query stringclasses 190 values | positive listlengths 1 5 | negative listlengths 4 4 | system stringlengths 69 2.19k |
|---|---|---|---|
What is the biomedical concept corresponding to 'staphylococcus aureus'? | [
"staphylococcus pyogenes aureus (staphylococcus aureus)",
"micrococcus aureus (staphylococcus aureus)",
"staphylococcus aureus (staphylococcus aureus subsp. anaerobius)",
"micrococcus pyogenes (staphylococcus aureus)"
] | [
"staphylococcus staphylolyticus (staphylococcus simulans bv. staphylolyticus)",
"staphylococcus aureus subsp. aureus col (staphylococcus aureus col)",
"staphylococcus aureus col (staphylococcus aureus subsp. aureus col)",
"staphylococcus sp. s"
] | Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', answer the user's query. |
What is the biomedical concept corresponding to 'drosophila'? | [
"fruit fly (drosophila melanogaster)",
"drosophila melanogaster (sophophora melanogaster)"
] | [
"drosophila (drosophila <flies,genus>)",
"drosophila (drosophila <basidiomycete fungi>)",
"drosophila (drosophila <flies,subgenus>)",
"drosophila <flies,subgenus> (drosophila)"
] | Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', answer the user's query. |
What is the biomedical concept corresponding to 'caenorhabditis elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"caenorhabditis",
"drosophila elegans",
"caenorhabditis sp.",
"elegans subgroup (in: flies)"
] | Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', answer the user's query. |
What is the biomedical concept corresponding to 's.pombe'? | [
"fission yeast (schizosaccharomyces pombe)",
"schizosaccharomyces pombe (schizosaccharomyces malidevorans)"
] | [
"schizosaccharomyces",
"fission yeasts (schizosaccharomycetaceae)",
"zygosaccharomyces",
"schizosaccharomyces sp."
] | Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query. |
What is the biomedical concept corresponding to 'arabidopsis thaliana'? | [
"arabidopsis thaliana (mouse-ear cress)",
"arabis thaliana (arabidopsis thaliana)",
"thale-cress (arabidopsis thaliana)",
"mouse-ear cress (arabidopsis thaliana)"
] | [
"arabidopsis thaliana x arabidopsis arenosa",
"arabidopsis thaliana x arabidopsis lyrata",
"arabidopsis sp.",
"arabidopsis thaliana x arabidopsis halleri"
] | Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query. |
What is the biomedical concept corresponding to 'c.elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query. |
What is the biomedical concept corresponding to 'drosophila melanogaster'? | [
"fruit fly (drosophila melanogaster)",
"drosophila melanogaster (sophophora melanogaster)"
] | [
"drosophila (drosophila <flies,genus>)",
"drosophila (drosophila <basidiomycete fungi>)",
"drosophila <flies,subgenus> (drosophila)",
"drosophila <basidiomycete fungi> (drosophila)"
] | Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query. |
What is the biomedical concept corresponding to 'mouse'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mouse (mus <genus>)",
"mice (mus <genus>) (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown).
', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'DISCUSSION
ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', answer the user's query. |
What is the biomedical concept corresponding to 'yeast'? | [
"saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)",
"saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)",
"baker's yeast (saccharomyces cerevisiae)",
"mycoderma cerevisiae (saccharomyces cerevisiae)",
"brewer's yeast (saccharomyces ce... | [
"true yeasts (saccharomycotina)",
"saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)",
"saccharomyces lactis (kluyveromyces lactis)",
"saccharomyces albicans (candida albicans)"
] | Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines
Abstract
Background
The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Background
CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee.
', answer the user's query. |
What is the biomedical concept corresponding to 'bovine'? | [
"bovine (bos taurus)",
"cow (bos taurus) (bos taurus)",
"bos bovis (bos taurus)",
"domestic cattle (bos taurus)",
"domestic cow (bos taurus)"
] | [
"cattle (bos)",
"bos (cattle)",
"bovidae",
"bos taurus indicus (bos indicus)"
] | Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', answer the user's query. |
What is the biomedical concept corresponding to 'bovine'? | [
"bovine (bos taurus)",
"cow (bos taurus) (bos taurus)",
"bos bovis (bos taurus)",
"domestic cattle (bos taurus)",
"domestic cow (bos taurus)"
] | [
"cattle (bos)",
"bos (cattle)",
"bovidae",
"bos taurus indicus (bos indicus)"
] | Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population
Abstract
Objective
GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Introduction
Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', answer the user's query. |
What is the biomedical concept corresponding to 'women'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"kingdom",
"this",
"humans (homo)",
"genus"
] | Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', answer the user's query. |
What is the biomedical concept corresponding to 'children'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"genus",
"kingdom",
"this",
"humans (homo)"
] | Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', answer the user's query. |
What is the biomedical concept corresponding to 'women'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"kingdom",
"this",
"humans (homo)",
"genus"
] | Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', answer the user's query. |
What is the biomedical concept corresponding to 'participant'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"kingdom",
"suborder"
] | Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', answer the user's query. |
What is the biomedical concept corresponding to 'women'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"kingdom",
"this",
"humans (homo)",
"genus"
] | Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', answer the user's query. |
What is the biomedical concept corresponding to 'women'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"kingdom",
"this",
"humans (homo)",
"genus"
] | Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', answer the user's query. |
What is the biomedical concept corresponding to 'women'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"kingdom",
"this",
"humans (homo)",
"genus"
] | Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'Several sequence changes have been reported in patients with familial or idiopathic short stature,11,26,27 whereas P8, P19, P20 and P25 (at positions 5165, 5681, 5686 and 6358, respectively, in the Genebank accession GI 183148) located in the promoter, intron 2 and intron 4 regions, respectively, had not been previously described.
', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'The populations described to date comprised small numbers of normal-stature individuals,9 male adults with narrow height range12 or growth-retarded patients with/without GHD before achievement of adult height.9,11,12 Our study was designed to characterize the GH1 gene sequence variation in individuals within the whole range of normal adult height (between −2 and +2 SDS) according to the standards for our population.', answer the user's query. |
What is the biomedical concept corresponding to 'patient'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"genus",
"this",
"species"
] | Given the context 'Five single nucleotide changes are located in exon 5; of these five, three predict an amino acid change, and one of the three (Ile179Met) has been described by Lewis et al.27 in a paediatric patient with familial short stature and the other two, as yet undescribed, are contiguous in a single individual (Pro133Hys and Arg134Leu).', answer the user's query. |
What is the biomedical concept corresponding to 'patient'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"genus",
"this",
"species"
] | Given the context 'Analysis of SNP association with adult height was subsequently performed to establish a body of knowledge useful for comparing patient genotypes and phenotypes.', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'A recent study from Giordano et al.34 has shown a twofold reduced luciferase activity for the G nucleotide bearing promoter haplotype in transfected rat pituitary cells.', answer the user's query. |
What is the biomedical concept corresponding to 'patient'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"genus",
"this",
"species"
] | Given the context 'The high density of SNPs and their proximity hamper other genotyping strategies for rapid determination of the complete GH1 SNP map in large control and patient populations.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes
Abstract
Background
The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis.', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'Results
We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'However, alterations in the control of apoptosis have also been shown to contribute to human diseases.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth.', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes
We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice.', answer the user's query. |
What is the biomedical concept corresponding to 'mice'? | [
"mouse (mus musculus)",
"mus musculus (house mouse)",
"house mouse (mus musculus)"
] | [
"mice (mus <genus>) (mus <genus>)",
"mouse (mus <genus>)",
"mus <genus> (mice (mus <genus>))",
"mus musculus musculus (eastern european house mouse)"
] | Given the context 'M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II.', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9).', answer the user's query. |
What is the biomedical concept corresponding to 'rats'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"rat (rattus norvegicus) (rattus norvegicus)",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"rattus (rats (rattus))"
] | Given the context 'Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP
Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington).', answer the user's query. |
What is the biomedical concept corresponding to 'horse'? | [
"horse (equus caballus)",
"equine (equus caballus)",
"domestic horse (equus caballus)",
"equus caballus (equus przewalskii forma caballus)"
] | [
"horses (equidae)",
"equidae (horses)",
"equus subg. equus (equus)",
"eques"
] | Given the context 'The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity.', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template.', answer the user's query. |
What is the biomedical concept corresponding to 'rat'? | [
"rats (rattus norvegicus) (rattus norvegicus)",
"rat (rattus norvegicus) (rattus norvegicus)",
"rattus norvegicus (rats (rattus norvegicus))",
"norway rat (rattus norvegicus)",
"brown rat (rattus norvegicus)"
] | [
"rats (rattus) (rattus)",
"rat (rattus) (rattus)",
"house rat (rattus rattus)",
"mus rattus (rattus rattus)"
] | Given the context 'Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice.', answer the user's query. |
What is the biomedical concept corresponding to 'bovine'? | [
"bovine (bos taurus)",
"cow (bos taurus) (bos taurus)",
"bos bovis (bos taurus)",
"domestic cattle (bos taurus)",
"domestic cow (bos taurus)"
] | [
"cattle (bos)",
"bos (cattle)",
"bovidae",
"bos taurus indicus (bos indicus)"
] | Given the context 'They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context 'Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C.', answer the user's query. |
What is the biomedical concept corresponding to 'patients'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"probles",
"this",
"genus",
"species"
] | Given the context 'For example, Britto and Elliot reported that the loss of abductor pollicis longus and extensor pollicis brevis in their two patients did not show functional compromise of strength and grip strength', answer the user's query. |
What is the biomedical concept corresponding to 'ascaris suum'? | [
"ascaris suum (pig roundworm)",
"pig roundworm (ascaris suum)"
] | [
"ascaris",
"ascaris ovis",
"ascaris lumbricoides (common roundworm)",
"ascaris simplex (anisakis simplex)"
] | Given the context 'Genomic-Bioinformatic Analysis of Transcripts Enriched in the Third-Stage Larva of the Parasitic Nematode Ascaris suum
Abstract
Differential transcription in Ascaris suum was investigated using a genomic-bioinformatic approach.', answer the user's query. |
What is the biomedical concept corresponding to 'ascaris suum'? | [
"ascaris suum (pig roundworm)",
"pig roundworm (ascaris suum)"
] | [
"ascaris",
"ascaris ovis",
"ascaris lumbricoides (common roundworm)",
"ascaris simplex (anisakis simplex)"
] | Given the context 'Genomic-Bioinformatic Analysis of Transcripts Enriched in the Third-Stage Larva of the Parasitic Nematode Ascaris suum
Abstract
Differential transcription in Ascaris suum was investigated using a genomic-bioinformatic approach.', answer the user's query. |
What is the biomedical concept corresponding to 'caenorhabditis elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"caenorhabditis",
"drosophila elegans",
"caenorhabditis sp.",
"elegans subgroup (in: flies)"
] | Given the context 'Of the 91 clusters assembled, 56 molecules (61.5%) had homologues/orthologues in the free-living nematodes Caenorhabditis elegans and C. briggsae and/or other organisms, whereas 35 (38.5%) had no significant similarity to any sequences available in current gene databases.', answer the user's query. |
What is the biomedical concept corresponding to 'c. briggsae'? | [
"rhabditis briggsae (caenorhabditis briggsae)",
"caenorhabditis briggsae (rhabditis briggsae)"
] | [
"pseudochaetosphaeronema briggsiae",
"histiogamphelus briggsii",
"cryptococcus neoformans var. grubii",
"ectopsocus briggsi"
] | Given the context 'Of the 91 clusters assembled, 56 molecules (61.5%) had homologues/orthologues in the free-living nematodes Caenorhabditis elegans and C. briggsae and/or other organisms, whereas 35 (38.5%) had no significant similarity to any sequences available in current gene databases.', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'In silico analyses inferred the C. elegans orthologues/homologues (n = 50) to be involved in apoptosis and insulin signaling (2%), ATP synthesis (2%), carbon metabolism (6%), fatty acid biosynthesis (2%), gap junction (2%), glucose metabolism (6%), or porphyrin metabolism (2%), although 34 (68%) of them could not be mapped to a specific metabolic pathway.', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'Functionally, 17 (34%) of them were predicted to be associated with (non-wild-type) RNAi phenotypes in C. elegans, the majority being embryonic lethality (Emb) (13 types; 58.8%), larval arrest (Lva) (23.5%) and larval lethality (Lvl) (47%).', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'A genetic interaction network was predicted for these 17 C. elegans orthologues, revealing highly significant interactions for nine molecules associated with embryonic and larval development (66.9%), information storage and processing (5.1%), cellular processing and signaling (15.2%), metabolism (6.1%), and unknown function (6.7%).', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'The potential roles of these molecules in development are discussed in relation to the known roles of their homologues/orthologues in C. elegans and some other nematodes.', answer the user's query. |
What is the biomedical concept corresponding to 'people'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"kingdom",
"genus",
"probles"
] | Given the context 'For example, hundreds of millions of people are infected with geohelminths (soil-transmitted worms), such as blood-feeding hookworms Ancylostoma duodenale and/or Necator americanus, Trichuris trichiura and Ascaris spp.', answer the user's query. |
What is the biomedical concept corresponding to 'ancylostoma duodenale'? | [
"ancylostoma duodenale (agchylostoma duodenale)",
"agchylostoma duodenale (ancylostoma duodenale)"
] | [
"ancylostoma caninum (dog hookworm)",
"dog hookworm (ancylostoma caninum)",
"ancylostoma",
"ancylostoma ceylanicum"
] | Given the context 'For example, hundreds of millions of people are infected with geohelminths (soil-transmitted worms), such as blood-feeding hookworms Ancylostoma duodenale and/or Necator americanus, Trichuris trichiura and Ascaris spp.', answer the user's query. |
What is the biomedical concept corresponding to 'necator americanus'? | [
"necator americanus (new world hookworm)",
"new world hookworm (necator americanus)"
] | [
"necator sp.",
"echinothrips americanus",
"entomoscelis americana",
"uromyces americanus"
] | Given the context 'For example, hundreds of millions of people are infected with geohelminths (soil-transmitted worms), such as blood-feeding hookworms Ancylostoma duodenale and/or Necator americanus, Trichuris trichiura and Ascaris spp.', answer the user's query. |
What is the biomedical concept corresponding to 'trichuris trichiura'? | [
"trichuris trichiura (ascaris trichiura)",
"human whipworm (trichuris trichiura)",
"ascaris trichiura (trichuris trichiura)"
] | [
"trichuris",
"trichuris suis (trichocephalus suis)",
"trichuris muris (trichocephalus muris)",
"trichuridae"
] | Given the context 'For example, hundreds of millions of people are infected with geohelminths (soil-transmitted worms), such as blood-feeding hookworms Ancylostoma duodenale and/or Necator americanus, Trichuris trichiura and Ascaris spp.', answer the user's query. |
What is the biomedical concept corresponding to 'human'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"kingdom",
"genus"
] | Given the context '[1], causing serious adverse effects on human health, particularly in children.', answer the user's query. |
What is the biomedical concept corresponding to 'children'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"genus",
"kingdom",
"this",
"humans (homo)"
] | Given the context '[1], causing serious adverse effects on human health, particularly in children.', answer the user's query. |
What is the biomedical concept corresponding to 'pigs'? | [
"pigs (sus scrofa) (sus scrofa)",
"pig (sus scrofa) (sus scrofa)",
"swine (sus scrofa)",
"sus scrofa (pigs (sus scrofa))",
"wild boar (sus scrofa)"
] | [
"pigs (suidae) (suidae)",
"domestic pig (sus scrofa domesticus)",
"suidae (pigs (suidae))",
"sus domestica (sus scrofa domesticus)"
] | Given the context 'Similarly, parasitic nematodes of livestock, such as pigs, also cause substantial economic losses due to subclinical and clinical diseases, with billions of dollars spent annually on the treatment and control of gastro-intestinal nematodes.', answer the user's query. |
What is the biomedical concept corresponding to 'caenorhabditis elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"caenorhabditis",
"drosophila elegans",
"caenorhabditis sp.",
"elegans subgroup (in: flies)"
] | Given the context 'Compared with the free-living nematode Caenorhabditis elegans, there is very little information on fundamental molecular aspects of development in parasitic nematodes [6]–[8].', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'Since the genome sequence of C. elegans was published in 1998 [9], many aspects of the molecular biology of this nematode have been elucidated.', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'For instance, microarray analyses have been used to examine developmental and gender-enriched gene expression [10],[11], and the functions of more than 96% of the C. elegans genes have been assessed by double-stranded RNA interference (RNAi, or gene silencing;', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'Comparative analyses of genetic data sets have shown that parasitic nematodes usually share ∼50–70% of genes with C. elegans (e.g., [19],[20]).', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'There is similarity in other features (such as basic body plan and moulting) between C. elegans and parasitic nematodes, suggesting that some molecular pathways are relatively conserved [8],[21].', answer the user's query. |
What is the biomedical concept corresponding to 'c. elegans'? | [
"caenorhabditis elegans (rhabditis elegans)",
"rhabditis elegans (caenorhabditis elegans)"
] | [
"elegans subgroup (in: flies)",
"caenorhabditis",
"drosophila elegans",
"elegans subgroup (in: mosquitos)"
] | Given the context 'Despite the advances in genomic technologies [7], [22]–[29] and the study of C. elegans, there is a paucity of information on the genomics of parasitic nematodes of animals, particularly in relation to development.', answer the user's query. |
What is the biomedical concept corresponding to 'humans'? | [
"human (homo sapiens)",
"homo sapiens (human)"
] | [
"humans (homo)",
"homo (humans)",
"primate (primates)",
"macrobiotus sapiens"
] | Given the context 'Also considering the major socioeconomic impact of Ascaris and ascariasis in humans and pigs [30]–[32], several characteristics, including the large size of the adult worm (providing the opportunity of investigating individual organ systems and tissues), the ability to maintain Ascaris in the pig, store eggs and culture larvae in vitro for relatively long periods of time (months to years)', answer the user's query. |
What is the biomedical concept corresponding to 'pigs'? | [
"pigs (sus scrofa) (sus scrofa)",
"pig (sus scrofa) (sus scrofa)",
"swine (sus scrofa)",
"sus scrofa (pigs (sus scrofa))",
"wild boar (sus scrofa)"
] | [
"pigs (suidae) (suidae)",
"domestic pig (sus scrofa domesticus)",
"suidae (pigs (suidae))",
"sus domestica (sus scrofa domesticus)"
] | Given the context 'Also considering the major socioeconomic impact of Ascaris and ascariasis in humans and pigs [30]–[32], several characteristics, including the large size of the adult worm (providing the opportunity of investigating individual organ systems and tissues), the ability to maintain Ascaris in the pig, store eggs and culture larvae in vitro for relatively long periods of time (months to years)', answer the user's query. |
What is the biomedical concept corresponding to 'pig'? | [
"pig (sus scrofa) (sus scrofa)",
"pigs (sus scrofa) (sus scrofa)",
"swine (sus scrofa)",
"sus scrofa (pigs (sus scrofa))",
"wild boar (sus scrofa)"
] | [
"domestic pig (sus scrofa domesticus)",
"pigs (suidae) (suidae)",
"suidae (pigs (suidae))",
"sus domestica (sus scrofa domesticus)"
] | Given the context 'Also considering the major socioeconomic impact of Ascaris and ascariasis in humans and pigs [30]–[32], several characteristics, including the large size of the adult worm (providing the opportunity of investigating individual organ systems and tissues), the ability to maintain Ascaris in the pig, store eggs and culture larvae in vitro for relatively long periods of time (months to years)', answer the user's query. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.