PMCID
string
Sentences
string
ner
list
PMC11023271
LPA has been shown extensively to play pleotropic roles in biological processes, including angiogenesis, cell proliferation and migration, and contributes to a variety of diseases such as cancer, wound healing, and neurological impairments .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11615743
To the best of our knowledge, there are a few DNA logic‐gate‐based methods that can accurately identify and isolate target cells in a serum‐containing environment or biological fluid.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11673902
Cell swelling: electroporation temporarily disrupts the cell membrane, allowing water and small molecules to enter the cell, resulting in an increase in cell size.iii.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11295144
Active presynaptic terminals were visualized with the Cy5-labeled anti-synaptotagmin luminal domain-specific antibody (cyan), while all presynaptic terminals were visualized with an anti-VGAT-specific antibody (blue).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Patients with cutaneous hemorrhagic syndrome were included in the Group №1, and those without cutaneous hemorrhages in the Group №2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patient...
PMC9429973
No significant differences were observed in patients in the Int-fit group who experienced chemotherapy AEs, treatment discontinuation, and TTP compared with the Fit group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC8143558
Eucalyptus camaldulensis Dehnh was the only plant in this review that was classified as a Near Threatened (NT) species.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Eucalyptus", "camaldule...
PMC9429973
Study shows that the rates of complete remission(CR),five-year OS,five-year PFS were significantly lower for the non-GCB subtype(77.5% vs 52.6%,78% vs 54%,76% vs 48%).Patients who failed in initial treatment had poor prognosis and short overall survival.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11591052
Asterisks indicate a significant difference in protein expression (* p ≤ 0.05; ** p ≤ 0.01; n.s.—non-significant).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11746948
once every three days).
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "once", "every", "three", "days", ")", "." ] } ]
PMC9429973
75%(9/12) patients with MYD88L265P mutation, 33%(1/3) patients with CXCR4 mutation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "75%(9/12", ")", "patients", "with", "MYD88L265P", "mutation", ",", "33%(1/3...
PMC9429973
Moreover, the involvement of c-Fos in miR-181a/b transcription during Ibrutinib is still not clear.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "the", "involvement", "of", "c-Fos", "in", ...
PMC10142392
This type of nanoparticle allowed for the improvement of the solubility of lipophilic drugs that are poorly soluble in water, as well as an increase in their efficacy and bioavailability .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11361748
These findings show that induced K17 in TPA-primed epidermal keratinocytes plays a significant role in the early amplification of the neutrophil influx induced by repeated stresses to skin. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11487720
Our study concerns the severity of frostbite and UV irradiation in the polar regions and even outer space .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "study", "concerns", "the", "sev...
PMC9429973
The STR-PCR was detected on + 30d, + 60d, + 90d, + 180d and + 270d respectively to evaluate the evidence of implantation and the chimeric body showed complete chimerism after transplantation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11495567
.
[ { "tags": [ "O" ], "tokens": [ "." ] } ]
PMC5941560
Fortunately, the targeted sequencing study found the stop codon on one allele and the 47 bp deletion on the others, both of which should block the production of a full length INPP5D transcript.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7215832
Indeed RX-3117 induces some cell cycle proteins (e.g., CHK2 and cdc25), with an arrest in the S and G2M phase), but whether this is related to DNMT1 down-regulation is unlikely because of the different time-span.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10719213
Cladribine tablets are a treatment for multiple sclerosis with effects on lymphocytes, yet its mode of action has not been fully established.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cladrib...
PMC10006224
We next asked if cohesin-STAG1 present at CTCF sites in NIPBL KD cells was able to form and extrude loops.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "next", "asked", ...
PMC10380508
Additionally, we performed RT-qPCR analysis to assess the expression levels of PAX genes in various RCC cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "we", "perfor...
PMC11578343
The measured i) transit time, ii) applied frequency, iii) elastic G′ modulus, and iv) viscous G″ modulus, versus zone length of MCF‐7 cells; n = 361.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10747160
Finally, although the Human Angiotensin-converting Enzyme 2 (hACE2) has been solidified as the required receptor to facilitate SARS-CoV-2 viral entry, the SARS-CoV-2 virion is known to be able to infect cells that only modestly express hACE2 .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11021472
Subsequent cell lysis was performed in the same buffer supplemented with 3 mM CaCl2 and 0.1% NP-40.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Subsequent", "cell", "lysis", "was", "...
PMC6160470
Wild-type Madin-Darby canine kidney cells type II (MDCKII-WT) and stable MDCKII transfectants overexpressing human P-glycoprotein (MDCKII-MDR1), were kindly provided by Drs.
[ { "tags": [ "O", "B-CellLine", "I-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "B-CellLine", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", ...
PMC9429973
We also found increased gene damage and increased likelihood of gene mutations in bcor mutant cells, which would promote MDS transformation into AML.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11322866
MM cells were treated with GSK126 for 24 h, and cell viability was determined by CCK-8 assay. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MM", "cells", "were", "treated", ...
PMC11752740
The RPMI 1640 medium contained sodium bicarbonate, glutamine, penicillin, and streptomycin (with concentrations of 100 units/ml of penicillin and 100 mg/ml of streptomycin), supplemented with 10% fetal bovine serum (FBS).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8345486
Nuclear magnetic resonance (NMR): The H, C, dept135 and B-NMR spectra in CDCl3, CD3OD or CD3COCD3 were recorded using a Bruker AVANCE III HD (Billerica, MA, USA) 500 MHz, a BrukerAvance DPX 250 MHz, or Varian Mercury 400 MHz spectrometer, resp.;
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11794588
konishii.
[ { "tags": [ "O", "O" ], "tokens": [ "konishii", "." ] } ]
PMC11583010
Hydrophobic interaction chromatography (HIC) was performed on an Agilent 1100 HPLC system using a TSK-GEL BUTYL-NPR 4.6 × 35 mm 2.5 μm column (Tosoh).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11021472
Cells or cell fractions were resuspended in Cell lysis buffer (Cell Signaling, Danvers, MA, USA) supplemented with 1 mM PMSF.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10243817
Further network analysis revealed that the collagen genes COL1A1, COL4A1, COL4A2, and COL5A1, were centrally located among the top 6 enriched GO terms (Figure 7C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11706776
HPRTQf: 5′- tcctcctcagaccgctttt -3′Qr: 5′- cctggttcatcatcgctaatc -3′B2MQf: 5′- ttctggcctggaggctatc -3′Qr: 5′- tcaggaaatttgactttccattc -3′ActinBQf: 5′- cgggacctgactgactacct c-3′Qr: 5′- ttcgtggatgccacagga -3′EWS-FLI1Qf: 5′- gccaagctccaagtcaatatagc -3′Qr: 5′- gaggccagaattcatgttattgc -3′KCNN1Qf: 5′- caccaaggagtctctgtactcat...
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10809689
Our results for the THP-1 cell line indicated that the concentration of Glu enhanced after 24 h of treatment with Gal-9 compared to the PMA and control group.
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11569208
and 1-part Fetal Bovine Serum (Gibco, cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "and", "1-part", "Fetal", "Bovine", "Serum", "(", "Gibco", ",", "cat", "." ] } ]
PMC9920575
They were finally ground (in a common mill), to a particle size of 2 mm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "were", "finally", "ground", "(...
PMC9268620
Apoptosis is generally defined as the suicide of a cell established in advance whereby the cell self-destructs to ensure the smooth continuity of normal body functions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10125312
The 786-0 cell line had a statistically lower uptake than A549 and HepG2.
[ { "tags": [ "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O" ], "tokens": [ "The", "786", "-", "0", "ce...
PMC10669128
While several stem cell-based models of synovial sarcoma and skeletal sarcomas have been developed, especially for the study of osteosarcoma and Ewing’s sarcoma , visceral sarcomas need to be further explored.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11279397
More than 200 recently published papers were reviewed and discussed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "More", "than", "200", "recently", "published", "papers", "were", "reviewed", "and", "discussed",...
PMC11705547
DCs are the primary APCs that initiate anti-tumor immune responses by phagocytosing and cross-presenting tumor antigens to T lymphocytes .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "DCs", "are", "the", "primary", ...
PMC11754094
We introduced a plasmid library containing three different sgRNAs per gene and the puromycin resistance gene into an engineered HeLa cell line that stably expresses deactivated Cas9 (dCas9) fused with Krüppel associated box (KRAB) domain to produce gene knockdown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6163708
Briefly, cells were seeded in NUNC (Roskilde, Denmark) chambers, 20 μM GANT61 added next day and treated (or untreated, controls) for three days, and mounted in a DAPI-containing medium.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11394227
In the experiment with the addition of BFA, the proportion of (HC-LC)2 in CHO-PAb-QS cells increased to a staggering 73.47%, while CHO-PAb cells only rose from 22.35% to 49.63%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11092418
In particular, treatment with a combination of neratinib with miransertib was accompanied by the synergistic growth inhibition of all HBCCLs (Table 4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11791264
We next performed lentivirus-mediated knockdown of SETD7 (SETD7 KD) in the A2780 cell line using SETD7-specific shRNAs or overexpression of SETD7 cDNA (SETD7 OE) in the SKOV3 cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9895440
RNA was quantified by Fluorometry using the QuantiFluor RNA System (Cat# E3310, Promega, Madison, WI, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RNA", ...
PMC9429973
Presented in Table 1.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Presented", "in", "Table", "1", "." ] } ]
PMC9429973
The B cell compartment was diminished in all alloHSCT recipients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "B", "cell", "compartment", "was", "diminished", "in", "all", "alloHSCT", "recipients", ...
PMC11732628
miR-490-3p, micro RNA-490-3p; STRING, Search Tool for the Retrieval of Interacting Genes/Proteins; NC, negative control; ns, no significance.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10571053
Fumitremorgin C (FTC, > 95% purity) was synthesized in-house by the Developmental Therapeutics Program at the National Institutes of Health (Bethesda, MD).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6267596
We plated 8n-polyploid cells in 50 μm microwells to facilitate single cell imaging at 20-minute intervals and tracking these cells over a period of 48 hours.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11799620
Several researchers confirm the ability of natural phenolic compounds to treat several acute and chronic damages in animals (Athmouni et al., 2018a; Waqas et al. 2023).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Image: Summary/Conclusion: Our results showed that TH17/Treg balance is impaired, revealing a predominant proinflammatory state in in MDS Low risk patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC10203589
Thus, FGF18 can inhibit the progression of ccRCC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "FGF18", "can", "inhibit", "the", "progression", "of", "ccRCC", "." ] } ]
PMC9429973
39 were diffuse large B-cell lymphoma (DLBCL), 1 was Hodgkin lymphoma (HL) and 3 were composite lymphomas (2 DLBCL/HL, 1 DLBCL/follicular lymphoma).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11155445
Compounds (159a and 159d) with LC50 values 145.90 and 148.56 ppm showed comparable activity to that of Lufenuron with LC50 values 103.12 ppm against 4th larvae of insect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11541409
Clinical trials (NCT02452424, NCT01316263) evaluating antibody targeting (CSF1R + PD-1, PDGFRAα) in patients with advanced GIST were terminated due to limited efficacy or poor accrual.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7192625
As the resolution of our datasets improves, the need for new genome visualization options is apparent.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "the", "resolution", "of", "our", "dat...
PMC10237474
Briefly, Protein A biosensors (cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "Protein", "A", "biosensors", "(", "cat", "." ] } ]
PMC11323699
Labeled TSP-1 (10 nmol) was incubated for 20 min at room temperature in the dark with a serial dilution testing series of TAX2 peptide (from 2.5 × 10 M to 7.63 × 10 M) in PBS, 0.1% Tween 20.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11462673
C Potential core transcriptional regulatory circuitry were constructed by analyzing H3K27ac ChIP data from T-ALL patient samples.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C", "Potential", "core", "transcriptional", "regu...
PMC11687167
Study of the efficacy and safety of MK-0616 in adults with hypercholesterolemia1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Study", "of", "the", "efficacy", "and", "safety", "of", "MK-0616", "in", "...
PMC10454535
The membrane was visualized on the Odyssey CLx Imaging System (LI-COR Biosciences, Lincoln, NE, USA), and intensity of protein bands was quantified using Image Studio Version 5.2 (LI-COR Biosciences).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11380329
Artepillin C and caffeic acid, which were identified in our study only in the Fre P, are among the major anti-cancer ingredients of propolis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10213199
Cilbn.),
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Cilbn", ".", ")", "," ] } ]
PMC10723784
Ac‐DEVD‐AMC generates the AMC fluorophore in the presence of caspase 3/7, which produces bright blue fluorescence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ac‐DEVD‐AMC", "generates", "the", "AMC", "fluorop...
PMC11755519
In addition, increased expression levels of ErbB2 and ErbB3 were observed in 5637 cells treated with EVs from UM-UC-3.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "O" ], "tokens": [ "In", "addition",...
PMC11612315
ANOVA analysis of variance, BCTC N-(4-tertiarybutylphenyl)-4-(3-cholorphyridin-2-yl) tetrahydropyrazine-1(2H)-carboxamide, CAP capsaicin, CHO K1 Chinese hamster ovary, GLP-1 glucagon-like peptide-1, S.E.M. standard error of the mean, TRPV1 transient receptor potential vanilloid 1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11760643
Finally, to determine if the anti‐P2X7 mAb could inhibit the P2X7‐mediated Ca response, Fura‐2 AM loaded HEK‐P2X7 cells were preincubated with increasing concentrations of the anti‐P2X7 or isotype control mAb, and then incubated with 760 µM ATP, approximate to the EC50 obtained above (Figure 1D,E).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", ...
PMC11413393
CPT = camptothecin.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "CPT", "=", "camptothecin", "." ] } ]
PMC11687167
PCSK9 physically binds to MHC-I to promote lysosomal degradation in tumor cells, decreasing the presentation of MHC-I on the cell surface and promoting immune escape from the tumor.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740573
Their activation induces synthesis of 1α-hydroxylase, which acts on 25-hydroxyvitamin D to generate intracellular calcitriol (1,25-dihydroxy-vitamin D3), the most active metabolite of vitamin D. Calcitriol turns on its receptor and enhances the synthesis of important human antibiotics such as cathelicidin and β-2 defen...
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9250505
Inhibition of BADS99 phosphorylation synergizes with Olaparib to suppress the xenograft growth of platinum-sensitive and resistant EOC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Inhibition", "of", "BADS99", "phosphorylation", "...
PMC11609529
The same cells were stained with DAPI to label the nuclei (bottom).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "same", "cells", "were", "stained", "with", "DAPI", "to", ...
PMC9688728
Another interesting example of differences in pathway analysis is the Warburg effect , highlighted when searching against the background of SMPDB.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Another", "interesting"...
PMC11011020
The cell line data shows good reproducibility of our assay (% RSD of <4.25% for n = 3) for the inter-assay signals for analysing DNA methylation levels in the ovarian cancer cell line without prior amplification or pre-treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11653533
Specifically, traditionally, roots that are carried in the air are useful in cases of osteomalacia of the limbs, leucorrhoea, hyperpiesia, diabetes, enuresis, ulcers, skin diseases, gonorrhea, hyperpiesia, hyperpiesis, hemorrhages, diarrhea, dysentery, and stubborn spitting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11761919
This results in the formation of self-assembled spherical phthaloyl inulin nanoparticles (PINs).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "results", "in", "the", "formation", "of", "self-assembled", ...
PMC9429973
Early mortality was related to infection in 2 patients and progression in another.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Early", "mortality", "was", "related", "to", "infection", "in", "2", ...
PMC9545474
After five hours of drug exposure, we observed a significant increase of ROS levels in treated cells compared to untreated cells (Figure 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973
Among them, mean initial DIs were 94%, 83%, 71%, and 66% (P <0.0001) (Figure); mean RDIs were 89%, 75%, 59%, and 48% (P <0.0001); incidences of unplanned hospitalization were 10%, 16%, 22%, 44% (P = 0.03845); incidences of FN were 7%, 9%, 16%, and 28% (P = 0.1712); and incidences of TRM were 0%, 0%, 2%, and 17% (P = 0....
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11240448
The different activation patterns of the core network components, which control a cell-wide network, are determined by the quantitative topology (in other words, circuitry) of the core network .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10965680
Furthermore, low inbreeding indicates higher levels of heterozygosity, which are more linked to genetic variation and improved adaptability to harsh environmental situations (Makina et al., 2015a; Abondio et al., 2022).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3734024
As expected, CD3 T cells accounted for most of the remaining FasL splenocytes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "expected", ",", "CD3", "T", "cells", "accounted", "for", ...
PMC9164404
However, at the same concentration, cisplatin and CisPt(IV) only induced an apoptosis rate of 11.1% and 38.9%, respectively (Additional file 1: Fig. S5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10165258
The successful adaptation of such 3D culture approaches for anti-cancer drug testing has become a powerful tool to better depict responses to currently used chemotherapies, novel immunotherapies, and in drug resistance studies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11674834
For all samples, protein concentrations of cell lysates were determined using the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA, catalog number: 5000006), and activity was calculated in nmoles of acetylated product/mL/min/mg protein.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10652261
Found: 421.1852.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Found", ":", "421.1852", "." ] } ]
PMC11185260
However, combining radiation and scL-vec did not improve the antitumor response (10.3-fold increase from the initial volume) compared to radiation alone.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11472569
Despite recent advances in understanding EVs, it remains challenging to isolate specific EV classes due to technical limitations in purification and isolation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite...
PMC9268183
Over the last 30 years of ethnobotanical prospection across the Catalan linguistic area, we have gathered information on folk plant uses related to cancer for 41 plant species, including references to curative, palliative or preventative purposes (Table 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10956161
Demographic and clinical data for patients with lung adenocarcinoma patients (n = 25) who were enrolled at the Fourth Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu Province, China.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Amino acids support multiple aspects of cell metabolism, ranging from precursors of nucleic acids, conversion to glucose and/or lipids, stimulation of the mTOR signaling pathway, production of TCA cycle intermediates, and maintenance of intracellular redox, amongst others.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11604830
The scale bar corresponds to 200 μm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "scale", "bar", "corresponds", "to", "200", "μm", "." ] } ]
PMC11768927
These factors suppress the activation and function of effector immune cells, limiting the immune system’s capacity to recognize and eliminate VSV-infected tumor cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973
During induction, the majority of the patients (90%) had AT3 and fibrinogen repletion, while only 10% received additional prophylactic anticoagulation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11599565
Of note is the tendency of EpCAM cells to generate clusters similar to organoids.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Of", "note", "is", "the", "tendency", "of", "EpCAM", "cells", ...