PMCID string | Sentences string | ner list |
|---|---|---|
PMC11705901 | One way of characterizing OXT function that has received considerable support is correlating variations in OXTR polymorphisms with complex human traits . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"One",
"way",
"of"... |
PMC11040965 | Starting at seeding, cells were stimulated with 10 µg/mL NY-ESO-1157–165 (SLLMWITQV) peptide (Proimmune) in culture medium. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Starting",
"at",
... |
PMC9429973 | Bulk RNAseq of FACS-sorted GFP+ TCF3-PBX1 leukemia cells were clustered and CNS cells separated from other tissues. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Bulk",
"RNAseq",
"of",
"FACS-sorted",
"GFP+",
... |
PMC8557138 | This model highlighted the need for the incorporation of immune cells in 3D models focusing on constructing translational models mimicking tumor microenvironment (Zervantonakis et al. 2012). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7887261 | Whole exome plus targeted sequencing of germline DNA was performed on 1045 LC cases and 885 controls in the discovery set. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Whole",
"exome",
... |
PMC10969097 | In the control group, mice received daily oral administration and weekly intraperitoneal injections of an equivalent volume of saline solution, as per the other groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11575040 | After washing three times with PBS-Tween, immunoreactive bands were detected using an Amersham ECL kit (Amersham Pharmacia Biotech). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"washing",
... |
PMC11564322 | Interestingly, in the K562 cell line, we observed a reverse relationship, namely a decrease in the c-SRC kinase expression caused by the VGVAPG peptide, in contrast to VVGPGA, which was able to increase the expression of this protein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10565698 | H. Verification of the binding of TCF12 to miR-211-5p. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"H.",
"Verification",
"of",
"the",
"binding",
"of",
"TCF12",
"to",
"miR-211",
"-",
... |
PMC2196094 | 8 out of 11 of the clones had inserts of a size of 600 bp or larger whereas the remaining clones had inserts that were too small to be visualized on a 2% agarose gel (probably ∼50 bp). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8998437 | In contrast, neither the transcripts of CCR1 or CCR2 nor their proteins were detected in the EBV-negative and EBV-carrying BL cell lines with latency I. Enhanced transcription of CCR2, CCR7, and CCR9 was previously detected in tonsillar B cells upon EBV infection in vitro . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10652261 | HRMS (m/z): [M + H] calcd for C24H26N4S: 403.1951. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"HRMS",
"(",
"m/z",
"):",
"[",
"M",
"+",
"H",
"]",
"c... |
PMC11767793 | A stock solution of MTS was diluted 5x in the appropriate colorless medium without a serum and antibiotic. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"stock",
"solution",
"of",
"MTS",
... |
PMC9577200 | P53 oligonucleotide primers were F 5′CCTCAGCATCTTATCCGAGTGG3′ and R5′TGGATGGTGGTACAGTCAGAGC3′ (ACC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"P53",
"oligonucleotide",
"primers",
"were",
"F",
"5′CCTCAGCATCTTATCCGAGTGG3′",
"and",
"R5′TGGATGGTGGTACAGTCA... |
PMC10812665 | The finding is particularly significant in the light of our data that non-modified Met as such was not reduced, and thus available within the cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11544771 | Cells, seeded in 96-well plates (at a density of 4000–6000 cells per well for cell viability assay) or in 6-well plates (at a density of 5 × 10 cells per well for cell proliferation assay) in triplicates, were grown under a standard culture condition. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7351993 | The position of the sample stream, the diameter of the sample stream, and the width of the sort window were verified to be at the center of the microchannel, 20 µm, and ~3 ms, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11676674 | In human intestinal epithelial cells, C. monspeliensis leaf extract induced the expression of enzymes related to intracellular ATP production and boosted intracellular ATP synthesis, suggesting potential antiaging properties . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Amplification-free WGS was performed with a median coverage of 103x (Illumina, San Diego, CA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Amplification-free",
"WGS",
"was",
"performe... |
PMC11612315 | of 10 μg of GLP-1(7–36) on heat sensitivity via the Hargreaves test (mean ± S.E.M., n = 5). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"of",
"10",
... |
PMC10823017 | We performed an immunoprecipitation (IP) study of PKC-ι to evaluate the interaction of c-Myc because the upstream and downstream protein molecules must associate with each other to establish a signaling cascade. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Demographics of the enrolled population include: 48% adolescents (age 12-18 years), 42% male, 71% with warts, 81% with nonsense CXCR4 mutations, and 19% with frameshift CXCR4 mutations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10812665 | The NeuriTox assay, also called UKN4, was developed about 10 years ago, as a high-throughput NAM to assess developmental neurotoxicity (DNT) hazard . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC4395774 | To test for normal perforin expression and processing in a perforin-deficient cell line, we transduced the RBL-1 cell line (rat basophilic leukemia) which is able to process and deliver perforin to secretory granules. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11791203 | Natural resources provide valuable medicinal components that are highly sought after as alternatives to synthetic drugs for treating serious diseases like cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Natural",
"r... |
PMC9429973 | Median PFS was 4.2 months (95% CI, 3.5-6) (see Figure). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Median",
"PFS",
"was",
"4.2",
"months"... |
PMC10748106 | The first iridoids closely resembled Genipin in terms of size (area and volume) and shape, as evidenced by their ovality values (ranging from 1.34 to 1.36). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11463018 | Further screening of representative 19 demonstrated that these triazolopyridines had broad-spectrum efficacy against solid tumour cell lines such as colon, melanoma, ovarian, and breast cancers as well as hematopoetic cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11612626 | A total of 5,368 peptides were eluted from the cells treated with compound A as compared with 4,063 peptides eluted from control-treated cells (Fig. 5A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11763111 | p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001; ns, not significant LLT1 overexpression promoted in vitro cytotoxicity and in vivo anti-tumor activity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | All markers were evaluated using commercially available monoclonal antibodies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"markers",
"were",
"evaluated",
"using",
"commercially",
"available",
"monoclonal",
"antibodies",
"."... |
PMC3675084 | We reported that BPR0L075 displayed vascular disrupting activity by inducing rapid, albeit, temporary tumor vascular shutdown and leading to reduction of tumor perfusion in orthotopic human breast cancer xenografts . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11486946 | In contrast with these five non-EGFR-TKI compounds, when treated with the other two compounds, glafenine and nilotinib, the cells exhibited no reduction of EGF-induced EGFR phosphorylation or downstream ERK (Fig. 4b) and showed no obvious internalization or degradation of EGFR (Fig. 4c and e). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC3765139 | Na8, D10, and HBL cells formed spheroids on poly-HEMA-coated flasks. | [
{
"tags": [
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Na8",
",",
"D10",
",",
"and",
"HBL",
"cells",
"formed",
... |
PMC7433824 | Next, the gels were stained overnight in Colloidal Coomassie Blue (CBB) solution (500 mL CBB/gel). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Next",
",",
"the",
"ge... |
PMC11033180 | Sale bars: 30 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Sale",
"bars",
":",
"30",
"μm",
"."
]
}
] |
PMC9429973 | This phenomenon leads to a reduction of B and T cell compartments and immune dysfunction. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"phenomenon",
"leads",
"to",
"a",
"reduction",
"of",... |
PMC9960565 | Hemotoxicity assay was used to study the interaction of the prepared cisplatin-metallodendrimers with red blood cells by measuring the release of hemoglobin through the membrane disruption of these cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9966931 | In comparison with C. gloeosporioides, hybrid molecules exerted lower antifungal efficacy against F. oxyposrum. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"comparison",
"with",
"C.",
"gloeosporioides",
",",
"h... |
PMC11594588 | Rates of oxygen consumption are calculated from the changes in the fluorescence signal over time. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Rates",
"of",
"oxygen",
"consumption",
"are",
"calculated",
... |
PMC11750712 | Cohort 1, 25 × 10; cohort 2, 75 × 10; cohort 3, 225 × 10; cohort 4, 450 × 10. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11155445 | Shafique et al. synthesized a novel series of heterocyclic compounds, Nimesulide–iminothiazoline conjugates, first by reduction of the nitro group to form corresponding amine followed by its conversion to substituted acyl thioureas (8a–j). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10482220 | 32P-labeling and phosphopeptide mapping were performed according to Gallouzi et al. (1998). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"32P-labeling",
"and",
"phosphopeptide",
"mapping",
"were",
"performed",
... |
PMC10747160 | This was important because although the antiviral/prophylactic capability of recombinant Q-Grft has been verified to match WT-Grft in the literature, there does not yet appear to be published verification that recombinant production of M78Q Griffithsin in E. coli does indeed produce a protein that exhibits structural similarity to WT-Grft . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Therapeutic approaches were categorized as best supportive care (BSC) only, low-dose chemotherapy, immunomodulatory treatment, hypomethylating agents (HMA), intensive chemotherapy (IC) and allogeneic stem cell transplantation (alloSCT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11578343 | Broad viscoelastic heterogeneity was observed between the two groups and among single cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Broad",
"viscoelastic",
"heterogeneity",
"was",
"observed",
"between",
"the",
... |
PMC11599565 | II: Expression of MGMT (Methylated-DNA–protein-cysteine methyltransferase) DNA repair enzyme in OC236, sorted by EpCAM expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"II",
":",
... |
PMC11095939 | NIH3T3 cells were synchronized in G0 phase by SS as previously described, followed by 15% FBS stimulation for 3 or 6 hr. | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"token... |
PMC11413393 | Cells were lysed and proteins were extracted in ice cold RIPA buffer (150 mM NaCl, 1.0%NP40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0) supplemented with HaltTM Protease Inhibitor Cocktail (Thermo # 78425). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | In line with mitochondrial dysfunction, in vitro inhibition of OXPHOS did not affect ATP levels in th3 HSCs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"line",
"with",
"mitochondri... |
PMC9672323 | Significant changes are indicated with asterisk (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8978939 | Since VBC complex was evidenced for both variants, we sought to evaluate its functionality. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Since",
"VBC",
"complex",
"was",
"evidenced",
"for",
"both"... |
PMC4816271 | Activation of the suicide gene in transduced PBMCs through a 72 hour culture with CID reduced cytokine responses towards Lan-1 cells to levels comparable to those seen in the presence of GD2 negative A204 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11665584 | Immune cell subtypes were significantly changed with PITX1 expression in the wounds. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immune",
"cell",
"subtypes",
"were",
"significantly",
"changed",
"with",
"PITX1",
... |
PMC11190062 | Thus, TLR signaling may interfere with the efficacy of immune therapy in a broader sense. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"TLR",
"signaling",
"may",
"interfere",
... |
PMC9143157 | For detecting the released THP from P-THP, an equal volume of 0.2 M sodium bicarbonate buffer (pH 9.8) was added to the cell lysate and mixed, to which 600 μL of chloroform was added and mixed vigorously. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11291490 | After washing with PBS, Alexa Flour 488-labeled goat anti-mouse IgG (Cat# A32723, ThermoFisher, USA) as the secondary antibody at 1:500 dilution was added and the cells were incubated in the dark. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11699042 | Each sample was individually normalized by performing a background correction (shifting of the 5% percentile of negative control probe intensities to 0) and a dye-bias correction (scaling the mean of normalization control probe intensities to 10,000) for both color channels. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11548041 | PLD01 has a size of 47 nucleotides and possesses a stem-loop structure with two internal loops and single stranded segments at both termini (Figure 1A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11155445 | A series of piperazine-containing thioureas were synthesized by Sashankh et al. for the treatment of colon and rectal cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"series",
"of",
"piperazine-c... |
PMC11172027 | A cytotoxicity assay (WST assay) was carried out to determine the viability all used cancer cell lines as used in our previous article . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9386809 | 320 mg (95% yield); yellow solid mp 95–97 °C; H NMR (400 MHz, DMSO-d6): δ 2.25 (s, 3H, CH3), 5.78 (s, 1H, CH), 6.81–7.36 (m, 14H, Ar and CH=C), 8.34 (s, 1H, NH), 10.82 (d, 1H, J = 1.8 Hz NH); C NMR (100 MHz, DMSO-d6): δ 21.1, 79.7, 111.8, 111.9, 118.5, 118.6, 118.7, 119.6, 121.3, 123.8, 123.9, 127.1, 128.7, 129.1, 135.0, 136.9, 137.0, 142.4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | IMGT/V-QUEST tool was used to annotate IGHV-D-J and mutational status (cut-off 98%) according to ERIC guidelines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"IMGT/V-QUEST",
"tool",
"was",
"us... |
PMC7759933 | In HepG2 spheroids, the expression of hepatic markers and metabolic genes from phases I and II changed over time of cultivation with important changes observed by day 7. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11265931 | In this study, we demonstrated a strategy to isolate exosome-like nanovesicles from garlic. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"this",
"study",
",",
"we",
"demonstrated",
"a",
"strategy"... |
PMC9429973 | Summary/Conclusion: We present a 3D culture system that underlines the role of T cells in sustained CLL proliferation, permitting investigation of CLL cells in the context of a protective niche consisting of multiple cell types, thereby opening up new avenues for clinically useful applications. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11612508 | The GO/CS/IO microspheres, both with and without temozolomide loading, demonstrated negligible cytotoxic effects on normal fibroblast L929 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"The",
"GO/CS/IO",
"... |
PMC3765139 | CD133+ D10 cells have a statistically significant higher clonogenic capacity as compared to CD133- D10 cells (p ≤ 0.001). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CD133",
"+",... |
PMC11714165 | Therefore, we evaluated the impact of NBD‐F on the viability of 143B cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"we",
"evaluated",
"the",
"impact",
"of",
... |
PMC10530622 | Moreover, more clinical data in models of cardiometabolic disease and a better understanding of the particularities of oxalate metabolism regulation in particular contexts (e.g., inflammation, hypoxia) and different precursors’ availability and metabolic shifts will shed light on this idea. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11721295 | We then filtered data manually to include only cells with 800–100,000 transcripts and less than 15% mitochondrial genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"then",
"filtered",
"data",
... |
PMC11409031 | However, due to significant tumor heterogeneity, a complex tumor microenvironment, and the development of resistance to these treatments, the majority of OV patients eventually face recurrence and disease progression [, , ]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11352311 | Finally, export the analyzed targets. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Finally",
",",
"export",
"the",
"analyzed",
"targets",
"."
]
}
] |
PMC11757230 | By contrast, when LL cell lines were co-cultured with cADSCs without direct cell-to-cell contact using Transwell inserts (which allow diffusion of soluble factors but prevent physical contact), proliferation was not inhibited in any LL cell line and was instead promoted in Ema cells (Fig. 1b).Fig. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC2118063 | In brief, total RNA was collected using the initial steps of the TRIzol protocol (Invitrogen). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"brief",
",",
"total",
"RNA",
... |
PMC11723947 | This study on PBMC biobank from healthy adult subjects was approved by the French South-West & Overseas ethical committee and was registered at the French Ministry of Higher Education and Research (DC-2015-2488). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11401350 | Survival increased up to 70% compared to non-treated mice . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Survival",
"increased",
"up",
"to",
"70",
"%",
"compared",
"to",
"non-treated",
"mice",
".... |
PMC9386809 | 332 mg (93% yield); white solid mp 75–77 °C; H NMR (400 MHz, CDCl3): δ 1.34 (br s, 2H, NH), 5.88 (s, 1H, CH), 6.56 (s, 2H, CH=C), 7.06 (t, 2H, J = 7.6 Hz, Ar), 7.22 (m, 4H, Ar), 7.34 (d, 2H, J = 8.6 Hz, Ar), 7.39 (d, 2H, J = 8.6 Hz, Ar), 7.77 (s, 2H, NH); C NMR (100 MHz, CDCl3): δ 39.7, 111.4, 119.2, 119.5, 119.9, 122.2, 123.8, 127.0, 128.5, 130.3, 131.9, 136.8, 142.7. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7519871 | However, development of chemo-resistance to cisplatin, intrinsic or acquired, seriously compromises the treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"development",
"of",
"chemo-resistance",
... |
PMC9429973 | Furthermore, profile II samples had significantly higher basal p53 protein levels than profile I samples, where p53 was generally detectable only upon DNA damage. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11093197 | RB1‐depleted cells can be transformed by oncogenic RAS once they evade the senescence program. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RB1‐depleted",
"cells",
"can",
"be",
"transformed",
"by",
"oncogenic",... |
PMC11334037 | PI3K-Akt signaling is the IGF2-IGF1R signal principal downstream target. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PI3K-Akt",
"signaling",
"is",
"the",
"IGF2-IGF1R",
"signal",
"principal",
"downstream",
"target",
"."
]... |
PMC11381192 | Identification of differential gene expression was carried out using ‘limma’ package. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Identification",
"of",
"differential",
"gene",
"expression",
"was",
"carried",
... |
PMC9429973 | To determine the signaling and cellular consequences of MYCT1 loss we performed phospho-proteomics, western blot, and single cell RNAseq in ECs and/or human HSPCs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC9429973 | Hospital discharge after a HIDAC cycle is safe with the use of G-CSF. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Hospital",
"discharge",
"after",
"a",
"HIDAC",
"cycle",
"is",
"safe",
... |
PMC11774747 | Autologous Chimeric Antigen Receptor T cell (CAR-T cell) therapy, while highly personalized and effective, faces several significant limitations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Autologous",
... |
PMC11342785 | Our above results show that synMAPs that directly fuse TPPP to droplet-forming sequences drive constitutive assembly of higher-order MT architectures in cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"above... |
PMC4005030 | It has a mild phenolic odour. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"has",
"a",
"mild",
"phenolic",
"odour",
"."
]
}
] |
PMC11706491 | One limitation is related to the specificity of the probes used in the FUCCI system. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"One",
"limitation",
"is",
"related",
"to",
"the",
"specific... |
PMC8481254 | Scale bar: 20 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Scale",
"bar",
":",
"20",
"μm",
"."
]
}
] |
PMC11740508 | E, F Death in BRCA1 mutant ovarian cancer cell lines COV362; JHOS2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O"
],
"tokens": [
"E",
",",
"F",
"Death",
"in",
"BRCA1",
"mutant",
... |
PMC11541241 | Potential homologues of YPK2 are identified in all the species studied. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Potential",
"homologues",
"of",
"YPK2",
"are",
"identified",
"in",
"all",
"the",
"spe... |
PMC9646302 | The weight, volume, and protein expression levels of migration-, invasion-, and proliferation-associated markers in LAPTM5-overexpressed mice were higher than those in the control group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11604768 | Displayed are the fold change values for all promoters that were significantly altered by treatment in at minimum one comparison. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Displayed",
"are",
"the",
... |
PMC4112127 | Many patients lack an identifiable risk factor other than age, making early diagnosis of CC extremely difficult . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Many",
"patients",
"lack",
"an",
"iden... |
PMC9429973 | -MRD (532 vs 611): a marked decrease in activity from March-May, with the biggest drop in April (-56%), and a marked total decrease (-13%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11727062 | The study revealed that this combination not only suppressed the proliferation of A375 cells but also triggered apoptosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"study",
"revealed",
"that",
... |
PMC11049294 | The data were aligned to hg38, and the on-target GLA gene sequence was evaluated in the Jurkat GLA KO and Jurkat mock-transfected cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"... |
PMC9429973 | Thus, is important to establish molecular mechanisms portending resistance in order to develop effective therapeutic strategies to overcome or prevent drug resistance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
... |
PMC11155445 | Compounds (156s and 156t) having chlorine substituents on benzene ring of phenoxy moiety had an inhibitory activity of less than 30% at a concentration of 1 ppm (Fig. 83). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.