instruction stringlengths 161 2.29k | input stringlengths 80 650 | response stringclasses 6 values |
|---|---|---|
<Instruct>: Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: probles
B: macrobiotus sapiens
C: homo sapiens (human) (aka homo sapiens)
D: species
E: animals (aka metazoa)
F: None of the above. | C |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: suborder
C: species
D: animals (aka metazoa)
E: probles
F: None of the above. | A |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mice (aka mus sp.) (aka mus sp.)
C: eastern european house mouse (aka mus musculus musculus)
D: mouse (aka mus musculus)
E: mus cricetus (aka cricetus cricetus)
F: None of the above. | D |
<Instruct>: Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', select the correct biomedical concept corresponding to 'canis familiaris'. Answer using one of the provided options. | <Options>: A: canis indica (canis lupus indica) (aka canis indica)
B: dog (aka canis lupus familiaris) (aka canis lupus familiaris)
C: canis
D: domestic cat (aka felis catus)
E: canis vulpes (aka vulpes vulpes)
F: None of the above. | B |
<Instruct>: Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus cricetus (aka cricetus cricetus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mouse (aka mus musculus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus sp. (mice (aka mus sp.))
F: None of the above. | C |
<Instruct>: Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: eutherian mammals (aka eutheria)
B: this
C: human (aka homo sapiens)
D: suborder
E: cellular organisms (biota) (aka cellular organisms)
F: None of the above. | C |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces hansenii (aka debaryomyces hansenii)
B: saccharomyces cf. cerevisiae
C: saccharomycodes
D: saccharomyces sp.
E: brewer's yeast (aka saccharomyces cerevisiae)
F: None of the above. | E |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept corresponding to 'saccharomyces cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
B: saccharomyces paradoxus
C: saccharomyces uvarum (saccharomyces bayanus var. uvarum) (aka saccharomyces uvarum)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: saccharomyces sp.
F: None of the above. | A |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept corresponding to 'saccharomyces cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae
B: saccharomyces paradoxus
C: saccharomyces lactis (aka kluyveromyces lactis)
D: saccharomyces cerevisiae x saccharomyces uvarum
E: saccharomyces hansenii (aka debaryomyces hansenii)
F: None of the above. | F |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces sp.
B: candida/saccharomycetales (aka candida/saccharomycales clade)
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: brewer's yeast (aka saccharomyces cerevisiae)
E: saccharomyces lactis (aka kluyveromyces lactis)
F: None of the above. | D |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept corresponding to 'saccharomyces cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces albicans (aka candida albicans)
B: saccharomyces italicus (aka saccharomyces cerevisiae)
C: saccharomyces lactis (aka kluyveromyces lactis)
D: saccharomyces cf. cerevisiae
E: saccharomyces cerevisiae synthetic construct
F: None of the above. | B |
<Instruct>: Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: brewer's yeast (aka saccharomyces cerevisiae)
B: saccharomyces cerevisiae x saccharomyces mikatae
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: saccharomycodes
F: None of the above. | A |
<Instruct>: Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: mycoderma cerevisiae (aka saccharomyces cerevisiae)
B: candida/saccharomycetales (aka candida/saccharomycales clade)
C: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
D: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
E: saccharomyces cerevisiae x saccharomyces mikatae
F: None of the above. | A |
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: kingdom
B: homo sapiens (human) (aka homo sapiens)
C: mammals (aka mammalia)
D: species
E: primate (aka primates)
F: None of the above. | B |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: mammals (aka mammalia)
C: humans (aka homo)
D: suborder
E: species
F: None of the above. | A |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyceta
B: baker's yeast (aka saccharomyces cerevisiae)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: saccharomyces lactis (aka kluyveromyces lactis)
E: candida/saccharomycetales (aka candida/saccharomycales clade)
F: None of the above. | B |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyceta
B: saccharomyces cf. cerevisiae
C: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
D: candida/saccharomycetales (aka candida/saccharomycales clade)
E: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
F: None of the above. | E |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept corresponding to 's.cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae x saccharomyces paradoxus
B: saccharomyces paradoxus
C: saccharomyces cerevisiae synthetic construct
D: baker's yeast (aka saccharomyces cerevisiae)
E: saccharomyces hansenii (aka debaryomyces hansenii)
F: None of the above. | D |
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept corresponding to 'schizosaccharomyces pombe'. Answer using one of the provided options. | <Options>: A: schizosaccharomyces japonicus (schizosaccharomyces japonicus var. versatilis) (aka schizosaccharomyces japonicus)
B: zygosaccharomyces
C: schizosaccharomyces
D: fission yeast (aka schizosaccharomyces pombe)
E: schizosaccharomycetaceae (schizosaccharomycetoideae) (aka schizosaccharomycetaceae)
F: None of the above. | D |
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept corresponding to 'schizosaccharomyces pombe'. Answer using one of the provided options. | <Options>: A: schizosaccharomyces osmophilus
B: zygosaccharomyces
C: schizosaccharomyces
D: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes)
E: schizosaccharomycetales
F: None of the above. | F |
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: placental mammals (aka eutheria)
B: homo sapiens (human) (aka homo sapiens)
C: suborder
D: genus
E: mammals (aka mammalia)
F: None of the above. | B |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: placental mammals (aka eutheria)
B: genus
C: primate (aka primates)
D: macrobiotus sapiens
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomycodes
D: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
F: None of the above. | E |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: homo (humans) (aka homo)
C: suborder
D: this
E: avian (aka aves)
F: None of the above. | A |
<Instruct>: Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: animals (aka metazoa)
B: avian (aka aves)
C: mammals (aka mammalia)
D: homo sapiens (human) (aka homo sapiens)
E: cellular organisms (biota) (aka cellular organisms)
F: None of the above. | D |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: mice (aka mus <genus>) (aka mus <genus>)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mouse (aka mus musculus)
E: mus cricetus (aka cricetus cricetus)
F: None of the above. | D |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept corresponding to 'donkey'. Answer using one of the provided options. | <Options>: A: horse (aka equus caballus)
B: equus asinus asinus
C: equus ferus (equus caballus ferus) (aka equus ferus)
D: african wild ass (aka equus asinus)
E: equus subg. asinus (aka equus)
F: None of the above. | D |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mouse (aka mus musculus)
C: mouse (aka mus <genus>)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | B |
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mice (aka mus sp.) (aka mus sp.)
B: mus musculus (house mouse) (aka mus musculus)
C: mus <subgenus> (mus (aka mus <subgenus>))
D: mus molossinus (aka mus musculus molossinus)
E: mus <genus> (mice (aka mus <genus>))
F: None of the above. | B |
<Instruct>: Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
B: true yeasts (aka saccharomycotina)
C: saccharomyces sp.
D: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
F: None of the above. | E |
<Instruct>: Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
D: saccharomyces cerevisiae x saccharomyces mikatae
E: saccharomycodes
F: None of the above. | F |
<Instruct>: Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', select the correct biomedical concept corresponding to 'staphylococcus aureus'. Answer using one of the provided options. | <Options>: A: staphylococcus group (aka staphylococcaceae)
B: staphylococcus sp. s
C: micrococcus aureus (aka staphylococcus aureus)
D: staphylococcus (aurococcus) (aka staphylococcus)
E: staphylococcus staphylolyticus (aka staphylococcus simulans bv. staphylolyticus)
F: None of the above. | C |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: placental mammals (aka eutheria)
B: genus
C: human (aka homo sapiens)
D: cellular organisms (biota) (aka cellular organisms)
E: avian (aka aves)
F: None of the above. | C |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept corresponding to 'drosophila'. Answer using one of the provided options. | <Options>: A: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
B: drosophila <basidiomycete fungi> (drosophila) (aka drosophila <basidiomycete fungi>)
C: melanogaster group
D: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>)
E: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>)
F: None of the above. | A |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept corresponding to 'caenorhabditis elegans'. Answer using one of the provided options. | <Options>: A: rhabditis elegans (aka caenorhabditis elegans)
B: bactris elegans
C: uronema elegans
D: polyzonia elegans
E: caenorhabditis
F: None of the above. | A |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: suborder
C: primate (aka primates)
D: homo (humans) (aka homo)
E: macrobiotus sapiens
F: None of the above. | A |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: baker's yeast (aka saccharomyces cerevisiae)
B: saccharomyces sp.
C: saccharomyces cf. cerevisiae
D: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces albicans (aka candida albicans)
F: None of the above. | A |
<Instruct>: Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: kingdom
C: human (aka homo sapiens)
D: mammals (aka mammalia)
E: this
F: None of the above. | C |
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: species
C: primate (aka primates)
D: animals (aka metazoa)
E: suborder
F: None of the above. | A |
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: this
B: primate (aka primates)
C: macrobiotus sapiens
D: human (aka homo sapiens)
E: animals (aka metazoa)
F: None of the above. | D |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: probles
B: homo sapiens (human) (aka homo sapiens)
C: this
D: kingdom
E: birds (aka aves)
F: None of the above. | B |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: probles
B: macrobiotus sapiens
C: biota (aka cellular organisms)
D: suborder
E: kingdom
F: None of the above. | F |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: placental mammals (aka eutheria)
C: kingdom
D: species
E: suborder
F: None of the above. | A |
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: this
B: human (aka homo sapiens)
C: probles
D: primate (aka primates)
E: cellular organisms (biota) (aka cellular organisms)
F: None of the above. | B |
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: mammals (aka mammalia)
C: homo sapiens (human) (aka homo sapiens)
D: biota (aka cellular organisms)
E: humans (aka homo)
F: None of the above. | C |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 's.pombe'. Answer using one of the provided options. | <Options>: A: sphaerosoma <ascomycete fungi> (sphaerosoma) (aka sphaerosoma <ascomycete fungi>)
B: schizosaccharomyces kambucha x schizosaccharomyces pombe
C: zygosaccharomyces
D: fission yeast (aka schizosaccharomyces pombe)
E: schizosaccharomyces pombe oy26
F: None of the above. | D |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'arabidopsis thaliana'. Answer using one of the provided options. | <Options>: A: fabiana
B: euphyia
C: arabidella
D: arabidopsis thaliana x arabidopsis lyrata
E: thale-cress (aka arabidopsis thaliana)
F: None of the above. | E |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'c.elegans'. Answer using one of the provided options. | <Options>: A: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
B: caenorhabditis
C: drosophila elegans
D: caromyxa elegans (aka mutinus elegans)
E: myzomyia elegans (aka anopheles elegans)
F: None of the above. | A |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'drosophila melanogaster'. Answer using one of the provided options. | <Options>: A: melanogaster group
B: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>)
C: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
D: melanogaster subgroup
E: hawaiian drosophila
F: None of the above. | C |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mouse (aka mus musculus)
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: peromyscus
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | A |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: eutherian mammals (aka eutheria)
B: human (aka homo sapiens)
C: genus
D: mammals (aka mammalia)
E: primate (aka primates)
F: None of the above. | B |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
B: saccharomyces cf. cerevisiae
C: baker's yeast (aka saccharomyces cerevisiae)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: true yeasts (aka saccharomycotina)
F: None of the above. | C |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae x saccharomyces mikatae
B: saccharomyceta
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
E: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
F: None of the above. | F |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: biota (aka cellular organisms)
B: animals (aka metazoa)
C: human (aka homo sapiens)
D: genus
E: probles
F: None of the above. | C |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae
B: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
C: candida/saccharomycetales (aka candida/saccharomycales clade)
D: baker's yeast (aka saccharomyces cerevisiae)
E: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
F: None of the above. | D |
<Instruct>: Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: cellular organisms (biota) (aka cellular organisms)
B: mammals (aka mammalia)
C: homo sapiens (human) (aka homo sapiens)
D: species
E: this
F: None of the above. | C |
<Instruct>: Given the context 'DISCUSSION
ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
B: saccharomyces cerevisiae x saccharomyces mikatae
C: budding yeasts & others (aka saccharomycotina)
D: baker's yeast (aka saccharomyces cerevisiae)
E: saccharomyces albicans (aka candida albicans)
F: None of the above. | D |
<Instruct>: Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: baker's yeast (aka saccharomyces cerevisiae)
B: candida/saccharomycetales (aka candida/saccharomycales clade)
C: saccharomyces albicans (aka candida albicans)
D: saccharomycodes
E: saccharomyces sp.
F: None of the above. | A |
<Instruct>: Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: mycoderma cerevisiae (aka saccharomyces cerevisiae)
B: saccharomyceta
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomyces lactis (aka kluyveromyces lactis)
E: saccharomyces sp.
F: None of the above. | A |
<Instruct>: Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: suborder
B: species
C: biota (aka cellular organisms)
D: macrobiotus sapiens
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo (humans) (aka homo)
B: this
C: biota (aka cellular organisms)
D: homo sapiens (human) (aka homo sapiens)
E: genus
F: None of the above. | D |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: biota (aka cellular organisms)
B: animals (aka metazoa)
C: human (aka homo sapiens)
D: eutherian mammals (aka eutheria)
E: avian (aka aves)
F: None of the above. | C |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces sp.
B: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
C: saccharomyces cf. cerevisiae
D: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces lactis (aka kluyveromyces lactis)
F: None of the above. | B |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: candida/saccharomycetales (aka candida/saccharomycales clade)
D: saccharomyces lactis (aka kluyveromyces lactis)
E: saccharomyces sp.
F: None of the above. | F |
<Instruct>: Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: mammals (aka mammalia)
B: homo (humans) (aka homo)
C: genus
D: probles
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines
Abstract
Background
The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: species
B: human (aka homo sapiens)
C: mammals (aka mammalia)
D: animals (aka metazoa)
E: primate (aka primates)
F: None of the above. | B |
<Instruct>: Given the context 'Background
CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: probles
B: species
C: primate (aka primates)
D: human (aka homo sapiens)
E: kingdom
F: None of the above. | D |
<Instruct>: Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: macrobiotus sapiens
C: human (aka homo sapiens)
D: species
E: kingdom
F: None of the above. | C |
<Instruct>: Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: species
C: eutherian mammals (aka eutheria)
D: kingdom
E: animals (aka metazoa)
F: None of the above. | A |
<Instruct>: Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: domestic cattle (aka bos taurus)
B: bos (cattle) (aka bos)
C: bos taurus x bos indicus (aka bos indicus x bos taurus)
D: boveria
E: bos sp.
F: None of the above. | A |
<Instruct>: Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: avian (aka aves)
B: species
C: human (aka homo sapiens)
D: humans (aka homo)
E: mammals (aka mammalia)
F: None of the above. | C |
<Instruct>: Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: ox (aka bos taurus) (aka bos taurus)
B: bovidae
C: bos bubalis (aka bubalus bubalis)
D: bovinae
E: bos taurus x bos indicus (aka bos indicus x bos taurus)
F: None of the above. | A |
<Instruct>: Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population
Abstract
Objective
GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: eutherian mammals (aka eutheria)
B: kingdom
C: homo sapiens (human) (aka homo sapiens)
D: genus
E: primate (aka primates)
F: None of the above. | C |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: subsection
C: other (aka unidentified)
D: probles
E: mus <genus> (mice (aka mus <genus>))
F: None of the above. | A |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: aides
B: this
C: mouse (aka mus musculus)
D: subsection
E: genus
F: None of the above. | F |
<Instruct>: Given the context 'Introduction
Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: placental mammals (aka eutheria)
B: human (aka homo sapiens)
C: animals (aka metazoa)
D: kingdom
E: humans (aka homo)
F: None of the above. | B |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: mus musculus (house mouse) (aka mus musculus)
C: genus
D: circe
E: kingdom
F: None of the above. | A |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: probles
B: this
C: human (aka homo sapiens)
D: humans (aka homo)
E: chicken (aka gallus gallus)
F: None of the above. | C |
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', select the correct biomedical concept corresponding to 'children'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: birds (aka aves)
C: this
D: homo (humans) (aka homo)
E: family
F: None of the above. | A |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: china
B: avian (aka aves)
C: menetus
D: homo (humans) (aka homo)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menetes
B: menesia
C: menneus
D: menoidium
E: menkeleon
F: None of the above. | F |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: genus
B: humans (aka homo)
C: human (aka homo sapiens)
D: probles
E: subsection
F: None of the above. | C |
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept corresponding to 'participant'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: probles
C: other (aka unidentified)
D: cohort
E: primate (aka primates)
F: None of the above. | A |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: genus
B: probles
C: eutherian mammals (aka eutheria)
D: human (aka homo sapiens)
E: mouse (aka mus musculus)
F: None of the above. | D |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menigrates
B: menecleonus
C: menophra
D: menkeleon
E: menevia
F: None of the above. | F |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menigrates
B: menetes
C: menesia
D: menkeleon
E: menecles
F: None of the above. | F |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: probles
B: species
C: menetus
D: avian (aka aves)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menoidium
B: menkeleon
C: menenotus
D: menida
E: menneus
F: None of the above. | F |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: mouse (aka mus musculus)
B: mammals (aka mammalia)
C: eutherian mammals (aka eutheria)
D: human (aka homo sapiens)
E: avian (aka aves)
F: None of the above. | D |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menophra
B: menigrates
C: menosoma
D: menecles
E: menura
F: None of the above. | F |
<Instruct>: Given the context 'Several sequence changes have been reported in patients with familial or idiopathic short stature,11,26,27 whereas P8, P19, P20 and P25 (at positions 5165, 5681, 5686 and 6358, respectively, in the Genebank accession GI 183148) located in the promoter, intron 2 and intron 4 regions, respectively, had not been previously described.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: other (aka unidentified)
B: cancer
C: probles
D: theraps
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: avian (aka aves)
B: homo sapiens (human) (aka homo sapiens)
C: homo (humans) (aka homo)
D: mammals (aka mammalia)
E: eutherian mammals (aka eutheria)
F: None of the above. | B |
<Instruct>: Given the context 'The populations described to date comprised small numbers of normal-stature individuals,9 male adults with narrow height range12 or growth-retarded patients with/without GHD before achievement of adult height.9,11,12 Our study was designed to characterize the GH1 gene sequence variation in individuals within the whole range of normal adult height (between −2 and +2 SDS) according to the standards for our population.', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: probles
B: circe
C: human (aka homo sapiens)
D: genus
E: humans (aka homo)
F: None of the above. | C |
<Instruct>: Given the context 'Five single nucleotide changes are located in exon 5; of these five, three predict an amino acid change, and one of the three (Ile179Met) has been described by Lewis et al.27 in a paediatric patient with familial short stature and the other two, as yet undescribed, are contiguous in a single individual (Pro133Hys and Arg134Leu).', select the correct biomedical concept corresponding to 'patient'. Answer using one of the provided options. | <Options>: A: circe
B: probles
C: kingdom
D: goes
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Analysis of SNP association with adult height was subsequently performed to establish a body of knowledge useful for comparing patient genotypes and phenotypes.', select the correct biomedical concept corresponding to 'patient'. Answer using one of the provided options. | <Options>: A: suborder
B: proxys
C: humans (aka homo)
D: human (aka homo sapiens)
E: subsection
F: None of the above. | D |
<Instruct>: Given the context 'A recent study from Giordano et al.34 has shown a twofold reduced luciferase activity for the G nucleotide bearing promoter haplotype in transfected rat pituitary cells.', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options. | <Options>: A: rat (aka rattus) (aka rattus)
B: black rat (aka rattus rattus)
C: rattus norvegicus albus
D: rats (aka rattus sp.) (aka rattus sp.)
E: rattus norvegicus (rats (aka rattus norvegicus))
F: None of the above. | E |
<Instruct>: Given the context 'A recent study from Giordano et al.34 has shown a twofold reduced luciferase activity for the G nucleotide bearing promoter haplotype in transfected rat pituitary cells.', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options. | <Options>: A: rattus norvegicus albus
B: rattus rattus (rattus wroughtoni) (aka rattus rattus)
C: rattus sp. (rats (aka rattus sp.))
D: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
E: rats (aka rattus) (aka rattus)
F: None of the above. | F |
<Instruct>: Given the context 'The high density of SNPs and their proximity hamper other genotyping strategies for rapid determination of the complete GH1 SNP map in large control and patient populations.', select the correct biomedical concept corresponding to 'patient'. Answer using one of the provided options. | <Options>: A: genus
B: homo sapiens (human) (aka homo sapiens)
C: theraps
D: isolate
E: mouse (aka mus musculus)
F: None of the above. | B |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: species
C: theraps
D: mus <genus> (mice (aka mus <genus>))
E: circe
F: None of the above. | A |
<Instruct>: Given the context 'Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes
Abstract
Background
The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis.', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options. | <Options>: A: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
B: rattus norvegicus albus
C: rattus rattus (rattus wroughtoni) (aka rattus rattus)
D: rat (aka rattus) (aka rattus)
E: mus norvegicus (aka rattus norvegicus)
F: None of the above. | E |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.