OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC10523483	P < 0.05; P < 0.01; *P < 0.001.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "<", "0.05", ";", "", "", "P", "<", ...
PMC11756907	Moreover, the results indicate that DMSO to a lesser extent destabilises the complex of graphene nanoflakes with 2-ME, increasing its stability in the biological system and thus enhancing the potential therapeutic effect of the complex carrier-drug system.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9143157	The cells were seeded in a 96-well plate at 3000 cells/well.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "seeded", "in", "a", "96-well", "plate", "at", "3000", "...
PMC6182045	Notably, and nearly all the potential N-linked glycosylation sites (PNGS) are aligned.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "and", "nearly", "all", "the", "potential", ...
PMC7823217	The most frequently utilized 3D cancer models for drug testing include multicellular tumor spheroid model (MCTS), multilayered cell cultures, organotypic slices of cancer tissue, and cell seeded scaffolds .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Despite the lack of consensus for predicting D-d levels, our results suggest that D-d values, at ICU admission, can be predictive of future TE.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8481254	A The protein expression of OGT, O-GlcNAc, YAP, CDK19, and CDK8 was analyzed by WB in cells subjected to the indicated treatments.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10810426	These results also explain our previous findings in 293T cells, suggesting that RNA/DNA intermediate products of reverse transcription were nuclear; we showed that although APOBEC3G largely deaminates cytoplasmic MLV reverse transcripts, the nuclear enzyme UNG, which preferentially removes uracils found in ssDNA, acts on unintegrated nuclear viral DNA .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC9000591	The fractions including SE1 and SE2 showed suppression at an average level (IC50 = 353.55 and 383.25 µg/mL, respectively).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "fract...
PMC6771295	To investigate potential interdependency between individual family members, the protein levels of SIRT1, SIRT3, and SIRT5 were determined in U2OS, Mero-14, and REN cells in which each one of these sirtuin family members had been silenced.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "...
PMC10440586	Survival outcomes were analyzed in the CGGA data set by screening patient samples who received concurrent chemoradiotherapy, chemotherapy alone, and radiotherapy alone.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC6642070	Statin-associated muscle symptoms (SAMS) are the major adverse effects of the class of widely used lipid-lowering agents, and the underlying mechanism remains elusive.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11655536	However, MM is still an incurable disease.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "MM", "is", "still", "an", "incurable", "disease", "." ] } ]
PMC9429973	This supports the notion that proinflammatory risk factors identified in other cohorts with GM dysbiosis are also present within CLL patients.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "supports", ...
PMC11768927	Alajez et al. tested the VSV-MΔ51 strain against the human hypopharyngeal FaDu tumor model for HNSCC in vitro and in vivo.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Alajez", "et",...
PMC7334607	Localized disease has a 50%–70% 5-year survival rate, and metastatic disease has a devastating 18%–30% 5-year survival rate (Esiashvili et al., 2008; Grier et al., 2003; Hunold et al., 2006).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11604768	GPCRs were clustered using Euclidean distance with complete linkage.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GPCRs", "were", "clustered", "using", "Euclidean", "distance", "with", "complete", "linkage", "." ] }...
PMC9919300	To date, various drugs have been developed for the therapeutic approach to NALFD: natural farnesoid X receptor (FXR) agonist, dual peroxisome proliferator-activated receptor α-δ (PPARα-δ) agonist, and glucagon-like peptide-1 antagonists.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9739791	To evaluate the photoinduced cytotoxicity of PPE against malignant cell types, SKOV-3 ovarian cancer cells were chosen as a model cell line and were treated with PPE, then irradiated with 460 nm light (Figure 18A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11604768	Here, we employed TRE-MPRA to profile transcriptional changes induced by activation of three well-characterized aminergic GPCRs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Here", ",", "we", "employed", "TRE-MPRA", "...
PMC9429973	Median age at death was 72 years and death occurred at a median of 12 years post SVT diagnosis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "age", "at", "death", ...
PMC10847511	A value of 0 indicated the presence of LOH, while a value of 1 or more indicated the absence of LOH.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "value",...
PMC11699042	f Volcano plot of DEG resulting from comparing the two A-673, HeLa, and MCF-7 strains with the highest variance (A-673_7 vs A-673_3, HeLa_5 vs HeLa_3 and MCF-7_5 vs MCF-7_3).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC5925824	PD-L1-Fc proteins were injected for 180 s (contact time) over the immobilized LY3300054 at a flow rate of 30 μl/min.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PD-L1-Fc", "...
PMC11621493	All animal procedures were performed as humanely as possible to minimize suffering.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "animal", "procedures", "were", "performed", "as", "humanely", "as", "poss...
PMC11751675	Four xanthanolides (compounds 46–49) have been identified in the aerial parts of young Xanthium spinosum L. plants.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Four", "xanthanolides", "(", "com...
PMC11026382	The points themselves are mean-centered.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "points", "themselves", "are", "mean-centered", "." ] } ]
PMC10728200	Subsequently, they were permeabilized with 0.3% Triton X-100 (Sigma-Aldrich, #9036–19–5) in PBS for 10 min and then blocked with 10% normal goat serum (Beyotime, #C0265, Jiangsu, China) for 1 h at 37 °C.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11543885	An Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Fisher Scientific) paired with an Ultimate 3000 UHPLC system (Thermo Fisher Scientific) was utilized to analyze purified tryptic peptides through LC-MS/MS, as previously described.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10812665	We used here the hits obtained from the NeuriTox NTP screen for an exemplary mechanistic study.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "used", "here", "the", "hits", "obtained", ...
PMC11694066	Such an effect of PARPi and ATRi has been reported in other preclinical models with high replication stress [reviewed in Chabanon and colleagues (60)] and in clinical studies evaluating ATRi, notably in non–small cell lung cancer (NSCLC) and melanoma, in which they can potentiate or revert resistance to anti–PD-L1, respectively (61–63).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786600	Based on the above theory, we designed a portable electrospinning dressing (PED) and a PED loaded with kaempferol (PED4) (Scheme 1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6684588	Finally, incorporation of an Fc domain assists in purification during protein production, and use of the IgG2 Fc isotype reduces the possibility of effector function due to immune cell engagement.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11300085	SK-OV-3 cells were cultured into a 6-well plate and transfected with indicated CMKLR1 siRNA using Lipofectamine 8000 (Beyotime, Shanghai, China) according to manufacturer's instruction for 48 h. Then, the silenced cells were treated with chemerin (50 ng/ml) for another 24 h. The silencing sequences are presented in the following: si-CMKLR1#1: AAUAAUCAGGGUAUUCAUCAC si-CMKLR1#2: ACAUGUUGUGGAUGAGAAGAA si-CMKLR1#1: AAUAAUCAGGGUAUUCAUCAC si-CMKLR1#2: ACAUGUUGUGGAUGAGAAGAA Cells were cultured on 6-well plates and treated with chemerin (50 ng/mL) for 24 h. After treatment, supernatants were collected and lysed with a mixture of protease inhibitor RIPA lysis buffer (Beyotime, Haimen, China) for 40 min at 4°C.	[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10671321	Very recently, Uyen Dao et al. demonstrated that ColQ binds LRP4.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Very", "recently", ",", "Uyen", "Dao", "et", "al.", "demonstrated", "that", ...
PMC8751435	Supernatants were transferred to precooled centrifuge tubes for immediate measurement of caspase‐1, caspase‐3 activities by using caspase‐1, caspase‐3 activity assay kits (Beyotime) according to the manufacturer's protocols.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11519077	In a previous study, it was shown that the clinical and histological indications of DSS-induced colitis in mice were successfully alleviated by systemic infusion of umbilical cord MSCs (UCMSCs), whereas MMP2 and MMP9 activities were increased in DSS-treated animals but were considerably reduced in mice receiving UCMSC .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8609870	In the past few decades, the disease has caused heavy psychological burden for couples who want to have children and their families.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", ...
PMC11155445	Mono acylated thiourea (103a–i) showed the best inhibition activity against S. aureus, and among them, compound 103a exhibited comparable activity to standard drug Ampicillin, the highest activity of compound 103a was due to the presence of Br atom at ortho position as it strongly interacted with active sites of bacterial cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11711347	In summary, the Ni(II)ProDtc complex was synthesized in situ by reacting proline with carbon disulfide (CS2) in ethanol.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "summary", "...
PMC11782508	The amplicons were resolved by electrophoresis on a 1% (w/v) agarose gel prepared in 1X Tris-Borate-EDTA (TBE) buffer.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC9429973	Our overarching hypothesis is environmental factors such as air pollution, weather, and chemical exposures modify disease severity in children with sickle cell disease.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10454535	Our data suggested oxidative stress to be induced by the treatment as well.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "data", "suggested", "oxidative", "stress", "to", "be", "induced", ...
PMC6267596	Anti-DLBCL chemotherapy dosing schedules are intermittent to avoid damage to normal tissue such as the mucous membranes, intestinal lining, and the bone marrow.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11352746	Neurites, which are small processes in neurons, are notably affected by alterations in neuronal homeostasis, which are present in most neurodegenerative disorders .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973	The MDS-specific comorbidity index (MDS-CI) offers a comprehensive tool to assess the prognostic impact of comorbidities of the major organ systems (see fig A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11496728	Next, the cells were verified at the protein level, and the results indicated that the Apaf1 protein level of KO-1, 2, and 3 cell lines was lower than that of CHO-WT cells compared with CHO-WT cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "...
PMC9429973	The published first-line median OS in TP53m AML is 4-7 months, regardless of whether patients are treated with intensive chemotherapy or non-intensive approaches, such as a hypomethylating agent with venetoclax (VEN).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6461034	Since substrate‐centric inference attributes data from multiple, possibly numerous, substrate phosphosites to a single kinase, bar segments coalesce into a black stack in more extreme cases.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	ITI significantly increased the probability to reveal the transformation from LGL in pts with c-MYC/BCL6 HGBL DH (p=0,01) and HGBL NOS (p<0,001) compared with morphological study only.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10810426	Knockdown of several nuclear pore proteins dramatically reduced the appearance of integrated MLV DNA in DCs but not NIH3T3 cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Knockdown", "of"...
PMC11676674	Briefly, the following functions were combined through Boolean logic to create the final mask: Threshold, Spot, Range, LevelSet, Dilate.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973	Despite expansion of therapeutic options, WM remains incurable.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "expansion", "of", "therapeutic", "options", ",", "WM", "remains", "incurable", "." ] } ]
PMC11539788	Therefore, we concluded that RNF19A affected the activity of the AKT/mTOR signalling pathway through the regulation of ILK and suppressed the proliferation, migration, and invasion of BCa cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4485786	In the NHS-IL12-treated groups, levels of both PCNA- (Fig. 5A) and Ki67-stained sarcoma cells were significantly lower than in the FcIL-7-control (Fig. 5A, B).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10887351	GPCRs show three intracellular and extracellular loops, an extracellular N-terminal domain, and a cytosolic C-terminal tail with phosphorylation sites for GPCR kinases (Figure 1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11769516	Furthermore, DON contributes to oxidative stress in HEK-293 and DF-1 cells .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O" ], "tokens": [ "Furthermore", ",", "DON", "contributes", "to", "oxidative", "stress", ...
PMC11612794	Half-maximal inhibitory concentration (IC50) of nocodazole calculated using the data shown in (E).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Half-maximal", "inhibitory", "concentration", "(", ...
PMC11612626	Compound A treatment also increased the levels of PA28α/PSME1 by three-fold and PA28β/PSME2 levels five-fold (Fig. 7B).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "A", "treatment", "als...
PMC11705484	5637 cells were treated with vehicle control (NC), TNF‐α and/or Flag‐tagged IκBαS32AS36A, followed by cytoplasmic and nuclear protein fractionation and immunoblot analysis of TRMT61A and p65 protein expression.	[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11476106	Elevated VN levels have previously been described in plasma (and other fluids) of poor prognosis patients with glioma , melanoma , and breast , ovarian, and endometrial cancer and in children with Hodgkin’s lymphoma , acute lymphoblastic leukemia , and NB .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Compassion of groups was carried out using χ2 test.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compassion", "of", "groups", "was", "carried", "out", "using", "χ2", "test", "." ] } ]
PMC11770199	To further investigate if MSCs-p14 treatment could enhance the immune response and contribute to its therapeutic effects, we repeated the in vivo experiment with slight modifications.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6160470	Representative flow cytometry histogram of Rhodamine 123 after treatment with indicated compounds is shown in inlet. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Representative", "flow", "cytometry", "histogram", ...
PMC11371627	Multi-gene panel sequencing including common candidate genes for myopathy or muscular dystrophy revealed a novel hemizygous deletion (c.756del, p.Trp253Glyfs*15) of the XK gene (Figure 2B).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11555465	Bladder cancer is the tenth most frequent malignancy worldwide and is ~4 times more likely to occur in men than in women (2).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11545737	In particular, the expression of CagA, VacA and CagL was reduced in emodin-treated H. pylori compared to untreated bacteria.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "particular", ...
PMC11705862	After that time the cells were washed 1x with PBS and incubated for 30 min.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "that", "time", "the", "cells", "were", "washed", ...
PMC11591030	The expression of the MyD88 and IL-6 genes was reduced in the LPS + ML385 group compared to the LPS stress group, but the expression levels of other inflammatory factor-related genes did not differ significantly from those in the LPS stress group (p < 0.05).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10588957	Further experiments are warranted to confirm this hypothesis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "experiments", "are", "warranted", "to", "confirm", "this", "hypothesis", "." ] } ]
PMC11401358	Juhui Qiu: Funding acquisition, Methodology, Resources, Writing – review & editing.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Juhui", "Qiu", ":", "Funding", "acquisition", ",", "Methodo...
PMC11621565	The data are shown as a fold increase to control.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "data", "are", "shown", "as", "a", "fold", "increase", "to", "control", "." ] ...
PMC11686380	Additionally, GAP43 was found in medial ganglionic eminence-originated SST-positive and caudal ganglionic eminence-originated VIP-positive GABAergic interneurons.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "GAP43", "was", "found", ...
PMC11761919	The tubes were incubated at 41 °C with shaking at 180 rpm for 180 min.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tubes", "were", "incubated", "at", "41", ...
PMC7039683	Third, the Irf6 binding site was enriched to a greater extent in the enhancer candidates that were associated with more anti-H3K27Ac ChIP-seq reads at 8 hour post fertilization (hpf) than at 11 hpf.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10482220	These data suggest that many RNA-binding proteins will be found within SGs, even those that have a nuclear localization.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "data", "suggest", ...
PMC3915447	Firstly, 5.41 g of FeCl3·6H2O (99% purity) and 1.99 g FeCl2·4H2O (99% purity) were dissolved in 100 ml of distilled water in a three-necked flask.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11365983	Measurements of cilia length in ATDC5 (automatic, Cell Profiler) and mIMCD3 (manual, using Fiji software) were performed under conditions of growth in complete media with 10% FBS.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC2777936	For real-time RT-PCR analyses of individual gene products, cDNA synthesis and SYBR green PCR reagents were purchased from Applied Biosystems (CA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC7709199	The crystallization conditions for wild-type and GD-derived DSCAMIg7–Ig9 are almost identical (Table 1 ▸), yet a crystal structure could only be determined with the GD-derived DSCAMIg7–Ig9 crystals.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11472569	Comparable transfer of drug resistance and ABCB1 protein by EVs have been reported in breast cancer, bladder cancer, and ovarian cancer cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973	Infection by the new corona virus strain (COVID-19) and its related syndrome has been associated with more than 6 million deaths worldwide.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11679326	β1,6-GlcNAc-bearing complex N-glycans involved in glioblastoma migration and invasiveness were studied by Yamamoto et al. Stable transfection of MGAT5 into human glioma cells resulted in a marked increase in the invasiveness of glioma in vitro .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Results: In total, 128 patients received SC ravulizumab (SC/SC: n = 84; IV/SC: n = 44; mean [range] duration of SC treatment: 486.4 [37–709] days).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11723210	To assess the accuracy of phase reconstruction for large phase objects using the BPR method, three types of experimental samples were prepared for distinct validation experiments.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	OS at 12 months post REL of these 143 patients was 22% with no significant difference between axi-cel and tisa-cel failures (Figure).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC2118063	Results were normalized to transcript levels in IgD PBB.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", "were", "normalized", "to", "transcript", "levels", "in", "IgD", "PBB", "." ] } ]
PMC9878278	To attenuate the MDA5 pathway in SC, we treated the cells with siMDA5 and measured MDA5 protein expression at 48 hpt.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "attenu...
PMC11659734	Micronuclei form from acentric chromosomal fragments or whole chromosomes that are not incorporated into the daughter nuclei during cell division.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Micronuclei", "form", "from"...
PMC11723947	Fig. 6b).	[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Fig.", "6b", ")", "." ] } ]
PMC11471157	No noticeable increase in the number of spheroids was observed for any of the cell types even after the culture period.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "noticeable", ...
PMC11679033	Upon completion of the exposure, lymphocyte cultures were subjected to centrifugation at 100× g using a benchtop centrifuge (ROTOFIX 32A, Hettich, Tuttlingen, Germany).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Summary/Conclusion: On admission of a patient with COVID19, calculation of the neutrophil to lymphocyte ratio (NLR) is important, a high NLR could be a predictor of a severe disease course to which clinicians should be alerted for better management of the patient.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7081114	Differential expression of KIF21B in The Cancer Genome Atlas database and hepatocellular carcinoma cell lines.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Differential", "expression", "of", "KIF21B", "in", "The", "...
PMC10317042	B, SU-CCS1, and Hewga-CCS cells were treated for 24 hours with the absence (–) or presence (+) of 300 nmol/L vorinostat or JQ1.	[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC11775197	In CRC, with tumor progression, increased expression of PPARα and PPARβ/δ or decreased expression of PPARγ .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "CRC", ",", "with", "tumor", ...
PMC11411131	Krab-Sec/Luc was transfected into primary cultured cerebellar granule cells (CGCs), which were subsequently exposed to 0, 6, or 20 µM MeHg for 24 h. Krab-Sec/Luc exhibited a MeHg-dependent signal in CGCs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11730311	The pA2 of 8.23 for CGRP8-37 is in accordance with other findings.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "pA2", "of", "8.23", "for", "CGRP8", "-", "37", "is"...
PMC11476222	The separation conditions for sphingolipids were optimized by comparing two columns: the Acclaim C18 column (3 μm, 300 Å, 150 × 2.1 mm; Thermo Scientific, Sunnyvale, CA, USA) and the ZIC-HILIC column (3.5 μm, 200 Å, 150 × 2.1 mm; Millipore Sigma, Darmstadt, Germany).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11635519	The Gibson reaction was performed with 30 μL of HiFi DNA master mix mixed with 28 μL of plasmid (1.2 μg) and 5 μL of the PCR product (3 μg).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10523483

P < 0.05; **P < 0.01; ***P < 0.001.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "<", "0.05", ";", "*", "*", "P", "<", ...

PMC11756907

Moreover, the results indicate that DMSO to a lesser extent destabilises the complex of graphene nanoflakes with 2-ME, increasing its stability in the biological system and thus enhancing the potential therapeutic effect of the complex carrier-drug system.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9143157

The cells were seeded in a 96-well plate at 3000 cells/well.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "seeded", "in", "a", "96-well", "plate", "at", "3000", "...

PMC6182045

Notably, and nearly all the potential N-linked glycosylation sites (PNGS) are aligned.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "and", "nearly", "all", "the", "potential", ...

PMC7823217

The most frequently utilized 3D cancer models for drug testing include multicellular tumor spheroid model (MCTS), multilayered cell cultures, organotypic slices of cancer tissue, and cell seeded scaffolds .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Despite the lack of consensus for predicting D-d levels, our results suggest that D-d values, at ICU admission, can be predictive of future TE.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8481254

A The protein expression of OGT, O-GlcNAc, YAP, CDK19, and CDK8 was analyzed by WB in cells subjected to the indicated treatments.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC10810426

These results also explain our previous findings in 293T cells, suggesting that RNA/DNA intermediate products of reverse transcription were nuclear; we showed that although APOBEC3G largely deaminates cytoplasmic MLV reverse transcripts, the nuclear enzyme UNG, which preferentially removes uracils found in ssDNA, acts on unintegrated nuclear viral DNA .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...

PMC9000591

The fractions including SE1 and SE2 showed suppression at an average level (IC50 = 353.55 and 383.25 µg/mL, respectively).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "fract...

PMC6771295

To investigate potential interdependency between individual family members, the protein levels of SIRT1, SIRT3, and SIRT5 were determined in U2OS, Mero-14, and REN cells in which each one of these sirtuin family members had been silenced.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "...

PMC10440586

Survival outcomes were analyzed in the CGGA data set by screening patient samples who received concurrent chemoradiotherapy, chemotherapy alone, and radiotherapy alone.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC6642070

Statin-associated muscle symptoms (SAMS) are the major adverse effects of the class of widely used lipid-lowering agents, and the underlying mechanism remains elusive.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11655536

However, MM is still an incurable disease.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "MM", "is", "still", "an", "incurable", "disease", "." ] } ]

PMC9429973

This supports the notion that proinflammatory risk factors identified in other cohorts with GM dysbiosis are also present within CLL patients.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "supports", ...

PMC11768927

Alajez et al. tested the VSV-MΔ51 strain against the human hypopharyngeal FaDu tumor model for HNSCC in vitro and in vivo.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Alajez", "et",...

PMC7334607

Localized disease has a 50%–70% 5-year survival rate, and metastatic disease has a devastating 18%–30% 5-year survival rate (Esiashvili et al., 2008; Grier et al., 2003; Hunold et al., 2006).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11604768

GPCRs were clustered using Euclidean distance with complete linkage.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GPCRs", "were", "clustered", "using", "Euclidean", "distance", "with", "complete", "linkage", "." ] }...

PMC9919300

To date, various drugs have been developed for the therapeutic approach to NALFD: natural farnesoid X receptor (FXR) agonist, dual peroxisome proliferator-activated receptor α-δ (PPARα-δ) agonist, and glucagon-like peptide-1 antagonists.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9739791

To evaluate the photoinduced cytotoxicity of PPE against malignant cell types, SKOV-3 ovarian cancer cells were chosen as a model cell line and were treated with PPE, then irradiated with 460 nm light (Figure 18A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11604768

Here, we employed TRE-MPRA to profile transcriptional changes induced by activation of three well-characterized aminergic GPCRs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Here", ",", "we", "employed", "TRE-MPRA", "...

PMC9429973

Median age at death was 72 years and death occurred at a median of 12 years post SVT diagnosis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "age", "at", "death", ...

PMC10847511

A value of 0 indicated the presence of LOH, while a value of 1 or more indicated the absence of LOH.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "value",...

PMC11699042

f Volcano plot of DEG resulting from comparing the two A-673, HeLa, and MCF-7 strains with the highest variance (A-673_7 vs A-673_3, HeLa_5 vs HeLa_3 and MCF-7_5 vs MCF-7_3).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O"...

PMC5925824

PD-L1-Fc proteins were injected for 180 s (contact time) over the immobilized LY3300054 at a flow rate of 30 μl/min.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PD-L1-Fc", "...

PMC11621493

All animal procedures were performed as humanely as possible to minimize suffering.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "animal", "procedures", "were", "performed", "as", "humanely", "as", "poss...

PMC11751675

Four xanthanolides (compounds 46–49) have been identified in the aerial parts of young Xanthium spinosum L. plants.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Four", "xanthanolides", "(", "com...

PMC11026382

The points themselves are mean-centered.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "points", "themselves", "are", "mean-centered", "." ] } ]

PMC10728200

Subsequently, they were permeabilized with 0.3% Triton X-100 (Sigma-Aldrich, #9036–19–5) in PBS for 10 min and then blocked with 10% normal goat serum (Beyotime, #C0265, Jiangsu, China) for 1 h at 37 °C.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11543885

An Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Fisher Scientific) paired with an Ultimate 3000 UHPLC system (Thermo Fisher Scientific) was utilized to analyze purified tryptic peptides through LC-MS/MS, as previously described.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10812665

We used here the hits obtained from the NeuriTox NTP screen for an exemplary mechanistic study.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "used", "here", "the", "hits", "obtained", ...

PMC11694066

Such an effect of PARPi and ATRi has been reported in other preclinical models with high replication stress [reviewed in Chabanon and colleagues (60)] and in clinical studies evaluating ATRi, notably in non–small cell lung cancer (NSCLC) and melanoma, in which they can potentiate or revert resistance to anti–PD-L1, respectively (61–63).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11786600

Based on the above theory, we designed a portable electrospinning dressing (PED) and a PED loaded with kaempferol (PED4) (Scheme 1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6684588

Finally, incorporation of an Fc domain assists in purification during protein production, and use of the IgG2 Fc isotype reduces the possibility of effector function due to immune cell engagement.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11300085

SK-OV-3 cells were cultured into a 6-well plate and transfected with indicated CMKLR1 siRNA using Lipofectamine 8000 (Beyotime, Shanghai, China) according to manufacturer's instruction for 48 h. Then, the silenced cells were treated with chemerin (50 ng/ml) for another 24 h. The silencing sequences are presented in the following: si-CMKLR1#1: AAUAAUCAGGGUAUUCAUCAC si-CMKLR1#2: ACAUGUUGUGGAUGAGAAGAA si-CMKLR1#1: AAUAAUCAGGGUAUUCAUCAC si-CMKLR1#2: ACAUGUUGUGGAUGAGAAGAA Cells were cultured on 6-well plates and treated with chemerin (50 ng/mL) for 24 h. After treatment, supernatants were collected and lysed with a mixture of protease inhibitor RIPA lysis buffer (Beyotime, Haimen, China) for 40 min at 4°C.

[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10671321

Very recently, Uyen Dao et al. demonstrated that ColQ binds LRP4.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Very", "recently", ",", "Uyen", "Dao", "et", "al.", "demonstrated", "that", ...

PMC8751435

Supernatants were transferred to precooled centrifuge tubes for immediate measurement of caspase‐1, caspase‐3 activities by using caspase‐1, caspase‐3 activity assay kits (Beyotime) according to the manufacturer's protocols.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11519077

In a previous study, it was shown that the clinical and histological indications of DSS-induced colitis in mice were successfully alleviated by systemic infusion of umbilical cord MSCs (UCMSCs), whereas MMP2 and MMP9 activities were increased in DSS-treated animals but were considerably reduced in mice receiving UCMSC .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8609870

In the past few decades, the disease has caused heavy psychological burden for couples who want to have children and their families.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", ...

PMC11155445

Mono acylated thiourea (103a–i) showed the best inhibition activity against S. aureus, and among them, compound 103a exhibited comparable activity to standard drug Ampicillin, the highest activity of compound 103a was due to the presence of Br atom at ortho position as it strongly interacted with active sites of bacterial cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11711347

In summary, the Ni(II)ProDtc complex was synthesized in situ by reacting proline with carbon disulfide (CS2) in ethanol.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "summary", "...

PMC11782508

The amplicons were resolved by electrophoresis on a 1% (w/v) agarose gel prepared in 1X Tris-Borate-EDTA (TBE) buffer.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC9429973

Our overarching hypothesis is environmental factors such as air pollution, weather, and chemical exposures modify disease severity in children with sickle cell disease.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC10454535

Our data suggested oxidative stress to be induced by the treatment as well.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "data", "suggested", "oxidative", "stress", "to", "be", "induced", ...

PMC6267596

Anti-DLBCL chemotherapy dosing schedules are intermittent to avoid damage to normal tissue such as the mucous membranes, intestinal lining, and the bone marrow.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11352746

Neurites, which are small processes in neurons, are notably affected by alterations in neuronal homeostasis, which are present in most neurodegenerative disorders .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC9429973

The MDS-specific comorbidity index (MDS-CI) offers a comprehensive tool to assess the prognostic impact of comorbidities of the major organ systems (see fig A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11496728

Next, the cells were verified at the protein level, and the results indicated that the Apaf1 protein level of KO-1, 2, and 3 cell lines was lower than that of CHO-WT cells compared with CHO-WT cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "...

PMC9429973

The published first-line median OS in TP53m AML is 4-7 months, regardless of whether patients are treated with intensive chemotherapy or non-intensive approaches, such as a hypomethylating agent with venetoclax (VEN).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6461034

Since substrate‐centric inference attributes data from multiple, possibly numerous, substrate phosphosites to a single kinase, bar segments coalesce into a black stack in more extreme cases.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

ITI significantly increased the probability to reveal the transformation from LGL in pts with c-MYC/BCL6 HGBL DH (p=0,01) and HGBL NOS (p<0,001) compared with morphological study only.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10810426

Knockdown of several nuclear pore proteins dramatically reduced the appearance of integrated MLV DNA in DCs but not NIH3T3 cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Knockdown", "of"...

PMC11676674

Briefly, the following functions were combined through Boolean logic to create the final mask: Threshold, Spot, Range, LevelSet, Dilate.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC9429973

Despite expansion of therapeutic options, WM remains incurable.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "expansion", "of", "therapeutic", "options", ",", "WM", "remains", "incurable", "." ] } ]

PMC11539788

Therefore, we concluded that RNF19A affected the activity of the AKT/mTOR signalling pathway through the regulation of ILK and suppressed the proliferation, migration, and invasion of BCa cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC4485786

In the NHS-IL12-treated groups, levels of both PCNA- (Fig. 5A) and Ki67-stained sarcoma cells were significantly lower than in the FcIL-7-control (Fig. 5A, B).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10887351

GPCRs show three intracellular and extracellular loops, an extracellular N-terminal domain, and a cytosolic C-terminal tail with phosphorylation sites for GPCR kinases (Figure 1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11769516

Furthermore, DON contributes to oxidative stress in HEK-293 and DF-1 cells .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O" ], "tokens": [ "Furthermore", ",", "DON", "contributes", "to", "oxidative", "stress", ...

PMC11612794

Half-maximal inhibitory concentration (IC50) of nocodazole calculated using the data shown in (E).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Half-maximal", "inhibitory", "concentration", "(", ...

PMC11612626

Compound A treatment also increased the levels of PA28α/PSME1 by three-fold and PA28β/PSME2 levels five-fold (Fig. 7B).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "A", "treatment", "als...

PMC11705484

5637 cells were treated with vehicle control (NC), TNF‐α and/or Flag‐tagged IκBαS32AS36A, followed by cytoplasmic and nuclear protein fractionation and immunoblot analysis of TRMT61A and p65 protein expression.

[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11476106

Elevated VN levels have previously been described in plasma (and other fluids) of poor prognosis patients with glioma , melanoma , and breast , ovarian, and endometrial cancer and in children with Hodgkin’s lymphoma , acute lymphoblastic leukemia , and NB .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Compassion of groups was carried out using χ2 test.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compassion", "of", "groups", "was", "carried", "out", "using", "χ2", "test", "." ] } ]

PMC11770199

To further investigate if MSCs-p14 treatment could enhance the immune response and contribute to its therapeutic effects, we repeated the in vivo experiment with slight modifications.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6160470

Representative flow cytometry histogram of Rhodamine 123 after treatment with indicated compounds is shown in inlet. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Representative", "flow", "cytometry", "histogram", ...

PMC11371627

Multi-gene panel sequencing including common candidate genes for myopathy or muscular dystrophy revealed a novel hemizygous deletion (c.756del, p.Trp253Glyfs*15) of the XK gene (Figure 2B).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11555465

Bladder cancer is the tenth most frequent malignancy worldwide and is ~4 times more likely to occur in men than in women (2).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11545737

In particular, the expression of CagA, VacA and CagL was reduced in emodin-treated H. pylori compared to untreated bacteria.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "particular", ...

PMC11705862

After that time the cells were washed 1x with PBS and incubated for 30 min.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "that", "time", "the", "cells", "were", "washed", ...

PMC11591030

The expression of the MyD88 and IL-6 genes was reduced in the LPS + ML385 group compared to the LPS stress group, but the expression levels of other inflammatory factor-related genes did not differ significantly from those in the LPS stress group (p < 0.05).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10588957

Further experiments are warranted to confirm this hypothesis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "experiments", "are", "warranted", "to", "confirm", "this", "hypothesis", "." ] } ]

PMC11401358

Juhui Qiu: Funding acquisition, Methodology, Resources, Writing – review & editing.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Juhui", "Qiu", ":", "Funding", "acquisition", ",", "Methodo...

PMC11621565

The data are shown as a fold increase to control.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "data", "are", "shown", "as", "a", "fold", "increase", "to", "control", "." ] ...

PMC11686380

Additionally, GAP43 was found in medial ganglionic eminence-originated SST-positive and caudal ganglionic eminence-originated VIP-positive GABAergic interneurons.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "GAP43", "was", "found", ...

PMC11761919

The tubes were incubated at 41 °C with shaking at 180 rpm for 180 min.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tubes", "were", "incubated", "at", "41", ...

PMC7039683

Third, the Irf6 binding site was enriched to a greater extent in the enhancer candidates that were associated with more anti-H3K27Ac ChIP-seq reads at 8 hour post fertilization (hpf) than at 11 hpf.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10482220

These data suggest that many RNA-binding proteins will be found within SGs, even those that have a nuclear localization.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "data", "suggest", ...

PMC3915447

Firstly, 5.41 g of FeCl3·6H2O (99% purity) and 1.99 g FeCl2·4H2O (99% purity) were dissolved in 100 ml of distilled water in a three-necked flask.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11365983

Measurements of cilia length in ATDC5 (automatic, Cell Profiler) and mIMCD3 (manual, using Fiji software) were performed under conditions of growth in complete media with 10% FBS.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC2777936

For real-time RT-PCR analyses of individual gene products, cDNA synthesis and SYBR green PCR reagents were purchased from Applied Biosystems (CA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC7709199

The crystallization conditions for wild-type and GD-derived DSCAMIg7–Ig9 are almost identical (Table 1 ▸), yet a crystal structure could only be determined with the GD-derived DSCAMIg7–Ig9 crystals.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11472569

Comparable transfer of drug resistance and ABCB1 protein by EVs have been reported in breast cancer, bladder cancer, and ovarian cancer cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC9429973

Infection by the new corona virus strain (COVID-19) and its related syndrome has been associated with more than 6 million deaths worldwide.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11679326

β1,6-GlcNAc-bearing complex N-glycans involved in glioblastoma migration and invasiveness were studied by Yamamoto et al. Stable transfection of MGAT5 into human glioma cells resulted in a marked increase in the invasiveness of glioma in vitro .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Results: In total, 128 patients received SC ravulizumab (SC/SC: n = 84; IV/SC: n = 44; mean [range] duration of SC treatment: 486.4 [37–709] days).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11723210

To assess the accuracy of phase reconstruction for large phase objects using the BPR method, three types of experimental samples were prepared for distinct validation experiments.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

OS at 12 months post REL of these 143 patients was 22% with no significant difference between axi-cel and tisa-cel failures (Figure).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC2118063

Results were normalized to transcript levels in IgD PBB.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", "were", "normalized", "to", "transcript", "levels", "in", "IgD", "PBB", "." ] } ]

PMC9878278

To attenuate the MDA5 pathway in SC, we treated the cells with siMDA5 and measured MDA5 protein expression at 48 hpt.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "attenu...

PMC11659734

Micronuclei form from acentric chromosomal fragments or whole chromosomes that are not incorporated into the daughter nuclei during cell division.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Micronuclei", "form", "from"...

PMC11723947

Fig. 6b).

[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Fig.", "6b", ")", "." ] } ]

PMC11471157

No noticeable increase in the number of spheroids was observed for any of the cell types even after the culture period.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "noticeable", ...

PMC11679033

Upon completion of the exposure, lymphocyte cultures were subjected to centrifugation at 100× g using a benchtop centrifuge (ROTOFIX 32A, Hettich, Tuttlingen, Germany).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Summary/Conclusion: On admission of a patient with COVID19, calculation of the neutrophil to lymphocyte ratio (NLR) is important, a high NLR could be a predictor of a severe disease course to which clinicians should be alerted for better management of the patient.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7081114

Differential expression of KIF21B in The Cancer Genome Atlas database and hepatocellular carcinoma cell lines.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Differential", "expression", "of", "KIF21B", "in", "The", "...

PMC10317042

B, SU-CCS1, and Hewga-CCS cells were treated for 24 hours with the absence (–) or presence (+) of 300 nmol/L vorinostat or JQ1.

[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...

PMC11775197

In CRC, with tumor progression, increased expression of PPARα and PPARβ/δ or decreased expression of PPARγ .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "CRC", ",", "with", "tumor", ...

PMC11411131

Krab-Sec/Luc was transfected into primary cultured cerebellar granule cells (CGCs), which were subsequently exposed to 0, 6, or 20 µM MeHg for 24 h. Krab-Sec/Luc exhibited a MeHg-dependent signal in CGCs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11730311

The pA2 of 8.23 for CGRP8-37 is in accordance with other findings.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "pA2", "of", "8.23", "for", "CGRP8", "-", "37", "is"...

PMC11476222

The separation conditions for sphingolipids were optimized by comparing two columns: the Acclaim C18 column (3 μm, 300 Å, 150 × 2.1 mm; Thermo Scientific, Sunnyvale, CA, USA) and the ZIC-HILIC column (3.5 μm, 200 Å, 150 × 2.1 mm; Millipore Sigma, Darmstadt, Germany).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11635519

The Gibson reaction was performed with 30 μL of HiFi DNA master mix mixed with 28 μL of plasmid (1.2 μg) and 5 μL of the PCR product (3 μg).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...