instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'Analogous recordings of turgor pressure and patch clamp pressure on grapevines, bananas, and Eucalyptus trees also yielded results (D Zimmermann, unpublished results) which were consistent with the predictions of equation 8.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bananas; eucalyptus]
<Options>: A: eucalyptus pulverulenta (powdered gum) (aka eucalyptus pulverulenta)
B: eucalyptus
C: sweet banana (aka musa acuminata)
D: eucalyptus pterocarpa
E: dessert banana (aka musa acuminata aaa group)
F: eucalyptus absita
G: musa balbisiana (starchy banana) (aka musa balbisiana)
H: musaceae (banana family) (aka musaceae)
I: banta
J: eucalyptus foliosa
K: None of the above. | [C; B] |
<Instruct>: Given the context 'The process seemed to be very similar to the refilling of the cells of the resurrection plant Myrothamnus flabellifolia with water after desiccation (Wagner et al., 2000).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [myrothamnus flabellifolia]
<Options>: A: myrothamnus flabellifolius (aka myrothamnus flabellifolia)
B: martensia flabelliformis
C: chaetanthera flabellifolia
D: hydnum flabellatum
E: acacia flabellifolia
F: None of the above. | [A] |
<Instruct>: Given the context '4A and B, restoration of full turgescence in T. voinierianum was faster than the preceding turgor pressure loss if the lianas were well-watered.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum]
<Options>: A: didymium radiaticolumellum
B: tetrastigma voinierianum (vitis voinieriana) (aka tetrastigma voinierianum)
C: trichinium beckerianum (aka ptilotus beckerianus)
D: hypobathrum boivinianum (aka tricalysia boiviniana)
E: leucochloridium vogtianum
F: None of the above. | [B] |
<Instruct>: Given the context 'Even though more work is required, the present study shows that the leaf patch clamp pressure probe is a promising tool to elucidate short- and long-distance water transport in T. voinierianum and other plants.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum]
<Options>: A: haplotrema voyanum (ancotrema voyanum) (aka haplotrema voyanum)
B: trichinium beckerianum (aka ptilotus beckerianus)
C: tetrastigma voinierianum (vitis voinieriana) (aka tetrastigma voinierianum)
D: taxithelium vernieri (hypnum vernieri) (aka taxithelium vernieri)
E: didymium radiaticolumellum
F: None of the above. | [C] |
<Instruct>: Given the context 'These considerations led Blalock to recommend the use of the former except in infants under two years of age in whom this artery may be too small and in adults or children over twelve years old or five feet tall with a left aortic arch in whom it is often too short to permit a satisfactory anastomosis.7'
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infants; children]
<Options>: A: humans (aka homo)
B: neoneides
C: gallus
D: equetus
E: kingdom
F: probles
G: chicken (aka gallus gallus)
H: human (aka homo sapiens)
I: menetus
J: None of the above. | [H; H] |
<Instruct>: Given the context 'These considerations led Blalock to recommend the use of the former except in infants under two years of age in whom this artery may be too small and in adults or children over twelve years old or five feet tall with a left aortic arch in whom it is often too short to permit a satisfactory anastomosis.7'
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infants; children]
<Options>: A: probles
B: humans (aka homo)
C: gallus
D: chicken (aka gallus gallus)
E: menetus
F: kingdom
G: neoneides
H: equetus
I: None of the above. | [I; I] |
<Instruct>: Given the context 'These considerations led Blalock to recommend the use of the former except in infants under two years of age in whom this artery may be too small and in adults or children over twelve years old or five feet tall with a left aortic arch in whom it is often too short to permit a satisfactory anastomosis.7'
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infants; children]
<Options>: A: genus
B: gallus
C: this
D: miletus
E: homo sapiens (human) (aka homo sapiens)
F: kingdom
G: neonella
H: placental mammals (aka eutheria)
I: circe
J: None of the above. | [E; E] |
<Instruct>: Given the context 'Nevertheless, the choice of the systemic artery in each individual patient is important since in certain cases one or another is unsuitable.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: other (aka unidentified)
C: aides
D: cancer
E: humans (aka homo)
F: None of the above. | [A] |
<Instruct>: Given the context 'The subclavian branch of the innominate has generally been preferred in patients ranging between two and twelve years of age and in older individuals in whom there is a right aortic arch.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: human (aka homo sapiens)
B: theraps
C: cancer
D: aides
E: this
F: None of the above. | [A] |
<Instruct>: Given the context 'One eighteen-month-old child died the day after operation and was found at post-mortem examination to have an occluded anastomosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [child]
<Options>: A: human (aka homo sapiens)
B: infraclass
C: circe
D: this
E: menetus
F: None of the above. | [A] |
<Instruct>: Given the context 'In one three-year-old child and one twenty-year-old woman a poor result was obtained and a second operation upon the other side was necessary.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [child; woman]
<Options>: A: proeces
B: eutherian mammals (aka eutheria)
C: somaticus
D: probles
E: humans (aka homo)
F: infraclass
G: homo (humans) (aka homo)
H: suborder
I: homo sapiens (human) (aka homo sapiens)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'In one three-year-old child and one twenty-year-old woman a poor result was obtained and a second operation upon the other side was necessary.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [child; woman]
<Options>: A: genus
B: infraclass
C: birds (aka aves)
D: proeces
E: family
F: homo sapiens (human) (aka homo sapiens)
G: species
H: mammals (aka mammalia)
I: None of the above. | [F; F] |
<Instruct>: Given the context 'Excluding the patients mentioned in the present report, only in two was an unquestionably good result obtained.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: theraps
C: goes
D: subsection
E: probles
F: None of the above. | [A] |
<Instruct>: Given the context 'Excluding the patients mentioned in the present report, only in two was an unquestionably good result obtained.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: goes
B: probles
C: theraps
D: subsection
E: None of the above. | [E] |
<Instruct>: Given the context 'Case report
The patient was a 19-year-old girl who had been cyanotic since the age of six months.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; girl]
<Options>: A: proxys
B: this
C: menetus
D: infraclass
E: gallus
F: kingdom
G: human (aka homo sapiens)
H: mouse (aka mus musculus)
I: cancer
J: None of the above. | [G; G] |
<Instruct>: Given the context 'Case report
The patient was a 19-year-old girl who had been cyanotic since the age of six months.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; girl]
<Options>: A: this
B: homo (humans) (aka homo)
C: theraps
D: homo sapiens (human) (aka homo sapiens)
E: other (aka unidentified)
F: avian (aka aves)
G: mammals (aka mammalia)
H: aides
I: species
J: None of the above. | [D; D] |
<Instruct>: Given the context 'The patient had an uneventful but disappointing convalescence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: humans (aka homo)
B: goes
C: homo sapiens (human) (aka homo sapiens)
D: mouse (aka mus musculus)
E: kingdom
F: None of the above. | [C] |
<Instruct>: Given the context 'Though the patient has been markedly improved, it is recognized that the result is not as good as is commonly obtained when patients with more adequate pulmonary arteries are treated by the conventional anastomosis of a systemic artery to the side of the pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; patients]
<Options>: A: goes
B: species
C: suborder
D: human (aka homo sapiens)
E: cancer
F: other (aka unidentified)
G: probles
H: subsection
I: mouse (aka mus musculus)
J: None of the above. | [D; D] |
<Instruct>: Given the context 'Though the patient has been markedly improved, it is recognized that the result is not as good as is commonly obtained when patients with more adequate pulmonary arteries are treated by the conventional anastomosis of a systemic artery to the side of the pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; patients]
<Options>: A: probles
B: proxys
C: circe
D: isolate
E: mouse (aka mus musculus)
F: cancer
G: species
H: human (aka homo sapiens)
I: kingdom
J: None of the above. | [H; H] |
<Instruct>: Given the context 'Nevertheless, the patient has thus far been given such good health and relatively normal capacity for ordinary activity that further operation has seemed unwarranted, though the possibility of some future attempt at creation of an additional shunt is being kept in mind.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: other (aka unidentified)
B: probles
C: human (aka homo sapiens)
D: subsection
E: circe
F: None of the above. | [C] |
<Instruct>: Given the context 'Nevertheless, the patient has thus far been given such good health and relatively normal capacity for ordinary activity that further operation has seemed unwarranted, though the possibility of some future attempt at creation of an additional shunt is being kept in mind.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: other (aka unidentified)
B: circe
C: probles
D: subsection
E: None of the above. | [E] |
<Instruct>: Given the context 'TREATMENT OF TETRALOGY OF FALLOT
Case reports
The first patient was a fully grown young man of 17 with tetralogy of Fallot which caused considerable incapacity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; man]
<Options>: A: theraps
B: circe
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: this
E: homo sapiens (human) (aka homo sapiens)
F: cancer
G: probles
H: species
I: kingdom
J: None of the above. | [E; E] |
<Instruct>: Given the context 'TREATMENT OF TETRALOGY OF FALLOT
Case reports
The first patient was a fully grown young man of 17 with tetralogy of Fallot which caused considerable incapacity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; man]
<Options>: A: aides
B: human (aka homo sapiens)
C: neanderthal man (aka homo sapiens neanderthalensis)
D: species
E: mus musculus (house mouse) (aka mus musculus)
F: mus <subgenus> (mus (aka mus <subgenus>))
G: data
H: probles
I: isolate
J: None of the above. | [B; B] |
<Instruct>: Given the context 'The patient had an uneventful convalescence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: proxys
C: this
D: isolate
E: goes
F: None of the above. | [A] |
<Instruct>: Given the context 'The second patient was a 16-year-old boy who had been cyanotic since birth.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; boy]
<Options>: A: genus
B: humans (aka homo)
C: mouse (aka mus musculus)
D: proeces
E: species
F: avian (aka aves)
G: this
H: proxys
I: human (aka homo sapiens)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'The second patient was a 16-year-old boy who had been cyanotic since birth.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; boy]
<Options>: A: theraps
B: kingdom
C: proeces
D: suborder
E: other (aka unidentified)
F: gallus
G: data
H: birds (aka aves)
I: homo sapiens (human) (aka homo sapiens)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'The operation performed in my first patient constitutes in reality the use of the subclavian artery as an autogenous graft between the aorta and pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: subsection
B: suborder
C: proxys
D: human (aka homo sapiens)
E: theraps
F: None of the above. | [D] |
<Instruct>: Given the context 'The operation performed in my first patient constitutes in reality the use of the subclavian artery as an autogenous graft between the aorta and pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: suborder
B: proxys
C: theraps
D: subsection
E: None of the above. | [E] |
<Instruct>: Given the context 'Observation on arterial grafts in dogs.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [dogs]
<Options>: A: felis domesticus (aka felis catus)
B: canis canis (aka canis lupus familiaris)
C: bovidae
D: canis
E: felis
F: None of the above. | [B] |
<Instruct>: Given the context 'Report of transplantation of preserved arterial grafts in nine human cases.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: humans (aka homo)
B: cellular organisms (biota) (aka cellular organisms)
C: probles
D: avian (aka aves)
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Organization and structure of the mouse interleukin-2 gene.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: house mouse (aka mus musculus)
C: mus cricetus (aka cricetus cricetus)
D: mus sp. (mice (aka mus sp.))
E: peromyscus
F: None of the above. | [B] |
<Instruct>: Given the context 'Abstract
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus musculus (house mouse) (aka mus musculus)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus norvegicus (aka rattus norvegicus)
F: None of the above. | [B] |
<Instruct>: Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: humans (aka homo)
B: homo sapiens (human) (aka homo sapiens)
C: this
D: biota (aka cellular organisms)
E: probles
F: None of the above. | [B] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: this
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mouse (aka mus musculus)
D: mus molossinus (aka mus musculus molossinus)
E: homo sapiens (human) (aka homo sapiens)
F: neandertal man (aka homo sapiens neanderthalensis)
G: mus sp. (mice (aka mus sp.))
H: mouse (aka mus <genus>)
I: birds (aka aves)
J: None of the above. | [C; E] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: birds (aka aves)
C: species
D: mice (aka mus sp.) (aka mus sp.)
E: genus
F: mus cricetus (aka cricetus cricetus)
G: house mouse (aka mus musculus)
H: probles
I: mus molossinus (aka mus musculus molossinus)
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | [G; J] |
<Instruct>: Given the context 'Images
Volume 12 Number 24 1984 Nucleic Acids Research
Organization and structure of the mouse interleukin-2 gene
Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi?
Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan
Received 10 October 1984; Revised and Accepted 20 November 1984
ABSTRACT
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; murine]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mouse (aka mus musculus)
D: mice (aka mus <genus>) (aka mus <genus>)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: mice (aka mus sp.) (aka mus sp.)
G: mus (aka mus <genus>) (aka mus <genus>)
H: mus norvegicus (aka rattus norvegicus)
I: mus domesticus (aka mus musculus domesticus)
J: None of the above. | [C; C] |
<Instruct>: Given the context 'Images
Volume 12 Number 24 1984 Nucleic Acids Research
Organization and structure of the mouse interleukin-2 gene
Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi?
Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan
Received 10 October 1984; Revised and Accepted 20 November 1984
ABSTRACT
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; murine]
<Options>: A: mouse (aka mus <genus>)
B: mus domesticus (aka mus musculus domesticus)
C: mice (aka mus sp.) (aka mus sp.)
D: mus musculus (house mouse) (aka mus musculus)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: mus cricetus (aka cricetus cricetus)
G: peromyscus
H: mus norvegicus (aka rattus norvegicus)
I: None of the above. | [D; D] |
<Instruct>: Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: suborder
C: birds (aka aves)
D: mammals (aka mammalia)
E: primate (aka primates)
F: None of the above. | [A] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: neanderthal man (aka homo sapiens neanderthalensis)
B: mus (aka mus <genus>) (aka mus <genus>)
C: homo sapiens (human) (aka homo sapiens)
D: this
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: peromyscus
G: house mouse (aka mus musculus)
H: macrobiotus sapiens
I: eastern european house mouse (aka mus musculus musculus)
J: kingdom
K: None of the above. | [G; C] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: human (aka homo sapiens)
B: mus <genus> (mice (aka mus <genus>))
C: mus cricetus (aka cricetus cricetus)
D: mammals (aka mammalia)
E: house mouse (aka mus musculus)
F: mus (aka mus <subgenus>) (aka mus <subgenus>)
G: homo (humans) (aka homo)
H: species
I: kingdom
J: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
K: None of the above. | [E; A] |
<Instruct>: Given the context 'We previously reported isolation and sequence analysis of the cDNA for human IL-2 (8), as well as the chromosomal gene (9).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: birds (aka aves)
B: genus
C: kingdom
D: homo sapiens (human) (aka homo sapiens)
E: this
F: None of the above. | [D] |
<Instruct>: Given the context 'More recently, we have isolated a cDNA which encodes murine IL-2 (Kashima et al., submitted for publication). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mouse (aka mus <genus>)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mus sp. (mice (aka mus sp.))
D: house mouse (aka mus musculus)
E: peromyscus
F: None of the above. | [D] |
<Instruct>: Given the context 'More recently, we have isolated a cDNA which encodes murine IL-2 (Kashima et al., submitted for publication). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus sp. (mice (aka mus sp.))
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mouse (aka mus <genus>)
D: peromyscus
E: None of the above. | [E] |
<Instruct>: Given the context 'In order to study the structure of the murine IL-2 chromosomal gene and its controlling region, we isolated and analysed a A phage clone containing the gene and its flanking sequences.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mouse (aka mus musculus)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus cricetus (aka cricetus cricetus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [B] |
<Instruct>: Given the context 'MATERIALS AND METHODS
Southern blotting of total mouse DNA
Mouse chromosomal DNA was extracted from liver of BALB/c6
?', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mouse (aka mus musculus)
D: western european house mouse (aka mus musculus domesticus)
E: peromyscus
F: None of the above. | [C] |
<Instruct>: Given the context 'Nucleic Acids Research
Volume 12 Number 24 1984
9323
Nucleic Acids Research
mouse as described before (10).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus domesticus (aka mus musculus domesticus)
C: mouse (aka mus <genus>)
D: mus molossinus (aka mus musculus molossinus)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Screening of genomic DNA library
A bacteriophage XCharon 4A/mouse genomic DNA library prepared with partial EcoRI digests of mouse DNA from MPC 11 plasmacytoma cells was kindly provided by Dr. T. Honjo.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: peromyscus
C: mus (aka mus <genus>) (aka mus <genus>)
D: eastern european house mouse (aka mus musculus musculus)
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Mouse IL-2-specific clones were screened by the method of Benton and Davis (12), using 700 bp PstI-AccI fragment of a cDNA clone, pMIL2-45 as the probe (Kashima et al., submitted for publication). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: mus musculus (house mouse) (aka mus musculus)
C: mus <subgenus> (mus (aka mus <subgenus>))
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [B] |
<Instruct>: Given the context 'Subcloninq and sequencing of the mouse IL-2 gene
Two EcoRI fragments of 3.3 Kbp and 2.8 Kbp from the positive recombinant X phage were subcloned into EcoRI site of plasmid pBR322. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mus sp. (mice (aka mus sp.))
C: peromyscus
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'RESULTS
Total DNA blotting analysis
In order to study structural organization of the mouse IL-2 gene, we first subjected total mouse DNA to the blotting analysis by using various probes specific for IL-2 gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus (house mouse) (aka mus musculus)
E: western european house mouse (aka mus musculus domesticus)
F: None of the above. | [D] |
<Instruct>: Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: this
C: animals (aka metazoa)
D: mus domesticus (aka mus musculus domesticus)
E: homo sapiens (human) (aka homo sapiens)
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: species
H: mammals (aka mammalia)
I: mus molossinus (aka mus musculus molossinus)
J: mouse (aka mus musculus)
K: None of the above. | [J; E] |
<Instruct>: Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus domesticus (aka mus musculus domesticus)
B: animals (aka metazoa)
C: eastern european house mouse (aka mus musculus musculus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: species
F: suborder
G: human (aka homo sapiens)
H: mus musculus (house mouse) (aka mus musculus)
I: mammals (aka mammalia)
J: peromyscus
K: None of the above. | [H; G] |
<Instruct>: Given the context 'Additional bands corresponding to those observed by using mouse IL-2 cDNA probes (lane 13-17) also appeared by longer
9324
Nucleic Acids Research
M 1 2 3 4 M 5 6 7 8 M 9 101112 M 13 141516 17
a~ ~ 3 ..
I pMIL2-45 SacI Acc I
CZI~~1 1t L2- 20
Acc I
1 00', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus <genus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus sp. (mice (aka mus sp.))
D: mus musculus (house mouse) (aka mus musculus)
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [D] |
<Instruct>: Given the context '1. Blot hybridization analysis of mouse chromosomal DNA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus <genus>)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus molossinus (aka mus musculus molossinus)
D: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'High molecular DNA prepared from Liver BALB/C6 mouse was digested with various restriction endonucleases (BamHI for lanes 1, 5, 9, 13 ; EcoRI for lanes 2, 6, 10, 14, 17 ; HindIII for lanes 3, 7, 11, 15 ; XbaI for lanes 4, 8, 12, 16 ).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mus cricetus (aka cricetus cricetus)
C: mus musculus (house mouse) (aka mus musculus)
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: peromyscus
F: None of the above. | [C] |
<Instruct>: Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: eastern european house mouse (aka mus musculus musculus)
C: mus cricetus (aka cricetus cricetus)
D: eutherian mammals (aka eutheria)
E: mouse (aka mus musculus)
F: human (aka homo sapiens)
G: mammals (aka mammalia)
H: suborder
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: birds (aka aves)
K: None of the above. | [F; E] |
<Instruct>: Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: this
D: species
E: mus (aka mus <genus>) (aka mus <genus>)
F: birds (aka aves)
G: mice (aka mus sp.) (aka mus sp.)
H: human (aka homo sapiens)
I: peromyscus
J: genus
K: None of the above. | [H; A] |
<Instruct>: Given the context 'Brief restriction endonuclease cleavage map for the mouse IL-2 cDNAs is presented in the lower part of the figure.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mouse (aka mus musculus)
D: mus sp. (mice (aka mus sp.))
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: None of the above. | [C] |
<Instruct>: Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: peromyscus
B: species
C: human (aka homo sapiens)
D: mus cricetus (aka cricetus cricetus)
E: house mouse (aka mus musculus)
F: avian (aka aves)
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: mus <subgenus> (mus (aka mus <subgenus>))
I: animals (aka metazoa)
J: probles
K: None of the above. | [C; E] |
<Instruct>: Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: biota (aka cellular organisms)
B: mouse (aka mus musculus)
C: animals (aka metazoa)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: birds (aka aves)
F: homo sapiens (human) (aka homo sapiens)
G: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
H: mus domesticus (aka mus musculus domesticus)
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: primate (aka primates)
K: None of the above. | [F; B] |
<Instruct>: Given the context 'When the PstI insert of a mouse IL-2 cDNA clone, pMIL2-20, was used as the probe, a simple pattern was
9325
Nucleic Acids Research
obtained at higher stringent condition (lane 13-17). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus cricetus (aka cricetus cricetus)
C: mus (aka mus <genus>) (aka mus <genus>)
D: mouse (aka mus musculus)
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [D] |
<Instruct>: Given the context 'The 3.3 kb band was similar in its size with the positive band which became detectable by probing the same DNA with the 7.0 kb human DNA probe (Fig. 1, lane 2).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: humans (aka homo)
B: mammals (aka mammalia)
C: suborder
D: this
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'BamHI digest of the mouse DNA (Fig. 1, lane 1, 13) constantly gave a very faint signal which would correspond to a DNA larger than 15 kb. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: mice (aka mus sp.) (aka mus sp.)
D: mus molossinus (aka mus musculus molossinus)
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Taken together, the results suggested the presence of a single copy gene for murine IL-2. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus norvegicus (aka rattus norvegicus)
C: mus musculus (house mouse) (aka mus musculus)
D: western european house mouse (aka mus musculus domesticus)
E: peromyscus
F: None of the above. | [C] |
<Instruct>: Given the context 'On the other hand appearance of the multiple positive bands at lower stringent washing condition (lane 9-12) indicates the presence of IL-2 related sequences within the mouse genome.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: peromyscus
C: western european house mouse (aka mus musculus domesticus)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Screening of recombinant phaqe libraries
We next screened a gene library from partial EcoRIdigested DNA from MPC 11 cells and by using 0.8 Kbp SacI-AccI cDNA fragment as the probe and isolated 14 positive clones containing sequences specific to the mouse IL-2 gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: house mouse (aka mus musculus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mice (aka mus sp.) (aka mus sp.)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: None of the above. | [B] |
<Instruct>: Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mouse (aka mus <genus>)
C: human (aka homo sapiens)
D: this
E: kingdom
F: eutherian mammals (aka eutheria)
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: mus molossinus (aka mus musculus molossinus)
I: mus cricetus (aka cricetus cricetus)
J: homo (humans) (aka homo)
K: None of the above. | [A; C] |
<Instruct>: Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus <genus> (mice (aka mus <genus>))
C: humans (aka homo)
D: homo sapiens (human) (aka homo sapiens)
E: mice (aka mus sp.) (aka mus sp.)
F: genus
G: house mouse (aka mus musculus)
H: biota (aka cellular organisms)
I: mus molossinus (aka mus musculus molossinus)
J: primate (aka primates)
K: None of the above. | [G; D] |
<Instruct>: Given the context 'Restriction map and sequencing strategy of mouse IL-2 gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus musculus)
B: mus <genus> (mice (aka mus <genus>))
C: western european house mouse (aka mus musculus domesticus)
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Horizontal lines indicate the length of mouse DNA inserted into the X phage Charon 4A or plasmid subclones. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: house mouse (aka mus musculus)
C: mice (aka mus sp.) (aka mus sp.)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus <genus> (mice (aka mus <genus>))
F: None of the above. | [B] |
<Instruct>: Given the context 'As seen also in the murine IL-2 cDNA, there is an unusual repeat of CAG triplet coding for 12 glutamine residues in a row in the first exon.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus sp. (mice (aka mus sp.))
B: house mouse (aka mus musculus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus cricetus (aka cricetus cricetus)
E: mice (aka mus <genus>) (aka mus <genus>)
F: None of the above. | [B] |
<Instruct>: Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: kingdom
B: peromyscus
C: mus cricetus (aka cricetus cricetus)
D: homo sapiens (human) (aka homo sapiens)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: primate (aka primates)
G: probles
H: mus sp. (mice (aka mus sp.))
I: mammals (aka mammalia)
J: house mouse (aka mus musculus)
K: None of the above. | [D; J] |
<Instruct>: Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mice (aka mus sp.) (aka mus sp.)
D: mus cricetus (aka cricetus cricetus)
E: house mouse (aka mus musculus)
F: this
G: mammals (aka mammalia)
H: homo sapiens (human) (aka homo sapiens)
I: probles
J: biota (aka cellular organisms)
K: None of the above. | [H; E] |
<Instruct>: Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: biota (aka cellular organisms)
C: this
D: mice (aka mus sp.) (aka mus sp.)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: mus molossinus (aka mus musculus molossinus)
G: mammals (aka mammalia)
H: house mouse (aka mus musculus)
I: probles
J: None of the above. | [J; H] |
<Instruct>: Given the context 'There are two potential poly (A) addition signals within the mouse gene (nucleotide positions 793 - 798 and 924 - 929 in Fig. 3 ) and, based on our sequence data for various cDNA clones, both signals seem to function and give rise to heterogeneous termini of the mRNA in the LBRM-33 cells (16).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: house mouse (aka mus musculus)
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: mus sp. (mice (aka mus sp.))
E: mus <subgenus> (mus (aka mus <subgenus>))
F: None of the above. | [B] |
<Instruct>: Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus sp. (mice (aka mus sp.))
B: homo sapiens (human) (aka homo sapiens)
C: animals (aka metazoa)
D: probles
E: peromyscus
F: mouse (aka mus musculus)
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: species
I: mus <subgenus> (mus (aka mus <subgenus>))
J: homo (humans) (aka homo)
K: None of the above. | [F; B] |
<Instruct>: Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: suborder
C: macrobiotus sapiens
D: mus musculus (house mouse) (aka mus musculus)
E: mammals (aka mammalia)
F: primate (aka primates)
G: mus molossinus (aka mus musculus molossinus)
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: homo sapiens (human) (aka homo sapiens)
J: peromyscus
K: None of the above. | [D; I] |
<Instruct>: Given the context 'Nucleotide sequence of mouse IL-2 gene. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: peromyscus
C: mice (aka mus sp.) (aka mus sp.)
D: mouse (aka mus musculus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [D] |
<Instruct>: Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: peromyscus
B: kingdom
C: eutherian mammals (aka eutheria)
D: species
E: this
F: mus molossinus (aka mus musculus molossinus)
G: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
H: mus <genus> (mice (aka mus <genus>))
I: mouse (aka mus musculus)
J: human (aka homo sapiens)
K: None of the above. | [I; J] |
<Instruct>: Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: mus sp. (mice (aka mus sp.))
C: genus
D: birds (aka aves)
E: mus musculus (house mouse) (aka mus musculus)
F: western european house mouse (aka mus musculus domesticus)
G: mus molossinus (aka mus musculus molossinus)
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: suborder
J: animals (aka metazoa)
K: None of the above. | [E; A] |
<Instruct>: Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mus molossinus (aka mus musculus molossinus)
C: birds (aka aves)
D: suborder
E: genus
F: western european house mouse (aka mus musculus domesticus)
G: mus sp. (mice (aka mus sp.))
H: mus musculus (house mouse) (aka mus musculus)
I: animals (aka metazoa)
J: None of the above. | [H; J] |
<Instruct>: Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: house mouse (aka mus musculus)
B: this
C: mammals (aka mammalia)
D: mus domesticus (aka mus musculus domesticus)
E: mus sp. (mice (aka mus sp.))
F: macrobiotus sapiens
G: mus <genus> (mice (aka mus <genus>))
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: genus
J: human (aka homo sapiens)
K: None of the above. | [A; J] |
<Instruct>: Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: avian (aka aves)
B: homo (humans) (aka homo)
C: suborder
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mice (aka mus sp.) (aka mus sp.)
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
H: mouse (aka mus musculus)
I: mammals (aka mammalia)
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | [H; J] |
<Instruct>: Given the context 'We have isolated recombinant clones for mouse IL-2 gene from a phage Charon 4A/mouse genomic DNA library and determined the entire sequence of the gene except for the sequence of the internal portion of the second and third introns. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: eastern european house mouse (aka mus musculus musculus)
C: peromyscus
D: mouse (aka mus musculus)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: None of the above. | [D] |
<Instruct>: Given the context 'The mouse IL-2 cDNA sequence was aligned with the genomic sequence and both sequences matched completely each other.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus sp. (mice (aka mus sp.))
D: mus domesticus (aka mus musculus domesticus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: None of the above. | [A] |
<Instruct>: Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: mus cricetus (aka cricetus cricetus)
C: suborder
D: eutherian mammals (aka eutheria)
E: mus musculus (house mouse) (aka mus musculus)
F: peromyscus
G: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
H: primate (aka primates)
I: kingdom
J: eastern european house mouse (aka mus musculus musculus)
K: None of the above. | [A; E] |
<Instruct>: Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: homo (humans) (aka homo)
C: avian (aka aves)
D: eutherian mammals (aka eutheria)
E: cellular organisms (biota) (aka cellular organisms)
F: mouse (aka mus musculus)
G: mus (aka mus <genus>) (aka mus <genus>)
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: mice (aka mus sp.) (aka mus sp.)
J: human (aka homo sapiens)
K: None of the above. | [J; F] |
<Instruct>: Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: avian (aka aves)
B: human (aka homo sapiens)
C: homo (humans) (aka homo)
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mice (aka mus sp.) (aka mus sp.)
F: mus (aka mus <genus>) (aka mus <genus>)
G: cellular organisms (biota) (aka cellular organisms)
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: eutherian mammals (aka eutheria)
J: None of the above. | [B; J] |
<Instruct>: Given the context '9329
Nucleic Acids Research
Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus domesticus (aka mus musculus domesticus)
B: mus sp. (mice (aka mus sp.))
C: animals (aka metazoa)
D: primate (aka primates)
E: human (aka homo sapiens)
F: suborder
G: mus molossinus (aka mus musculus molossinus)
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: house mouse (aka mus musculus)
J: mammals (aka mammalia)
K: None of the above. | [I; E] |
<Instruct>: Given the context '9329
Nucleic Acids Research
Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mouse (aka mus <genus>)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: suborder
E: mus <subgenus> (mus (aka mus <subgenus>))
F: humans (aka homo)
G: mouse (aka mus musculus)
H: biota (aka cellular organisms)
I: animals (aka metazoa)
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | [G; J] |
<Instruct>: Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus sp. (mice (aka mus sp.))
D: homo (humans) (aka homo)
E: biota (aka cellular organisms)
F: macrobiotus sapiens
G: human (aka homo sapiens)
H: mus <subgenus> (mus (aka mus <subgenus>))
I: suborder
J: peromyscus
K: None of the above. | [A; G] |
<Instruct>: Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: eutherian mammals (aka eutheria)
B: mus sp. (mice (aka mus sp.))
C: avian (aka aves)
D: mus <genus> (mice (aka mus <genus>))
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: human (aka homo sapiens)
G: primate (aka primates)
H: mammals (aka mammalia)
I: western european house mouse (aka mus musculus domesticus)
J: house mouse (aka mus musculus)
K: None of the above. | [J; F] |
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine; human]
<Options>: A: cellular organisms (biota) (aka cellular organisms)
B: mus norvegicus (aka rattus norvegicus)
C: homo sapiens (human) (aka homo sapiens)
D: homo (humans) (aka homo)
E: primate (aka primates)
F: genus
G: house mouse (aka mus musculus)
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: eastern european house mouse (aka mus musculus musculus)
J: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
K: None of the above. | [G; C] |
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine; human]
<Options>: A: house mouse (aka mus musculus)
B: cellular organisms (biota) (aka cellular organisms)
C: primate (aka primates)
D: mus norvegicus (aka rattus norvegicus)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: genus
H: homo (humans) (aka homo)
I: eastern european house mouse (aka mus musculus musculus)
J: None of the above. | [A; J] |
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine; human]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: biota (aka cellular organisms)
C: house mouse (aka mus musculus)
D: homo sapiens (human) (aka homo sapiens)
E: eastern european house mouse (aka mus musculus musculus)
F: humans (aka homo)
G: species
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: suborder
J: mus norvegicus (aka rattus norvegicus)
K: None of the above. | [C; D] |
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: cellular organisms (biota) (aka cellular organisms)
D: mus domesticus (aka mus musculus domesticus)
E: suborder
F: this
G: species
H: mus cricetus (aka cricetus cricetus)
I: mus musculus (house mouse) (aka mus musculus)
J: peromyscus
K: None of the above. | [A; I] |
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: human (aka homo sapiens)
B: avian (aka aves)
C: mus <subgenus> (mus (aka mus <subgenus>))
D: mus cricetus (aka cricetus cricetus)
E: mus musculus (house mouse) (aka mus musculus)
F: cellular organisms (biota) (aka cellular organisms)
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: mammals (aka mammalia)
I: probles
J: mus sp. (mice (aka mus sp.))
K: None of the above. | [A; E] |
<Instruct>: Given the context 'Since we have not yet determined the nucleotide sequence further upstream of the mouse gene, we do not know whether or not this similarity extends further. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: mus molossinus (aka mus musculus molossinus)
C: mice (aka mus sp.) (aka mus sp.)
D: mouse (aka mus musculus)
E: peromyscus
F: None of the above. | [D] |
<Instruct>: Given the context 'Our preliminary results indicate that the 5 '-flanking sequence of the human IL-2 gene mediates mitogen induced expression of the gene in T-lymphocytic cells (Fujita & Taniguchi, unpublished observation).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: eutherian mammals (aka eutheria)
B: homo sapiens (human) (aka homo sapiens)
C: mammals (aka mammalia)
D: macrobiotus sapiens
E: biota (aka cellular organisms)
F: None of the above. | [B] |
<Instruct>: Given the context 'We thank Dr. T. Honjo for mouse gene library. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: mouse (aka mus <genus>)
C: mouse (aka mus musculus)
D: mus cricetus (aka cricetus cricetus)
E: western european house mouse (aka mus musculus domesticus)
F: None of the above. | [C] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.