OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC11476106	Given the rarity of childhood tumors, and in line with the ethical commitment to reducing animal experimentation, other material source options need to be explored for ES research.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	S. Aggarwal, S. Kumar, A. Bela, O. Topaloglu Health Economics and Outcomes Research; Veno-occlusive Disease Research Group, NOVEL Health Strategies, Columbia; HEOR; Systematic Literature Review Group, NOVEL Health Strategies, Chevy Chase, United States of America Background: Veno-occlusive disease (VOD), also called sinusoidal obstruction syndrome (SOS), is a potentially life-threatening complication of hematopoietic stem cell transplantation (HSCT) conditioning or high-dose nontransplant chemotherapy.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11367146	The validation of docking was confirmed based on low RMSD (<2 Å) of the redocked ligand from the orientation of the co-crystallized ligand and the reproduction of observed interactions from the pdb structure.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Eight cases (72.7%) experienced central nervous system (CNS) leukemia, and 3 had mediastinal invasion.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Eight", "cases", "(", ...
PMC11792740	Moreover, activating the MAPK/ERK pathway has been shown to enhance T-cell differentiation and effector functions, further boosting antitumor immunity .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "...
PMC11335267	In the first case, insulin promotes glucose uptake by target organs such as the liver, muscle, and adipose tissue, whereas in the second case, glucagon stimulates hepatic glucose release into the bloodstream.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11787355	Although i.v.	[ { "tags": [ "O", "O", "O" ], "tokens": [ "Although", "i.v", "." ] } ]
PMC11388384	One day after induction, cells were imaged to count cytonemes.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "day", "after", "induction", ",", "cells", "were", "imaged", "to", "count", ...
PMC10204952	Thus, adipose tissue may be detrimental to local high-concentration S1P treatment of TNBC.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "adipose", "tissue", "may", "be", "detrimental", "to...
PMC6450504	However, siRNA delivery into cancer cells either alone or in combination with other drugs is a challenging task which requires overcoming unique barriers including plasma instability, very low cellular internalization and immediate degradation within the endosomal compartments of the cancer cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11306331	B Representative images showing changes in 3xFUS (RFP channel) and candidate dissolver protein (iRFP), expressed in HEK293T cells, before and after 3 min stimulation with blue light.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9577200	The viability and proliferation of HeLa cells treated with chitosan were significantly decreased (p < 0.05) from 95.3% at 0% to 12.93%, 10.33%, and 5.93% at 0.2%, 0.4%, and 0.60% concentrations of chitosan, respectively.	[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10589262	We first aimed to exclude the possibility that ER- or PM-localized MT-KIT initiates downstream signaling.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "first", "aimed", "to", "exclude", "the", "possibility...
PMC11678448	During bacterial infections, IL-6 is vital for activating the STAT signaling pathway, enhancing neutrophil recruitment, and reducing the bacterial load, thereby playing a central role in the host’s defense against P. multocida .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11680562	Early apoptotic cells showed cytoplasmic shrinkage, nuclear condensation, and rounding.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Early", "apoptotic", "cells", "showed", "cytoplasmic", "shrinkage", ",", "nuclear", ...
PMC11591794	RT-qPCR experiments were performed on a total of 9 samples in all experimental groups; Proapoptotic P53 and Bax gene expressions were normalized to β-actin expression of the same sample, which was used as the internal control gene.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3915447	The TMAOH (tetramethyl ammonium hydroxide) was used as the surfactant, in preparing the bare MNPs to maintain the aqueous solution of bare NPs in the state of colloidal suspension.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	It also revealed that NDMM with RI has poorer HR and OS than pts with normal renal function when both treated by a Brotezomib induction regimen followed by ASCT.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10440586	Correlation between CD99 and hypoxia response markers.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "between", "CD99", "and", "hypoxia", "response", "markers", "." ] } ]
PMC7154001	Most of the works in metabolite analysis were carried out using triple-quadrupole mass spectrometers.28,39,55,57,63,82 The main advantages include its superior quantitative capabilities in the multiple reaction monitoring (MRM) mode and the fact that a family of metabolites can easily be identified using neutral-loss and precursor ion scans.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6268318	A dose of 100 mg/kg of the extract was the most effective, among the doses tested.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "dose", "of", "100", "mg/kg", "of", ...
PMC8382973	This is the first study to evaluate the rectal and vaginal use of the 2P23 gel.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "is", "the", "first", "study", "to", "eva...
PMC11754291	Once all conditions for all three populations (N = 3) were treated, the cell media were thawed on ice and assayed following the manufacturer’s recommendations (Figure 4).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11194678	Scale bar: 15 μm. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bar", ":", "15", "μm", ".", "(" ] } ]
PMC11566417	ImageJ was used to calculate the percentage of area without cells (scratch percentage) at each timepoint.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ImageJ", "was", "used", "to", "calcula...
PMC9429973	Eight machine learning classifiers were utilized to produce eight candidate models.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Eight", "machine", "learning", "classifiers", "were", "utilized", "to", "produce", "eight",...
PMC11695546	H. pylori was then incubated for 72 h at 36°C.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H.", "pylori", "was", "then", "incubated", "for", "72", "h", "at", "36", ...
PMC10551595	Lipinski's rule of 5 was used for evaluating the drug likeness of GinA. Filters exploited in this analysis are the MW ≤500, MLogP (Lipophilicity) ≤4.15, number of HBA ≤10, and number of HBD ≤5.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11323699	There is no treatment for patients who relapse after treatment with PARPi (bottom panel) Schematic illustration of two major clinical challenges in ovarian carcinoma.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC8382973	MIC, minimal inhibitory concentration.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "MIC", ",", "minimal", "inhibitory", "concentration", "." ] } ]
PMC11342785	This manuscript includes a Supplemental Information file.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "manuscript", "includes", "a", "Supplemental", "Information", "file", "." ] } ]
PMC9429973	Aims: Describe our clinical experience and therapeutic management, also the clinical-biochemical alterations at diagnosis in a heterogeneous NDMM HRC`s cohort.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", ...
PMC2944824	Finally, Hr expression did not attenuate apoptosis in mouse embryonic fibroblasts from p53 knockout mice but was effective in mouse embryonic fibroblasts from wild type mice.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9065483	For instance, several viruses activate EGFR as part of their viral lifecycle to allow for their propagation.46, 47, 48, 49 Poxviruses, which are currently used in oncolytic virotherapy, in particular encode vaccinia growth factor, which has been shown to activate EGFR.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11718274	To characterize Y2O3NPs, X-ray diffraction (XRD) analysis was performed to estimate the crystal structure and purity of the purchased Y2O3NPs powders.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11590870	The microplate was incubated for 4 min at room temperature in the absence of light, mixed at medium speed for 1 min in the microplate reader, and read at a wavelength of 593 nm.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Image: Summary/Conclusion: This is one of the largest cohort studies of patients with MPN-SVT to date with over 70% diagnosed in the last 13 years.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11194678	STAU1 can enhance the translation of a specific mRNA population that contains an SBS in the 5′UTR or coding sequence regions with high GC content (Dugré-Brisson et al., 2005; Ricci et al., 2014).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11615743	Using this logic device, the L‐DNA probes demonstrated significant superiority in both PBS and FBS.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "this", "logic", "device", ",", "the", "...
PMC11047729	This indicates that this specific subunit is a key determinant of telomerase engagement in replication and may be the best option to choose while attacking this enzyme .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	This suggests improvements in Hb may be an important driver of morbidity and costs among patients with PNH.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "suggests", "improvements", "in", ...
PMC9429973	Global Health Status (GHS) was significantly worse with VMP vs Rd at 3 months (-3.3 vs +9.0; P=0.002), while from the 6-month time point onwards no differences can be found due to an improvement in GHS in the VMP arm (Figure).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11703896	The analysis of residue-level propensity utilizing Root Mean Square Fluctuation (RMSF) trajectories was performed with default restraint parameters.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "analysis", "of", ...
PMC10849234	Another limitation to the use of promyelocytic cell lines is possible inconsistency from line-to-line in different laboratories.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Another", "limitation", "to", "the", "use", ...
PMC11718817	Macrophages were polarized into M2-like CD206 cells by treatment with 20 ng/mL murine rm-IL-4 (Peprotech) and either activated with LPS and nigericin or left not activated before spheroid formation began.	[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10073922	The primer sequences for the real-time PCR analysis of NDRG2 and MMP-2 gene expressions All statistical analyses were performed using the SPSS software, version 15.0.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10748106	Then, the MEP map was obtained (Figure 4), indicating the regions more susceptible to an electrophilic attack (yellow to red color) and those more susceptible to a nucleophilic attack (blue color).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	The % surface bound AMs over time at 37 °C vs 4 °C was analyzed.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "%", "surface", "bound", "AMs", "over...
PMC9848491	Multivariate Cox regression analysis showed that OS was independently associated with grade and risk score of UCEC patients ( Figure 3D ).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Multivariate", ...
PMC9693627	Precursors with a charge state of +1 and more than +5 were rejected and all measured precursors were dynamically excluded from triggering of a subsequent MS/MS for 20 s. The obtained raw data were processed using the MaxQuant software with the built-in search engine Andromeda .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11453018	E Bar graphs show RT-qPCR results illustrating unchanged EWS::FLI1 expression following P300/CBP inhibition, with a significant reduction in EWS::FLI1 target gene expression (NKX2.2 and CMYC) at 24 hours post-treatment.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11252033	Figure 2A shows the identified binding site highlighted in mesh, along with the key interacting residues that correspond to those found interacting with ASA in the docking calculation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11725127	Currently, most small molecules are designed to target a frequent KRAS mutant, KRAS, by forming a covalent bond with the cysteine 12 residue.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9545474	ROS detection: Flow cytometry analysis of total induction of ROS in A2780 cells caused by exposure to complexes 6 and 8 was carried out using DCFH2‐DA assay.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10823017	The following primers were used in the experiment: PKC-ζ; forward: ACCCCTTCCTGGTCGGATTA; reverse: AGGGGGCTTCTGGAAGAGTA.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "following", "primers", "were", ...
PMC8345486	Compound 23 exerted similar effects on the sensitive cell line, A2780, and resistant cells, A2780cis and A2780cisR (Figure S2, Supplementary Materials).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11678448	This activation leads to the production of various pro-inflammatory cytokines, notably IL-6 and TNF-α .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "activation", "leads", "to", "the", "production", "o...
PMC9429973	Renal failure due to leukemic infiltration in chronic lymphocytic leukemia is extremely rare condition.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Renal", "failure", "due", "to", "leukemic", "infiltration", "in", ...
PMC11621565	Research has shown that LPS exposure induces neuroinflammation in SH-SY5Y cells, reducing cell viability.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Research", "has", "shown", "that", "LPS", "exposure", ...
PMC9268620	Following Giemsa staining, as shown in Figure 4, the untreated cells appeared healthy, some were round, and some were irregular in shape and size.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11380329	The metabolites in propolis from Egypt, Germany, and France are represented by aqua, green, and violet colors, respectively.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11381192	CSI, cellular stress index; EFS, event‐free survival; PFS, progression‐free survival.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CSI", ",", "cellular", "stress", "index", ";", "EFS", ...
PMC11806818	Kim et al. developed a colorimetric and electrochemical dual-mode sensing platform for the breast cancer biomarker thioredoxin 1 (TRX1) based on the excellent peroxidase mimetic and electrocatalytic properties of Prussian blue nanoparticles (PBNPs), achieving selective and sensitive detection of TRX1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11377827	Comparable findings were observed using HIF1β ChIP-PCR (Fig. 6B), indicating that USP43 depletion altered the binding of the HIF-1 complex at selected HIF-1 loci.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11742290	Phosphorylation regulates signal transduction pathways, while ubiquitination targets LGR5 for proteasomal degradation, affecting its stability, localization, and function .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Phosphorylation", ...
PMC11700247	After identifying the more effective regimen, we combined it with CART-19 cell therapy in a dual-tumor mouse model, treating 1 tumor with RT.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11792888	Therefore, it is likely that the peptides in these fractions include some ion channel-interacting proteins, which may explain the in vitro cytotoxic effect of R. junceus scorpion venom described in this study.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7192625	Even if assortativity can summarise relationships between 3D structure and specific features with a single correlation coefficient, the complexity of genome architecture will rarely be fully resolved by this approach.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8740518	With VIP > 1.0 and P-value < 0.05, a total of 23 differential metabolites were annotated, in which isoleucine, 5-dihydrocortisol, and indole-3-acetamide had the highest diagnostic values based on ROC analysis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Current algorithms for patients with SM-AHN direct treatment to each of the components tailored to the patient.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Current", "algorithms", "for", "patients", "with"...
PMC11442172	Presumably, these improvements will generate novel and meaningful insights into cancer metabolism that will be more effectively translated into successful anti-cancer therapies.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Presuma...
PMC11541241	Phytophthora infestans causes late blight of potato (Solanum tuberosum) and tomato (Solanum lycopersicum) and incurs enormous quantitative and qualitative losses on agriculture (Fry, 2016; Haas et al., 2009; Wang & Long, 2023).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	No cardiovascular event was noted.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "cardiovascular", "event", "was", "noted", "." ] } ]
PMC11755467	Initially, Enoxacin has been reported to directly bind to the TRBP protein, which is an integral part of the RISC loading complex increasing its affinity to pre-miRNA or siRNA thus enhancing RNAi by facilitating processing and mature strand loading .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740508	We found that these drugs synergized to produce smaller final populations in all 4 cell lines in a 4 day endpoint SRB assay (M231, SynergyFinder ZIP score 23.39; M231, ZIP score 16.37; M231, ZIP score 12.82; SUM149PT, ZIP score 18.379; Supplementary Fig. S1C-F; ).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Aims: We hypothesized that SOX11 may promote stem cell-like properties through the activation of stem cell-related genes, leading to an aggressive and incurable tumor in MCL patients.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10898159	The c-Abl Src homology 3 domain-binding protein-2 (SH3BP2) has 561 amino acids, containing an SH3-binding proline-rich region, an N-terminal pleckstrin homology (PH) domain, and a C-terminal SH2 domain .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10713411	The assessment of immune checkpoint expression revealed that the high-PRPCDGs-risk group presented higher expression levels of CTLA4, PDCD1, TIGIT, CD27, and LAG3 while CD274 was less expressed.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7759933	For the analysis, 30 spheroids per sample were collected and dissociated with enzymatic digestion and mechanical degradation, as described by Štampar et al. (2019).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6034753	Co-infection with MDV and CAV is common in many countries, CAV antigens are readily detectable in MD lymphomas, and the MDV-transformed T-lymphoblastoid cell lines such as MSB-1 is widely used for propagating CAV for vaccine production.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11306331	p > 0.05; : p < 0.05, : p < 0.01, **: p < 0.001.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11755467	More specifically, our data raise the question if an analogy may be drawn to hsa-miR-122 and HCV, i.e., if there is a potential to develop a small-molecule drug targeting approach against hsa-miR-132.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6133382	HEK 293 GnTI suspension-adapted cells were obtained from ATCC (ATCC, Manassas, VA, US).	[ { "tags": [ "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HEK", "293", "GnTI", "susp...
PMC11680391	The meeting is set, and the topic discussed is the udder health, but they do not discuss it out of a common understanding of the aims and goals of the dairy farmer.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11055510	The circMAN1A2 vector, sh-circMAN1A2, and its control plasmids were transfected into 293T cells for lentivirus preparation, and the viruses were collected to infect A2780 and SKOV3 cells, and then puromycin was selected.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC11670954	The present study demonstrated that BA increased cell viability, preserved the integrity and permeability of the intestinal epithelial barrier, upregulated the expression of ZO-1 and Occludin, maintained the subcellular localization of these proteins, and inhibited the RhoA/ROCK2/MLCK signaling pathway.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	B. D. Shah, R. D. Cassaday, J. H. Park, R. Houot, O. O. Oluwole, A. C. Logan, N. Boissel, T. Leguay, M. R. Bishop, M. S. Topp, D. Tzachanis, K. M. O’Dwyer, M. L. Arellano, Y. Lin, M. R. Baer, G. J. Schiller, M. Subklewe, M. Abedi, M. C. Minnema, W. G. Wierda, D. J. DeAngelo, P. Stiff, D. Jeyakumar, J. Dong, S. Adhikary, L. Zhou, P. C. Schuberth, B. Kharabi Masouleh, A. Ghobadi Moffitt Cancer Center, Tampa, FL; University of Washington, Fred Hutchinson, Seattle Cancer Care Alliance, Seattle WA; Memorial Sloan Kettering Cancer Center, New York, NY, United States of America; CHU Rennes, University Hospital Rennes, Inserm & EFS, Rennes, France; Vanderbilt University Cancer Center, Nashville, TN; UCSF Medical Center, San Francisco, CA, United States of America; Hôpital Saint-Louis, Paris; Service d’hématologie clinique et thérapie cellulaire Hôpital du Haut-Leveque CHU de Bordeaux, Bordeaux, France; The University of Chicago Medicine, Chicago, IL, United States of America; Medizinische Klinik und Poliklinik II, Universitätsklinikum Würzburg, Würzburg, Germany; University of California San Diego, San Deigo, CA; Wilmot Cancer Institute of University of Rochester, Rochester, NY; Winship Cancer Institute of Emory University, Atlanta, GA; Mayo Clinic, Rochester, MN; University of Maryland Marlene and Stewart Greenebaum Comprehensive Cancer Center, Baltimore, MD; David Geffen School of Medicine at UCLA, Los Angeles, CA, United States of America; Ludwig-Maximilians-Universität München, Munich, Germany; University of California Davis Comprehensive Cancer Center, Sacramento, CA, United States of America; University Medical Center Utrecht, on behalf of HOVON/LLPC, Utrecht, Netherlands; The University of Texas MD Anderson Cancer Center, Houston, TX; Dana-Farber Cancer Institute, Boston, MA; Loyola University Chicago Stritch School of Medicine, Maywood, IL; University of California Irvine Medical Center, Irvine, CA; Kite, a Gilead Company, Santa Monica, CA; Washington University School of Medicine, St Louis, MO, United States of America Background: Brexucabtagene autoleucel (KTE-X19) is approved in the US for the treatment of adult patients with R/R B-ALL based on the positive results of the ZUMA-3 study.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11790599	Consequently, NRF2 agonists like bardoxolone, sulforaphane, and dimethyl fumarate have been explored for cancer and metabolic diseases (Dodson et al., 2019).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9473868	Proteins were transferred to a PVDF membrane (Millipore, Eschborn, Germany) and then was blocked with 5% skim milk and immunoblotted with a primary antibody (Cell Signaling Technology, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6684588	Follistatin is a secreted protein that promotes muscle growth and function by sequestering these ligands extracellularly.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Follistatin", "is", "a", "secreted", "protein", "that"...
PMC11683240	α1AT deficiency is a genetic disorder that leads to unregulated tissue degradation in the lower respiratory tract and requires intravenous replacement therapy.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "α1AT", "defi...
PMC11546117	Primary cultures of hMECs (P8) were seeded at a density of 3.3 × 10 cells/cm on PET transwell inserts with a pore size of 0.4 µm and a surface area of 0.3 cm.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Since the treatment of T-PLL mostly remains an unmet clinical need, the finding of an increased apoptosis in Bz-treated cells paves the way for a deeper study on molecular mechanisms involved in the apoptosis of the leukemic clone.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11612626	Cells were washed and analyzed using an Attune NxT flow cytometer.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "washed", "and", "analyzed", "using", "an", "Attune", "NxT", "flow", ...
PMC3730428	Consistent with these findings, siRNA-mediated downregulation of either FLIP(L) or FLIP(S) enhanced caspase 3 processing and PARP cleavage in AT-IAP/TNFα-treated MPM Ren cells, although maximal levels of PARP cleavage were observed when both splice forms were simultaneously downregulated (Figure 4a).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "...
PMC11467800	Confocal microscopy z‐stack images showing the extravasated cells from the vasculature system of zebrafish larvae (trunk). (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Confocal", "microscopy", "z‐stack", ...
PMC11052306	Dendrimers possess a wide range of properties and are used in various fields, such as sensing, catalysis, electronics, photonics, and nanomedicine, to name a few .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9027909	Our analysis indicated that changes in both cytokines were not statistically significant.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "analysis", "indicated", "that", "changes", "in", "both", "cytokines", "we...
PMC11684821	Our recent methodology for identifying novel, stabilized Schiff base–bound MR1 ligands at the cell surface via crosslinking mass spectrometry (49) will hopefully aid the discovery of new, natural MR1 ligands, including those recognized by CAITs and other cancer-activated MR1-restricted T cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11766332	Notably, patients with DOLK-CDG may present with pure neurological phenotypes including ASD .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "patients", "with", "DOLK-CDG", "may", "present", "with", ...

PMC11476106

Given the rarity of childhood tumors, and in line with the ethical commitment to reducing animal experimentation, other material source options need to be explored for ES research.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

S. Aggarwal, S. Kumar, A. Bela, O. Topaloglu Health Economics and Outcomes Research; Veno-occlusive Disease Research Group, NOVEL Health Strategies, Columbia; HEOR; Systematic Literature Review Group, NOVEL Health Strategies, Chevy Chase, United States of America Background: Veno-occlusive disease (VOD), also called sinusoidal obstruction syndrome (SOS), is a potentially life-threatening complication of hematopoietic stem cell transplantation (HSCT) conditioning or high-dose nontransplant chemotherapy.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11367146

The validation of docking was confirmed based on low RMSD (<2 Å) of the redocked ligand from the orientation of the co-crystallized ligand and the reproduction of observed interactions from the pdb structure.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Eight cases (72.7%) experienced central nervous system (CNS) leukemia, and 3 had mediastinal invasion.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Eight", "cases", "(", ...

PMC11792740

Moreover, activating the MAPK/ERK pathway has been shown to enhance T-cell differentiation and effector functions, further boosting antitumor immunity .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "...

PMC11335267

In the first case, insulin promotes glucose uptake by target organs such as the liver, muscle, and adipose tissue, whereas in the second case, glucagon stimulates hepatic glucose release into the bloodstream.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11787355

Although i.v.

[ { "tags": [ "O", "O", "O" ], "tokens": [ "Although", "i.v", "." ] } ]

PMC11388384

One day after induction, cells were imaged to count cytonemes.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "day", "after", "induction", ",", "cells", "were", "imaged", "to", "count", ...

PMC10204952

Thus, adipose tissue may be detrimental to local high-concentration S1P treatment of TNBC.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "adipose", "tissue", "may", "be", "detrimental", "to...

PMC6450504

However, siRNA delivery into cancer cells either alone or in combination with other drugs is a challenging task which requires overcoming unique barriers including plasma instability, very low cellular internalization and immediate degradation within the endosomal compartments of the cancer cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11306331

B Representative images showing changes in 3xFUS (RFP channel) and candidate dissolver protein (iRFP), expressed in HEK293T cells, before and after 3 min stimulation with blue light.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9577200

The viability and proliferation of HeLa cells treated with chitosan were significantly decreased (p < 0.05) from 95.3% at 0% to 12.93%, 10.33%, and 5.93% at 0.2%, 0.4%, and 0.60% concentrations of chitosan, respectively.

[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10589262

We first aimed to exclude the possibility that ER- or PM-localized MT-KIT initiates downstream signaling.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "first", "aimed", "to", "exclude", "the", "possibility...

PMC11678448

During bacterial infections, IL-6 is vital for activating the STAT signaling pathway, enhancing neutrophil recruitment, and reducing the bacterial load, thereby playing a central role in the host’s defense against P. multocida .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11680562

Early apoptotic cells showed cytoplasmic shrinkage, nuclear condensation, and rounding.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Early", "apoptotic", "cells", "showed", "cytoplasmic", "shrinkage", ",", "nuclear", ...

PMC11591794

RT-qPCR experiments were performed on a total of 9 samples in all experimental groups; Proapoptotic P53 and Bax gene expressions were normalized to β-actin expression of the same sample, which was used as the internal control gene.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC3915447

The TMAOH (tetramethyl ammonium hydroxide) was used as the surfactant, in preparing the bare MNPs to maintain the aqueous solution of bare NPs in the state of colloidal suspension.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

It also revealed that NDMM with RI has poorer HR and OS than pts with normal renal function when both treated by a Brotezomib induction regimen followed by ASCT.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10440586

Correlation between CD99 and hypoxia response markers.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "between", "CD99", "and", "hypoxia", "response", "markers", "." ] } ]

PMC7154001

Most of the works in metabolite analysis were carried out using triple-quadrupole mass spectrometers.28,39,55,57,63,82 The main advantages include its superior quantitative capabilities in the multiple reaction monitoring (MRM) mode and the fact that a family of metabolites can easily be identified using neutral-loss and precursor ion scans.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6268318

A dose of 100 mg/kg of the extract was the most effective, among the doses tested.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "dose", "of", "100", "mg/kg", "of", ...

PMC8382973

This is the first study to evaluate the rectal and vaginal use of the 2P23 gel.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "is", "the", "first", "study", "to", "eva...

PMC11754291

Once all conditions for all three populations (N = 3) were treated, the cell media were thawed on ice and assayed following the manufacturer’s recommendations (Figure 4).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11194678

Scale bar: 15 μm. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bar", ":", "15", "μm", ".", "(" ] } ]

PMC11566417

ImageJ was used to calculate the percentage of area without cells (scratch percentage) at each timepoint.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ImageJ", "was", "used", "to", "calcula...

PMC9429973

Eight machine learning classifiers were utilized to produce eight candidate models.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Eight", "machine", "learning", "classifiers", "were", "utilized", "to", "produce", "eight",...

PMC11695546

H. pylori was then incubated for 72 h at 36°C.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H.", "pylori", "was", "then", "incubated", "for", "72", "h", "at", "36", ...

PMC10551595

Lipinski's rule of 5 was used for evaluating the drug likeness of GinA. Filters exploited in this analysis are the MW ≤500, MLogP (Lipophilicity) ≤4.15, number of HBA ≤10, and number of HBD ≤5.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11323699

There is no treatment for patients who relapse after treatment with PARPi (bottom panel) Schematic illustration of two major clinical challenges in ovarian carcinoma.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC8382973

MIC, minimal inhibitory concentration.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "MIC", ",", "minimal", "inhibitory", "concentration", "." ] } ]

PMC11342785

This manuscript includes a Supplemental Information file.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "manuscript", "includes", "a", "Supplemental", "Information", "file", "." ] } ]

PMC9429973

Aims: Describe our clinical experience and therapeutic management, also the clinical-biochemical alterations at diagnosis in a heterogeneous NDMM HRC`s cohort.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", ...

PMC2944824

Finally, Hr expression did not attenuate apoptosis in mouse embryonic fibroblasts from p53 knockout mice but was effective in mouse embryonic fibroblasts from wild type mice.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9065483

For instance, several viruses activate EGFR as part of their viral lifecycle to allow for their propagation.46, 47, 48, 49 Poxviruses, which are currently used in oncolytic virotherapy, in particular encode vaccinia growth factor, which has been shown to activate EGFR.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11718274

To characterize Y2O3NPs, X-ray diffraction (XRD) analysis was performed to estimate the crystal structure and purity of the purchased Y2O3NPs powders.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11590870

The microplate was incubated for 4 min at room temperature in the absence of light, mixed at medium speed for 1 min in the microplate reader, and read at a wavelength of 593 nm.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Image: Summary/Conclusion: This is one of the largest cohort studies of patients with MPN-SVT to date with over 70% diagnosed in the last 13 years.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11194678

STAU1 can enhance the translation of a specific mRNA population that contains an SBS in the 5′UTR or coding sequence regions with high GC content (Dugré-Brisson et al., 2005; Ricci et al., 2014).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11615743

Using this logic device, the L‐DNA probes demonstrated significant superiority in both PBS and FBS.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "this", "logic", "device", ",", "the", "...

PMC11047729

This indicates that this specific subunit is a key determinant of telomerase engagement in replication and may be the best option to choose while attacking this enzyme .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

This suggests improvements in Hb may be an important driver of morbidity and costs among patients with PNH.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "suggests", "improvements", "in", ...

PMC9429973

Global Health Status (GHS) was significantly worse with VMP vs Rd at 3 months (-3.3 vs +9.0; P=0.002), while from the 6-month time point onwards no differences can be found due to an improvement in GHS in the VMP arm (Figure).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11703896

The analysis of residue-level propensity utilizing Root Mean Square Fluctuation (RMSF) trajectories was performed with default restraint parameters.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "analysis", "of", ...

PMC10849234

Another limitation to the use of promyelocytic cell lines is possible inconsistency from line-to-line in different laboratories.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Another", "limitation", "to", "the", "use", ...

PMC11718817

Macrophages were polarized into M2-like CD206 cells by treatment with 20 ng/mL murine rm-IL-4 (Peprotech) and either activated with LPS and nigericin or left not activated before spheroid formation began.

[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10073922

The primer sequences for the real-time PCR analysis of NDRG2 and MMP-2 gene expressions All statistical analyses were performed using the SPSS software, version 15.0.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC10748106

Then, the MEP map was obtained (Figure 4), indicating the regions more susceptible to an electrophilic attack (yellow to red color) and those more susceptible to a nucleophilic attack (blue color).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

The % surface bound AMs over time at 37 °C vs 4 °C was analyzed.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "%", "surface", "bound", "AMs", "over...

PMC9848491

Multivariate Cox regression analysis showed that OS was independently associated with grade and risk score of UCEC patients ( Figure 3D ).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Multivariate", ...

PMC9693627

Precursors with a charge state of +1 and more than +5 were rejected and all measured precursors were dynamically excluded from triggering of a subsequent MS/MS for 20 s. The obtained raw data were processed using the MaxQuant software with the built-in search engine Andromeda .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11453018

E Bar graphs show RT-qPCR results illustrating unchanged EWS::FLI1 expression following P300/CBP inhibition, with a significant reduction in EWS::FLI1 target gene expression (NKX2.2 and CMYC) at 24 hours post-treatment.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11252033

Figure 2A shows the identified binding site highlighted in mesh, along with the key interacting residues that correspond to those found interacting with ASA in the docking calculation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11725127

Currently, most small molecules are designed to target a frequent KRAS mutant, KRAS, by forming a covalent bond with the cysteine 12 residue.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC9545474

ROS detection: Flow cytometry analysis of total induction of ROS in A2780 cells caused by exposure to complexes 6 and 8 was carried out using DCFH2‐DA assay.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10823017

The following primers were used in the experiment: PKC-ζ; forward: ACCCCTTCCTGGTCGGATTA; reverse: AGGGGGCTTCTGGAAGAGTA.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "following", "primers", "were", ...

PMC8345486

Compound 23 exerted similar effects on the sensitive cell line, A2780, and resistant cells, A2780cis and A2780cisR (Figure S2, Supplementary Materials).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11678448

This activation leads to the production of various pro-inflammatory cytokines, notably IL-6 and TNF-α .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "activation", "leads", "to", "the", "production", "o...

PMC9429973

Renal failure due to leukemic infiltration in chronic lymphocytic leukemia is extremely rare condition.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Renal", "failure", "due", "to", "leukemic", "infiltration", "in", ...

PMC11621565

Research has shown that LPS exposure induces neuroinflammation in SH-SY5Y cells, reducing cell viability.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Research", "has", "shown", "that", "LPS", "exposure", ...

PMC9268620

Following Giemsa staining, as shown in Figure 4, the untreated cells appeared healthy, some were round, and some were irregular in shape and size.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11380329

The metabolites in propolis from Egypt, Germany, and France are represented by aqua, green, and violet colors, respectively.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC11381192

CSI, cellular stress index; EFS, event‐free survival; PFS, progression‐free survival.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CSI", ",", "cellular", "stress", "index", ";", "EFS", ...

PMC11806818

Kim et al. developed a colorimetric and electrochemical dual-mode sensing platform for the breast cancer biomarker thioredoxin 1 (TRX1) based on the excellent peroxidase mimetic and electrocatalytic properties of Prussian blue nanoparticles (PBNPs), achieving selective and sensitive detection of TRX1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11377827

Comparable findings were observed using HIF1β ChIP-PCR (Fig. 6B), indicating that USP43 depletion altered the binding of the HIF-1 complex at selected HIF-1 loci.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11742290

Phosphorylation regulates signal transduction pathways, while ubiquitination targets LGR5 for proteasomal degradation, affecting its stability, localization, and function .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Phosphorylation", ...

PMC11700247

After identifying the more effective regimen, we combined it with CART-19 cell therapy in a dual-tumor mouse model, treating 1 tumor with RT.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11792888

Therefore, it is likely that the peptides in these fractions include some ion channel-interacting proteins, which may explain the in vitro cytotoxic effect of R. junceus scorpion venom described in this study.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7192625

Even if assortativity can summarise relationships between 3D structure and specific features with a single correlation coefficient, the complexity of genome architecture will rarely be fully resolved by this approach.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8740518

With VIP > 1.0 and P-value < 0.05, a total of 23 differential metabolites were annotated, in which isoleucine, 5-dihydrocortisol, and indole-3-acetamide had the highest diagnostic values based on ROC analysis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Current algorithms for patients with SM-AHN direct treatment to each of the components tailored to the patient.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Current", "algorithms", "for", "patients", "with"...

PMC11442172

Presumably, these improvements will generate novel and meaningful insights into cancer metabolism that will be more effectively translated into successful anti-cancer therapies.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Presuma...

PMC11541241

Phytophthora infestans causes late blight of potato (Solanum tuberosum) and tomato (Solanum lycopersicum) and incurs enormous quantitative and qualitative losses on agriculture (Fry, 2016; Haas et al., 2009; Wang & Long, 2023).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

No cardiovascular event was noted.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "cardiovascular", "event", "was", "noted", "." ] } ]

PMC11755467

Initially, Enoxacin has been reported to directly bind to the TRBP protein, which is an integral part of the RISC loading complex increasing its affinity to pre-miRNA or siRNA thus enhancing RNAi by facilitating processing and mature strand loading .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11740508

We found that these drugs synergized to produce smaller final populations in all 4 cell lines in a 4 day endpoint SRB assay (M231, SynergyFinder ZIP score 23.39; M231, ZIP score 16.37; M231, ZIP score 12.82; SUM149PT, ZIP score 18.379; Supplementary Fig. S1C-F; ).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Aims: We hypothesized that SOX11 may promote stem cell-like properties through the activation of stem cell-related genes, leading to an aggressive and incurable tumor in MCL patients.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10898159

The c-Abl Src homology 3 domain-binding protein-2 (SH3BP2) has 561 amino acids, containing an SH3-binding proline-rich region, an N-terminal pleckstrin homology (PH) domain, and a C-terminal SH2 domain .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10713411

The assessment of immune checkpoint expression revealed that the high-PRPCDGs-risk group presented higher expression levels of CTLA4, PDCD1, TIGIT, CD27, and LAG3 while CD274 was less expressed.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7759933

For the analysis, 30 spheroids per sample were collected and dissociated with enzymatic digestion and mechanical degradation, as described by Štampar et al. (2019).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6034753

Co-infection with MDV and CAV is common in many countries, CAV antigens are readily detectable in MD lymphomas, and the MDV-transformed T-lymphoblastoid cell lines such as MSB-1 is widely used for propagating CAV for vaccine production.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11306331

p > 0.05; *: p < 0.05, **: p < 0.01, ***: p < 0.001.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11755467

More specifically, our data raise the question if an analogy may be drawn to hsa-miR-122 and HCV, i.e., if there is a potential to develop a small-molecule drug targeting approach against hsa-miR-132.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6133382

HEK 293 GnTI suspension-adapted cells were obtained from ATCC (ATCC, Manassas, VA, US).

[ { "tags": [ "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HEK", "293", "GnTI", "susp...

PMC11680391

The meeting is set, and the topic discussed is the udder health, but they do not discuss it out of a common understanding of the aims and goals of the dairy farmer.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11055510

The circMAN1A2 vector, sh-circMAN1A2, and its control plasmids were transfected into 293T cells for lentivirus preparation, and the viruses were collected to infect A2780 and SKOV3 cells, and then puromycin was selected.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...

PMC11670954

The present study demonstrated that BA increased cell viability, preserved the integrity and permeability of the intestinal epithelial barrier, upregulated the expression of ZO-1 and Occludin, maintained the subcellular localization of these proteins, and inhibited the RhoA/ROCK2/MLCK signaling pathway.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

B. D. Shah, R. D. Cassaday, J. H. Park, R. Houot, O. O. Oluwole, A. C. Logan, N. Boissel, T. Leguay, M. R. Bishop, M. S. Topp, D. Tzachanis, K. M. O’Dwyer, M. L. Arellano, Y. Lin, M. R. Baer, G. J. Schiller, M. Subklewe, M. Abedi, M. C. Minnema, W. G. Wierda, D. J. DeAngelo, P. Stiff, D. Jeyakumar, J. Dong, S. Adhikary, L. Zhou, P. C. Schuberth, B. Kharabi Masouleh, A. Ghobadi Moffitt Cancer Center, Tampa, FL; University of Washington, Fred Hutchinson, Seattle Cancer Care Alliance, Seattle WA; Memorial Sloan Kettering Cancer Center, New York, NY, United States of America; CHU Rennes, University Hospital Rennes, Inserm & EFS, Rennes, France; Vanderbilt University Cancer Center, Nashville, TN; UCSF Medical Center, San Francisco, CA, United States of America; Hôpital Saint-Louis, Paris; Service d’hématologie clinique et thérapie cellulaire Hôpital du Haut-Leveque CHU de Bordeaux, Bordeaux, France; The University of Chicago Medicine, Chicago, IL, United States of America; Medizinische Klinik und Poliklinik II, Universitätsklinikum Würzburg, Würzburg, Germany; University of California San Diego, San Deigo, CA; Wilmot Cancer Institute of University of Rochester, Rochester, NY; Winship Cancer Institute of Emory University, Atlanta, GA; Mayo Clinic, Rochester, MN; University of Maryland Marlene and Stewart Greenebaum Comprehensive Cancer Center, Baltimore, MD; David Geffen School of Medicine at UCLA, Los Angeles, CA, United States of America; Ludwig-Maximilians-Universität München, Munich, Germany; University of California Davis Comprehensive Cancer Center, Sacramento, CA, United States of America; University Medical Center Utrecht, on behalf of HOVON/LLPC, Utrecht, Netherlands; The University of Texas MD Anderson Cancer Center, Houston, TX; Dana-Farber Cancer Institute, Boston, MA; Loyola University Chicago Stritch School of Medicine, Maywood, IL; University of California Irvine Medical Center, Irvine, CA; Kite, a Gilead Company, Santa Monica, CA; Washington University School of Medicine, St Louis, MO, United States of America Background: Brexucabtagene autoleucel (KTE-X19) is approved in the US for the treatment of adult patients with R/R B-ALL based on the positive results of the ZUMA-3 study.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11790599

Consequently, NRF2 agonists like bardoxolone, sulforaphane, and dimethyl fumarate have been explored for cancer and metabolic diseases (Dodson et al., 2019).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9473868

Proteins were transferred to a PVDF membrane (Millipore, Eschborn, Germany) and then was blocked with 5% skim milk and immunoblotted with a primary antibody (Cell Signaling Technology, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6684588

Follistatin is a secreted protein that promotes muscle growth and function by sequestering these ligands extracellularly.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Follistatin", "is", "a", "secreted", "protein", "that"...

PMC11683240

α1AT deficiency is a genetic disorder that leads to unregulated tissue degradation in the lower respiratory tract and requires intravenous replacement therapy.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "α1AT", "defi...

PMC11546117

Primary cultures of hMECs (P8) were seeded at a density of 3.3 × 10 cells/cm on PET transwell inserts with a pore size of 0.4 µm and a surface area of 0.3 cm.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Since the treatment of T-PLL mostly remains an unmet clinical need, the finding of an increased apoptosis in Bz-treated cells paves the way for a deeper study on molecular mechanisms involved in the apoptosis of the leukemic clone.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11612626

Cells were washed and analyzed using an Attune NxT flow cytometer.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "washed", "and", "analyzed", "using", "an", "Attune", "NxT", "flow", ...

PMC3730428

Consistent with these findings, siRNA-mediated downregulation of either FLIP(L) or FLIP(S) enhanced caspase 3 processing and PARP cleavage in AT-IAP/TNFα-treated MPM Ren cells, although maximal levels of PARP cleavage were observed when both splice forms were simultaneously downregulated (Figure 4a).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "...

PMC11467800

Confocal microscopy z‐stack images showing the extravasated cells from the vasculature system of zebrafish larvae (trunk). (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Confocal", "microscopy", "z‐stack", ...

PMC11052306

Dendrimers possess a wide range of properties and are used in various fields, such as sensing, catalysis, electronics, photonics, and nanomedicine, to name a few .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9027909

Our analysis indicated that changes in both cytokines were not statistically significant.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "analysis", "indicated", "that", "changes", "in", "both", "cytokines", "we...

PMC11684821

Our recent methodology for identifying novel, stabilized Schiff base–bound MR1 ligands at the cell surface via crosslinking mass spectrometry (49) will hopefully aid the discovery of new, natural MR1 ligands, including those recognized by CAITs and other cancer-activated MR1-restricted T cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11766332

Notably, patients with DOLK-CDG may present with pure neurological phenotypes including ASD .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "patients", "with", "DOLK-CDG", "may", "present", "with", ...