Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11612626
C, Patient multiple myeloma CD138 cells were treated with compound A followed by co-culturing with CD8 patient-derived autologous T cells (E:T = 2:1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C", ",", "Patient", "multiple", "myeloma", "CD138", "cells", "were", "treated", "with", "compound", "A", "followed", "by", "co-culturing", "with", "CD8", "patient-derived", "autologous", "T", "cells", "(", "E", ":", "T", "=", "2:1", ")", "." ] } ]
PMC11247842
Pleiotropic effects on mastitis and milk production have also been reported for the BTA6 QTL (GC CNV region) in several breeds .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Pleiotropic", "effects", "on", "mastitis", "and", "milk", "production", "have", "also", "been", "reported", "for", "the", "BTA6", "QTL", "(", "GC", "CNV", "region", ")", "in", "several", "breeds", "." ] } ]
PMC11765243
The following oligonucleotides were used: Cre 5′FW: GATGCAACGAGTGATGAGGT Cre 5′RV: GCATTGCTGTCACTTGGTCGT β-tubulin 5′-FW: GCCAGAGTGGTGCAGGAAATA β-tubulin 5′RV: TCACCACGTCCAGGACAGAGT Antibodies used in tissue culture, flow cytometry, Ig ELISA, and immunoblot are listed in Table S1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "following", "oligonucleotides", "were", "used", ":", "Cre", "5′FW", ":", "GATGCAACGAGTGATGAGGT", "Cre", "5′RV", ":", "GCATTGCTGTCACTTGGTCGT", "β-tubulin", "5′-FW", ":", "GCCAGAGTGGTGCAGGAAATA", "β-tubulin", "5′RV", ":", "TCACCACGTCCAGGACAGAGT", "Antibodies", "used", "in", "tissue", "culture", ",", "flow", "cytometry", ",", "Ig", "ELISA", ",", "and", "immunoblot", "are", "listed", "in", "Table", "S1", "." ] } ]
PMC11684269
To thoroughly explore T cell heterogeneity between AKI and CKD, a study adopted 2 established murine models of kidney regeneration and fibrosis, founding that Tregs preferentially accumulate in fibrotic mouse kidneys to limit initial inflammation and cellular injury (137).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "thoroughly", "explore", "T", "cell", "heterogeneity", "between", "AKI", "and", "CKD", ",", "a", "study", "adopted", "2", "established", "murine", "models", "of", "kidney", "regeneration", "and", "fibrosis", ",", "founding", "that", "Tregs", "preferentially", "accumulate", "in", "fibrotic", "mouse", "kidneys", "to", "limit", "initial", "inflammation", "and", "cellular", "injury", "(", "137", ")", "." ] } ]
PMC9918897
Sample and study solution preparation and in vitro plasma antioxidant-capacity measurements were performed at the Laboratory of Food Chemistry, Faculty of Health Sciences, Semmelweis University, Hungary.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sample", "and", "study", "solution", "preparation", "and", "in", "vitro", "plasma", "antioxidant-capacity", "measurements", "were", "performed", "at", "the", "Laboratory", "of", "Food", "Chemistry", ",", "Faculty", "of", "Health", "Sciences", ",", "Semmelweis", "University", ",", "Hungary", "." ] } ]
PMC11437637
Analysis revealed significant differences in the numbers of total lymphocytes, CD3+, CD4+T, CD8+T, and double-positive T cells, as well as in the ratios of Th1/CD4+T and Th1/Th2 between patients with EC and those with uterine fibroids (P < 0.05, Table 4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Analysis", "revealed", "significant", "differences", "in", "the", "numbers", "of", "total", "lymphocytes", ",", "CD3", "+", ",", "CD4+T", ",", "CD8+T", ",", "and", "double-positive", "T", "cells", ",", "as", "well", "as", "in", "the", "ratios", "of", "Th1/CD4+T", "and", "Th1/Th2", "between", "patients", "with", "EC", "and", "those", "with", "uterine", "fibroids", "(", "P", "<", "0.05", ",", "Table", "4", ")", "." ] } ]
PMC10656496
Our model is composed of cell lines with extensive RNAseq and copy number characterization which will be deposited in public databases to explore correlations between agents and molecular changes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "model", "is", "composed", "of", "cell", "lines", "with", "extensive", "RNAseq", "and", "copy", "number", "characterization", "which", "will", "be", "deposited", "in", "public", "databases", "to", "explore", "correlations", "between", "agents", "and", "molecular", "changes", "." ] } ]
PMC9429973
Hematological and non-hematological adverse events were reported in 75.9% and 17.2% of patients, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hematological", "and", "non-hematological", "adverse", "events", "were", "reported", "in", "75.9", "%", "and", "17.2", "%", "of", "patients", ",", "respectively", "." ] } ]
PMC11739696
The tumor cells can avoid apoptosis through a loss of balance between anti- and pro-apoptotic proteins, reduced caspase function and impaired death receptor signaling.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tumor", "cells", "can", "avoid", "apoptosis", "through", "a", "loss", "of", "balance", "between", "anti-", "and", "pro-apoptotic", "proteins", ",", "reduced", "caspase", "function", "and", "impaired", "death", "receptor", "signaling", "." ] } ]
PMC10969097
Each 15 g mushroom powder sample was extracted in 200 mL of solvent using ultrasound for 60 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Each", "15", "g", "mushroom", "powder", "sample", "was", "extracted", "in", "200", "mL", "of", "solvent", "using", "ultrasound", "for", "60", "min", "." ] } ]
PMC9429973
Biallelic inactivation of TP53, included in the definition of double-hit (DH) MM, entails an ominous prognosis, although is present in less than 5% of newly diagnosed MM (NDMM).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Biallelic", "inactivation", "of", "TP53", ",", "included", "in", "the", "definition", "of", "double-hit", "(", "DH", ")", "MM", ",", "entails", "an", "ominous", "prognosis", ",", "although", "is", "present", "in", "less", "than", "5", "%", "of", "newly", "diagnosed", "MM", "(", "NDMM", ")", "." ] } ]
PMC10218459
Cells were first incubated for 24 h before being treated with various concentrations of the cytostatic drugs DMSO (control).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "first", "incubated", "for", "24", "h", "before", "being", "treated", "with", "various", "concentrations", "of", "the", "cytostatic", "drugs", "DMSO", "(", "control", ")", "." ] } ]
PMC11401350
To prevent CAR T cell fratricide, we used CD8-targeted LVs for CAR delivery.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "prevent", "CAR", "T", "cell", "fratricide", ",", "we", "used", "CD8-targeted", "LVs", "for", "CAR", "delivery", "." ] } ]
PMC6190245
Gudarzi et al. also showed that ethanolic extract of F. gummosa seeds induce apoptosis in BHY (human oral squamous cell carcinoma) cell line (Gudarzi et al., 2015 ▶).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Gudarzi", "et", "al.", "also", "showed", "that", "ethanolic", "extract", "of", "F.", "gummosa", "seeds", "induce", "apoptosis", "in", "BHY", "(", "human", "oral", "squamous", "cell", "carcinoma", ")", "cell", "line", "(", "Gudarzi", "et", "al.", ",", "2015", "▶", ")", "." ] } ]
PMC11119602
TG2 is also involved in the homeostasis of the actin cytoskeleton, the regulation of which is essential for proper intracellular trafficking of autophagic vesicles and their fusion with lysosomes .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "TG2", "is", "also", "involved", "in", "the", "homeostasis", "of", "the", "actin", "cytoskeleton", ",", "the", "regulation", "of", "which", "is", "essential", "for", "proper", "intracellular", "trafficking", "of", "autophagic", "vesicles", "and", "their", "fusion", "with", "lysosomes", "." ] } ]
PMC9429973
Methods: Four patients with intestinal aGVHD and four healthy volunteers were invited to have peripheral blood drawn early in the morning on an empty stomach.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Methods", ":", "Four", "patients", "with", "intestinal", "aGVHD", "and", "four", "healthy", "volunteers", "were", "invited", "to", "have", "peripheral", "blood", "drawn", "early", "in", "the", "morning", "on", "an", "empty", "stomach", "." ] } ]
PMC11699465
Photos are taken by confocal microscopy.(C) 3D images of nuclear TMEM199, taken and reconstructed by Confocal Microscopy.(D) Immunofluorescence assay to show the flag signal location when cells exogenously expressed TMEM-Flag protein.(E) Live cell imaging to show the GFP signal in HEK293 cells with TMEM199-GFP plasmid transfection.(F) Western blotting assay shows the cellular fracture TMEM199 containing content.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Photos", "are", "taken", "by", "confocal", "microscopy.(C", ")", "3D", "images", "of", "nuclear", "TMEM199", ",", "taken", "and", "reconstructed", "by", "Confocal", "Microscopy.(D", ")", "Immunofluorescence", "assay", "to", "show", "the", "flag", "signal", "location", "when", "cells", "exogenously", "expressed", "TMEM-Flag", "protein.(E", ")", "Live", "cell", "imaging", "to", "show", "the", "GFP", "signal", "in", "HEK293", "cells", "with", "TMEM199-GFP", "plasmid", "transfection.(F", ")", "Western", "blotting", "assay", "shows", "the", "cellular", "fracture", "TMEM199", "containing", "content", "." ] } ]
PMC9777812
The full-length CDKN1A 3′UTR sequence was transfected into HEK293 cells (Procell, Hubei, China).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "full-length", "CDKN1A", "3′UTR", "sequence", "was", "transfected", "into", "HEK293", "cells", "(", "Procell", ",", "Hubei", ",", "China", ")", "." ] } ]
PMC11711663
Table 2 presents a detailed list of these 17 features grouped by their respective families.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Table", "2", "presents", "a", "detailed", "list", "of", "these", "17", "features", "grouped", "by", "their", "respective", "families", "." ] } ]
PMC6892818
Others reported that in primary RCC cultures stimulation of CD40 by soluble agonists caused proliferation and enhanced cell motility.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Others", "reported", "that", "in", "primary", "RCC", "cultures", "stimulation", "of", "CD40", "by", "soluble", "agonists", "caused", "proliferation", "and", "enhanced", "cell", "motility", "." ] } ]
PMC10606998
The irradiated Caco-2 cells incubated with citrate-coated SPIONs increased ROS concentration by 388% and, with malate-coated SPIONs, by 369% relative to the unirradiated cells.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "irradiated", "Caco-2", "cells", "incubated", "with", "citrate-coated", "SPIONs", "increased", "ROS", "concentration", "by", "388", "%", "and", ",", "with", "malate-coated", "SPIONs", ",", "by", "369", "%", "relative", "to", "the", "unirradiated", "cells", "." ] } ]
PMC9429973
As far as histological features are concerned, follicular lymphoma was the most frequent one (35%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "far", "as", "histological", "features", "are", "concerned", ",", "follicular", "lymphoma", "was", "the", "most", "frequent", "one", "(", "35", "%", ")", "." ] } ]
PMC10203589
In exploring growth inhibitory factors in SS, ERK phosphorylation was completely inhibited after inhibition of FGFR autophosphorylation using SU5402 (157, 158), whereas p38 phosphorylation was not affected.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "exploring", "growth", "inhibitory", "factors", "in", "SS", ",", "ERK", "phosphorylation", "was", "completely", "inhibited", "after", "inhibition", "of", "FGFR", "autophosphorylation", "using", "SU5402", "(", "157", ",", "158", ")", ",", "whereas", "p38", "phosphorylation", "was", "not", "affected", "." ] } ]
PMC11653168
Furthermore, Stattic treatment induced both apoptosis and autophagy in CCRF-CEM and Jurkat cells, as evidenced by the respective upregulation of cleaved caspase-3 and LC3B.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "Stattic", "treatment", "induced", "both", "apoptosis", "and", "autophagy", "in", "CCRF-CEM", "and", "Jurkat", "cells", ",", "as", "evidenced", "by", "the", "respective", "upregulation", "of", "cleaved", "caspase-3", "and", "LC3B", "." ] } ]
PMC11791203
Currently, cancer has emerged as a significant public health issue, with over 52,900 new diagnoses and more than 27,000 deaths occurring daily worldwide.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Currently", ",", "cancer", "has", "emerged", "as", "a", "significant", "public", "health", "issue", ",", "with", "over", "52,900", "new", "diagnoses", "and", "more", "than", "27,000", "deaths", "occurring", "daily", "worldwide", "." ] } ]
PMC11786156
Inside blood vessels, tumor cells adhere to each other less frequently via CD54 because of the sparse cell density.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Inside", "blood", "vessels", ",", "tumor", "cells", "adhere", "to", "each", "other", "less", "frequently", "via", "CD54", "because", "of", "the", "sparse", "cell", "density", "." ] } ]
PMC10006224
For all the libraries, 8–9 PCR cycles were used for amplification and they were then sequenced on an Illumina NextSeq550 (82 × 43 bp).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "all", "the", "libraries", ",", "8–9", "PCR", "cycles", "were", "used", "for", "amplification", "and", "they", "were", "then", "sequenced", "on", "an", "Illumina", "NextSeq550", "(", "82", "×", "43", "bp", ")", "." ] } ]
PMC10958426
We identified copy number variations (CNVs) in each cancer cell and found correlation between gene copy number and expression level in cancer cells at single cell resolution.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "identified", "copy", "number", "variations", "(", "CNVs", ")", "in", "each", "cancer", "cell", "and", "found", "correlation", "between", "gene", "copy", "number", "and", "expression", "level", "in", "cancer", "cells", "at", "single", "cell", "resolution", "." ] } ]
PMC11732628
no. ABS132005; 1:500; Absin; Shanghai, China), cleaved caspase-9 (cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "no.", "ABS132005", ";", "1:500", ";", "Absin", ";", "Shanghai", ",", "China", ")", ",", "cleaved", "caspase-9", "(", "cat", "." ] } ]
PMC11552389
After reaching 90–95% confluence in 6-well plates, wounds were created by scratching the surface of the plates with a 10 μL pipette tip.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "reaching", "90–95", "%", "confluence", "in", "6-well", "plates", ",", "wounds", "were", "created", "by", "scratching", "the", "surface", "of", "the", "plates", "with", "a", "10", "μL", "pipette", "tip", "." ] } ]
PMC11365427
To investigate the impact of phenylalanine deprivation on MM in vitro, we designed a phenylalanine-free medium to create an external environment conducive to phenylalanine deprivation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "investigate", "the", "impact", "of", "phenylalanine", "deprivation", "on", "MM", "in", "vitro", ",", "we", "designed", "a", "phenylalanine-free", "medium", "to", "create", "an", "external", "environment", "conducive", "to", "phenylalanine", "deprivation", "." ] } ]
PMC9031474
It is suggested that 8 is a prodrug of 7 and the in situ formation of 7 inside the cell increases its cytotoxic activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", "suggested", "that", "8", "is", "a", "prodrug", "of", "7", "and", "the", "in", "situ", "formation", "of", "7", "inside", "the", "cell", "increases", "its", "cytotoxic", "activity", "." ] } ]
PMC8010066
In contrast to the SA-1/PA-4 combination, the co-culture of SA-1 with PA-2 and PA-3 led to a notable decline in resistance to carbapenems.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", "to", "the", "SA-1/PA-4", "combination", ",", "the", "co-culture", "of", "SA-1", "with", "PA-2", "and", "PA-3", "led", "to", "a", "notable", "decline", "in", "resistance", "to", "carbapenems", "." ] } ]
PMC9429973
90% of t-MDS pts had adverse CG (IPSS-R CG score 3-4) at MDS dx, compared to 46% in de novo MDS pts (p=0.004).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "90", "%", "of", "t-MDS", "pts", "had", "adverse", "CG", "(", "IPSS-R", "CG", "score", "3", "-", "4", ")", "at", "MDS", "dx", ",", "compared", "to", "46", "%", "in", "de", "novo", "MDS", "pts", "(", "p=0.004", ")", "." ] } ]
PMC10440586
The color development was performed using diaminobenzidine (DAB) solution after thorough rinsing in PBS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "color", "development", "was", "performed", "using", "diaminobenzidine", "(", "DAB", ")", "solution", "after", "thorough", "rinsing", "in", "PBS", "." ] } ]
PMC9429973
During pre-HSCT dental assessment a squamous cell carcinoma of the right tongue was noted and later confirmed on biopsy; he subsequently underwent hemi-glossectomy and right neck dissection with free flap reconstruction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "During", "pre-HSCT", "dental", "assessment", "a", "squamous", "cell", "carcinoma", "of", "the", "right", "tongue", "was", "noted", "and", "later", "confirmed", "on", "biopsy", ";", "he", "subsequently", "underwent", "hemi-glossectomy", "and", "right", "neck", "dissection", "with", "free", "flap", "reconstruction", "." ] } ]
PMC3995603
The HPLC-PDA method was utilized for simultaneous determination of the chlorogenic acid, caffeic acid, hyperoside, isoquercitrin, isochlorogenic acid A and scoparone content of A. capillaris using mobile phases comprised of 1.0% (v/v) acetic acid in water (A) and 1.0% (v/v) acetic acid in acetonitrile (B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "HPLC-PDA", "method", "was", "utilized", "for", "simultaneous", "determination", "of", "the", "chlorogenic", "acid", ",", "caffeic", "acid", ",", "hyperoside", ",", "isoquercitrin", ",", "isochlorogenic", "acid", "A", "and", "scoparone", "content", "of", "A.", "capillaris", "using", "mobile", "phases", "comprised", "of", "1.0", "%", "(", "v/v", ")", "acetic", "acid", "in", "water", "(", "A", ")", "and", "1.0", "%", "(", "v/v", ")", "acetic", "acid", "in", "acetonitrile", "(", "B", ")", "." ] } ]
PMC11734514
p<0.05.
[ { "tags": [ "O", "O" ], "tokens": [ "p<0.05", "." ] } ]
PMC7081114
KIF21B expression levels were significantly higher in HCC tissues than in corresponding adjacent normal tissues.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "KIF21B", "expression", "levels", "were", "significantly", "higher", "in", "HCC", "tissues", "than", "in", "corresponding", "adjacent", "normal", "tissues", "." ] } ]
PMC11661040
All cells were supplemented with 10% FBS (Servicebio Technology, Wuhan, China), penicillin (100 U/mL) and streptomycin (100 mg/mL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "cells", "were", "supplemented", "with", "10", "%", "FBS", "(", "Servicebio", "Technology", ",", "Wuhan", ",", "China", ")", ",", "penicillin", "(", "100", "U/mL", ")", "and", "streptomycin", "(", "100", "mg/mL", ")", "." ] } ]
PMC9429973
Median OS rate was NE for the TN and R/R cohorts; estimated 66-mo OS rate was 91% (TN; 51, 99) and 71% (R/R; 60, 80).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "OS", "rate", "was", "NE", "for", "the", "TN", "and", "R/R", "cohorts", ";", "estimated", "66-mo", "OS", "rate", "was", "91", "%", "(", "TN", ";", "51", ",", "99", ")", "and", "71", "%", "(", "R/R", ";", "60", ",", "80", ")", "." ] } ]
PMC11766350
Samples were loaded onto a 96-well U-bottom plate and analyzed by FACS Accuri C6 (BD, Franklin Lakes, NJ, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Samples", "were", "loaded", "onto", "a", "96-well", "U-bottom", "plate", "and", "analyzed", "by", "FACS", "Accuri", "C6", "(", "BD", ",", "Franklin", "Lakes", ",", "NJ", ",", "USA", ")", "." ] } ]
PMC11730305
In this method, metal nanoparticles are coated with non-toxic molecules to reduce their undesirable cytotoxic effects and improve their stability, and then, they are conjugated to therapeutic molecules.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "method", ",", "metal", "nanoparticles", "are", "coated", "with", "non-toxic", "molecules", "to", "reduce", "their", "undesirable", "cytotoxic", "effects", "and", "improve", "their", "stability", ",", "and", "then", ",", "they", "are", "conjugated", "to", "therapeutic", "molecules", "." ] } ]
PMC11787381
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "information", "on", "research", "design", "is", "available", "in", "the", "Nature", "Portfolio", "Reporting", "Summary", "linked", "to", "this", "article", "." ] } ]
PMC8345486
Before fixation, the number of cells was estimated by using a Thoma cell counting chamber (Marienfeld, Germany).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Before", "fixation", ",", "the", "number", "of", "cells", "was", "estimated", "by", "using", "a", "Thoma", "cell", "counting", "chamber", "(", "Marienfeld", ",", "Germany", ")", "." ] } ]
PMC11411004
Finally, the complex was added to the 12-well plate after liquid exchange, waited for about 5 h, replaced with 1 mL of DMEM/F12 complete medium to continue the culture, cultured for 24–48 h, digested and then transferred to the 6-well plate for culture, and screened with 15 μg/mL of Blasticidin S (ST018, Beyotime) at progressively decreasing concentrations, successfully screening out the desired pooled polyclonal cells, named CHO-ADM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O" ], "tokens": [ "Finally", ",", "the", "complex", "was", "added", "to", "the", "12-well", "plate", "after", "liquid", "exchange", ",", "waited", "for", "about", "5", "h", ",", "replaced", "with", "1", "mL", "of", "DMEM/F12", "complete", "medium", "to", "continue", "the", "culture", ",", "cultured", "for", "24–48", "h", ",", "digested", "and", "then", "transferred", "to", "the", "6-well", "plate", "for", "culture", ",", "and", "screened", "with", "15", "μg/mL", "of", "Blasticidin", "S", "(", "ST018", ",", "Beyotime", ")", "at", "progressively", "decreasing", "concentrations", ",", "successfully", "screening", "out", "the", "desired", "pooled", "polyclonal", "cells", ",", "named", "CHO-ADM", "." ] } ]
PMC11779993
We examined whether SPEE affects the phosphorylation of FAK and Src, which play a crucial role in regulating keratinocyte migration and wound healing by western blotting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "examined", "whether", "SPEE", "affects", "the", "phosphorylation", "of", "FAK", "and", "Src", ",", "which", "play", "a", "crucial", "role", "in", "regulating", "keratinocyte", "migration", "and", "wound", "healing", "by", "western", "blotting", "." ] } ]
PMC10577955
A549 cells were developed and attached to the well walls during night.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A549", "cells", "were", "developed", "and", "attached", "to", "the", "well", "walls", "during", "night", "." ] } ]
PMC9635307
Incorporation of [H] in the harvested cells were measured by a β-ray scintillation counter (MicroBeta, PerkinElmer).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Incorporation", "of", "[", "H", "]", "in", "the", "harvested", "cells", "were", "measured", "by", "a", "β-ray", "scintillation", "counter", "(", "MicroBeta", ",", "PerkinElmer", ")", "." ] } ]
PMC9429973
Patients with cMPN and those transplanted after to 2 years from diagnosis had a higher incidence (28.5% and 13%; p-value 0.03).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "with", "cMPN", "and", "those", "transplanted", "after", "to", "2", "years", "from", "diagnosis", "had", "a", "higher", "incidence", "(", "28.5", "%", "and", "13", "%", ";", "p-value", "0.03", ")", "." ] } ]
PMC11442172
Acidosis-induced metabolic rewiring of cancer cells results in novel metabolic vulnerabilities that could potentially be exploited.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Acidosis-induced", "metabolic", "rewiring", "of", "cancer", "cells", "results", "in", "novel", "metabolic", "vulnerabilities", "that", "could", "potentially", "be", "exploited", "." ] } ]
PMC11791478
Clinical signs, body weights, food intake, ophthalmology, clinical pathology parameters (hematology, clinical chemistry, coagulation, and urinalysis), toxicokinetic (TK) parameters, gross necropsy, organ weights, and histopathology (lungs, gross lesions, and eyes for one animal dosed at 18 mg/kg XB002 with ocular symptoms) were evaluated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Clinical", "signs", ",", "body", "weights", ",", "food", "intake", ",", "ophthalmology", ",", "clinical", "pathology", "parameters", "(", "hematology", ",", "clinical", "chemistry", ",", "coagulation", ",", "and", "urinalysis", ")", ",", "toxicokinetic", "(", "TK", ")", "parameters", ",", "gross", "necropsy", ",", "organ", "weights", ",", "and", "histopathology", "(", "lungs", ",", "gross", "lesions", ",", "and", "eyes", "for", "one", "animal", "dosed", "at", "18", "mg/kg", "XB002", "with", "ocular", "symptoms", ")", "were", "evaluated", "." ] } ]
PMC11422497
Our research findings indicate that circ_SMA4-induced silencing of miR-494-3p results in the activation of KIT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "research", "findings", "indicate", "that", "circ_SMA4-induced", "silencing", "of", "miR-494", "-", "3p", "results", "in", "the", "activation", "of", "KIT", "." ] } ]
PMC11593713
The accumulation of reactive oxygen species (ROS) affects the host’s defense mechanisms, which in turn enhances viral infections.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "accumulation", "of", "reactive", "oxygen", "species", "(", "ROS", ")", "affects", "the", "host", "’s", "defense", "mechanisms", ",", "which", "in", "turn", "enhances", "viral", "infections", "." ] } ]
PMC11506670
Finally, the in silico analysis carried out predicted a deleterious or pathogenic consequence for each of the NRAS mutants.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "the", "in", "silico", "analysis", "carried", "out", "predicted", "a", "deleterious", "or", "pathogenic", "consequence", "for", "each", "of", "the", "NRAS", "mutants", "." ] } ]
PMC9429973
Overall, 24%, 33% and 11% of pts had 1 log, 2 logs or 3 BCR-ABL transcript logs reduction from baseline (68% of pts had a molecular improvement from baseline).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Overall", ",", "24", "%", ",", "33", "%", "and", "11", "%", "of", "pts", "had", "1", "log", ",", "2", "logs", "or", "3", "BCR-ABL", "transcript", "logs", "reduction", "from", "baseline", "(", "68", "%", "of", "pts", "had", "a", "molecular", "improvement", "from", "baseline", ")", "." ] } ]
PMC10530622
The activation of TRPV1 was associated with an increase of arachidonate 12-lipoxygenase (ALOX-12) protein levels and, consequently, increased 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE], an endogenous TRPV1 ligand.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "activation", "of", "TRPV1", "was", "associated", "with", "an", "increase", "of", "arachidonate", "12-lipoxygenase", "(", "ALOX-12", ")", "protein", "levels", "and", ",", "consequently", ",", "increased", "12(S)-hydroxyeicosatetraenoic", "acid", "[", "12(S)-HETE", "]", ",", "an", "endogenous", "TRPV1", "ligand", "." ] } ]
PMC10968586
In the large intestine, OLE is metabolized by gut microbiota, producing HT .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "large", "intestine", ",", "OLE", "is", "metabolized", "by", "gut", "microbiota", ",", "producing", "HT", "." ] } ]
PMC11285179
The number of cells migrated to the lower chamber was calculated (Fig. 2D, right panel), and we found that the optimal concentration of CCL28 for enhancing the migration efficiency of pericytes is 250 ng/ml.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "number", "of", "cells", "migrated", "to", "the", "lower", "chamber", "was", "calculated", "(", "Fig.", "2D", ",", "right", "panel", ")", ",", "and", "we", "found", "that", "the", "optimal", "concentration", "of", "CCL28", "for", "enhancing", "the", "migration", "efficiency", "of", "pericytes", "is", "250", "ng/ml", "." ] } ]
PMC11711127
Evidence for this as primary suppression mechanism of CD8+ Tregs is supported by reports that Prf1 negative mice are incapable of supressing TFH in Rag2 mice (160) and proliferation of Ag-activated CD4+ T cells in EAE model (161).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Evidence", "for", "this", "as", "primary", "suppression", "mechanism", "of", "CD8", "+", "Tregs", "is", "supported", "by", "reports", "that", "Prf1", "negative", "mice", "are", "incapable", "of", "supressing", "TFH", "in", "Rag2", "mice", "(", "160", ")", "and", "proliferation", "of", "Ag-activated", "CD4", "+", "T", "cells", "in", "EAE", "model", "(", "161", ")", "." ] } ]
PMC9927933
As such, the mTORC signals (S6K1 and AKT) are activated to cooperate with Kras (MAPK) for lung tumorigenesis (Figure 7C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "such", ",", "the", "mTORC", "signals", "(", "S6K1", "and", "AKT", ")", "are", "activated", "to", "cooperate", "with", "Kras", "(", "MAPK", ")", "for", "lung", "tumorigenesis", "(", "Figure", "7C", ")", "." ] } ]
PMC11533140
Thus, evaluating the selectivity of compounds toward normal cells might reduce the risk of clinical failure of new compounds.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "evaluating", "the", "selectivity", "of", "compounds", "toward", "normal", "cells", "might", "reduce", "the", "risk", "of", "clinical", "failure", "of", "new", "compounds", "." ] } ]
PMC11742290
Anti-LGR5-ADC effectively inhibited tumor growth in MDA-MB231 and patient-derived xenografts with high-LGR5 in breast cancer .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Anti-LGR5-ADC", "effectively", "inhibited", "tumor", "growth", "in", "MDA-MB231", "and", "patient-derived", "xenografts", "with", "high-LGR5", "in", "breast", "cancer", "." ] } ]
PMC11679326
A characteristic feature of carcinoma tumor cell glycosylation is the expression of α2,3-, α2,6-, and α2,8-terminal sialic acid residues within the glycans.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "characteristic", "feature", "of", "carcinoma", "tumor", "cell", "glycosylation", "is", "the", "expression", "of", "α2,3-", ",", "α2,6-", ",", "and", "α2,8-terminal", "sialic", "acid", "residues", "within", "the", "glycans", "." ] } ]
PMC9784246
DMSO was used as a negative control, and etoposide as a positive control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "DMSO", "was", "used", "as", "a", "negative", "control", ",", "and", "etoposide", "as", "a", "positive", "control", "." ] } ]
PMC7553912
The protein concentrations of the lysates were determined using the BCA Protein Assay kit (PIERCE, Rockford, IL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "protein", "concentrations", "of", "the", "lysates", "were", "determined", "using", "the", "BCA", "Protein", "Assay", "kit", "(", "PIERCE", ",", "Rockford", ",", "IL", ")", "." ] } ]
PMC10033453
Heterogeneity within cancer cell lines prior to infection may have affected susceptibility to infection or killing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Heterogeneity", "within", "cancer", "cell", "lines", "prior", "to", "infection", "may", "have", "affected", "susceptibility", "to", "infection", "or", "killing", "." ] } ]
PMC11761919
On day 12 after the third immunization, 49-day chickens in all groups except the negative control were inoculated with FAdV-4/GS01 with a dose of 10 ELD50 by intramuscular injection.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "day", "12", "after", "the", "third", "immunization", ",", "49-day", "chickens", "in", "all", "groups", "except", "the", "negative", "control", "were", "inoculated", "with", "FAdV-4/GS01", "with", "a", "dose", "of", "10", "ELD50", "by", "intramuscular", "injection", "." ] } ]
PMC11794847
Considering the nature of HVEM and its primary expression on T cells, we next planned to investigate the impact of T cells on the progression of NSCLC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Considering", "the", "nature", "of", "HVEM", "and", "its", "primary", "expression", "on", "T", "cells", ",", "we", "next", "planned", "to", "investigate", "the", "impact", "of", "T", "cells", "on", "the", "progression", "of", "NSCLC", "." ] } ]
PMC7724160
The total peak area of all three species was set to 100% and the relative percentage of each species is calculated as a percentage of the total integrated peak area.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "total", "peak", "area", "of", "all", "three", "species", "was", "set", "to", "100", "%", "and", "the", "relative", "percentage", "of", "each", "species", "is", "calculated", "as", "a", "percentage", "of", "the", "total", "integrated", "peak", "area", "." ] } ]
PMC11703896
Findings from a recent study by Wang et al. (Wang et al. 2021) aligns with these observations and thus supports the current data.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Findings", "from", "a", "recent", "study", "by", "Wang", "et", "al.", "(", "Wang", "et", "al.", "2021", ")", "aligns", "with", "these", "observations", "and", "thus", "supports", "the", "current", "data", "." ] } ]
PMC9429973
Patients with PK deficiency also had more than twice as many outpatient visits than those in the non-PK deficiency cohort (mean [SD]: 35.2 [23.6] vs 14.1 [17.4] visits, respectively, p=0.0004).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "with", "PK", "deficiency", "also", "had", "more", "than", "twice", "as", "many", "outpatient", "visits", "than", "those", "in", "the", "non-PK", "deficiency", "cohort", "(", "mean", "[", "SD", "]", ":", "35.2", "[", "23.6", "]", "vs", "14.1", "[", "17.4", "]", "visits", ",", "respectively", ",", "p=0.0004", ")", "." ] } ]
PMC9429973
In the multivariate analysis, palliative status HR 4.8 (95% CI 1.07-22.18)p=0.040 and complete response HR 0.22 (95% CI 0.062-0.815)p=0.023 were risk and protective factors, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "multivariate", "analysis", ",", "palliative", "status", "HR", "4.8", "(", "95", "%", "CI", "1.07", "-", "22.18)p=0.040", "and", "complete", "response", "HR", "0.22", "(", "95", "%", "CI", "0.062", "-", "0.815)p=0.023", "were", "risk", "and", "protective", "factors", ",", "respectively", "." ] } ]
PMC9250505
Pharmacological inhibition of pBADS99 synergizes with PARPis to enhance PARPi IC50 and decreases survival, foci formation, and growth in ex vivo culture of EOC cells and patient-derived organoids (PDOs).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Pharmacological", "inhibition", "of", "pBADS99", "synergizes", "with", "PARPis", "to", "enhance", "PARPi", "IC50", "and", "decreases", "survival", ",", "foci", "formation", ",", "and", "growth", "in", "ex", "vivo", "culture", "of", "EOC", "cells", "and", "patient-derived", "organoids", "(", "PDOs", ")", "." ] } ]
PMC10253553
The induction of NDRG1 in response to hypoxia in cancer cells inhibits apoptosis and thus promotes cancer cell survival in tumors that have high levels of hypoxia .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "induction", "of", "NDRG1", "in", "response", "to", "hypoxia", "in", "cancer", "cells", "inhibits", "apoptosis", "and", "thus", "promotes", "cancer", "cell", "survival", "in", "tumors", "that", "have", "high", "levels", "of", "hypoxia", "." ] } ]
PMC11658074
ADSCs were passaged every 3‒7 days, and passage 3 ADSCs were used to prepare ADSC-EVs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ADSCs", "were", "passaged", "every", "3‒7", "days", ",", "and", "passage", "3", "ADSCs", "were", "used", "to", "prepare", "ADSC-EVs", "." ] } ]
PMC11655536
H Transmission electron microscope shows the lysosome when RPMI-8226 treated HA for 48 h, yellow arrow: lysosome.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H", "Transmission", "electron", "microscope", "shows", "the", "lysosome", "when", "RPMI-8226", "treated", "HA", "for", "48", "h", ",", "yellow", "arrow", ":", "lysosome", "." ] } ]
PMC9429973
After determining the expansion dose, up to 8 cohorts in Phase 1b will be investigated in patients with subsets of advanced cancers including DLBCL-RT (n = 16).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "determining", "the", "expansion", "dose", ",", "up", "to", "8", "cohorts", "in", "Phase", "1b", "will", "be", "investigated", "in", "patients", "with", "subsets", "of", "advanced", "cancers", "including", "DLBCL-RT", "(", "n", "=", "16", ")", "." ] } ]
PMC11218145
Further research on the action of TB on the mevalonate pathways is fully justified.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "research", "on", "the", "action", "of", "TB", "on", "the", "mevalonate", "pathways", "is", "fully", "justified", "." ] } ]
PMC11786767
∗∗P < 0.01; two-tailed unpaired Student’s t-test.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "∗∗P", "<", "0.01", ";", "two-tailed", "unpaired", "Student", "’s", "t-test", "." ] } ]
PMC6799808
All data represent the mean ± SD (n = 3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "data", "represent", "the", "mean", "±", "SD", "(", "n", "=", "3", ")", "." ] } ]
PMC10154097
After incubation, the absorbance was assessed at 450 nm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "incubation", ",", "the", "absorbance", "was", "assessed", "at", "450", "nm", "." ] } ]
PMC11588008
Both ends of the umbilical cord, measuring 0.5 cm in length, were removed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "ends", "of", "the", "umbilical", "cord", ",", "measuring", "0.5", "cm", "in", "length", ",", "were", "removed", "." ] } ]
PMC11640419
Cell cycle analysis was performed using the MAK344 cell cycle assay kit (Sigma-Aldrich, St. Louis, MO, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cell", "cycle", "analysis", "was", "performed", "using", "the", "MAK344", "cell", "cycle", "assay", "kit", "(", "Sigma-Aldrich", ",", "St.", "Louis", ",", "MO", ",", "USA", ")", "." ] } ]
PMC11644761
In differentiated cells, pterostilbene exhibited an inhibitory effect on cyclin CCND1 expression, observable even after just 4 h of treatment at the lowest concentration tested.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "differentiated", "cells", ",", "pterostilbene", "exhibited", "an", "inhibitory", "effect", "on", "cyclin", "CCND1", "expression", ",", "observable", "even", "after", "just", "4", "h", "of", "treatment", "at", "the", "lowest", "concentration", "tested", "." ] } ]
PMC10728535
Sixteen expression profiles were excluded from this work due to being unclear.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sixteen", "expression", "profiles", "were", "excluded", "from", "this", "work", "due", "to", "being", "unclear", "." ] } ]
PMC11525028
To further validate the cytidine acetylation in ATF4 mRNA, we used the chemical reduction method using sodium cyanoborohydride (NaCNBH3), which causes the incorporation of non-cognate deoxynucleotide triphosphates in acetylated cytidine sites upon reverse transcription, and the ac4C site can be detected via Sanger sequencing at single-nucleotide resolution (Figure 3M).Figure 3ATF4 is regulated by NAT10 through ac4C modification(A) Volcano plot showing the mRNA expression of NAT10-KO compared to control cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "further", "validate", "the", "cytidine", "acetylation", "in", "ATF4", "mRNA", ",", "we", "used", "the", "chemical", "reduction", "method", "using", "sodium", "cyanoborohydride", "(", "NaCNBH3", ")", ",", "which", "causes", "the", "incorporation", "of", "non-cognate", "deoxynucleotide", "triphosphates", "in", "acetylated", "cytidine", "sites", "upon", "reverse", "transcription", ",", "and", "the", "ac4C", "site", "can", "be", "detected", "via", "Sanger", "sequencing", "at", "single-nucleotide", "resolution", "(", "Figure", "3M).Figure", "3ATF4", "is", "regulated", "by", "NAT10", "through", "ac4C", "modification(A", ")", "Volcano", "plot", "showing", "the", "mRNA", "expression", "of", "NAT10-KO", "compared", "to", "control", "cells", "." ] } ]
PMC6948907
It causes hyperacetylation of the N- terminal tails of H3 and H4 in vivo and in vitro (Göttlicher et al., 2001).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "causes", "hyperacetylation", "of", "the", "N-", "terminal", "tails", "of", "H3", "and", "H4", "in", "vivo", "and", "in", "vitro", "(", "Göttlicher", "et", "al.", ",", "2001", ")", "." ] } ]
PMC10969097
Chemotherapy uses drugs that target dividing cells such as cancer cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Chemotherapy", "uses", "drugs", "that", "target", "dividing", "cells", "such", "as", "cancer", "cells", "." ] } ]
PMC9872547
Our findings indicated that nano-curcumin could increase cellular apoptosis and reduce cell viability in human cervical cancer HeLa cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Our", "findings", "indicated", "that", "nano-curcumin", "could", "increase", "cellular", "apoptosis", "and", "reduce", "cell", "viability", "in", "human", "cervical", "cancer", "HeLa", "cells", "." ] } ]
PMC10158546
Full-length hamster (29–231) PrP substrate was prepared in-house via recombinant expression in bacteria followed by purification with histidine affinity chromatography according to published methods .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Full-length", "hamster", "(", "29–231", ")", "PrP", "substrate", "was", "prepared", "in-house", "via", "recombinant", "expression", "in", "bacteria", "followed", "by", "purification", "with", "histidine", "affinity", "chromatography", "according", "to", "published", "methods", "." ] } ]
PMC11240448
External and internal cues processed by cell-surface receptors and downstream signaling pathways and resulting changes in posttranslational protein modifications, such as protein (de)phosphorylation, connect a cell’s biological responses and state transition dynamics with a cell’s omics profiles.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "External", "and", "internal", "cues", "processed", "by", "cell-surface", "receptors", "and", "downstream", "signaling", "pathways", "and", "resulting", "changes", "in", "posttranslational", "protein", "modifications", ",", "such", "as", "protein", "(de)phosphorylation", ",", "connect", "a", "cell", "’s", "biological", "responses", "and", "state", "transition", "dynamics", "with", "a", "cell", "’s", "omics", "profiles", "." ] } ]
PMC11224020
For the FLIM experiments involving CK666, cells were plated in Fluorobright (Gibco) supplemented with 10% FBS, 1% penicillin–streptomycin, 1× GlutaMAX (Gibco) and 25 mM HEPES for 30 min and incubated with 30 µM CK666 and 1 µM ER Flipper-TR for 30 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "FLIM", "experiments", "involving", "CK666", ",", "cells", "were", "plated", "in", "Fluorobright", "(", "Gibco", ")", "supplemented", "with", "10", "%", "FBS", ",", "1", "%", "penicillin", "–", "streptomycin", ",", "1", "×", "GlutaMAX", "(", "Gibco", ")", "and", "25", "mM", "HEPES", "for", "30", "min", "and", "incubated", "with", "30", "µM", "CK666", "and", "1", "µM", "ER", "Flipper-TR", "for", "30", "min", "." ] } ]
PMC11715644
In comparison, 10A + ErbB2 cells had more homogeneous distribution of AR and SI, with very few cells showing large shape changes, indicating their less requirement for dramatic shape transitions to enter confinement.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "comparison", ",", "10A", "+", "ErbB2", "cells", "had", "more", "homogeneous", "distribution", "of", "AR", "and", "SI", ",", "with", "very", "few", "cells", "showing", "large", "shape", "changes", ",", "indicating", "their", "less", "requirement", "for", "dramatic", "shape", "transitions", "to", "enter", "confinement", "." ] } ]
PMC11449273
SKOV-3 cells were grown to confluency on glass coverslips and processed for staining as described previously .
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SKOV-3", "cells", "were", "grown", "to", "confluency", "on", "glass", "coverslips", "and", "processed", "for", "staining", "as", "described", "previously", "." ] } ]
PMC11481779
In our case, it guides diffusion to create a heat map that is as close as possible; however, it can be easily applied to classification problems as well (see Supplementary Materials).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "our", "case", ",", "it", "guides", "diffusion", "to", "create", "a", "heat", "map", "that", "is", "as", "close", "as", "possible", ";", "however", ",", "it", "can", "be", "easily", "applied", "to", "classification", "problems", "as", "well", "(", "see", "Supplementary", "Materials", ")", "." ] } ]
PMC11641532
After quality control filtering, 96,175 cells were collected from 23 samples for downstream analyses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "quality", "control", "filtering", ",", "96,175", "cells", "were", "collected", "from", "23", "samples", "for", "downstream", "analyses", "." ] } ]
PMC11519583
These results indicated that Wnt11-Ror2 signaling is required to regulate MP proliferation, adipogenic differentiation, and senescence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "indicated", "that", "Wnt11-Ror2", "signaling", "is", "required", "to", "regulate", "MP", "proliferation", ",", "adipogenic", "differentiation", ",", "and", "senescence", "." ] } ]
PMC9429973
Comparable 5-year cumulative incidences in validation dataset were 86% (82, 90%), 69% (64, 74%) and 31% (22, 40%) (p for trend<0.001; Figure B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Comparable", "5-year", "cumulative", "incidences", "in", "validation", "dataset", "were", "86", "%", "(", "82", ",", "90", "%", ")", ",", "69", "%", "(", "64", ",", "74", "%", ")", "and", "31", "%", "(", "22", ",", "40", "%", ")", "(", "p", "for", "trend<0.001", ";", "Figure", "B", ")", "." ] } ]
PMC11413393
These results are consistent with the reduced transcript levels noted in Fig. 4e indicating a potential compromise in the integrity of these critical repair pathways.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "are", "consistent", "with", "the", "reduced", "transcript", "levels", "noted", "in", "Fig.", "4e", "indicating", "a", "potential", "compromise", "in", "the", "integrity", "of", "these", "critical", "repair", "pathways", "." ] } ]