query stringclasses 190 values | positive listlengths 1 5 | negative listlengths 4 4 | system stringlengths 69 2.19k |
|---|---|---|---|
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', answer the user's query. |
What is the biomedical concept corresponding to 'man'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Images
Volume 12 Number 24 1984 Nucleic Acids Research
Organization and structure of the mouse interleukin-2 gene
Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi?
Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan
Received 10 October 1984; Revised and Accepted 20 November 1984
ABSTRACT
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', answer the user's query. |
What is the biomedical concept corresponding to 'murine'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mus musculus musculus (eastern european house mouse)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))"
] | Given the context 'Images
Volume 12 Number 24 1984 Nucleic Acids Research
Organization and structure of the mouse interleukin-2 gene
Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi?
Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan
Received 10 October 1984; Revised and Accepted 20 November 1984
ABSTRACT
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', answer the user's query. |
What is the biomedical concept corresponding to 'man'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'We previously reported isolation and sequence analysis of the cDNA for human IL-2 (8), as well as the chromosomal gene (9).', answer the user's query. |
What is the biomedical concept corresponding to 'murine'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mus musculus musculus (eastern european house mouse)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))"
] | Given the context 'More recently, we have isolated a cDNA which encodes murine IL-2 (Kashima et al., submitted for publication). ', answer the user's query. |
What is the biomedical concept corresponding to 'murine'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mus musculus musculus (eastern european house mouse)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))"
] | Given the context 'In order to study the structure of the murine IL-2 chromosomal gene and its controlling region, we isolated and analysed a A phage clone containing the gene and its flanking sequences.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'MATERIALS AND METHODS
Southern blotting of total mouse DNA
Mouse chromosomal DNA was extracted from liver of BALB/c6
?', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'MATERIALS AND METHODS
Southern blotting of total mouse DNA
Mouse chromosomal DNA was extracted from liver of BALB/c6
?', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Nucleic Acids Research
Volume 12 Number 24 1984
9323
Nucleic Acids Research
mouse as described before (10).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Screening of genomic DNA library
A bacteriophage XCharon 4A/mouse genomic DNA library prepared with partial EcoRI digests of mouse DNA from MPC 11 plasmacytoma cells was kindly provided by Dr. T. Honjo.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Screening of genomic DNA library
A bacteriophage XCharon 4A/mouse genomic DNA library prepared with partial EcoRI digests of mouse DNA from MPC 11 plasmacytoma cells was kindly provided by Dr. T. Honjo.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Mouse IL-2-specific clones were screened by the method of Benton and Davis (12), using 700 bp PstI-AccI fragment of a cDNA clone, pMIL2-45 as the probe (Kashima et al., submitted for publication). ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Subcloninq and sequencing of the mouse IL-2 gene
Two EcoRI fragments of 3.3 Kbp and 2.8 Kbp from the positive recombinant X phage were subcloned into EcoRI site of plasmid pBR322. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'RESULTS
Total DNA blotting analysis
In order to study structural organization of the mouse IL-2 gene, we first subjected total mouse DNA to the blotting analysis by using various probes specific for IL-2 gene.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'RESULTS
Total DNA blotting analysis
In order to study structural organization of the mouse IL-2 gene, we first subjected total mouse DNA to the blotting analysis by using various probes specific for IL-2 gene.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Additional bands corresponding to those observed by using mouse IL-2 cDNA probes (lane 13-17) also appeared by longer
9324
Nucleic Acids Research
M 1 2 3 4 M 5 6 7 8 M 9 101112 M 13 141516 17
a~ ~ 3 ..
I pMIL2-45 SacI Acc I
CZI~~1 1t L2- 20
Acc I
1 00', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context '1. Blot hybridization analysis of mouse chromosomal DNA.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'High molecular DNA prepared from Liver BALB/C6 mouse was digested with various restriction endonucleases (BamHI for lanes 1, 5, 9, 13 ; EcoRI for lanes 2, 6, 10, 14, 17 ; HindIII for lanes 3, 7, 11, 15 ; XbaI for lanes 4, 8, 12, 16 ).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Brief restriction endonuclease cleavage map for the mouse IL-2 cDNAs is presented in the lower part of the figure.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'When the PstI insert of a mouse IL-2 cDNA clone, pMIL2-20, was used as the probe, a simple pattern was
9325
Nucleic Acids Research
obtained at higher stringent condition (lane 13-17). ', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The 3.3 kb band was similar in its size with the positive band which became detectable by probing the same DNA with the 7.0 kb human DNA probe (Fig. 1, lane 2).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'BamHI digest of the mouse DNA (Fig. 1, lane 1, 13) constantly gave a very faint signal which would correspond to a DNA larger than 15 kb. ', answer the user's query. |
What is the biomedical concept corresponding to 'murine'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mus musculus musculus (eastern european house mouse)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))"
] | Given the context 'Taken together, the results suggested the presence of a single copy gene for murine IL-2. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'On the other hand appearance of the multiple positive bands at lower stringent washing condition (lane 9-12) indicates the presence of IL-2 related sequences within the mouse genome.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Screening of recombinant phaqe libraries
We next screened a gene library from partial EcoRIdigested DNA from MPC 11 cells and by using 0.8 Kbp SacI-AccI cDNA fragment as the probe and isolated 14 positive clones containing sequences specific to the mouse IL-2 gene.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Restriction map and sequencing strategy of mouse IL-2 gene.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Horizontal lines indicate the length of mouse DNA inserted into the X phage Charon 4A or plasmid subclones. ', answer the user's query. |
What is the biomedical concept corresponding to 'murine'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mus musculus musculus (eastern european house mouse)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))"
] | Given the context 'As seen also in the murine IL-2 cDNA, there is an unusual repeat of CAG triplet coding for 12 glutamine residues in a row in the first exon.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'There are two potential poly (A) addition signals within the mouse gene (nucleotide positions 793 - 798 and 924 - 929 in Fig. 3 ) and, based on our sequence data for various cDNA clones, both signals seem to function and give rise to heterogeneous termini of the mRNA in the LBRM-33 cells (16).
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Nucleotide sequence of mouse IL-2 gene. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'We have isolated recombinant clones for mouse IL-2 gene from a phage Charon 4A/mouse genomic DNA library and determined the entire sequence of the gene except for the sequence of the internal portion of the second and third introns. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'We have isolated recombinant clones for mouse IL-2 gene from a phage Charon 4A/mouse genomic DNA library and determined the entire sequence of the gene except for the sequence of the internal portion of the second and third introns. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'The mouse IL-2 cDNA sequence was aligned with the genomic sequence and both sequences matched completely each other.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context '9329
Nucleic Acids Research
Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context '9329
Nucleic Acids Research
Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', answer the user's query. |
What is the biomedical concept corresponding to 'murine'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mus musculus musculus (eastern european house mouse)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))"
] | Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Since we have not yet determined the nucleotide sequence further upstream of the mouse gene, we do not know whether or not this similarity extends further. ', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Our preliminary results indicate that the 5 '-flanking sequence of the human IL-2 gene mediates mitogen induced expression of the gene in T-lymphocytic cells (Fujita & Taniguchi, unpublished observation).
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'We thank Dr. T. Honjo for mouse gene library. ', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Over two-thirds of human genes are thought to undergo alternative splicing (32).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', answer the user's query. |
What is the biomedical concept corresponding to 'canis familiaris'? | [
"canis familiaris (canis lupus familiaris)",
"canis domesticus (canis lupus familiaris)",
"canis canis (canis lupus familiaris)",
"canis lupus familiaris (dogs (canis lupus familiaris))",
"dog (canis lupus familiaris) (canis lupus familiaris)"
] | [
"canis",
"canis vulpes (vulpes vulpes)",
"canidae (dog, coyote, wolf, fox)",
"canis variabilis (canis lupus variabilis)"
] | Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material).
', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', answer the user's query. |
What is the biomedical concept corresponding to 'saccharomyces cerevisiae'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces cf. cerevisiae",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces hansenii (debaryomyces hansenii)"
] | Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', answer the user's query. |
What is the biomedical concept corresponding to 'saccharomyces cerevisiae'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces cf. cerevisiae",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces hansenii (debaryomyces hansenii)"
] | Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', answer the user's query. |
What is the biomedical concept corresponding to 's.cerevisiae'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces cf. cerevisiae",
"saccharomyces hansenii (debaryomyces hansenii)"
] | Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', answer the user's query. |
What is the biomedical concept corresponding to 'schizosaccharomyces pombe'? | [
"fission yeast (schizosaccharomyces pombe)",
"schizosaccharomyces pombe (schizosaccharomyces malidevorans)"
] | [
"schizosaccharomyces",
"fission yeasts (schizosaccharomycetaceae)",
"schizosaccharomyces sp.",
"zygosaccharomyces"
] | Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118.
', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', answer the user's query. |
What is the biomedical concept corresponding to 'donkey'? | [
"donkey (equus asinus)",
"equus asinus (ass (equus asinus))",
"domestic ass (equus asinus)",
"african ass (equus asinus)",
"ass (equus asinus) (equus asinus)"
] | [
"equus africanus (equus asinus africanus)",
"equus asinus africanus (equus africanus asinus)",
"equus africanus asinus (equus asinus africanus)",
"equus caballus x equus asinus (hybrid of male horse and female donkey)"
] | Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', answer the user's query. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.