PMCID string | Sentences string | ner list |
|---|---|---|
PMC7570809 | Viral proteins with the RGD motif promote infection by binding integrin heterodimers , thus activating PI3K/AKT or MAPK signaling pathways which promote virus entry and infection of the host cell . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10671321 | As expected, ColQ1a p.E428HfsX58 is able to associate with AChE since this interaction only requires the PRAD motif in the N-terminus of the protein . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11700523 | CKD progression has multiple pathogenesis, including aging, diabetes, hypertension, glomerulonephritis, and ambient heat stress . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CKD",
"progression",
"has",
"mult... |
PMC11343332 | The study also demonstrated how caspases and reactive oxygen species contribute to pycnogenol's anti-cancer properties . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"study",
"also",
"demonstrated",
"how",
"caspase... |
PMC11739504 | The membranes were blocked in 5% skim milk in PBS with 0.1% Tween® 20 (PBST) at room temperature for 1 h and incubated with primary antibodies diluted in 1% skim milk in PBST at 4 °C overnight for probing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Aims: 1) To describe the distribution of organ damage in AdvSM patients (pts) at initial presentation or at time of trial enrollment using WHO, IWG, and mIWG criteria; 2) to evaluate clinicopathologic and molecular correlates of organ damage. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10123657 | Proteoforms significantly contribute to proteome complexity . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Proteoforms",
"significantly",
"contribute",
"to",
"proteome",
"complexity",
"."
]
}
] |
PMC11055323 | n = 30 pixels, from 3 nuclei. **** | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"n",
"=",
"30",
"pixels",
",",
"from",
"3",
"nuclei",
".",
"*",
"*",
... |
PMC11354225 | Data were presented as mean ± SD and significance was analyzed with Mann Whitney test, using GraphPad Prism (GraphPad Software version 8, La Jolla, CA, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9688728 | This procedure was not used to prepare samples for metabolomic analysis since obtaining a single-cell suspension was not necessary. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"procedure",
"was",
"not",... |
PMC11746948 | Single guide RNAs (sgRNAs) were designed to target the critical exons of the genes of interest for inactivation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Single",
"guide",
"RNAs",
... |
PMC11129910 | The vectors were subjected to restriction digestion with the enzymes flanking the gene of insert and site of insertion in MCS, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
PMC10530622 | Oxalate is present in food, particularly fruit, vegetables, and nuts, and is absorbed as a dietary component. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Oxalate",
"is",
"... |
PMC9429973 | Aims: This study aimed to determine whether online continuing medical education could improve the knowledge, competence, and confidence of hematologists/oncologists (hem/oncs) in diagnosing and managing patients with high-risk AML, using a case-based approach. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11092382 | The hepatic and renal clearance rates were 6.21 and 2.94 mL/min, respectively (Liu and Huang, 1988). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"hepatic",
"and",
... |
PMC10969097 | In addition, the aim is to explore immunomodulatory effects, the influence on sexual function and changes in cancer signalling pathways. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"additi... |
PMC11544122 | Protein purity and concentration were verified by SDS page gel stained with GelCode Blue Stain (Thermo Scientific, cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Protein",
"purity",
"and",
... |
PMC9429973 | Summary/Conclusion: CHZ868 is a promising drugfor the treatment of JAK2 fusionsBCP-ALL. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Summary/Conclusion",
":",
"CHZ868",
"is",
"a",
"promising",
"drugfor",
"the",
"t... |
PMC11756514 | The vector was transformed into the Escherichia coli strain BL21 (DE3) (cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"vector",
"was",
"transformed",
"into",
"the",
"Esche... |
PMC9429973 | The content of CD45CD34 cells was higher in BMC (0.901±1.009%) than in BMAT (0.357±0.505%), while interestingly no differences were found in CD33 cell frequencies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5415764 | Apoptosis analysis by the Annexin V-FITC/PI staining method was further used to confirm the proapoptotic effects of P+T/iRGD LPNs treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Apoptosis",
"analysis",
"by"... |
PMC11543853 | The variability in the location and timing of genome release among individual enterovirus particles is probably caused by the variability in environmental stimuli experienced by individual particles and by internal differences between the particles. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9592219 | Taken together, these results demonstrate that TOP2A promotes HCC development primarily by inactivating the Hippo signaling pathway. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Taken",
"together",
",",
"these",
"res... |
PMC11676169 | To independently confirm a role for BCAT1 in modulating DNA DSB repair, we assessed the kinetics and localization of 53BP1 and γH2AX in etoposide-treated CCRF-CEM T-ALL cells following stable knockdown of BCAT1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
... |
PMC9429973 | Patients’ characteristics are displayed on Fig 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Patients",
"’",
"characteristics",
"are",
"displayed",
"on",
"Fig",
"1",
"."
]
}
] |
PMC11290772 | It has been observed that ROBO1 is highly expressed in tumor cells, and the SLIT-ROBO signaling pathway plays a pivotal role in tumor angiogenesis and metastatic processes [5–9]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Based on the existing literature, we wondered whether IL-27 affects the development and progression of CLL. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Based",
"on",
"the",
"existing",
"literature",
... |
PMC6642070 | The p53RRE of CD44 gene was used as a positive control. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"p53RRE",
"of",
"CD44",
"gene",
"was",
"used",
"as",
"a",
"positive"... |
PMC11078693 | Centrifuge the cells at 200 g and 4°C for 10 min; from this point, handle the tube with care to avoid cell detachment (problem 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11629192 | Recent studies, including a report from China, have demonstrated promising effects of OFA in treating adult patients with refractory anti-NMDAR encephalitis [, , ]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11706776 | Indeed, a significant decrease in the number of clones is observed with a decrease of at least 50% for shRNA 908 and shRNA 576 cells (Fig. 4B, left and middle panel). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8584319 | AZD8055 inhibited protein synthesis in mouse embryonic fibroblasts and hepatocellular carcinoma HepG2 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"AZD8055",
"inhibited",
"protein",
"synthesis",
"in",
"mouse",
"embryonic... |
PMC11721277 | Yield: 296 mg (74.5%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Yield",
":",
"296",
"mg",
"(",
"74.5",
"%",
")",
"."
]
}
] |
PMC10165258 | Before testing the drugs, the compatibility of the droplet-based culture with the spheroids was verified by measuring the growth and the viability of the spheroids in droplets over several days. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11476106 | This results in clonal selection of the tumor cells best adapted to the niche . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"results",
"in",
"clonal",
"selection",
"of",
"the",
"tum... |
PMC11740207 | ECCs are pluripotent, meaning they can differentiate into many cell types, similar to normal SCs (Cunningham et al., 2012; Gropp et al., 2012; Montilla-Rojo et al., 2023). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11607638 | Note that no changes in body weight were found with SK2 injections at different doses (left, Figure 3E). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Note",
"that",
"n... |
PMC11266100 | Plasmids were prepared from transfected E. Coli using the Plasmid Plus Giga Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions and diluted in sterile H2O to a 2 mg/mL concentration. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | RNA-seq was performed by using an Illumina NovaSeq 6000 platform. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RNA-seq",
"was",
"performed",
"by",
"using",
"an",
"Illumina",
"NovaSeq",
"6000",
"platform",
... |
PMC5839394 | Flow cytometry analysis (Figure 5A) revealed that only the 11.57% of AgNPs-EPS treated cells underwent to apoptosis compared to the 5.50% in untreated cells and doxorubicin treated cells (27.81%), while no apoptosis was recorded for AgNPs-EPS treated cells (5.58%) and for free-metal EPS treated cells (6.06%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11190538 | C-phycocyanin suppressed CPE of HCoV-229E virus; when host cells were pretreated with C-phycocyanin for 1 h before infection, the C-phycocyanin showed a significant decrease in viral infection with a selective index of up to 36.76 (Table 5).Fig. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Our results give an evidence that MM hematopoietic niche is not returned to normal after treatment especially in patients non-responding or partially responding to it. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11754094 | P = 0.0072 for large deletion between ART558-treated and non-treated HeLa cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"P",
"=",
"0.0072",
"for",
"large",
"deletion",
"between",
"ART558-treated",
... |
PMC9429973 | Targeted next-generation sequencing by Illumina MiSeq is ongoing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Targeted",
"next-generation",
"sequencing",
"by",
"Illumina",
"MiSeq",
"is",
"ongoing",
"."
]
}
] |
PMC10870498 | This study was designed to investigate the regulatory effects of kinesin family member (KIF) 23 on anaplastic thyroid cancer (ATC) cell viability and migration and the underlying mechanism. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11257988 | Immune therapies aim to reactivate anti-tumor immune cells and overcome the tumor’s immune escape mechanisms. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immune",
"therapies",
"aim",
"to",
"reactivate",
"anti... |
PMC11332076 | A: Representative immunoblot images of pIR or pIGF1R, myc, pIRS-1, total IRS-1 and actin in Cos-7 cells transfected with plasmids expressing F-iIR, iIR, F-iIGF1R or iIGF1R. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6642070 | The potential p53 repressive response elements (p53RREs), which are consisting of four canonical p53-binding sites (5’-RRRCW-3′) arranged head to tail and matching >90%, were identified by Vector NTI Advance 10 software (Invitrogen). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11666785 | The SBR is calculated as the ratio of number of molecules on the filament and outside the filament. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"SBR",
"is",
"calculated",
"as",... |
PMC4369959 | This tract starts from the mouth, includes esophagus, stomach, small and large intestine, and rectum, and finally ends with anus. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC8097906 | The solvent (0.1% DMSO for lupeol and 0.1% CHCl3 for ß-sitosterol) was used as negative control and set to 100%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11190062 | mRNA expression of TNFRSF17 relative to ACTB in freshly obtained primary bone marrow CD138 MM cells from 14 donors treated with a cocktail of TLR agonists for 6 hours as determined by RT-qPCR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Results: A survey amongst 67 (80%) of the participating centers revealed that INHERENT has the potential to recruit over 73 500 patients, of which 53 755 are SCD, 15 691 are β thalassemia (62% transfusion dependent), 4 179 (α thalassemia). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11335267 | PET acquisition was performed during 20 min and was followed by a CT scan. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PET",
"acquisition",
"was",
"performed",
"during",
"20",
"min",
... |
PMC11783017 | This indicates that the degradation of MYC and the release of ICD factors enhanced tumor immune infiltration and subsequent immune activation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"indicates",
... |
PMC10761571 | Drug-induced activation of caspase-8 may occur through the both death receptor and mitochondrial pathways. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Drug-induced",
"activation",
"of",
"caspase-8",
"may",
"occur",
"throu... |
PMC9220170 | In addition, SELENOT expression is increased in neurons and astrocytes upon treatment with neurotoxin and oxidative stress, but the molecular mechanisms of regulation of such expression remain unknown. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10093184 | The migration capability of COS3600 and COS3600B cells was similar with a small, but still visible, scratch after 60 h. The cell-free area after 60 h was biggest in COS4074 cells, clearly indicating the lowest migration capacity in these cells (scratch visible even after 72 h—data nor shown). | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC10823017 | In addition, BYL and aPKC inhibitor ICA-1 combination therapy is marked by a more pronounced effect on the downstream effectors ( Figure 5 ). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11525028 | Asn levels in 143B (left) and HOS (right) cells treated with paliperidone or AG-401 (24 h) at the indicated concentrations (n = 3). ( | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC10006224 | Primary and secondary antibodies were diluted in blocking solution and incubated for 1 h each at room temperature (RT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Primary",
"and",
... |
PMC9847912 | In the first phase of the assay, 293T/17 cells were seeded into 48-well, tissue culture-treated plates (two plates per virus isolate) at a density of 3 × 10 cells per well in 200 μl of complete DMEM per well, and incubated for ~24 h at 37°C in 5% CO2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11707577 | In particular, intracellular M13EGFR(TNP) overlayed with the Mitotracker fluorescence signal. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"particular",
",",
"intracellular",
"M13EGFR(TNP",
")",
"overlayed",
"with",
... |
PMC11637276 | Similarly, p38 inhibition reduced collagen I internalisation in YEJ P and SW1990 cells (S5E and S5F Fig), suggesting that p38 signalling regulates ECM internalisation in breast, ovarian, and PDAC cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC9065483 | Viral titers were quantified 48 hpi by high-throughput titration. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Viral",
"titers",
"were",
"quantified",
"48",
"hpi",
"by",
"high-throughput",
"titration",
"."
]
}
] |
PMC9429973 | A total of 15 patients (33%) received rilzabrutinib monotherapy, and 30 had concomitant therapy (TPO-RA n=13 [29%], CS n=12 [27%], TPO-RA + CS n=5 [11%]). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | DOT was compared between cohorts using a Cox proportional hazards model and reduction in serum tryptase levels was compared using a generalized estimating equation linear model. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11680049 | As seen in Figure 2, they are an essential component of the cuticle, cell walls, and intercellular spaces of epidermal cells and stomata cells, further demonstrating the high reactivity of these low-molecular-weight compounds. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11283030 | The immunoreactive bands were visualized by 3,3′-diaminobenzidine (DAB, P0202, Beyotime, China) or chemiluminescence (ECL, WBKlS0100, Millipore, USA), and quantified by Image J software. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11739504 | Less than half of the NLS domain-depleted Kat2b were localized in the nucleus, and the NLS and AT domain-depleted Kat2b were in a nearly nonnuclear position. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11740399 | T24 cells and 5637 cells were treated with 3025@ML, OXA, or the com by reducing PKM2 and FASN bination to verify 3025@ML enhanced anti-tumor activity of OXA by CCK8 analysis (A and B) and trypan blue staining (C and D). | [
{
"tags": [
"B-CellLine",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC9429973 | Similarly, the percentage of patients presenting additional somatic variants in other myeloid-related genes was similar between CADD<20 and CADD>20 TERT variant carriers (60% vs 64%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11752767 | Lysed tumor cells release cancer antigens, which are then presented by DCs, promoting specific T cell proliferation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Lysed",
"tumor",
"cells",
"releas... |
PMC11036064 | 1×10 cells were transfected with scramble, 5, 7.5, and 10 pmol of hsa-miR-34a-5p mimics (UGGCAGUGUCUUAGCUGGUUGU) using a Gene Pulser Electroporation (Bio-Rad, CA, USA) and a 0.4 cm Gene Pulser Cuvette (Bio-Rad, CA, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8735881 | As detected by GFP and anti-His antibody, the GPI-10E8/GFP construct was efficiently expressed on the surface of CEMss-CCR5 cells and did not affect the expression of CD4, CCR5, and CXCR4 either. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11247842 | Our meta-analysis study involved only SNPs and small insertion and deletions (INDELs) and therefore could not test CNVs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"meta-analysis",
"stud... |
PMC11675244 | A similar mechanism of action appears with other inhibitors as well when observed in in vivo models of breast cancer and head and neck squamous cell carcinoma . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9621239 | Recently, the characteristic of HBV QS in the liver tissues of patients with HCC has been investigated, wherein the QS heterogeneity across the HBV PreS region or core promoter region between tumour and adjacent non-tumour tissues was observed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8984067 | The absorption peak intensity-time curve was drawn at 420 nm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"absorption",
"peak",
"intensity-time",
"curve",
"was",
"drawn",
"at",
"420",
"nm",
... |
PMC11481779 | The diffusion models work in two steps - the first is the model’s training, and the second is inference. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"diffusion",
... |
PMC11618052 | As a result, compounds 8g, 8h, and 8j are potential antiproliferative agents that operate as dual inhibitors of EGFR and BRAF. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11751675 | Moreover, various studies have reported that the presence of alkylating centres, lipophilicity, and molecular geometry and electronic properties play a pivotal role in the biological properties of SLs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9964635 | The insulin-like growth factor-1 receptor (IGF-1R) has a vital role in cells in conjunction with PI3K–AKT and Ras–Raf–MEK signalling cascades, which control proliferation and apoptosis within cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8996378 | The third-generation of ABCB1 inhibitors, such as tariquidar and zosuquidar, were much more effective than the first-generation and second-generation inhibitors (Martin et al., 1999). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11519567 | two-sided, unpaired t test; n = 6 nuclei. **** | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"two-sided",
",",
"unpaired",
"t",
"test",
";",
"n",
"=",
"... |
PMC11607638 | We know from the present work that the mammalian peptide cholecystokinin (CCK) has much higher efficacy/sensitivity for the rat pancreatic acinar cell receptor in comparison with the mosquito sulfakinin receptor (a difference of three orders of magnitude, see Figure 6), and reverse selectivity for the mosquito receptor... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11534377 | This cell suspension was evenly allocated in triplicate across a 6-well plate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"cell",
"suspension",
"was",
"evenly",
"allocated",
"in",
"triplicate",
"... |
PMC11774747 | Currently, off-the-shelf, potentially multi-target VSTs represent a promising therapy for both early and late-stage viral infections in immunocompromised patients, provided that a compatible VST cell line is available (58, 65, 66). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11754291 | Prior to each light treatment, media from wells designated for that day’s treatment (as outlined in the plate design) were collected, harvested, and stored at −80°C. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11129910 | Cells were stained by using Crystal Violet for 15 minutes at room temperature. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"stained",
"by",
"using",
"Crystal",
"Violet",
"for",
... |
PMC3888431 | In general, the method and options used to assemble sequence reads, like the k-mer value chosen for de Bruijn graph based de novo assemblers, have a strong influence on the result of an assembly. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7090062 | a, b Beclin-1 siRNA alone or the combination of beclin-1 siRNA and miR-30a inhibitor were transfected into the GIST cells, then the cell viability following imatinib treatment was measured by the CCK-8 assay. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11555465 | To assess whether T. gondii tachyzoite culture supernatant can inhibit proliferation of bladder cancer 5637 cells in vitro, CCK-8 assay was used to detect the effects of T. gondii tachyzoite culture supernatant on the proliferation of bladder cancer 5637 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11365427 | Cell viability of MM cell lines after 48 h of phenylalanine deprivation. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cell",
"viability",
"of",
"MM",
"cell",
"lines",
"after",
"48",
"h",
... |
PMC11470381 | Mix gently. | [
{
"tags": [
"O",
"O",
"O"
],
"tokens": [
"Mix",
"gently",
"."
]
}
] |
PMC10810426 | Our data strongly suggest that in both NIH3T3 cells and dendritic cells (DCs), the initial step of reverse transcription occurs in the cytoplasm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11640247 | The novel de novo RAC3 variant (NM_005052.3): c.196C>T, p.R66W was recently identified via whole exome sequencing (WES) in a male fetus at 24 weeks gestation, presenting with akinesia deformation sequence, which involves a range of conditions arising from genetic, neuromuscular, or other abnormalities that impair fetal... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11724582 | A-B) Colony formation was evaluated via a colony formation assay. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A-B",
")",
"Colony",
"formation",
"was",
"evaluated",
"via",
"a",
"colony",
... |
PMC11750696 | This stress response is instrumental in shaping the functionality of CD8 T cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"stress",
"response",
"is",
"instrumental",
"in",
"shaping",
"the",
... |
PMC11267830 | a Schematic diagram of the in vivo experiment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"a",
"Schematic",
"diagram",
"of",
"the",
"in",
"vivo",
"experiment",
"."
]
}
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.