start_date stringlengths 10 10 | end_date stringlengths 10 10 | thread_id stringlengths 8 10 ⌀ | subreddit stringclasses 1
value | subreddit_id stringclasses 1
value | total_score int64 -564 194k | text stringlengths 52 58.9k | num_messages int64 3 160 | avg_score float64 -55.17 14.3k |
|---|---|---|---|---|---|---|---|---|
1653308503 | 1653316098 | t3_uvyy6x | t5_2to41 | 2 | [deleted]: TIFU by sending a video to my friend
[deleted]
XenoMetrick: Graffiti is art. Fuck the haters
Maddoggacino: Graffiti is art, tagging isn’t.
XenoMetrick: Thanks officer. I'm guessing drugs are bad and don't talk to strangers as well right?
duddly0831: I mean I haven’t met a meth head I want to be around lmao
| 5 | 0.4 | |
1653313232 | 1653412363 | t3_uw0gmj | t5_2to41 | 2,633 | [deleted]: Tifu by trying to look cool
[deleted]
Terrible_Biscotti_14: Tripping over was a good thing, jogging past and waving is just a bit desperate/weird/creepy.
nomadzebra: Especially to girls half your age, ew
LameBMX: If it worked in his 20's, why wouldn't it work now?
goldfinnches: because he’s 43
LameBMX: Not the best at math are you. What was half his age @ 20?
athrowawayjackass: Did you get into my pcp again?
LameBMX: No, I made that crappy of a joke 100% sober. Take that anti-drug propaganda!
TheApocalyticOne: You should have added to /s to make it easier to recognize as a joke haha
LameBMX: But it wasn't sarcasm
| 10 | 263.3 | |
1653314624 | 1653321022 | t3_uw0xw4 | t5_2to41 | 43 | [deleted]: Tifu by projecting my personal laptop in class
[removed]
severalcouches: Damn, feeling real bad for your wife and students rn. Is there anyone in your life you’re not disappointing?
Alchemis7: He didn’t activate a nuclear missile.
severalcouches: But if he did, he would make sure to do it in front of a bunch of people just trying to get an education AND he’d hide it from his poor wife
Alchemis7: Ha????
| 5 | 8.6 | |
1653314964 | 1653408988 | t3_uw12bi | t5_2to41 | 126 | No_Championship1324: TIFU by kissing my friend (a married woman)
Ahh the usual fuck up. I have a married friend, separated from her husband going through divorce and the whole nine yards. Me and her talk a good amount and I consider us to be good friends. We’ll meet up and vent about our lives at 2am, give advice and try to help. We went out to a bar recently and she started drinking at a faster pace than I was. She started getting touchy and close, we started dancing, the night was good.
Bar closes and I drive her back to her place, get her into bed and all that, to which she asks me to stay with her. I don’t feel like driving the hour to my place after drinking so I say alright and climb into bed. We’re talking about our lives and the shit going on, and next thing I know we’re making out. Doesn’t go much further than that, we go to sleep and part ways in the morning.
Now we’re not talking as much, and I’m hoping said kiss didn’t ruin our friendship as I do value it a lot, and two I have to hope/pray her husband doesn’t find out because he’s a bit gun crazy.
TLDR: Drunk night out, kisses my friend who is married to a gun crazy dude. Now I’m looking into Krav Maga and hoping I don’t lose my friendship
bubba7557: Also OP is a bit of an ass. Doesn't want to drive home from her house bc of drinking but admits to driving to her house when bar closed. So was already drunk driving. Get bent OP, that's not cool.
No_Championship1324: Not denying I shouldn’t have driven. Her place was like 10 minutes away and she insisted that:
1. I drive her (she ditched her friends for me to take her home)
2. I stay there with her.
Not saying I did the right thing.
SlammyWhammies: If you want to get drunk, don't drive there. Don't drive home. A 10 minute drive could still kill you and people you may run into. It's not worth the risk.
lanc3rz3r0: Drunk driver kills themselves? That's sad. Drunk driver kills or maims somebody else? That's a fucking tragedy
SlammyWhammies: Exactly. Do everything right and then die cause some asshole didn't want to get an Uber.
sonicitch: Uber still works in your area? I tried using them last weekend, 2hr wait, no thanks
SlammyWhammies: Lyft. Cabs. A sober friend. A family member. A bus. There's no excuse to drive drunk.
sonicitch: I do agree with the sentiment but I've met plenty of people that are better drunk drivers than others are when they are sober. Not saying that's okay but we really need more involved driving tests in the usa. Never really saw this issue in Germany
| 9 | 14 | |
1653316347 | 1653329567 | t3_uw1kkf | t5_2to41 | 337 | aliiipaige: TIFU by ordering a hoodie.
this is a genuine fuck up, and i'm not entirely sure if the company are just busy of if I've been scammed.
so there's an independent clothing business that my partner has been obsessed with, ever since we got together (3 years ago). He's always wanted a hoodie from there and ive never been able to afford it really, nor him, (they're about £80 each and we couldn't justify spending that much on just a single hoodie).
anyway i had a really nice wage one month due to overtime and i decided to treat him, not because it was a special occasion, i just like to make him happy i knew how much he wanted this certain hoodie. so i order it, everything is going fine and it says it should be dispatched within two weeks.
3 weeks go by and i havent heard anything! so i messaged them in IG and he replies, apologising for the lack of communication etc and will ship the hoodie soon.
the issue is my partner and i were moving out a month after that, so we decided to leave it another week or so and still hadnt heard anything, so we emailed him again asking for an update and if we could change the shipping address.
nothing.
it has been over 3 months, absolutely no communication. the 'company' is still posting on IG and everything yet still haven't replied to our dms nor our emails.
so yeah, i've not only fucked up but i've also been scammed :)
TL;DR i ordered a hoodie from an independent business, they haven't sent me the hoodie after 3 months and will not reply to any emails or messages i send them.
OpportunityRoyal5191: Give us a name? And I’m not trying to be a shit about it but it’s helpful for others to know to not fall to the same fate
aliiipaige: theanitlife, i believe they're a british independent brand and i do feel bad for exposing them especially if they are just busy but there's so many messages my partner and i have sent them and yet they're still active on ig and its been over 3 months since my order lol...i dont want others to experience it like i did
PlzBeInLondon: There's like a suspicious amount of their posts where it says they have a load of comments and then you click it but only 2 or so comments show. I feel this might be happening to a load of people
aliiipaige: i rly wish id done more intensive research, most of the time i do but the one time i dont it comes back to bite me in the ass lmao
Pestyballs: I searched for them on Instagram and found nothing. I may have done a typo, may I get the full spelling? I'll spam them for you!
EDIT: it's antilife . You mixed two letters by accident
| 6 | 56.166667 | |
1653318400 | 1653567467 | t3_uw2bs5 | t5_2to41 | 6 | Strawberrycray: TIFU by dating my best friends ex
I 16f have a best friend named Elle and we have been best friends since birth.
We have had no problems in our friendship until she started dating this one lad, Jake. Me and Jake had become friends during their relationship and Elle never had an issue, until this one time she caught him kissing me on my head. Elle didn’t take that very well and took her anger out on me and got Jake to block me on everything he agreed to block me but straight after he got back home from her house he unblocked me and texted me explaining I was on his side and I was angry that she even suggested making us stop being happy for her selfish needs. She has no other friends than me so she had to stay friends with me but she would hate it if I hung out with Jake and not her which I hated cuz I thought it was rude she still didn’t accept my relationship.
The biggest problem happened when I said I couldn’t sleep at her house because my Mum wanted me to stay home but I later posted me with Jake. She told me that she didn’t even want me to date Jake and I stole what was hers and that all she wanted was for us to break up. I went ballistic on her a told her that she is a selfish bitch and that she should realise that she is angry over nothing and she needs to chill out. I carried on saying things like that and I just got angrier and angrier and I told her that clearly I am the better option otherwise he wouldn’t have chose me and I said how dare you be in love with my boyfriend still when we have been dating for over two weeks. She told that he may have chose me but she will always be better.
Most of my friends think I am right and that she shouldn’t care but some of my now ex friends were on her side so I am wondering am I totally wrong?
TL;DR I fucked up by dating my best friends ex ending my 16 year friendship because of it.
charlievalentine93: This story feels like it's missing some context.
How soon after they broke up did you start this relationship with Jake?
When he kissed you on the head, were they broken up? How soon after they broke up did he do that with you?
Overall it sounds like you are in the wrong here and you don't think you are. Let me explain why I think you are in the wrong.
Chances are you won't be with this guy for the rest of your life, to be honest I would be surprised if the relationship with Jake lasted longer than a few months. That means you threw away a 16 year relationship with your friend because you had the hots for her ex boyfriend and it probably won't even last that long anyways. If you got with Jake immediately after they broke up then you definitely fucked up.
Calling your friend a "selfish bitch" for being upset with you for getting with her ex (possibly right after they broke up) sounds like a selfish mindset to me. You clearly do not care about your lifelong friend that much if you are willing to throw it away for a boy and saying you dont care how she feels about it.
Also depending on how soon you got with her boyfriend, you've only been with her ex for 2 weeks and it would make sense she would be upset with you and Jake if she still has feelings for him. If I broke up with my girlfriend and my best friend hooked up with her a day or two after the fact, I would 100% be upset by it and think reconsider being friends with that person.
Lastly, when you said "told her that clearly I am the better option otherwise he wouldn’t have chose me", that is a terrible thing to say to anyone, let alone your childhood friend. The fact you would think to say this to your friend tells me you are not a good person and your friend is probably better off without you.
Strawberrycray: They were dating when he kissed me but then she got mad and they broke up.
charlievalentine93: Do you think she's in the wrong for feeling the way she does?
Strawberrycray: Yes I feel like she’s over reacting.
charlievalentine93: I dont think she is.
This Jake guy cheated on her, she broke up with him over it and then he got with you right after.
You and your new boyfriend are in the wrong, also dont be shocked when he cheats on you too.
Strawberrycray: He would never even dream of it.
charlievalentine93: It will happen eventually. Once he finds someone else who catches his eye he'll be kissing their heads instead, then you'll know how it feels to be on the other end.
Strawberrycray: He won’t he loves me more than all of his family.
| 9 | 0.666667 | |
1653319944 | 1653320420 | t3_uw2wqi | t5_2to41 | 58 | PrinceDietrich: TIFU by not sleeping for 2 days
Currently a FU in progress. So as a little background, I'm not exactly in the happiest of marriages. It's been an ongoing issue for a few years in a steady decline, but in the last 6 months it seems like the bottom fell out. It frequently ends up in a situation where I'm in the guest room, as has been the situation for the past week and a half. Honestly I don't mind actually being in the guest room, it's the circumstances that put me there that I stress about.
The advantages of my situation are that I get peace and quiet, no covers being taken from me, and I have the freedom to partake in my favorite pastime which is video games on my laptop. I get up Saturday morning at a reasonable hour (damn dog...) and go to bed that night to get my game on. Next thing I know the sun is coming up and it's Sunday morning. Sunday passes normally for the most part but I'm moving kinda slow and am a bit scatterbrained. Sunday night I go to bed and the same thing happens, I end up gaming all night until the sun is coming up. The kicker this time is that it's Monday morning which means work day, brain has to be functional. Problem is, the brain is barely functioning and I can't get it out of first gear. This is proving difficult in terms of typical adult obligations such as wife and kids and job. The cherry on top is that I have to take the kid to his ninja class (glorified gymnastics with some parkour and taewkondo mixed in) tonight and run a serious risk of falling asleep at the wheel.
TL;DR - I spent the last 2 nights gaming all night and have been awake for 52 hours and counting with no sleep
Kain0wnz: Ima say this for your growth, and also because I’ve been there.
The faults in the marriage aren’t gonna fix themselves, and gaming all night is avoidance behavior. You’re making it worse.
You have kids. This will end badly for you, especially since your wife isn’t staying up all night and remaining functional.
It may be time to grow the fuck up. Set a gaming schedule, you don’t let the game run your life. You game for x hours, and you cut that shit off.
You’re grown. You can either listen or not. Good luck!
jblaze805: Speak the truth, priorities
| 3 | 19.333333 | |
1653319863 | 1653326697 | t3_uw2vml | t5_2to41 | 7 | humblefreak: TIFU by thinking my Zoom call was on mute....
Hooo boy. This really did happen today and I am still reeling from the shame.... My zoom calls typically are automatically muted and video off when I join a meeting. I have a new computer that apparently does not do that!!! I joined a whole department meeting at work today and really had to pee right at the start. So, thinking the audio and video were off, I went for it. Fortunately no video, but the entire department heard me peeing. I finally realized and muted, but I had already messed up big time. And now I have to go continue working with everyone like nothing happened. I am so humiliated, I feel like I can hardly face any of them again! Wish me luck, y'all.
TLDR: New computer didn't mute my Zoom call on joining a meeting and my entire department heard me peeing.
Hanako-kun0: why did you take your laptop with you to pee?
ribd4yourpleasure: I'm thinking they just peed in a bottle at their desk like a normal person s/
Infamous_State_6348: So he/she is an Amazon delivery driver using pee bottles cuz of Bezos lol 😂
| 4 | 1.75 | |
1653320638 | 1653325545 | t3_uw361s | t5_2to41 | 80 | fertileasfuck: TIFU by getting 2 women pregnant at the same time.
Well where to begin... Things in my marriage haven't been great, which caused me to step outside of my marriage. I know I know....not great. But here we are! I've dove head first in to an affair and I'm all in. One might say, "too far in." But that's neither here nor there. But wait! There's more! My affair partner (AP) and I work together in a capacity that this could cause both of us lose our jobs and she is in a long term relationship.... This has been going on for months. Again, not ideal!
Now to the real fuck up! Just over a month ago my wife and I were intimate for once. We used a contraceptive. Life went on. A few weeks later she informs me that she is pregnant. WTF?! Like what in the actual fuck.... We never have sex and the one time that we actually do this happens!! This has to be some sort of karma. This has caused a bit of a rift in the already fucked up household dynamic. Fast forward another 2 weeks...and my AP has missed her period. Now this one makes some sort of sense... We were reckless and caught up in each other. (Still are!) But after that moment everything checked out. She wasn't ovulating and things were good, at least according to her "app." Welp! Fuck that app! She's pregnant... One star review to come!
So here I am, I've got 2 women pregnant at the same time. One, my wife who I'm planning on leaving. The second, my affair partner who I love to fucking death. 2 children from 2 women, 2 weeks apart! GOD DAMN!
And yes my AP knows about my wife being pregnant but my wife has zero clue about my AP.
Icing on the cake...AP and I were actually crazy enough to discuss possibly going through with the pregnancy. That would be a cluster fuck of a dumpster fire...
TL;DR got my wife and my affair partner pregnant at the same time.
P3naught: All I have to say is, play stupid games, win stupid prizes
In this case, you are also the stupid prize
kiwishrew: Well, yeah. That's why it's a TIFU
P3naught: This is more of a "I keep fucking up" if anything
Capable-Site-301: *This is more of a "I keep fucking ~~up~~" and if anything*
FTFY
P3naught: What did that fix?
| 6 | 13.333333 | |
1653320729 | 1653321398 | t3_uw379n | t5_2to41 | 14 | [deleted]: TIFU by discovering my gf is an ex pornstar
[deleted]
Badhaase: BS meter……Off the charts.
Money-Target-4983: Lmao this exactly what I was thinking + the way OP tells the story lmao.
| 3 | 4.666667 | |
1653321035 | 1653323082 | t3_uw3beq | t5_2to41 | 21 | [deleted]: TIFU by forgetting to show up for new work contract signing
[deleted]
Bozwell99: Be honest. They won’t believe/care about your story anyway and will have already made judgement on it. The fact they still want you to sign means everything is cool right?
IF THEY MENTION IT tell them how sorry and embarrassed you are, otherwise don’t even mention it. Seems like they fucked up too if person that needs to be there wasn’t?
vinepest: Thanks, that's sound advice. Well, the other guy was there waiting for me, but left at some point. Yeah, everything should be cool eventually.. I was the only guy that applied for the job, so I don't think the position is in any real danger (I've worked there as a student before, so I'm convinced I'll feel at home and not be stressed as much as at my current job).. It's just that my conscience is in shambles, I usually agonize over important appointments for 2-3 days in advance, pick and wash the right clothes, obsess over unimportant details etc.. so this type of mistake just feels foreign.
| 3 | 7 | |
1653323670 | 1653326432 | t3_uw4aw1 | t5_2to41 | 16 | Digitt82: Tifu by mowing the lawn
So this happened on Saturday, so technically 'sifu'.
Heading into the weekend, I knew that there was supposed to be some rain, and it was supposed to be very hot. I also knew I needed to mow the lawn. I couldn't do it Friday night after work, so Saturday morning seemed like the best time to tackle this task.
I waited until 9 because that's the absolute earliest I can do it and not feel bad about making noise when neighbors may still be sleeping. The problem was my daughter had a swim lesson at 11:00, so I'd have to hurry. Didn't get to use the string trimmer in the back yard, but edged the front and got the whole thing done with just enough time to hop in the shower and get everyone in the car.
We were going to be about 5 minutes late to the 30-minute lesson, but oh well. I still considered it a productivity win. Threw the car in reverse, and looking through the passenger-side rearview mirror, aiming the car at the corner of my driveway, which marks the perfect angle to back with space between the edge of the garage door opening, and my pickup truck parked on the other side of the driveway. It's a tight squeeze, but this line never fails.
...Except I forgot that I had moved my truck to the center of the driveway so I could trim the grass along the edge, and had failed to move it back.
So now I'm waiting for a new tail light to arrive in the mail. At least I was able to heat the fender cover a little and pop the dent out with minimal scratching. (And we ended up only being 10 minutes late to the swim class.)
Tl;dr: Decided to be responsible and productive and ended up damaging my car for the first time in 22-year's of driving. Oh well, it was a good record while it lasted.
twotall88: lol... you need to learn to string trim next to a vehicle without damaging it :P
Digitt82: It's less about damaging it (It's a 22 year old truck) and more about having room to work around it.
I guess the good news is that the truck that wouldn't lose anything for a minor dent or two took exactly zero damage from the collision. Heh.
| 3 | 5.333333 | |
1653327303 | 1653329162 | t3_uw5np6 | t5_2to41 | 24 | [deleted]: TIFU by clearing my wife's sinuses
[deleted]
Kcardwelljr: r/ihavesex
There is no fu here.
knaks74: Even if he thought there was he could’ve told the story without the details.
| 3 | 8 | |
1653320477 | 1653339119 | t3_uw33x5 | t5_2to41 | 5 | [deleted]: TIFU by cleaning out my sisters car.
[deleted]
nekokattt: This isn't a TIFU, she is just being ungrateful or wanting to live in a pig sty.
You did nothing wrong imo.
travelingfeet172: Okay thank you. I guess since it’s not really a fuck up I’ll remove it.
| 3 | 1.666667 | |
1653329006 | 1653340820 | t3_uw6b1m | t5_2to41 | 32 | bitchhwtf: TIFU by getting drunk and peeing through my underwear.
So this happened last night and I'm still not really over it and not sure if I can ever live it down.
Me and my boyfriend had a couple friends over and they all brought some booze along and we as the night went on we got more and more wasted.
As people have to when they drink, I had to pee 10 thousand times. So me and my toilet became pretty close last night. Now usually when I go to the bathroom I try to be in and out as fast as possible. Idk why. It's been that way as long as possible.
So the 10 thousandth and first time I made my way to the bathroom in a drunken stupor, at the peak of the night. I got in the bathroom and nearly ripped my shorts off but somehow managed to miss my underwear (I usually pull both waist bands down at the same time) and sat down on the toilet. I started peeing and instantly realized I forgot to pull my underwear down.
It was too late to do anything because I felt them getting wet and warm and almost threw up because as a 24 year old adult I haven't pissed myself in well over a decade. I knew I couldn't take them off mid stream or else it would just get all over the seat and floor and make a much bigger mess than what was already happening.
After I was done peeing I sat on the toilet and managed to get them off and threw them in the hamper. I only told my boyfriend what happened but I felt so embarrassed I cut my night short and went to bed. I think I'm gonna stop drinking for a while now.
Tldr: got way too drunk, went pee and forgot to pull down my underwear. Ended up pissing through them and almost died from embarrassment.
MVSugar: Congrats.
bitchhwtf: Saddest congrats but thanks mate
MVSugar: I’ve had two kids, sometimes I pee when I sneeze. Solidarity?
President_Calhoun: My wife does the same thing, and we adopted.
MVSugar: Getting older sucks. Giving birth also sucks, at least the things that happen after do.
hotseltzer: Pelvic floor PT! While it is *common,* it is not *normal.* It makes me sad to see how many people just accept this as life after having kids (or just getting older).
MVSugar: I know, I’m working on it. I see a gyno urologist. I also have kidney stones.
| 8 | 4 | |
1653328853 | 1653360979 | t3_uw68w3 | t5_2to41 | 49,095 | Definitely_obvious: TIFU by quoting Lion King during sex
Obligatory not today but last night. Wife and I were in bed talking when she told me that sometimes she stares at me because she wants to memorize my face at different points in our lives because she is romantic and sentimental like that. She then expressed to me that she is afraid that I will die first because, at the end of the day, one of us has to go before the other and it might as well be me, right? Anyways, I cracked a joke speaking like Mufasa and said “All the land the light touches is yours.” This was not the fuck up, but set the scene for the fuck up. One things lead to another and wife and I have passionate “you will someday be dead” sex. I ended up finishing first (side fuck up for those who care) but wanted to be a gentleman and help her out. So I start doing my thing and that rat fucking bastard Mufasa popped into my brain with the scene when he appears in the clouds to Simba and says “Remember.” Cut to me trying to make my wife finish while Mufasa keeps saying “Remember” over and over and over in my mind. I bust out laughing like the mentally challenged hyena that I am and all passion and hopes of finishing are totally out the window. She’s pissed, I can’t stop laughing, sad times were had by all.
TLDR: Mufasa prevented me from making my wife cum and I probably won’t be Hakuna’ing any Matatas for a little while.
Edit: Thank all of you for the awards and comments, they are absolutely hilarious and I am glad that my stupidity did not happen completely in vain. I do think I might be pushed from a cliff if I try and “Simba” my wife though!
aleqqqs: Next time, use your thumb to wipe some cum across her forehead and whisper "Simba"
Definitely_obvious: I love you for this comment.
LeTroxit: This is a much more tame variant of an old internet meme, the "sneaky rafiki". There's a few other variants out there, but urban dictionary will give you the rundown pretty quickly.
HurtsToSmith: I just looked it up. Wtf is wrong with people? I'm not religious, but some people need a little bit of Jesus in their lives, coming up with all sorts of crazy stuff. That's just ridiculous!
HondoNasty: Charizarding is a classic from urban dictionary also
GOOD_BONE_N_CALCIUM: Thr legendary [CLEVELAND STEAMER](https://www.urbandictionary.com/define.php?term=Cleveland+Steamer)
E: you have to make the WOO WOO steam engine noise or the act is not complete nor authentic
GirlCowBev: Ok, wow. Definition has sure changed since I last used “Cleveland Steamer” to mean taking a dump into a tube sock and then smacking someone in the face with it. Good times either way, I suppose?
GOOD_BONE_N_CALCIUM: As woth other words, definitions change woth time and a good dictionary captures that.
Arviay: You almost had ot.
GOOD_BONE_N_CALCIUM: Have big thumb
Arviay: I can aympathize
| 12 | 4,091.25 | |
1653329563 | 1653336656 | t3_uw6il9 | t5_2to41 | 428 | Key-Indication3984: TIFU by listening to the far cry 5 album and making my boss think i joined a cult
for those unfamiliar far cry 5 soundtrack is pseudo gospel music with lyrics referencing apocalyptic prophecies and fighting the government. ive been listening to it alot and when i was at work i was playing it without any headphones(2 hours after i get there most people leave for the day)
today i was called in by my boss and he seemed genuinely concerned. Our work environment is really casual and close knit so i wasnt worried when he called me in. He started asking me about my religious beliefs and seemed to get more confused when i gave noncommittal answers.
He asked me if ive been hanging around anyone new and how often do i talk to my family
then he tells me that a few of my coworkers are worried i joined a cult or something which seems weird since i didnt seem like that kind of guy. He says that ive seen a little more withdrawn recently plus theyve heard you listening to music with strange lyrics.
​
I then had to explain to him far cry 5 and come out and flat out say i wasnt in a cult.
He was super relieved and he told me depending on how this conversation with he was going to reach out to my mom on facebook.
He then told me they had an unofficial meeting where they discussed how to talk to me about it. he said that since changing shifts my personality had did like a 180(i used to be pretty talkative but since i work late now im far too tired to talk plus by the time i go to work most people are probably ready to just head home. )
​
Im actually kind of touched they were concerned about me but ive since started listening to other music
tldr : me being tired and listening to weird music made my coworked think i joined a cult.
AdSame573: I listened to the doom eternal ost and ppl thought i joined a satanic cult so that was also an interesting discussion with the higher ups
OMGitsTK447: Why do people think doom is a satanic game? You literally slay demons in this game, fight against god, god-god and satan god-god.
AdSame573: Well just with the speaking between tracks
KamikaziSolly: *"When the shadows first lengthened..."*
| 5 | 85.6 | |
1653330983 | 1653332295 | t3_uw71j1 | t5_2to41 | 5 | Cozy-in-the-rocket: TIFU by being an Overachiever who fails in the crucial moment
I was always an overachiever from childhood on, I always got the top grades, I was always prepared, I was the teachers pet and golden child all my life.
Fast forward to this year, my final year before Uni.
And suddenly I suck at everything!
My grades are still good but not by any means as they used to be, just a year ago. Because of this I’m not as confident and not the favorite student/child anymore. My friends, who are overachievers too, turned their back on me, when I couldn’t keep up with them anymore. They were afraid, I would drag them down.
I developed anxiety because of this and often can’t get myself to study because I’ll just get another „ok“ grade.
And all of this had to happen in my final year! Why?!
This is really the crucial moment, the moment all my hard work over the past years should’ve payed off!
No one cares how good I was last year, only this years grades matter, and they suck.
I feel like I really fucked up and I don’t even know what I did. Before, everything always was easy and fun, now it’s hard for me to even focus and study.
It was my dream to become a doctor and I put so much work into it and now I ruined it all. I know, I probably sound pathetic and selfish but I’m having a hard time coping with all of this.
(I’m not a native speaker, so there might be some grammar/spelling mistakes)
TLDR: I’m an overachiever but this year I fucked up completely and it’s affecting my future
forgotMyPrevious: I mean.. you can still become a doctor?
Cozy-in-the-rocket: Here in Germany it strongly depends on your grades whether you can study what you want and for medicine you have to be the best. And my grades are by far not good enough anymore
GeekyTricky: If other people's perception of you is what maintained you performance until now, you weren't doing it for yourself.
Did you ever really want to be a doctor? Or did you just want to stay the golden boy all your life? You haven't been living your life, just been chasing approval this whole time.
No wonder you're gassed out. You've got no desire or motivation to pull through. You have the skills, the competence, the got you till here, but you don't have the will cause it's not what **you** want. If it were you'd push through no matter what.
Find something you like, something you're good at or at least that doesn't depend on whether others like it or not.
Also, you might not know how to work. If it came easy until now, and you got great results for minimal effort, then you were just lucky. Actual work means giving effort for average results. Then using things like consistency and attention to detail to break ahead.
You've been relying on talent so long you never learned to work. Learning to work should be your number one priority.
| 4 | 1.25 | |
1653332017 | 1653357639 | t3_uw7f48 | t5_2to41 | 15 | Forward_Physics9824: Tifu by grabbing my dads dick
So this is nothing like when he accidentally shot himself in the dick with an airsoft gun on full auto We decided for the last day of this visit we’d take the tops off the 1986 camaro and cruse around the city we get to the city and cruse around a bit Then decide to head up to union station (we live in the kc metro and parked at the park near river market near the lock bridge and the bridge that raises so we park to walk around and we go to take the street car to union station so we have to cross the old lovelock bridge) (they cut all the locks :( ) we see the new locks then we get to the street car and hop on now after A walk around union station and around crown center we see a shallow fountain with people walking in it so i decide I want to record a tiktok there with an I am jesus sound as it looks like you walking on water now this fountain has a large step down so after filming i jump down but start to slip so i grab on to the nearest thing… my dads dick was the closest thing to my hands i then realized what happend still heading head first into the floor and let go then Try to grab further up I didn’t calculate my had moved down and I grabbed it again then a third time I grabbed his arm and saved myself from falling the worst part is he stopped recording and missed that part in camera for anyone wondering heres the vid he stood to close as well https://www.tiktok.com/t/ZTdnrfQ78/?k=1 tl;dr I jumped off a fountain and grabbed my dads dick twice
htepO: .,;'"-
You dropped a bag of these.
Forward_Physics9824: Huh
lactosefreepotato: Punctuation
Forward_Physics9824: I have been diagnosed with autism and adhd punctuated text is hard for me to read so I don’t punctuate text
outta_luck_2022: You may want to work on being a better human being.
A very brief look at your profile and fuck, you suck.
*as far as lgbtq in my eyes there is 3 gender male female and whatever it’s called when your born with a penis vagina and uterus all other genders are worthless and this world would be better without lgbtq*
Like, what the fuck dude?
Forward_Physics9824: I am a good person to the people who deserve it Why we’re you stalking like really does it help that I’m not pro anti abortion but if you check my old profile u/vinnydeltoro you can see I’m a good person but I’m anti progressive and rooted in the old ways
CorrosiveAlkonost: You know, kid, nobody'll believe ya when you just outright declare that "you're a good person" while hanging on to outdated-ass beliefs.
Forward_Physics9824: Ehh I may have an iPhone XS I may have music subscriptions yet i still use a second gen iPod nano i like the old ways
CorrosiveAlkonost: I'm not talking about that. I'm talking your declaration of yourself to be a "good person" while hanging onto 18th-century ideals and also declaring yourself to be "far-right" and possibly not knowing exactly what it means.
Learn the world first, kid, then maybe you can gain a semblance of knowledge regarding how dirty and corrupt politics is, across the world. Don't blindly parrot shit you read on the news without verification or self-reflection.
Forward_Physics9824: I know you weren’t talking about that I was just saying that I enjoy the old ways I am not parroting either I tend to avoid the news at the end of the day social media and the news is often left leaning as leftist cry more about stuff And rightists just suck it up
| 11 | 1.363636 | |
1653338293 | 1653339571 | t3_uw9rp2 | t5_2to41 | 29 | evadssor: TIFU By telling a mother I’d like to pull her young son’s pants off
Obligatory “this happened a few years ago”..
I was attending an orchestral concert at my wife’s college alma mater. My wife, was a violinist in the symphony.
After the concert, I made my way backstage to meet my wife, where I ended up running into a mutual friend of our’s. The woman was with her young son who couldn’t have been any older than 4 years of age.
I noticed the boy was wearing some really trendy pants (I think they were bright colored or patterned in some way), and I thought they’d be something I’d wear if there was an adult version out there somewhere.
Which is a totally normal thing to think right? What you’d look like wearing a toddler’s pair of pants?
Hunched over, I looked down at the boy and said, “I really like your pants, those are cool!”. Then I looked up at the mother and said, “I wish I could pull those off!”
You know, as in “look as good in them” if I were wearing them.
Immediately I panicked after hearing the words leave my mouth.
Due to my years of exposure to Disney and MTV, I was convinced that what I just said may have been taken the wrong way (perverted). As if I was literally telling this child’s mother that I just wished I could take the pants off of her young son.
To quickly remedy the situation, I blurted out “not like 𝑡ℎ𝑎𝑡!”
Which, now looking back at it years later, I feel like was actually the worst possible thing to have done in that moment. I still cringe thinking back on it. Major F UP.
The mother laughed it off and the rest of the conversation went normal, but I can’t help but think she took it wrong.
TL;DR - I saw a toddler in trendy pants and told his mother I wish I could “pull them off” as in, wear them as cool as the toddler does, not “pull them off” in a weird or perverted way.
AllanfromWales1: She probably thought you wanted to pull the boy off, not the pants.
evadssor: Eeeeeeek
| 3 | 9.666667 | |
1653339139 | 1653342826 | t3_uwa32k | t5_2to41 | 28 | BluTofu8: TIFU by letting a bee get inside when opening my door
Today I took my dogs on a walk and when I opened the door to go inside, I heard a buzzing noise. I looked around because maybe I let a bee in and I did. There was a bee rapidly flying around. I started freaking out because I have a massive phobia of bees/wasps. I didn’t want to loose it so I ran over to the door to open it and the thing flew into me. Luckily I didn’t get stung, but the thing just did not get out even after 30 mins of waiting. I called some of my siblings to come downstairs to help and we tried to kill it cause it wouldn’t leave. This went on for an hour and eventually we gave up because we lost it. I went to my room, opened the door, AND IT WAS THERE! Because I was terrified and basically got paralyzed of fear, my mom swatted it and it fell into a crevasse. We assumed it was dead, but apparently not, because 2 hours later I heard it buzzing around while I was in my room. I ran out and after a bit tried to kill it but we couldn’t find it. The only trace of its existence is the occasional buzzing. Eventually I made a sugar water trap but that just didn’t work. Now I am outside my room, occasionally peeking in to see if it’s shown itself, but it hasn’t. My family has left so now I am all by myself. Every time I think it’s safe I hear it buzz again. This has been going on for like 6 hours and I haven’t gotten shit done today. Now it’s probably going to sleep and wake up in my room cause it’s the evening.
TL:DR bee gets in the house because I opened the door, and torments me for 6 hours+ because it won’t get out
Ramast: Unlike wasps bees typically only sting if u r close to their hive.
It doesn't make sense for a bee to sting in self-defense because that sting is certainly going to kill it.
Hope that make u feel better
BluTofu8: I honestly can’t really tell if it’s a wasp or a bee tbh
GojuSuzi: Round and fuzzy = bee, won't sting you unless it has to because stinging you kills it; long and spiteful = wasp, born angry.
If it bumped into you and didn't sting you out of sheer liquefied hatred, probably a bee, and you're safe.
It'll try to head to light, so if it's dark there, turn on a light outside your door/window and turn off all lights in the room. If it fell in a crack, it may be stuck there though.
| 4 | 7 | |
1653342554 | 1653361626 | t3_uwbbqq | t5_2to41 | 96 | gnarnognar: TIFU by waxing my own penis and balls
This happened literally today, probably 30 minutes ago.
For context, last week I waxed my armpits in an attempt to reduce BO, I'm not a smelly person (and have almost no body hair) but I'm kinda allergic to deodorant with scents and alcohol. This went well, almost painless I would say.
For the balls I use a razor blade and a trimmer to groom above.
So I remembered, "hey years ago I waxed my penis shaft and it didn't hurt that much".
Boy I was wrong, it did hurt, A LOT.
I heated up the wax, tested the temperature on my hand, waited probably 5 minutes to cool down a little bit. I applied a small patch on my balls and another one in the base of the penis. I pulled the wax and instantly was in pain. To top it off, I spilled some wax in another area so now I'm trying to remove 3 patches of wax.
At the end I managed to pull the 3 areas with wax (with a lot of pain). Now I've got three baby ass smooth patches.
TLDR: I tried to wax my penis and balls and it was extremely painful
soul-linker: Try waxing like some women do, you'll probably end up writing TIFU every week
uk-side: TWIFU
Book-bomber: More like TWIFUA
| 4 | 24 | |
1653342250 | 1653357183 | t3_uwb7w0 | t5_2to41 | 26 | [deleted]: TIFU by injuring myself during sex
[deleted]
colossalcanoe: Better story? Flag football or cunnilingus?
cosmernaut420: Everyone tears their shit being too old for contact sports, going so hard you injured yourself pleasing a woman is a much better story.
| 3 | 8.666667 | |
1653343072 | 1653345628 | t3_uwbia4 | t5_2to41 | 6 | [deleted]: TIFU by going on a week long vacation
[deleted]
ElectroStaticSpeaker: Cool story bro. I'm confused about where you lost the kidney tho?
VultureMadAtTheOx: Not sure if you're joking, but it's just an idiom. When something's too expensive you say it costs a kidney.
Any-Confusion-4526: I think they were being serious and you now have confused them even more using the word idiom.
| 4 | 1.5 | |
1653334201 | 1653364064 | t3_uw88lr | t5_2to41 | 307 | PeachyPlumbobs: TIFU by making my sister feel anxious on her birthday
So my mom doesn't get along with me or my sister. She's a textbook narcissist who only cares about herself. However, our mom also paints herself in a good light to everyone else, so no one believes me or my sister when we talk about the things she's done.
My sister has a Facebook account but blocks our mom on it. My sister swears she's going to go full no-contact as soon as she saves enough money to move out.
Today is my sister's 23rd birthday. My mom went and made a Facebook post saying how proud she is and all this stuff she would never say to us in real life.
I showed the post to my sister because our mom and I are Facebook friends (only because she's always posting about us). I got permission from my sister to comment that there was no point to the post because my sister couldn't even see it.
I got a bunch of nasty comments from other family members saying that it wasn't fair. That they just wanted to wish her happy birthday and let her know she was loved. That they knew she wouldn't be able to see it, but they didn't care. One of our aunts said I was a "whiny crybaby that needs to grow the hell up". My mom's fiancé commented that I need to be nicer to my mom and all that jazz, even though the post wasn't about her.
Quote, "And we all know she can't see it. We don't need a whiny crybaby pointing it out. So grow the hell up. All we wanted to do was tell *Sister* Happy birthday and let her know people are thinking of her"
My sister got a call from our grandma two hours later. She immediately hung up because she was afraid our grandma was going to yell at her or chew her out for the Facebook comment.
I had her call our grandma back who turned out to have no ill intentions and just wanted to wish her a happy birthday.
So now my sister is anxious. She doesn't want to answer the phone today at all.
It's my fault. I was the one who suggested the comment in the first place. I don't know what to do to help make sure she has a good birthday.
TL;DR It's my sister's birthday, and I left a comment on my mom's Facebook post that got the rest of the family mad, so now my sister is refusing to pick up the phone because she's afraid she's going to be yelled at.
Edit: I deleted the comment and took her to a coffeeshop and bookstore where I bought her drinks and a few books. I played her favorite songs in the car on the way there. She seemed fine and said she liked it, so hopefully I helped make her birthday a little better.
BBrea101: I thought I was reading my own post for a moment.
You two are not alone. There are so many women out there with fractured relationships with their mothers. It's hard. I pine for a relationship of comfort and support with my mother, but after 35 years of various forms of abuse, I know it'll never be achieved.
One thing that helped me was finding women who have similar relationships with their mothers. That has helped a lot. They don't make "she's your mother, love her" excuses, but understand the difficulties of the relationship.
The book "it didn't start with you" by M Wolynn helped as there are generations of trauma that impacted everyone in our family. Difficult Mothers, Adult Daughters by Karen Anderson is a good read as well. I Thought It Was Just Me by Bene Brown was also a phenomenal read but make sure you have good supports with you - this book was very difficult to read as it exposed so much within me. I'm happy I got through it.
Good luck. It is hard to cut ties with family and it takes some time. You're making good choices to created a stronger foundation for you.
makarewnzi: Is it the "Making the Journey from 'What will people think?' to 'I am enough.'" version? There are a few different versions of it so I want to make sure I'm looking at the right copy.
BBrea101: I am enough. It talks a lot of the shame women place on one another.
makarewnzi: Thank you so much! Adding to cart rn <3
| 5 | 61.4 | |
1653345774 | 1653448517 | t3_uwcfxz | t5_2to41 | 111 | r7kr2949281: TIFU by screaming and running out on my date
alright so I live in a small town, and somebody recently moved in. at first I didn’t think anything of it, because I usually don’t really care about that kind of stuff.
until she ended up talking to me, and we started talking a lot. I ended up really liking her. one day, she confessed that she liked me and I said I liked her back. we started going out a little while ago.
she asked to go out on a date, and I accepted. I told her to meet me near a lake where there wouldn’t be many people, because I wanted to keep our relationship a secret for awhile longer. I didn’t know how the town would react if they found out about our relationship.
we meet up near the lake, and I ask if anybody followed her. she said no, and I believed her until I saw somebody walking by. usually it would be whatever, but it’s somebody who I don’t really like. we argue a lot over petty things.
so I say that somebody did follow her, and it was the last person who I wanted to see. she casually says it isn’t a huge deal, but I still thought it was one.
he walked by, and proceeded to give us both a look while saying “don’t mind me. enjoy your date.”
I asked how he knew, and he said it was obvious because of “how much happier I looked.”
he told us that the whole town already knew what was going on, and that we didn’t need to keep it a secret.
this is where I messed up. I got really unnecessarily nervous, and didn’t know what to do. I kinda said “you’ve gotta be kidding me…” and then without thinking, I screamed and ran away. I didn’t process anything and didn’t even know what I was doing. i’m too scared to talk to my girlfriend or message her or anything because of how pathetic I was.
TLDR - I went out on a date with my girlfriend while trying to keep our relationship a secret and I saw somebody who I don’t particularly like. he told us about how everybody knew about our relationship and there wasn’t any reason to hide it. I got nervous, and ended up screaming and running away.
J11Knight: Sounds like you either need to desperately get out of this small town, or need to learn to not let what others think effect you/your relationship.
I realize it's easier said than done but it's not fair to your girlfriend, that she can't feel comfortable in public with you just because you don't want the town knowing you are dating her. That just sounds like a rough situation for her all around.
fabpieceoftrash: I mean op could be gay?? That might make more sense
J11Knight: How does that change anything? It's still unfair to the OPs partner. There really isn't a scenario where a mature adult, ready for dating would realistically do this.
fabpieceoftrash: being gay in a small town is hard and hiding is many people defaults. not wanting to be hatecrimed is a very valid reason for acting like that
J11Knight: Nah, it's not a valid reason. Obviously you have every right to not want to be "hatecrimed", but if you can't at the very least explain that to your date. You are VERY likely too immature emotionally to be dating.
Feeling uncomfortable is totally okay. Running off and leaving someone without saying anything is not acceptable.
HawkwingAutumn: So I'm not in this conversation, but like, why the scare quotes, dawg?
J11Knight: Scare quotes? I felt that was a weird way to use it casually like that. I'm sorry for putting it in quotations?
| 8 | 13.875 | |
1653346305 | 1653405611 | t3_uwcm8t | t5_2to41 | 2,021 | Voracious_Port: TIFU by losing it at work
So I basically just snapped at my boss today. I have been really stressed out lately, I have a ton of work, the AC in the office breaks down, he was being rude, he was being an asshole, and I couldn’t take it anymore.
I grabbed my keyboard and smashed it against the wall, while asking him if he ever learned to be polite or if he ever learned some manners. So, of course I was yelling and an awkward silence just took over the office. Nobody said a peep. Not even him. His eyes peeled like unexpected and I just stormed out of there.
I'm usually a very chill guy, 35 years old, never picking fights with anybody, I hang out with my coworkers, we drink beer, I help out in the community. I don't know what came over me.
I received a call from upper management, a few minutes ago, saying that they would like to speak to me in person tomorrow. So I don’t know what will happen, and if anybody has ever felt like this before and what do you do in this kind of situation? I really can’t lose my job.
EDIT: Great news everyone! yeah, no. I got canned.
So they basically gave me two options. I could keep my job, but would need to apologize, take AM sessions, also see a regular stress therapist and take a few days off, etc. etc. After that, they had no choice but to tighten things up a bit with me, you know, as a precaution for the safety of everyone. I absolutely cannot get a promotion now and some other restrictions would be put in place.
They interviewed those nearby and nobody felt threatened, but they did feel uncomfortable. We reviewed the CCTV footage and I did not throw the keyboard at anybody, it was just a wall and minor damage occurred. They told me that I didn't had to pay for that, not to worry about liability or anything like that. They brought up my manager and said they had been receiving some complaints for a while. Just nobody did anything. Last time I saw him, he was receiving counsel as well. Not sure what they said to him.
As for me, the other option was to leave. I felt like I was being relegated. I got the vibe that they were trying to tell me, "if can´t handle the job, we will find someone who can". I have to decide by today, but after talking to friends and family and reading Reddit. I think it´s time to find something new.
Just to clarify, the AC was not the main issue here, it was certainly a contributing factor, I would not go AWOL because I was hot, no. It was the pressure, sum of a thousand little things that just, happened to blow up right there and then.
Also, for those of you asking, I´m an analyst. I do data analysis for an insurance company. Or was, not anymore.
&#x200B;
TL;DR I snapped at my boss for being a prick
Economics_Troll: LOL no more job for you buddy. Guarantee upper management / HR says something like:
"After your violent outburst yesterday, your coworkers no longer feel comfortable around you. We strive to foster a working environment in the office where everyone feels safe and respected, and that can no longer happen with you here. Pack your things."
In no world does a business say "No worries buddy, don't worry about that whole smashing a keyboard into a wall and cursing out your manager thing. We know it's been hot in the office because the air conditioner has been on the fritz, it happens."
Felix_Dragonhammer: Depends if they’re a key person or not 💁♂️
the-Boat83: Exactly!! If he's a great employee and this was his first issue they may look the other way. If op is a constant thorn in there side your out.
DrunkenHooker: Their* you're*
yungmilkman: It makes me sick that people like you breath the same air as me.
DrunkenHooker: Come on, how else is the dummy ever gonna learn?
yungmilkman: People know they’re just typing on Reddit they don’t care about they’re spelling and shit man when you get older you’ll realize how dumb this is
DrunkenHooker: Okay pop pop. Literacy rates are supposed to have gone up. Not knowing the difference between their, there and they're, for a native speaker, is just pathetic. If my little niece can figure it out I'm sure you big boys can too.
yungmilkman: Did you even read what I said your commenting on Reddit not writing an essay who the fuck cares
DrunkenHooker: I'll give you three guesses but two don't count.
| 11 | 183.727273 | |
1653347663 | 1653369475 | t3_uwd29w | t5_2to41 | 27 | YourInfidelityInMe: TIFU I failed to heed the caws of crows nearby
My Tinder coffee date went so well that I decided to take him on a stroll along my favorite jogging path after coffee. It was an early afternoon on a Monday, people were either at work, at lunch, or in school. The path in the park was deserted, so I offered him an off-trail blowjob.
At first he was hesitant. By the growing bulge in his crotch area, however, I knew he was persuadable. So I challenged him: I bet him that I could finish him from a blowjob before anyone chanced upon us. We had unobstructed views from our tree-lined path and would be able to tell if anyone approached from hundreds of feet away. Finally, he relented. To my (pleasant) surprise, Mr Too Shy For Off-Trail BJ came commando (guys still do that?).
While I was deliriously going to town on his manhood, he suddenly jerked his erection out of my mouth (and might have scratched it on my teeth in the process). I was dumbfounded - wtf was going on?!
Next thing I knew, I saw him waddling away with his pants around his ankles, trying to pull up his pants while frantically sprinting off. I heard him yell and curse in the process. His shaft or head got caught a little in his zipper as he tried to zip his pants, I later found out. It all happened so quickly I couldn’t process the events in my head. Everything was a blur.
Why did he take off like that? I ran after him and that’s when I saw it: an angry bird kept dive bombing the back of his head. It was a crow. This 6ft4 man was scared of a little bird.
Somehow, he blamed me for his penile misfortune. Well, if he didn’t want his erection getting caught in his zipper, perhaps he shouldn’t go commando on a date, or ever, really. Or perhaps, he should’ve realized the little crow was no match for a man his size.
But I did learn that corvids are extremely intelligent with an incredible memory for faces. I also learned that they can become aggressive in late spring when fledglings leave their nests. Perhaps I should have heeded the angry caws before I unzipped Mr Commando Bloody Cock. I didn’t know. To me, the caws blended in with the constant noise of the city. Now, I am more aware.
Someone once said, “Good judgment is the result of experience and experience the result of bad judgment.” Where I stand in this cycle of judgment is TBD. But you can bet your ass I won’t be giving BJs in that spot again. Goddamn angry birds.
TL;DR: I didn’t pay attention to the caws of angry crows and my Tinder date got attacked by a crow and his own zipper.
More info on angry birds: [Angry birds](https://www.theguardian.com/science/punctuated-equilibrium/2011/jul/06/2)
opschief0299: This story doesn't suck.
BadBadGrades: It blew me away.
| 3 | 9 | |
1653351373 | 1653352586 | t3_uwe8cg | t5_2to41 | 2 | somethingoriginaltbh: TIFU by not taking breakfast
So, uhmm, today was an interesting day for me. I recently started taking new medicine, and everyone was aware in case of any secondary effect, because this medicines are kinda strong (anti depressants btw), well, everyone except me. Today, I woke up, but it was already late for school, but I, being the smart person I am, decided not to take breakfast to get to school in time. My first class goes by, and I have a lot of free time, because the teacher of the next 2 hours didnt go. I decided to take breakfast, but instead of the usual place I go thats near the school, its pretty far, and since I dont own a car, I went walking. Midway there I feel a bit strange, but nothing I cant manage, so I keep walking. 10 seconds later I had a seizure and then passed out. Police came to the scene, called an ambulance and then my mother. So yeah, pretty rough day to be me, and even worse because the cops stole all the money that was in my wallet.
TL;DR: Didnt take breakfast, had a seizure then passed out, and police came and stole my money before calling an ambulance
FoxPawsFauxPas: A few questions...
1) how did everyone but you know about the new meds?
2) how do you know the cops stole the money and not some random person before they got there?
somethingoriginaltbh: 1)i know too, but just didnt care enough lol and 2)i live in Mexico, and here police is very corrupt, like, I can kill someone in front of them, 20$ and nothing happened, so yeah, I wouldnt be surprised if it was police, or anyone else lol
FoxPawsFauxPas: Ahh. Understood. I say just be very very careful going forward. Maybe keep a snack in your bag in case you have other mornings where you don't have time to eat before you need to be somwhere. And definitely let your prescriber know this happened if you didn't already.
somethingoriginaltbh: My doctor already knows, so yeah, Im going to follow your advice complete stranger
FoxPawsFauxPas: Haha. Sorry. I work in the medical field...in psychiatry specifically. Was just trying to offer advice to help. Take it or leave it. Best of luck.
somethingoriginaltbh: Thank you, I appreciate it
| 7 | 0.285714 | |
1653353336 | 1653353702 | t3_uwetre | t5_2to41 | 5 | Natural_Ad_4304: TIFU by outing one of my best friends as bisexual by sharing photos of him with dildos shoved up his ass
[removed]
NovemberInfinity: And then you out him on here, you’re just a winner
Natural_Ad_4304: Not his real name
| 3 | 1.666667 | |
1653355272 | 1653356048 | t3_uwfefj | t5_2to41 | 10 | [deleted]: TIFU by asking a question
[deleted]
dylc: It's not so bad being ugly. Sex is overrated. Focus on being a good responsible person and get good at masturbating.
arandomaccount1337: I don't care about sex, it's all about the company
KhSepticShock: But you only described physical
arandomaccount1337: Just about the amount of attention. Less attractive = less chance of company.
KhSepticShock: Just seems you have a strewed understanding of quality connections and surroundings.
Might reflect on oneself first then reassess those around you.
A lot to learn in life and what important things draw quality circles in life.
| 6 | 1.666667 | |
1653355022 | 1653417649 | t3_uwfbs5 | t5_2to41 | 37 | AccomplishdAccomplce: TIFU by putting on red lipstick
I'm working a huge event with my boss (I'm a personal assistant). It's an evening, glamorous event (well, glamorous for her) but I still need to look business nice. So I have a nice black dress on and went with dark red accessories and thought, oh, I packed some lipsticks! and found a red shade similar to my accents. I then grab everything else I need, including my mask.
Which I put on.
I'm in the green room and go to take a selfie (it's a cute mask) but remove it to adjust it and see myself in my front facing camera.
The first thing I thought was a line from Buffy the Vampire Slayer (the TV show) "You have fruit punch mouth"
It is smeared all over my mask and around my mouth and there's no fixing it. I wiped enough so the remnant color is mostly contained to my lips, but of course the rubbing it off just made everything red.
The worst is at some point I took the mask off in front of our little work crew to drink some water. So everyone saw my clown mouth before I knew it (palm meets face)
So, I'm being SUPER Covid compliant by keeping my mask on for the rest of the night :)
TLDR: Today I put on red lipstick right before putting on my face mask and my entire mouth area is stained like I chugged Hawaiian punch, and my work team saw it before I did
ExoticButters79: Where are you that yous till have to wear a mask?
ElectroStaticSpeaker: There are plenty of places even in the the US that are still requiring masks under various circumstances.
ExoticButters79: Such as?
ElectroStaticSpeaker: BART
ExoticButters79: Homer?
ElectroStaticSpeaker: Is that a question? BART is requiring masks until mid July.
Do you really need me to list for you every place in the country that still requires masks for you to realize that places ares sometimes different than where you live?
ExoticButters79: I don't know what BART is no. I also don't care. My question was answered by OP you are just side noise at this point.
| 8 | 4.625 | |
1653359417 | 1653464103 | t3_uwgn6m | t5_2to41 | 80 | pinky117: TIFU by driving through a crime scene
Obligatory this happened years ago. I started at a new company as an EMT. I had just finished school and hadn't driven an ambulance for very long. My partner was a d*ck. He was a seasoned paramedic who complained about everything and hated training new people. We responded to several calls over the week and I was improving. He had me drive most of the time so he could take care of patients. The ambulance was equipped with a computer that let us read what the calls were about, and also had built-in GPS. We were supposed to follow that GPS, not our phones.
One night, not too far along in my training, we were dispatched to a high priority call. I don't remember what for. I followed the GPS. I ended up on a main road that was split down the middle by a curb divider. I saw police ahead blocking the road. I wasn't sure what to do, but my partner said to go ahead. I drove up to the police car and waited, lights and sirens blaring. Eventually the cop backed up and let me through. I drove slowly and a ways up started feeling a crunching under my tires. I kept going and we got to the destination safely.
A couple of days later I was called into the office. Apparently the police had called to complain that I drove through their crime scene and over several bullet shells. I ended up losing my job over it. Fortunately I found another job right away, but I was a lot more careful after that.
TL;DR: I drove over several bullet casings while responding to a call as a new EMT.
WhitDawg214: I was smilng along until the lost your job part. After a cop waved you in? Crazy. But glad you rebounded, hope you enjoy the work.
-A former EMS dispatcher.
MaxScar: Exactly. The cop is at fault.
NoTheyDontMatter: No. If the cop blocked the ambulance and someone died because of it, the cop (and the entire department) would be in deep shit.
thetoiletslayer: So you're saying the cop is not at fault, because the cop is at fault?
iron_and_carbon: While the cop may be at fault in reality where a ambulance drives is the drivers responsibility never the cops. Setting up a system differently invites disaster
thetoiletslayer: Pretty sure crime scenes are an exception
iron_and_carbon: I mean what if someone is injured at a crime seen. Seems a fairly plausible thing
thetoiletslayer: The cop should still direct the ambulance through the area safely
iron_and_carbon: No, unless the ambulance is endangering anyone or placing itself at risk the cop should not instruct it to stop
thetoiletslayer: I never said stop. Only that the cop should direct the ambulance down a safe path through the area
| 11 | 7.272727 | |
1653361901 | 1653462100 | t3_uwhdev | t5_2to41 | 231 | baljeet223149: TIFU by saying no to a girl when she wasn't sober.
We were in the movies and this girl, and like any dumb teenagers would do we took turns taking hits of a cart because it would be fun, I did just enough to really enjoy it and stay sane, but she went over the top, she asked me if she was living a dream about 8 times and was opening and closing her hands like there were stress balls in her hands I let her lay down on me and held her and she moved my hand over her chest, to be straightforward, this is where I started to feel uncomfortable. Then she started asking me to do things, she wanted to make out she wanted to do everything you’re possibly thinking. And I said no. Because I’m not an idiot, it seemed like a huge turn off for her and she doesn’t feel the same way, now I’m here. I feel like I screwed up, because I really liked this girl but at the same time like I dodged a bullet.
TLDR: I didn't give a girl consent, and she doesn't feel the same way about me because of it.
slb609: Thing is, she was too drunk to give you consent, and now she’s embarrassed.
Good work - this was no fuck up at all. You did the right thing.
MrMichaelTheHuman: Where are you getting that she was drunk?
x820x: did you read any of the post?
HirsuteWitch: Bruh she was high. Cart = cartridge. As in vape pen of concentrated THC. Same principle though
Tmanbelli: Is it? Seriously asking cuz used to be whippets, CO2 cartridges.
WoodpeckerSignal9947: Haha, yes, carts mean weed these days among the younguns. Source: I’m slightly above 20 and up until a year ago worked with maaany teenagers
| 7 | 33 | |
1653362524 | 1653390058 | t3_uwhjun | t5_2to41 | 17 | birdpigeonduck: TIFU by giving my coworker my phone number
I (F/16) have been working at my current job for about a year. I recently got a promotion that has me more focused on scheduling and taking care of party’s at my job. This requires me to be in the kitchen more. About three weeks ago I met another teenager, let’s call he Leo (M/19). He is currently enrolled in a nearby college. I originally found him attractive. We would flirt back and forth and I was extremely excited to see him for my shift today. We got along very well, flirted a little, it was nice. At the end of my shift he started talking about his family trauma, but I had to leave. I wrote down my Snapchat and my phone number and encouraged him to talk to me more about his family if he wanted. I got home and originally didn’t receive a text. Around 8pm he messaged me pretending to be some dude who found the paper with my number on it on the ground. After a couple of minutes I told who I thought was a random person to throw out the number and I thanked them for looking out for me. The next thing I received was a photo of Leo in his closet next to a bow and arrow, a hunting rifle and a assault riffle. I found that odd but not odd enough to deter me from talking to him. He then sends a long ass paragraph about his family trauma and how “there is no love” in his house anymore. I replied to the best of my ability and was ready to end the conversation. (For this next part keep in mind that he knew I am a vegetarian) He then sends me a photo of a deer heart in his bare hands and then a photo of a dead deer. This was completely unprovoked and this completely petrified me, I have absolutely nothing against hunters (my dad is one) but this ultimately freaked me out. I then open snap to a photo of Leo crying because our conversation apparently got to him. I feel absolutely terrible because this man likes me but I am now completely freaked out by him. He said he doesn’t open up to many so now I feel extremely guilty for not wanting to speak to him anymore. He luckily also put his two weeks in today but I am scared for my next shift. I have continued to talk to him because I do not know what to do, i have been very dry however. I had a few male friends snapchat him thinking he might get the message but he has not. I really fucked up.
TL;DR: Today I fucked up by giving my coworker my number. He completely freaked me out by sending me photos of a deer heart and a dead deer. I don’t want to talk to him anymore but I feel terrible because I originally gave him my number.
im_2old4this_shit: Thank goodness he put in his 2 weeks. Hopefully he decides to leave sooner. Are you able to schedule yourself so that the 2 of you don't work the same shit?
I'm sure you already have but if not, block him from your phone and social media.
birdpigeonduck: I have it scheduled so I shouldn’t see him our next shift but there is always a chance I’ll run into him. As soon as he leaves im planning on blocking him on everything.
| 3 | 5.666667 | |
1653367394 | 1653512538 | t3_uwiuyp | t5_2to41 | 211 | davidbates: Tifu by opening my eyes
We’ve all been told this. We all obey. “Don’t open your eyes when you’re washing your face!” There’s just enough reinforcement from time to time when you didn’t rinse your eyes well or happened to rub them while washing to keep us in line. I’m 40(m) and have abided by this sage advice my whole life. Until today.
Well I’m typing this from the commode out of breath and still wet. Not able to just yet dry off. Here’s the tea.
About a month ago we replaced our shower head. This might be the real tifu but alas. When I shower my routine is rinse, shampoo, soap (face, extremities, buts and nuts), and rinse again. Typically I’ll use the hand held shower head and turn it on the blast setting to rinse all the bits and bobs. Well this new shower head has a blue switch on the back of it to do a fan or a real blast (you can probably guess where this is heading). When I tried it out after installing I had both heads running and the pressure was fine. Tonight I had just the handheld on, leg up on the side of tub and switched on the booty hole cleaner 9000! When I tell you I’ve had enemas less invasive I’m not exaggerating. I had this thing pointed exactly right. Here’s where the tifu comes in. In the shock I forget I’m covered in soap and open my eyes to quickly find the switch. I drop the shower head as my eyes feel like they’re getting a chemical peal the wife comes in to the most horrid episode of naked and afraid and I finally turn off this water jet.
I’m ok and after she stopped laughing she told me that that switch was not for booty hole cleaning but rather to get tough spots off the shower. My fresh and sore bunghole say different but I also see why warning labels are nice.
TLDR; I used the shower cleaner setting on my shower head to clean my crack and opened my eyes while still soapy to turn it off.
beardedrockerboy: I had always felt weird that I used the handheld shower to clean my butthole. I like knowing that I don’t have dingleberries making me smell and the shower head makes it easier to know that you’re clean down there. As a guy though, it just makes you feel like you’re a woman for some reason. I weirdly feel better after reading this.
LynxKuroneko: It's just toxic masculinity. Fuck those fragile fucks. Be clean for you ( and your partners ).
spaceraverdk: Toxic my ass. Its a label slapped on everything considered to be anti feminist these days. Which is more or less every single thing men enjoy.
LynxKuroneko: What a toxic comment.
spaceraverdk: What a witty response
| 6 | 35.166667 | |
1653368081 | 1653369305 | t3_uwj13s | t5_2to41 | 22 | creampastry420: TIFU with a rimjob
this didnt happen today but it happened recently that I just know it will forever be engrained in me.
I (m21) am a reasonably horny fellow with a strange construct built between sexual activity and the meaning of my life itself. I dabble here and there, but honestly the male agenda is convenient, fun, and my forte.
I personally have never had penetrative anal or vaginal sex as the opportunity had never come for me to be in full appeal of it, but my experiences can make a long list. I’m shocked how long its gotten without defiling my virginity construct.
I went on grindr recently and reconnected with a hookup I had a couple months prior. If you ask me now, I don’t even remember his name, i’m just horny. We got together, spoke of life, smoked some weed, played with his dog, and eventually our meat. Most of the time, I keep it between our dicks and mouths, and don’t really go beyond that.
Rarely, ill let the partner in crime eat me out, which almost never happens. I dont clean my ass pit when i dont expect any business there.It got more than business though, it was a suctioned asshole to his mouth and it was the cleanest he ever had allegedly.
Spoiler… IT WAS NOT. Except I was also under the influence, then he asked me to eat him out. For the first time I said…
“fuck it, why not?”
There he was bent and spread with all his glory, with my background in the health sciences, all I could think of was a biology experiment in that hole i’m going to mouth pound.
The mouth pound lasted less than ten thrusts before I regretted it, and I did it well apparently. I’m an ass natural, but I didnt love them enough to keep going.
It was nothing though and I just went back to our freaky business, until they went to make out with me. As soon as their hot breath was on my face, all I could smell was shit. It was my shit from my ass I never cleaned. I hated it. I couldnt do it.
I told them I smell something weird… and they started to say I was making things up?! As if I don’t remember NOT preparing and NOT washing my ass. I literally smell shit from their mouth but I didn’t want to say it like that, so I just asked if we could take a rinse break because I was about to gag with their breath this close to me.
After the weirdest conversation of being called delusional by a hookup for smelling shit right after getting my unprepared, unwashed ass ate. I rinsed that shit so quick and thoroughly, it cleared my high and knew I couldn’t do this ever again.
It wasn’t just the shit smell that ruined the experience, its the hookup telling me its all in my head when its the actual particles of shit in my ass, now in his mouth, and briefly mine. It is a smell I will never forget. We also told each other were NSA and just for fun, but they’ve tried asking me on a date the day after we agreed to just hookup this once.
Sometimes its just not worth it no matter how horny you are.
TL;DR: Grindr NSA hook-up rimmed and sucked my unclean asshole, made out with me, tainted me with the smell of shit, got called delusional, and asked out on a date. CLEAN YOUR ASS.
DaddyDarko87: Clean YOUR ass.
Marc123123: Or get used to the smell 😂
| 3 | 7.333333 | |
1653369338 | 1653409277 | t3_uwjctj | t5_2to41 | 12 | YaKuzya: TIFU by knocking over a homeless person's change cup
Not necessarily today but more like a decade ago. I was reminded about this situation while walking through the same BART station in the Bay Area (underground metro for y'all non bay area folks).
So rewind back about a decade, I'm in undergrad at Berkeley and took a BART train with a good friend to SF to go to an art opening. It was an opening for some post-modern artistic "experience" that I quite frankly can't remember much of. I remember the girl that I went with. I remember how close we were and how much of a good human being she was to everyone. She'd go out of her way to give money to the homeless, to volunteer, etc.
We get off the train and are heading towards the exit. It's a somewhat full station at the early evening on a weekday. I see a homeless person being quiet and not yelling for a change. There is a modest sharpie-doodled sign asking for some change or love and a red Solo cup with coins. He's a bit off the path towards the escalator but I tell the girl that I'm going to go and give him some spare change. She smiles and says something sweet but the rest is history.
I grab whatever coins I had in my pocket, transfer them to my left hand, and as I approach the Solo cup on the floor, I release the coins from my hand into the cup.
I didn't account for momentum. I didn't account for the fact the cup may not be stable. I let the coins go and within a few moments, the cup topples over.
I'm sure it was quiet for most but to me, it sounded like an avalanche of coins scattering on the mildly dirty floor of the BART station in every possible direction. I remember having a moment in my mind thinking if I need to assist the homeless man or just run. In that instance, the man stood up and screamed an unexplainable shriek.
I picked up the pace to a gentle power walk. My friend's eyes were wide open in confusion and distrust. As I began to open my mouth to say something I felt an impact of an umbrella against my head. I turned my head to yell "I'm sorry!" and we kept walking in silence. We went up the escalator quietly. I kept looking back and heading the guy yelling at the top of his lungs while collecting coins off the floor.
I didn't get laid that night and the art opening was not memorable at all. We never exited at that BART station again together.
TL;DR - I wanted to be a good person and give a homeless man some change but the spare coins knocked over his cup of coins and they went all over.
SemperFiNj: I bet if i tell you what happened to me a few months ago it will make you hopefully feel not alone. I was at a left turn arrow stop light and I held my arm out with a Poland spring sport bottle to a homelessman. I motioned to throw it when I start rolling forward when the arrow light turned green he stepped off the foot curb thinking it would be better to catch it that way and the bottle cracked him in the head. I felt terrible for like a week. I tried and so did you. It wasn't out of maliciousness.
YaKuzya: It's the epitome of "Well intended, poorly executed"
SemperFiNj: The curb was like a foot too. Tried to factor in every element except this lol. I'm glad you're ok tho. Sorry this happened again.
| 4 | 3 | |
1653370091 | 1653375641 | t3_uwjjkw | t5_2to41 | 24 | Practical-Roof5616: TIFU by drinking SIX shots of espresso
So my friends are taking a barista course, (19f,19f & 20f) I love coffee but I have it strong but with a lot of sugar. I took the same course when I was 16 I’m now (18) but I’m taking the course again.
I have a cup of coffee everyday it’s like two shots of espresso I usually don’t have anymore after that. But today my friends gave me a cup of coffee, after I told them to make me one jokingly. There is an inside joke that I make the best coffee ever.
So they bring me this tiny cup of coffee like (250ml mine is usually 500ml). I like my coffee sweet & it was definitely sweet so I didn’t know who strong it was. Turns out THERE WAS SIX SHOTS OF ESPRESSO.
My stupid ass drank the whole thing in 3 minutes. I will say it was not good, I instantly went hyper & had trouble standing up. It’s been 3 hours since with many problems & I feel so sick.
TLDR I accidentally had 6 extra shots of coffee from a friend & now feel dead.
sinadoh: >tiny cup of coffee like (250ml mine is usually 500ml)
Tell me you're American without actually telling me
LegendOmegaX: I swear. How on earth is half a litre is small?
Practical-Roof5616: I’m saying the 250ml one is small compared to the cup I usually have.
LegendOmegaX: My friend, 250ml is still quite a decent amount. 500ml is overkill. Do adjust the amount of caffeine intake you're getting please.
Practical-Roof5616: Oh my gosh the coffee in it is like 200ml the rest is milk my brain is slowly coming back that sounds like I drink straight coffee 😂
| 6 | 4 | |
1653371138 | 1653458771 | t3_uwjtdv | t5_2to41 | 151 | [deleted]: TIFU by boofing meth, wiping my butt, and snorting the toilet paper
[removed]
OMGoblin: Sir, I think this is literally rock bottom.
jzdpd: oh you can get lower, trust me
louisme97: im sure i dont wanna know, but how???
I never done crack, but i would waaaay more likely blow another dude (im not gay) then snorting my own bloody shit.
Atiggerx33: So I'm presuming we're talking only about stuff you can do and not stuff that can happen to you (like dying, getting assaulted, etc.)
I guess murder would top snorting bloody shit, like getting so paranoid you end up killing someone. I'd rather live with the fact that I snorted my own bloody shit than that I murdered someone. Look at what that dude on bath salts did; I'm kinda glad he's dead because either he's a complete monster or sobering up and having to live with the fact of what he did honestly sounds like a far worse fate (like I personally would choose death over living with that).
louisme97: what dude on bath salt?
And yeah murder is kinda worse.
Atiggerx33: The guy who ate a dude's face that one time.
louisme97: and? dont see the problem here...
EnchantrelIe: The guy whose face got eaten doesn't see anything either.
louisme97: exactly.
| 10 | 15.1 | |
1653371429 | 1653447846 | t3_uwjwac | t5_2to41 | 720 | Wide-Competition1399: TIFU by reading this
Arabeskas: Meth.... reminds me of the "What if we used 100% of our brain" meme, only in reverse...
Electrical-Release61: If 100% of our brain used us?
mcnathan80: You aren't that far off. Most of what we do is determined genetically with a little sub-conscious prompting based on early life experience (and the meaning we gave it (also highly genetically determined)) that our brain gives intelligent rationale for *ex-post facto*
We are basically a strand of sentient DNA encased in a meat ship piloted by a delusional lump of electrical fat through an imaginary universe and the ship occasionally poops
angry_old_dude: > strand of sentient DNA encased in a meat ship
This is quality flair material.
mcnathan80: Well thank you angry old dude
I may not always try to be correct, but I do always try to be quotable
| 6 | 120 | |
1653373715 | 1653374314 | t3_uwkf8z | t5_2to41 | -1 | tanaka015: TIFU by being banned from askreddit in 96 seconds (New Record)
You read the title and you’re probably thinking "yea, you earned it" but just listen to what I have to say or read what I will write in here. Lets start at the start at the very beginning of it all. It was night time and I was watching galactik football with enthusiasm. I felt it was enough episode for the day, plus, it was very late so I went to sleep but I actually didn’t. I was on my intelligent portable device ( yes, my phone) and was really bored at this time so you know what happens next. I hope on the Reddit app and decide to not be a lurker anymore and actually do something. Like i said I was bored so I just made a post about what was the first that went through my thoughts and it all started from there. I typed my first simple question and then told myself to keep typing simple,unoriginal and unserious questions. At first I was like "brooo!!" but now I’m like "brooooo??" I reacted like that because of that comment that caught my eye. One comment that says "You’ll get ban" I didn’t know that you could get ban but then I started remembering that askreddit has rules but it was already too late for myself to go verify the rules and to save me from this autobot rightful banishment. As I continue observing the top of my screen, the worst was to arrive. A notification from askreddit themselves quoting "you’ve been temporarily banned from this subreddit". All of this in only 96 seconds.
TLDR; established the record time to be ban from askreddit by asking child-like question.
gerbageman: I tried to give you a good answer but somebody downvoted me.
Admiral_Gecko: Looks like someone has it out for ya, my condolences
gerbageman: Now I'm downvoted again. I am stalked and abused. FML and SMDH
| 4 | -0.25 | |
1653372859 | 1653446198 | t3_uwk87e | t5_2to41 | 31 | fahken_gahjuss: TIFU by becoming hooked on smoothies and turning my toilet seat blue
I have a job that keeps me on my feet, so I got into the habit of buying a smoothie before work for several months. I found having fruits & veggies (plus adding a vitamin supplement & protein powder) are a great way for me to sneak in some extra calories until I can get a more substantial meal.
Getting a daily smoothie has now become part of my pre-work ritual that I rarely miss.
In case you’re wondering, my go-to Vitamin is B12 because it has a lot of benefits: it helps with mood, energy, improves memory, and is great for hair, skin, and nail health.
Now, this past month I have found work to be extra stressful, so I have made certain to never miss a smoothie. I was helping myself out, right? Getting nutrients in, all was well, or so I thought.
When I experience higher stress levels than normal, my time-of-the-month cycle tends to reflect that, resulting in higher spikes of hormones which can change a person’s pH levels.
Did I mention that an excess of B-12 changes pH levels too?
Apparently, this acidity in one’s pH levels can react with the coating on a toilet seat… and turn it blue.
So I am currently, at 2am, trying everything possible to get this blue stain out before we have guests tomorrow.
TLDR; Drank too many smoothies with B-12. Had a stressful month of work. Stress + excess B-12 turns pH levels acidic which turned my toilet seat blue.
Update: Since it’s not my house (it’s my parent’s) their pretty pissed off at me. Mom calmed down a bit when she realized it now matches the decor, but I still need to replace it.
fahken_gahjuss: Proof: the now [blue](https://www.reddit.com/user/fahken_gahjuss/comments/uwkhy2/the_blue_seat/?utm_source=share&utm_medium=ios_app&utm_name=iossmf) seat
throwaway-gat: You’re wasting time worrying about this.
fahken_gahjuss: Don’t see how I’m wasting my time. It’s my bathroom, but my parents’ house. So, it’s definitely a fuck up as they are pretty pissed.
throwaway-gat: Apologies! I misunderstood the circumstances. I thought it just bothered you and it didn’t seem that noticeable. I understand now.
| 5 | 6.2 | |
1653361011 | 1653546714 | t3_uwh3v0 | t5_2to41 | 30 | DarkInkPixie: TIFU by not picking up my beer.
So today I found out I majorly fucked up at my friend's house. We'll call him M, his wife E, and my fiance C. So it's been a while since M and myself got to see each other, and when he told me he and his wife were moving, I saw it as the perfect opportunity to lend a hand and introduce them to C. Things were going very smoothly with helping them move into their new house, and as the weather turned, we decided to call it a day. After E went off to work, M broke out some beers. As a note, he has a dog who *loves* the taste and smell of alcohol. If you can see where this is going, keep reading. So his doggo, we'll call her Lu, was all up in trying to steal nips of Angry Apple beer but we weren't having it. Eventually, she got put to bed which helped. What did not help was the alcohol causing my dipshit self to become even more spastic. Watching a movie and chilling, I sat my beer down on the floor cause there wasn't anywhere else to put it due to furniture not being available, and eventually went to sleep. I completely forgot about it the next day, and C and I went back home. Well today, Lu found the bottle! She's no bigger than a loaf of bread and obviously can't hold her liquor so after she tipped the beer out and happily lapped it up, the poor thing wound up drunk. I've been getting pictures of her drunkness sent to me by her human father, and I am so disappointed in her inability to control her little drunk self. And in myself for forgetting they have a dog that needs AA.
TL;DR: Forgot my friend has an alcohol loving dog, left my beer on the floor. She eventually found it and has now wound up drunker than a frat boy at his first house party.
Abhish0210: Here for dog tax
CorrosiveAlkonost: Not OP's dog
googlyeyes88: IF you talk about dogs, you need to pay the fine
Abhish0210: I agree on that
| 5 | 6 | |
1653378596 | 1653380195 | t3_uwliws | t5_2to41 | 34 | PastelPeach314: TIFU by going to the ER for a stupid reason
So I have bipolar disorder and since I've started going to therapy, I am able to recognize when I am manic or depressed. At the moment I am experiencing mania, and it is starting to push my limits. Yesterday I got a large red painful lump on my arm that had radiating pain. Today it started to look discolored and hurt more. As the paranoid internet sleuth I am, I started to believe I had a blood clot. I am on a lot of medications that you can develop blood clots as a side effect. Immediately my chest started to hurt. With this knowledge I had one of the worst anxiety attacks I have ever had and jumped in my car. I was super paranoid thinking I was dying. So I went to the ER and waited for an hour to only be told it was a normal bruise. A bruise...I am a fucking idiot. I became so delusional that I made a fool of my self. I also was panicking and dissociating throughout the visit to the point the Doctor and staff looked puzzled at me. I am going to go cringe and die now.
TL;DR Went to the ER thinking I was dying, it was a bruise.
fieldofonions: You didn't fuck up. Anxiety can make you truly believe that you are dying. You did what anyone would do when they think that. I know you feel silly afterwards but try to be kind to yourself. You did nothing wrong.
PastelPeach314: Thank you, I do feel quite stupid but I'm trying to take it in stride.
| 3 | 11.333333 | |
1653380839 | 1653382519 | t3_uwm0nu | t5_2to41 | 9 | [deleted]: TIFU by calling my FIL by my ex GF's father name
[deleted]
cruisin5268d: Holy shit this is insane!!!!.
Let me get this straight…..you made a verbal blunder and then *dramatic pause* they didn’t even notice? And then nothing bad happened / there were no consequences?!?!?
Omg how did you survive
madjahead: Man I wish there would be no consequences, my wife is now refusing to talk with me, and I don't know how to fix this shit.
cruisin5268d: If you’re with someone that legitimately won’t speak to you over something this ridiculous then the real TIFU is you being with that person.
madjahead: I didn't think about it from that point of view to be honest. I just feel so guilty about this whole situation. So you think it's not a big deal??
cruisin5268d: Are you dating Amber Heard?
Seriously everyone makes a verbal mistake from time to time. It’s such a non issue.
madjahead: I mean if she didn't react the way she did, like stop talking to me and stuff, I would consider it just a funny story for the future and move on, but now I don't know what to do and what to think.
| 7 | 1.285714 | |
1653381808 | 1653403136 | t3_uwm7x7 | t5_2to41 | 6 | feellikepooping: TIFU by offending my grandma so much
I’m such an a-hole today. Well, almost everyday I guess.
We talked about our maid who is seemingly off and does whatever she wants around the house; and by whatever, we mean that she doesn’t follow any of us (we talk to her nicely and treat her reasonably and kindly) but when she’s tired, she’s doing whatever she wanted in our house, even if she knows she’ll get in trouble for doing so. She only follows my parent who’s the breadwinner of the house plus she gives her so much incentives also.
I told grandma, why don’t you tell my parent (breadwinner of our house) about her being this discourteous? She said that no, your parent will just side her relentlessly again and again. I told her stop being such a scaredy cat of your child (my parent) and being under them.
She got offended by that so much. I felt so ashamed of what I have said. We continued to argue.
TL;DR Told my granny that she’s allowing to be her childrens’ “under someone’s thumb” (sorry for my bad english) she proceeded to tell me how ill-mannered, immature and shallow i am as a person.
sharnikov: Is your maid giving the handy or know some secrets by any chance
feellikepooping: What do you mean?
sharnikov: Only way I see the maid being defended so much is either she's deep in some family secrets or provides a service that's borderline prostitution
feellikepooping: Nah, my parent just want to spoil her so much and always side her (always telling us to “understand her” because “she’s tired etc”) but man that is just so wrong always
| 5 | 1.2 | |
1653383578 | 1653483989 | t3_uwmm6l | t5_2to41 | 35,538 | [deleted]: TIFU By Allowing A Friend to Get Handsy (NSFW)
[deleted]
bluecollarNH: This story was a nice reminder of why I stopped drinking. Amazing how a bunch of my problems ceased to exist.
NotSoNiceO1: Heard a bunch of excuses from OP.
altersun: She did tell her SO, so that does bring back a little respect from me
stuiterveer: Told the SO and, despite giving excuses to some extent, still acknowledging they fucked up. Shitty situation to put their SO and kids in, but indeed I respect that they at least remain open even when not taking responsibility for how things happened.
Dodlemcno: Down I dive into the depths of downvotes but for me the major fuck up was telling. OP made a mistake and should feel as bad as they should about it. But telling fucks up the entire family and should be only OP's burden to bear. No-one's getting pregnant or STDs or losing feelings of love. OP should have swallowed it and got on with their life
LostSands: The only way two people can keep a secret is if one of them is dead. Not confessing will potentially cause a more traumatic end to the relationship in the future. Confessing immediately has some non-zero chance of reconciliation which will decrease over time.
Not to mention most people aren’t really concerned about utility here, its a ethics concern.
Edit to add:
I’m always curious on people who have this take,
Have you ever been cheated on?
I recognize it would be very easy for you to say “Yes,” there is no reason to not lie after all.
So I suppose its a rhetorical question. Put yourself in the position of having found out ten years later from the affair partner instead of your significant other.
You would really rather that outcome than to be told by your partner immediately?
Dodlemcno: Honestly if I found out 10 years later that some half conscious hungover rubbing had resulted in an orgasm- I might not like it, but if I’m being told it was a 1 time thing I think it’s better than knowing in the moment and having to choose between always wondering if it’s happening again, or losing your whole family.
I have been cheated on and it was horrible. But I was a teenager then and I’m an adult now. And my partner did it multiple times with feelings involved.
Do you have a family?
LostSands: > but if I’m being told it was a 1 time thing I think it’s better than knowing in the moment and having to choose between always wondering if it’s happening again, or losing your whole family.
That’s the thing. You don’t know ten years after the fact that it was a one time thing. The information you have is
(1) it happened once
(2) the person you were supposed to trust the most concealed that for ten years.
There is no reason to believe that they didn’t do it again, or wouldn’t do it again, and just conceal it from you like they did the last time. Complete disclosure allows you the opportunity to rebuild trust, which concealment otherwise destroys.
I have a family, I do not have children.
Dodlemcno: Ok I guess I was assuming that the person who did it admitted it 10 years later. To which they would probably admit any others. Funny rabbit hole we’re going down here- from the info given by OP I stand by my analysis
LostSands: Yes, that would be an assumption. More likely ten years later someone isn’t confessing, someone else is the one breaking the news.
To confirm, you prefer the world where OP does not admit anything, then (arbitrary period of time) later, their partner finds out from someone who isn’t OP?
And you’d prefer that?
Dodlemcno: All of your comments are based on your belief of a law that it always gets out. Which I get. My figuring is based on a situation where OP can pretty much guarantee it won’t get out
LostSands: You can’t guarantee that it won’t, that’s my point. I don’t need to guarantee that it will.
The only thing I need to guarantee is that it will be more traumatic to find out later, if found out, than if it was confessed.
And it would be.
At that point, however unlikely you believe eventual disclosure to be, it still isn’t worth it. To think of it symbolically, I would suggest the following:
H1 = (Ti-Td) * cD
H2 = D
Where H is the harm suffered, Ti is the time when the incident occurs, Td is the time of discovery, and cD is the chance of discovery.
I would argue that, H2 << H1 in all cases where cD is not zero. Because the betrayal of hiding it is going to amplify the initial act.
I don’t need cD to be one, it only needs to be not zero, which as long as there was someone else involved and/or told who is still alive, it is.
People talk, and shit gets around. Sometimes, it might not. But I don’t think suggesting people take that chance is ethical.
You’re doing the equivalent of suggesting people bet it all on the lottery because they may win.
Dodlemcno: Are you using algebra to solve a relationship issue?
LostSands: “Symbolic logic is a shorthand way to change logical expressions into basic symbols and remove the ambiguity that comes with using a language.”
I was attempting to convey to you what I have already stated. If you don’t have a response, that’s fine.
You have a knack for ignoring questions.
Dodlemcno: Well to be honest you lost me. My brain won’t go to equations for this. It’s an organic non-logical matter.
As for ignoring- I am not ‘suggesting people bet it all on the lottery’ I am talking about this specific situation where I am giving OP the benefit of the doubt and assuming they themselves knew it was a mistake and meant nothing and care about the long term affects on their family and don’t wNt to risk losing them. That’s enough to stop one wanting to do it again. When you have children things like this I feel like are less important and for the sake of the family OP could bury this and the chances of it affecting the family have a possibility of zero. If you tell, I feel like the chances of zero affect long term are far from zero. That’s my equation. But as I said in the other comment I feel like we’re probably filling in the gaps with our own life experiences and thus we aren’t going to agree here. And it doesn’t even matter, as OP seems to have admitted it and fucked her family’s future. And perhaps more so if she hadn’t admitted we’ll never know and can only go about our own lives being the centre of those and those only.
Respectfully, I rest my case and wish you the best.
LostSands: > don’t wNt to risk losing them
It astounds me that you have continued to miss my point.
Both telling and not telling have a risk of losing your family.
In not telling, that risk is proportional to the chance of discovery. Which, even if low, is never truly zero. In addition, you will cause the discover to be more traumatic than if you confessed initially.
In telling, you have the chance of reconciliation.
> It’s an organic non-logical matter
This is short for “I haven’t actually been critically thinking about the topic at all.”
Dodlemcno: I haven't missed your point. You're just making your decision based on the belief it's more likely to come out, I'm basing my judgement on believing reconciliation being less likely once out than it coming out at all.
It's a very silly basis for an argument, especially given it's entirely hypothetical
LostSands: ... We've circled back again.
I don't have to establish that discovery is more likely, because added to the fact that discovery is possible, the additional harm caused by concealing the act makes confession have a better expected outcome on average.
The reason I went to symbolic logic to try and express that is because there is not a way that I can say this next sentence which doesn't sound loaded.
You are literally gambling that the (a) additional harm you would cause to your partner and family, if discovered, is worth (b) whatever increased chance of null-harm impacting the family at large by concealing the information.
Dodlemcno: Well I don’t think the concealment - in the case of this highly unlikely scenario happening to me- would be all that much worse. I think my partner would understand, and would possibly be more upset at the busy-body who told her than me for doing it.
Yes it would be a gamble. In this situation, given my life experience, one I would take.
Gosh it’s almost like arguing with strangers on the internet is a futile endeavour
LostSands: In your situation. I am proposing that in the average experience, this is a bad gamble, and consequently, it shouldn't be suggested.
| 21 | 1,692.285714 | |
1653383621 | 1653412050 | t3_uwmmj5 | t5_2to41 | 16 | friedpicklerice: TIFU by walking away from threesome.
Wasn't something that happened today but quite a while ago.
About a year back or so I ( m22) was out at some basket ballcourt that I lived near at the time and 2 of my friends (f22 and f21) had had tagged along with me since they had wanted to hangout. It wasn't completely out of the ordinary sometimes they played other times they didn't, this was one of the times they didn't and thought nothing of it . As I was playing a game with some of the other guys that were also there , my friends were cheering me on and chatting on the side. Still nothing out of the ordinary.
After the game I had went to take a breather on the bench. They came by my side to talk about the game and such ( I don't sweat that much so there really was no body oder)
As we were talking they got closer to me kinda getting their chests around my arms and their hands on my upper thighs. I thought they were a bit more handsy than usual but didn't really think much of it. They had began saying they wanted to go back to their place get some drinks. I wanted to go back to my place first and get washed off but they said to do it at their place since it'll be more fun.
Unfortunately, despite all the hints I still thought everything was normal, I had insisted on me going to my place, alone, to get cleaned up a bit (despite not sweating much I still felt gross). I had then told them I would text them and meet them there after.
The game had taken a bit more out of me than I thought and passed out after I got home. One of the guys I had played with that day asked me how it went and after some small confusion it hit me like a truck what their intentions were. From that shame I felt as a man missing that I couldn't bring myself to ask them personally about it. They never did anything like that again probably thinking they were rejected.
Tldr; Instead of heading back to a threesome after playing basketball I went home and slept.
ElSpudman: The logistics of a threesome make it nowhere near as appealing as you would think. You made the right call.
Openheartguy1980s: Nah, as long as you go into it with a clear head, an understanding of the goal (everyone has fun) and relax, it's almost as good as passionate one on one sex. There are definitely some experiences I've enjoyed a lot.
ElSpudman: Key word there was "almost" lol
Openheartguy1980s: Not at all. There is nothing better sexually than being one on one with a partner who wants you. But 3-ways are a lot of fun too. My gf loves watching me with another girl and I like watching her and I like two girls going down on me. Experiences are fun.
| 5 | 3.2 | |
1653387651 | 1653422669 | t3_uwnjnr | t5_2to41 | 4 | problematic_adult: tifu by scaring everyone in the library
This past Sunday my sister and I recorded our voice screaming and put it as ringtone on my phone.
Now we did this to prank our parents, kind of fun. I was too lazy to set it back again yesterday so my phone was on silent the whole time in college.
Today on the morning, I changed my ringtone back to the decent one I had (or at least I thought so), now coming from hospital rotations I unmuted the ringtone and was heading to the library.
As soon as I entered, my mom called me and IT WAS THE SAME SCREAMING VOICE, I really thought I had changed it.
This caused the whole library to stare at me literally.
Like what kind of sociopath has this kind of ringtone, right.
The librarian was also shocked.
Now I'm too embarrassed to step again inside.
Tldr; set up a screaming voice as a ringtone and am pretty sure scared everyone
swcult: That’s either a really small library or a really loud ringtone for it to scare everyone.
problematic_adult: Yup a really small one it is
| 3 | 1.333333 | |
1653385184 | 1653389053 | t3_uwmyyc | t5_2to41 | 10 | tay_401: TIFU by sending my boyfriend my recent tabs and accidentally exposing myself
I haven’t stopped sweating. I was confident in sending my recent safari tabs, genuinely thinking there was no bad tabs in the screen recording but one of the tabs had the google search was “my discharge smells bad but not fishy”.
This was a couple days before he fingered me but he didnt complain at all so I stopped being insecure about it and realized maybe I was just paranoid?? I already apologized after I took in what was there but its on imessage so he can rewind it and slow it down to see it.
He said he still can’t find anything wrong in the video but I feel like it might gross him out even though he’s smelled me for himself?
I know talking about stuff like this is normal in a relationship but we haven’t had sex yet so what if this turns him off? Is this embarassing or not? He hasn’t said anything about it or than the fact that he can’t tell that’s wrong (its disguised amongst the other tabs, you have to pause and read every tab to actually see it)
TL;DR Accidentally exposed my possible insecurities of smelling bad down there to my boyfriend based off my own google search. He’s smelt me himself though and hasn’t complained but I’m worried it’ll put him off.
elephanthoody: This post needs to decide if it's a tifu or askreddit post
KcocNoisnetxeGib: r/AmITheAsshole
| 3 | 3.333333 | |
1653389304 | 1653479338 | t3_uwnyq2 | t5_2to41 | 94 | MatFink01: TIFU by paying my bills
Every end of the month, my gf pay all our bills (rent, electricity, TV, internet and others) from her bank account, then I paid her the half with Twint, a paying app that we have in Switzerland.
Twint is cool. Fast, practical, you can pay with it almost everywhere.
But ONE THING SUCKS : when you receive a payment, you can't accept or decline it. It just goes straight to your bank account.
So.. I owed 1200chf to my girlfriend, but mistyped, and bam, send her 12.000chf.
Nothing bad, you'll say me. She just send them back to me and everyone is happy.
But for a big payment like that, there's a 24h pending period. Which means the money will not be on my account or his. Just the equivalent of two salaries floating in the air.
Then, Thursday and Friday are public holidays in Switzerland, the bank will be closed. Then Saturday and Sunday, where the bank will also be closed.
So I'm at -8000chf on my account at least until monday, my girlfriend is on vacation with her parents 500km away until Thursday, and I've already planned a motorcycle road trip with some friends for these holidays, with hotel, restaurant and everything. I think it will be instant noodles in front of the TV..
Oh and before you're asking, it's too late to cancel the payment..
TL ; DR : I fucked up by adding a 0 to a paiement and destroyed my holidays
jnelsoninjax: I guess I am not seeing something here, but 1200 CHF is what you meant to send, but instead, you only sent 12.000 as in just 12 CHF, since the decimal point is after the 12, and there are simply zeros after it, that makes it just 12? Or am I overlooking something?
Mollusktshirt: I’m many countries, a period is used where other countries use a comma. This is twelve thousand Swiss Francs.
hellec123: >I’m many countries
*Finally, a person who* ***is*** *many countries...*
Mollusktshirt: I guess I’m huge.
| 5 | 18.8 | |
1653393411 | 1653399445 | t3_uwp3ql | t5_2to41 | 25 | CONVEY__YOUR__GLANDS: TIFU by treating my genital herpes with garlic
[removed]
nbuzd: Yo, you got coverage for prescription medications? Or live somewhere where you don't have to choose between a mended bone or food for a month?
If so, valacyclovir. Comes in pill and cream form. Soon as you feel a tingle/itch, pop 4 and rub some cream on the itchy spot. Later in the day, take another 4.
Shouldn't even need the cream if you catch it before the itchy area starts forming blisters, but attacking it externally and internally simultaneously will leave no room for error lol.
CONVEY__YOUR__GLANDS: Thank you will try whenever I can get a prescription
nbuzd: Hope it helps. Been having outbreaks since I was an ankle biter. Down to a couple times a year or less, and they are short lived.
CONVEY__YOUR__GLANDS: Honestly I'm happy for you, sometimes I feel like this is so unfair and how I wish my first partner were honest about their condition.
nbuzd: It is super unfair. Especially since I got mine from mom or dad kissing me on the cheek. They didn't know better. Fun fact, don't necessarily need blisters to spread. There's a thing called viral shedding. You literally shed HSV microbes and can infect other people. Usually happens before and/or after an outbreak, but it can happen at any time. It's more prevalent in the first few years after your first outbreak.
Eventually, people typically viral shed less and less outside of an actual outbreak and it's something like 30% of those with the virus go their whole life being asymptomatic.
On the bright side, I seem to get sick a lot less than your average person. Some literature suggests that, because we are dealing with reoccurent infections and our bodies are regularly taking out HSV microbes that are found outside of our nerve cells (where the little bastards hide), our immune system is often alert and ready to fight infections. Haven't found any recent studies on the subject, but hope there are more in the future.
| 6 | 4.166667 | |
1653396417 | 1653458676 | t3_uwq0rl | t5_2to41 | 87 | Khurast: TIFU by thinking fridges were dumb
So this happened when I was probably 13-15 years old, I can't exactly remember.
I'm not sure where it came from, but for some reason I developed this strange notion that refrigerating food was unnecessary and a scam. I live life for several months with no real impact and never really finding evidence to dispute my wild conspiracy.
Come around to school holidays, my parents left to go overseas for 3 weeks, leaving me at home by myself. Food is stocked for a few weeks and I've got extended family nearby in case I need anything. Before starting my 3 week gaming session and wankathon, I decided to cook a full 4kg of brown rice (as I recently learnt it's healthier than white rice, happy days). As I thought fridges were a scam, I left the huge pot of cooked rice on the stove top after for easy access. Fast forward a week or so, and I start to feel sick after eating. A nice mixture of nausea, headaches, reflux and violent shits. I didn't really think much of it for a few days until I went to grab some rice for dinner one night. At this point I'm feeling sick all day long, and the smell of the rice is starting to get a little off putting but I'm not sure why. I then notice while serving that one of the pots that I haven't got to yet (4kg is a lot of rice once cooked) is green and VERY fluffy on top. I immediately got a wave of nausea at the realisation I've pretty much been eating mould for at least a week.
I now refrigerate food, but I'm still pretty slack with leaving stuff out.
Note: I'm red-green colour blind which I think is why it took me so long to notice.
TLDR: I thought fridges were dumb, left rice out for 1.5 weeks while continuing to eat it. Turns out it was moudly af.
GoonyGooGoo42: Brown rice is not healthier than white rice.
Mysterious_Nature193: And fridges ARE dumb.
GoonyGooGoo42: They make smart ones now.
mrdumbazcanb: Yeah some actually know how to cook and store food
| 5 | 17.4 | |
1653395702 | 1653533051 | t3_uwpszu | t5_2to41 | 10 | VultureMadAtTheOx: TIFU by going on a week long vacation
Well, not today but last week. Close enough. Wall of text warning.
For full context... Back in 2019 my wife had some friends over who invited her to their home city 1500+km / 932+ miles away from our city. I wasn't present and my wife being the supreme queen of FOMO bought plane tickets for us on the spot without so much as hinting it past me. Well, covid happened, we lost some people and the trip was cancelled. I confess I was a bit happy that she was gonna lose the money because she didn't ask me or anything.
But my wife... well, she doesn't give up on some things easily. She made it her life goal to get her money's worth for the plane tickets. She tried at least 15 times to get the tickets rescheduled and the airline's website kept returning that there were no available tickets for the dates she selected. It should have been a sign. Well, some formal complaints, a small cause suit and almost 2 years later she got her tickets. The catch is that the origin and destination should be the same as the original tickets. We didn't live in the same city (or state) from where the plane would fly. Another sign. She bought 2 more tickets so we could go to the city and fly with our rescheduled tickets from there.
I had to beg for 5 days of PTO to my boss. I have 30 days of PTO a year and hadn't used any so far, but since this was short notice and we were working on some important launches it was difficult. I was at the brink of quitting my job because they were denying me my rightful days off, when they finally accepted. This should have been another sign. And then I was finally on vacations.
The flights were ok, we arrived and I rented a car. The wife wanted to go to some city upstate that had some very beatiful beaches, but they were 250km away from the city we flew to. So, I paid extra for some nice car that had support for Android Auto so I could get us there. The first car we got had issues on the seatbelt sensor and if she was in the car with me it kept beeping. We went back for a replacement, and they offered me an upgrade to an SUV. Great, or so I thought. The SUV they gave me didn't even have a USB port so I could charge my phone while using GPS in the 4h drive ahead of us. Well, time to swap cars again. The third car had a screen, but it was a 3 years old car that didn't have any support for Android Auto. Well, time to swap cars again. The fourth one was pretty uncomfortable to drive, everything seemed stiff, but I was too pissed to even bother. GPS worked, so I went on with it. This should have been a fucking sign. But I didn't notice. Well...
We arrived, the city and the beaches were brautiful, the hotel was pretty cozy, everything was ok. Or was it?
To the beach we went. It was a nice, warm, sunny day. We chose some place to sit in a beachfront restaurant, I took my shirt off, slathered on a shitload of sunscreen and ordered some fish fingers and fries. The food was great, but of course I had to order some hot sauce. Why wouldn't I? Turns out the leaving hot sauce open in the sun for some time can grow some bacteria. Not the good kind. The diarrhea and puke kind. Not so fun, but that was my reality for the next days. No more food without painful cramps for me. No more trusting farts for a week. No more alcohol without feeling like being stabbed in the guy. Repeatedly. It should have been the ultimate sign, but I would still enjoy what I could.
My wife wanted to have some touristic experiences and we paid a guide to take us to a small community where people live off breeding and selling shellfish and oysters. He went in our car with us, and after that we got on a canoe to see the locals working on the shellfish farm and get to know them. It was fucking amazing to be honest. I won't get into too much detail since this is already long and the signs are far from over. In the end, the guide asked if we wanted to go to a "beautiful" river and again, my wife being the queen of FOMO, we agreed. Turns out this river is more like a lake you can see from 3km / 2miles away stading at his door being eaten alive by mosquitoes that seemed to be giving us intramuscular injections instead of bites. He wanted a fucking ride and scammed us. Well, it happens. But again, should have been a sign.
The road to this guy's house was a very badly kept dirt road, and while I was trying to avoid a gigantic whole to prevent a flat tire, guess what?! I ran over a stump and completely slashed the front tire. Great. Let's just get the spare and get it over with. And to my (not) surprise, the spare was one of those slim tires that you should not use when over 80km/h / 50miles/h. In my mind I was just trying to imagine how I would drive over 250km / 155 miles to return this piece of shit not going over 80km/h. And to complete my luck, where I stopped was a sandy road, which made it even harder to swap the tires. Try doing it under the noon sun at 38°C / 100F while having to hold back your diarrhea with painful stomach cramps. Not fun. After a lot of struggle I got it done, but since the wheel weights no less than 35kg / 77lb, I sprained my wirst trying to remove it. It's still sore and swollen. I was too mad to be bothered by it then. Big mistake. I just wanted to go back to the hotel after the spare was in place. I plugged in the GPS and back we went. Enough signs for you?
I was so tired, in so much pain and sadness when I left the car that I completely forgot that my shorts had a ripped pocket. And guess in which pocket my phone went? Yeah, you guessed right. If fell right trough, screen first on the stone ground. The shattered screen shattered my spirit. What a day.
But I still needed to find a solution to the tire. I could not drive safely with this shitty slim spare for 250km / 155 miles to return it to where we got it. So I found a place where I could return the car some 40km / 25 miles away and there we went. Guess who forgot to add tire insurance to their rental. Yep, me. There goes 20% of my monthly income in a single tire, nothing I could do. And that is because the nice lady at the counter removed as many extra tolls as she could. So we got a new car and guess whose phone now had a faulty usb port due to the fall? Yep, me again. So there we go to spend more money on a new phone.
5/7 would go on vacations again.
tl;dr: went on vacations after a long battle to reschedule plane tickets, got food poisoning, a flat tire that cost me a kidney (figure of speech), a sprained wirst, a shattered phone and a story to tell.
twotall88: >Turns out the leaving hot sauce open in the sun for some time can grow some bacteria.
Unless the hot sauce was completely devoid of vinegar, that's not the case. Hot sauce is *usually* mostly vinegar and extremely high in sodium making it shelf stable for years.
All this to say, don't blame the hot sauce.
Edit: read the rest of the article. Are you saying you only make $1,250/month? At most an SUV's tire only costs like $250+ mount/balance.
Stougerbour: i got a set for 400 + mount/balance
| 3 | 3.333333 | |
1653406438 | 1653428288 | t3_uwtkqz | t5_2to41 | 83,922 | EmpatheticApatheist: TIFU by sending a call from the International Space Station to voicemail
This happened two days ago (Sunday). A friend of mine is currently on his second mission to the ISS. I saw a call come in on my iPhone and the caller ID said “Us Gov.” I first had that thought / feeling you get when the principal calls you to their office. “Crap. What did I do that I thought I got away with but maybe I didn’t?!” I was in the middle of something with a bunch of people and showed them what it said on my phone and everyone was all "Don't answer it!" Between everyone's suggestion and my gut feeling of being in trouble, I sent it to voicemail. Turns out it was my buddy calling from SPACE. I had a chance to speak to someone that wasn't on Earth and screwed it up. First thing he said in the voicemail was “You probably saw a call from Us Gov and turned it down.” I know he’ll call again, but damn I feel like an idiot right now.
TL;DR My buddy called me from the Iinternational Space Station and the caller ID said “Us Gov” so I sent it to voicemail and missed a call from space.
Edit: He called back tonight! What a fascinating and amazing call! I asked where he was flying over and he said the Western coast of Africa. I asked how the ride was and he said smooth and awesome. He said the second stage acceleration was incredible and that they hit over 4Gs, then at SECO they got thrown into their straps from the deceleration, and bam…orbit. Took roughly 8.5 min to get into orbit. They have a couple of days off (not because of Memorial Day). The conversation was 12 minutes long but we had to end it because of a satellite issue that was about to happens (exact reason is out of my wheelhouse). Ironically, I made him and I laser engraved rocks glasses and I was drinking out of it when he called. We also joked about some funny stuff that happened when I went out for the launch. He was cracking up about the situation with the first call that I shared here and said that’s a common occurrence :)
Ritehandwingman: The fact he knew why you didn’t answer tells me him and others have probably had the experience one too many times and know the drill.
EmpatheticApatheist: Totally. That’s why I gave him crap for not giving me a heads up.
bettycrockerpot: How’s he gonna give you a heads up from space
123ludwig: by calling ahead… /S
JK_Chan: r/fuckthes
D4ltaOne: Omg theres a sub for that. I always fucking hated the /s its so boring.
Gotcha_The_Spider: Sometimes it's necessary.
DrMux: Yeah it's totally impossible to convey sarcasm without it.
Gotcha_The_Spider: I didn't say it was impossible, but I don't think you can tell me in good faith that it can't be unclear if someone is being sarcastic or not.
You've never had someone not recognize your sarcasm before?
maxstronge: The comment you were replying to was being sarcastic lmao, that's the point. It can be very difficult to tell sometimes, you're definitely right, I think they were just making a joke.
Gotcha_The_Spider: I know, I responded according to their sarcasm. Though I disregarded the joke because I wanted to genuinely address the implication.
Ragdoll_Knight: Oh so now they are in danger?
Gotcha_The_Spider: Absolutely. I haven't gotten my fix of scoobie snacks in 6 weeks, do you **know** what that does to a man? DO YOU?!?!?! It's not just them that's in danger, it's everyone.
Ragdoll_Knight: Because of the implication.
| 15 | 5,594.8 | |
1653401861 | 1653496561 | t3_uwrw4b | t5_2to41 | 83 | thatoneburneracount: TIFU by stabbing my own leg
I unfortunately managed to stab my own leg and haven’t told anyone, it’s not bad or anything but felt I needed to tell someone about how stupid I’ve been today .
So In my kitchen we recently bought these really sharp knifes. I also recently gained a habit of flipping random items for no reason like water bottles, cleanex, books, pencils etc.
So today, I was putting away dishes and in the dishwasher there was one of these really sharp knifes, one thing I forgot to mention is that all the knifes have cases and I stupidly took it off. So I kept flipping this knife walking across my house and i sat down and some how I dropped the knife went to go catch it before it hit the floor and ended up propelling it into my leg
Not my brightest moment by far, but I think I might drop this habit.
TL;DR: I stabbed my leg and I have to go clean my leg now
karensworstnightmare: I have the same fixation right now and what I figured is if im gonna flip knifes it will only be butterknives to avoid injury
LazyK0a1a: I once used a butterknife to sperate the coconut flesh from a shell. The knife slipped and didn't stop until it hit the base of the metacarpal bone in my thumb. Luckily I didn't hit any tendons so I just had to go to the ER and get it stitched back together.
thatoneburneracount: DANG,HOW SHARP ARE YOUR BUTTER KNIFES?!
karensworstnightmare: I would also like this question answered, it is possible for a blunt knife to go through skin if you use enough force but still damn
LazyK0a1a: See comment above :-)
| 6 | 13.833333 | |
1653407755 | 1653415045 | t3_uwu2hj | t5_2to41 | 10 | Darkurn: TIFU by not saving my work.
This happened at college around 30 minutes ago when writing this. I'm on the bus home right now.
I go to college for games design so most of my work is online, saving my work is pretty easy it's just control + S as most programs have it.
Sometimes games design can be pretty tedious, especially if you're working on a spot you're not good at, this time i was working with Unity Tilemaps which are finicky to begin with, i was making coastlines for my 2D game and expanding the island you play on more, this took about half an hour to do since it was a lot of cutting pieces off of the big square and patching holes so the fill tool doesn't take off all of that tile connected, I also decided to add some lakes and rivers aswell and have them have colliders so you can't just walk over them.
Well about halfway through doing the lakes and rivers a notification pops up on my screen saying "computer restarting" and them every computer in the room restarted, basically a digital nuke went off throughout the computers, one of my friends lost all his work that day and another lost 5 minutes because he's smart and saves often.
The deadline for the project is Friday too so that's a pain in the ass to deal with.
TL:DR didn't save my work before all the computers in my class got a digital nuke and reset loosing the last half hour or so of work.
Msebada: It’s 30 minutes of work.
Darkurn: That was an average guess to be fair I don't remember when I saved.
Still if you know Unity and it's tilemap system you'd know its a pain to deal with.
Msebada: No, I’m saying it literally took you 30 minutes to do it. I’m not talking about complexity of work.
| 4 | 2.5 | |
1653408170 | 1653434912 | t3_uwu8er | t5_2to41 | 15 | karensworstnightmare: tifu by finding out how I've been sick
I, 17F have been really sick the past week, I thought it was a mild cold at first but as I got worse, I started to think it was covid bc I showed every single symptom, except loss of taste, and I have been getting violently sick more common than I usually would, didn't think too much of it, maybe the iud is suppressing my immune system.
Well while I was playing a game, I went onto my stomach and adjusted my pillow for stability and comfort, and that's when it hit me, the smell, I have a curious mind so if I smell or wonder something I will not stop until I figure it out, so I turn on my flashlight, and went into shock, there was black mould all over my Pillows, I felt sick to my stomach as I have been sleeping on that for the past month, I still feel like shit, so now for the next 24/48 hrs I must monitor my health because also have underlying health issues (asthma, and kidney issues)
TL:DR: I came into contact with mould for a months without knowing so now I need to keep an eye on my kidneys to ensure I didn't accidentally hurt them
PupperPuppet: You went into your stomach?
karensworstnightmare: Onto, damn it thankyou for pointing that out I wrote this at 1am
PupperPuppet: You'd think I'd have been able to interpret that autocorrect from context.
karensworstnightmare: 😂 I've had another look and I can't find anymore errors atm
| 5 | 3 | |
1653408404 | 1653410491 | t3_uwubl1 | t5_2to41 | 4 | [deleted]: TIFU by killing a stranger's dog
[deleted]
twotall88: Yeah, this is fiction. There's absolutely no way to confuse a small dog's bark with a large dog's bark and the likelihood of you being able to kick a dog hard enough to kill it is negligible.
frikkenkids: I don't believe this story either, but I can assure you of two things:
* I have small dogs and one of them has a deceptively deep bark at times
* I'm personally 6'2", around 240 pounds, and I have been doing taekwondo with my family for around ten years. I'm no Bruce Lee but if I connected with a dog the size of any of mine with a full-force spin kick, they would fly away and almost certainly be killed.
| 3 | 1.333333 | |
1653409585 | 1653445737 | t3_uwurej | t5_2to41 | 7,364 | petitepaddington: TIFU by not knowing my own genital anatomy at 21
My whole life, I’ve prided myself on not being like the “idiots” who don’t know their own genitals and think things like having sex upside-down will prevent pregnancy, or that the vagina magically gets loose. I paid attention in sex-ed and figured, hey, since I can look at my own bits, that’s enough!
However, someone linked a diagram on yet another r/badwomensanatomy post, and I had a revelation that *I was the idiot*.
Turns out, I didn’t know where my own fucking *pee* was coming from. “Why do some idiots think you pee from your vagina,” I thought, “when the urethra is so far away?”
What I thought was my urethra… is my clitoris. And the ACTUAL urethra, wouldnt you know, is quite close to the vaginal opening. After 21 years of being alive, however, I’ve finally found the clitoris.
Goddammit.
I’m just forever thankful this didn’t happen during sexy times, or I’d just expire on the spot. Please learn from my mistakes, and look at your bits with a mirror. Make sure you know what everything is. Don’t be like me.
TL;DR I thought my clitoris was my peepee hole and I now wish to perish
Edit: To whoever awarded this “Helpful”, you’re welcome. May you find the elusive creature that is the clitoris.
Turbulent_Place_7064: 24 yo virgin male here .
I plan on googling this shit before getting married ... I ve no fucking idea on where tf things go out and in from in female parts .
No we dont have sex ed .
Ktulu789: Why would you wait until then? She might be an awesome person but terrible in bed.
Then you'll have to get a divorce.
Or you could be terrible in bed... And she will have to get a divorce xD
Turbulent_Place_7064: Everyone waits here . Maybe 10% or 25% dont . But most wait until marriage . A different culture than europe and US .
Most people have their first experience after marriage . I dont know how good it usually goes or how exactly it goes cause no one tells you how to approach it the first night or anything ... I m diving head first . Blindfolded ... Lol
Ktulu789: Society shouldn't rule what you do in your bedroom.
Turbulent_Place_7064: Sure but for me it s religion .
And the lack of finding a girl willing to do it since they too are waiting for marriage xD
Ktulu789: What about traveling? Internet dating? Where do you live?
Turbulent_Place_7064: Oh and people dont do internet dating here . They do but they just meet irl then and get to kniw each ither if it works they arra'ge a marriage .
My main reason is religion tho personally .
Ktulu789: I meant internet dating abroad. Like using happen and changing your virtual location with an app. Or any other app and setting another country.
DuePomegranate: Why are you trying so hard to convince a person who is happy and willing to wait until marriage to have premarital sex? It’s so rude!
Ktulu789: I'm not trying to convince, I'm asking about possibilities. I'm curious. It's rude to treat curiosity the way you do. Don't jump to conclusions.
DuePomegranate: You’re not curious. You’re treating him like a freak. It’s likely that society would have worked the same way in your grandparents’ generation, and I think you know that.
Ktulu789: Wow! And you think your conclusions are not rude at all!
What a specimen! 😂
| 13 | 566.461538 | |
1653409787 | 1653459944 | t3_uwuu8y | t5_2to41 | 2,444 | ihasfirecape: TIFU by being issued a Mini Vibrator by Navy Medicine
So almost one month ago (this isn't the TIFU part although it was a FU) I was cutting zip ties at work and one of the zip ties had been pulled so tight that I couldn't get scissors underneath of it. (In hindsight I should have grabbed pliers to break the cinch part but such is life) Anyways, I pulled out my pocket knife and was able to get the blade enough into the zip tie to cut it. I was pushing the blade as much as I could while trying to be careful but it wasn't working so I decided to quickly adjust my grip with my non cutting hand, which then caused the knife to slide through the tie like butter. The blade stopped at the bone in my left hand index finger. I immediately went over to medical on base and our flight surgeon gave me stitches.
Fast forward... Today I had an appointment for occupational therapy since something internal to the finger isn't healing properly. My range of motion and strength with the finger is extremely limited. Mind you this is my first time at OT and the Navy Occupational Therapist (F) assessing me was extremely professional and helpful through the assessment. She determined that I need an MRI and that until then I would do "finger exercises" to try to help strengthen it.
Well, then she starts reaching into drawers and pulling items out and placing them on the table. First, she pulls out what looks like a wooden nerf dart with a rubber tip. It's essentially a "foam roller" for the scar tissue in my finger. Then she pulls out a jar of putty, and explains how I will do different exercises with the putty...interesting... Well then she grabs a sleek and slender box from the cabinet.
The label of the box is covered by her hand while she holds it and continues to talk about it. "I want you to use this 3 times a day, it doesn't matter when, you can use it at work, at home, etc." She sets the box down on the table and I immediately see that the box says in big bold letters across the label: "Mini Vibrator"...
Mind you, internally I am doing everything I can in my power to be an adult, but externally my eyebrows and eyelids reach their max apogee and the nurse notices this, and she quickly looks away. Thankfully, you have to wear a mask in the hospital so she can't see my mouth. I, now greatly confused, slowly grab the box.
She continues talking about the "mini vibrator."
"So when ever you want to use your vibrator, I want you to push firmly but not too hard."
My head is frozen, but my eyes are beginning to dart around the room, as if I'm looking to see if anyone else is hearing this..
"You want it to feel good, but not hurt."
Trying my best to remain professional...
"Make sure to alternate using your vibrator between using short strokes and long strokes and in a circular manner"
My nose does that thing when you see a meme and you "laugh" silently and to everyone else it just sounds like a dog sniffing something.
Her eyes immediately make contact with mine, and I can tell she is holding back a smile under her mask, at which point I lose my shit and start laughing. I try to reel it back and say "I'm sorry I'm trying my best to be an adult right now."
After I compose myself, I ask "So.. again, just to be clear, I am being issued, by Navy Medicine, a mini vibrator?"
She starts laughing, and reassures me that it is very hard to get through that each time without laughing. She assures me that she will not put "mini vibrator" in my medical record.
Now to the FU.
So I throw the mini vibrator in my flight suit pocket, take all the other fun toys, throw them in my car, and drove back to work. It's around 1900 when I get home for the day and my wife had been looking for her small purse all day and I remembered it was in the front seat of my car. "Babe it's in the passenger seat on the floor of my car"
She goes out to look.
The door opens and she is standing in the door way with a confused and stern look on her face.
"Why the heck do you have an EMPTY box for a "mini vibrator" under your seat?!"
I immediately realized how horrible that looked from her perspective...
While driving home, the box must have rolled under the seat. The "vibrator" was also still in my flight suit pocket. I then had to explain how I was issued a Vibrator for occupational therapy and we had a great laugh.
TL;DR Was issued a "mini vibrator" by Navy Medicine at Occupational Therapy in order to break up scar tissue in my hand and my wife found the empty box under the passenger seat of my car.
RudeSprinkles1240: That's pretty funny.
Did your wife believe you?
ihasfirecape: Yes, especially when she saw what said "mini vibrator" looked like and the fact that I had it in my flight suit pocket. It was so hard explaining it to her to take me seriously, when I too, was now going through what the Nurse went through trying to explain it to me
kagalibros: can you show us the box and the vibrator?
ihasfirecape: https://imgur.com/a/E2azp5t
skumgummii: What is this KN brand of car? Ask of a sudden I see them everywhere.
lzunia: New branding for kia!
skumgummii: Oh it’s Kia! Not KN !
lzunia: Yeah!
| 9 | 271.555556 | |
1653410831 | 1653469016 | t3_uwv854 | t5_2to41 | 435 | DucatiMunster: TIFU by wearing loose clothing around spinning machinery and nearly dying.
I was working on my truck bed frame with an angle grinder and a wire wheel knocking off old paint to prepare for new. I had a plastic face shield on, but couldn't find my respirator so I wrapped a T-shirt around my face to keep out the dust. The grinder caught an edge of the frame and jumped back at me, grabbing my neck t-shirt and instantly twisting it into a tight knot around my neck. It was so sudden and violent that I nearly lost consciousness trying to turn off the grinder and loosen the death grip around my throat.
Now it feels like someone punched me in the Adam's apple, and I have a nice bruise on my right jugular from the grinder slamming into my neck. If there's anything to be thankful for in this moment, it's that the Tshirt wrapped around the wheel enough to prevent it from tearing out my throat.
Don't be like me, wear proper PPE(personal protection equipment).
TL;DR a spinning wheel grabbed the Tshirt around my neck and nearly choked me to death.
liamboyy1: I got grabbed into a belt sander at work by a loose hoodie string that I normally have tied away that I forgot about being too careless because I use it everyday for hours sometimes.
In half a second I was yanked right into, face near the belt but it but luckily it didn’t have the power to chew through all my clothes and got stuck. Needless to say I shat myself and quickly got back into the habit of making sure everything is safe
DucatiMunster: Complacency kills. Glad it wasn't a lathe!
TallChick66: Ugh, a lathe can do insane damage. I went to a therapy clinic for upper extremities for almost 5 years after an accident. In those years I saw the results of many terrible accidents. The absolute worst was from a lathe. He was wearing gloves and when one got caught in the lathe, it split his entire arm lengthwise. Remarkably, with dozens of surgeries they managed to save his arm.
StellaWolflove: I remember a post of a guy in r/ watchppldie (its gone) where this guy got hung onto a lathe until the flesh was flung from his bones.
Shit will never leave my brain, and I WASNT THERE. Fucking be careful around those things ;-;
SauceWithOnion: I have seen aftermath of similar incident. Pieces stuck to the walls that looked like minced meat, fingers on the ground... I keep my distance from spinning machines ever since
| 6 | 72.5 | |
1653411178 | 1653948453 | t3_uwvcsf | t5_2to41 | 330 | ashistheendresult: TIFU by letting my body builder partner dom me
My partner (19M) and I (20 F) have been seeing each other for a few months now. He's really well built since he's been hitting the gym for over a decade, but being the shy person he is he has very minimal experience in bed. I usually take the lead in bed since I have a dominant personality and I have a little more experience than him. Although it is a huge power boost and turn on to dominate someone so strong and have the reins in my hands always I've always wanted him to take over sometimes.
I brought this up in conversation and he told me that he would love to dominate me but thay he's scared he'll forget to restraint his strength in the heat of the moment and end up hurting me. I've always encouraged him to go for it and not worry too much and that if something starts to hurt I would tell him.
Today things got a little spicy and he FINALLY took over. Of course I enjoyed being tossed around here and there. Lets fast forward to the moment of the fuck up. I was lying down and he picked me up and low key propelled me in air from the horizontal position (I'm sorry if this doesn't sound too sexy,,,but it was) and caught me by my butt. We were both really sweaty by this point and our grips were loose so we couldn't hold onto each other at the right moment. In the very high spirits my partner was in, he grabbed my ass very strongly and spread it a little. What was his little was a lot for me. He spread them a little too much and I got a small tear on my butt hole and at that moment I couldn't even understand what went wrong but God I was in above moderate pain later.
I was embarrassed on learning about it and I'm also embarrassed typing it now, but I guess sex is messy and mistakes are made. I will talk to my partner about it when I'm less shy about talking it but I'm worried his apologetic gentle giant nature will be guilty of dominating me again.
TLDR: I let my body builder boyfriend who's unexperienced in bed dom me for the first time and he accidentally tore my butthole a little
MVSugar: He’s been hitting the gym since before he was 9 years old?
ashistheendresult: Yeah his older brother and father are both huge into fitness. He has a home gym so he's been working out since about 7 years of age because of his family
mlb689: Sounds like he might be short. There’s nothing wrong with that. It’s just expected from people who go to the gym from a very young age. It tends to stunt ya height.
nerdwithadhd: Sorry there's no evidence for that.
https://pubmed.ncbi.nlm.nih.gov/17119361/
There's other papers on this as well.
mlb689: It varies on a case on a case basis. There’s no evidence that it doesn’t affect your height.
Thoreau80: >There’s no evidence that it doesn’t affect your height.
Wow. I guess you really proved your claim with that comment. Your logic is flawless. /s
Of course it "varies on a case on a case basis." The proof is that not everyone is the same height.
mlb689: Hey I know comprehension may be hard but at least try before replying on impulse.
I said there is no evidence that it doesn’t affect your height in addition to the previous comment saying that there is no evidence that it does.
However, from your response I can make the fair postulation that you are either short or below average height and it bothers you every day.
Its okay my short King/Queen, I love you for who you are 😌
Jamie___May: I claim you are being followed at all times by nanobots from North Korea. You can’t prove me wrong, so it’s a valid belief.
mlb689: The absence of evidence is not the evidence of absence. Because you don’t have proof something exists does not mean you have proof it doesn’t exist.
That is the simplest way I can explain it. If that goes over your head then you need to work on your comprehension skills.
Zimakov: >The absence of evidence is not the evidence of absence. Because you don’t have proof something exists does not mean you have proof it doesn’t exist.
Mate that's literally the point **the other guy** is making.
You literally said "there's no proof it doesn't make you short" now you're saying "the absence of evidence is not the evidence of absence."
You're literally proving yourself wrong.
mlb689: Did you read the second paragraph of my earlier reply where I said “I said there is no evidence that it doesn’t affect your height in addition to the previous reply saying that there no evidence that it does”?
It’s been clear to me that most don’t understand what they read and simply reply on impulse based on feelings and not reason.
To get a better understanding, read the initial comment and reply. It’s not the one starting with “I know comprehension is hard..”
Zimakov: Yes I read it. You're using the same logic you're arguing against.
mlb689: Could you elaborate on your point because my stance was that it affects your height. The response was that there is no evidence that it does. My reply accepted that and added there was no evidence that it doesn’t affect your height.
Zimakov: Yes. And there being no evidence it *doesn't* affect your height is good enough for you in one argument, but in the other it wasn't, leading you to say "absence of evidence is not evidence of absence."
Either evidence is required or it isn't. You can't have it both ways.
mlb689: What I was saying in summary is that there is no evidence that it does or doesn’t affect your height.
The statement “the absence of evidence is not the evidence of absence ” implies that just because there is no evidence that it does affect your height doesn’t mean that there is evidence that it doesn’t affect your height and vice versa.
Hope that clears up any confusion.
Zimakov: Yes. And in one instance the fact there was no evidence *against it* was enough for you to accept it as fact, and in the other instance it wasn't.
I'm saying you need to be consistent on whether or not evidence is required instead of flip flopping based on your preferences.
mlb689: You make no logical sense. If there is no evidence that it does or doesn’t why should I chose a side?
Sounds to me like you stand firm on your views despite new information being presented to you. Sounds like blissful ignorance to me.
Take care. Have a good day😘
Zimakov: I dont have any views on this subject. I'm talking about what *you* said.
You were perfectly happy to accept that it affected your height based on there being "no evidence that it doesn't" but then when someone else did the same thing you called their logic faulty.
mlb689: I said it could. Not it does. Could as in it may. Not does as in it definitely does.
Lool here we are back on the comprehension point. Try to assimilate statements and their semantics.
Zimakov: Right on mate. No point talking to someone who will bend over backwards to avoid admitting they're wrong.
Have a good one.
mlb689: Loool there’s no right or wrong here there is no evidence that proves it does or doesn’t.
I think you need English comprehension lessons mate.
All the best 😘😘
Zimakov: "If I agree with something I don't need evidence, if I don't then I need evidence."
Just admit it and move on. Don't pretend that isn't what you're saying. Your words are the for everyone to see.
mlb689: What are you saying? Loool I was told that there was no evidence that it does and agreed and add that there is no evidence that it doesn’t.
Thus, the absence of evidence is not the evidence of absence.
So is your lack of understanding there for all to see.
But I am well aware that I can’t comprehend what I write for you.
Zimakov: >What are you saying? Loool I was told that there was no evidence that it does and agreed and add that there is no evidence that it doesn’t.
>
>Thus, the absence of evidence is not the evidence of absence.
>
>So is your lack of understanding there for all to see.
>
>But I am well aware that I can’t comprehend what I write for you.
Lmao. Yes and evidence was required by you in one case and not in the other. I don't know how I can possibly make this simpler for you.
mlb689: There is no evidence that it does or doesn’t. How does one show evidence that doesn’t exist?
What is a fact is that no one can say definitively that it can or It can’t. However, it can be inferred that it could or couldn’t.
You sir/madam/sirmadam/madamsir are very slow.
Zimakov: >There is no evidence that it does or doesn’t. How does one show evidence that doesn’t exist?
>What is a fact is that no one can say definitively that it can or It can’t. However, it can be inferred that it could or couldn’t.
Holy fuck. **Nobody is saying you can prove evidence doesn't exist**.
Actually read what I'm saying before you reply this time.
* In the first situation you demanded evidence because you didn't agree with the claim.
* In the second situation you declared evidence wasn't necessary because the claim fit your preconceived notions.
All I'm asking is that you be consistent. And that you learn how to read.
mlb689: I don’t know whose comments you read but I never asked for evidence. I never said evidence wasn’t necessary.
At this point I’m a certain you have no clue what the phrase “the absence of evidence is not the evidence of absence ” actually means.
At this point, I can say with certainty that you are attributing someone else’s comments to me.
Don’t do that. Have a good day.
| 28 | 11.785714 | |
1653413100 | 1653487560 | t3_uww2sf | t5_2to41 | 15 | greyzombie: TIFU by calling dibs on death.
So I don't respond well to death (I mean, who does?), and I go from making inappropriate jokes to anger to tears, in that order.
Luckily, I have been able to surround myself will like-minded friends. We're all in our late 30's/early 40's, and make lots of jokes about how we wish we would die. Usually over the smallest of inconveniences. We strongly believe that most people who have passed on would appreciate some inappropriate jokes vs feeling sad and miserable. Sadness and misery are always a part of it, but we take the time to joke about the situation, if that makes any sense.
Anyways, we recently had a friend die suddenly. Car accident. He wasn't at fault. It was terrible but apparently painless. When we all met up a few days later to have some drinks in his memory, someone mentioned that they were grateful it was quick and painless.
Then my dumbass opens my dumb mouth and says "Sounds great, me next."
That might not seem too bad, but this group apparently had varying levels of friendship that I wasn't entirely aware of.
The TIFU is that one of the friends was like a brother to the departed and another was an ex of his. The ex burst into tears and ran for the restroom while the 'brother' just sat stone faced and stared at me. Another friend took me aside and explained why they both got upset. I'm part of the 'core' of friends, I guess, and these two only seemed to come and go when late friend was around, and not often for the ex, so I never really knew them as well as the other friends.
I felt my face go red, muttered an apology and immediately went outside to have a smoke and feel embarrassed in private.
Anyways, this is probably me just overthinking it, but I feel like an ass.
**TL;DR**
Called dibs on being the next to die painlessly in front of the deceased's ex and very close 'brother' friend.
AcrobaticSource3: You don’t call dibs on death. Death calls dibs on you.
Far-Algae4772: That's only in russia.
| 3 | 5 | |
1653413384 | 1653417816 | t3_uww6kb | t5_2to41 | 40 | Adventurous_Mail5120: TIFU By Crashing A Kid's Birthday Party
Well, today I screwed up, in every sense of the word. I am a full-time custodian at a gym, but today I had the night shift so I decided to go to an arcade and play some games. The closest one to me happened to be Chuck E. Cheese, and considering it was morning I was hardly expecting any people to be there especially children, since school isn't out yet. Well to my surprise there was a large group of children sitting, and I did something uncharacteristic of me, I wanted some free pizzas. I introduced myself to some of the parents and said I was the gym coach of the kid, so they let me join the party. Sadly, by the time I got to the table the pizzas were pretty much gone so an idea popped into my head.
I started the all-too-familiar chant, "WE WANT PIZZA!". Keep in mind these kids basically filled up this damn Chuck E. Cheese, honestly I have no idea how this kid has so many friends when I can barely even find any. SO imagine this huge group of kids becoming unruly over some pizza, their voices were loud, and the parents were shocked. The pizzas soon came... and I feasted. But this is where my fuck up happened, I guess I stayed too long because the kid's father asked if he knew who I was and obviously he said no. I mean at this point I had devoured two whole pizzas with no one being the wiser, but now the gig was up. I got up calmly, then sprinted as fast as I could out of the exit. He was faster. The Dad sternly informed me that unless I paid for all of the pizzas I had riled up the kids for he would call the cops and tell them that a stranger is acting suspicious around a large group of kids, which would technically be correct. I did not want to know how THAT would go down, so I ended up paying about $150 in pizzas. Yep... I'm an idiot.
TL;DR I crashed a kid's birthday party, then riled up the kids to ask for more pizza, then the Dad of the kid made me pay for said pizzas and I ended up paying about 150 dollars in pizza damages.
-AM
randousr88: Hah, you 100% deserved that. Also, kind of weird to go to a Chuck E. Cheese as a grown ass adult knowing full well it's meant for kids. This would go great in AITA? Because you are TA
colcatsup: Might be one of the few places with good arcade games?
randousr88: Yeah, meant for kids.
Adventurous_Mail5120: It’s for both kids and adults.
| 5 | 8 | |
1653415220 | 1653415571 | t3_uwwvit | t5_2to41 | 31 | zeewrecks: TIFU by using a Roomba.
Got brand new carpet 3 months ago in our recently purchased home. It was this morning that I realized choosing white wasn’t a great decision.
We have hardwood floors upstairs and the only carpet is downstairs. We usually put up a gate at the top of the stairs, so if our dog has a rare accident, it’s easily cleanable on the hardwood. It should be noted that she still has not had an accident in this house since buying last October. Last night, the gate was left open, and our dog jumped at the chance to mark her territory.
We have our Roomba set to vacuum every 3 days at 8am, which of course, just had to fall on this morning. I heard it turn and do it’s business, which usually takes about 45 minutes. About 20 minutes in, it started beeping like it was jammed somewhere or stuck on something. I got out of bed to go fix it and it turns out, that something was my dog’s poop. Not only was the Roomba clogged with poop, but it had ran over the poo pile and spread it all over our new white carpet and area rug for probably 15 minutes, based on the fact she dropped her poop load pretty close to the Roomba charging base.
So, I got all the bigger clumps picked up and put the Roomba outside. All of the undercarriage components were completely engulfed in poop and I have no intention of cleaning it. I think we’re going to stick with standard vacuums from now on! Shockingly, a local floor cleaning business was able to get out here within a couple hours and they did an amazing job.
TL;DR: Woke up to my Roomba vacuum spreading dog poop all over my brand new white carpet.
HungaryToWinWC: I think the bigger issue is the fact your dog shits in the carpet.
zeewrecks: I think reading the story explains this take.
| 3 | 10.333333 | |
1653416792 | 1653446939 | t3_uwxh3m | t5_2to41 | 8 | boy_wonder456: TIFU grocery store clerk caught checking out some ass
This was a few years ago, in my mid-late teens. Was working an evening shift with my assistant manager.
He brought some edible (cannabis) cookies in, I had never tried them before so my dumb ass thought it would be a good idea to try it while stocking fruit.
An hour goes by and the edible is starting to hit me. Assistant manager and I are on the floor stocking product. I’m packing a box of apples onto the shelf and notice two beautiful women walk in the store.
…I guess my eyes caught one of the girls behinds & didn’t leave. My assistant manager notices me looking & yells my name. As my eyes look up from the girls ass, I happened to see the friends face - which was 😲.
I panicked, flipped over the box of apples. They poured all over the ground, dropped the box and ran to the back to hide.
TLDR: ate edible cookie at work, got caught checking out a girls behind, apples suffered.
c_man_49: I’ve been busted like 8 times. Just checking shit out. I’m a bit of a mouthpiece but I always say” you put on display for a reason. How would you feel if I didn’t look?” All of a sudden I’m less of a perv and she’s out there fishing for compliments or dick. Don’t feel bad getting caught looking at floozys. The three second rule though I think is pretty common across the world. But… that’s 3 seconds after you get caught bahahaha
Dependent_Ad_5035: We went ALL in the misogyny today
c_man_49: You got it right. That was like 17 years ago when I was 17 and I was proud of It. I definitely don’t have the balls to try to say something like that today. But back then it worked. And well
| 4 | 2 | |
1653417927 | 1653419530 | t3_uwxwm5 | t5_2to41 | 40 | [deleted]: TIFU by shaving my FWB who has a fragile ego
[deleted]
topcat5: The big fuck up here is in not going to the doctor to get proper medical treatment. Sticking a safety pin in the ball sized boil on his man parts is a very bad idea
GeekyTricky: This is toxic masculinity at its finest.
This dude shaved his dick to feel like a macho man, then wouldn't go to the doctor for a small problem, and now rather than face the fact that he was wrong he'd rather have his equally unreal gf stab his third ball to death with a safety pin.
cobalt1981: And the drama queen of the year award, goes to this person.
| 4 | 10 | |
1653417937 | 1653424359 | t3_uwxwqv | t5_2to41 | 10 | embarrassingfailureg: TIFU by yelling at my neighbor
tl;dr some guy came to my front door acting weird, and I ran him of my porch. Turns out he was my neighbor, and now I have to see him every day.
Some context before I dive into my shameful story. I work from home, and my office looks out the front window. I am familiar with pretty much everyone who lives on my street, and I have a good relationship with the people who live close to me.
The other day an unfamiliar man knocked on my front door. When I opened the door, the first thing he said was "did you call the cops on me?" I responded that I didn't. He then asked if I drove a Tesla. I don't - and at this point I my spidey sense started tingling. I told him to please leave my porch, and I closed the door.
A few minutes later, I hear knocking on my front door. I let it go. The knocking continues for over a minute.
Here's where I fucked up. I opened the front door and said "get the fuck off my porch." He replied "or what?" I replied "or you are going to get hurt." He asked if I was threatening him, after which I said "I am absolutely threatening you. Leave now."
At this point, my neighbor from across the street came out. He's a retired cop, so that put me at ease. He basically chased the guy away.
After he left, he let me know the guy is a shut-in who lives two doors down. Apparently he's been off kilter for some time. Shit.
Now this guy has decided he is going to park in front of my house, and try and provoke me into a fight whenever he sees me. I should have just called the cops on him when he came around the first time acting the fool.
nanny2359: Or just talk to him like a fucking human being
embarrassingfailureg: LOL.
| 3 | 3.333333 | |
1653421013 | 1653436018 | t3_uwz29l | t5_2to41 | 185 | NathanielWolf: TIFU by not changing my houses's air filter for a decade
So this FU has been going on for 12 years, but the realization just hit me today.
I've owned a home for over a decade. There's no A/C, but a furnace I run during the winter, and occasionally as a fan for circulation in the summer.
There's an air intake in the hallway ceiling, where i have been dutifully changing out an air filter every month (or so...). However, it's always been a huge pain- there are no brackets to keep the air filter in place (it kinda just rattles around in there), it's a circular intake, the grate that covers it is screwed right into the drywall (dryceiling?), etc.
So I've always though "geez, this is such a pain, why did they design it this way?". At this point I'm not even sure why I thought that was the thing to do, I guess I saw the intake when I moved in and was like "hey, why is there no filter there?"
Fast-forward to today, and I stumble across this Reddit thread: [https://www.reddit.com/r/lifehacks/comments/uwt3dv/make\_some\_handles\_out\_of\_tape\_on\_your\_air\_filter/](https://www.reddit.com/r/lifehacks/comments/uwt3dv/make_some_handles_out_of_tape_on_your_air_filter/)
I'm looking at the picture and it clicks: Wait, there's an air filter \*in the furnace\*?
So I go out to the garage, flip the breaker, crack open the furnace panel and shine the ole' phone-light around for a bit. It was hard to spot at first but ... sure enough, above the blower there it is. Barely recognizable, covered in 12 years of filth, dust and hair, the original air filter from when the house was built.
I'm \*horrified\*. Our poor lungs ...
I pull the sucker out and it's even worse than it first looked. Probably 3 inches thick of dust and who knows what. There's literally a dead moth embedded in it. It's just .. really bad.
Feel fortunate, dear readers, that this sub does not allow photos, because I took one and was ready to share it. Probably for the best.
Next month I'll be taking the one flopping loosely and uselessly around in the air intake out, and I'm going to be \*much\* better about changing the one in the furnace going forward.
TL;DR Just found out there's an air filter \*inside\* our furnace, which pumps out the air I've been breathing for 10 years, through 3 inches of accumulated dust and debris. Change your filters!
literallytwisted: It was probably still filtering well, You were just spending a lot of money on heat since your heater wasn't pushing much air.
NathanielWolf: Hey thanks, that’s good to know!
Guess I’ll find out next winter :)
imakesawdust: I'm surprised your furnace didn't go into an over-temperature shutdown if the filter was *that* clogged. I once clogged both of my furnaces' filters one winter with white dust residue after a failed DIY humidifier experiment (that probably warrants a TIFU) causing both to shut down with an over-temperature condition since the filters weren't allowing enough air to flow over the heat exchangers.
NathanielWolf: Oof! Well mostly I'm glad it didn't burst into flames ...
| 5 | 37 | |
1653421967 | 1653423542 | t3_uwzetn | t5_2to41 | 13 | [deleted]: TIFU by giving a homeless person a coffee
[deleted]
hawkmech67: How is your coffee related to her heroin? Maybe having coffee with you kept her from doing something worse or overdosing.
icannotbebothered7: It’s the fact that I’ve gave her it and I could potentially get in trouble if my boss finds out about the heroin on the floor. As much as I ain’t going to judge, letting someone who’s on drugs into a business that’s considered pretty “fancy” or “high end” can cause issues with my job security
SithRose: And you're supposed to know how exactly? It's not like you're a mobile drug test factory or have a canine nose to smell it with. You had no idea until she left. That's not a fuck up.
icannotbebothered7: Your very right, thanks for the reassurance
| 5 | 2.6 | |
1653422106 | 1653891156 | t3_uwzglw | t5_2to41 | 117 | Different_Length2292: Tifu by not realising how bad guys were at taking hints
So i have been crushing on my best friend's brother for some time now. She knows and tries her best to help me out, and is very often frustrated by how dense her brother is and how much of a fucking coward i am.
We have become good friends over the past few months of me trying to get his attention. We hang out (ever since his sister mysteriously cancelled plans to play badminton at the last moment and we decided to play without her anyways) and have a lot in common.
So on friday i decided to go for it, and sent him a text saying
"Dr. Strange on sunday?"
My plan here was to follow up with "Hazel isn't coming btw, this is a date" if he said yes.
But the little shit replied with
"Sure! I was planning to go this week but it'll be much more fun with a friend :)"
That day i died a little inside. I had a hundred fears running around in my mind and this message just confirmed most of them.
When hazel finds out the next day she's fucking mad at both of us. She's confident her brother likes me because she "knows him very well" but he's denser than a brick and i have the courage of a wet bunny.
So she gave me instructions for our little "date". I bought a tub of (awfully overpriced) popcorn which we shared. We were leaning towards each other. Then i rested my head on his shoulder. Then WE HELD HANDS DURING THE ENTRE FIRST HALF OF THE MOVIE(nsfw)
But during the break he pretended like nothing special happened??? Fucking killed my mood. It was the most angry i have ever been while watching a movie.
But holding hands had to mean something, right? So i went ahead with the plan anyways. I asked him if he was free for the rest of the afternoon. He said yes. So we played badminton. Then went over to his place to chill. I needed to change my sweaty clothes so i put on some of his clothes. I got hungry and we ordered pizza. We decided to watch another movie. And i kid you not, this dude pretended like we weren't just holding hands while watching doctor strange.
Desperate, i picked a movie i knew he had watched multiple times before. Star wars lll. It's not even that good. But he's still paying way more attention to the movie than to me resting me head on his shoulder. I had absolutely given up at this point. I was tired and sleepy(winning at badminton is draining) and I'd rather just take the hard rejection. And I'm having a hard time staying awake.
This guy goes "hey, it's gettig late, I'll sleep here and you can sleep on my bed" and i am absolutely annoyed right now. I snap back with
"Can't you see I'm trying to fuck you? I'd rather just go home right now than sleep alone on your fucking bed"
And i start gathering up my things. When he finally starts to realise that the girl he was cuddling with might be into him. And i start to realise how easy it was to get over with.
Long story short, we're dating now i guess but we just held hands and fell asleep on the couch that night ( we were too tired to do anything else) and i wish I'd done it earlier. He's dumb as fuck and rejection is better than uncertainty.
Tl:dr - struggled to get a friend i held hands with in the theatre to realise i was actually into him. Just ask them out. Saves a lot of time and effort
Pomoa: Ok, let me tell you :
After flirting with a girl for like two years, dating and sleeping together, I WAS STILL PERSUADED SHE WASN'T INTO ME.
I am dense as the core of the earth, yes, I have self esteem as low as the effing Mariana Trench and am dumb as a newborn chicken.
When years later she told me she was into me, realisation came... Fast at me.
Wish you to love each other a lot and for long!
pyrohydrosmok:
>After flirting with a girl for like two years, dating and sleeping together, I WAS STILL PERSUADED SHE WASN'T INTO ME.
>I am dense as the core of the earth
This. 10000% this. I was fucking married and my wife was smitten and all I could think was,"But does she *like* me?"
Spideyocd: How can you guys have SEX and not be convinced they are
into you
when you've been
into them?
pyrohydrosmok: As a man your get treated as disposable by women, society, everyone. Seriously.
I always felt I was only useful if I'm... Useful. That's how I was treated. That's how men are generally treated. Then our feelings are dismissed completely so we clam up and shut down and people wonder,"WHY ARE MEN SO COLD AND DETACHED‽" Gee Becky I fucking wonder why.
Pomoa: I'm sorry you feel like that and certainly do in a sincere painful state, but you're spreading a really hateful speech there.
What do women have to do with our society encouraging men into becoming adults with the emotional development of a three year old? They are not specifically, or more, responsible of it.
| 6 | 19.5 | |
1653423742 | 1653427903 | t3_ux032c | t5_2to41 | 32 | [deleted]: TIFU by name dropping to my roomate
[deleted]
yikesonbikes2: Your roommate sucks lol
yikesonbikes2: So anyways tell us more about your evening with him?! Was he nice? Did you bang? Is he a big name? Did you have to agree to not disclose his name to the masses?
throwaway83838399: THE REST NIGHT AFTER THAT EPISODE WAS SO COOL! Honestly I had a lot of anxiety after he gave me “the talk” about how I bragged to my roommate because I just wanted his approval so bad lol. But he moved on from that topic quickly. He’s actually sooo humble, besides my nerves it was very much like hanging out with a normal guy. We did bang lol, it was honestly a negligible part of the night which was super cool because that made it feel more like he honestly just wanted to get to know me. I don’t know what counts as a big name, but he has 4 million monthly listeners / 1.2 million followers on Spotify if that gives you an idea of his fame level. He was really interested in MY life, like he wanted to know about my studies and where I’m from ect. I wish at the end of the night I would’ve asked for a picture or an autograph or something but I didn’t because I already knew how he felt about me bragging about meeting him.
Thanks for asking, lol!! I really needed an oppurtunity to gush. I definitely have an unrealistic crush on him after that night
yikesonbikes2: That’s awesome! I’m glad you had a good time! Also glad you didn’t ask for a pic or auto after that 😅
throwaway83838399: He follows me on Instagram now and liked a few of my photos when he had initially noticed my messages the morning after the concert, so although I don’t have a picture or something at least that’s a relic. A pretty public one too, considering he wants to be secretive
yikesonbikes2: Maybe you’ll hang out more 😗
| 7 | 4.571429 | |
1653424514 | 1653425233 | t3_ux0dn5 | t5_2to41 | 4 | [deleted]: TIFU by attempting to draw my own blood in a room alone
[deleted]
only1dream: I'm a healthcare professional and I've always wondered if my patients messed around in the room after I left. Good thing you were already in a clinic where you could get checked out.
[deleted]: For sure. Not doing anything stupid like that again- thankfully I woke up in a minute or two because no one else was there. The most I would do as a kid was just touch the blood pressure cuffs and poke the blood vials.
| 3 | 1.333333 | |
1653424895 | 1653500849 | t3_ux0iuv | t5_2to41 | 8 | SandInMyBoots89: TIFU by being a cautionary tale. This is The Stories We Tell Ourselves
[removed]
DecepticonAF: Read this elsewhere (where we really hate on people like you and your married partner) and, while I have to say that the writing is compelling, I would still toss the protagonist of your story in a dumpster, where he belongs with the rest of the trash. You deserved everything that happened to you and then some. In the future, I hope that you either refrain from engaging in such disgusting behavior or that the BS you decide to help hurt gives you what for.
SandInMyBoots89: I'd love to know where to find more comments like yours. Can you share?
DecepticonAF: Doesn’t take a rocket scientist to find them and I’m not worried about your potential downvotes. I’ve got enough positive karma to withstand some brigading from a cheating pos and his fellow ilk.
SandInMyBoots89: I already upvoted you lol.
| 5 | 1.6 | |
1653428237 | 1653434070 | t3_ux1r4b | t5_2to41 | 8 | Tiezzynator: TIFU Missed obvious signs from a really hot girl at the sauna
So always after going to the gym I go to the wellness center that is in the building.
This time was different tho, there was a really hot girl in the sauna, she had beautiful blond hair, blue eyes, godly ass and nice tits. I caught her looking a couple of times but didnt think much of it. As soon as I went out of the sauna she also went out and she said "Its really hot in there". Then we both went for the jacuzzi and were talking and she gave me some compliments, suddenly she stood up and started jumping because "there was water in her ears and she learned that from swimclass". And when the place started closing we both walked to the changing rooms and she said "Hope to see you again some time" and I just repeated that. Only to realize the mistake I made when I got home. Now my head is racing, hoping that I have another chance if I see her again. I hope that I still have a chance if I see her again
TL;DR Saw hot girl in the sauna looking at me and giving me all the signs, didnt think much of it until I got home
radikaltruth: You blew it.
Tiezzynator: I hope not 😓
AcrobaticSource3: You blew it, you didn’t blow her
| 4 | 2 | |
1653430777 | 1653489256 | t3_ux2nc0 | t5_2to41 | 370 | kj194567: TIFU by drinking expired milk and wearing a dress
TL;DR - TIFU by drinking milk that I didn't know was expired, and I shit myself. While wearing a dress.
This should be a throwaway account but it's been a shit day and I'm tired. No pun intended.
So today, I had a presentation in person with one of my accounts. I love it, let's do this, I'm pumped. I normally make my own coffee because I'm tired of paying Starbucks, so I make myself a handy little latte as I'm getting ready because it's after noon, I'm already tired, and I want to be PUMPED for this meeting.
So I put my cute dress on because generally I WFH and I wanted to dress up and look nice, I jump in the car, and I drive to their office building. I take a sip of my coffee, and I think....hmmmm. When is the expiration date on the milk? May 26th, right? I swear it was the 26th. Why does it taste slightly off? I'm sure it's fine. It's fine! I chug it down because I want the energy of 16 energizer bunnies running through my veins.
I keep driving, and about 15 minutes later my stomach starts to feel a little upset. I think - all good, probably just the stress due to driving to a new place in downtown and wanting to be on time (directional skills are not...one of my skills).
I get there and get to the front desk 15 minutes early, woo! I ask the lady at the front desk if there is a restroom. She says no and that they have to buzz me into the office to get to the restroom. Alllll good, I say.
My point of contact comes to get me, I forget about having to go to the bathroom because I'm in my "omg it's so nice to meet you, hi how are you please buy our products" mode. I do my presentation with my sales partner, it goes fantastically, and I don't even remember that my stomach was upset.
They go to walk me out, they asked if I needed to use the restroom, and I SAID NO. And this is the first part of my f/u. I think to myself, I don't even need to go anymore! I crushed this meeting! I am invincible!
I get into the car, and as soon as I sit, my stomach starts to hurt again. All good, I think. 23 minutes to home, I can do that.
17 minutes, starting to feel it become more urgent.
Somehow I make it through the next 15 minutes. I round the corner to my apartment complex and pull into my spot.
At this point, the sirens are blaring in my head. I'm about to lose my shit, figuratively and literally.
I see a car pulling out while I am getting out of my car, so I walk gracefully as to not arouse suspicion.
Walking, walking, walking.
I also think at this point that running may not have a great effect on my stomach.
I walk, thinking "I can do this. I am SO CLOSE. I am going to push Lou (my dog) out of the way the moment I get to the door and run to the toilet".
At this point, logistics is on my mind. How can I get to the bathroom quickly enough once I get in the door?
I get in the elevator. Seconds feel like minutes. I text, I scroll, I do ANYTHING to distract myself.
I get to my floor. At this point, I don't know how I am still moving and why did this happen to me?
I sprint to my door, and at this point I'm pretty sure that I'm audibly speaking some unintelligible words, some foreign mumble of urgency and shock that I'm in this shit-uation.
Then, the unthinkable happens.
You know what is worse than shitting your pants?
Shitting your pants but you're wearing a dress.
Just picture the surface area that you have to protect you in a dress
Spoiler alert, there is very little.
That's all I have to say.
I will spare the remainder of the details, but let's just say that I have now checked something off my bucket list that I never knew was there.
A box I never wanted to check.
Now I am re-thinking my life decisions that brought me to this point.
I'm doing this while my dress is in the dryer and my ass is fresh out of the tub.
And I hope that my darkest moment has brought light to your day.
AcrobaticSource3: > I have now checked something off my bucket list
Ironically, if you had a bucket, it would’ve been helpful! And a question: was it solid so it clumped out or liquid so it ran down your leg?
OreoNachos: Thank you for asking the question we are all secretly want to know the answer to (seriously, I'm not sarcastic. I truly want to hear how gross and no I don't have a thing for that).
moonkingoutsider: I'd argue the latter, just based on personal experience with spoiled milk AND the urgency factor - usually it's easier to keep solid in and I would assume it would get caught by the underwear and not make it to the dress. The fact the dress had to be washed makes me think there was more of...um....an explosion.
| 4 | 92.5 | |
1653434675 | 1653449502 | t3_ux3xlu | t5_2to41 | 6 | Occasional-Mermaid: TIFU by accidentally lying about my age while purchasing a disposable vape.
Actually happened the day before yesterday but anyway, the story:
I’m 32, I don’t look like an old hag or anything but I’m clearly over the age of 21. It’s also worth mentioning that I am socially awkward & so anxious that [Pain and Panic](https://c.tenor.com/hhcfDlLwQ9wAAAAC/hercules-panic.gif) would tell me to chill.
I went to a gas station that I hadn’t been in before to purchase a disposable vape. There is just one person in the store, the worker behind the counter. She’s making friendly small talk but for some reason it makes me feel rushed to find what I’m looking for. I’m doin my best to listen and politely respond to her while frantically trying to read the boxes in front of me and the whole time this overwhelming mixture of apprehension and tension is washing over me.
Finally I just read out the name of what I’m looking at, not really paying attention to what it was just needing to hurry and get the heck out of there before I have a full blown panic attack for no damn reason. I look up from the boxes and realize that I have cut her off mid sentence and have no idea what she was even saying. I start apologizing but she just waves it off and asks me how old I am…so I did the absolutely normal thing and loudly blurt “TWENTY-ONE!” like a contestant answering a game show host. Definitely not suspicious or weird.
She raises her eyebrow and goes “okaaaayyy..”. Of course then I start awkwardly trying to explain that I’m not pretending to be 21, fumbling to pull out my drivers license, and she laughs and says “Oh hon, it’s okay, we all fudge it some when the years start adding up”. Now I obviously have to insist that I’m not self conscious about my age but she is just nodding and doing that half smile, condescending thing “Oh you don’t need to explain, you look just fine, no one is calling you old”. I grab the bag, mumble a few sorrys and thank yous and leave.
I make it to my car, open the bag, and realize I have paid double for less and a cartridge half the size I normally get AND I have gotten the wrong thing. FML.
TL;DR: I accidentally made it seem like I was trying to fake being a younger age than I am.
Natsurulite: This is why I use the internet to buy vape shit, I feel for you OP!
Occasional-Mermaid: I usually do but I was in a crunch lol I can never go back to that place tho 🤣
| 3 | 2 | |
1653433978 | 1653628116 | t3_ux3poe | t5_2to41 | 69 | Gamlos: TIFU by trying to help an earthworm
This happened today, and as I type this on my phone I'm still watching the ramifications. Today it rained where I live and as always the earthworms decided to crawl out of the soil and make their valiant run for dryer ground or escape to newer pastures or whatever these little dudes do when it rains. As usual, one had traversed out onto a little concrete pad in my back yard. I'm unfortunately a cigarette smoker, so I usually pop out in the back yard every hour or two for a smoke. I noticed him around noon when it was still damp and around 1:30 when I went out again the rain had stopped and the sun was beating down on this little wiggle friend, and he seemed to be writhing in agony. Idk if they can even feel pain, but it seemed like it in that moment and by thunder I was going to do something about it. I grabbed a little stick to move him because even though I'm a 29 y/o father and work with soil all day for my job I'm still a little bitch about creepy crawlies, and placed him back into some grass beside the pad. He started to dig into the soil and I was proud I had helped a less fortunate lower organism today. Fast forward a couple hours and I go out for another cigarette and decide to check on him. It looked as if he was covered in soil as I was approaching but to my complete horror he is not covered in soil, but infact covered in hundreds of angry ants, slowly gnawing him to death in a brutal display of raw nature. They had gnawed off and detached the rear section of his body and were carrying it away to God knows where. I know it's a small and some would say insignificant being, but damn do I ever feel horrendous for bringing him to a painful death like that. I think that's the last time I try to save a worm.
TL;DR: Tried to save a worm after a rainstorm and ended up feeding it to hundreds of ants that then dismembered it.
Chavakno: Nature is metal
victoriasheep: did you mean.. mental? 😔
Chavakno: Nope
| 4 | 17.25 | |
1653437984 | 1653501769 | t3_ux4ym3 | t5_2to41 | 28,702 | tiptopceriptop: TIFU by not disclosing that our professor was also my father
I'm using a throwaway because my main has a lot of identifying information. Also I have dyslexia and don't speak English natively.
Posting a second time because I forgot the tldr.
But anyway.
My dad was "poached" by my university and got an amazing contract for a teaching/ research position.
So anyway, I am studying something similar that both my parents did. So obviously this semester I had to go to a class that only my father was teaching.
I went to class and never told anyone that our professor was my dad. I don't like to socialize anyway lol.
We are around 100 students in his lecture, so I figured it wouldn't be a big deal eitherway. It's just a final exam with multiple choices and not like a paper that had bias options.
The fuck up happened monday afternoon. After class i waited for my dad and we went to eat lunch together.
After lunch we were talking and my dad kissed me on the head before I left for home.
Apparently some of the students of class were walking by. And intrigued by me eating with our professor they started filming us. Including the kiss on the head.
This afternoon the class whatsapp group started being flooded with screenshots and smug messages of the people that saw it. Saying " reported to administrators".
I responded by posting a childhood picture with me and my dad. It's very clearly me because my face kinda never changed.
The chat immediately died down. Then 10 minutes later a fucking war started. Students saying that I was a nepotist and it was my fault for not making an announcement about my father. Other students saying that the others were at fault. Again others making stupid incest jokes. Others spamming the group with stickers. Others hitting me up privately to talk them up to my dad. Others to ask me if I could steal my dad's exam.
This is the reason I don't socialize....
TLDR: Didn't tell classmates that my father was our professor, started a student war, was reported to administration and am now terrified to put a foot on campus ever again.
Edit: the administration obviously knows. This is not illegal. My father can in fact be my prof.
Again the test is multiple choice and he has 2 TA's helping him. There is little to no chance of bias towards me.
MyLittlePinky: Not your fault, people like to assume shit. Lol
ijustplaygamesman: This. People need to mind their own fucking business. Jesus fucking christ.
lobbo: And why do people think its OK to record other people eating their lunch?
Gloomy-Taste-9664: Because they need something to gossip about, be it a lunch between father and daughter or a teacher and his/her student
BudLightYear77: Nah I'm gonna jump in and say a teacher kissing a student is pretty in appropriate. It only becomes acceptable when you know he is he is her father.
Recording that moment was proof for the administration. If the post had been 'I saw my professor kissing a student, should I record and report this to the administration?' then what would we be saying?
They shouldn't have shared it with other students but also this event sounds like it happened in the open where everyone could see it.
DolphinFlavorDorito: But they were ALREADY filming to catch that moment.
JSmellerM: Obviously. If they didn't, they also wouldn't be able to film the kiss. Unless they are making out you just wouldn't be able to record that moment.
Here_Forthe_Comment: So we should always film everyone in case we catch something inappropriate?
traugdor: It's what the government does, why not?
Here_Forthe_Comment: What you're arguing is that no one should have a right to privacy because they could do something bad at any moment
traugdor: Nope.
Didn't say that at all.
You couldn't be more wrong.
| 12 | 2,391.833333 | |
1653439225 | 1653447296 | t3_ux5c5x | t5_2to41 | 12 | Indigo_132: TIFU by destroying a glass shelving unit in a jewelry store (in 2012)
As the title says, this story is from 2012. I would have been 8 years old at the time. This memory just popped into my head randomly today and it feels like a fever dream, honestly. It’s hard to believe this actually happened. Some memories aren’t super clear, but I’ll do my best to explain it.
I was with my friend and his mom out doing errands. At the time, both my friend and I were homeschooled, and his mom would homeschool both of us on weekdays. (My mom, who previously homeschooled me, had a debilitating illness at the time. She had a miraculous recovery in 2015.)
My friend and I had invented a game called “Am I Brave Enough?” where we would play with dolls and make them do crazy daring things like hang from the car handle and whatnot and say ”Am I brave enough?” The other friend would gauge whether or not that doll’s daring action was “brave” enough.
We had been playing this game in the car as his mom drove both of us around as she did errands and stuff, and we stopped at this store that I think was a jewelry store, but my memory is so foggy it might not have been. But it was some sort of store that sold small trinkets, probably jewelry. They had this multi-level shelving unit made of glass with presumably jewelry displayed inside. My friend and I were playing Am I Brave Enough? with the dolls while in the store while his mom looked at stuff (I presume. I have a vague memory of her talking with an employee while this happened.) We decided at the same time to try to put our dolls on top of the glass shelving unit while standing on top of a bench to do “Am I Brave Enough?” with the dolls from the top of the shelving unit. However, both my friend and I lost our balance at the same moment and somehow caused the whole shelving unit to fall on the floor, shattering completely and spreading items from inside the shelving unit everywhere on the floor. It was one of those moments where you’re just in complete disbelief of what just happened. I’ll never forget that day. I still feel bad for the store owners. I hope they were able to get another shelving unit easily. My friend‘s mom made both of us write an apology letter to the store owners when we got back to his house but for whatever reason it was never sent, I’m not sure why. As I mentioned, the whole thing feels like a fever dream now. It’s definitely the most physically destructive mistake I’ve ever made…
TL;DR: In 2012, when I was 8, I was with my friend playing with dolls in a jewelry store. We tried to put the dolls on top of a glass shelving unit while standing atop a bench, but we lost our balance and fell into the shelving unit, causing it to hit the floor and shatter completely.
Kane0819: Was he brave enough?
Indigo_132: I guess we never found out XD
| 3 | 4 | |
1653445604 | 1653446262 | t3_ux79ut | t5_2to41 | 3 | [deleted]: TIFU I tried to get a quick lift in at the gym and got permabanned.
[deleted]
Groundbreaking-Box20: Any chance you were being a dick? Something about your writing style and the way you told this story makes me think you were actually the asshole in this situation
Steezography: It depends who you ask really. I definitely wasn’t being nice about it, but trying to force someone off a bench press multiple times because you want your friend to get on it as an employee isn’t a good move.
| 3 | 1 | |
1653443308 | 1653667030 | t3_ux6l2t | t5_2to41 | 41 | ATGGTCGATAATGAATCTTC: TIFU Researching my genealogy.
My brother and I found out recently that we can get a dual citizenship in an EU country through descent (Hungary). While I'm aware that Hungary is a bit of a shitshow, having an EU passport is a bit of a golden ticket, and opens up huge opportunities for us and our families.
I had long known about my grandmothers side of the family, she is from Ukraine. Most of the identifiable family on her side was wiped out during the Holodomor. But had very little knowledge of my Swabian grandfathers side. No one talked about it much. I always knew there was pain and generational trauma, but our history was a black hole.
In order to get the documents we need, we hired a professional researcher, and she was able to find most of the documents in Canada, and the documents of my great great grandfather and further, but two generations where didn't exist as far as any records.
She then found a small breadcrumb, they had moved from Nakadorf Hungary to a small new community of Kikinda Hungary on the Danube river. We were discussing this with her over zoom, and we were excited, we felt this was good news we could trace where the records. But something was wrong, she was upset, like she was giving us bad news. She then told us that nothing was left. It was wiped out by the Russians/Tito Partisans and ethnically cleansed. The Russians utterly wiped out the village and the church where the records would have been kept.
She sent us this [link](https://www.dvhh.org/history/atrocities/chap_3_tito_1944-48-N-banat.htm) [NSFL] on what happened.
so as it turns out both sides of my family, grandmothers and grandfathers side were wiped out by the Russians in two different genocides. We are left to try and convince the Hungarian government to allow us to have our citizenship, in light that the records were destroyed during a genocide.
Im still in shock, I haven't slept in days. I go from sorrow and survivor guilt to utter hateful, murderous rage against Russians. It explains so many things about our family that I never knew, and explains why my uncles and my dad were such broken souls. It also explains why we would have nothing to do with the Russian immigrant families that lived near us. I met a girl in school from one of these families, and we hit it off, but my family told me they would disown me if I ever spoke to her again. I didn't understand this then, but I do now.
So this was a fuckup laying in wait that I had no idea about. I started this to give my family better opportunities, The thoughts and feelings I'm having give me serious fear I may have broken myself through this journey that was supposed to be a happy one about new horizons and opportunities.
TL;DR
Opened doors of history that were nailed shut by my family, found out we barely escaped genocide and there was nothing left but us. Some doors are closed for a reason.
Any-Confusion-4526: Hating Russia even more now, with everything going on is not a FU
ATGGTCGATAATGAATCTTC: Im trying not to, but I have a hard time looking at them as anything but barbarians. Its a FU because I should have left things well enough alone. Some doors are closed for a reason.
Any-Confusion-4526: I have nothing against the civilians because they are oppressed and can't do anything or face the military wrath. But the leaders and oligarchs need to be nuked into oblivion
ATGGTCGATAATGAATCTTC: I agree in principle, however in the case of Russia the citizens are the ones that enable the oligarchs. Russia's history has been a rhyming melody of murder since the kingdom of rus has existed. They are a bloodstain on the history of the world.
Savitrion: Don't listen to people trying to shame you for hating russians. Their vile politicians and rabid soldiers come from people and civilians. Theirs is a sick society full of hatred, jealousy and racism. It's not like civilians don't know wtf they did or are doing, they just don't give a crap because they live in the dirt and hate other counties for it. They're the ones cheering their "army" for their unspeakable war crimes. They have been like this at least since the 1700s.
Noidremained: >Theirs is a sick society full of hatred, jealousy and racism.
and ours are not?
ATGGTCGATAATGAATCTTC: Our society is not using the Geneva convention as a to-do list.
For me, it stops at Russian citizens openly advocating rape and murdering children. at that point its time to call out the 4 horsemen because that society has lost its soul.
| 8 | 5.125 | |
1653445246 | 1653447409 | t3_ux7667 | t5_2to41 | 100 | MisspelledAWerd: TIFU by not locking the front door..
As a father of two boys, there are few moments for the finer things in life. This past Sunday, my two boys went to bed quite early as they attended a birthday party the day before, slept over and spent most of the day outdoors. So safe to say the kids went to bed early, and my wife and I had time for "The Finer Things."
Well, the "Things" were getting heated. Ten seconds into the actual "Act," I hear a voice from downstairs."Birthday Boy" is the person in your house. It turns out that my son forgot something and Birthday Boy's house, and he brought it over and let himself in to return it. I retract my trouser snake from its safe, warm hiding place, throw on some shorts and catch him before he makes his way upstairs.
Thankfully he did not make his way up, and the wife and I had a riot laughing about it!
TLDR; a 7 Y/O Birthday Boy nearly caught my partner and me in our Birthday Suits.
unabashedlyglitter: Happy cake day
MisspelledAWerd: Thank you!
| 3 | 33.333333 | |
1653446141 | 1653447258 | t3_ux7fro | t5_2to41 | 2 | tmuseee2: TIFU by driving past my friend getting beat up and not realizing it
So I'm a 20f and last weekend I was driving home from a party at night. I live with my sister who is a couple years older than me. Well it was kinda late and as I'm driving home I saw a few girls on the side of the street appearing to be fighting. It was 2 and one on the ground getting beat up.
I looked to see what was going on and I thought it looked like my friend getting beat up, but I didn't believe it at the time so I just kept driving home.
About a half hour later I got a call from another friend of mine that my friend that got beat up was in the hospital for her injuries and got her ass kicked well.
I felt like shit at the time and still feel bad about it and that I fucked up really bad in this situation. I didn't tell my friend I drove by because I feel like that might make her feel worse.
TL;DR: TIFU by driving past a woman getting beat up by 2 women, not realizing it was my friend.
Comprehensive-Buy443: Everybody takes a beating. It’s apart of life. Don’t beat yourself up over it.
tmuseee2: I feel bad I couldve helped her
Comprehensive-Buy443: You’re a good friend for caring, and it’s natural to feel shitty, but really don’t beat yourself up over it. If your other friend got beat too and also involved herself, I’m not sure how much help you would have been realistically. If your friend wants to pursue charges, then at least you can assist in that way.
| 4 | 0.5 | |
1556910875 | 1667966773 | null | t5_2to41 | 17 | cyber411: TIFU by trying to swallow a whole Tums
Last night, I brushed my teeth, then decided I had an acidy tummy. It was almost midnight & I had to get up early, so I decided I would just swallow the whole tablet, like a pill (so I wouldn't have to brush my teeth again). I swallowed it down & it worked out fine. Jk that didn't happen. It got stuck in my throat, so I drank more water, but that only made it angry. It finally started to work its way up, then stopped in the back of my throat, refusing to budge. I tried to reach it, but I just gagged & drooled tums inspired dribble into the sink. I then get the great idea to just throw it up. I succeeded in choking out some of last night's pizza, but the tums held fast, mocking my stupidity. On the plus side, I think the puke may have softened it up, & I drank some hot water. Eventually, though reluctantly, it went down & I had to brush my teeth again. It was almost 1 by the time I got to bed, so now I'm tired af & my esophagus hurts. I'm still burping up tums.
TLDR Tried to swallow a whole tums to save time, it got stuck in my throat until it dissolved enough to go down. My esophagus hurts.
Reasonable-Pin8566: just swallowed a tums to save time as well, went to google and found this after it got stuck thank you lmao
cyber411: I'm glad I was able to help! 😆
PlagueDoctor5: So I just swallowed a tums whole so I can get back to bed. And it made me violently retch three times.
cyber411: I feel your retch... Cut them into 4ths next time, you will not be disappoint!
PlagueDoctor5: Copy that, skipper!
| 6 | 2.833333 | |
1653450928 | 1653452195 | t3_ux8tcp | t5_2to41 | 22 | OkRegret473: TIFU by making someone quit their job
I work as a cashier/manager at a pub. Yesterday was my day off and another manager covered for me.
This manager is notorious for leaving the waiters by themselves and also for not really doing the books right - two things he's not supposed to do.
Today when I got in I noticed that the books weren't done right, but there was no money missing. However, I still had extra work to do because of it.
Then I decided to ask the waiter who was here yesterday if he had been left alone at any point. Because it would explain why the coworker responsible hadn't done the books - if he hadn't been there and I would have to take it up with him.
The waiter then told me that the other manager had left to do a delivery, but came back quickly, and followed up by asking me why I wanted to know.
That's where I fucked up.
I said that the books weren't right.
He got angry and said he would not take that insult and quit.
That's when I realized how my words sounded and that I had apparently accused this waiter of stealing.
TL ; DR I asked a coworker if he had been left alone at work, implying I didn't trust him and that he had stolen money, and he quit
RealitySpeck: I think the waiter fucked up by assuming you were talking about him. Unless I read this wrong?
OkRegret473: I guess we both fucked up. I think that following up that question with telling him the books were wrong is where I fucked up - at least I've been told that I implied he stole money
| 3 | 7.333333 | |
1653458827 | 1653528754 | t3_uxavsn | t5_2to41 | 6 | [deleted]: TIFU by getting high on Xanax and booty fucking my friend
[removed]
canada1913: Sounds like a sex blog written by the 40 yr old virgin.
Shade_0: Or a 12/yo
canada1913: Same difference lol
| 4 | 1.5 | |
1653460147 | 1653492450 | t3_uxb719 | t5_2to41 | 59 | BannedOnTwitter: TIFU by destroying the reputation of my school
For some context: my school is considered one of the best schools in town and the 9th graders just had their chemistry tests. They were complaining all over social media about the difficulty of the test.
I saw that and thought it would be funny to comment "fight me" in one of those posts.
Heres a rough translation of the comments:
9th grader: We got 15 multiple choice questions on the test.
Me: Fight me at the playground at 1:30 idiot.
9th grader: How about we do it at the volleyball court at recess.
I thought that my comment was so absurd and out of nowhere that no one would think I was serious at the time.
At recess today, I was just doing my own stuff but then I saw people crowding at the windows and railings of the school, staring down at the volleyball court. I went outside and saw that theres huge crowds of people in the 3rd 4th and 5th floor waiting for the fight to happen. Some were even cheering. Teachers tried to disperse the crowds to no avail. It was literally anarchy. The crowds only left after recess when they realised there's no fight.
After recess, the disciplinary teachers made an announcement which was something like this:
"We are supposed to be the best school in town and what happened in recess was totally unacceptable. If anyone saw what happened in here from outside, our reputation that we have built up for decades would be gone in an instant."
As a result, the school banned students from playing ball games at the volleyball court and playground because they were scared that the fight would happen. Now I'm cringing so hard over the fact that I may have ruined the school's reputation and stopped people from playing ball games by saying "fight me idiot".
TLDR: I asked a 9th grader from my school to fight me as a joke. Students in the school took it seriously and the school literally descended into anarchy because they wanted to see the fight and now the school's reputation may be ruined.
insidmal: lmao your local high school reputation isn't shit and you have no impact on it
BannedOnTwitter: There was nothing like this in the school ever before tho
Like the crowding and the announcements were all a first
OMGoblin: It just doesn't matter though, to anyone outside of your school.
BannedOnTwitter: I just really dont wanna be blamed for screwing up the best school in the town lol
Metallbran88: I work at a school, a good school, trust me no care gives a shit.
| 6 | 9.833333 | |
1653462744 | 1653468376 | t3_uxbsv3 | t5_2to41 | -3 | [deleted]: TIFU by masturbating with sulfuric acid
[removed]
Everythingn0w: Nobody is *this* dumb. I can think of about 10 household liquids that would be more appropriate lubes (not to mention your own spit). So there is no way in hell you knowingly and willingly chose to use poison on your dick.
Edit: post history checks out 😒
[deleted]: Yeah I’ve used my own spit before and it actually feels really good. It feels like a blowjob but from my hand instead of a girls mouth
Everythingn0w: Mmhm willing to bet you’ve never gotten a bj, you’re a bored child shitposting on Reddit
[deleted]: I’ve gotten many BJs. I got one from your mother last night.
RudeSprinkles1240: And mine too, I bet.
She's 75. I hope she took her teeth out for you.
| 6 | -0.5 | |
1653463669 | 1653784442 | t3_uxc0b2 | t5_2to41 | 54 | Harshquestion: TIFU by beating myself up over hypothetical scenarios
[removed]
Rbot9: While OP's post and some of the replies sound like the makings of a great action flick someday, in light of what just happened in Texas, I think this post is, at the VERY least, in poor taste. You should either talk to a professional about your "hypothetical scenarios", or move to a faraway island on which you are the only human(?) inhabitant.
kingvortigern: "Hypothetical" is the key word here. Its just a mental exercise, whats the problem. And your judgemental tone is inappropriate, the question mark parenthesis thing is telling. You think you are better than OP. But hey! You do you, and judge away!
Rbot9: Judgmental(?)? ME(?)? Don't get your undies in a bunch. This is an open forum, and I spoke my opinion.
kingvortigern: Fair enough. My apologies. Undoing my bunched undies as we speak
| 5 | 10.8 | |
1653466316 | 1653656580 | t3_uxckp7 | t5_2to41 | 31,167 | Beardedrugbymonster: TIFU by sleeping naked and possibly ruining my marriage.
I'm a long time lurker and have enjoyed trying to catch my breath in laughter reading stories on this sub for a few years now. Maybe I can return the favor with my very first post here.
I'll keep it short and sweet since it's the middle of the night and I need to atleast try and get back to bed.
Main account...long hair don't care, here goes!
This just happened merely minutes ago...BUT let me start off by saying it's been a 13 hour work day and I'm tired.
So just a few minutes ago I had just gotten out of the shower to clean my self off. I'm still mortified.
I SHIT IN THE BED I SHARE WITH MY WIFE! I'm a grown ass 33yr old man.....how, why, everything was decent today. Why this?!!!
I might have been able to get out of this situation if I had worn underwear to bed. (Easier clean up)
I might have been able to avoid this situation had I not been soo tired.
I literally had no warnings signs of this before bed...no upset stomach, no stomach pains....nothing! Just liquid shit next my wife and I couldn't not tell her before she ya know...rolled in it or something.
It took me forever to realize what had happened, I had my back to her....I must've stirred and been slightly awakened when I felt my left ass cheek get cold and so I reached back and it was wet....it still took me a minute to figure out what was going on in my sleepy state. I remember thinking that's weird. So like any man I smelled my finger....I jumped up and immediately ran to the shower in all my shame. Wife changed the sheet and removed a pillow with some of my stomach soup on it.
I hope she still loves me... She's sleeping as I write this so I think that's a good sign she's not too traumatized.
The only thing I can think happened is my animal brain (while sleeping) must have thought it was a fart and let one rip...instead it was some liquid shit.
God hates me....
TL;DR Slept buck naked and shit the bed, literally...
**Update**
Good morning Reddit, I have good news! My wife and life partner of 16 years was more mad at the fact the light was on waiting for me to come back upstairs and fix my side of the bed after she remade the bed. She was tired too and just wanted to go back to sleep.
A little fun fact about my wife, she was a C.N.A. for 5 years. She has seen way worse than what I managed to create in our place of rest and coitus.
She literally just said it was the better than the time I puked in the bed....a story for another time.
I know I said "ruining my marriage" but in the moment I was feeling super awful about my accident. I read so many post about how one thing changes people's relationships forever...I just didn't want that to be me.
She was totally laughing with me this morning not at me.
**Health Update**
For those of you concerned with my health, I really appreciate it. I had a doctor's appointment that day. He gave me the ol'poke and prod. Questions galore, family history. I even asked him about a colonoscopy and prostate check. He said I have no family history of cancers or diseases of the sort....so there was no need for those screenings yet.
I have had runny shits my entire life...I'm physically fit but I don't eat the greatest sometimes. I punish my body when it comes to food and sometimes beer. I think that's the Irish in my blood and a rugby player mentality.
If you all care enough to know I'm getting a blood draw soon to have a follow up in 6 weeks with my Doc.
My wife is the absolute best to deal with me this long. She's the real deal.
Much love to you all!
***No I'm not Amber Heard***
NEzZen5991: 1. Either she will understand and you both will laugh about this.
2. This will awaken something in her and she’ll ask you to do it again
Either way I think your marriage will be fine
cnicalsinistaminista: "Honey, dinner time. I made your favorite soup *with laxatives"*
"What was that?"
"I said enjoy your soup"
"Aren't you the best Wife any man could ask for."
"Oh by the way, I did the laundry. I'm sorry all your clothes are in the washer"
zystyl: I vaguely remember a reddit story about a woman finding out her husband was feeding her bits of his feces in all her meals. Like sneaking it to her in her meals. Pooping the bed isn't so bad. Shit happens.
fallenheroxx: Sauce?
zystyl: https://www.reddit.com/r/relationship_advice/comments/f36rl8/my_husband_51m_has_been_feeding_me_50f_feces/ deleted apparently somewhat wisely.
Potato4: Copy of the OP https://www.reddit.com/r/relationship_advice/comments/f36rl8/my_husband_51m_has_been_feeding_me_50f_feces/fhhi0v4/
wanderin_fool: Was there ever an update? Please tell me she left him. Sued him. Castrated him and fed it to him as retaliation.
monkey_trumpets: That last option is my favorite.
sketchyadvice1977: Mmmmm, eating my own mountain oysters....
YourMominator: For a limited time... Lol
sketchyadvice1977: They don't do anything but get in the way these days. : )
| 12 | 2,597.25 | |
1653477158 | 1653477600 | t3_uxf08p | t5_2to41 | 15 | AgrestPL: TIFU by giving my grandpa a replacement phone
TLDR at the end
I’m not a native English speaker so I’m sorry if some parts of conversations will not make much sense in English.
So a few days ago my grandpa asked me to help him fix his phone. As the tech person in my family, I said sure, I’ll take a look. It turned out that the phone was lagging so much that it was unusable. It took around 15 minutes for it to unlock. But life without a phone is hard these days, so I gave him my old phone as a replacement. I wiped all the data from it and logged it in to my Apple ID so that if he loses it I can easily locate it.
That’s where the fuckup comes in. See, on iPhones there is this thing called iMessage. It’s like another communicator that works only between iPhones and is used by default instead of SMS. And the messages are synchronised between all devices in your Apple ID, because the iMessages get sent to the whole account, not to a particular phone. But neither of us were aware of this and we carried in with our lives.
I have a male friend that’s interested in aviation, so around 3 days ago when I found that you can buy a plane on OLX (like a Polish version of Craigslist) I told him about this on WhatsApp. But for some reason he responded on iMessage saying “show me the plane”. I proceeded to send the plane pic to him. He responded that it’s really nice. But what I didn’t know is that my grandpa thought that the messages which he was getting were addressed to him and naturally began reading each notification. He quickly realised that it’s not his conversation nor it isn’t anyone he knows, so he didn’t enter the conversation - and as such the only thing he’s seen was the messages I was receiving, not the ones I was sending.
So he called me and said that something is wrong and that he gets some random messages. His old phone unbricked by then, so he asked me to take out the SIM card and put it back into his old phone. I realised that he was seeing my messages and told him about this, but I haven’t really paid any attention to this because I didn’t text anything rowdy or private in the last days so there was nothing interesting that he has seen.
At least that’s what I thought. But in reality he’s seen the “show me your plane” and “it’s very nice” and today he messaged me saying that “don’t worry, I know what you guys meant by that plane but I won’t tell anyone”.
So yeah, my granddad is now convinced that I am gay and that I’ve sent my dick pic to my friend. I’m not sure how I’ll explain it to him that it’s not the case…
TLDR: grandpa was reading my messages on my old phone that he used as a replacement, thought I was gay when I sent my fellow avgeek friend a photo after he asked for a plane pic
some-white-dude: Had me in the first half lost me in the second, this isn't really a fuck up and if you're Grandpa thinks you're gay and isn't pissed off then you have a top notch Grandpa.
AgrestPL: Yeah, he’s a real treasure :)
| 3 | 5 | |
1653479067 | 1653526044 | t3_uxfi6d | t5_2to41 | 467 | MegaBags: TIFU - White socks and tea don’t mix
I recently relocated a set of drawers to the corner of my office/spare bedroom, right beside my desk (well, left beside my desk, actually).
&#x200B;
For some reason that is still beyond my comprehension, my wife was not keen on this location. Even though she never uses the room in question and does not store anything in the drawers. Before I relocated it, mild “debates” were had. Obviously my wish prevailed on this occasion.
&#x200B;
Fast forward to today… Here I am turning 180• in my office chair, with my desk raised and a cup of tea idiotically poised on the left hand corner of my desk.
&#x200B;
I hear a clumsy thud.
&#x200B;
I turn around, mug on the floor (in tact thankfully), but a puddle of tea surrounds it.
&#x200B;
My eyes scroll up the drawers… an open drawer… the white sock drawer. 🤦♂️
&#x200B;
Brand new white socks stained with blotches of tea.
&#x200B;
My wife can never know.
&#x200B;
TLDR - Moved some drawers to a place in a room that my wife irrationally did not want them placed, beside the desk I work from home at. Now I have dropped a cup of tea in a drawer full of white socks.
&#x200B;
This will remain our secret.
&#x200B;
Now queue the inevitable white socks hate…
tugashark: Dear OP, there is a top secret and experimental treatment that consists of a new product, with the provisional name of bleach.
Give it a try.
Just add a small amount on the washing machine.
MegaBags: I’ve heard it can cure Coronavirus too?
anime_lover713: Who owns the white socks?
MegaBags: They are my white socks
anime_lover713: Well, that's not too bad in my opinion. Bleach helps whiten clothes, how I keep my whites looking white.
| 6 | 77.833333 | |
1653482022 | 1653498887 | t3_uxgd7r | t5_2to41 | 269 | easycrumbeasydough: TIFU by telling a guest we're understaffed
I work in a luxury 5 star hotel and this field will 100% test your patience. After 14 hour shifts, 3 hours of commute I just want to go home and sleep but I ended up being asked to work for a few more hours until my reliver arrived.
At this point I was livid with anger, it was just me and another co-worker running all day carrying huge heavy trays of food up to all the rooms who had ordered room service. I was regretting all life decisions that led up to this moment and unfortunately the guest I was carrying the food for ended up being a Karen.
She ranted on and on about how she waited a really long 20 minutes just for an omelette that was bland and demanded she speak to a manager, I snapped I just rambled an apology I didn't want to say and slipped up saying we're extremely short-staffed.
Cut to a few hours later and I get a call from HR. Apparently the Karen went downstairs and complained to the general fucking manager of the hotel. If it was the operations manager, well and good it would have been don't do this again be careful blah blah blah but the GM? bad news.
I don't think I'll lose my job because like I said, understaffed but also I have no idea wtf is gonna happen to me. This industry especially in a luxury set up tends to be filled uptight asslickers who are willing to squeeze the last drop of patience out of all its associates. I definitely don't get paid enough for this.
TL;DR I (semi) snapped at a guest and told her we're understaffed, she goes and complains to the general manager. I currently have a call from HR and I'm shitting my pants rn.
gtalktoyou9205: If you can change careers to be more tech focused. E.g. a data analyst role does not need programming experience. This role can be learnt in 6 months
Valhallallama: Wait wait, would you happen to have resources? I teach, but given the low pay and general current lack of safety with school shootings, I’m looking for a change
gtalktoyou9205: What do u teach and if u don't mind my asking ur approximate age? Start with Udemy.com for simple learning
Valhallallama: Physics, early 30s
gtalktoyou9205: If u know physics then you are already 25% data scientist. ☺️
30s is super young !!!
I believe most of physics is now simulated through software. Game engines have a physics component for e.g.
Start with a course that includes python and see if u like it.
In general knowing little, I suggested Data analyst as it might be easier than studying data science.
My suggestion is still to start more on the analyst side because programming can be daunting for some. Data science is quite tricky to get into and"really" understand.
There are quite a few bootcamps too both for data analyst as well as data science or even web development...so start spending time on research.
As with physics, knowing and applying the principles in the context of a new problem take time. Assume you are going to have 2 years of some pain but in the long run ... "This is the way" 🤓
Valhallallama: This is the way. Thank you!
| 7 | 38.428571 | |
1653486620 | 1653487953 | t3_uxhtr6 | t5_2to41 | 0 | [deleted]: TIFU by eating and snorting pure citric acid powder
Kinda a double fuck up. Don’t fuck around with acids, not even the weak ones. Unless it’s LSD (acid) then go for it.
I got some pure citric acid, mainly just out of curiosity and to see what I could do with it. I found out that lemon juice contains 8% citric acid, and we all know how sour lemon juice is.
So this is fuck up 1, although it’s more of a light hearted fuck up that didn’t really hurt anything, except for my taste buds. I took a pinch of the stuff, and put it on my tongue. I can only imagine what the look on my face looked like if someone else was with me at the time. It was so fucking sour holy shit. Imagine the taste of lemon juice, but times 10, and also with no sweetness, just pure sour. That comes pretty close to what this tasted like.
Then I proceeded to fuck up again, and this time it was much worse. I decided that simply eating it, like a normal human being, was not enough. I felt as if, to conclude my experiments, that I should snort a line of it. Yes, snort it, like how you would snort cocaine.
I made a line of citric acid powder. I put my nose over it, and I snorted it. I thought the taste was bad, I hadn’t experienced anything yet. I’ll just say… it burns. Don’t try it.
If you ever, for any reason, have pure citric acid… don’t snort it, it really isn’t worth it.
TLDR: Ate pure citric acid, and assaulted my taste buds with overwhelming sourness. Then snorted a line of the acid, which completely fucked up my nose. Acids don’t belong in the sinuses.
joebothree: Citric acid has nothing on malic acid, that's what is used on the outside of sour candies like warheads, it's a fine powder not as grainy as citric acid.
[deleted]: Damn. Don’t think I’d wanna snort that
| 3 | 0 | |
1653492445 | 1653493544 | t3_uxjuvq | t5_2to41 | 4 | HamAndGrilledCheese: TIFU by posting on Facebook that I would let my mother’s friend lick my pussy. He is also a priest.
This actually happened when I was like 9-11 years old. I had just downloaded Facebook and there was this game on the app where you answer questions about your FB friends. All my friends at the time were my relatives and my parent’s friends. My mum is a devout catholic and is friends with several priests so of course I had several priests as friends on FB
So basically I was playing this game with my cousin who I believe was 16 at the time. A question came up that was “would you let (priest) lick your pussy”. My cousin and I were like “this is a weird question, why would anyone want to lick a cat? We don’t have one anyway and cats probably wouldn’t mind a little lick so sure.” Obviously neither of us knew that pussy could mean anything other than pussy cat at the time. We pretty much forgot about the game right after we were done playing.
Well, the priest showed up at our house the next day. We didn’t think anything of it because priests showing up was a regular occurrence. Turns out FB had posted my answers on my feed (or pinned it to his feed or whatever. I can’t remember now, I just know he had gotten my answer somehow). He had come to our house to have a conversation with my African mother about my morals. Naturally, I got a big black ass whopping. The priest advised me to mention my vulgarity during my next confession, which was uncomfortable because I was probably going to be confessing to him anyway. The hardest part was losing computer privileges though :(
TL;DR: Said I would let my mum’s reverend friend lick my pussy because I didn’t know what pussy meant. Got my ass severely whopped.
clsetbiguy: So did you end up confessing to him?
HamAndGrilledCheese: Lmao my parents took me in for confession the next Sunday and it was him, but I didn’t mention it anyway. He couldn’t snitch to my mum or do anything about it cause priests aren’t allowed to talk about what happened during confession so good stuff lol
| 3 | 1.333333 | |
1653493444 | 1653497206 | t3_uxjzz8 | t5_2to41 | 11 | threedogcircus: This is a pretty disgusting reply to someone who's clearly looking for help.
ActualCannibalMrY8s: Dude said he almost got off to a baby once, those are the only two options I see, if he doesn't get help he'll eventually offend
threedogcircus: Oh, well if you see it that way then it must be correct.
ActualCannibalMrY8s: And your opinion holds more weight because? I'm not saying he should kill himself, I'm saying he should get help and if he refuses to then he should kill himself, how is that not reasonable? Would you want your kid in the same room as a guy who had to stop himself from getting off to a baby, along with countless other children and teenagers? I'm sure most rapists and molesters didn't wanna be rapists and molesters, if not for moral reasons then out of their own self interest, they should've gotten help too.
threedogcircus: You just told a person who is clearly in crisis that their only options are therapy or killing themself. That's disgusting.
ActualCannibalMrY8s: Yeah, those are their only options as far as I'm concerned, I guess they could indulge in the thoughts too but I hope to God you aren't implying they should. Maybe it came across wrong, like I said I don't want them to kill themselves until they either molest a kid or just flat out refuse to seek help, then they become a ticking time bomb. So tell me, what's this magic third option? You keep saying I'm disgusting, apparently more so than OP somehow, what's the wholesome alternative here?
threedogcircus: You keep making a lot of assumptions based on nothing. Don't tell people in crisis to kill themselves. It's disgusting.
ActualCannibalMrY8s: You're giving me nothing to form an opinion with so I'm trying to figure out what you're saying, you still never gave me a third option anyways.
threedogcircus: I am quite clearly telling you that it's disgusting to tell someone in crisis that they have only two options and one of them is killing themself. That's it. And I can't be any more clear than that.
Have a better day.
| 9 | 1.222222 | |
1653485545 | 1654530011 | t3_uxhh42 | t5_2to41 | 7 | jcpham: TIFU by flipping our lawn mower over backwards into a ditch *slash* briar patch
It's was actually on Friday but I think I very nearly died when I flipped our lawn mower over backwards into a ditch of briars. My wife had to spend time Friday and Saturday nights picking briars and splinters out of my back, my neck, my arms - other than being scratched up and sore I'm fine though.
Except I guess nearly died - The ditch is the only thing that saved me from being crushed or seriously injured because it kept the lawn mower from landing on top of me. No one was around to see it happen & no one was coming to check on me. I was at home alone with my two children 8 and ten years old.
I'm mostly ok except for my pride but I feel like a huge idiot because we used to live on the lake and for a decade and I was afraid of doing this exact thing - flipping the lawn mower into the lake - well it never happened at the lake but these zero turn lawn mowers are dangerous yo!
PS: I keep the rollover bar folded down because I'm Pinky & The Brain level big brains smarts
TL;DR - Flipped heavy lawnmower over backwards into a ditch and the only thing that saved me from serious injury/death was the ditch itself
lawstandaloan: About 90 Americans are [killed by lawnmowers every year](https://www.newsweek.com/lawnmowers-kill-more-people-bears-sharks-alligators-each-year-1529280). Glad you are ok
jcpham: thank you sir
| 3 | 2.333333 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.