instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'A critical phase in the early stages of M. cerebralis infection in trout is invasion and intracellular replication, processes that begin as early as one hour post exposure to triactinomyxons [16].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis]
<Options>: A: encephalus
B: falco tinnunculus interstinctus (falco interstinctus) (aka falco tinnunculus interstinctus)
C: somniosus
D: distremocephalus
E: glomus cerebriforme
F: None of the above. | [F] |
<Instruct>: Given the context 'A role for accumulated ubiquinated proteins in the lysosome in the killing of Mycobacterium tuberculosis has recently been described that has implications for a range of intracellular infections [58] and some similar responses to infection may be occurring for both resistant and susceptible strains.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mycobacterium tuberculosis]
<Options>: A: mycobacterium tuberculosis complex bacterium (aka mycobacterium tuberculosis complex sp.)
B: mycobacterium tuberculosis var. bovis (aka mycobacterium tuberculosis variant bovis)
C: mycobacterium tuberculosis subsp. tuberculosis
D: mycobacterium tuberculosis (zopf 1883) lehmann and neumann 1896 (approved lists 1980) (aka mycobacterium tuberculosis)
E: mycobacterium tuberculosis complex (mycobacterium complex) (aka mycobacterium tuberculosis complex)
F: None of the above. | [D] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: paraglomus
B: cranidium
C: river trout (aka salmo trutta fario)
D: neurocallis
E: cerebratulus
F: salmo gilae gilae (aka oncorhynchus gilae gilae)
G: trouts, salmons & chars (aka salmoninae)
H: salmo keta (aka oncorhynchus keta)
I: salmo mykiss (aka oncorhynchus mykiss)
J: encephalartos
K: None of the above. | [K; I] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
B: golden trout (aka oncorhynchus mykiss aguabonita)
C: cerebratulus
D: mesopsocus
E: glomus cerebriforme
F: trouts, salmons & chars (aka salmoninae)
G: black sea salmon (aka salmo labrax)
H: gyrothrix encephalarti
I: salmons and trouts (aka salmoniformes)
J: striatula
K: None of the above. | [K; A] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: black sea salmon (aka salmo labrax)
B: salmons and trouts (aka salmoniformes)
C: golden trout (aka oncorhynchus mykiss aguabonita)
D: glomus cerebriforme
E: striatula
F: mesopsocus
G: trouts, salmons & chars (aka salmoninae)
H: cerebratulus
I: gyrothrix encephalarti
J: None of the above. | [J; J] |
<Instruct>: Given the context 'A role for host immune factors in the elimination of invading parasites, even in susceptible rainbow trout strains, is suggested by several prior light and electron microscopy studies that demonstrate an increase in degenerative stages in the skin beginning as early as 12 h and then their elimination by 24 h post-exposure to triactinomyxons [12,16,63].
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: trouts, salmons & chars (aka salmoninae)
B: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
C: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
D: river trout (aka salmo trutta fario)
E: salmon trout (aka oncorhynchus masou)
F: None of the above. | [B] |
<Instruct>: Given the context 'For instance, metallothionein's role as a zinc-finger transcriptional regulator [64] may dramatically alter the expression profiles between resistant and susceptible rainbow trout.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: river trout (aka salmo trutta)
B: black sea salmon (aka salmo labrax)
C: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
D: gila trout (aka oncorhynchus gilae)
E: golden trout (aka oncorhynchus mykiss aguabonita)
F: None of the above. | [C] |
<Instruct>: Given the context 'Given the high degree of statistical support and biological relevance of the candidate genes, we believe this study provides initial insight into rainbow trout genes and pathways responding to whirling disease infection and identifies the first candidate genes for whirling disease resistance.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: japanese salmon (aka oncorhynchus masou)
B: rainbow trout (aka oncorhynchus mykiss)
C: salmo keta (aka oncorhynchus keta)
D: salmo gilae gilae (aka oncorhynchus gilae gilae)
E: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
F: None of the above. | [B] |
<Instruct>: Given the context 'For instance, metallothionein's role as a zinc-finger transcriptional regulator [64] may dramatically alter the expression profiles between resistant and susceptible rainbow trout.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: golden trout (aka oncorhynchus mykiss aguabonita)
B: salmons and trouts (aka salmoniformes)
C: rainbow trout (aka oncorhynchus mykiss)
D: salmon trout (aka oncorhynchus masou)
E: trouts, salmons & chars (aka salmoninae)
F: None of the above. | [C] |
<Instruct>: Given the context 'Conclusion
The present study has provided the first examination into the genetic basis underlying rainbow trout's immune response and resistance to the whirling disease pathogen.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: rainbow trout (aka oncorhynchus mykiss)
B: salmo gilae gilae (aka oncorhynchus gilae gilae)
C: river trout (aka salmo trutta fario)
D: japanese salmon (aka oncorhynchus masou)
E: trouts, salmons & chars (aka salmoninae)
F: None of the above. | [A] |
<Instruct>: Given the context 'Several genes were significantly up-regulated in skin following pathogen exposure for both the resistant Hofer and susceptible Trout Lodge rainbow trout strains.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo gilae (aka oncorhynchus gilae)
B: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
C: salmo trutta (river trout) (aka salmo trutta)
D: brook trout (aka salvelinus fontinalis)
E: salmo gilae gilae (aka oncorhynchus gilae gilae)
F: None of the above. | [B] |
<Instruct>: Given the context 'Methods
Animal care, pathogen exposure, and RNA preparation
Hofer and Trout Lodge rainbow trout strains were reared in 35 gallon aquaria with 15°C flow-through well water for nine weeks post-hatch, with each fish weighing approximately 6.5 grams prior to pathogen exposure.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: river trout (aka salmo trutta fario)
B: salmo keta (aka oncorhynchus keta)
C: black sea salmon (aka salmo labrax)
D: salmo gilae gilae (aka oncorhynchus gilae gilae)
E: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
F: None of the above. | [E] |
<Instruct>: Given the context 'These arrays contain 13,421 Atlantic salmon and 2,576 rainbow trout cDNA features and have been successfully used for several previous rainbow trout gene expression studies [70-73].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: sea trout (aka salmo trutta trutta)
B: salmo gilae gilae (aka oncorhynchus gilae gilae)
C: salmo keta (aka oncorhynchus keta)
D: king salmon (aka oncorhynchus tshawytscha)
E: golden trout (aka oncorhynchus mykiss aguabonita)
F: atlantic salmon (aka salmo salar)
G: oncorhynchus keta (chum salmon) (aka oncorhynchus keta)
H: black sea salmon (aka salmo labrax)
I: rainbow trout (aka oncorhynchus mykiss)
J: salmonids (aka salmonidae)
K: None of the above. | [F; I] |
<Instruct>: Given the context 'These arrays contain 13,421 Atlantic salmon and 2,576 rainbow trout cDNA features and have been successfully used for several previous rainbow trout gene expression studies [70-73].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: trouts, salmons & chars (aka salmoninae)
B: salmons and trouts (aka salmoniformes)
C: brook trout (aka salvelinus fontinalis)
D: oncorhynchus keta (chum salmon) (aka oncorhynchus keta)
E: atlantic salmon (aka salmo salar)
F: coho salmon (aka oncorhynchus kisutch)
G: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
H: salmon trout (aka oncorhynchus masou)
I: salmo gilae gilae (aka oncorhynchus gilae gilae)
J: None of the above. | [E; G] |
<Instruct>: Given the context 'For each rainbow trout strain, competitive hybridization was conducted on every array using equal amounts (8 μg) of differentially labeled aRNA from one control fish and one exposed fish.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo gilae gilae (aka oncorhynchus gilae gilae)
B: golden trout (aka oncorhynchus mykiss aguabonita)
C: japanese salmon (aka oncorhynchus masou)
D: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
E: salmo trutta (river trout) (aka salmo trutta)
F: None of the above. | [D] |
<Instruct>: Given the context 'The Significance Analysis of Microarrays (SAM) software package [75] was used to identify differentially expressed genes between exposed and unexposed control fish for each rainbow trout strain.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: black sea salmon (aka salmo labrax)
B: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
C: river trout (aka salmo trutta)
D: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
E: salmons and trouts (aka salmoniformes)
F: None of the above. | [B] |
<Instruct>: Given the context 'In situ hybridization indicates the photoreceptor layer has the highest level of P2Y2 receptor of any region in the rabbit retina, although staining was not pronounced in monkey', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: rabbit (aka oryctolagus cuniculus)
B: lepus cuniculus cuniculus (aka oryctolagus cuniculus cuniculus)
C: lepus (hares) (aka lepus)
D: marsh rabbit (aka sylvilagus palustris)
E: ox (aka bos taurus) (aka bos taurus)
F: None of the above. | [A] |
<Instruct>: Given the context 'A2 receptors have been recognized on cultured and fresh RPE cells for some time [26, 27], with in situ hybridization confirming the presence of A2A receptors in rat RPE', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: mus norvegicus (aka rattus norvegicus)
B: rattus rattus (rattus wroughtoni) (aka rattus rattus)
C: rats (aka rattus) (aka rattus)
D: rattus norvegicus albus
E: rattus sp. (rats (aka rattus sp.))
F: None of the above. | [A] |
<Instruct>: Given the context 'Although adenosine alone does not increase intracellular Ca2+ levels [31], adenosine acts synergistically with ATP to elevate Ca2+ levels in human RPE cells by stimulating both A1 and A2A receptors', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: species
C: animals (aka metazoa)
D: this
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'The P2Y2 receptor was initially characterized in cultured human RPE', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: homo (humans) (aka homo)
C: cellular organisms (biota) (aka cellular organisms)
D: kingdom
E: genus
F: None of the above. | [A] |
<Instruct>: Given the context '[31], with subsequent reports localizing transcript for P2Y1, P2Y2, P2Y4, and P2Y6 in the rat RPE/choroid', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus albus
B: rats (aka rattus) (aka rattus)
C: roof rat (aka rattus rattus)
D: rat (aka rattus norvegicus) (aka rattus norvegicus)
E: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
F: None of the above. | [D] |
<Instruct>: Given the context '[40], and functionally identifying a P2X receptor in rat RPE cells [41].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus albus
B: rattus norvegicus (rats (aka rattus norvegicus))
C: rats (aka rattus sp.) (aka rattus sp.)
D: rattus rattoides (aka rattus pyctoris)
E: roof rat (aka rattus rattus)
F: None of the above. | [B] |
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos indicus (bos primigenius indicus) (aka bos indicus)
B: bos bubalis bubalis (aka bubalus bubalis bubalis)
C: bos sp.
D: domestic cow (aka bos taurus)
E: bovidae
F: None of the above. | [D] |
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos sp.
B: bovidae
C: bos indicus (bos primigenius indicus) (aka bos indicus)
D: bos bubalis bubalis (aka bubalus bubalis bubalis)
E: None of the above. | [E] |
<Instruct>: Given the context 'ATP, UTP, and the P2Y2 receptor agonist INS37217 decrease the size of subretinal fluid blebs when injected into subretinal space of rats [44].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rats]
<Options>: A: rattus norvegicus albus
B: rat (aka rattus) (aka rattus)
C: rattus sp. (rats (aka rattus sp.))
D: mus norvegicus (aka rattus norvegicus)
E: black rat (aka rattus rattus)
F: None of the above. | [D] |
<Instruct>: Given the context 'In both normal and rds +/- mice with experimentally induced detachment, INS31217 improves the ERG recovery and decreased cell death [45].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus musculus (house mouse) (aka mus musculus)
D: peromyscus
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [C] |
<Instruct>: Given the context 'INS37217 also reduces subretinal blebs in rabbits [46].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbits]
<Options>: A: ox (aka bos taurus) (aka bos taurus)
B: lepus (hares) (aka lepus)
C: japanese white rabbit (aka oryctolagus cuniculus)
D: cattle (aka bos)
E: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
F: None of the above. | [C] |
<Instruct>: Given the context 'NMDA also triggers a release of ATP when applied to the intact bovine RPE eyecup [51].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis bubalis (aka bubalus bubalis bubalis)
B: bovinae
C: bos primigenius taurus (aka bos taurus)
D: cattle (aka bos)
E: bos taurus x bos indicus (aka bos indicus x bos taurus)
F: None of the above. | [C] |
<Instruct>: Given the context 'The NMDA receptors and the ATP release sites have been functionally identified to the apical membrane of the bovine RPE, suggesting the neurotransmitter interactions could amplify the signal from any glutamate reaching subretinal space.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis (aka bubalus bubalis)
B: bos sp.
C: cow (aka bos taurus) (aka bos taurus)
D: bovinae
E: bos bubalis bubalis (aka bubalus bubalis bubalis)
F: None of the above. | [C] |
<Instruct>: Given the context 'While the precise mechanisms by which CFTR contributes to this release are not yet known, a role for CFTR in ATP release into subretinal space is consistent with the reduction of certain ERG components in cftr -/- mice [58] and with the ability of apical ATP to activate conductances associated with these ERG components [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: mus cricetus (aka cricetus cricetus)
C: peromyscus
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Degradation of ATP by the apical membrane of the fresh bovine eyecup and by ARPE-19 cells is inhibited by ARL67156 or βγmATP.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis (aka bubalus bubalis)
B: bos taurus x bos indicus (aka bos indicus x bos taurus)
C: cattle (aka bos)
D: bovine (aka bos taurus)
E: bovinae
F: None of the above. | [D] |
<Instruct>: Given the context 'The production of adenosine from ATP at the apical membrane of the bovine RPE eyecup is inhibited by the ecto-5′-nucleotidase inhibitor αβmADP, confirming a role for this enzyme [63].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis (aka bubalus bubalis)
B: domestic cow (aka bos taurus)
C: bos bubalis bubalis (aka bubalus bubalis bubalis)
D: boveria
E: cattle (aka bos)
F: None of the above. | [B] |
<Instruct>: Given the context 'The enzyme is localized to rat RPE and ARPE-19 cells immunohistochemically.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
B: rats (aka rattus sp.) (aka rattus sp.)
C: brown rat (aka rattus norvegicus)
D: mus rattus (aka rattus rattus)
E: rat (aka rattus) (aka rattus)
F: None of the above. | [C] |
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rats (aka rattus sp.) (aka rattus sp.)
B: roof rat (aka rattus rattus)
C: rattus norvegicus albus
D: rattus rattoides (aka rattus pyctoris)
E: rattus norvegicus (rats (aka rattus norvegicus))
F: None of the above. | [E] |
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus albus
B: rats (aka rattus sp.) (aka rattus sp.)
C: roof rat (aka rattus rattus)
D: rattus rattoides (aka rattus pyctoris)
E: None of the above. | [E] |
<Instruct>: Given the context '[63], although localization in mouse indicated larger amounts of ecto-5′-nucleotidase at the tips of adjacent Müller cells', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: house mouse (aka mus musculus)
B: peromyscus
C: mus domesticus (aka mus musculus domesticus)
D: mus (aka mus <genus>) (aka mus <genus>)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: potatoes (aka solanum tuberosum)
B: triticum tauschii (aka aegilops tauschii)
C: triticum x secale (aka x triticosecale)
D: solanum glutinosum
E: solanum hirtum
F: chinese-potato (aka dioscorea polystachya)
G: potato yam (aka dioscorea bulbifera)
H: one-grained wheat (aka triticum monococcum)
I: solanum mammosum
J: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
K: solanum canense
L: chilean potato-tree (aka solanum crispum)
M: solanum trifidum
N: rivet wheat (aka triticum turgidum)
O: None of the above. | [A; A; J] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: potatoes (aka solanum tuberosum)
B: solanum giganteum
C: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
D: durum wheat (aka triticum turgidum subsp. durum)
E: solanum vescum
F: triticum x secale (aka x triticosecale)
G: solanum annuum
H: wild emmer wheat (aka triticum dicoccoides)
I: rivet wheat (aka triticum turgidum)
J: common wheat (aka triticum aestivum)
K: solanum
L: solanum barbisetum
M: solanum rugosum
N: None of the above. | [A; A; J] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
B: solanum annuum
C: solanum giganteum
D: solanum hirtum
E: triticum
F: durum wheat (aka triticum turgidum subsp. durum)
G: solanum crispum (chilean potato-tree) (aka solanum crispum)
H: potato (aka solanum tuberosum)
I: solanum canense
J: chaco potato (aka solanum chacoense)
K: poulard wheat (aka triticum turgidum)
L: wild emmer wheat (aka triticum dicoccoides)
M: solanum ipomoeoides
N: tuberaria
O: None of the above. | [H; H; A] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: chaco potato (aka solanum chacoense)
B: solanum giganteum
C: solanum canense
D: triticum
E: solanum crispum (chilean potato-tree) (aka solanum crispum)
F: durum wheat (aka triticum turgidum subsp. durum)
G: solanum annuum
H: potato (aka solanum tuberosum)
I: tuberaria
J: solanum ipomoeoides
K: solanum hirtum
L: poulard wheat (aka triticum turgidum)
M: wild emmer wheat (aka triticum dicoccoides)
N: None of the above. | [H; H; N] |
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: solanum glutinosum
B: durum wheat (aka triticum turgidum subsp. durum)
C: one-grained wheat (aka triticum monococcum)
D: solanum crispum (chilean potato-tree) (aka solanum crispum)
E: triticum
F: solanum ipomoeoides
G: potatoes (aka solanum tuberosum)
H: triticum strictum (aka secale strictum)
I: tuberaria
J: triticum sativum (aka triticum aestivum)
K: None of the above. | [G; J] |
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: english wheat (aka triticum turgidum)
B: chinese-potato (aka dioscorea polystachya)
C: chaco potato (aka solanum chacoense)
D: potato yam (aka dioscorea bulbifera)
E: triticum
F: triticum tauschii (aka aegilops tauschii)
G: triticum sativum (aka triticum aestivum)
H: durum wheat (aka triticum turgidum subsp. durum)
I: solanum ipomoeoides
J: potato (aka solanum tuberosum)
K: None of the above. | [J; G] |
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum glutinosum
B: tuberaria
C: chaco potato (aka solanum chacoense)
D: potato (aka solanum tuberosum)
E: solanum ipomoeoides
F: triticum durum (aka triticum turgidum subsp. durum)
G: triticum x secale (aka x triticosecale)
H: bread wheat (aka triticum aestivum)
I: triticum tauschii (aka aegilops tauschii)
J: triticum strictum (aka secale strictum)
K: None of the above. | [H; D] |
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: tuberaria
B: air-potato (aka dioscorea bulbifera)
C: triticum
D: triticum x secale (aka x triticosecale)
E: triticum sativum (aka triticum aestivum)
F: solanum rugosum
G: wild emmer wheat (aka triticum dicoccoides)
H: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
I: triticum strictum (aka secale strictum)
J: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
K: None of the above. | [E; J] |
<Instruct>: Given the context 'For this purpose, conditions for electroporating isolated potato mitochondria were established.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: air-potato (aka dioscorea bulbifera)
B: potatoes (aka solanum tuberosum)
C: chilean potato-tree (aka solanum crispum)
D: sweet potato (aka ipomoea batatas)
E: chinese-potato (aka dioscorea polystachya)
F: None of the above. | [B] |
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: potato (aka solanum tuberosum)
B: wild emmer wheat (aka triticum dicoccoides)
C: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
D: solanum
E: solanum annuum
F: common wheat (aka triticum aestivum)
G: poulard wheat (aka triticum turgidum)
H: sweet potato (aka ipomoea batatas)
I: triticum tauschii (aka aegilops tauschii)
J: triticum x secale (aka x triticosecale)
K: None of the above. | [A; F] |
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: chaco potato (aka solanum chacoense)
B: triticum strictum (aka secale strictum)
C: common wheat (aka triticum aestivum)
D: potato (aka solanum tuberosum)
E: potato yam (aka dioscorea bulbifera)
F: wild emmer wheat (aka triticum dicoccoides)
G: triticum aegilops (aka aegilops tauschii)
H: solanum ipomoeoides
I: solanum glutinosum
J: triticum
K: None of the above. | [D; C] |
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: chilean potato-tree (aka solanum crispum)
B: durum wheat (aka triticum turgidum subsp. durum)
C: triticum x secale (aka x triticosecale)
D: potatoes (aka solanum tuberosum)
E: solanum glutinosum
F: solanum giganteum
G: triticum tauschii (aka aegilops tauschii)
H: wheat (aka triticum aestivum)
I: tuberaria
J: poulard wheat (aka triticum turgidum)
K: None of the above. | [H; D] |
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum nutans
B: one-grained wheat (aka triticum monococcum)
C: bread wheat (aka triticum aestivum)
D: solanum glutinosum
E: triticum strictum (aka secale strictum)
F: durum wheat (aka triticum turgidum subsp. durum)
G: solanum
H: triticum
I: potato (aka solanum tuberosum)
J: solanum giganteum
K: None of the above. | [C; I] |
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: triticum
C: one-grained wheat (aka triticum monococcum)
D: sweet potato (aka ipomoea batatas)
E: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
F: tuberaria
G: solanum glutinosum
H: triticum x secale (aka x triticosecale)
I: solanum crispum (chilean potato-tree) (aka solanum crispum)
J: potato (aka solanum tuberosum)
K: None of the above. | [E; J] |
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: chinese-potato (aka dioscorea polystachya)
B: solanum annuum
C: one-grained wheat (aka triticum monococcum)
D: rivet wheat (aka triticum turgidum)
E: solanum rugosum
F: triticum vulgare (aka triticum aestivum)
G: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
H: potatoes (aka solanum tuberosum)
I: triticum durum (aka triticum turgidum subsp. durum)
J: triticum aegilops (aka aegilops tauschii)
K: None of the above. | [F; H] |
<Instruct>: Given the context 'In Arabidopsis thaliana 456 C-to-U editing events have been described (6).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [arabidopsis thaliana]
<Options>: A: euphyia
B: arabidopsis (cardaminopsis) (aka arabidopsis)
C: arabidopsis thaliana x arabidopsis lyrata
D: arabideae
E: thale-cress (aka arabidopsis thaliana)
F: None of the above. | [E] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: sorghum hybrid cultivar
B: ansola
C: arabidopsis thaliana x arabidopsis lyrata
D: common wild sorghum (aka sorghum arundinaceum)
E: zea mexicana (aka zea mays subsp. mexicana)
F: sorghum sudanense (aka sorghum bicolor subsp. drummondii)
G: brassica
H: maize (aka zea mays subsp. mays)
I: annea
J: arabis thaliana (aka arabidopsis thaliana)
K: zea mays subsp. mays x zea perennis
L: zea mays subsp. mays x zea mays subsp. mexicana
M: zea mays var. japonica (aka zea mays)
N: sorghum (aka sorghum bicolor)
O: saccharum x sorghum
P: None of the above. | [J; N; M] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: beana
B: zea mays subsp. mays x zea perennis
C: sorghum bicolor x saccharum hybrid cultivar
D: australytta
E: zea mays var. mays (aka zea mays subsp. mays)
F: zea mays subsp. mays x zea mays subsp. parviglumis
G: sorghum bicolor var. virgatum (aka sorghum virgatum)
H: common wild sorghum (aka sorghum arundinaceum)
I: holcus bicolor (aka sorghum bicolor)
J: zea mays var. japonica (aka zea mays)
K: arabidopsis thaliana x arabidopsis arenosa
L: zea mays subsp. mays x zea mays subsp. mexicana
M: thale-cress (aka arabidopsis thaliana)
N: sorghum sudanense (aka sorghum bicolor subsp. drummondii)
O: annea
P: None of the above. | [M; I; J] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: zea mexicana (aka zea mays subsp. mexicana)
B: thale-cress (aka arabidopsis thaliana)
C: zea mays subsp. mays x zea perennis
D: zea mays (zea mays var. japonica) (aka zea mays)
E: avian (aka aves)
F: australytta
G: common wild sorghum (aka sorghum arundinaceum)
H: sorghum bicolor x saccharum hybrid cultivar
I: saccharum x sorghum
J: zea mays subsp. mays x zea mays subsp. parviglumis
K: arabidopsis thaliana x arabidopsis arenosa
L: sorghum bicolor (sorghum bicolor subsp. bicolor) (aka sorghum bicolor)
M: land plants (aka embryophyta)
N: sorghum grande
O: zea mays subsp. mays x zea mays subsp. mexicana
P: None of the above. | [B; L; D] |
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; wheat]
<Options>: A: solanum glabratum
B: solanum
C: triticum sativum (aka triticum aestivum)
D: solanum trifidum
E: one-grained wheat (aka triticum monococcum)
F: triticum durum (aka triticum turgidum subsp. durum)
G: potatoes (aka solanum tuberosum)
H: solanum giganteum
I: wild emmer wheat (aka triticum dicoccoides)
J: english wheat (aka triticum turgidum)
K: None of the above. | [G; C] |
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; wheat]
<Options>: A: solanum mammosum
B: solanum annuum
C: one-grained wheat (aka triticum monococcum)
D: wheat (aka triticum aestivum)
E: solanum acuminatum
F: triticum durum (aka triticum turgidum subsp. durum)
G: triticum
H: wild emmer wheat (aka triticum dicoccoides)
I: potatoes (aka solanum tuberosum)
J: solanum hirtum
K: None of the above. | [I; D] |
<Instruct>: Given the context 'Using this model, we found that editing and splicing of cox2 transcripts were not linked in wheat mitochondria (15).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum durum (aka triticum turgidum subsp. durum)
B: wild emmer wheat (aka triticum dicoccoides)
C: triticum vulgare (aka triticum aestivum)
D: one-grained wheat (aka triticum monococcum)
E: triticum strictum (aka secale strictum)
F: None of the above. | [C] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: solanum luteum (aka solanum villosum)
B: triticum
C: solanum hirtum
D: potato (aka solanum tuberosum)
E: solanum mammosum
F: wild emmer wheat (aka triticum dicoccoides)
G: solanum lanceaefolium (aka solanum lanceifolium)
H: triticum strictum (aka secale strictum)
I: triticum x secale (aka x triticosecale)
J: wheat (aka triticum aestivum)
K: None of the above. | [D; J] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: triticum durum (aka triticum turgidum subsp. durum)
B: solanum glutinosum
C: solanum florulentum
D: potatoes (aka solanum tuberosum)
E: triticum aestivum subsp. aestivum (aka triticum aestivum)
F: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
G: wild emmer wheat (aka triticum dicoccoides)
H: triticum
I: triticum strictum (aka secale strictum)
J: solanum succosum
K: None of the above. | [D; E] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: potatoes (aka solanum tuberosum)
B: solanum glutinosum
C: wild emmer wheat (aka triticum dicoccoides)
D: triticum
E: solanum succosum
F: triticum durum (aka triticum turgidum subsp. durum)
G: solanum florulentum
H: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
I: triticum strictum (aka secale strictum)
J: None of the above. | [A; J] |
<Instruct>: Given the context 'Five C residues are changed to U in potato mitochondria rps10 transcripts by editing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
B: chaco potato (aka solanum chacoense)
C: chilean potato-tree (aka solanum crispum)
D: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
E: tuberaria
F: None of the above. | [D] |
<Instruct>: Given the context 'To test this hypothesis, it was necessary to set up the conditions for electroporation of foreign DNA into S.tuberosum mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum barbisetum
B: solanum luteum (aka solanum villosum)
C: tuberosum group
D: solanum esculentum (aka solanum lycopersicum)
E: potato (aka solanum tuberosum)
F: None of the above. | [E] |
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: triticum sativum (aka triticum aestivum)
B: solanum ipomoeoides
C: triticum durum (aka triticum turgidum subsp. durum)
D: solanum rugosum
E: triticum x secale (aka x triticosecale)
F: triticum strictum (aka secale strictum)
G: solanum nutans
H: solanum
I: triticum
J: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
K: None of the above. | [J; A] |
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: potato (aka solanum tuberosum)
B: english wheat (aka triticum turgidum)
C: common wheat (aka triticum aestivum)
D: triticum
E: one-grained wheat (aka triticum monococcum)
F: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
G: solanum
H: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
I: chaco potato (aka solanum chacoense)
J: triticum durum (aka triticum turgidum subsp. durum)
K: None of the above. | [A; C] |
<Instruct>: Given the context 'In contrast, a rps10 construct is correctly expressed and processed in cognate potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum giganteum
B: chinese-potato (aka dioscorea polystachya)
C: potatoes (aka solanum tuberosum)
D: sweet potato (aka ipomoea batatas)
E: solanum annuum
F: None of the above. | [C] |
<Instruct>: Given the context 'This is the first report on DNA electroporation into potato mitochondria.
MATERIALS AND METHODS
Plasmids
All plasmids used in this study are based on the previously described pCOXII vector (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum glutinosum
B: potatoes (aka solanum tuberosum)
C: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
E: chinese-potato (aka dioscorea polystachya)
F: None of the above. | [B] |
<Instruct>: Given the context 'An NsiI restriction site was introduced at the initiation codon of the wheat cox2 open reading frame (ORF).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum x secale (aka x triticosecale)
C: common wheat (aka triticum aestivum)
D: wild emmer wheat (aka triticum dicoccoides)
E: triticum
F: None of the above. | [C] |
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors.
S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: potatoes (aka solanum tuberosum)
B: solanum luteum (aka solanum villosum)
C: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
D: solanum ruvu
E: solanum pallidum
F: None of the above. | [A] |
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors.
S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
B: solanum ruvu
C: solanum pallidum
D: solanum luteum (aka solanum villosum)
E: None of the above. | [E] |
<Instruct>: Given the context 'accession no. AF096321, containing the KpnI restriction sequence, and primer B derived from Triticum timopheevi cox2 (AF336134).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [triticum timopheevi]
<Options>: A: triticum timopheevii var. viticulosum
B: triticum urartu var. binartulutriru
C: triticum sphaerococcum (aka triticum aestivum subsp. sphaerococcum)
D: triticum aethiopicum (aka triticum turgidum)
E: triticum timopheevii (triticum timonovum) (aka triticum timopheevii)
F: None of the above. | [E] |
<Instruct>: Given the context 'The complete sequence of the S.tuberosum cox2 was determined (accession no. DQ18064).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum glutinosum
B: solanum barbisetum
C: potatoes (aka solanum tuberosum)
D: solanum luteum (aka solanum villosum)
E: solanum lanceaefolium (aka solanum lanceifolium)
F: None of the above. | [C] |
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: solanum glabratum
B: solanum esculentum (aka solanum lycopersicum)
C: rivet wheat (aka triticum turgidum)
D: triticum strictum (aka secale strictum)
E: durum wheat (aka triticum turgidum subsp. durum)
F: triticum x secale (aka x triticosecale)
G: potato (aka solanum tuberosum)
H: solanum lanceaefolium (aka solanum lanceifolium)
I: wheat (aka triticum aestivum)
J: solanum hirtum
K: None of the above. | [G; I] |
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: triticum x secale (aka x triticosecale)
B: solanum mammosum
C: common wheat (aka triticum aestivum)
D: potatoes (aka solanum tuberosum)
E: solanum ruvu
F: solanum barbisetum
G: poulard wheat (aka triticum turgidum)
H: solanum pallidum
I: wild emmer wheat (aka triticum dicoccoides)
J: durum wheat (aka triticum turgidum subsp. durum)
K: None of the above. | [D; C] |
<Instruct>: Given the context 'This 23 bp insertion provides a specific sequence allowing isolation of potato cox2 transcripts originating from the introduced DNA by RT–PCR.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: chaco potato (aka solanum chacoense)
B: tuberaria
C: solanum ipomoeoides
D: potato (aka solanum tuberosum)
E: sweet potato (aka ipomoea batatas)
F: None of the above. | [D] |
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: solanum giganteum
C: triticum sativum (aka triticum aestivum)
D: chinese-potato (aka dioscorea polystachya)
E: potatoes (aka solanum tuberosum)
F: triticum
G: chilean potato-tree (aka solanum crispum)
H: triticum strictum (aka secale strictum)
I: triticum x secale (aka x triticosecale)
J: solanum ipomoeoides
K: None of the above. | [C; E] |
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum
B: solanum nutans
C: potato (aka solanum tuberosum)
D: common wheat (aka triticum aestivum)
E: air-potato (aka dioscorea bulbifera)
F: sweet potato (aka ipomoea batatas)
G: english wheat (aka triticum turgidum)
H: triticum aegilops (aka aegilops tauschii)
I: triticum strictum (aka secale strictum)
J: wild emmer wheat (aka triticum dicoccoides)
K: None of the above. | [D; C] |
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum giganteum
B: triticum x secale (aka x triticosecale)
C: triticum
D: triticum strictum (aka secale strictum)
E: solanum crispum (chilean potato-tree) (aka solanum crispum)
F: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
G: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
H: triticum vulgare (aka triticum aestivum)
I: solanum nutans
J: wild emmer wheat (aka triticum dicoccoides)
K: None of the above. | [H; G] |
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: chinese-potato (aka dioscorea polystachya)
B: triticum
C: wild emmer wheat (aka triticum dicoccoides)
D: one-grained wheat (aka triticum monococcum)
E: triticum vulgare (aka triticum aestivum)
F: potatoes (aka solanum tuberosum)
G: solanum rugosum
H: tuberaria
I: sweet potato (aka ipomoea batatas)
J: durum wheat (aka triticum turgidum subsp. durum)
K: None of the above. | [E; F] |
<Instruct>: Given the context 'The coding region was isolated from total S.tuberosum DNA by PCR using primers D1 and D2 containing the restriction sites NsiI and SpeI, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum glabratum
B: solanum barbisetum
C: solanum ruvu
D: solanum succosum
E: potatoes (aka solanum tuberosum)
F: None of the above. | [E] |
<Instruct>: Given the context 'Since all vectors used here were based on pCOXII, they contain the downstream region from the wheat cob gene (Ir-cob) (accession no. AF337547) (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum tauschii (aka aegilops tauschii)
C: bread wheat (aka triticum aestivum)
D: triticum strictum (aka secale strictum)
E: wild emmer wheat (aka triticum dicoccoides)
F: None of the above. | [C] |
<Instruct>: Given the context 'For constructs MA and MAB containing the wheat cox2 C259 editing site, two consecutive insertions were carried out using primers: GGAAGATTGGATTACTATCGAAATTGCCCTGAATCA and TACTATCGAAATTATTCGGACCATGCCCTGAATCA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum
B: wheat (aka triticum aestivum)
C: triticum aethiopicum (aka triticum turgidum)
D: triticum aegilops (aka aegilops tauschii)
E: one-grained wheat (aka triticum monococcum)
F: None of the above. | [B] |
<Instruct>: Given the context 'Mitochondria purification
S.tuberosum cv.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: tuberosum group
B: solanum mammosum
C: solanum vicinum
D: potatoes (aka solanum tuberosum)
E: solanum lanceaefolium (aka solanum lanceifolium)
F: None of the above. | [D] |
<Instruct>: Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum giganteum
B: potato (aka solanum tuberosum)
C: solanum
D: solanum glutinosum
E: solanum rugosum
F: None of the above. | [B] |
<Instruct>: Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum
B: solanum glutinosum
C: solanum rugosum
D: solanum giganteum
E: None of the above. | [E] |
<Instruct>: Given the context 'The supernatant was centrifuged in a Sorvall SS-34 rotor at 15 000 g for 10 min, the pellet was resuspended in 12 ml of homogenization buffer and mitochondria were purified by centrifugation on a sucrose gradient essentially as described for wheat embryo mitochondria (14).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum aestivum subsp. aestivum (aka triticum aestivum)
C: triticum x secale (aka x triticosecale)
D: wild emmer wheat (aka triticum dicoccoides)
E: triticum tauschii (aka aegilops tauschii)
F: None of the above. | [B] |
<Instruct>: Given the context 'Electroporation
Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum x secale (aka x triticosecale)
B: solanum glutinosum
C: solanum rugosum
D: potato (aka solanum tuberosum)
E: wheat (aka triticum aestivum)
F: wild emmer wheat (aka triticum dicoccoides)
G: triticum aegilops (aka aegilops tauschii)
H: potato yam (aka dioscorea bulbifera)
I: triticum aethiopicum (aka triticum turgidum)
J: solanum annuum
K: None of the above. | [E; D] |
<Instruct>: Given the context 'Electroporation
Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum ipomoeoides
B: solanum nutans
C: potato yam (aka dioscorea bulbifera)
D: wild emmer wheat (aka triticum dicoccoides)
E: triticum durum (aka triticum turgidum subsp. durum)
F: english wheat (aka triticum turgidum)
G: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
H: potatoes (aka solanum tuberosum)
I: wheat (aka triticum aestivum)
J: triticum x secale (aka x triticosecale)
K: None of the above. | [I; H] |
<Instruct>: Given the context 'In the case of potato mitochondria the incubation mixture was supplemented with 1 mg/ml of fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum
B: chaco potato (aka solanum chacoense)
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: sweet potato (aka ipomoea batatas)
E: solanum crispum (chilean potato-tree) (aka solanum crispum)
F: None of the above. | [C] |
<Instruct>: Given the context 'One microliter of 20% SDS was added to achieve mitochondrial lysis and the DNA was extracted with phenol/chloroform, precipitated with 0.1 vol of 3 M Sodium Acetate (pH 5.2), 3 vol of 100% ethanol and 100 ng of carrier yeast tRNA and left overnight at −20°C.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces hansenii (aka debaryomyces hansenii)
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: brewer's yeast (aka saccharomyces cerevisiae)
E: saccharomyceta
F: None of the above. | [D] |
<Instruct>: Given the context 'DNA sequencing
Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem).
RESULTS
S.tuberosum rps10 transcripts are not processed in wheat mitochondria
The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: solanum vicinum
B: poulard wheat (aka triticum turgidum)
C: tuberosum group
D: solanum glutinosum
E: triticum vulgare (aka triticum aestivum)
F: triticum x secale (aka x triticosecale)
G: triticum strictum (aka secale strictum)
H: potato (aka solanum tuberosum)
I: solanum tuberosum var. boreale (aka solanum stoloniferum)
J: durum wheat (aka triticum turgidum subsp. durum)
K: None of the above. | [H; E] |
<Instruct>: Given the context 'DNA sequencing
Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem).
RESULTS
S.tuberosum rps10 transcripts are not processed in wheat mitochondria
The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: triticum
B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
C: solanum glutinosum
D: solanum barbisetum
E: triticum durum (aka triticum turgidum subsp. durum)
F: solanum vicinum
G: potato (aka solanum tuberosum)
H: triticum x secale (aka x triticosecale)
I: wild emmer wheat (aka triticum dicoccoides)
J: triticum sativum (aka triticum aestivum)
K: None of the above. | [G; J] |
<Instruct>: Given the context 'DNA sequencing
Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem).
RESULTS
S.tuberosum rps10 transcripts are not processed in wheat mitochondria
The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum durum (aka triticum turgidum subsp. durum)
B: triticum aegilops (aka aegilops tauschii)
C: bread wheat (aka triticum aestivum)
D: wild emmer wheat (aka triticum dicoccoides)
E: triticum aethiopicum (aka triticum turgidum)
F: None of the above. | [C] |
<Instruct>: Given the context 'The primers used allowed detection of the transcripts generated by the constructs introduced and excluded any product from endogenous cox2 (or rps10 in the potato system).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum giganteum
B: solanum crispum (chilean potato-tree) (aka solanum crispum)
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: solanum ipomoeoides
E: solanum rugosum
F: None of the above. | [C] |
<Instruct>: Given the context 'Previously, five C residues, two in exon 1, one in the intron and two in exon 2 have been reported to be changed to U by editing in potato mitochondria (23).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum glutinosum
B: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
C: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
E: chinese-potato (aka dioscorea polystachya)
F: None of the above. | [B] |
<Instruct>: Given the context 'To determine if the non-cognate transcript could be recognized by the wheat RNA editing machinery, the 1204 bp RT–PCR product was sequenced.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: triticum
C: triticum strictum (aka secale strictum)
D: triticum tauschii (aka aegilops tauschii)
E: triticum vulgare (aka triticum aestivum)
F: None of the above. | [E] |
<Instruct>: Given the context 'While wheat cox2 editing sites were correctly edited in control as expected (Figure 1C, only site C77 is shown), all five editable residues in potato rps10 transcript remain unchanged.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum sativum (aka triticum aestivum)
B: tuberaria
C: triticum x secale (aka x triticosecale)
D: solanum
E: solanum nutans
F: chinese-potato (aka dioscorea polystachya)
G: potato (aka solanum tuberosum)
H: triticum
I: rivet wheat (aka triticum turgidum)
J: triticum aegilops (aka aegilops tauschii)
K: None of the above. | [A; G] |
<Instruct>: Given the context 'While wheat cox2 editing sites were correctly edited in control as expected (Figure 1C, only site C77 is shown), all five editable residues in potato rps10 transcript remain unchanged.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: chinese-potato (aka dioscorea polystachya)
B: triticum
C: triticum strictum (aka secale strictum)
D: potatoes (aka solanum tuberosum)
E: tuberaria
F: triticum aethiopicum (aka triticum turgidum)
G: one-grained wheat (aka triticum monococcum)
H: solanum ipomoeoides
I: triticum vulgare (aka triticum aestivum)
J: solanum nutans
K: None of the above. | [I; D] |
<Instruct>: Given the context 'cox2 C77 editing sites are identical in potato and wheat.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: wheat (aka triticum aestivum)
B: solanum ipomoeoides
C: triticum strictum (aka secale strictum)
D: chilean potato-tree (aka solanum crispum)
E: durum wheat (aka triticum turgidum subsp. durum)
F: triticum
G: triticum x secale (aka x triticosecale)
H: potatoes (aka solanum tuberosum)
I: solanum giganteum
J: solanum annuum
K: None of the above. | [H; A] |
<Instruct>: Given the context 'cox2 C77 editing sites are identical in potato and wheat.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: triticum aethiopicum (aka triticum turgidum)
B: potato (aka solanum tuberosum)
C: solanum nutans
D: one-grained wheat (aka triticum monococcum)
E: triticum
F: chaco potato (aka solanum chacoense)
G: solanum annuum
H: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
I: bread wheat (aka triticum aestivum)
J: triticum durum (aka triticum turgidum subsp. durum)
K: None of the above. | [B; I] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.