PMCID
string
Sentences
string
ner
list
PMC7570809
Viral proteins with the RGD motif promote infection by binding integrin heterodimers , thus activating PI3K/AKT or MAPK signaling pathways which promote virus entry and infection of the host cell .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10671321
As expected, ColQ1a p.E428HfsX58 is able to associate with AChE since this interaction only requires the PRAD motif in the N-terminus of the protein .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11700523
CKD progression has multiple pathogenesis, including aging, diabetes, hypertension, glomerulonephritis, and ambient heat stress .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CKD", "progression", "has", "mult...
PMC11343332
The study also demonstrated how caspases and reactive oxygen species contribute to pycnogenol's anti-cancer properties .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "study", "also", "demonstrated", "how", "caspase...
PMC11739504
The membranes were blocked in 5% skim milk in PBS with 0.1% Tween® 20 (PBST) at room temperature for 1 h and incubated with primary antibodies diluted in 1% skim milk in PBST at 4 °C overnight for probing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Aims: 1) To describe the distribution of organ damage in AdvSM patients (pts) at initial presentation or at time of trial enrollment using WHO, IWG, and mIWG criteria; 2) to evaluate clinicopathologic and molecular correlates of organ damage.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10123657
Proteoforms significantly contribute to proteome complexity .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Proteoforms", "significantly", "contribute", "to", "proteome", "complexity", "." ] } ]
PMC11055323
n = 30 pixels, from 3 nuclei. ****
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "n", "=", "30", "pixels", ",", "from", "3", "nuclei", ".", "*", "*", ...
PMC11354225
Data were presented as mean ± SD and significance was analyzed with Mann Whitney test, using GraphPad Prism (GraphPad Software version 8, La Jolla, CA, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9688728
This procedure was not used to prepare samples for metabolomic analysis since obtaining a single-cell suspension was not necessary.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "procedure", "was", "not",...
PMC11746948
Single guide RNAs (sgRNAs) were designed to target the critical exons of the genes of interest for inactivation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single", "guide", "RNAs", ...
PMC11129910
The vectors were subjected to restriction digestion with the enzymes flanking the gene of insert and site of insertion in MCS, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC10530622
Oxalate is present in food, particularly fruit, vegetables, and nuts, and is absorbed as a dietary component.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Oxalate", "is", "...
PMC9429973
Aims: This study aimed to determine whether online continuing medical education could improve the knowledge, competence, and confidence of hematologists/oncologists (hem/oncs) in diagnosing and managing patients with high-risk AML, using a case-based approach.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11092382
The hepatic and renal clearance rates were 6.21 and 2.94 mL/min, respectively (Liu and Huang, 1988).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "hepatic", "and", ...
PMC10969097
In addition, the aim is to explore immunomodulatory effects, the influence on sexual function and changes in cancer signalling pathways.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "additi...
PMC11544122
Protein purity and concentration were verified by SDS page gel stained with GelCode Blue Stain (Thermo Scientific, cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Protein", "purity", "and", ...
PMC9429973
Summary/Conclusion: CHZ868 is a promising drugfor the treatment of JAK2 fusionsBCP-ALL.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "CHZ868", "is", "a", "promising", "drugfor", "the", "t...
PMC11756514
The vector was transformed into the Escherichia coli strain BL21 (DE3) (cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "vector", "was", "transformed", "into", "the", "Esche...
PMC9429973
The content of CD45CD34 cells was higher in BMC (0.901±1.009%) than in BMAT (0.357±0.505%), while interestingly no differences were found in CD33 cell frequencies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5415764
Apoptosis analysis by the Annexin V-FITC/PI staining method was further used to confirm the proapoptotic effects of P+T/iRGD LPNs treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Apoptosis", "analysis", "by"...
PMC11543853
The variability in the location and timing of genome release among individual enterovirus particles is probably caused by the variability in environmental stimuli experienced by individual particles and by internal differences between the particles.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9592219
Taken together, these results demonstrate that TOP2A promotes HCC development primarily by inactivating the Hippo signaling pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Taken", "together", ",", "these", "res...
PMC11676169
To independently confirm a role for BCAT1 in modulating DNA DSB repair, we assessed the kinetics and localization of 53BP1 and γH2AX in etoposide-treated CCRF-CEM T-ALL cells following stable knockdown of BCAT1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", ...
PMC9429973
Patients’ characteristics are displayed on Fig 1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "’", "characteristics", "are", "displayed", "on", "Fig", "1", "." ] } ]
PMC11290772
It has been observed that ROBO1 is highly expressed in tumor cells, and the SLIT-ROBO signaling pathway plays a pivotal role in tumor angiogenesis and metastatic processes [5–9].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Based on the existing literature, we wondered whether IL-27 affects the development and progression of CLL.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Based", "on", "the", "existing", "literature", ...
PMC6642070
The p53RRE of CD44 gene was used as a positive control. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "p53RRE", "of", "CD44", "gene", "was", "used", "as", "a", "positive"...
PMC11078693
Centrifuge the cells at 200 g and 4°C for 10 min; from this point, handle the tube with care to avoid cell detachment (problem 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11629192
Recent studies, including a report from China, have demonstrated promising effects of OFA in treating adult patients with refractory anti-NMDAR encephalitis [, , ].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11706776
Indeed, a significant decrease in the number of clones is observed with a decrease of at least 50% for shRNA 908 and shRNA 576 cells (Fig. 4B, left and middle panel).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8584319
AZD8055 inhibited protein synthesis in mouse embryonic fibroblasts and hepatocellular carcinoma HepG2 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "AZD8055", "inhibited", "protein", "synthesis", "in", "mouse", "embryonic...
PMC11721277
Yield: 296 mg (74.5%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Yield", ":", "296", "mg", "(", "74.5", "%", ")", "." ] } ]
PMC10165258
Before testing the drugs, the compatibility of the droplet-based culture with the spheroids was verified by measuring the growth and the viability of the spheroids in droplets over several days.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11476106
This results in clonal selection of the tumor cells best adapted to the niche .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "results", "in", "clonal", "selection", "of", "the", "tum...
PMC11740207
ECCs are pluripotent, meaning they can differentiate into many cell types, similar to normal SCs (Cunningham et al., 2012; Gropp et al., 2012; Montilla-Rojo et al., 2023).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11607638
Note that no changes in body weight were found with SK2 injections at different doses (left, Figure 3E).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Note", "that", "n...
PMC11266100
Plasmids were prepared from transfected E. Coli using the Plasmid Plus Giga Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions and diluted in sterile H2O to a 2 mg/mL concentration.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
RNA-seq was performed by using an Illumina NovaSeq 6000 platform.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RNA-seq", "was", "performed", "by", "using", "an", "Illumina", "NovaSeq", "6000", "platform", ...
PMC5839394
Flow cytometry analysis (Figure 5A) revealed that only the 11.57% of AgNPs-EPS treated cells underwent to apoptosis compared to the 5.50% in untreated cells and doxorubicin treated cells (27.81%), while no apoptosis was recorded for AgNPs-EPS treated cells (5.58%) and for free-metal EPS treated cells (6.06%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11190538
C-phycocyanin suppressed CPE of HCoV-229E virus; when host cells were pretreated with C-phycocyanin for 1 h before infection, the C-phycocyanin showed a significant decrease in viral infection with a selective index of up to 36.76 (Table 5).Fig.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Our results give an evidence that MM hematopoietic niche is not returned to normal after treatment especially in patients non-responding or partially responding to it.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11754094
P = 0.0072 for large deletion between ART558-treated and non-treated HeLa cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "P", "=", "0.0072", "for", "large", "deletion", "between", "ART558-treated", ...
PMC9429973
Targeted next-generation sequencing by Illumina MiSeq is ongoing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Targeted", "next-generation", "sequencing", "by", "Illumina", "MiSeq", "is", "ongoing", "." ] } ]
PMC10870498
This study was designed to investigate the regulatory effects of kinesin family member (KIF) 23 on anaplastic thyroid cancer (ATC) cell viability and migration and the underlying mechanism.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11257988
Immune therapies aim to reactivate anti-tumor immune cells and overcome the tumor’s immune escape mechanisms.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Immune", "therapies", "aim", "to", "reactivate", "anti...
PMC11332076
A: Representative immunoblot images of pIR or pIGF1R, myc, pIRS-1, total IRS-1 and actin in Cos-7 cells transfected with plasmids expressing F-iIR, iIR, F-iIGF1R or iIGF1R.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", ...
PMC6642070
The potential p53 repressive response elements (p53RREs), which are consisting of four canonical p53-binding sites (5’-RRRCW-3′) arranged head to tail and matching >90%, were identified by Vector NTI Advance 10 software (Invitrogen).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11666785
The SBR is calculated as the ratio of number of molecules on the filament and outside the filament.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "SBR", "is", "calculated", "as",...
PMC4369959
This tract starts from the mouth, includes esophagus, stomach, small and large intestine, and rectum, and finally ends with anus.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC8097906
The solvent (0.1% DMSO for lupeol and 0.1% CHCl3 for ß-sitosterol) was used as negative control and set to 100%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11190062
mRNA expression of TNFRSF17 relative to ACTB in freshly obtained primary bone marrow CD138 MM cells from 14 donors treated with a cocktail of TLR agonists for 6 hours as determined by RT-qPCR.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Results: A survey amongst 67 (80%) of the participating centers revealed that INHERENT has the potential to recruit over 73 500 patients, of which 53 755 are SCD, 15 691 are β thalassemia (62% transfusion dependent), 4 179 (α thalassemia).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11335267
PET acquisition was performed during 20 min and was followed by a CT scan.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PET", "acquisition", "was", "performed", "during", "20", "min", ...
PMC11783017
This indicates that the degradation of MYC and the release of ICD factors enhanced tumor immune infiltration and subsequent immune activation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "indicates", ...
PMC10761571
Drug-induced activation of caspase-8 may occur through the both death receptor and mitochondrial pathways.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Drug-induced", "activation", "of", "caspase-8", "may", "occur", "throu...
PMC9220170
In addition, SELENOT expression is increased in neurons and astrocytes upon treatment with neurotoxin and oxidative stress, but the molecular mechanisms of regulation of such expression remain unknown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10093184
The migration capability of COS3600 and COS3600B cells was similar with a small, but still visible, scratch after 60 h. The cell-free area after 60 h was biggest in COS4074 cells, clearly indicating the lowest migration capacity in these cells (scratch visible even after 72 h—data nor shown).
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC10823017
In addition, BYL and aPKC inhibitor ICA-1 combination therapy is marked by a more pronounced effect on the downstream effectors ( Figure 5 ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11525028
Asn levels in 143B (left) and HOS (right) cells treated with paliperidone or AG-401 (24 h) at the indicated concentrations (n = 3). (
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC10006224
Primary and secondary antibodies were diluted in blocking solution and incubated for 1 h each at room temperature (RT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Primary", "and", ...
PMC9847912
In the first phase of the assay, 293T/17 cells were seeded into 48-well, tissue culture-treated plates (two plates per virus isolate) at a density of 3 × 10 cells per well in 200 μl of complete DMEM per well, and incubated for ~24 h at 37°C in 5% CO2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11707577
In particular, intracellular M13EGFR(TNP) overlayed with the Mitotracker fluorescence signal.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "particular", ",", "intracellular", "M13EGFR(TNP", ")", "overlayed", "with", ...
PMC11637276
Similarly, p38 inhibition reduced collagen I internalisation in YEJ P and SW1990 cells (S5E and S5F Fig), suggesting that p38 signalling regulates ECM internalisation in breast, ovarian, and PDAC cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC9065483
Viral titers were quantified 48 hpi by high-throughput titration.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Viral", "titers", "were", "quantified", "48", "hpi", "by", "high-throughput", "titration", "." ] } ]
PMC9429973
A total of 15 patients (33%) received rilzabrutinib monotherapy, and 30 had concomitant therapy (TPO-RA n=13 [29%], CS n=12 [27%], TPO-RA + CS n=5 [11%]).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
DOT was compared between cohorts using a Cox proportional hazards model and reduction in serum tryptase levels was compared using a generalized estimating equation linear model.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11680049
As seen in Figure 2, they are an essential component of the cuticle, cell walls, and intercellular spaces of epidermal cells and stomata cells, further demonstrating the high reactivity of these low-molecular-weight compounds.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11283030
The immunoreactive bands were visualized by 3,3′-diaminobenzidine (DAB, P0202, Beyotime, China) or chemiluminescence (ECL, WBKlS0100, Millipore, USA), and quantified by Image J software.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11739504
Less than half of the NLS domain-depleted Kat2b were localized in the nucleus, and the NLS and AT domain-depleted Kat2b were in a nearly nonnuclear position.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740399
T24 cells and 5637 cells were treated with 3025@ML, OXA, or the com by reducing PKM2 and FASN bination to verify 3025@ML enhanced anti-tumor activity of OXA by CCK8 analysis (A and B) and trypan blue staining (C and D).
[ { "tags": [ "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC9429973
Similarly, the percentage of patients presenting additional somatic variants in other myeloid-related genes was similar between CADD<20 and CADD>20 TERT variant carriers (60% vs 64%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11752767
Lysed tumor cells release cancer antigens, which are then presented by DCs, promoting specific T cell proliferation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lysed", "tumor", "cells", "releas...
PMC11036064
1×10 cells were transfected with scramble, 5, 7.5, and 10 pmol of hsa-miR-34a-5p mimics (UGGCAGUGUCUUAGCUGGUUGU) using a Gene Pulser Electroporation (Bio-Rad, CA, USA) and a 0.4 cm Gene Pulser Cuvette (Bio-Rad, CA, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8735881
As detected by GFP and anti-His antibody, the GPI-10E8/GFP construct was efficiently expressed on the surface of CEMss-CCR5 cells and did not affect the expression of CD4, CCR5, and CXCR4 either.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", ...
PMC11247842
Our meta-analysis study involved only SNPs and small insertion and deletions (INDELs) and therefore could not test CNVs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "meta-analysis", "stud...
PMC11675244
A similar mechanism of action appears with other inhibitors as well when observed in in vivo models of breast cancer and head and neck squamous cell carcinoma .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9621239
Recently, the characteristic of HBV QS in the liver tissues of patients with HCC has been investigated, wherein the QS heterogeneity across the HBV PreS region or core promoter region between tumour and adjacent non-tumour tissues was observed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8984067
The absorption peak intensity-time curve was drawn at 420 nm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "absorption", "peak", "intensity-time", "curve", "was", "drawn", "at", "420", "nm", ...
PMC11481779
The diffusion models work in two steps - the first is the model’s training, and the second is inference.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "diffusion", ...
PMC11618052
As a result, compounds 8g, 8h, and 8j are potential antiproliferative agents that operate as dual inhibitors of EGFR and BRAF.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11751675
Moreover, various studies have reported that the presence of alkylating centres, lipophilicity, and molecular geometry and electronic properties play a pivotal role in the biological properties of SLs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9964635
The insulin-like growth factor-1 receptor (IGF-1R) has a vital role in cells in conjunction with PI3K–AKT and Ras–Raf–MEK signalling cascades, which control proliferation and apoptosis within cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8996378
The third-generation of ABCB1 inhibitors, such as tariquidar and zosuquidar, were much more effective than the first-generation and second-generation inhibitors (Martin et al., 1999).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11519567
two-sided, unpaired t test; n = 6 nuclei. ****
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "two-sided", ",", "unpaired", "t", "test", ";", "n", "=", "...
PMC11607638
We know from the present work that the mammalian peptide cholecystokinin (CCK) has much higher efficacy/sensitivity for the rat pancreatic acinar cell receptor in comparison with the mosquito sulfakinin receptor (a difference of three orders of magnitude, see Figure 6), and reverse selectivity for the mosquito receptor...
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11534377
This cell suspension was evenly allocated in triplicate across a 6-well plate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "cell", "suspension", "was", "evenly", "allocated", "in", "triplicate", "...
PMC11774747
Currently, off-the-shelf, potentially multi-target VSTs represent a promising therapy for both early and late-stage viral infections in immunocompromised patients, provided that a compatible VST cell line is available (58, 65, 66).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11754291
Prior to each light treatment, media from wells designated for that day’s treatment (as outlined in the plate design) were collected, harvested, and stored at −80°C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11129910
Cells were stained by using Crystal Violet for 15 minutes at room temperature.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "stained", "by", "using", "Crystal", "Violet", "for", ...
PMC3888431
In general, the method and options used to assemble sequence reads, like the k-mer value chosen for de Bruijn graph based de novo assemblers, have a strong influence on the result of an assembly.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7090062
a, b Beclin-1 siRNA alone or the combination of beclin-1 siRNA and miR-30a inhibitor were transfected into the GIST cells, then the cell viability following imatinib treatment was measured by the CCK-8 assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11555465
To assess whether T. gondii tachyzoite culture supernatant can inhibit proliferation of bladder cancer 5637 cells in vitro, CCK-8 assay was used to detect the effects of T. gondii tachyzoite culture supernatant on the proliferation of bladder cancer 5637 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11365427
Cell viability of MM cell lines after 48 h of phenylalanine deprivation. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cell", "viability", "of", "MM", "cell", "lines", "after", "48", "h", ...
PMC11470381
Mix gently.
[ { "tags": [ "O", "O", "O" ], "tokens": [ "Mix", "gently", "." ] } ]
PMC10810426
Our data strongly suggest that in both NIH3T3 cells and dendritic cells (DCs), the initial step of reverse transcription occurs in the cytoplasm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11640247
The novel de novo RAC3 variant (NM_005052.3): c.196C>T, p.R66W was recently identified via whole exome sequencing (WES) in a male fetus at 24 weeks gestation, presenting with akinesia deformation sequence, which involves a range of conditions arising from genetic, neuromuscular, or other abnormalities that impair fetal...
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11724582
A-B) Colony formation was evaluated via a colony formation assay. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A-B", ")", "Colony", "formation", "was", "evaluated", "via", "a", "colony", ...
PMC11750696
This stress response is instrumental in shaping the functionality of CD8 T cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "stress", "response", "is", "instrumental", "in", "shaping", "the", ...
PMC11267830
a Schematic diagram of the in vivo experiment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "a", "Schematic", "diagram", "of", "the", "in", "vivo", "experiment", "." ] } ]