query
stringclasses
190 values
positive
listlengths
1
5
negative
listlengths
4
4
system
stringlengths
69
2.19k
What is the biomedical concept corresponding to 'mice'?
[ "mouse (mus musculus)", "mus musculus (house mouse)", "house mouse (mus musculus)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mus musculus musculus (eastern european house mouse)" ]
Given the context 'While the precise mechanisms by which CFTR contributes to this release are not yet known, a role for CFTR in ATP release into subretinal space is consistent with the reduction of certain ERG components in cftr -/- mice [58] and with the ability of apical ATP to activate conductances associated with these ERG components [43].', answer the user's query.
What is the biomedical concept corresponding to 'bovine'?
[ "bovine (bos taurus)", "cow (bos taurus) (bos taurus)", "bos bovis (bos taurus)", "domestic cattle (bos taurus)", "domestic cow (bos taurus)" ]
[ "cattle (bos)", "bos (cattle)", "bovidae", "bos taurus indicus (bos indicus)" ]
Given the context 'Degradation of ATP by the apical membrane of the fresh bovine eyecup and by ARPE-19 cells is inhibited by ARL67156 or βγmATP.', answer the user's query.
What is the biomedical concept corresponding to 'bovine'?
[ "bovine (bos taurus)", "cow (bos taurus) (bos taurus)", "bos bovis (bos taurus)", "domestic cattle (bos taurus)", "domestic cow (bos taurus)" ]
[ "cattle (bos)", "bos (cattle)", "bovidae", "bos taurus indicus (bos indicus)" ]
Given the context 'The production of adenosine from ATP at the apical membrane of the bovine RPE eyecup is inhibited by the ecto-5′-nucleotidase inhibitor αβmADP, confirming a role for this enzyme [63].', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rats (rattus norvegicus) (rattus norvegicus)", "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "norway rat (rattus norvegicus)", "brown rat (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "house rat (rattus rattus)", "mus rattus (rattus rattus)" ]
Given the context 'The enzyme is localized to rat RPE and ARPE-19 cells immunohistochemically.', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rats (rattus norvegicus) (rattus norvegicus)", "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "norway rat (rattus norvegicus)", "brown rat (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "house rat (rattus rattus)", "mus rattus (rattus rattus)" ]
Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "mus musculus (house mouse)", "house mouse (mus musculus)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mus musculus musculus (eastern european house mouse)" ]
Given the context '[63], although localization in mouse indicated larger amounts of ecto-5′-nucleotidase at the tips of adjacent Müller cells', answer the user's query.
What is the biomedical concept corresponding to 'solanum tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum florulentum", "solanum hirtum", "solanum", "solanum acuminatum" ]
Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria ', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'For this purpose, conditions for electroporating isolated potato mitochondria were established.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'arabidopsis thaliana'?
[ "arabidopsis thaliana (mouse-ear cress)", "arabis thaliana (arabidopsis thaliana)", "thale-cress (arabidopsis thaliana)", "mouse-ear cress (arabidopsis thaliana)" ]
[ "arabidopsis thaliana x arabidopsis arenosa", "arabidopsis thaliana x arabidopsis lyrata", "arabidopsis sp.", "arabidopsis thaliana x arabidopsis halleri" ]
Given the context 'In Arabidopsis thaliana 456 C-to-U editing events have been described (6).', answer the user's query.
What is the biomedical concept corresponding to 'a.thaliana'?
[ "arabidopsis thaliana (mouse-ear cress)", "arabis thaliana (arabidopsis thaliana)", "thale-cress (arabidopsis thaliana)" ]
[ "arabidopsis thaliana x arabidopsis lyrata", "arabidopsis thaliana x arabidopsis arenosa", "beana", "arabidopsis sp." ]
Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria. ', answer the user's query.
What is the biomedical concept corresponding to 'sorghum bicolor'?
[ "sorghum bicolor (sorghum bicolor subsp. bicolor)", "sorghum bicolor subsp. bicolor (sorghum bicolor)", "sorghum (sorghum bicolor)", "sorghum vulgare (sorghum bicolor)", "sorghum saccharatum (sorghum bicolor)" ]
[ "common wild sorghum (sorghum arundinaceum)", "sorghum bicolor var. virgatum (sorghum virgatum)", "sorghum grande", "sorghum hybrid cultivar" ]
Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria. ', answer the user's query.
What is the biomedical concept corresponding to 'maize'?
[ "maize (zea mays)", "zea mays (zea mays var. japonica)", "zea mays var. japonica (zea mays)" ]
[ "maize (zea mays subsp. mays)", "corn (zea mays subsp. mays) (zea mays subsp. mays)", "zea mays var. mays (zea mays subsp. mays)", "indian corn (zea mays subsp. mays)" ]
Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria. ', answer the user's query.
What is the biomedical concept corresponding to 'solanum tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum florulentum", "solanum hirtum", "solanum", "solanum acuminatum" ]
Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Using this model, we found that editing and splicing of cox2 transcripts were not linked in wheat mitochondria (15). ', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Five C residues are changed to U in potato mitochondria rps10 transcripts by editing.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'To test this hypothesis, it was necessary to set up the conditions for electroporation of foreign DNA into S.tuberosum mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'In contrast, a rps10 construct is correctly expressed and processed in cognate potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'This is the first report on DNA electroporation into potato mitochondria. MATERIALS AND METHODS Plasmids All plasmids used in this study are based on the previously described pCOXII vector (14).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'An NsiI restriction site was introduced at the initiation codon of the wheat cox2 open reading frame (ORF).', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors. S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', answer the user's query.
What is the biomedical concept corresponding to 'triticum timopheevi'?
[ "triticum timopheevii (triticum timonovum)", "triticum timonovum (triticum timopheevii)", "sanduri wheat (triticum timopheevii)" ]
[ "triticum timopheevii subsp. timopheevii (triticum militinae)", "triticum x timococcum", "triticum militinae (triticum timopheevii subsp. timopheevii)", "triticum urartu" ]
Given the context 'accession no. AF096321, containing the KpnI restriction sequence, and primer B derived from Triticum timopheevi cox2 (AF336134).', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'The complete sequence of the S.tuberosum cox2 was determined (accession no. DQ18064).', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'This 23 bp insertion provides a specific sequence allowing isolation of potato cox2 transcripts originating from the introduced DNA by RT–PCR.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII. ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII. ', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII. ', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'The coding region was isolated from total S.tuberosum DNA by PCR using primers D1 and D2 containing the restriction sites NsiI and SpeI, respectively.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Since all vectors used here were based on pCOXII, they contain the downstream region from the wheat cob gene (Ir-cob) (accession no. AF337547) (14).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'For constructs MA and MAB containing the wheat cox2 C259 editing site, two consecutive insertions were carried out using primers: GGAAGATTGGATTACTATCGAAATTGCCCTGAATCA and TACTATCGAAATTATTCGGACCATGCCCTGAATCA.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'Mitochondria purification S.tuberosum cv.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'The supernatant was centrifuged in a Sorvall SS-34 rotor at 15 000 g for 10 min, the pellet was resuspended in 12 ml of homogenization buffer and mitochondria were purified by centrifugation on a sucrose gradient essentially as described for wheat embryo mitochondria (14). ', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Electroporation Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Electroporation Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'In the case of potato mitochondria the incubation mixture was supplemented with 1 mg/ml of fatty acid-free BSA.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)", "brewer's yeast (saccharomyces ce...
[ "true yeasts (saccharomycotina)", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)", "saccharomyces lactis (kluyveromyces lactis)", "saccharomyces albicans (candida albicans)" ]
Given the context 'One microliter of 20% SDS was added to achieve mitochondrial lysis and the DNA was extracted with phenol/chloroform, precipitated with 0.1 vol of 3 M Sodium Acetate (pH 5.2), 3 vol of 100% ethanol and 100 ng of carrier yeast tRNA and left overnight at −20°C.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'The primers used allowed detection of the transcripts generated by the constructs introduced and excluded any product from endogenous cox2 (or rps10 in the potato system).', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Previously, five C residues, two in exon 1, one in the intron and two in exon 2 have been reported to be changed to U by editing in potato mitochondria (23).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'To determine if the non-cognate transcript could be recognized by the wheat RNA editing machinery, the 1204 bp RT–PCR product was sequenced.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'While wheat cox2 editing sites were correctly edited in control as expected (Figure 1C, only site C77 is shown), all five editable residues in potato rps10 transcript remain unchanged.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'While wheat cox2 editing sites were correctly edited in control as expected (Figure 1C, only site C77 is shown), all five editable residues in potato rps10 transcript remain unchanged.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'cox2 C77 editing sites are identical in potato and wheat. ', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'cox2 C77 editing sites are identical in potato and wheat. ', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Failure of rps10 transcript splicing in wheat mitochondria is not linked to the absence of editing It has been suggested that residues C2 and C3 participate in the secondary structure of the intron necessary for splicing (23).', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'For this purpose, it was necessary to set up an electroporation protocol adapted to S.tuberosum mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Purified organelles were prepared from potato tubers as indicated in Materials and Methods.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'Potato mitochondria show a broad range response with a maximum around 13 kV (Figure 3).', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', answer the user's query.
What is the biomedical concept corresponding to 't.aestivum'?
[ "wheat (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)", "common wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)" ]
[ "triticum aestivum var. aureum", "triticum aethiopicum (triticum turgidum)", "triticum", "english wheat (triticum turgidum)" ]
Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'As shown in Figure 4, the construct containing the wheat or potato promoters was transcribed only in cognate mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'As shown in Figure 4, the construct containing the wheat or potato promoters was transcribed only in cognate mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'In potato, the mature product is barely detectable.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'In contrast to wheat mitochondria, the 821 nt mature transcript was only detected when the electroporated potato mitochondria were incubated in the presence of fatty acid-free BSA. ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'In contrast to wheat mitochondria, the 821 nt mature transcript was only detected when the electroporated potato mitochondria were incubated in the presence of fatty acid-free BSA. ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'A cognate rps10 construct is correctly expressed, edited and processed in potato mitochondria ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'The construct expressing potato rps10 under the control of potato cox2 promoter was introduced into S.tuberosum isolated mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'The construct expressing potato rps10 under the control of potato cox2 promoter was introduced into S.tuberosum isolated mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 's.tuberosum'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)" ]
[ "solanum glutinosum", "solanum hirtum", "solanum esculentum (solanum lycopersicum)", "solanum trifolium" ]
Given the context 'The construct expressing potato rps10 under the control of potato cox2 promoter was introduced into S.tuberosum isolated mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'A cognate editing site in a non-native context is not recognized by wheat mitochondria but is recognized in heterologous mitochondria To test whether wheat mitochondria are able to edit a cognate site when placed in the context of a potato transcript, we introduced the C259 −16/+6 region from wheat cox2 into potato rps10 exon 1 or intron (Figure 6A, construct MA and ME6, respectively).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'A cognate editing site in a non-native context is not recognized by wheat mitochondria but is recognized in heterologous mitochondria To test whether wheat mitochondria are able to edit a cognate site when placed in the context of a potato transcript, we introduced the C259 −16/+6 region from wheat cox2 into potato rps10 exon 1 or intron (Figure 6A, construct MA and ME6, respectively).', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'A cognate editing site in a non-native context is not recognized by wheat mitochondria but is recognized in heterologous mitochondria To test whether wheat mitochondria are able to edit a cognate site when placed in the context of a potato transcript, we introduced the C259 −16/+6 region from wheat cox2 into potato rps10 exon 1 or intron (Figure 6A, construct MA and ME6, respectively).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'A cognate editing site in a non-native context is not recognized by wheat mitochondria but is recognized in heterologous mitochondria To test whether wheat mitochondria are able to edit a cognate site when placed in the context of a potato transcript, we introduced the C259 −16/+6 region from wheat cox2 into potato rps10 exon 1 or intron (Figure 6A, construct MA and ME6, respectively).', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "sweet potato (ipomoea batatas)", "chilean potato-tree (solanum crispum)", "solanum crispum (chilean potato-tree)", "air-potato (dioscorea bulbifera)" ]
Given the context 'A cognate editing site in a non-native context is not recognized by wheat mitochondria but is recognized in heterologous mitochondria To test whether wheat mitochondria are able to edit a cognate site when placed in the context of a potato transcript, we introduced the C259 −16/+6 region from wheat cox2 into potato rps10 exon 1 or intron (Figure 6A, construct MA and ME6, respectively).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'As reported previously, the 23 nt region forming the C259 editing site from wheat cox2 was efficiently edited when grafted into a different context in a wheat transcript (17).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum sativum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum tauschii (aegilops tauschii)", "triticum durum (triticum turgidum subsp. durum)" ]
Given the context 'As reported previously, the 23 nt region forming the C259 editing site from wheat cox2 was efficiently edited when grafted into a different context in a wheat transcript (17).', answer the user's query.