PMCID string | Sentences string | ner list |
|---|---|---|
PMC11696576 | The metabolic stability of the compounds was determined through in vitro stability assays in human plasma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"metabolic",
"stability",
"of",
"the",
"compound... |
PMC11429241 | The sophisticated architecture plays a key role in enhancing the area for cell support. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"sophisticated",
"architecture",
"plays",
"a",
"key",
"role",
... |
PMC11001582 | Following a small incision, the skin overlying the skull was retracted and connective tissue over the skull cleared. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Following",
"a",
"small",
"incisi... |
PMC9429973 | First VC (VC1) had 86 pts, and median age was 44 years. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"First",
"VC",
"(",
"VC1",
")",
"had",
"86",
"pts",
... |
PMC7504302 | Although not translated into proteins, ncRNAs have been shown to play multidimensional roles in a wide range of biological processes such as activation or repression of transcription, regulation of mRNA translation, post-translational modifications, and chromatin remodeling . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11656657 | Notably, CAR.GD2 T-cells demonstrated a significant and highly effective lysis of tumor cells even at a very low E:T ratio of 1:32 (p = 0.0044 for 143B and p = 0.0130 for RD cell line, respectively) in 2D models (Supplemental Fig. 6A-B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11499955 | The mean number of TMPP linked to the antibodies, TAR for Tag-Antibody-Ratio, was determined (TAR from 2 to 4, Fig. 3 and Table S1†). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11322866 | Western blots showing p21 levels in RPMI-8226 and OCI-MY5 cells after GSK126 treatment. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Western",
"blots",
"showing",
"p21",
"levels",
"in",
... |
PMC9429973 | E. Heyes, A. S. Wilhelmson, A. Wenzel, M. B. Schuster, M. Ali, T. D’Altri, T. Eder, G. Manhart, E. Rzepa, L. Schmidt, M. Meggendorfer, T. Haferlach, G. Volpe, C. Nerlov, J. Frampton, K. Jae Won, F. Grebien, B. Porse Institute of Medical Biochemistry, University of Veterinary Medicine Vienna, Vienna, Austria; The Finsen... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Patients were aged >18 years with untreated DLBCL and impaired cardiac function with a left ventricular ejection fraction (LVEF) >40% and ≤ 50%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8584319 | In addition, the combined treatment with AZD8055 and refametinib or SB203580 did not affect the phosphorylation pattern of 4E-BP1 (Figure 3c,d). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC7987994 | Extracts were either added to a sub-confluent cell monolayer 24 h post-seeding (1st mode) or were added to freshly suspended cells (2nd mode). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10938377 | Cisplatin and RAPTA-C were tested as positive (0–100 μM) and negative (>200 μM) controls, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cisplatin",
"and",
... |
PMC11765879 | Generally, quercetin exerted a more potent influence than rutin in both cell lines, as the resulting IC50 values were around 90 and 50 µM for rutin and quercetin, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11740907 | The first need is that particles must have a size large enough to hinder their excretion via the kidneys.55 The second condition is that the particles have a small size to avoid being engulfed by phagocytosis and then eliminated by the system of reticuloendothelial cells (RES).56 Current research suggests that biomolec... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11087766 | The Upper panel shows a cell with a single nucleus, while the Lower panel depicts a cell with multiple phage nuclei and a single PicA punctum on each nucleus. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Methods: STIMULUS-MDS1 (NCT03946670) is an international, randomized, double-blind, placebo-controlled, ph II trial evaluating sabatolimab + HMA in pts with very-high, high-, or intermediate-risk (vH/H/IR)-MDS who have completed enrollment (N=127). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | LNPs were characterized by dynamic light scattering (DLS) and cryo electron microscopy (EM). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"LNPs",
"were",
"characterized",
"by",
"dynamic",
... |
PMC9429973 | L. Van Der Straten, C. C. Maas, M.-D. Levin, O. Visser, E. F. Posthuma, J. K. Doorduin, A. W. Langerak, A. P. Kater, A. G. Dinmohamed Research and Development, Netherlands Comprehensive Cancer Organisation (IKNL), Utrecht; Internal Medicine, Albert Schweitzer hospital, Dordrecht; Immunology, Laboratory Medical Immunolo... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11754432 | However, SREBP2 protein localisation was not altered in keratinocytes upon ALOX15B silencing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"SREBP2",
"protein",
"localisation",
"was",
"not",
"altered"... |
PMC11478724 | Then 150µl of the solution was centrifuged at 400g for 5 min and 50 µl of the supernatant to was an equal proportion of buffer and substrate solution. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6600253 | The ectopic subunit of the telomerase complex is able to maintain the telomere length and immortalize normal cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"ectopic",
"subunit",
"of",
"the... |
PMC11799620 | Also, Future research is needed to carry out further biochemical investigations to isolate and clarify the mechanism behind the activity of this extract. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11770746 | Progress of reactions was monitored by analytical HPLC system (Thermo Scientific UltiMate 3000) with a reversed-phase C18 column Phenomenex Kinetex, length 100 mm, internal dia 4.60 mm, particle size 2.6 μm, pore size 100 Å. The purity and retention time (RT) of the synthesized compound reported here were measured with... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11597291 | Next, the samples were centrifuged at 1000× g for 5 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Next",
",",
"the",
"samples",
"were",
"centrifuged",
"at",
"1000",
"×... |
PMC11474209 | Abbreviations: Bcl-2: B-cell leukemia/lymphoma 2 protein; cdc2: Cell division control 2; cdc25C: Cell division cycle 25; cGAS: Cyclic GMP-AMP synthase; cGAS-STING signaling pathway: Cyclic GMP–AMP synthase-stimulator of interferon gene signaling pathway; c-Myc: Cellular Myc; COX2: Cyclooxygenase enzyme; CTNNB1: Ctenin ... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC3730428 | Surprisingly, all MPM cell lines assessed were highly resistant to SMCs either alone or when incubated in the presence of clinically relevant levels of TNFα. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11665555 | Master regulator analysis of the RNA-Seq results helped us identify TFs orchestrating differentially expressed target genes (41, 42). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Master",
"regulator",
... |
PMC6442998 | Cells were washed with 0.01M PBS pH 7.4 and fixed for 30 min in fresh 4% paraformaldehyde, pH 7.4 then washed two times with 0.01M TBS, pH7.4 and stored in 0.01M TBS/Sodium azide 0.1% solution until use. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11757230 | The normality of the data was tested using the Shapiro–Wilks normality test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"normality",
"of",
"the",
"data",
"was",
"tested",
"using"... |
PMC11471176 | Note: Red color (circles) is for the Vero Cell line, Green (squares) for the luminal or hormonal breast cancer cell line (MCF-7), Blue (diamond) for human triple negative breast cancer cell line (MDA-MB-231), Grey (triangle) for the murine cell line (EMT-6). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine"... |
PMC11678368 | In the IR spectra of these complexes, a band observed in the 3319–3219 cm range is attributed to the antisymmetric stretching vibration, νas(N1H), of the pyrrole ring. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Furthermore, a limiting dilution was introduced to determine the lowest cell concentration required for invasion. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Furthermore",
",",
"a",
"limiting",
"dilution",
"was",... |
PMC11412752 | The wild-type (WT) HepG2 cell line was kindly provided by Professor Qiaoming Long (Medical College of Soochow University, Suzhou, China) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11470999 | Thus, combining PF with existing standard treatments might produce synergistic effects in treating melanoma and its metastases. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"combining",
"PF",
"with",... |
PMC11696576 | Inducing ROS-dependent cell death has become a key approach in cancer biology. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Inducing",
"ROS-dependent",
"cell",
"death",
"has",
"become",
"a",
"key",
"appro... |
PMC10772747 | In other words, EBE compounds have the potential to inhibit the activity of CDK 4/6, maintain Rb in an unphosphorylated state, and prevent the release of E2F. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9918897 | In the development of a XN-based functional health product, preliminary in vivo experimental experience is essential to unravel the factors that may result in the maximum health benefit of the product. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Image: Summary/Conclusion: •Our study generates data that contribute to future research on physicians exposed to prolonged uncertainties in clinical and laboratory practice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11049294 | Graphpad Prism 9.0 (Graphad, San Diego, CA, USA) was used for statistical analysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Graphpad",
"Prism",
"9.0",
"(",
"Graph... |
PMC11699042 | Interestingly, Ben-David et al. reanalyzed the genomic data (whole exome sequencing) of 106 cancer cell lines provided by the Broad and the Sanger Institutes and showed a significant diversity in allelic fraction for somatic variants in this panel of cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11721587 | Gli1: TATGGGGTTGGGAGAGTTTG(F); AAAGAGACCTGG-GACAGACAC(R). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Gli1",
":",
"TATGGGGTTGGGAGAGTTTG(F",
")",
";",
"AAAGAGACCTGG-GACAGACAC(R",
")",
"."
]
}
] |
PMC3681794 | indicates p<0.05 as determined by the 2-tailed student t-test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"indicates",
"p<0.05",
"as",
"determined",
"by",
"the",
"2-tailed",
"student",
"t-test",
"."
]
}
] |
PMC11295144 | Representative examples of voltage-clamp recordings of IPSCs in HEK cells expressing (A) α2β3γ2-GABAARs without NL2, (B) α2β3γ2 with NL2, (C) α4β3γ2 with NL2, (D) α4β3δ without NL2, (E) α4β3δ with NL2, and (F) α2β3δ with NL2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5963610 | However, NGcGM3/VSSP vaccine surprisingly reduces the phosphorylation of EGFR (Figure 2B) and Stat3 (Figure 2C) as compared with 7A7 mAb and the control (PBS). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Aims: We studied factors that affected early and late optimal PCR responses (OPR) and survival in patients (pts) of CBF AML who were treated with fludarabine based regiemns (fludarabine, cytarabine and GCSF) with idarubicin (FLAG-IDA) or gemtuzumab (FLAG-GO). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10605143 | In the case of MCF12A cells with reduced HSF1 expression, they began to form clusters in subconfluent 2D culture, which was not observed in cells with normal HSF1 levels (Figure 2g, upper panel). | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7917457 | All naive mice presented uncontrollable tumor growth and were sacrificed at day 29 post-tumor implantation, whereas none of the complete responders from any group showed signs of tumor growth at this time point, indicating an effective systemic immunity against the injected tumor. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11615101 | Figure 7Alpha-Taxilin ameliorates RA-like symptom in CIA rats. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Figure",
"7Alpha-Taxilin",
"ameliorates",
"RA-like",
"symptom",
"in",
"CIA",
"rats",
".",
"("
]
}
] |
PMC9325715 | The results may indicate, that the first adsorption layer was fully filled with iron in the obtained complex. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"results",
"may",
"indicate... |
PMC4685407 | We were able to efficiently insert exogenous genes into a specific genomic region using the simple CRISPR-Cas9 vector system; additionally, Dnmt3a knock-out CHO cell lines were successfully constructed using this method. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
... |
PMC11628904 | Following burn injury, larvae were returned to 28.5°C until imaging. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Following",
"burn",
"injury",
",",
"larvae",
"were",
"returned",
"to",
... |
PMC11594806 | Extracellular ADO can function as both an immune stimulator and suppressor, depending on the context and the signaling pathways involved . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Extracellular",
"ADO",
... |
PMC11320834 | BRCA1 and BRCA2 regulate cellular processes, e.g., transcription, the cell cycle, and the DNA damage response (DDR), with a particularly significant role in the mechanism of DNA double-strand break repair and homologous recombination . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11224020 | Data were analyzed by ordinary one-way ANOVA; ****P < 0.0001; *P = 0.0134. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"were",
"analyzed",
... |
PMC11513011 | The DIB group had significantly suppressed cell proliferation at each concentration in all kind of bladder cancer cells tested. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"DIB",
"group",
"had",
... |
PMC11300639 | CDK4/6 inhibitors have been approved for the clinical treatment of breast cancer, and it has been found that they have synergistic effects with estrogen antagonists in breast cancer cell lines [8–10]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11599565 | Both SKOV3 and SKOV3 cells were exposed to single drugs or to the combinations of the MAP4K4 inhibitor (MAP4K4i) with each one of the Notch pathway inhibitors for 24h. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC11733919 | The dissolved iron ions were retained around the NP core as a ring, most probably forming coordination complexes with the carboxylic groups of the polymer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10870498 | KIF23, kinesin family member 23; ATC, anaplastic thyroid cancer; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; THCA, thyroid carcinoma KIF23 was highly expressed in ATC cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11774747 | GD2.ζ and GD2.41BBζ VSTs exhibited also higher frequencies of apoptotic cells and increased Fas expression compared to NT controls and GD2.CD28ζ-transduced VST. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"GD2.ζ",
"and... |
PMC9429973 | During the follow-up, 5 vaccinated pts were diagnosed with COVID-19 when the Delta variant was prevalent and 9 - during the Omicron wave. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | These inhibitors also exhibit cytotoxic effect on activated Treg cells ex vivo, reinforcing its therapeutic potential for CLL treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"inhibitors",
"also"... |
PMC9429973 | Aims: We report updated efficacy and safety results from MajesTEC-1 in patients treated at the RP2D, including additional patients and longer follow-up. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11360263 | Due to their tumor-promoting functions, PGCCs are considered potential markers for predicting treatment response and patient outcomes in cancer and detecting their presence in biological fluids has become a new paradigm in cancer progression . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11551844 | Growth and stabilization resulted in AuNP formation, which is indicated by a color change of the solution. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Growth",
"and",
"stabilization",
"resulted",... |
PMC8567602 | Approximately half of GBAF remains bound to insoluble chromatin following nuclear extraction from synovial sarcoma cells without fusion depletion (Fig. 7F). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Approxi... |
PMC9429973 | I. Dogliotti, M. Clerico, F. Vassallo, S. Ragaini, V. Peri, B. Botto, C. Consoli, L. Orsucci, R. Freilone, S. Ferrero, A. Lonardo, G. De Luca, D. Ferrero, F. Cavallo Division of Hematology 1U, Department of Biotechnology and Health Sciences, University of Torino; Division of Hematology 2, University Hospital AOU Città ... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11528603 | Interestingly, the HL60 cell-growth inhibition acknowledged in our study is also in line with the same reported effects of S. affinis derived extract and compound on HeLa cells. | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10850553 | Figure 4The co-expression of C5AR1 and its ligand C5a in intracranial aneurysm lesions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Figure",
"4The",
"co-expression",
"of",
"C5AR1",
"and",
"its",
"ligand",
... |
PMC11788920 | DNA construct indicating the relative positions of the RNAP promoter, the PQS, and one of the dCas9 target sites. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"DNA",
"const... |
PMC11754784 | All fluorescence spectra were measured using a FS5 Spectrofluorometer fluorescence spectrophotometer (Edinburgh Instruments, UK). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"fluorescence",
"spectra",
"were",
"measure... |
PMC9429973 | S. De Coninck, P. Van Vlierberghe, S. Goossens, R. De Smedt, B. Lintermans Biomolecular Medicine; Cancer Research Institute Ghent (CRIG); Center for Medical Genetics; Diagnostic Sciences, Ghent University, Ghent, Belgium Background: T cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematologic malignancy tha... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10507284 | KM, Kaplan–Meier; OS, overall survival; PFI, progression‐free interval; DSS, disease‐specific survival; DL, dedifferentiated liposarcoma; LMS, leiomyosarcomas; UPS, undifferentiated pleomorphic sarcoma. * | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The Hans algorithm based on immunohistochemistry (IHC) analysis helps classifying DLBCL into GCB and non-GCB subtypes in clinical practice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"Hans",
"al... |
PMC11180402 | A Methylation status of the miR-129 promoter in 5637 cells treated with ISO at indicated concentrations was determined by MS-PCR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"Methylation",
... |
PMC10968586 | Hematological malignancies arise from the loss of hematopoietic homeostasis, and may be configured as a large category including both myeloid and lymphatic neoplasms (leukemia, lymphoma, and multiple myeloma) whose incidence is pretty variable at the regional level . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11300639 | Data are presented as the mean ± SEM of three replicates for in vitro assay and six replicates for in vivo assay. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"are"... |
PMC11541241 | TOR inhibition through inhibitor treatments, RNAi, or VIGS technologies primes immunity and pathogen resistance in plants. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"TOR",
"inhibition",
"through",
"inhibitor",
... |
PMC11143482 | To recap, in this study, NSG mice were randomly divided into three groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"recap",
",",
"in",
"this",
"study",
",",
"NSG",... |
PMC7369657 | The tumor volume in the CQD-treated group was smaller than that in the control group, and the tumor volume inhibition rate was 38.9%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11352666 | To further evaluate the therapeutic potential of MERTK inhibition in EWS, we tested the activity of MRX-2843 against EWS cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"furthe... |
PMC11448304 | d Immunoprecipitation of EGFR and pan anti-hydroxyisobutyryllysine antibody was used for immunoblotting Combined analysis of transcriptome, proteome, and 2-hydroxyisobutyrylome. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"d",
"Immunoprecipitatio... |
PMC11640419 | Afterwards, 70 μL of streptavidin-phycoerythrin (streptavidin-PE) (Luminex, USA) was added to each well and incubated for 30 min at room temperature on a shaker at 600 rpm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11247842 | The Radial plot shows a the enrichment (OR) in meta-analysis of clinical mastitis; b OR in meta-analysis of somatic cell score, c OR in multi-trait analysis of clinical mastitis, d OR in multi-trait analysis of somatic cell score. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11555465 | The present study evaluated the effect of T. gondii tachyzoite culture supernatant on the induction of apoptosis in bladder cancer 5637 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"The",
... |
PMC11718817 | However, two different conditions were investigated with T cells from two fully separated mouse lines, WT and Il18r OT-I mice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",... |
PMC11543853 | The resulting maps were used as initial models for subsequent 3D refinements. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"resulting",
"maps",
"were",
"used",
"as",
"initial",
"models",
"for",
... |
PMC11064533 | In this study, ΔyggT in the gentamicin-stressed adhesion assay as well as the gentamicin MIC assay exhibited the highest sensitivity compared to the wild type and other mutants. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC4485786 | After incubation for another 4 d (ZCRH and SRH) or 10 d (CCA) living cells were counted. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"incubation",
... |
PMC11279397 | From the TCMSP database, we retrieved the monomeric constituents of Perilla frutescens, ranked their OB, and selected the top 20% with higher OB (%) values for the literature review using the PubMed database. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | In the TCL1-driven CLL mouse model, administration of the DUSP1/6 inhibitor is effective in lowering CLL cell progression (>50% reduction of total CLL cell count in the spleen; n=5; p=0.0029). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11769522 | The culture media was incubated at 37 °C in a cell incubator with 5% CO2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"culture",
"media",
"was",
"incubated",
... |
PMC11397654 | The newly obtained macrocycles could be promising theranostic compounds allowing the antiangiogenic treatment and monitoring the delivery using the fluorescent fragment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"newly",
"o... |
PMC9429973 | Studies were reviewed against predefined eligibility criteria by two independent reviewers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Studies",
"were",
"reviewed",
"against",
"predefined",
"eligibility",
"criteria",
"by",
"tw... |
PMC11216402 | Also, following the method of Ghandi et al. (2016) for feature interpretation but not for quantitative assessment, we use the gapped k-mer weight vector when training on all the data to reduce variability in the inferred features. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Aims: To evaluate the Q30 Kit to detect rearrangements on bone marrow and peripheral blood specimens from newly diagnosed AML patients; and compare concordance of Q30 and FISH in identifying leukaemia fusion genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11790971 | Cell lines C and D had similar Peak Titre and Peak Viable Cell Concentration (VCC) values, but they had different stability profiles (i.e., cell line C was unstable, while cell line D was stable). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9577200 | Furthermore, for BC and PAO1, different mixture ratios of GO to CS (2:1, 1:1, and 1:2) were prepared using GO (700 μg ml) and CS (0.6 and 0.8%), respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11128598 | We previously reported that CQ/LBH-induced lethality in ovarian cancer cell lines largely depended on DSBs caused by ROS. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"previously",
"reported",
"that",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.