd = -dd;
}
long g = Math.abs(gcd(nn, dd));
if (g > 1) {
nn /= g;
dd /= g;
}
num = nn;
denom = dd;
}
public Frac plus(Frac rhs) {
return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom);
}
public Frac unaryMinus() {
return new Frac(-num, denom);
}
public Frac minus(Frac rhs) {
return this.plus(rhs.unaryMinus());
}
public Frac times(Frac rhs) {
return new Frac(this.num * rhs.num, this.denom * rhs.denom);
}
@Override
public int compareTo(Frac o) {
double diff = toDouble() - o.toDouble();
return Double.compare(diff, 0.0);
}
@Override
public boolean equals(Object obj) {
return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0;
}
@Override
public String toString() {
if (denom == 1) {
return Long.toString(num);
}
return String.format("%d/%d", num, denom);
}
public double toDouble() {
return (double) num / denom;
}
public BigDecimal toBigDecimal() {
return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC);
}
}
private static Frac bernoulli(int n) {
if (n < 0) throw new IllegalArgumentException("n may not be negative or zero");
Frac[] a = new Frac[n + 1];
Arrays.fill(a, Frac.ZERO);
for (int m = 0; m <= n; ++m) {
a[m] = new Frac(1, m + 1);
for (int j = m; j >= 1; --j) {
a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1));
}
}
if (n != 1) return a[0];
return a[0].unaryMinus();
}
private static long binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException();
if (n == 0 || k == 0) return 1;
long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b);
long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i);
return num / den;
}
private static Frac[] faulhaberTriangle(int p) {
Frac[] coeffs = new Frac[p + 1];
Arrays.fill(coeffs, Frac.ZERO);
Frac q = new Frac(1, p + 1);
int sign = -1;
for (int j = 0; j <= p; ++j) {
sign *= -1;
coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j));
}
return coeffs;
}
public static void main(String[] args) {
for (int i = 0; i <= 9; ++i) {
Frac[] coeffs = faulhaberTriangle(i);
for (Frac coeff : coeffs) {
System.out.printf("%5s ", coeff);
}
System.out.println();
}
System.out.println();
int k = 17;
Frac[] cc = faulhaberTriangle(k);
int n = 1000;
BigDecimal nn = BigDecimal.valueOf(n);
BigDecimal np = BigDecimal.ONE;
BigDecimal sum = BigDecimal.ZERO;
for (Frac c : cc) {
np = np.multiply(nn);
sum = sum.add(np.multiply(c.toBigDecimal()));
}
System.out.println(sum.toBigInteger());
}
}
| package main
import (
"fmt"
"math/big"
)
func bernoulli(n uint) *big.Rat {
a := make([]big.Rat, n+1)
z := new(big.Rat)
for m := range a {
a[m].SetFrac64(1, int64(m+1))
for j := m; j >= 1; j-- {
d := &a[j-1]
d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j]))
}
}
if n != 1 {
return &a[0]
}
a[0].Neg(&a[0])
return &a[0]
}
func binomial(n, k int) int64 {
if n <= 0 || k <= 0 || n < k {
return 1
}
var num, den int64 = 1, 1
for i := k + 1; i <= n; i++ {
num *= int64(i)
}
for i := 2; i <= n-k; i++ {
den *= int64(i)
}
return num / den
}
func faulhaberTriangle(p int) []big.Rat {
coeffs := make([]big.Rat, p+1)
q := big.NewRat(1, int64(p)+1)
t := new(big.Rat)
u := new(big.Rat)
sign := -1
for j := range coeffs {
sign *= -1
d := &coeffs[p-j]
t.SetInt64(int64(sign))
u.SetInt64(binomial(p+1, j))
d.Mul(q, t)
d.Mul(d, u)
d.Mul(d, bernoulli(uint(j)))
}
return coeffs
}
func main() {
for i := 0; i < 10; i++ {
coeffs := faulhaberTriangle(i)
for _, coeff := range coeffs {
fmt.Printf("%5s ", coeff.RatString())
}
fmt.Println()
}
fmt.Println()
k := 17
cc := faulhaberTriangle(k)
n := int64(1000)
nn := big.NewRat(n, 1)
np := big.NewRat(1, 1)
sum := new(big.Rat)
tmp := new(big.Rat)
for _, c := range cc {
np.Mul(np, nn)
tmp.Set(np)
tmp.Mul(tmp, &c)
sum.Add(sum, tmp)
}
fmt.Println(sum.RatString())
}
|
Write the same code in Go as shown below in Java. | public class Arguments {
public static void main(String[] args) {
System.out.println("There are " + args.length + " arguments given.");
for(int i = 0; i < args.length; i++)
System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i);
}
}
| package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
|
Convert the following code from Java to Go, ensuring the logic remains intact. | public class Arguments {
public static void main(String[] args) {
System.out.println("There are " + args.length + " arguments given.");
for(int i = 0; i < args.length; i++)
System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i);
}
}
| package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
|
Transform the following Java implementation into Go, maintaining the same output and logic. | String[] fruits = ["apples", "oranges"];
String[] grains = ["wheat", "corn"];
String[] all = fruits + grains;
| package main
import "fmt"
func main() {
a := []int{1, 2, 3}
b := []int{7, 12, 60}
c := append(a, b...)
fmt.Println(c)
i := []interface{}{1, 2, 3}
j := []interface{}{"Crosby", "Stills", "Nash", "Young"}
k := append(i, j...)
fmt.Println(k)
l := [...]int{1, 2, 3}
m := [...]int{7, 12, 60}
var n [len(l) + len(m)]int
copy(n[:], l[:])
copy(n[len(l):], m[:])
fmt.Println(n)
}
|
Produce a language-to-language conversion: from Java to Go, same semantics. | import java.util.Scanner;
public class GetInput {
public static void main(String[] args) throws Exception {
Scanner s = new Scanner(System.in);
System.out.print("Enter a string: ");
String str = s.nextLine();
System.out.print("Enter an integer: ");
int i = Integer.parseInt(s.next());
}
}
| package main
import "fmt"
func main() {
var s string
var i int
if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 {
fmt.Println("good")
} else {
fmt.Println("wrong")
}
}
|
Convert this Java snippet to Go and keep its semantics consistent. |
import processing.sound.*;
float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25};
SinOsc sine;
size(500,500);
sine = new SinOsc(this);
for(int i=0;i<frequencies.length;i++){
sine.freq(frequencies[i]);
sine.play();
delay(500);
}
| package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
|
Write the same algorithm in Go as shown in this Java implementation. |
import processing.sound.*;
float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25};
SinOsc sine;
size(500,500);
sine = new SinOsc(this);
for(int i=0;i<frequencies.length;i++){
sine.freq(frequencies[i]);
sine.play();
delay(500);
}
| package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
|
Convert this Java snippet to Go and keep its semantics consistent. | package hu.pj.alg.test;
import hu.pj.alg.ZeroOneKnapsack;
import hu.pj.obj.Item;
import java.util.*;
import java.text.*;
public class ZeroOneKnapsackForTourists {
public ZeroOneKnapsackForTourists() {
ZeroOneKnapsack zok = new ZeroOneKnapsack(400);
zok.add("map", 9, 150);
zok.add("compass", 13, 35);
zok.add("water", 153, 200);
zok.add("sandwich", 50, 160);
zok.add("glucose", 15, 60);
zok.add("tin", 68, 45);
zok.add("banana", 27, 60);
zok.add("apple", 39, 40);
zok.add("cheese", 23, 30);
zok.add("beer", 52, 10);
zok.add("suntan cream", 11, 70);
zok.add("camera", 32, 30);
zok.add("t-shirt", 24, 15);
zok.add("trousers", 48, 10);
zok.add("umbrella", 73, 40);
zok.add("waterproof trousers", 42, 70);
zok.add("waterproof overclothes", 43, 75);
zok.add("note-case", 22, 80);
zok.add("sunglasses", 7, 20);
zok.add("towel", 18, 12);
zok.add("socks", 4, 50);
zok.add("book", 30, 10);
List<Item> itemList = zok.calcSolution();
if (zok.isCalculated()) {
NumberFormat nf = NumberFormat.getInstance();
System.out.println(
"Maximal weight = " +
nf.format(zok.getMaxWeight() / 100.0) + " kg"
);
System.out.println(
"Total weight of solution = " +
nf.format(zok.getSolutionWeight() / 100.0) + " kg"
);
System.out.println(
"Total value = " +
zok.getProfit()
);
System.out.println();
System.out.println(
"You can carry the following materials " +
"in the knapsack:"
);
for (Item item : itemList) {
if (item.getInKnapsack() == 1) {
System.out.format(
"%1$-23s %2$-3s %3$-5s %4$-15s \n",
item.getName(),
item.getWeight(), "dag ",
"(value = " + item.getValue() + ")"
);
}
}
} else {
System.out.println(
"The problem is not solved. " +
"Maybe you gave wrong data."
);
}
}
public static void main(String[] args) {
new ZeroOneKnapsackForTourists();
}
}
| package main
import "fmt"
type item struct {
string
w, v int
}
var wants = []item{
{"map", 9, 150},
{"compass", 13, 35},
{"water", 153, 200},
{"sandwich", 50, 160},
{"glucose", 15, 60},
{"tin", 68, 45},
{"banana", 27, 60},
{"apple", 39, 40},
{"cheese", 23, 30},
{"beer", 52, 10},
{"suntan cream", 11, 70},
{"camera", 32, 30},
{"T-shirt", 24, 15},
{"trousers", 48, 10},
{"umbrella", 73, 40},
{"waterproof trousers", 42, 70},
{"waterproof overclothes", 43, 75},
{"note-case", 22, 80},
{"sunglasses", 7, 20},
{"towel", 18, 12},
{"socks", 4, 50},
{"book", 30, 10},
}
const maxWt = 400
func main() {
items, w, v := m(len(wants)-1, maxWt)
fmt.Println(items)
fmt.Println("weight:", w)
fmt.Println("value:", v)
}
func m(i, w int) ([]string, int, int) {
if i < 0 || w == 0 {
return nil, 0, 0
} else if wants[i].w > w {
return m(i-1, w)
}
i0, w0, v0 := m(i-1, w)
i1, w1, v1 := m(i-1, w-wants[i].w)
v1 += wants[i].v
if v1 > v0 {
return append(i1, wants[i].string), w1 + wants[i].w, v1
}
return i0, w0, v0
}
|
Transform the following Java implementation into Go, maintaining the same output and logic. | import java.io.*;
import java.util.*;
public class PrimeDescendants {
public static void main(String[] args) {
try (Writer writer = new BufferedWriter(new OutputStreamWriter(System.out))) {
printPrimeDesc(writer, 100);
} catch (IOException ex) {
ex.printStackTrace();
}
}
private static void printPrimeDesc(Writer writer, int limit) throws IOException {
List<Long> primes = findPrimes(limit);
List<Long> ancestor = new ArrayList<>(limit);
List<List<Long>> descendants = new ArrayList<>(limit);
for (int i = 0; i < limit; ++i) {
ancestor.add(Long.valueOf(0));
descendants.add(new ArrayList<Long>());
}
for (Long prime : primes) {
int p = prime.intValue();
descendants.get(p).add(prime);
for (int i = 0; i + p < limit; ++i) {
int s = i + p;
for (Long n : descendants.get(i)) {
Long prod = n * p;
descendants.get(s).add(prod);
if (prod < limit)
ancestor.set(prod.intValue(), Long.valueOf(s));
}
}
}
int totalDescendants = 0;
for (int i = 1; i < limit; ++i) {
List<Long> ancestors = getAncestors(ancestor, i);
writer.write("[" + i + "] Level: " + ancestors.size() + "\n");
writer.write("Ancestors: ");
Collections.sort(ancestors);
print(writer, ancestors);
writer.write("Descendants: ");
List<Long> desc = descendants.get(i);
if (!desc.isEmpty()) {
Collections.sort(desc);
if (desc.get(0) == i)
desc.remove(0);
}
writer.write(desc.size() + "\n");
totalDescendants += desc.size();
if (!desc.isEmpty())
print(writer, desc);
writer.write("\n");
}
writer.write("Total descendants: " + totalDescendants + "\n");
}
private static List<Long> findPrimes(int limit) {
boolean[] isprime = new boolean[limit];
Arrays.fill(isprime, true);
isprime[0] = isprime[1] = false;
for (int p = 2; p * p < limit; ++p) {
if (isprime[p]) {
for (int i = p * p; i < limit; i += p)
isprime[i] = false;
}
}
List<Long> primes = new ArrayList<>();
for (int p = 2; p < limit; ++p) {
if (isprime[p])
primes.add(Long.valueOf(p));
}
return primes;
}
private static List<Long> getAncestors(List<Long> ancestor, int n) {
List<Long> result = new ArrayList<>();
for (Long a = ancestor.get(n); a != 0 && a != n; ) {
n = a.intValue();
a = ancestor.get(n);
result.add(Long.valueOf(n));
}
return result;
}
private static void print(Writer writer, List<Long> list) throws IOException {
if (list.isEmpty()) {
writer.write("none\n");
return;
}
int i = 0;
writer.write(String.valueOf(list.get(i++)));
for (; i != list.size(); ++i)
writer.write(", " + list.get(i));
writer.write("\n");
}
}
| package main
import (
"fmt"
"sort"
)
func getPrimes(max int) []int {
if max < 2 {
return []int{}
}
lprimes := []int{2}
outer:
for x := 3; x <= max; x += 2 {
for _, p := range lprimes {
if x%p == 0 {
continue outer
}
}
lprimes = append(lprimes, x)
}
return lprimes
}
func main() {
const maxSum = 99
descendants := make([][]int64, maxSum+1)
ancestors := make([][]int, maxSum+1)
for i := 0; i <= maxSum; i++ {
descendants[i] = []int64{}
ancestors[i] = []int{}
}
primes := getPrimes(maxSum)
for _, p := range primes {
descendants[p] = append(descendants[p], int64(p))
for s := 1; s < len(descendants)-p; s++ {
temp := make([]int64, len(descendants[s]))
for i := 0; i < len(descendants[s]); i++ {
temp[i] = int64(p) * descendants[s][i]
}
descendants[s+p] = append(descendants[s+p], temp...)
}
}
for _, p := range append(primes, 4) {
le := len(descendants[p])
if le == 0 {
continue
}
descendants[p][le-1] = 0
descendants[p] = descendants[p][:le-1]
}
total := 0
for s := 1; s <= maxSum; s++ {
x := descendants[s]
sort.Slice(x, func(i, j int) bool {
return x[i] < x[j]
})
total += len(descendants[s])
index := 0
for ; index < len(descendants[s]); index++ {
if descendants[s][index] > int64(maxSum) {
break
}
}
for _, d := range descendants[s][:index] {
ancestors[d] = append(ancestors[s], s)
}
if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) {
continue
}
temp := fmt.Sprintf("%v", ancestors[s])
fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp)
le := len(descendants[s])
if le <= 10 {
fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s])
} else {
fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10])
}
}
fmt.Println("\nTotal descendants", total)
}
|
Convert this Java block to Go, preserving its control flow and logic. | import static java.util.Arrays.asList;
import static java.util.Collections.emptyList;
import static java.util.Optional.of;
import static java.util.stream.Collectors.toList;
import java.util.List;
public class CartesianProduct {
public List<?> product(List<?>... a) {
if (a.length >= 2) {
List<?> product = a[0];
for (int i = 1; i < a.length; i++) {
product = product(product, a[i]);
}
return product;
}
return emptyList();
}
private <A, B> List<?> product(List<A> a, List<B> b) {
return of(a.stream()
.map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList()))
.flatMap(List::stream)
.collect(toList())).orElse(emptyList());
}
}
| package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
|
Change the programming language of this snippet from Java to Go without modifying what it does. | import static java.util.Arrays.asList;
import static java.util.Collections.emptyList;
import static java.util.Optional.of;
import static java.util.stream.Collectors.toList;
import java.util.List;
public class CartesianProduct {
public List<?> product(List<?>... a) {
if (a.length >= 2) {
List<?> product = a[0];
for (int i = 1; i < a.length; i++) {
product = product(product, a[i]);
}
return product;
}
return emptyList();
}
private <A, B> List<?> product(List<A> a, List<B> b) {
return of(a.stream()
.map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList()))
.flatMap(List::stream)
.collect(toList())).orElse(emptyList());
}
}
| package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
|
Can you help me rewrite this code in Go instead of Java, keeping it the same logically? | import java.util.ArrayList;
public class FirstClass{
public interface Function<A,B>{
B apply(A x);
}
public static <A,B,C> Function<A, C> compose(
final Function<B, C> f, final Function<A, B> g) {
return new Function<A, C>() {
@Override public C apply(A x) {
return f.apply(g.apply(x));
}
};
}
public static void main(String[] args){
ArrayList<Function<Double, Double>> functions =
new ArrayList<Function<Double,Double>>();
functions.add(
new Function<Double, Double>(){
@Override public Double apply(Double x){
return Math.cos(x);
}
});
functions.add(
new Function<Double, Double>(){
@Override public Double apply(Double x){
return Math.tan(x);
}
});
functions.add(
new Function<Double, Double>(){
@Override public Double apply(Double x){
return x * x;
}
});
ArrayList<Function<Double, Double>> inverse = new ArrayList<Function<Double,Double>>();
inverse.add(
new Function<Double, Double>(){
@Override public Double apply(Double x){
return Math.acos(x);
}
});
inverse.add(
new Function<Double, Double>(){
@Override public Double apply(Double x){
return Math.atan(x);
}
});
inverse.add(
new Function<Double, Double>(){
@Override public Double apply(Double x){
return Math.sqrt(x);
}
});
System.out.println("Compositions:");
for(int i = 0; i < functions.size(); i++){
System.out.println(compose(functions.get(i), inverse.get(i)).apply(0.5));
}
System.out.println("Hard-coded compositions:");
System.out.println(Math.cos(Math.acos(0.5)));
System.out.println(Math.tan(Math.atan(0.5)));
System.out.println(Math.pow(Math.sqrt(0.5), 2));
}
}
| package main
import "math"
import "fmt"
func cube(x float64) float64 { return math.Pow(x, 3) }
type ffType func(float64) float64
func compose(f, g ffType) ffType {
return func(x float64) float64 {
return f(g(x))
}
}
func main() {
funclist := []ffType{math.Sin, math.Cos, cube}
funclisti := []ffType{math.Asin, math.Acos, math.Cbrt}
for i := 0; i < 3; i++ {
fmt.Println(compose(funclisti[i], funclist[i])(.5))
}
}
|
Convert the following code from Java to Go, ensuring the logic remains intact. | import java.util.Collections;
import java.util.LinkedList;
import java.util.List;
public class Proper{
public static List<Integer> properDivs(int n){
List<Integer> divs = new LinkedList<Integer>();
if(n == 1) return divs;
divs.add(1);
for(int x = 2; x < n; x++){
if(n % x == 0) divs.add(x);
}
Collections.sort(divs);
return divs;
}
public static void main(String[] args){
for(int x = 1; x <= 10; x++){
System.out.println(x + ": " + properDivs(x));
}
int x = 0, count = 0;
for(int n = 1; n <= 20000; n++){
if(properDivs(n).size() > count){
x = n;
count = properDivs(n).size();
}
}
System.out.println(x + ": " + count);
}
}
| package main
import (
"fmt"
"strconv"
)
func listProperDivisors(limit int) {
if limit < 1 {
return
}
width := len(strconv.Itoa(limit))
for i := 1; i <= limit; i++ {
fmt.Printf("%*d -> ", width, i)
if i == 1 {
fmt.Println("(None)")
continue
}
for j := 1; j <= i/2; j++ {
if i%j == 0 {
fmt.Printf(" %d", j)
}
}
fmt.Println()
}
}
func countProperDivisors(n int) int {
if n < 2 {
return 0
}
count := 0
for i := 1; i <= n/2; i++ {
if n%i == 0 {
count++
}
}
return count
}
func main() {
fmt.Println("The proper divisors of the following numbers are :\n")
listProperDivisors(10)
fmt.Println()
maxCount := 0
most := []int{1}
for n := 2; n <= 20000; n++ {
count := countProperDivisors(n)
if count == maxCount {
most = append(most, n)
} else if count > maxCount {
maxCount = count
most = most[0:1]
most[0] = n
}
}
fmt.Print("The following number(s) <= 20000 have the most proper divisors, ")
fmt.Println("namely", maxCount, "\b\n")
for _, n := range most {
fmt.Println(n)
}
}
|
Ensure the translated Go code behaves exactly like the original Java snippet. | import java.io.StringWriter;
import javax.xml.parsers.DocumentBuilderFactory;
import javax.xml.transform.Result;
import javax.xml.transform.Source;
import javax.xml.transform.Transformer;
import javax.xml.transform.TransformerFactory;
import javax.xml.transform.dom.DOMSource;
import javax.xml.transform.stream.StreamResult;
import org.w3c.dom.Document;
import org.w3c.dom.Element;
public class XmlCreation {
private static final String[] names = {"April", "Tam O'Shanter", "Emily"};
private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily",
"Burns: \"When chapman billies leave the street ...\"",
"Short & shrift"};
public static void main(String[] args) {
try {
final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument();
final Element root = doc.createElement("CharacterRemarks");
doc.appendChild(root);
for(int i = 0; i < names.length; i++) {
final Element character = doc.createElement("Character");
root.appendChild(character);
character.setAttribute("name", names[i]);
character.appendChild(doc.createTextNode(remarks[i]));
}
final Source source = new DOMSource(doc);
final StringWriter buffer = new StringWriter();
final Result result = new StreamResult(buffer);
final Transformer transformer = TransformerFactory.newInstance().newTransformer();
transformer.setOutputProperty("indent", "yes");
transformer.transform(source, result);
System.out.println(buffer.toString());
} catch (Exception e) {
e.printStackTrace();
}
}
}
| package main
import (
"encoding/xml"
"fmt"
)
func xRemarks(r CharacterRemarks) (string, error) {
b, err := xml.MarshalIndent(r, "", " ")
return string(b), err
}
type CharacterRemarks struct {
Character []crm
}
type crm struct {
Name string `xml:"name,attr"`
Remark string `xml:",chardata"`
}
func main() {
x, err := xRemarks(CharacterRemarks{[]crm{
{`April`, `Bubbly: I'm > Tam and <= Emily`},
{`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`},
{`Emily`, `Short & shrift`},
}})
if err != nil {
x = err.Error()
}
fmt.Println(x)
}
|
Generate an equivalent Go version of this Java code. | import java.awt.*;
import java.awt.event.*;
import java.awt.geom.*;
import javax.swing.JApplet;
import javax.swing.JFrame;
public class Plot2d extends JApplet {
double[] xi;
double[] yi;
public Plot2d(double[] x, double[] y) {
this.xi = x;
this.yi = y;
}
public static double max(double[] t) {
double maximum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] > maximum) {
maximum = t[i];
}
}
return maximum;
}
public static double min(double[] t) {
double minimum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] < minimum) {
minimum = t[i];
}
}
return minimum;
}
public void init() {
setBackground(Color.white);
setForeground(Color.white);
}
public void paint(Graphics g) {
Graphics2D g2 = (Graphics2D) g;
g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
RenderingHints.VALUE_ANTIALIAS_ON);
g2.setPaint(Color.black);
int x0 = 70;
int y0 = 10;
int xm = 670;
int ym = 410;
int xspan = xm - x0;
int yspan = ym - y0;
double xmax = max(xi);
double xmin = min(xi);
double ymax = max(yi);
double ymin = min(yi);
g2.draw(new Line2D.Double(x0, ym, xm, ym));
g2.draw(new Line2D.Double(x0, ym, x0, y0));
for (int j = 0; j < 5; j++) {
int interv = 4;
g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20);
g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)),
ym - j * yspan / interv + y0 - 5);
g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5));
g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0));
}
for (int i = 0; i < xi.length; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
g2.drawString("o", x0 + f - 3, h + 14);
}
for (int i = 0; i < xi.length - 1; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin));
g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0));
}
}
public static void main(String args[]) {
JFrame f = new JFrame("ShapesDemo2D");
f.addWindowListener(new WindowAdapter() {
public void windowClosing(WindowEvent e) {
System.exit(0);
}
});
double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09};
JApplet applet = new Plot2d(r, t);
f.getContentPane().add("Center", applet);
applet.init();
f.pack();
f.setSize(new Dimension(720, 480));
f.show();
}
}
| package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Convert this Java snippet to Go and keep its semantics consistent. | import java.awt.*;
import java.awt.event.*;
import java.awt.geom.*;
import javax.swing.JApplet;
import javax.swing.JFrame;
public class Plot2d extends JApplet {
double[] xi;
double[] yi;
public Plot2d(double[] x, double[] y) {
this.xi = x;
this.yi = y;
}
public static double max(double[] t) {
double maximum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] > maximum) {
maximum = t[i];
}
}
return maximum;
}
public static double min(double[] t) {
double minimum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] < minimum) {
minimum = t[i];
}
}
return minimum;
}
public void init() {
setBackground(Color.white);
setForeground(Color.white);
}
public void paint(Graphics g) {
Graphics2D g2 = (Graphics2D) g;
g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
RenderingHints.VALUE_ANTIALIAS_ON);
g2.setPaint(Color.black);
int x0 = 70;
int y0 = 10;
int xm = 670;
int ym = 410;
int xspan = xm - x0;
int yspan = ym - y0;
double xmax = max(xi);
double xmin = min(xi);
double ymax = max(yi);
double ymin = min(yi);
g2.draw(new Line2D.Double(x0, ym, xm, ym));
g2.draw(new Line2D.Double(x0, ym, x0, y0));
for (int j = 0; j < 5; j++) {
int interv = 4;
g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20);
g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)),
ym - j * yspan / interv + y0 - 5);
g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5));
g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0));
}
for (int i = 0; i < xi.length; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
g2.drawString("o", x0 + f - 3, h + 14);
}
for (int i = 0; i < xi.length - 1; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin));
g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0));
}
}
public static void main(String args[]) {
JFrame f = new JFrame("ShapesDemo2D");
f.addWindowListener(new WindowAdapter() {
public void windowClosing(WindowEvent e) {
System.exit(0);
}
});
double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09};
JApplet applet = new Plot2d(r, t);
f.getContentPane().add("Center", applet);
applet.init();
f.pack();
f.setSize(new Dimension(720, 480));
f.show();
}
}
| package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Rewrite this program in Go while keeping its functionality equivalent to the Java version. | String str = "I am a string";
if (str.matches(".*string")) {
System.out.println("ends with 'string'");
}
| package main
import "fmt"
import "regexp"
func main() {
str := "I am the original string"
matched, _ := regexp.MatchString(".*string$", str)
if matched { fmt.Println("ends with 'string'") }
pattern := regexp.MustCompile("original")
result := pattern.ReplaceAllString(str, "modified")
fmt.Println(result)
}
|
Translate this program into Go but keep the logic exactly as in Java. | import java.util.AbstractList;
import java.util.Collections;
import java.util.Scanner;
public class GuessNumber {
public static final int LOWER = 0, UPPER = 100;
public static void main(String[] args) {
System.out.printf("Instructions:\n" +
"Think of integer number from %d (inclusive) to %d (exclusive) and\n" +
"I will guess it. After each guess, you respond with L, H, or C depending\n" +
"on if my guess was too low, too high, or correct.\n",
LOWER, UPPER);
int result = Collections.binarySearch(new AbstractList<Integer>() {
private final Scanner in = new Scanner(System.in);
public int size() { return UPPER - LOWER; }
public Integer get(int i) {
System.out.printf("My guess is: %d. Is it too high, too low, or correct? (H/L/C) ", LOWER+i);
String s = in.nextLine();
assert s.length() > 0;
switch (Character.toLowerCase(s.charAt(0))) {
case 'l':
return -1;
case 'h':
return 1;
case 'c':
return 0;
}
return -1;
}
}, 0);
if (result < 0)
System.out.println("That is impossible.");
else
System.out.printf("Your number is %d.\n", result);
}
}
| package main
import (
"fmt"
"sort"
)
func main() {
lower, upper := 0, 100
fmt.Printf(`Instructions:
Think of integer number from %d (inclusive) to %d (exclusive) and
I will guess it. After each guess, I will ask you if it is less than
or equal to some number, and you will respond with "yes" or "no".
`, lower, upper)
answer := sort.Search(upper-lower, func (i int) bool {
fmt.Printf("Is your number less than or equal to %d? ", lower+i)
s := ""
fmt.Scanf("%s", &s)
return s != "" && s[0] == 'y'
})
fmt.Printf("Your number is %d.\n", lower+answer)
}
|
Convert the following code from Java to Go, ensuring the logic remains intact. | import java.util.HashMap;
public static void main(String[] args){
String[] keys= {"a", "b", "c"};
int[] vals= {1, 2, 3};
HashMap<String, Integer> hash= new HashMap<String, Integer>();
for(int i= 0; i < keys.length; i++){
hash.put(keys[i], vals[i]);
}
}
| package main
import "fmt"
func main() {
keys := []string{"a", "b", "c"}
vals := []int{1, 2, 3}
hash := map[string]int{}
for i, key := range keys {
hash[key] = vals[i]
}
fmt.Println(hash)
}
|
Translate this program into Go but keep the logic exactly as in Java. | import java.util.Arrays;
import java.util.Collections;
import java.util.List;
public class Bins {
public static <T extends Comparable<? super T>> int[] bins(
List<? extends T> limits, Iterable<? extends T> data) {
int[] result = new int[limits.size() + 1];
for (T n : data) {
int i = Collections.binarySearch(limits, n);
if (i >= 0) {
i = i+1;
} else {
i = ~i;
}
result[i]++;
}
return result;
}
public static void printBins(List<?> limits, int[] bins) {
int n = limits.size();
if (n == 0) {
return;
}
assert n+1 == bins.length;
System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]);
for (int i = 1; i < n; i++) {
System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]);
}
System.out.printf(">= %3s : %2d\n", limits.get(n-1), bins[n]);
}
public static void main(String[] args) {
List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83);
List<Integer> data = Arrays.asList(
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55);
System.out.println("Example 1:");
printBins(limits, bins(limits, data));
limits = Arrays.asList(14, 18, 249, 312, 389,
392, 513, 591, 634, 720);
data = Arrays.asList(
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749);
System.out.println();
System.out.println("Example 2:");
printBins(limits, bins(limits, data));
}
}
| package main
import (
"fmt"
"sort"
)
func getBins(limits, data []int) []int {
n := len(limits)
bins := make([]int, n+1)
for _, d := range data {
index := sort.SearchInts(limits, d)
if index < len(limits) && d == limits[index] {
index++
}
bins[index]++
}
return bins
}
func printBins(limits, bins []int) {
n := len(limits)
fmt.Printf(" < %3d = %2d\n", limits[0], bins[0])
for i := 1; i < n; i++ {
fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i])
}
fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n])
fmt.Println()
}
func main() {
limitsList := [][]int{
{23, 37, 43, 53, 67, 83},
{14, 18, 249, 312, 389, 392, 513, 591, 634, 720},
}
dataList := [][]int{
{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47,
16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55,
},
{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933,
416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306,
655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247,
346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123,
345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97,
854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395,
787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237,
605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791,
466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749,
},
}
for i := 0; i < len(limitsList); i++ {
fmt.Println("Example", i+1, "\b\n")
bins := getBins(limitsList[i], dataList[i])
printBins(limitsList[i], bins)
}
}
|
Maintain the same structure and functionality when rewriting this code in Go. | import java.util.Arrays;
import java.util.Collections;
import java.util.List;
public class Bins {
public static <T extends Comparable<? super T>> int[] bins(
List<? extends T> limits, Iterable<? extends T> data) {
int[] result = new int[limits.size() + 1];
for (T n : data) {
int i = Collections.binarySearch(limits, n);
if (i >= 0) {
i = i+1;
} else {
i = ~i;
}
result[i]++;
}
return result;
}
public static void printBins(List<?> limits, int[] bins) {
int n = limits.size();
if (n == 0) {
return;
}
assert n+1 == bins.length;
System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]);
for (int i = 1; i < n; i++) {
System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]);
}
System.out.printf(">= %3s : %2d\n", limits.get(n-1), bins[n]);
}
public static void main(String[] args) {
List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83);
List<Integer> data = Arrays.asList(
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55);
System.out.println("Example 1:");
printBins(limits, bins(limits, data));
limits = Arrays.asList(14, 18, 249, 312, 389,
392, 513, 591, 634, 720);
data = Arrays.asList(
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749);
System.out.println();
System.out.println("Example 2:");
printBins(limits, bins(limits, data));
}
}
| package main
import (
"fmt"
"sort"
)
func getBins(limits, data []int) []int {
n := len(limits)
bins := make([]int, n+1)
for _, d := range data {
index := sort.SearchInts(limits, d)
if index < len(limits) && d == limits[index] {
index++
}
bins[index]++
}
return bins
}
func printBins(limits, bins []int) {
n := len(limits)
fmt.Printf(" < %3d = %2d\n", limits[0], bins[0])
for i := 1; i < n; i++ {
fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i])
}
fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n])
fmt.Println()
}
func main() {
limitsList := [][]int{
{23, 37, 43, 53, 67, 83},
{14, 18, 249, 312, 389, 392, 513, 591, 634, 720},
}
dataList := [][]int{
{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47,
16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55,
},
{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933,
416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306,
655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247,
346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123,
345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97,
854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395,
787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237,
605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791,
466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749,
},
}
for i := 0; i < len(limitsList); i++ {
fmt.Println("Example", i+1, "\b\n")
bins := getBins(limitsList[i], dataList[i])
printBins(limitsList[i], bins)
}
}
|
Translate the given Java code snippet into Go without altering its behavior. | import java.util.Arrays;
import java.util.Collections;
import java.util.List;
public class Bins {
public static <T extends Comparable<? super T>> int[] bins(
List<? extends T> limits, Iterable<? extends T> data) {
int[] result = new int[limits.size() + 1];
for (T n : data) {
int i = Collections.binarySearch(limits, n);
if (i >= 0) {
i = i+1;
} else {
i = ~i;
}
result[i]++;
}
return result;
}
public static void printBins(List<?> limits, int[] bins) {
int n = limits.size();
if (n == 0) {
return;
}
assert n+1 == bins.length;
System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]);
for (int i = 1; i < n; i++) {
System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]);
}
System.out.printf(">= %3s : %2d\n", limits.get(n-1), bins[n]);
}
public static void main(String[] args) {
List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83);
List<Integer> data = Arrays.asList(
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55);
System.out.println("Example 1:");
printBins(limits, bins(limits, data));
limits = Arrays.asList(14, 18, 249, 312, 389,
392, 513, 591, 634, 720);
data = Arrays.asList(
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749);
System.out.println();
System.out.println("Example 2:");
printBins(limits, bins(limits, data));
}
}
| package main
import (
"fmt"
"sort"
)
func getBins(limits, data []int) []int {
n := len(limits)
bins := make([]int, n+1)
for _, d := range data {
index := sort.SearchInts(limits, d)
if index < len(limits) && d == limits[index] {
index++
}
bins[index]++
}
return bins
}
func printBins(limits, bins []int) {
n := len(limits)
fmt.Printf(" < %3d = %2d\n", limits[0], bins[0])
for i := 1; i < n; i++ {
fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i])
}
fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n])
fmt.Println()
}
func main() {
limitsList := [][]int{
{23, 37, 43, 53, 67, 83},
{14, 18, 249, 312, 389, 392, 513, 591, 634, 720},
}
dataList := [][]int{
{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47,
16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55,
},
{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933,
416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306,
655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247,
346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123,
345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97,
854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395,
787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237,
605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791,
466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749,
},
}
for i := 0; i < len(limitsList); i++ {
fmt.Println("Example", i+1, "\b\n")
bins := getBins(limitsList[i], dataList[i])
printBins(limitsList[i], bins)
}
}
|
Convert this Java snippet to Go and keep its semantics consistent. | import java.awt.Color;
import java.awt.Graphics;
import javax.swing.JFrame;
public class FractalTree extends JFrame {
public FractalTree() {
super("Fractal Tree");
setBounds(100, 100, 800, 600);
setResizable(false);
setDefaultCloseOperation(EXIT_ON_CLOSE);
}
private void drawTree(Graphics g, int x1, int y1, double angle, int depth) {
if (depth == 0) return;
int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0);
int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0);
g.drawLine(x1, y1, x2, y2);
drawTree(g, x2, y2, angle - 20, depth - 1);
drawTree(g, x2, y2, angle + 20, depth - 1);
}
@Override
public void paint(Graphics g) {
g.setColor(Color.BLACK);
drawTree(g, 400, 500, -90, 9);
}
public static void main(String[] args) {
new FractalTree().setVisible(true);
}
}
| package main
import (
"math"
"raster"
)
const (
width = 400
height = 300
depth = 8
angle = 12
length = 50
frac = .8
)
func main() {
g := raster.NewGrmap(width, height)
ftree(g, width/2, height*9/10, length, 0, depth)
g.Bitmap().WritePpmFile("ftree.ppm")
}
func ftree(g *raster.Grmap, x, y, distance, direction float64, depth int) {
x2 := x + distance*math.Sin(direction*math.Pi/180)
y2 := y - distance*math.Cos(direction*math.Pi/180)
g.AaLine(x, y, x2, y2)
if depth > 0 {
ftree(g, x2, y2, distance*frac, direction-angle, depth-1)
ftree(g, x2, y2, distance*frac, direction+angle, depth-1)
}
}
|
Port the provided Java code into Go while preserving the original functionality. | import java.awt.*;
import static java.awt.Color.*;
import javax.swing.*;
public class ColourPinstripeDisplay extends JPanel {
final static Color[] palette = {black, red, green, blue, magenta,cyan,
yellow, white};
final int bands = 4;
public ColourPinstripeDisplay() {
setPreferredSize(new Dimension(900, 600));
}
@Override
public void paintComponent(Graphics g) {
super.paintComponent(g);
int h = getHeight();
for (int b = 1; b <= bands; b++) {
for (int x = 0, colIndex = 0; x < getWidth(); x += b, colIndex++) {
g.setColor(palette[colIndex % palette.length]);
g.fillRect(x, (b - 1) * (h / bands), x + b, b * (h / bands));
}
}
}
public static void main(String[] args) {
SwingUtilities.invokeLater(() -> {
JFrame f = new JFrame();
f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
f.setTitle("ColourPinstripeDisplay");
f.add(new ColourPinstripeDisplay(), BorderLayout.CENTER);
f.pack();
f.setLocationRelativeTo(null);
f.setVisible(true);
});
}
}
| package main
import "github.com/fogleman/gg"
var palette = [8]string{
"000000",
"FF0000",
"00FF00",
"0000FF",
"FF00FF",
"00FFFF",
"FFFF00",
"FFFFFF",
}
func pinstripe(dc *gg.Context) {
w := dc.Width()
h := dc.Height() / 4
for b := 1; b <= 4; b++ {
for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 {
dc.SetHexColor(palette[ci%8])
y := h * (b - 1)
dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h))
dc.Fill()
}
}
}
func main() {
dc := gg.NewContext(900, 600)
pinstripe(dc)
dc.SavePNG("color_pinstripe.png")
}
|
Write a version of this Java function in Go with identical behavior. | class Doom {
public static void main(String[] args) {
final Date[] dates = {
new Date(1800,1,6),
new Date(1875,3,29),
new Date(1915,12,7),
new Date(1970,12,23),
new Date(2043,5,14),
new Date(2077,2,12),
new Date(2101,4,2)
};
for (Date d : dates)
System.out.println(
String.format("%s: %s", d.format(), d.weekday()));
}
}
class Date {
private int year, month, day;
private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5};
private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5};
public static final String[] weekdays = {
"Sunday", "Monday", "Tuesday", "Wednesday",
"Thursday", "Friday", "Saturday"
};
public Date(int year, int month, int day) {
this.year = year;
this.month = month;
this.day = day;
}
public boolean isLeapYear() {
return year%4 == 0 && (year%100 != 0 || year%400 == 0);
}
public String format() {
return String.format("%02d/%02d/%04d", month, day, year);
}
public String weekday() {
final int c = year/100;
final int r = year%100;
final int s = r/12;
final int t = r%12;
final int c_anchor = (5 * (c%4) + 2) % 7;
final int doom = (s + t + t/4 + c_anchor) % 7;
final int anchor =
isLeapYear() ? leapdoom[month-1] : normdoom[month-1];
return weekdays[(doom + day - anchor + 7) % 7];
}
}
| package main
import (
"fmt"
"strconv"
)
var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"}
func anchorDay(y int) int {
return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7
}
func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) }
var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5}
var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5}
func main() {
dates := []string{
"1800-01-06",
"1875-03-29",
"1915-12-07",
"1970-12-23",
"2043-05-14",
"2077-02-12",
"2101-04-02",
}
fmt.Println("Days of week given by Doomsday rule:")
for _, date := range dates {
y, _ := strconv.Atoi(date[0:4])
m, _ := strconv.Atoi(date[5:7])
m--
d, _ := strconv.Atoi(date[8:10])
a := anchorDay(y)
f := firstDaysCommon[m]
if isLeapYear(y) {
f = firstDaysLeap[m]
}
w := d - f
if w < 0 {
w = 7 + w
}
dow := (a + w) % 7
fmt.Printf("%s -> %s\n", date, days[dow])
}
}
|
Keep all operations the same but rewrite the snippet in Go. | class Doom {
public static void main(String[] args) {
final Date[] dates = {
new Date(1800,1,6),
new Date(1875,3,29),
new Date(1915,12,7),
new Date(1970,12,23),
new Date(2043,5,14),
new Date(2077,2,12),
new Date(2101,4,2)
};
for (Date d : dates)
System.out.println(
String.format("%s: %s", d.format(), d.weekday()));
}
}
class Date {
private int year, month, day;
private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5};
private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5};
public static final String[] weekdays = {
"Sunday", "Monday", "Tuesday", "Wednesday",
"Thursday", "Friday", "Saturday"
};
public Date(int year, int month, int day) {
this.year = year;
this.month = month;
this.day = day;
}
public boolean isLeapYear() {
return year%4 == 0 && (year%100 != 0 || year%400 == 0);
}
public String format() {
return String.format("%02d/%02d/%04d", month, day, year);
}
public String weekday() {
final int c = year/100;
final int r = year%100;
final int s = r/12;
final int t = r%12;
final int c_anchor = (5 * (c%4) + 2) % 7;
final int doom = (s + t + t/4 + c_anchor) % 7;
final int anchor =
isLeapYear() ? leapdoom[month-1] : normdoom[month-1];
return weekdays[(doom + day - anchor + 7) % 7];
}
}
| package main
import (
"fmt"
"strconv"
)
var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"}
func anchorDay(y int) int {
return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7
}
func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) }
var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5}
var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5}
func main() {
dates := []string{
"1800-01-06",
"1875-03-29",
"1915-12-07",
"1970-12-23",
"2043-05-14",
"2077-02-12",
"2101-04-02",
}
fmt.Println("Days of week given by Doomsday rule:")
for _, date := range dates {
y, _ := strconv.Atoi(date[0:4])
m, _ := strconv.Atoi(date[5:7])
m--
d, _ := strconv.Atoi(date[8:10])
a := anchorDay(y)
f := firstDaysCommon[m]
if isLeapYear(y) {
f = firstDaysLeap[m]
}
w := d - f
if w < 0 {
w = 7 + w
}
dow := (a + w) % 7
fmt.Printf("%s -> %s\n", date, days[dow])
}
}
|
Convert this Java block to Go, preserving its control flow and logic. | import java.util.*;
public class CocktailSort {
public static void main(String[] args) {
Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 };
System.out.println("before: " + Arrays.toString(array));
cocktailSort(array);
System.out.println("after: " + Arrays.toString(array));
}
public static void cocktailSort(Object[] array) {
int begin = 0;
int end = array.length;
if (end == 0)
return;
for (--end; begin < end; ) {
int new_begin = end;
int new_end = begin;
for (int i = begin; i < end; ++i) {
Comparable c1 = (Comparable)array[i];
Comparable c2 = (Comparable)array[i + 1];
if (c1.compareTo(c2) > 0) {
swap(array, i, i + 1);
new_end = i;
}
}
end = new_end;
for (int i = end; i > begin; --i) {
Comparable c1 = (Comparable)array[i - 1];
Comparable c2 = (Comparable)array[i];
if (c1.compareTo(c2) > 0) {
swap(array, i, i - 1);
new_begin = i;
}
}
begin = new_begin;
}
}
private static void swap(Object[] array, int i, int j) {
Object tmp = array[i];
array[i] = array[j];
array[j] = tmp;
}
}
| package main
import (
"fmt"
"math/rand"
"time"
)
func cocktailShakerSort(a []int) {
var begin = 0
var end = len(a) - 2
for begin <= end {
newBegin := end
newEnd := begin
for i := begin; i <= end; i++ {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newEnd = i
}
}
end = newEnd - 1
for i := end; i >= begin; i-- {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newBegin = i
}
}
begin = newBegin + 1
}
}
func cocktailSort(a []int) {
last := len(a) - 1
for {
swapped := false
for i := 0; i < last; i++ {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
swapped = false
for i := last - 1; i >= 0; i-- {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
}
}
func main() {
a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170}
fmt.Println("Original array:", a)
b := make([]int, len(a))
copy(b, a)
cocktailSort(a)
fmt.Println("Cocktail sort :", a)
cocktailShakerSort(b)
fmt.Println("C/Shaker sort :", b)
rand.Seed(time.Now().UnixNano())
fmt.Println("\nRelative speed of the two sorts")
fmt.Println(" N x faster (CSS v CS)")
fmt.Println("----- -------------------")
const runs = 10
for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} {
sum := 0.0
for i := 1; i <= runs; i++ {
nums := make([]int, n)
for i := 0; i < n; i++ {
rn := rand.Intn(100000)
if i%2 == 1 {
rn = -rn
}
nums[i] = rn
}
nums2 := make([]int, n)
copy(nums2, nums)
start := time.Now()
cocktailSort(nums)
elapsed := time.Since(start)
start2 := time.Now()
cocktailShakerSort(nums2)
elapsed2 := time.Since(start2)
sum += float64(elapsed) / float64(elapsed2)
}
fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs)
}
}
|
Transform the following Java implementation into Go, maintaining the same output and logic. | import java.awt.*;
import javax.swing.*;
public class Pendulum extends JPanel implements Runnable {
private double angle = Math.PI / 2;
private int length;
public Pendulum(int length) {
this.length = length;
setDoubleBuffered(true);
}
@Override
public void paint(Graphics g) {
g.setColor(Color.WHITE);
g.fillRect(0, 0, getWidth(), getHeight());
g.setColor(Color.BLACK);
int anchorX = getWidth() / 2, anchorY = getHeight() / 4;
int ballX = anchorX + (int) (Math.sin(angle) * length);
int ballY = anchorY + (int) (Math.cos(angle) * length);
g.drawLine(anchorX, anchorY, ballX, ballY);
g.fillOval(anchorX - 3, anchorY - 4, 7, 7);
g.fillOval(ballX - 7, ballY - 7, 14, 14);
}
public void run() {
double angleAccel, angleVelocity = 0, dt = 0.1;
while (true) {
angleAccel = -9.81 / length * Math.sin(angle);
angleVelocity += angleAccel * dt;
angle += angleVelocity * dt;
repaint();
try { Thread.sleep(15); } catch (InterruptedException ex) {}
}
}
@Override
public Dimension getPreferredSize() {
return new Dimension(2 * length + 50, length / 2 * 3);
}
public static void main(String[] args) {
JFrame f = new JFrame("Pendulum");
Pendulum p = new Pendulum(200);
f.add(p);
f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
f.pack();
f.setVisible(true);
new Thread(p).start();
}
}
| package main
import (
"github.com/google/gxui"
"github.com/google/gxui/drivers/gl"
"github.com/google/gxui/math"
"github.com/google/gxui/themes/dark"
omath "math"
"time"
)
const (
ANIMATION_WIDTH int = 480
ANIMATION_HEIGHT int = 320
BALL_RADIUS float32 = 25.0
METER_PER_PIXEL float64 = 1.0 / 20.0
PHI_ZERO float64 = omath.Pi * 0.5
)
var (
l float64 = float64(ANIMATION_HEIGHT) * 0.5
freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL))
)
type Pendulum interface {
GetPhi() float64
}
type mathematicalPendulum struct {
start time.Time
}
func (p *mathematicalPendulum) GetPhi() float64 {
if (p.start == time.Time{}) {
p.start = time.Now()
}
t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9)
return PHI_ZERO * omath.Cos(t*freq)
}
type numericalPendulum struct {
currentPhi float64
angAcc float64
angVel float64
lastTime time.Time
}
func (p *numericalPendulum) GetPhi() float64 {
dt := 0.0
if (p.lastTime != time.Time{}) {
dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9)
}
p.lastTime = time.Now()
p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi)
p.angVel += p.angAcc * dt
p.currentPhi += p.angVel * dt
return p.currentPhi
}
func draw(p Pendulum, canvas gxui.Canvas, x, y int) {
attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y}
phi := p.GetPhi()
ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))}
line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}}
canvas.DrawLines(line, gxui.DefaultPen)
m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)}
rect := math.Rect{ball.Sub(m), ball.Add(m)}
canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow))
}
func appMain(driver gxui.Driver) {
theme := dark.CreateTheme(driver)
window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum")
window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50))
image := theme.CreateImage()
ticker := time.NewTicker(time.Millisecond * 15)
pendulum := &mathematicalPendulum{}
pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}}
go func() {
for _ = range ticker.C {
canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT})
canvas.Clear(gxui.White)
draw(pendulum, canvas, 0, 0)
draw(pendulum2, canvas, 0, ANIMATION_HEIGHT)
canvas.Complete()
driver.Call(func() {
image.SetCanvas(canvas)
})
}
}()
window.AddChild(image)
window.OnClose(ticker.Stop)
window.OnClose(driver.Terminate)
}
func main() {
gl.StartDriver(appMain)
}
|
Change the programming language of this snippet from Java to Go without modifying what it does. | public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
| package main
import "fmt"
func enc(b int) int {
return b ^ b>>1
}
func dec(g int) (b int) {
for ; g != 0; g >>= 1 {
b ^= g
}
return
}
func main() {
fmt.Println("decimal binary gray decoded")
for b := 0; b < 32; b++ {
g := enc(b)
d := dec(g)
fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d)
}
}
|
Change the following Java code into Go without altering its purpose. | public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
| package main
import "fmt"
func enc(b int) int {
return b ^ b>>1
}
func dec(g int) (b int) {
for ; g != 0; g >>= 1 {
b ^= g
}
return
}
func main() {
fmt.Println("decimal binary gray decoded")
for b := 0; b < 32; b++ {
g := enc(b)
d := dec(g)
fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d)
}
}
|
Change the following Java code into Go without altering its purpose. | import java.io.IOException;
import java.nio.file.Files;
import java.nio.file.Path;
import java.nio.file.Paths;
import java.util.Collections;
public class CreateFile {
public static void main(String[] args) throws IOException {
String os = System.getProperty("os.name");
if (os.contains("Windows")) {
Path path = Paths.get("tape.file");
Files.write(path, Collections.singletonList("Hello World!"));
} else {
Path path = Paths.get("/dev/tape");
Files.write(path, Collections.singletonList("Hello World!"));
}
}
}
| package main
import (
"archive/tar"
"compress/gzip"
"flag"
"io"
"log"
"os"
"time"
)
func main() {
filename := flag.String("file", "TAPE.FILE", "filename within TAR")
data := flag.String("data", "", "data for file")
outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)")
gzipFlag := flag.Bool("gzip", false, "use gzip compression")
flag.Parse()
var w io.Writer = os.Stdout
if *outfile != "" {
f, err := os.Create(*outfile)
if err != nil {
log.Fatalf("opening/creating %q: %v", *outfile, err)
}
defer f.Close()
w = f
}
if *gzipFlag {
zw := gzip.NewWriter(w)
defer zw.Close()
w = zw
}
tw := tar.NewWriter(w)
defer tw.Close()
w = tw
tw.WriteHeader(&tar.Header{
Name: *filename,
Mode: 0660,
Size: int64(len(*data)),
ModTime: time.Now(),
Typeflag: tar.TypeReg,
Uname: "guest",
Gname: "guest",
})
_, err := w.Write([]byte(*data))
if err != nil {
log.Fatal("writing data:", err)
}
}
|
Produce a language-to-language conversion: from Java to Go, same semantics. | public static void heapSort(int[] a){
int count = a.length;
heapify(a, count);
int end = count - 1;
while(end > 0){
int tmp = a[end];
a[end] = a[0];
a[0] = tmp;
siftDown(a, 0, end - 1);
end--;
}
}
public static void heapify(int[] a, int count){
int start = (count - 2) / 2;
while(start >= 0){
siftDown(a, start, count - 1);
start--;
}
}
public static void siftDown(int[] a, int start, int end){
int root = start;
while((root * 2 + 1) <= end){
int child = root * 2 + 1;
if(child + 1 <= end && a[child] < a[child + 1])
child = child + 1;
if(a[root] < a[child]){
int tmp = a[root];
a[root] = a[child];
a[child] = tmp;
root = child;
}else
return;
}
}
| package main
import (
"sort"
"container/heap"
"fmt"
)
type HeapHelper struct {
container sort.Interface
length int
}
func (self HeapHelper) Len() int { return self.length }
func (self HeapHelper) Less(i, j int) bool { return self.container.Less(j, i) }
func (self HeapHelper) Swap(i, j int) { self.container.Swap(i, j) }
func (self *HeapHelper) Push(x interface{}) { panic("impossible") }
func (self *HeapHelper) Pop() interface{} {
self.length--
return nil
}
func heapSort(a sort.Interface) {
helper := HeapHelper{ a, a.Len() }
heap.Init(&helper)
for helper.length > 0 {
heap.Pop(&helper)
}
}
func main() {
a := []int{170, 45, 75, -90, -802, 24, 2, 66}
fmt.Println("before:", a)
heapSort(sort.IntSlice(a))
fmt.Println("after: ", a)
}
|
Change the programming language of this snippet from Java to Go without modifying what it does. | public enum Pip { Two, Three, Four, Five, Six, Seven,
Eight, Nine, Ten, Jack, Queen, King, Ace }
| package cards
import (
"math/rand"
)
type Suit uint8
const (
Spade Suit = 3
Heart Suit = 2
Diamond Suit = 1
Club Suit = 0
)
func (s Suit) String() string {
const suites = "CDHS"
return suites[s : s+1]
}
type Rank uint8
const (
Ace Rank = 1
Two Rank = 2
Three Rank = 3
Four Rank = 4
Five Rank = 5
Six Rank = 6
Seven Rank = 7
Eight Rank = 8
Nine Rank = 9
Ten Rank = 10
Jack Rank = 11
Queen Rank = 12
King Rank = 13
)
func (r Rank) String() string {
const ranks = "A23456789TJQK"
return ranks[r-1 : r]
}
type Card uint8
func NewCard(r Rank, s Suit) Card {
return Card(13*uint8(s) + uint8(r-1))
}
func (c Card) RankSuit() (Rank, Suit) {
return Rank(c%13 + 1), Suit(c / 13)
}
func (c Card) Rank() Rank {
return Rank(c%13 + 1)
}
func (c Card) Suit() Suit {
return Suit(c / 13)
}
func (c Card) String() string {
return c.Rank().String() + c.Suit().String()
}
type Deck []Card
func NewDeck() Deck {
d := make(Deck, 52)
for i := range d {
d[i] = Card(i)
}
return d
}
func (d Deck) String() string {
s := ""
for i, c := range d {
switch {
case i == 0:
case i%13 == 0:
s += "\n"
default:
s += " "
}
s += c.String()
}
return s
}
func (d Deck) Shuffle() {
for i := range d {
j := rand.Intn(i + 1)
d[i], d[j] = d[j], d[i]
}
}
func (d Deck) Contains(tc Card) bool {
for _, c := range d {
if c == tc {
return true
}
}
return false
}
func (d *Deck) AddDeck(decks ...Deck) {
for _, o := range decks {
*d = append(*d, o...)
}
}
func (d *Deck) AddCard(c Card) {
*d = append(*d, c)
}
func (d *Deck) Draw(n int) Deck {
old := *d
*d = old[n:]
return old[:n:n]
}
func (d *Deck) DrawCard() (Card, bool) {
if len(*d) == 0 {
return 0, false
}
old := *d
*d = old[1:]
return old[0], true
}
func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) {
for i := 0; i < cards; i++ {
for j := range hands {
if len(*d) == 0 {
return hands, false
}
hands[j] = append(hands[j], (*d)[0])
*d = (*d)[1:]
}
}
return hands, true
}
|
Translate the given Java code snippet into Go without altering its behavior. | Int[] literalArray = [1,2,3];
Int[] fixedLengthArray = new Int[10];
Int[] variableArray = new Int[];
assert literalArray.size == 3;
Int n = literalArray[2];
fixedLengthArray[4] = 12345;
fixedLengthArray += 6789;
variableArray += 6789;
| package main
import (
"fmt"
)
func main() {
var a [5]int
fmt.Println("len(a) =", len(a))
fmt.Println("a =", a)
a[0] = 3
fmt.Println("a =", a)
fmt.Println("a[0] =", a[0])
s := a[:4]
fmt.Println("s =", s)
fmt.Println("len(s) =", len(s), " cap(s) =", cap(s))
s = s[:5]
fmt.Println("s =", s)
a[0] = 22
fmt.Println("a =", a)
fmt.Println("s =", s)
s = append(s, 4, 5, 6)
fmt.Println("s =", s)
fmt.Println("len(s) =", len(s), " cap(s) =", cap(s))
a[4] = -1
fmt.Println("a =", a)
fmt.Println("s =", s)
s = make([]int, 8)
fmt.Println("s =", s)
fmt.Println("len(s) =", len(s), " cap(s) =", cap(s))
}
|
Port the following code from Java to Go with equivalent syntax and logic. | public static boolean inCarpet(long x, long y) {
while (x!=0 && y!=0) {
if (x % 3 == 1 && y % 3 == 1)
return false;
x /= 3;
y /= 3;
}
return true;
}
public static void carpet(final int n) {
final double power = Math.pow(3,n);
for(long i = 0; i < power; i++) {
for(long j = 0; j < power; j++) {
System.out.print(inCarpet(i, j) ? "*" : " ");
}
System.out.println();
}
}
| package main
import (
"fmt"
"strings"
"unicode/utf8"
)
var order = 3
var grain = "#"
func main() {
carpet := []string{grain}
for ; order > 0; order-- {
hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0]))
middle := make([]string, len(carpet))
for i, s := range carpet {
middle[i] = s + hole + s
carpet[i] = strings.Repeat(s, 3)
}
carpet = append(append(carpet, middle...), carpet...)
}
for _, r := range carpet {
fmt.Println(r)
}
}
|
Convert this Java block to Go, preserving its control flow and logic. | public class BogoSort
{
public static void main(String[] args)
{
int[] arr={4,5,6,0,7,8,9,1,2,3};
BogoSort now=new BogoSort();
System.out.print("Unsorted: ");
now.display1D(arr);
now.bogo(arr);
System.out.print("Sorted: ");
now.display1D(arr);
}
void bogo(int[] arr)
{
int shuffle=1;
for(;!isSorted(arr);shuffle++)
shuffle(arr);
System.out.println("This took "+shuffle+" shuffles.");
}
void shuffle(int[] arr)
{
int i=arr.length-1;
while(i>0)
swap(arr,i--,(int)(Math.random()*i));
}
void swap(int[] arr,int i,int j)
{
int temp=arr[i];
arr[i]=arr[j];
arr[j]=temp;
}
boolean isSorted(int[] arr)
{
for(int i=1;i<arr.length;i++)
if(arr[i]<arr[i-1])
return false;
return true;
}
void display1D(int[] arr)
{
for(int i=0;i<arr.length;i++)
System.out.print(arr[i]+" ");
System.out.println();
}
}
| package main
import (
"fmt"
"math/rand"
"sort"
"time"
)
func main() {
list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84}
rand.Seed(time.Now().UnixNano())
fmt.Println("unsorted:", list)
temp := make([]int, len(list))
copy(temp, list)
for !sort.IntsAreSorted(temp) {
for i, v := range rand.Perm(len(list)) {
temp[i] = list[v]
}
}
fmt.Println("sorted! ", temp)
}
|
Port the provided Java code into Go while preserving the original functionality. | public class Euler {
private static void euler (Callable f, double y0, int a, int b, int h) {
int t = a;
double y = y0;
while (t < b) {
System.out.println ("" + t + " " + y);
t += h;
y += h * f.compute (t, y);
}
System.out.println ("DONE");
}
public static void main (String[] args) {
Callable cooling = new Cooling ();
int[] steps = {2, 5, 10};
for (int stepSize : steps) {
System.out.println ("Step size: " + stepSize);
euler (cooling, 100.0, 0, 100, stepSize);
}
}
}
interface Callable {
public double compute (int time, double t);
}
class Cooling implements Callable {
public double compute (int time, double t) {
return -0.07 * (t - 20);
}
}
| package main
import (
"fmt"
"math"
)
type fdy func(float64, float64) float64
func eulerStep(f fdy, x, y, h float64) float64 {
return y + h*f(x, y)
}
func newCoolingRate(k float64) func(float64) float64 {
return func(deltaTemp float64) float64 {
return -k * deltaTemp
}
}
func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 {
return func(time float64) float64 {
return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time)
}
}
func newCoolingRateDy(k, ambientTemp float64) fdy {
crf := newCoolingRate(k)
return func(_, objectTemp float64) float64 {
return crf(objectTemp - ambientTemp)
}
}
func main() {
k := .07
tempRoom := 20.
tempObject := 100.
fcr := newCoolingRateDy(k, tempRoom)
analytic := newTempFunc(k, tempRoom, tempObject)
for _, deltaTime := range []float64{2, 5, 10} {
fmt.Printf("Step size = %.1f\n", deltaTime)
fmt.Println(" Time Euler's Analytic")
temp := tempObject
for time := 0.; time <= 100; time += deltaTime {
fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time))
temp = eulerStep(fcr, time, temp, deltaTime)
}
fmt.Println()
}
}
|
Preserve the algorithm and functionality while converting the code from Java to Go. | public class SeqNonSquares {
public static int nonsqr(int n) {
return n + (int)Math.round(Math.sqrt(n));
}
public static void main(String[] args) {
for (int i = 1; i < 23; i++)
System.out.print(nonsqr(i) + " ");
System.out.println();
for (int i = 1; i < 1000000; i++) {
double j = Math.sqrt(nonsqr(i));
assert j != Math.floor(j);
}
}
}
| package main
import (
"fmt"
"math"
)
func remarkable(n int) int {
return n + int(.5+math.Sqrt(float64(n)))
}
func main() {
fmt.Println(" n r(n)")
fmt.Println("--- ---")
for n := 1; n <= 22; n++ {
fmt.Printf("%3d %3d\n", n, remarkable(n))
}
const limit = 1e6
fmt.Println("\nChecking for squares for n <", limit)
next := 2
nextSq := 4
for n := 1; n < limit; n++ {
r := remarkable(n)
switch {
case r == nextSq:
panic(n)
case r > nextSq:
fmt.Println(nextSq, "didn't occur")
next++
nextSq = next * next
}
}
fmt.Println("No squares occur for n <", limit)
}
|
Rewrite the snippet below in Go so it works the same as the original Java code. | public static String Substring(String str, int n, int m){
return str.substring(n, n+m);
}
public static String Substring(String str, int n){
return str.substring(n);
}
public static String Substring(String str){
return str.substring(0, str.length()-1);
}
public static String Substring(String str, char c, int m){
return str.substring(str.indexOf(c), str.indexOf(c)+m+1);
}
public static String Substring(String str, String sub, int m){
return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1);
}
| package main
import (
"fmt"
"strings"
)
func main() {
s := "ABCDEFGH"
n, m := 2, 3
fmt.Println("Index: ", "01234567")
fmt.Println("String:", s)
fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m])
fmt.Printf("Start %d, to end: %s\n", n, s[n:])
fmt.Printf("All but last: %s\n", s[:len(s)-1])
dx := strings.IndexByte(s, 'D')
fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m])
sx := strings.Index(s, "DE")
fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m])
}
|
Change the following Java code into Go without altering its purpose. | public class JortSort {
public static void main(String[] args) {
System.out.println(jortSort(new int[]{1, 2, 3}));
}
static boolean jortSort(int[] arr) {
return true;
}
}
| package main
import (
"log"
"sort"
)
func main() {
log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4}))
log.Println(jortSort([]int{0, 1, 0, 0, 0, 0}))
log.Println(jortSort([]int{1, 2, 4, 11, 22, 22}))
log.Println(jortSort([]int{0, 0, 0, 1, 2, 2}))
}
func jortSort(a []int) bool {
c := make([]int, len(a))
copy(c, a)
sort.Ints(a)
for k, v := range c {
if v == a[k] {
continue
} else {
return false
}
}
return true
}
|
Generate an equivalent Go version of this Java code. | import java.util.GregorianCalendar;
import java.text.MessageFormat;
public class Leapyear{
public static void main(String[] argv){
int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100};
GregorianCalendar cal = new GregorianCalendar();
for(int year : yrs){
System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.",
year, cal.isLeapYear(year), isLeapYear(year)));
}
}
public static boolean isLeapYear(int year){
return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0);
}
}
| func isLeap(year int) bool {
return year%400 == 0 || year%4 == 0 && year%100 != 0
}
|
Can you help me rewrite this code in Go instead of Java, keeping it the same logically? | import java.math.BigInteger;
public class CombinationsAndPermutations {
public static void main(String[] args) {
System.out.println(Double.MAX_VALUE);
System.out.println("A sample of permutations from 1 to 12 with exact Integer arithmetic:");
for ( int n = 1 ; n <= 12 ; n++ ) {
int k = n / 2;
System.out.printf("%d P %d = %s%n", n, k, permutation(n, k));
}
System.out.println();
System.out.println("A sample of combinations from 10 to 60 with exact Integer arithmetic:");
for ( int n = 10 ; n <= 60 ; n += 5 ) {
int k = n / 2;
System.out.printf("%d C %d = %s%n", n, k, combination(n, k));
}
System.out.println();
System.out.println("A sample of permutations from 5 to 15000 displayed in floating point arithmetic:");
System.out.printf("%d P %d = %s%n", 5, 2, display(permutation(5, 2), 50));
for ( int n = 1000 ; n <= 15000 ; n += 1000 ) {
int k = n / 2;
System.out.printf("%d P %d = %s%n", n, k, display(permutation(n, k), 50));
}
System.out.println();
System.out.println("A sample of combinations from 100 to 1000 displayed in floating point arithmetic:");
for ( int n = 100 ; n <= 1000 ; n += 100 ) {
int k = n / 2;
System.out.printf("%d C %d = %s%n", n, k, display(combination(n, k), 50));
}
}
private static String display(BigInteger val, int precision) {
String s = val.toString();
precision = Math.min(precision, s.length());
StringBuilder sb = new StringBuilder();
sb.append(s.substring(0, 1));
sb.append(".");
sb.append(s.substring(1, precision));
sb.append(" * 10^");
sb.append(s.length()-1);
return sb.toString();
}
public static BigInteger combination(int n, int k) {
if ( n-k < k ) {
k = n-k;
}
BigInteger result = permutation(n, k);
while ( k > 0 ) {
result = result.divide(BigInteger.valueOf(k));
k--;
}
return result;
}
public static BigInteger permutation(int n, int k) {
BigInteger result = BigInteger.ONE;
for ( int i = n ; i >= n-k+1 ; i-- ) {
result = result.multiply(BigInteger.valueOf(i));
}
return result;
}
}
| package main
import (
"fmt"
"math/big"
)
func main() {
var n, p int64
fmt.Printf("A sample of permutations from 1 to 12:\n")
for n = 1; n < 13; n++ {
p = n / 3
fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p)))
}
fmt.Printf("\nA sample of combinations from 10 to 60:\n")
for n = 10; n < 61; n += 10 {
p = n / 3
fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p)))
}
fmt.Printf("\nA sample of permutations from 5 to 15000:\n")
nArr := [...]int64{5, 50, 500, 1000, 5000, 15000}
for _, n = range nArr {
p = n / 3
fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p)))
}
fmt.Printf("\nA sample of combinations from 100 to 1000:\n")
for n = 100; n < 1001; n += 100 {
p = n / 3
fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p)))
}
}
func fact(n *big.Int) *big.Int {
if n.Sign() < 1 {
return big.NewInt(0)
}
r := big.NewInt(1)
i := big.NewInt(2)
for i.Cmp(n) < 1 {
r.Mul(r, i)
i.Add(i, big.NewInt(1))
}
return r
}
func perm(n, k *big.Int) *big.Int {
r := fact(n)
r.Div(r, fact(n.Sub(n, k)))
return r
}
func comb(n, r *big.Int) *big.Int {
if r.Cmp(n) == 1 {
return big.NewInt(0)
}
if r.Cmp(n) == 0 {
return big.NewInt(1)
}
c := fact(n)
den := fact(n.Sub(n, r))
den.Mul(den, fact(r))
c.Div(c, den)
return c
}
|
Please provide an equivalent version of this Java code in Go. | import java.util.List;
import java.util.stream.*;
public class LexicographicalNumbers {
static List<Integer> lexOrder(int n) {
int first = 1, last = n;
if (n < 1) {
first = n;
last = 1;
}
return IntStream.rangeClosed(first, last)
.mapToObj(Integer::toString)
.sorted()
.map(Integer::valueOf)
.collect(Collectors.toList());
}
public static void main(String[] args) {
System.out.println("In lexicographical order:\n");
int[] ints = {0, 5, 13, 21, -22};
for (int n : ints) {
System.out.printf("%3d: %s\n", n, lexOrder(n));
}
}
}
| package main
import (
"fmt"
"sort"
"strconv"
)
func lexOrder(n int) []int {
first, last, k := 1, n, n
if n < 1 {
first, last, k = n, 1, 2-n
}
strs := make([]string, k)
for i := first; i <= last; i++ {
strs[i-first] = strconv.Itoa(i)
}
sort.Strings(strs)
ints := make([]int, k)
for i := 0; i < k; i++ {
ints[i], _ = strconv.Atoi(strs[i])
}
return ints
}
func main() {
fmt.Println("In lexicographical order:\n")
for _, n := range []int{0, 5, 13, 21, -22} {
fmt.Printf("%3d: %v\n", n, lexOrder(n))
}
}
|
Rewrite this program in Go while keeping its functionality equivalent to the Java version. | module NumberNames
{
void run()
{
@Inject Console console;
Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000,
123456789000, 0x123456789ABCDEF];
for (Int test : tests)
{
console.print($"{test} = {toEnglish(test)}");
}
}
static String[] digits = ["zero", "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine"];
static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen"];
static String[] tens = ["zero", "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"];
static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion",
"quadrillion", "quintillion"];
static String toEnglish(Int n)
{
StringBuffer buf = new StringBuffer();
if (n < 0)
{
"negative ".appendTo(buf);
n = -n;
}
format3digits(n, buf);
return buf.toString();
}
static void format3digits(Int n, StringBuffer buf, Int nested=0)
{
(Int left, Int right) = n /% 1000;
if (left != 0)
{
format3digits(left, buf, nested+1);
}
if (right != 0 || (left == 0 && nested==0))
{
if (right >= 100)
{
(left, right) = (right /% 100);
digits[left].appendTo(buf);
" hundred ".appendTo(buf);
if (right != 0)
{
format2digits(right, buf);
}
}
else
{
format2digits(right, buf);
}
if (nested > 0)
{
ten3rd[nested].appendTo(buf).add(' ');
}
}
}
static void format2digits(Int n, StringBuffer buf)
{
switch (n)
{
case 0..9:
digits[n].appendTo(buf).add(' ');
break;
case 10..19:
teens[n-10].appendTo(buf).add(' ');
break;
default:
(Int left, Int right) = n /% 10;
tens[left].appendTo(buf);
if (right == 0)
{
buf.add(' ');
}
else
{
buf.add('-');
digits[right].appendTo(buf).add(' ');
}
break;
}
}
}
| package main
import "fmt"
func main() {
for _, n := range []int64{12, 1048576, 9e18, -2, 0} {
fmt.Println(say(n))
}
}
var small = [...]string{"zero", "one", "two", "three", "four", "five", "six",
"seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen",
"fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"}
var tens = [...]string{"", "", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"}
var illions = [...]string{"", " thousand", " million", " billion",
" trillion", " quadrillion", " quintillion"}
func say(n int64) string {
var t string
if n < 0 {
t = "negative "
n = -n
}
switch {
case n < 20:
t += small[n]
case n < 100:
t += tens[n/10]
s := n % 10
if s > 0 {
t += "-" + small[s]
}
case n < 1000:
t += small[n/100] + " hundred"
s := n % 100
if s > 0 {
t += " " + say(s)
}
default:
sx := ""
for i := 0; n > 0; i++ {
p := n % 1000
n /= 1000
if p > 0 {
ix := say(p) + illions[i]
if sx != "" {
ix += " " + sx
}
sx = ix
}
}
t += sx
}
return t
}
|
Transform the following Java implementation into Go, maintaining the same output and logic. | package stringlensort;
import java.io.PrintStream;
import java.util.Arrays;
import java.util.Comparator;
public class ReportStringLengths {
public static void main(String[] args) {
String[] list = {"abcd", "123456789", "abcdef", "1234567"};
String[] strings = args.length > 0 ? args : list;
compareAndReportStringsLength(strings);
}
public static void compareAndReportStringsLength(String[] strings) {
compareAndReportStringsLength(strings, System.out);
}
public static void compareAndReportStringsLength(String[] strings, PrintStream stream) {
if (strings.length > 0) {
strings = strings.clone();
final String QUOTE = "\"";
Arrays.sort(strings, Comparator.comparing(String::length));
int min = strings[0].length();
int max = strings[strings.length - 1].length();
for (int i = strings.length - 1; i >= 0; i--) {
int length = strings[i].length();
String predicate;
if (length == max) {
predicate = "is the longest string";
} else if (length == min) {
predicate = "is the shortest string";
} else {
predicate = "is neither the longest nor the shortest string";
}
stream.println(QUOTE + strings[i] + QUOTE + " has length " + length
+ " and " + predicate);
}
}
}
}
| package main
import (
"fmt"
"os"
"sort"
)
func main() {
if len(os.Args) == 1 {
compareStrings("abcd", "123456789", "abcdef", "1234567")
} else {
strings := os.Args[1:]
compareStrings(strings...)
}
}
func compareStrings(strings ...string) {
sort.SliceStable(strings, func(i, j int) bool {
return len(strings[i]) > len(strings[j])
})
for _, s := range strings {
fmt.Printf("%d: %s\n", len(s), s)
}
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.