OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC11066331	The physico-chemical reasons of batch effects involve the process of sample-matrix crystallization, where the size of co-crystals and the effect of "sweet spots" cause variations in the measured intensities All of these discrepancies create an overall undesired variability in the measurement, which is usually referred to as the 'batch effect'.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10470467	This research was supported by National Natural Science Foundation of China (Grant No. 81873998) and Chongqing Young and Middle-aged Medical High-end Talent Studio (Grant No. cstc2022ycjh-bgzxm0103).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11033180	The Sema5A-Fc, corresponding to a soluble protein containing the extracellular domain of Sema5A has previously been shown to be fully functional.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Sema5...
PMC11730320	B Patient CD4-CD8- DN Vδ1+ and Vδ1-Vδ2- populations demonstrate a primarily naive phenotype, while CD8lo/int subsets are mostly CD28-CD45RA+.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", "Patient", "C...
PMC8750422	GPCRs are known to be involved in various intracellular processes such as cell growth, proliferation, survival, and tumorigenesis through the AKT signaling pathway .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11306019	Golden et al. demonstrated the antagonistic capabilities of EGCG analogs against BTZ (Golden et al., 2009).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Golden", "et", "al.", "demonstrat...
PMC11307990	More importantly, DNA nanotapes can achieve cellular membrane retention and surface receptor inhibition.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "More", "importantly", ",", "DNA", "nanotapes", "can", "achieve", ...
PMC11680578	PTX displayed an IC50 value of 25 nM, whereas RGZ exhibited an IC50 value of 25 µM (Fig. 1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PTX", "displ...
PMC11320834	Triapine is a small molecule inhibitor of ribonucleotide reductase (RNR), which blocks de novo dNTP production.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Triapine", "is", "a", "small", ...
PMC11381192	D, E) Assessment of immune scores and tumour purity using ESTIMATE algorithm between CSI risk groups. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D", ",", "E", ")", "Assessm...
PMC9429973	Summary/Conclusion: Overall, we demonstrate that NPM1c directly regulates a network of leukemia self-renewal associated genes through direct chromatin interaction.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":...
PMC11575040	Finally, Chen et al. reported that HCG11, a tumor suppressor, regulated the AKT/mTOR pathway and inhibited cell growth in ovarian cancer by modulating the miR-1270/PTEN pathway.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6642070	Indeed, fluvastatin increased MDM2 phosphorylation dose-dependently (Fig. 4b) and enhanced the binding of MDM2 with p53 proteins (Fig. 4c).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9784246	The MS operated in the negative mode with a capillary voltage of 30 eV, 3 kV; desolvation temperature, 450 °C; cone gas flow, 50 L/h; and desolvation gas flow, 900 L/h.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11468365	MultiComb demonstrates high , , and for synergy and sensitivity prediction, and achieves lower , , and compared to other deep learning models.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC7762347	The statistical significance between solvent control and treated groups was analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison test using Graph-Pad Prism 6 software (Graph-PadSoftware Inc., La Jolla, CA, USA) (* p < 0.05).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11277157	For DJ-1 (376 nt), the primers were F: GCCTGGTGTGGGGCTTGTAA and R: GCCAACAGAGCAGTAGGACC.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "DJ-1", "(", "376", "nt", ")", ...
PMC11248911	Redundant descriptors “low variance descriptors” that do not have an added value to the model were first filtered out leaving 299 descriptors for model construction.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8633974	This was affirmed by monitoring culture cell supernatants for progeny virion production by RT activity (Figure 5f) and by polymerase chain reaction (PCR) of cell lysates with HIV-1 specific primers spanning the subgenomic viral DNA fragments of the gRNAs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11093197	Myc plays a pivotal role in promoting anabolic metabolism which is primarily driven by the degradation of glucose and glutamine. ,	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Myc", "plays", "a...
PMC9429973	Results: Ten patients were included in the study.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Ten", "patients", "were", "included", "in", "the", "study", "." ] } ]
PMC11680562	A localized therapeutic gel delivering CuO NPs and 5-Fu using pectin and xanthan gum may effectively treat cervical cancer.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "localized", "therapeutic", "...
PMC9429973	Chromosome 17 abnormalities were found in 7 MCL patients with TP53 mutations out of 11 studied.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Chromosome", "17", "abnormalities", "were", "found", "...
PMC11544122	Further work is required to fully explore this possibility.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "work", "is", "required", "to", "fully", "explore", "this", "possibility", "." ] } ]
PMC11544771	In addition, our immunofluorescence staining also showed that approximately 5% of A549 cells were γH2AX-positive when treated with vehicle (DMSO), while about 55% and 15% cells were γH2AX-positive when treated with CPX (5 μM) and PRE (20 nM) for 48 h, respectively (Figure 3C,D).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11201989	The presence of the polycystins in cilia of renal epithelial cells, for example, regulates calcium influx and their dysfunction leads to aberrant calcium influx and uncontrolled cyst formation , and retention of Hh receptors in embryo cilia could lead to various developmental manifestations .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	In addition, blast lysis is increased vs control.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "blast", "lysis", "is", "increased", "vs", "control", "." ] } ]
PMC10606998	Thus, both viability tests confirm the appearance of a combined effect upon X-ray irradiation of the cells containing nanoparticles.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "both", "v...
PMC11139449	Therefore, using the genomic primer as the forward and the vector primer as the reverse primer confirmed the integration of the donor vector at the targeted site in CASP8AP2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786704	4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), Streptozotocin, Lipopolysaccharide (LPS) and Anti-mouse ELISA kits for IL-6, TNF-α, IL-1β and IL-10 were supplied by Beijing Solarbio Science & Technology Co., Ltd. Serum-free Cell cryopreservation solution (C40050) and universal antibody diluent (WB100D) were purchased from New Cell & Molecular Biotech.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11218145	Having found that TB modulated the intracellular Ca dynamics, we asked whether this compound could also modulate the mitochondrial metabolism.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Having", "found", ...
PMC11496491	The pie chart shows the cell component classifications. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "pie", "chart", "shows", "the", "cell", "component", "classifications", ".", "(" ] } ]
PMC11612508	In our previous review article, hydrogel microspheres-based nanocomposites in novel drug delivery platforms were investigated in detail.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "our", "previous", "review", "art...
PMC9429973	Results: We found increased systemic levels of FGF23 and an unbalanced iFGF23/cFGF23 ratio in favor of cFGF23.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "We", "found", "increas...
PMC11747949	Cells were analyzed by flow cytometry using BD FACS Symphony A1 flow cytometer (USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "analyzed", "by", "flow", "cytometry",...
PMC11755624	Furthermore, the development and implementation of lncRNA-based therapeutics is difficult due to the potential context-dependent activity of these molecules.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "the", ...
PMC11470999	However, these studies did not clearly identify its direct target proteins, thus limiting the clinical application of PF as an anticancer agent.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9917080	Thus, sorafenib has a weak effect on the gene expression of selenoproteins and selenium-containing proteins in glioblastoma cells after 24 and 48 h of exposure.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11680562	The green-synthesized CuO NPs exhibited a zeta potential of −23.7 mV, a particle size of approximately 26 nm, and spherical morphology.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11544122	It is important to note that this interpretation is complicated by the fact that β-arr1 and SNX9 also interact downstream of CXCR4.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", ...
PMC9817179	To understand what factors are underlying the diverging fixation artifact of in vivo LLPS systems, we performed the above-described fixation imaging assay with glycine added to live cells prior to PFA fixation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9516447	Here in our studies, we have demonstrated that the anti-GRP78 small molecule inhibitors HA15 and YUM70 can suppress multiple types of oncogenic KRAS protein expression in PDAC, LUAD and colorectal cancer cell lines, leading to apoptosis and loss of cell viability.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11481779	Examples include Stable Diffusion or DALL-E 2 .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Examples", "include", "Stable", "Diffusion", "or", "DALL-E", "2", "." ] } ]
PMC11026382	a Schematic of metabolic control.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "a", "Schematic", "of", "metabolic", "control", "." ] } ]
PMC11704135	Broadly speaking, the mechanism of action of pyrimidine derivatives has been elucidated to involve the inhibition of various processes such as FtsZ (an essential protein for bacterial cell division) polymerization, DHFR (Gram-negative bacteria enzyme responsible for its existence) inhibition, modulation of GTPase activity, and interference with bacterial cell division.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11423992	C34565, Invitrogen).	[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "C34565", ",", "Invitrogen", ")", "." ] } ]
PMC11291490	Until now, the TMUV exhibits the capacity to infect a range of bird species, including chickens, ducks, geese, and sparrows.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11802929	Created in BioRender.	[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Created", "in", "BioRender", "." ] } ]
PMC11286266	ER stress treatments with 2.5 µg/ml Tm lasted 20 hr.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ER", "stress", "treatments", "with", "2.5", "µg/ml", "Tm", "lasted", "20", "hr", "." ]...
PMC9429973	This descriptive analysis presents the safety data for all Part 1 pts and the efficacy data for all Part 1 pts with ≥2 post-baseline efficacy assessments by the cut-off date (14/01/2022).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10969097	These results, despite having been achieved using an isolated compound, are in line with the results of the study included in this work and presented by Zhang et al. , where a polysaccharide extracted from Lentinula edodes was able to negatively regulate the JAK/STAT oncogenic signalling pathway .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11583690	Our assessment of their drug loading capability consistently shows that when compared with MSN, BPMO loads DTX more efficiently.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "assessment", "of", ...
PMC11397654	Compounds 2–6 significantly increased the apoptotic cell death.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compounds", "2–6", "significantly", "increased", "the", "apoptotic", "cell", "death", "." ] } ]
PMC9065483	In the case of two IFN-2 cytokines, CXCL9 and CXCL10, the interaction between STAT1 and NF-κB has shown to increase recruitment of a third protein, CREB-binding protein to subsequently increase RNA polymerase II transcription activity at their respective promoters.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Patients were enrolled between 2009–14 and followed for up to 5 years.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "were", "enrolled", "between", "2009–14", "and", "followed", "for", "...
PMC11535726	Mycelium partly immersed, on the substrate, pale brown to dark brown.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mycelium", "partly", "immersed", ",", "on", "the", "substrate", ",", ...
PMC11478724	This research uses GraphPad Prism program version 8.2.1.(441, ©1992-2019 GraphPad Software, Inc).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "research", "uses", "GraphPad", ...
PMC11759543	5637 and BFTC 905 cells were pretreated with 40 μM Z-LEHD-FMK for 1 h, then cultured with seleted doses of doxorubicin and vorinostat for 24 h. Protein expression were analyzed by Western blot. (	[ { "tags": [ "B-CellLine", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC9014716	Previous studies have shown that Huaier granules or extract can down-regulate mRNA expression of MDR1 and, subsequently, P-gp levels.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Previous", "studies", ...
PMC11763111	E Schematic illustration of the model simulating the in vivo lysis of tumor cells by CAR-T cells and NK cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "E", "Schematic", "illustrati...
PMC9532503	pMOZ-G62 carry neomycin resistance (NEO) gene as a dominant selectable marker.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "pMOZ-G62", "carry", "neomycin", "resistance", "(", "NEO", ")", "gene", ...
PMC11756907	The results for the ANOVA test were: p < 0.001, n=5.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", "for", "the", "ANOVA", "test", "were", ":", "p", ...
PMC8097906	and Geni used within Figs. 2a, b and c are to optimize the respective assay conditions to capture respective minimum effective initial concentration in each graph and to ensure assay function, respectively Anti-tumor screening of two plant extracts and five plant derived compounds on the RMA cell line RH-30.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Therapy-resistant or refractory T-ALL remains a major clinical challenge.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therapy-resistant", "or", "refractory", "T-ALL", "remains", "a", "major", "clinical", "challenge", "." ...
PMC11407042	Discard the spent medium and wash cells twice with 3 mL of pre-warmed PBS.c.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Discard", "the", "spent", "medium", "and", "wash", "cells", "twi...
PMC11637284	It has previously been shown that the N- and C-termini of the integral OM TAC subunit TAC60 are exposed to the cytosol, indicating that the sequence segment between the two TMDs (aa 142–237) must face the IMS .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11596967	Conversely, other nonpolar hydrophobic amino acids like Phe (F), Trp (W), Met (M), and Cys (C) are less common, representing just 7.6% of the amino acids in these peptides (Figure S3).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11742670	Fig. 7MSE comparison for testing and training datasets to predict IC50 on the three different cell lines. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", "7MSE", "comparison", "for", "t...
PMC11525028	For the colony formation assay, cells were seeded at a density of 500 cells per well in 6-well plates.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "colony", ...
PMC11087766	Statistical significance was determined by Fisher’s exact test performed as a pairwise comparison between each of the three conditions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "significance", ...
PMC9429973	In CR2 patients, promising DFS and OS were observed as compared to historical cohorts of patients treated with chemotherapy alone or with blinatumomab in overt relapse.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11770130	P < 0.05; P < 0.01; *P < 0.001.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "<", "0.05", ";", "", "", "P", "<", ...
PMC11473750	These functions can be disordered and quantitatively dysregulated in cancer.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "functions", "can", "be", "disordered", "and", "quantitatively", "dysregulated", "in", "...
PMC9621239	D-F) Average mutation frequency across different fragments within the X gene was assessed via average entropy. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D-F", ")", "Average", "mutation", "fre...
PMC8873393	Primers used to amplify exon-intron junctions for the human KIFAP3 and ACTB gene were described as follows: Human KIFAP3 Ex-In8_For: ACAGGAACAGCTATTACGAGGT Human KIFAP3 Ex-In8_Rev: CCCATGCTAAAGACAGACGAAC Human KIFAP3 Ex-In18_For: CCCTGCTAGGAAGAGAATCTTGGT Human KIFAP3 Ex-In18_Rev: TGGTTGGCCAAAGCCATCCATT Human ACTB Ex-In1_For: CCGACCAGTGTTTGCCTTTT Human ACTB Ex-In1_Rev: GCGGCGATATCATCATCCAT Human ACTB Ex-In5_For: GTGTCACATCCAGGGTCCTC Human ACTB Ex-In5_Rev: TCGTCATACTCCTGCTTGCT Exponentially multiplying cells were incubated for 12 h in maintenance media supplemented with 2 mM thymidine.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786767	Ki-67 is phosphorylated during mitosis by cyclin-dependent kinase 1 (CDK1), the best-known master regulator of the cell cycle.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ki-67", "is", "ph...
PMC9429973	START provides the first clinical evidence supporting preclinical studies that DFP can shuttle iron from labile pools to transferrin.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "START", "provides", "the", "first...
PMC11612315	g Mean normalized 340/380 ratios of sequential CAP-induced calcium increases (mean ± S.E.M.).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "g", "Mean", "normalized", "340/380", "ratios", "of", "seque...
PMC11767793	In this step, the reaction medium was reduced from 100 mL to 10 to 20 mL, then backfilled with deionized water (DIW) to about 100 mL. This purification cycle was repeated 4 times, with the final volume of Au-PEI@NIST suspension adjusted to ≈100 mL with DIW, which yielded an Au concentration of ≈2.5 mmol/L (or 500 µg/mL).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	The presence of hypodiploidy and elevated serum LDH were found to be prognostic for worse PFS, whereas age＞60 and elevated LDH were the independent predictors for worse OS.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8010066	The RNA was extracted, and cDNA synthesis was performed using the GeneAll RNA extraction kit and the GeneAll cDNA synthesis kit (GeneAll, Korea) according to the manufacturer's instructions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11496728	Thus, the pharmaceutical industry has increasingly attempted to produce more protein-based drugs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "pharmaceutical", "industry", "has", "increasingly", "at...
PMC8973725	The cells were grown in a humidified CO2 incubator at 37°C and maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11064533	In terms of prevalence, the seven targeted genes had variable distribution within pathotypes and commensal E. coli (Fig. S2).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "terms"...
PMC10578720	HBV stimulation regulates the expression of SIRT3 in macrophages through the TLR2-NF-κB-PGC-1α axis. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HBV", "stimulation", "regulates", "the", "expression", "of", "SIRT3", ...
PMC11644761	N. 8059.0500) as previously described .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "N.", "8059.0500", ")", "as", "previously", "described", "." ] } ]
PMC11185260	Treatment schedule.	[ { "tags": [ "O", "O", "O" ], "tokens": [ "Treatment", "schedule", "." ] } ]
PMC11764090	Table 2) .	[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Table", "2", ")", "." ] } ]
PMC8164677	Similarly more favorable binding energy for interactions with ecto-5-nucleotidase CD73 was observed in the case of wedelolactone (−8.3 Kcal/mol) than respective standard (−6.1 Kcal/mol).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11087055	Note: vorticity is identified in both a full-rotation and curve, particularly in (J-J’’’).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Note", ":", "vorticity", "is", ...
PMC11697703	Specifically, how distinct projection neurons develop appropriate dendritic arbors that determine their inputs is unknown.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Specifically", ",", "how", "distinct", "projection", "...
PMC11391695	Conversely, there were no noteworthy variations in the expression levels of ERCC5 and ABCC2 between the adjacent normal tissues and the HCC tissues (Fig. 1B).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10747139	The pharmacological activity of metal complexes can be attributed to either the metal itself, its ligands, or both, depending on the structure of the complex.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11549612	For instance, BOLA-mediated regulation of cytokine signaling pathways or immune cell recruitment mechanisms could contribute to the establishment of distinct immune microenvironments within KIRC tumors, with implications for disease progression and therapeutic response.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11634027	ds mutants have enlarged, rounder wings, abnormalities in wing patterning, and abnormal wing hair planar cell polarity (PCP) (Adler et al., 1998; Baena-López et al., 2005; Clark et al., 1995).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	The study is ongoing and will evaluate additional dosing schedules.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "study", "is", "ongoing", "and", "will", "evaluate", "additional", "dosing", "schedules", ...
PMC11252553	In summary, Taurine is widely recognized as a potent radioprotective agent due to the reduction of radiation-induced apoptosis at a concentration of 100 μg/ml.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11785489	Sample sizes are listed in Table 1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sample", "sizes", "are", "listed", "in", "Table", "1", "." ] } ]
PMC7504302	The inhibition of YAP by siRNAs or Verteporfin, a YAP-specific inhibitor, significantly suppressed invasion and tumorsphere formation of MPM cells by repressing downstream gene transcription of the Hippo kinase cascade, suggesting that MPMswith aberrant YAP activity could be sensitive to Verteporfin therapy .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	On the other hand, p53 can be deregulated by other mechanisms different from changes in DNA gene sequence, such as epigenetic regulation or altered expression of its regulators.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11066331

The physico-chemical reasons of batch effects involve the process of sample-matrix crystallization, where the size of co-crystals and the effect of "sweet spots" cause variations in the measured intensities All of these discrepancies create an overall undesired variability in the measurement, which is usually referred to as the 'batch effect'.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10470467

This research was supported by National Natural Science Foundation of China (Grant No. 81873998) and Chongqing Young and Middle-aged Medical High-end Talent Studio (Grant No. cstc2022ycjh-bgzxm0103).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11033180

The Sema5A-Fc, corresponding to a soluble protein containing the extracellular domain of Sema5A has previously been shown to be fully functional.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Sema5...

PMC11730320

B Patient CD4-CD8- DN Vδ1+ and Vδ1-Vδ2- populations demonstrate a primarily naive phenotype, while CD8lo/int subsets are mostly CD28-CD45RA+.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", "Patient", "C...

PMC8750422

GPCRs are known to be involved in various intracellular processes such as cell growth, proliferation, survival, and tumorigenesis through the AKT signaling pathway .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11306019

Golden et al. demonstrated the antagonistic capabilities of EGCG analogs against BTZ (Golden et al., 2009).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Golden", "et", "al.", "demonstrat...

PMC11307990

More importantly, DNA nanotapes can achieve cellular membrane retention and surface receptor inhibition.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "More", "importantly", ",", "DNA", "nanotapes", "can", "achieve", ...

PMC11680578

PTX displayed an IC50 value of 25 nM, whereas RGZ exhibited an IC50 value of 25 µM (Fig. 1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PTX", "displ...

PMC11320834

Triapine is a small molecule inhibitor of ribonucleotide reductase (RNR), which blocks de novo dNTP production.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Triapine", "is", "a", "small", ...

PMC11381192

D, E) Assessment of immune scores and tumour purity using ESTIMATE algorithm between CSI risk groups. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D", ",", "E", ")", "Assessm...

PMC9429973

Summary/Conclusion: Overall, we demonstrate that NPM1c directly regulates a network of leukemia self-renewal associated genes through direct chromatin interaction.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":...

PMC11575040

Finally, Chen et al. reported that HCG11, a tumor suppressor, regulated the AKT/mTOR pathway and inhibited cell growth in ovarian cancer by modulating the miR-1270/PTEN pathway.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6642070

Indeed, fluvastatin increased MDM2 phosphorylation dose-dependently (Fig. 4b) and enhanced the binding of MDM2 with p53 proteins (Fig. 4c).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC9784246

The MS operated in the negative mode with a capillary voltage of 30 eV, 3 kV; desolvation temperature, 450 °C; cone gas flow, 50 L/h; and desolvation gas flow, 900 L/h.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11468365

MultiComb demonstrates high , , and for synergy and sensitivity prediction, and achieves lower , , and compared to other deep learning models.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC7762347

The statistical significance between solvent control and treated groups was analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison test using Graph-Pad Prism 6 software (Graph-PadSoftware Inc., La Jolla, CA, USA) (* p < 0.05).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11277157

For DJ-1 (376 nt), the primers were F: GCCTGGTGTGGGGCTTGTAA and R: GCCAACAGAGCAGTAGGACC.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "DJ-1", "(", "376", "nt", ")", ...

PMC11248911

Redundant descriptors “low variance descriptors” that do not have an added value to the model were first filtered out leaving 299 descriptors for model construction.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8633974

This was affirmed by monitoring culture cell supernatants for progeny virion production by RT activity (Figure 5f) and by polymerase chain reaction (PCR) of cell lysates with HIV-1 specific primers spanning the subgenomic viral DNA fragments of the gRNAs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11093197

Myc plays a pivotal role in promoting anabolic metabolism which is primarily driven by the degradation of glucose and glutamine. ,

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Myc", "plays", "a...

PMC9429973

Results: Ten patients were included in the study.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Ten", "patients", "were", "included", "in", "the", "study", "." ] } ]

PMC11680562

A localized therapeutic gel delivering CuO NPs and 5-Fu using pectin and xanthan gum may effectively treat cervical cancer.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "localized", "therapeutic", "...

PMC9429973

Chromosome 17 abnormalities were found in 7 MCL patients with TP53 mutations out of 11 studied.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Chromosome", "17", "abnormalities", "were", "found", "...

PMC11544122

Further work is required to fully explore this possibility.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "work", "is", "required", "to", "fully", "explore", "this", "possibility", "." ] } ]

PMC11544771

In addition, our immunofluorescence staining also showed that approximately 5% of A549 cells were γH2AX-positive when treated with vehicle (DMSO), while about 55% and 15% cells were γH2AX-positive when treated with CPX (5 μM) and PRE (20 nM) for 48 h, respectively (Figure 3C,D).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11201989

The presence of the polycystins in cilia of renal epithelial cells, for example, regulates calcium influx and their dysfunction leads to aberrant calcium influx and uncontrolled cyst formation , and retention of Hh receptors in embryo cilia could lead to various developmental manifestations .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

In addition, blast lysis is increased vs control.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "blast", "lysis", "is", "increased", "vs", "control", "." ] } ]

PMC10606998

Thus, both viability tests confirm the appearance of a combined effect upon X-ray irradiation of the cells containing nanoparticles.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "both", "v...

PMC11139449

Therefore, using the genomic primer as the forward and the vector primer as the reverse primer confirmed the integration of the donor vector at the targeted site in CASP8AP2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11786704

4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), Streptozotocin, Lipopolysaccharide (LPS) and Anti-mouse ELISA kits for IL-6, TNF-α, IL-1β and IL-10 were supplied by Beijing Solarbio Science & Technology Co., Ltd. Serum-free Cell cryopreservation solution (C40050) and universal antibody diluent (WB100D) were purchased from New Cell & Molecular Biotech.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11218145

Having found that TB modulated the intracellular Ca dynamics, we asked whether this compound could also modulate the mitochondrial metabolism.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Having", "found", ...

PMC11496491

The pie chart shows the cell component classifications. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "pie", "chart", "shows", "the", "cell", "component", "classifications", ".", "(" ] } ]

PMC11612508

In our previous review article, hydrogel microspheres-based nanocomposites in novel drug delivery platforms were investigated in detail.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "our", "previous", "review", "art...

PMC9429973

Results: We found increased systemic levels of FGF23 and an unbalanced iFGF23/cFGF23 ratio in favor of cFGF23.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "We", "found", "increas...

PMC11747949

Cells were analyzed by flow cytometry using BD FACS Symphony A1 flow cytometer (USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "analyzed", "by", "flow", "cytometry",...

PMC11755624

Furthermore, the development and implementation of lncRNA-based therapeutics is difficult due to the potential context-dependent activity of these molecules.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "the", ...

PMC11470999

However, these studies did not clearly identify its direct target proteins, thus limiting the clinical application of PF as an anticancer agent.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC9917080

Thus, sorafenib has a weak effect on the gene expression of selenoproteins and selenium-containing proteins in glioblastoma cells after 24 and 48 h of exposure.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11680562

The green-synthesized CuO NPs exhibited a zeta potential of −23.7 mV, a particle size of approximately 26 nm, and spherical morphology.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC11544122

It is important to note that this interpretation is complicated by the fact that β-arr1 and SNX9 also interact downstream of CXCR4.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", ...

PMC9817179

To understand what factors are underlying the diverging fixation artifact of in vivo LLPS systems, we performed the above-described fixation imaging assay with glycine added to live cells prior to PFA fixation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9516447

Here in our studies, we have demonstrated that the anti-GRP78 small molecule inhibitors HA15 and YUM70 can suppress multiple types of oncogenic KRAS protein expression in PDAC, LUAD and colorectal cancer cell lines, leading to apoptosis and loss of cell viability.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11481779

Examples include Stable Diffusion or DALL-E 2 .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Examples", "include", "Stable", "Diffusion", "or", "DALL-E", "2", "." ] } ]

PMC11026382

a Schematic of metabolic control.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "a", "Schematic", "of", "metabolic", "control", "." ] } ]

PMC11704135

Broadly speaking, the mechanism of action of pyrimidine derivatives has been elucidated to involve the inhibition of various processes such as FtsZ (an essential protein for bacterial cell division) polymerization, DHFR (Gram-negative bacteria enzyme responsible for its existence) inhibition, modulation of GTPase activity, and interference with bacterial cell division.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11423992

C34565, Invitrogen).

[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "C34565", ",", "Invitrogen", ")", "." ] } ]

PMC11291490

Until now, the TMUV exhibits the capacity to infect a range of bird species, including chickens, ducks, geese, and sparrows.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11802929

Created in BioRender.

[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Created", "in", "BioRender", "." ] } ]

PMC11286266

ER stress treatments with 2.5 µg/ml Tm lasted 20 hr.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ER", "stress", "treatments", "with", "2.5", "µg/ml", "Tm", "lasted", "20", "hr", "." ]...

PMC9429973

This descriptive analysis presents the safety data for all Part 1 pts and the efficacy data for all Part 1 pts with ≥2 post-baseline efficacy assessments by the cut-off date (14/01/2022).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10969097

These results, despite having been achieved using an isolated compound, are in line with the results of the study included in this work and presented by Zhang et al. , where a polysaccharide extracted from Lentinula edodes was able to negatively regulate the JAK/STAT oncogenic signalling pathway .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11583690

Our assessment of their drug loading capability consistently shows that when compared with MSN, BPMO loads DTX more efficiently.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "assessment", "of", ...

PMC11397654

Compounds 2–6 significantly increased the apoptotic cell death.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compounds", "2–6", "significantly", "increased", "the", "apoptotic", "cell", "death", "." ] } ]

PMC9065483

In the case of two IFN-2 cytokines, CXCL9 and CXCL10, the interaction between STAT1 and NF-κB has shown to increase recruitment of a third protein, CREB-binding protein to subsequently increase RNA polymerase II transcription activity at their respective promoters.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Patients were enrolled between 2009–14 and followed for up to 5 years.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "were", "enrolled", "between", "2009–14", "and", "followed", "for", "...

PMC11535726

Mycelium partly immersed, on the substrate, pale brown to dark brown.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mycelium", "partly", "immersed", ",", "on", "the", "substrate", ",", ...

PMC11478724

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "research", "uses", "GraphPad", ...

PMC11759543

5637 and BFTC 905 cells were pretreated with 40 μM Z-LEHD-FMK for 1 h, then cultured with seleted doses of doxorubicin and vorinostat for 24 h. Protein expression were analyzed by Western blot. (

[ { "tags": [ "B-CellLine", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...

PMC9014716

Previous studies have shown that Huaier granules or extract can down-regulate mRNA expression of MDR1 and, subsequently, P-gp levels.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Previous", "studies", ...

PMC11763111

E Schematic illustration of the model simulating the in vivo lysis of tumor cells by CAR-T cells and NK cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "E", "Schematic", "illustrati...

PMC9532503

pMOZ-G62 carry neomycin resistance (NEO) gene as a dominant selectable marker.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "pMOZ-G62", "carry", "neomycin", "resistance", "(", "NEO", ")", "gene", ...

PMC11756907

The results for the ANOVA test were: p < 0.001, n=5.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", "for", "the", "ANOVA", "test", "were", ":", "p", ...

PMC8097906

and Geni used within Figs. 2a, b and c are to optimize the respective assay conditions to capture respective minimum effective initial concentration in each graph and to ensure assay function, respectively Anti-tumor screening of two plant extracts and five plant derived compounds on the RMA cell line RH-30.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Therapy-resistant or refractory T-ALL remains a major clinical challenge.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therapy-resistant", "or", "refractory", "T-ALL", "remains", "a", "major", "clinical", "challenge", "." ...

PMC11407042

Discard the spent medium and wash cells twice with 3 mL of pre-warmed PBS.c.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Discard", "the", "spent", "medium", "and", "wash", "cells", "twi...

PMC11637284

It has previously been shown that the N- and C-termini of the integral OM TAC subunit TAC60 are exposed to the cytosol, indicating that the sequence segment between the two TMDs (aa 142–237) must face the IMS .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11596967

Conversely, other nonpolar hydrophobic amino acids like Phe (F), Trp (W), Met (M), and Cys (C) are less common, representing just 7.6% of the amino acids in these peptides (Figure S3).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11742670

Fig. 7MSE comparison for testing and training datasets to predict IC50 on the three different cell lines. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", "7MSE", "comparison", "for", "t...

PMC11525028

For the colony formation assay, cells were seeded at a density of 500 cells per well in 6-well plates.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "colony", ...

PMC11087766

Statistical significance was determined by Fisher’s exact test performed as a pairwise comparison between each of the three conditions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "significance", ...

PMC9429973

In CR2 patients, promising DFS and OS were observed as compared to historical cohorts of patients treated with chemotherapy alone or with blinatumomab in overt relapse.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11770130

P < 0.05; **P < 0.01; ***P < 0.001.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "<", "0.05", ";", "*", "*", "P", "<", ...

PMC11473750

These functions can be disordered and quantitatively dysregulated in cancer.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "functions", "can", "be", "disordered", "and", "quantitatively", "dysregulated", "in", "...

PMC9621239

D-F) Average mutation frequency across different fragments within the X gene was assessed via average entropy. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D-F", ")", "Average", "mutation", "fre...

PMC8873393

Primers used to amplify exon-intron junctions for the human KIFAP3 and ACTB gene were described as follows: Human KIFAP3 Ex-In8_For: ACAGGAACAGCTATTACGAGGT Human KIFAP3 Ex-In8_Rev: CCCATGCTAAAGACAGACGAAC Human KIFAP3 Ex-In18_For: CCCTGCTAGGAAGAGAATCTTGGT Human KIFAP3 Ex-In18_Rev: TGGTTGGCCAAAGCCATCCATT Human ACTB Ex-In1_For: CCGACCAGTGTTTGCCTTTT Human ACTB Ex-In1_Rev: GCGGCGATATCATCATCCAT Human ACTB Ex-In5_For: GTGTCACATCCAGGGTCCTC Human ACTB Ex-In5_Rev: TCGTCATACTCCTGCTTGCT Exponentially multiplying cells were incubated for 12 h in maintenance media supplemented with 2 mM thymidine.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11786767

Ki-67 is phosphorylated during mitosis by cyclin-dependent kinase 1 (CDK1), the best-known master regulator of the cell cycle.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ki-67", "is", "ph...

PMC9429973

START provides the first clinical evidence supporting preclinical studies that DFP can shuttle iron from labile pools to transferrin.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "START", "provides", "the", "first...

PMC11612315

g Mean normalized 340/380 ratios of sequential CAP-induced calcium increases (mean ± S.E.M.).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "g", "Mean", "normalized", "340/380", "ratios", "of", "seque...

PMC11767793

In this step, the reaction medium was reduced from 100 mL to 10 to 20 mL, then backfilled with deionized water (DIW) to about 100 mL. This purification cycle was repeated 4 times, with the final volume of Au-PEI@NIST suspension adjusted to ≈100 mL with DIW, which yielded an Au concentration of ≈2.5 mmol/L (or 500 µg/mL).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

The presence of hypodiploidy and elevated serum LDH were found to be prognostic for worse PFS, whereas age＞60 and elevated LDH were the independent predictors for worse OS.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8010066

The RNA was extracted, and cDNA synthesis was performed using the GeneAll RNA extraction kit and the GeneAll cDNA synthesis kit (GeneAll, Korea) according to the manufacturer's instructions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11496728

Thus, the pharmaceutical industry has increasingly attempted to produce more protein-based drugs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "pharmaceutical", "industry", "has", "increasingly", "at...

PMC8973725

The cells were grown in a humidified CO2 incubator at 37°C and maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11064533

In terms of prevalence, the seven targeted genes had variable distribution within pathotypes and commensal E. coli (Fig. S2).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "terms"...

PMC10578720

HBV stimulation regulates the expression of SIRT3 in macrophages through the TLR2-NF-κB-PGC-1α axis. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HBV", "stimulation", "regulates", "the", "expression", "of", "SIRT3", ...

PMC11644761

N. 8059.0500) as previously described .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "N.", "8059.0500", ")", "as", "previously", "described", "." ] } ]

PMC11185260

Treatment schedule.

[ { "tags": [ "O", "O", "O" ], "tokens": [ "Treatment", "schedule", "." ] } ]

PMC11764090

Table 2) .

[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Table", "2", ")", "." ] } ]

PMC8164677

Similarly more favorable binding energy for interactions with ecto-5-nucleotidase CD73 was observed in the case of wedelolactone (−8.3 Kcal/mol) than respective standard (−6.1 Kcal/mol).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11087055

Note: vorticity is identified in both a full-rotation and curve, particularly in (J-J’’’).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Note", ":", "vorticity", "is", ...

PMC11697703

Specifically, how distinct projection neurons develop appropriate dendritic arbors that determine their inputs is unknown.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Specifically", ",", "how", "distinct", "projection", "...

PMC11391695

Conversely, there were no noteworthy variations in the expression levels of ERCC5 and ABCC2 between the adjacent normal tissues and the HCC tissues (Fig. 1B).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10747139

The pharmacological activity of metal complexes can be attributed to either the metal itself, its ligands, or both, depending on the structure of the complex.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11549612

For instance, BOLA-mediated regulation of cytokine signaling pathways or immune cell recruitment mechanisms could contribute to the establishment of distinct immune microenvironments within KIRC tumors, with implications for disease progression and therapeutic response.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11634027

ds mutants have enlarged, rounder wings, abnormalities in wing patterning, and abnormal wing hair planar cell polarity (PCP) (Adler et al., 1998; Baena-López et al., 2005; Clark et al., 1995).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

The study is ongoing and will evaluate additional dosing schedules.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "study", "is", "ongoing", "and", "will", "evaluate", "additional", "dosing", "schedules", ...

PMC11252553

In summary, Taurine is widely recognized as a potent radioprotective agent due to the reduction of radiation-induced apoptosis at a concentration of 100 μg/ml.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11785489

Sample sizes are listed in Table 1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sample", "sizes", "are", "listed", "in", "Table", "1", "." ] } ]

PMC7504302

The inhibition of YAP by siRNAs or Verteporfin, a YAP-specific inhibitor, significantly suppressed invasion and tumorsphere formation of MPM cells by repressing downstream gene transcription of the Hippo kinase cascade, suggesting that MPMswith aberrant YAP activity could be sensitive to Verteporfin therapy .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

On the other hand, p53 can be deregulated by other mechanisms different from changes in DNA gene sequence, such as epigenetic regulation or altered expression of its regulators.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...