PMCID string | Sentences string | ner list |
|---|---|---|
PMC11023271 | LPA has been shown extensively to play pleotropic roles in biological processes, including angiogenesis, cell proliferation and migration, and contributes to a variety of diseases such as cancer, wound healing, and neurological impairments . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11615743 | To the best of our knowledge, there are a few DNA logic‐gate‐based methods that can accurately identify and isolate target cells in a serum‐containing environment or biological fluid. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11673902 | Cell swelling: electroporation temporarily disrupts the cell membrane, allowing water and small molecules to enter the cell, resulting in an increase in cell size.iii. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11295144 | Active presynaptic terminals were visualized with the Cy5-labeled anti-synaptotagmin luminal domain-specific antibody (cyan), while all presynaptic terminals were visualized with an anti-VGAT-specific antibody (blue). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Patients with cutaneous hemorrhagic syndrome were included in the Group №1, and those without cutaneous hemorrhages in the Group №2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Patient... |
PMC9429973 | No significant differences were observed in patients in the Int-fit group who experienced chemotherapy AEs, treatment discontinuation, and TTP compared with the Fit group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC8143558 | Eucalyptus camaldulensis Dehnh was the only plant in this review that was classified as a Near Threatened (NT) species. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Eucalyptus",
"camaldule... |
PMC9429973 | Study shows that the rates of complete remission(CR),five-year OS,five-year PFS were significantly lower for the non-GCB subtype(77.5% vs 52.6%,78% vs 54%,76% vs 48%).Patients who failed in initial treatment had poor prognosis and short overall survival. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11591052 | Asterisks indicate a significant difference in protein expression (* p ≤ 0.05; ** p ≤ 0.01; n.s.—non-significant). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11746948 | once every three days). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"once",
"every",
"three",
"days",
")",
"."
]
}
] |
PMC9429973 | 75%(9/12) patients with MYD88L265P mutation, 33%(1/3) patients with CXCR4 mutation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"75%(9/12",
")",
"patients",
"with",
"MYD88L265P",
"mutation",
",",
"33%(1/3... |
PMC9429973 | Moreover, the involvement of c-Fos in miR-181a/b transcription during Ibrutinib is still not clear. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"the",
"involvement",
"of",
"c-Fos",
"in",
... |
PMC10142392 | This type of nanoparticle allowed for the improvement of the solubility of lipophilic drugs that are poorly soluble in water, as well as an increase in their efficacy and bioavailability . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11361748 | These findings show that induced K17 in TPA-primed epidermal keratinocytes plays a significant role in the early amplification of the neutrophil influx induced by repeated stresses to skin. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11487720 | Our study concerns the severity of frostbite and UV irradiation in the polar regions and even outer space . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"study",
"concerns",
"the",
"sev... |
PMC9429973 | The STR-PCR was detected on + 30d, + 60d, + 90d, + 180d and + 270d respectively to evaluate the evidence of implantation and the chimeric body showed complete chimerism after transplantation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11495567 | . | [
{
"tags": [
"O"
],
"tokens": [
"."
]
}
] |
PMC5941560 | Fortunately, the targeted sequencing study found the stop codon on one allele and the 47 bp deletion on the others, both of which should block the production of a full length INPP5D transcript. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7215832 | Indeed RX-3117 induces some cell cycle proteins (e.g., CHK2 and cdc25), with an arrest in the S and G2M phase), but whether this is related to DNMT1 down-regulation is unlikely because of the different time-span. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10719213 | Cladribine tablets are a treatment for multiple sclerosis with effects on lymphocytes, yet its mode of action has not been fully established. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cladrib... |
PMC10006224 | We next asked if cohesin-STAG1 present at CTCF sites in NIPBL KD cells was able to form and extrude loops. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"next",
"asked",
... |
PMC10380508 | Additionally, we performed RT-qPCR analysis to assess the expression levels of PAX genes in various RCC cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additionally",
",",
"we",
"perfor... |
PMC11578343 | The measured i) transit time, ii) applied frequency, iii) elastic G′ modulus, and iv) viscous G″ modulus, versus zone length of MCF‐7 cells; n = 361. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10747160 | Finally, although the Human Angiotensin-converting Enzyme 2 (hACE2) has been solidified as the required receptor to facilitate SARS-CoV-2 viral entry, the SARS-CoV-2 virion is known to be able to infect cells that only modestly express hACE2 . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11021472 | Subsequent cell lysis was performed in the same buffer supplemented with 3 mM CaCl2 and 0.1% NP-40. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Subsequent",
"cell",
"lysis",
"was",
"... |
PMC6160470 | Wild-type Madin-Darby canine kidney cells type II (MDCKII-WT) and stable MDCKII transfectants overexpressing human P-glycoprotein (MDCKII-MDR1), were kindly provided by Drs. | [
{
"tags": [
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
... |
PMC9429973 | We also found increased gene damage and increased likelihood of gene mutations in bcor mutant cells, which would promote MDS transformation into AML. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11322866 | MM cells were treated with GSK126 for 24 h, and cell viability was determined by CCK-8 assay. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"MM",
"cells",
"were",
"treated",
... |
PMC11752740 | The RPMI 1640 medium contained sodium bicarbonate, glutamine, penicillin, and streptomycin (with concentrations of 100 units/ml of penicillin and 100 mg/ml of streptomycin), supplemented with 10% fetal bovine serum (FBS). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8345486 | Nuclear magnetic resonance (NMR): The H, C, dept135 and B-NMR spectra in CDCl3, CD3OD or CD3COCD3 were recorded using a Bruker AVANCE III HD (Billerica, MA, USA) 500 MHz, a BrukerAvance DPX 250 MHz, or Varian Mercury 400 MHz spectrometer, resp.; | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11794588 | konishii. | [
{
"tags": [
"O",
"O"
],
"tokens": [
"konishii",
"."
]
}
] |
PMC11583010 | Hydrophobic interaction chromatography (HIC) was performed on an Agilent 1100 HPLC system using a TSK-GEL BUTYL-NPR 4.6 × 35 mm 2.5 μm column (Tosoh). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11021472 | Cells or cell fractions were resuspended in Cell lysis buffer (Cell Signaling, Danvers, MA, USA) supplemented with 1 mM PMSF. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC10243817 | Further network analysis revealed that the collagen genes COL1A1, COL4A1, COL4A2, and COL5A1, were centrally located among the top 6 enriched GO terms (Figure 7C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11706776 | HPRTQf: 5′- tcctcctcagaccgctttt -3′Qr: 5′- cctggttcatcatcgctaatc -3′B2MQf: 5′- ttctggcctggaggctatc -3′Qr: 5′- tcaggaaatttgactttccattc -3′ActinBQf: 5′- cgggacctgactgactacct c-3′Qr: 5′- ttcgtggatgccacagga -3′EWS-FLI1Qf: 5′- gccaagctccaagtcaatatagc -3′Qr: 5′- gaggccagaattcatgttattgc -3′KCNN1Qf: 5′- caccaaggagtctctgtactcat... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10809689 | Our results for the THP-1 cell line indicated that the concentration of Glu enhanced after 24 h of treatment with Gal-9 compared to the PMA and control group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11569208 | and 1-part Fetal Bovine Serum (Gibco, cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"and",
"1-part",
"Fetal",
"Bovine",
"Serum",
"(",
"Gibco",
",",
"cat",
"."
]
}
] |
PMC9920575 | They were finally ground (in a common mill), to a particle size of 2 mm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"They",
"were",
"finally",
"ground",
"(... |
PMC9268620 | Apoptosis is generally defined as the suicide of a cell established in advance whereby the cell self-destructs to ensure the smooth continuity of normal body functions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10125312 | The 786-0 cell line had a statistically lower uptake than A549 and HepG2. | [
{
"tags": [
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O"
],
"tokens": [
"The",
"786",
"-",
"0",
"ce... |
PMC10669128 | While several stem cell-based models of synovial sarcoma and skeletal sarcomas have been developed, especially for the study of osteosarcoma and Ewing’s sarcoma , visceral sarcomas need to be further explored. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11279397 | More than 200 recently published papers were reviewed and discussed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"More",
"than",
"200",
"recently",
"published",
"papers",
"were",
"reviewed",
"and",
"discussed",... |
PMC11705547 | DCs are the primary APCs that initiate anti-tumor immune responses by phagocytosing and cross-presenting tumor antigens to T lymphocytes . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"DCs",
"are",
"the",
"primary",
... |
PMC11754094 | We introduced a plasmid library containing three different sgRNAs per gene and the puromycin resistance gene into an engineered HeLa cell line that stably expresses deactivated Cas9 (dCas9) fused with Krüppel associated box (KRAB) domain to produce gene knockdown. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6163708 | Briefly, cells were seeded in NUNC (Roskilde, Denmark) chambers, 20 μM GANT61 added next day and treated (or untreated, controls) for three days, and mounted in a DAPI-containing medium. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11394227 | In the experiment with the addition of BFA, the proportion of (HC-LC)2 in CHO-PAb-QS cells increased to a staggering 73.47%, while CHO-PAb cells only rose from 22.35% to 49.63%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11092418 | In particular, treatment with a combination of neratinib with miransertib was accompanied by the synergistic growth inhibition of all HBCCLs (Table 4). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11791264 | We next performed lentivirus-mediated knockdown of SETD7 (SETD7 KD) in the A2780 cell line using SETD7-specific shRNAs or overexpression of SETD7 cDNA (SETD7 OE) in the SKOV3 cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9895440 | RNA was quantified by Fluorometry using the QuantiFluor RNA System (Cat# E3310, Promega, Madison, WI, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RNA",
... |
PMC9429973 | Presented in Table 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Presented",
"in",
"Table",
"1",
"."
]
}
] |
PMC9429973 | The B cell compartment was diminished in all alloHSCT recipients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"B",
"cell",
"compartment",
"was",
"diminished",
"in",
"all",
"alloHSCT",
"recipients",
... |
PMC11732628 | miR-490-3p, micro RNA-490-3p; STRING, Search Tool for the Retrieval of Interacting Genes/Proteins; NC, negative control; ns, no significance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10571053 | Fumitremorgin C (FTC, > 95% purity) was synthesized in-house by the Developmental Therapeutics Program at the National Institutes of Health (Bethesda, MD). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6267596 | We plated 8n-polyploid cells in 50 μm microwells to facilitate single cell imaging at 20-minute intervals and tracking these cells over a period of 48 hours. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11799620 | Several researchers confirm the ability of natural phenolic compounds to treat several acute and chronic damages in animals (Athmouni et al., 2018a; Waqas et al. 2023). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Image: Summary/Conclusion: Our results showed that TH17/Treg balance is impaired, revealing a predominant proinflammatory state in in MDS Low risk patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC10203589 | Thus, FGF18 can inhibit the progression of ccRCC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"FGF18",
"can",
"inhibit",
"the",
"progression",
"of",
"ccRCC",
"."
]
}
] |
PMC9429973 | 39 were diffuse large B-cell lymphoma (DLBCL), 1 was Hodgkin lymphoma (HL) and 3 were composite lymphomas (2 DLBCL/HL, 1 DLBCL/follicular lymphoma). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11155445 | Compounds (159a and 159d) with LC50 values 145.90 and 148.56 ppm showed comparable activity to that of Lufenuron with LC50 values 103.12 ppm against 4th larvae of insect. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11541409 | Clinical trials (NCT02452424, NCT01316263) evaluating antibody targeting (CSF1R + PD-1, PDGFRAα) in patients with advanced GIST were terminated due to limited efficacy or poor accrual. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7192625 | As the resolution of our datasets improves, the need for new genome visualization options is apparent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"As",
"the",
"resolution",
"of",
"our",
"dat... |
PMC10237474 | Briefly, Protein A biosensors (cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Briefly",
",",
"Protein",
"A",
"biosensors",
"(",
"cat",
"."
]
}
] |
PMC11323699 | Labeled TSP-1 (10 nmol) was incubated for 20 min at room temperature in the dark with a serial dilution testing series of TAX2 peptide (from 2.5 × 10 M to 7.63 × 10 M) in PBS, 0.1% Tween 20. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11462673 | C Potential core transcriptional regulatory circuitry were constructed by analyzing H3K27ac ChIP data from T-ALL patient samples. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"C",
"Potential",
"core",
"transcriptional",
"regu... |
PMC11687167 | Study of the efficacy and safety of MK-0616 in adults with hypercholesterolemia1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Study",
"of",
"the",
"efficacy",
"and",
"safety",
"of",
"MK-0616",
"in",
"... |
PMC10454535 | The membrane was visualized on the Odyssey CLx Imaging System (LI-COR Biosciences, Lincoln, NE, USA), and intensity of protein bands was quantified using Image Studio Version 5.2 (LI-COR Biosciences). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11380329 | Artepillin C and caffeic acid, which were identified in our study only in the Fre P, are among the major anti-cancer ingredients of propolis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10213199 | Cilbn.), | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Cilbn",
".",
")",
","
]
}
] |
PMC10723784 | Ac‐DEVD‐AMC generates the AMC fluorophore in the presence of caspase 3/7, which produces bright blue fluorescence. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Ac‐DEVD‐AMC",
"generates",
"the",
"AMC",
"fluorop... |
PMC11755519 | In addition, increased expression levels of ErbB2 and ErbB3 were observed in 5637 cells treated with EVs from UM-UC-3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O"
],
"tokens": [
"In",
"addition",... |
PMC11612315 | ANOVA analysis of variance, BCTC N-(4-tertiarybutylphenyl)-4-(3-cholorphyridin-2-yl) tetrahydropyrazine-1(2H)-carboxamide, CAP capsaicin, CHO K1 Chinese hamster ovary, GLP-1 glucagon-like peptide-1, S.E.M. standard error of the mean, TRPV1 transient receptor potential vanilloid 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11760643 | Finally, to determine if the anti‐P2X7 mAb could inhibit the P2X7‐mediated Ca response, Fura‐2 AM loaded HEK‐P2X7 cells were preincubated with increasing concentrations of the anti‐P2X7 or isotype control mAb, and then incubated with 760 µM ATP, approximate to the EC50 obtained above (Figure 1D,E). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11413393 | CPT = camptothecin. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"CPT",
"=",
"camptothecin",
"."
]
}
] |
PMC11687167 | PCSK9 physically binds to MHC-I to promote lysosomal degradation in tumor cells, decreasing the presentation of MHC-I on the cell surface and promoting immune escape from the tumor. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11740573 | Their activation induces synthesis of 1α-hydroxylase, which acts on 25-hydroxyvitamin D to generate intracellular calcitriol (1,25-dihydroxy-vitamin D3), the most active metabolite of vitamin D. Calcitriol turns on its receptor and enhances the synthesis of important human antibiotics such as cathelicidin and β-2 defen... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9250505 | Inhibition of BADS99 phosphorylation synergizes with Olaparib to suppress the xenograft growth of platinum-sensitive and resistant EOC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Inhibition",
"of",
"BADS99",
"phosphorylation",
"... |
PMC11609529 | The same cells were stained with DAPI to label the nuclei (bottom). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"same",
"cells",
"were",
"stained",
"with",
"DAPI",
"to",
... |
PMC9688728 | Another interesting example of differences in pathway analysis is the Warburg effect , highlighted when searching against the background of SMPDB. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Another",
"interesting"... |
PMC11011020 | The cell line data shows good reproducibility of our assay (% RSD of <4.25% for n = 3) for the inter-assay signals for analysing DNA methylation levels in the ovarian cancer cell line without prior amplification or pre-treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11653533 | Specifically, traditionally, roots that are carried in the air are useful in cases of osteomalacia of the limbs, leucorrhoea, hyperpiesia, diabetes, enuresis, ulcers, skin diseases, gonorrhea, hyperpiesia, hyperpiesis, hemorrhages, diarrhea, dysentery, and stubborn spitting. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11761919 | This results in the formation of self-assembled spherical phthaloyl inulin nanoparticles (PINs). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"results",
"in",
"the",
"formation",
"of",
"self-assembled",
... |
PMC9429973 | Early mortality was related to infection in 2 patients and progression in another. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Early",
"mortality",
"was",
"related",
"to",
"infection",
"in",
"2",
... |
PMC9545474 | After five hours of drug exposure, we observed a significant increase of ROS levels in treated cells compared to untreated cells (Figure 6). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC9429973 | Among them, mean initial DIs were 94%, 83%, 71%, and 66% (P <0.0001) (Figure); mean RDIs were 89%, 75%, 59%, and 48% (P <0.0001); incidences of unplanned hospitalization were 10%, 16%, 22%, 44% (P = 0.03845); incidences of FN were 7%, 9%, 16%, and 28% (P = 0.1712); and incidences of TRM were 0%, 0%, 2%, and 17% (P = 0.... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11240448 | The different activation patterns of the core network components, which control a cell-wide network, are determined by the quantitative topology (in other words, circuitry) of the core network . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10965680 | Furthermore, low inbreeding indicates higher levels of heterozygosity, which are more linked to genetic variation and improved adaptability to harsh environmental situations (Makina et al., 2015a; Abondio et al., 2022). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC3734024 | As expected, CD3 T cells accounted for most of the remaining FasL splenocytes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"As",
"expected",
",",
"CD3",
"T",
"cells",
"accounted",
"for",
... |
PMC9164404 | However, at the same concentration, cisplatin and CisPt(IV) only induced an apoptosis rate of 11.1% and 38.9%, respectively (Additional file 1: Fig. S5). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10165258 | The successful adaptation of such 3D culture approaches for anti-cancer drug testing has become a powerful tool to better depict responses to currently used chemotherapies, novel immunotherapies, and in drug resistance studies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11674834 | For all samples, protein concentrations of cell lysates were determined using the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA, catalog number: 5000006), and activity was calculated in nmoles of acetylated product/mL/min/mg protein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10652261 | Found: 421.1852. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Found",
":",
"421.1852",
"."
]
}
] |
PMC11185260 | However, combining radiation and scL-vec did not improve the antitumor response (10.3-fold increase from the initial volume) compared to radiation alone. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11472569 | Despite recent advances in understanding EVs, it remains challenging to isolate specific EV classes due to technical limitations in purification and isolation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Despite... |
PMC9268183 | Over the last 30 years of ethnobotanical prospection across the Catalan linguistic area, we have gathered information on folk plant uses related to cancer for 41 plant species, including references to curative, palliative or preventative purposes (Table 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10956161 | Demographic and clinical data for patients with lung adenocarcinoma patients (n = 25) who were enrolled at the Fourth Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu Province, China. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Amino acids support multiple aspects of cell metabolism, ranging from precursors of nucleic acids, conversion to glucose and/or lipids, stimulation of the mTOR signaling pathway, production of TCA cycle intermediates, and maintenance of intracellular redox, amongst others. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11604830 | The scale bar corresponds to 200 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"scale",
"bar",
"corresponds",
"to",
"200",
"μm",
"."
]
}
] |
PMC11768927 | These factors suppress the activation and function of effector immune cells, limiting the immune system’s capacity to recognize and eliminate VSV-infected tumor cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9429973 | During induction, the majority of the patients (90%) had AT3 and fibrinogen repletion, while only 10% received additional prophylactic anticoagulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11599565 | Of note is the tendency of EpCAM cells to generate clusters similar to organoids. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Of",
"note",
"is",
"the",
"tendency",
"of",
"EpCAM",
"cells",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.