OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC9429973	Notably, treatment with BTK inhibitors significantly inhibited CLL proliferation and resulted in disintegration of the 3D spheroid architecture.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "treatment", "with...
PMC11802929	For example, PG3-High denotes cells captured by PG3 peptides with HPhobic-High TCRs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "example", ",", "PG3-High", "denotes", "cells", "captured", "by", ...
PMC11696659	Luis Paz-Ares: Writing – review & editing, Project administration, Investigation, Conceptualization.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Luis", "Paz-Ares", ":", "Writing", "–", "review", "&", ...
PMC10362265	All-to-all RMSD plots showed that the human IL18-IL18BP complex from the crystallization study showed the highest backbone mobility in the repeated runs (Fig. S1a).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973	The purpose of this randomized phase 3 study is to demonstrate the superiority of continued BTK pathway inhibition with pirtobrutinib compared to other available therapies in patients with BTKi-treated CLL/SLL.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10631132	As was later established, the creation of these cells by transfecting them with the so-called Yamanaka factors (Oct3/4, Sox2, Klf4, c-Myc) allowed for their differentiation into all three germ-layers and subsequently into numerous terminally differentiated cell types [3–10], thereby proving their pluripotency.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7185206	Additional-related experimental data are in Supplemental Tables 3–4, Supplemental Figures 5–6.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additional-related", "experimental", "data", "are", "in", "Supplemental", "Tables", "3...
PMC9429973	Disease profile at diagnosis and sample evolution in terms of overall survival (OS) and progression-free survival (PFS) were analyzed.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Disease...
PMC11730311	These functions range from regulation of energy homeostasis, vasodilation and sensitization of nociceptive nerve fibres.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "functions", "range", "from", "regulation", "o...
PMC11474209	The toxins CYN comes in two different forms, 7-epi-CYN, and 7-deoxy-CYN.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "toxins", "CYN", "comes", "in", "two", "different", "forms", ",...
PMC11216402	Normal fibroblasts would be distinguishable by lower mutation or CN alteration rates.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Normal", "fibroblasts", "would", "be", "distinguishable", "by", "lower", "mutation", ...
PMC11591794	Although treatment can be easily applied in the early stages, long-term morbidity resulting from treatment is also common .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "treatment", "can", "b...
PMC9429973	To gain better understanding we use AML in vivo models and in vitro assays in combination with next-generation sequencing (NGS) approaches to identify molecular mechanisms explaining the tumor suppressive function of STAT3β in AML.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10812665	On first sight, a consistent metabolite up-regulation in a group of related compounds is surprising in cells exposed to metabolic inhibitors.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "first"...
PMC9712534	Ku80 was shown as a loading control.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ku80", "was", "shown", "as", "a", "loading", "control", "." ] } ]
PMC11317131	Host cells were cultured in chemostats to maintain a supply of fresh uninfected cells for the selection scheme.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Host", "cells", "were", "cultured", "i...
PMC7154001	Several factors were found to influence the metabolite profiles of these drugs/compounds, including species, gender, and route and dose of administration.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC10587429	Monitor tumor growth by IVIS imaging once a week.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Monitor", "tumor", "growth", "by", "IVIS", "imaging", "once", "a", "week", "." ] } ]
PMC11371747	The competitive inhibition by 2.5 μM [H]-l-LV influx of PCFT was measured essentially as described for the RFC assay, except that the incubation time was 3 min, at pH 5.5 (the optimal pH for PCFT) and pH 7.4 with increasing amounts of unlabelled LV stereoisomers/antifolate drug.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9646302	RAC1 is overexpressed in ccRCC cells, thereby promoting proliferation, migration, metastasis, and angiogenesis and is required for MAPK pathway activation .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11670407	Cell survival was normalized to that of control cells treated with vector only.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cell", "survival", "was", "normalized", "to", "that", "of", "control", ...
PMC9027909	P value < 0.05 were considered statistically significant.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "value", "<", "0.05", "were", "considered", "statistically", "significant", "." ] } ]
PMC5600151	As shown in the sections above, dendrimers have been extensively used as carriers for drugs or siRNA and have the potential to combine both payloads in one formulation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8414691	CB show different statistically significant levels depending on comparison between SRCAP A and scramble (**) or mock () Depletion of SRCAP affects cell division in HeLa cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11116779	The aforementioned structural and functional analyses indicated that cell death resulting from redox imbalance likely plays a central role in lung injury induced by PS-NPs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10654497	Immune landscape of patients with subtypes C1 and C2. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Immune", "landscape", "of", "patients", "with", "subtypes", "C1", "and", "C2", ".", "(" ...
PMC9429973	One patient presented with seizures on day 2 of the first cycle, and another patient presented with diplopia, abnormal coordination (dismetry) and visual blurring on the 10 day of the first cycle.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11721295	This gives a multiplicity-adjusted P value for each comparison, which is reported.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "gives", "a", "multiplicity-adjusted", "P", "value", "for", "each", ...
PMC11047729	It also influences communication with the nuclear receptor–corepressor complex, restoring the wild-type RARα/RXR regulatory pathway.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "also", "influences", "communication", ...
PMC9429973	Aims: In this work we sought to define the genomic architecture of MPN patients during disease evolution, and gain insight into the chromatin and transcriptional perturbations induced by epigenetic modifiers’ mutations.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	The elucidation of potential mechanisms needs further exploration.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "elucidation", "of", "potential", "mechanisms", "needs", "further", "exploration", "." ] } ]
PMC11803918	To confirm the ROS production in vivo, hybrid exosomes were intravenously injected into the A375 tumor-bearing nude mice.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O" ], "tokens": [ "To", "confirm", "the", "...
PMC11472639	Blood samples were collected into sodium heparin (17 IU/mL), ethylenediaminetetraacetic-acid (EDTA, 1.8 mg/mL) and silica act clot activator treated vacutainers (Becton & Dickson, NJ, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10938336	Compound–Target Network: In this subfigure, nodes represent compounds and their associated proteins.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "–", "Target", "Network", ":", "In", ...
PMC9370419	Docking using AutoDock 4 illustrated that estradiol benzoate binds with HBx at TRP87 and TRP107, which overlap the H-box of HBx.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Docking", "u...
PMC7709199	Protein expression was performed in accordance with previously published protocols (Aricescu et al., 2006 ▸).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Protein", "expression", "was", "performed", ...
PMC9429973	Methods: Pts were treated in 28-day cycles (C) with CC-95251 administered intravenously at doses of 3, 10, or 20 mg/kg every week (QW) and with ritux 375 mg/m on days (D) 1, 8, 15, and 22 of C1, D1 of C2–5, and D1 of every other cycle C6–24 until disease progression or unacceptable toxicity.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9031474	TRPA1 is related to TRPV1 and leads to the influx of Ca ions into the cytosol .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "TRPA1", "is", "related", "to", "TRPV1", "and", "...
PMC11747467	We selected the genes with a weight > 1 of JAK/STAT3 pathways and observed the mRNA expression in basal and luminal bladder cancer ( Supplementary Table S5 ).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11803918	On day 21, all mice were euthanized, and tumor tissues were weighed and saved together with other organs for histological and immunofluorescence staining analysis: length × [width] × 0.52 = tumor volume.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11045125	The stronger expression of progenitor B cell proteins in the new model may be due to the somewhat higher level of Myb.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "stron...
PMC9429973	Recent data show that the status of the TP53 gene may be of prognostic value in children with B-NHL.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Recent", "data", "show", "that", ...
PMC9844987	We focused on promoters with at least 2 decomposed promoters significantly contributing to the overall expression of the promoter.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "focused", "on", "promoters"...
PMC11528603	B: HL60 cells treated with doxorubicin (0.1 μg/ml) for 24 hours.	[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", ":", "HL60", "cells", "treated", "with", "doxorubicin", ...
PMC11519583	We found that Wnt5b could associate with Ror2 via its extracellular CRD (Fig. 3c).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "found", "that", "Wnt5b", "could", "associate", ...
PMC10831439	Considering that α-GalCer seems to be necessary for CD1d-mediated cytotoxicity in vitro, the assays were performed in the presence of α-GalCer or DMSO.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11767725	Dyslipidemia further alters the skin’s lipid environment.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dyslipidemia", "further", "alters", "the", "skin", "’s", "lipid", "environment", "." ] } ]
PMC9429973	Time-to-event analyses utilized the Kaplan-Meier method.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Time-to-event", "analyses", "utilized", "the", "Kaplan-Meier", "method", "." ] } ]
PMC6901583	Warm medium was used to wash away the cells that did not adhere gently and repeatedly after 6 days of culture.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Warm", "medium", ...
PMC8524093	Phosphorylated STAT translocates to cell nucleus where it will induce the expression of Interferon-stimulated genes (ISG), which includes pattern-recognition receptors (PRRs), interferon-regulatory factors (IRFs), cytokines and chemokines, and pro-apoptotic molecules.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11680391	The herd veterinarian would analyze and comment on the udder health status of the dairy farm at minimum every three months and suggest interventions where required according to the target.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9096373	Results from the curve and the bar chart, and micro-PET/CT (red arrows) revealed that the tumor volume (A) in the APA + RT group was significantly lower compared with the control and RT groups (F=3.97 and 4.77, respectively, P<0.05).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3675084	It was reported that reduction or loss of survivin is associated with several mitotic defects, including hyperduplication of centrosomes and aberrant spindle assembly .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11545737	In H. pylori-infected dendritic cells, TLR2 dependent-NLRP3 inflammasome activation and IL-1β secretion are reduced in the absence of cagPAI or CagL but not in the absence of CagA or VacA .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9503669	This interaction, together with binding of the SH2 domain to the tyrosine-phosphorylated C-terminal tail, allosterically stabilize the inactive conformation of the kinase domain .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11737091	Briefly, 1,000 cells in 500 µL of medium were seeded in the wells of a 6-well plate.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "1,000", "cells", "in",...
PMC11322866	This finding provides new evidence for the involvement of ERK1/2 in the regulation of cellular senescence.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "finding", "provides", "new", "evidence", "for"...
PMC10454535	Studies with various concentrations of PIN would more clearly confirm whether PIN itself induces or ameliorates oxidative stress in MM cells and whether it does so in a dose-dependent manner.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10734950	Hoechst is a fluorescent dye that permeates both live and dead cells, whereas P.I. selectivity can only permeate cells whose plasma membrane is compromised.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11400680	Outputs of prompt generator (YOLOv9-E) on an input image from medium test set (21_CHO image in Figure 1A). (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Outputs...
PMC9684669	Proteins were transferred to polyvinylidene difluoride (PVDF) membrane by dry transfer (iBlot 2 Gel Transfer Device, both from Thermo Fisher Scientific) or tank wet transfer.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7570809	Taken together these results indicate that the peptide can be considered a promising molecule with properties suited to be assessed in the future for its validation as a selective therapeutic/diagnostic weapon in hepatocarcinoma.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10919056	Axitinib. (	[ { "tags": [ "O", "O", "O" ], "tokens": [ "Axitinib", ".", "(" ] } ]
PMC6461034	Biopsies were collected both before and after 2 weeks of erlotinib treatment to study intra‐tumor drug concentrations within the framework of a phase I clinical study (standard dose, trial NCT01636908; Labots et al, in preparation).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9503669	This activation event occurs in the trans-Golgi network, where Nef is recruited by the phosphofurin acidic cluster 2 (PACS-2) adaptor protein .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9841531	This lack of application is of course accompanied by uncertainty with respect to the outcome data.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "lack", "of", "application", "is", "of", ...
PMC11726183	Compound 18 with a nicotinic ring displayed much lower inhibition potential in comparison with compound 8 with an iso-nicotinic ring.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "18", "with", ...
PMC11544771	Moreover, in response to the combined treatment, the level of CDK1 was not altered, but cyclin B1 was substantially downregulated, which may be linked to the decreased cell population in the G2/M phase.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10452486	Dimerization may occur in different alleles at different time points depending on the nature of the activating factor, implying that the dimerization may differ under different pathological conditions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11721587	Similar protocol was applied to tagging endogenous Gli2 (SgRNA: TTTTAAACATGATGACCTAA+) with C-terminal 3× Flag except that Puromycin (5 μg/ml) was used for selection.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9000591	Remarkably, SE2 and SE3 (SI = 5.20 and 2.03, respectively) achieved higher selectivity indexes than the drug doxorubicin (SI = 1.80).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Results: TDS was performed in a total of 78 samples from 67 patients.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "TDS", "was", "performed", "in", "a", "total", ...
PMC11001582	Intriguingly, using two complementary methods, namely two-photon calcium imaging and high-density Neuropixels recording, we observed hyperexcitability in polyGR mice in superficial cortical layers, which are affected in FTD, but not deeper layer 5 neurons which are vulnerable in ALS.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11610461	Considering the items with frequencies less than 5, Fisher’s exact test was used for verification, and p < 0.05 was considered as a statistically significant difference.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11012313	While viruses have developed many pathways to alter metabolisms, almost all oncogenic viruses increase HIF-1α levels via multiple pathways .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "viruses", "have", ...
PMC9268620	The damnacanthal-induced Ca was found to be mediated by voltage-dependent and voltage-independent Ca channels .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "damnacanthal-induced", "Ca", "was", "found", "to", "be", ...
PMC9429973	Median duration of FEDR therapy in the FEDR group was 3.7 (range, 0–12.2) months, and 47.1% (33/70) received 400 mg FEDR once/day.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10873328	The univariate Cox regression analysis of 12 hypoxia-related genes. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "univariate", "Cox", "regression", "analysis", "of", "12", "hypoxia-related", "genes", "."...
PMC10772747	The activity categories obtained from the cytotoxicity test indicate the potential of these compounds as effective anticancer agents (Kroll, 2001).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11806182	F Leave-one-out sensitivity analysis for UCEC Two-sample Mendelian randomization analysis illustrating the causal effects of AURKA gene expression on PCOS and UCEC.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "F", "Leave-o...
PMC11363012	However, iridoid, flavonoid, and anthocyanin compounds show different colocalization patterns across these tissues.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "iridoid", ",", "flavonoid", ",", ...
PMC11756514	Thus, the host’s immune system needs to recognize and clear this bacterium when an infection is initiated.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "host", ...
PMC11525028	In bladder cancer, upregulated NAT10 increases the ac4C modification level on AHNAK mRNA, which suppresses its mRNA decay and further results in chemoresistance.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11388384	We cultured explanted E13.0 mouse limb tissue on top of sparsely plated SHH-Halo sender cells, and tracked SHH-Halo diffusing through the cultured primary limb tissue (Fig. 2F).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	To the best of our knowledge, we have first reported the changes in circulating CD34+ cells count during RUX, showing a parallel decrease in spleen diameter and circulating hematopoietic precursors.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3122064	Taken together, these results indicate that targeting MDM2 in combination with cisplatin treatment overcomes both intrinsic as well as acquired-resistance to cisplatin in wild-type p53-expressing TC cells, and is largely dependent on activation of the Fas death receptor pathway.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11678130	Moreover, this combination had no toxic effect on human keratinocytes—HaCaT. This study also examined the non-irritating and angio-inhibiting effects of the QUE + 5-FU combinatorial treatment in ovo, representing a starting point for future studies.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11055323	These results provide the first case for condensate remodeling as a transforming event to generate oncogene and such condensates can be targeted for therapy.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11694625	As shown in Fig. S18,† the fluorescence spectra of 3a–3d were similar too.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "shown", "in", "Fig.", "S18,†", "the", "fluorescence", "spectra", ...
PMC5916734	The membrane was washed according to the manufacturer’s protocol; detection was performed using a Biotin Chromogenic Detection Kit (Fermentas, Lithuania).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11394112	A successful engraftment of DLBCL in NOD/scid mice was previously showing that subcutaneous passage enhanced the engraftment and metastatic capacity of various DLBCL cell lines .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11225860	The use of the TPX2/AK-A inhibitor Aurkin A disrupts the cell G2 phase of the cell cycle resulting in apoptosis during or shortly after G2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11377827	A cross-liking chromatin enrichment approach was used (Kustatscher et al, 2014) with some modifications.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "cross-liking", "chromatin", "enrichment", "a...
PMC11496728	Fig. 8Comparison of transient and stable expression levels and relative copy number of IL-3 in CHO-WT and CHO-KO cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O" ], "tokens": [ "Fig.", "8Comparison", ...
PMC10578720	Meanwhile, PGC-1α and SIRT3 expression was downregulated.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Meanwhile", ",", "PGC-1α", "and", "SIRT3", "expression", "was", "downregulated", "." ] } ]
PMC9024365	In SD4 KO mice, we observed significant reduction in both extrasynaptic GluA2 and extrasynaptic GluA1 puncta density (Matt et al., 2018), consistent with our observations in COS cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Methods: The EPICOVIDEHA registry is an online survey (www.clinicalsurveys.net) that has collected since April 2020 until January 2022 5,445 cases of COVID-19 in individuals with baseline haematological malignancies (Salmanton-García et al, 2021 Hemasphere) The survey is promoted by the European Hematology Association - Infectious Diseases Working Party (EHA-IDWP) and has been approved centrally by the Institutional Review Board and Ethics Committee of Fondazione Policlinico Universitario A. Gemelli – IRCCS – Università Cattolica del Sacro Cuore, Rome, Italy (Study ID: 3226).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11525028	RNA-seq revealed the differentially expressed genes in NAT10-KO compared to control cell lines (Figure 3A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RNA-seq", "revealed", "the", "differentially", "e...
PMC11257988	KS-58 was shown to selectively bind to KRASG12D and inhibit the in vitro proliferation of both the A427 human lung cancer cell line and the PANC-1 human pancreatic cancer cell line that expresses KRASG12D.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLin...
PMC11551844	JDE was not toxic at 0.1 μg mL but showed toxicity at 1, 10 and 100 μg mL. JDH was toxic at 100 μg mL only.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Notably, treatment with BTK inhibitors significantly inhibited CLL proliferation and resulted in disintegration of the 3D spheroid architecture.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "treatment", "with...

PMC11802929

For example, PG3-High denotes cells captured by PG3 peptides with HPhobic-High TCRs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "example", ",", "PG3-High", "denotes", "cells", "captured", "by", ...

PMC11696659

Luis Paz-Ares: Writing – review & editing, Project administration, Investigation, Conceptualization.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Luis", "Paz-Ares", ":", "Writing", "–", "review", "&", ...

PMC10362265

All-to-all RMSD plots showed that the human IL18-IL18BP complex from the crystallization study showed the highest backbone mobility in the repeated runs (Fig. S1a).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC9429973

The purpose of this randomized phase 3 study is to demonstrate the superiority of continued BTK pathway inhibition with pirtobrutinib compared to other available therapies in patients with BTKi-treated CLL/SLL.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10631132

As was later established, the creation of these cells by transfecting them with the so-called Yamanaka factors (Oct3/4, Sox2, Klf4, c-Myc) allowed for their differentiation into all three germ-layers and subsequently into numerous terminally differentiated cell types [3–10], thereby proving their pluripotency.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7185206

Additional-related experimental data are in Supplemental Tables 3–4, Supplemental Figures 5–6.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additional-related", "experimental", "data", "are", "in", "Supplemental", "Tables", "3...

PMC9429973

Disease profile at diagnosis and sample evolution in terms of overall survival (OS) and progression-free survival (PFS) were analyzed.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Disease...

PMC11730311

These functions range from regulation of energy homeostasis, vasodilation and sensitization of nociceptive nerve fibres.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "functions", "range", "from", "regulation", "o...

PMC11474209

The toxins CYN comes in two different forms, 7-epi-CYN, and 7-deoxy-CYN.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "toxins", "CYN", "comes", "in", "two", "different", "forms", ",...

PMC11216402

Normal fibroblasts would be distinguishable by lower mutation or CN alteration rates.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Normal", "fibroblasts", "would", "be", "distinguishable", "by", "lower", "mutation", ...

PMC11591794

Although treatment can be easily applied in the early stages, long-term morbidity resulting from treatment is also common .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "treatment", "can", "b...

PMC9429973

To gain better understanding we use AML in vivo models and in vitro assays in combination with next-generation sequencing (NGS) approaches to identify molecular mechanisms explaining the tumor suppressive function of STAT3β in AML.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10812665

On first sight, a consistent metabolite up-regulation in a group of related compounds is surprising in cells exposed to metabolic inhibitors.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "first"...

PMC9712534

Ku80 was shown as a loading control.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ku80", "was", "shown", "as", "a", "loading", "control", "." ] } ]

PMC11317131

Host cells were cultured in chemostats to maintain a supply of fresh uninfected cells for the selection scheme.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Host", "cells", "were", "cultured", "i...

PMC7154001

Several factors were found to influence the metabolite profiles of these drugs/compounds, including species, gender, and route and dose of administration.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC10587429

Monitor tumor growth by IVIS imaging once a week.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Monitor", "tumor", "growth", "by", "IVIS", "imaging", "once", "a", "week", "." ] } ]

PMC11371747

The competitive inhibition by 2.5 μM [H]-l-LV influx of PCFT was measured essentially as described for the RFC assay, except that the incubation time was 3 min, at pH 5.5 (the optimal pH for PCFT) and pH 7.4 with increasing amounts of unlabelled LV stereoisomers/antifolate drug.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9646302

RAC1 is overexpressed in ccRCC cells, thereby promoting proliferation, migration, metastasis, and angiogenesis and is required for MAPK pathway activation .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11670407

Cell survival was normalized to that of control cells treated with vector only.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cell", "survival", "was", "normalized", "to", "that", "of", "control", ...

PMC9027909

P value < 0.05 were considered statistically significant.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "value", "<", "0.05", "were", "considered", "statistically", "significant", "." ] } ]

PMC5600151

As shown in the sections above, dendrimers have been extensively used as carriers for drugs or siRNA and have the potential to combine both payloads in one formulation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8414691

CB show different statistically significant levels depending on comparison between SRCAP A and scramble (***) or mock (*) Depletion of SRCAP affects cell division in HeLa cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11116779

The aforementioned structural and functional analyses indicated that cell death resulting from redox imbalance likely plays a central role in lung injury induced by PS-NPs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC10654497

Immune landscape of patients with subtypes C1 and C2. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Immune", "landscape", "of", "patients", "with", "subtypes", "C1", "and", "C2", ".", "(" ...

PMC9429973

One patient presented with seizures on day 2 of the first cycle, and another patient presented with diplopia, abnormal coordination (dismetry) and visual blurring on the 10 day of the first cycle.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11721295

This gives a multiplicity-adjusted P value for each comparison, which is reported.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "gives", "a", "multiplicity-adjusted", "P", "value", "for", "each", ...

PMC11047729

It also influences communication with the nuclear receptor–corepressor complex, restoring the wild-type RARα/RXR regulatory pathway.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "also", "influences", "communication", ...

PMC9429973

Aims: In this work we sought to define the genomic architecture of MPN patients during disease evolution, and gain insight into the chromatin and transcriptional perturbations induced by epigenetic modifiers’ mutations.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

The elucidation of potential mechanisms needs further exploration.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "elucidation", "of", "potential", "mechanisms", "needs", "further", "exploration", "." ] } ]

PMC11803918

To confirm the ROS production in vivo, hybrid exosomes were intravenously injected into the A375 tumor-bearing nude mice.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O" ], "tokens": [ "To", "confirm", "the", "...

PMC11472639

Blood samples were collected into sodium heparin (17 IU/mL), ethylenediaminetetraacetic-acid (EDTA, 1.8 mg/mL) and silica act clot activator treated vacutainers (Becton & Dickson, NJ, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10938336

Compound–Target Network: In this subfigure, nodes represent compounds and their associated proteins.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "–", "Target", "Network", ":", "In", ...

PMC9370419

Docking using AutoDock 4 illustrated that estradiol benzoate binds with HBx at TRP87 and TRP107, which overlap the H-box of HBx.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Docking", "u...

PMC7709199

Protein expression was performed in accordance with previously published protocols (Aricescu et al., 2006 ▸).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Protein", "expression", "was", "performed", ...

PMC9429973

Methods: Pts were treated in 28-day cycles (C) with CC-95251 administered intravenously at doses of 3, 10, or 20 mg/kg every week (QW) and with ritux 375 mg/m on days (D) 1, 8, 15, and 22 of C1, D1 of C2–5, and D1 of every other cycle C6–24 until disease progression or unacceptable toxicity.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9031474

TRPA1 is related to TRPV1 and leads to the influx of Ca ions into the cytosol .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "TRPA1", "is", "related", "to", "TRPV1", "and", "...

PMC11747467

We selected the genes with a weight > 1 of JAK/STAT3 pathways and observed the mRNA expression in basal and luminal bladder cancer ( Supplementary Table S5 ).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11803918

On day 21, all mice were euthanized, and tumor tissues were weighed and saved together with other organs for histological and immunofluorescence staining analysis: length × [width] × 0.52 = tumor volume.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11045125

The stronger expression of progenitor B cell proteins in the new model may be due to the somewhat higher level of Myb.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "stron...

PMC9429973

Recent data show that the status of the TP53 gene may be of prognostic value in children with B-NHL.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Recent", "data", "show", "that", ...

PMC9844987

We focused on promoters with at least 2 decomposed promoters significantly contributing to the overall expression of the promoter.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "focused", "on", "promoters"...

PMC11528603

B: HL60 cells treated with doxorubicin (0.1 μg/ml) for 24 hours.

[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", ":", "HL60", "cells", "treated", "with", "doxorubicin", ...

PMC11519583

We found that Wnt5b could associate with Ror2 via its extracellular CRD (Fig. 3c).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "found", "that", "Wnt5b", "could", "associate", ...

PMC10831439

Considering that α-GalCer seems to be necessary for CD1d-mediated cytotoxicity in vitro, the assays were performed in the presence of α-GalCer or DMSO.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11767725

Dyslipidemia further alters the skin’s lipid environment.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dyslipidemia", "further", "alters", "the", "skin", "’s", "lipid", "environment", "." ] } ]

PMC9429973

Time-to-event analyses utilized the Kaplan-Meier method.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Time-to-event", "analyses", "utilized", "the", "Kaplan-Meier", "method", "." ] } ]

PMC6901583

Warm medium was used to wash away the cells that did not adhere gently and repeatedly after 6 days of culture.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Warm", "medium", ...

PMC8524093

Phosphorylated STAT translocates to cell nucleus where it will induce the expression of Interferon-stimulated genes (ISG), which includes pattern-recognition receptors (PRRs), interferon-regulatory factors (IRFs), cytokines and chemokines, and pro-apoptotic molecules.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11680391

The herd veterinarian would analyze and comment on the udder health status of the dairy farm at minimum every three months and suggest interventions where required according to the target.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9096373

Results from the curve and the bar chart, and micro-PET/CT (red arrows) revealed that the tumor volume (A) in the APA + RT group was significantly lower compared with the control and RT groups (F=3.97 and 4.77, respectively, P<0.05).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC3675084

It was reported that reduction or loss of survivin is associated with several mitotic defects, including hyperduplication of centrosomes and aberrant spindle assembly .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11545737

In H. pylori-infected dendritic cells, TLR2 dependent-NLRP3 inflammasome activation and IL-1β secretion are reduced in the absence of cagPAI or CagL but not in the absence of CagA or VacA .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9503669

This interaction, together with binding of the SH2 domain to the tyrosine-phosphorylated C-terminal tail, allosterically stabilize the inactive conformation of the kinase domain .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11737091

Briefly, 1,000 cells in 500 µL of medium were seeded in the wells of a 6-well plate.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "1,000", "cells", "in",...

PMC11322866

This finding provides new evidence for the involvement of ERK1/2 in the regulation of cellular senescence.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "finding", "provides", "new", "evidence", "for"...

PMC10454535

Studies with various concentrations of PIN would more clearly confirm whether PIN itself induces or ameliorates oxidative stress in MM cells and whether it does so in a dose-dependent manner.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10734950

Hoechst is a fluorescent dye that permeates both live and dead cells, whereas P.I. selectivity can only permeate cells whose plasma membrane is compromised.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11400680

Outputs of prompt generator (YOLOv9-E) on an input image from medium test set (21_CHO image in Figure 1A). (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Outputs...

PMC9684669

Proteins were transferred to polyvinylidene difluoride (PVDF) membrane by dry transfer (iBlot 2 Gel Transfer Device, both from Thermo Fisher Scientific) or tank wet transfer.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7570809

Taken together these results indicate that the peptide can be considered a promising molecule with properties suited to be assessed in the future for its validation as a selective therapeutic/diagnostic weapon in hepatocarcinoma.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10919056

Axitinib. (

[ { "tags": [ "O", "O", "O" ], "tokens": [ "Axitinib", ".", "(" ] } ]

PMC6461034

Biopsies were collected both before and after 2 weeks of erlotinib treatment to study intra‐tumor drug concentrations within the framework of a phase I clinical study (standard dose, trial NCT01636908; Labots et al, in preparation).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9503669

This activation event occurs in the trans-Golgi network, where Nef is recruited by the phosphofurin acidic cluster 2 (PACS-2) adaptor protein .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC9841531

This lack of application is of course accompanied by uncertainty with respect to the outcome data.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "lack", "of", "application", "is", "of", ...

PMC11726183

Compound 18 with a nicotinic ring displayed much lower inhibition potential in comparison with compound 8 with an iso-nicotinic ring.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "18", "with", ...

PMC11544771

Moreover, in response to the combined treatment, the level of CDK1 was not altered, but cyclin B1 was substantially downregulated, which may be linked to the decreased cell population in the G2/M phase.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10452486

Dimerization may occur in different alleles at different time points depending on the nature of the activating factor, implying that the dimerization may differ under different pathological conditions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11721587

Similar protocol was applied to tagging endogenous Gli2 (SgRNA: TTTTAAACATGATGACCTAA+) with C-terminal 3× Flag except that Puromycin (5 μg/ml) was used for selection.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9000591

Remarkably, SE2 and SE3 (SI = 5.20 and 2.03, respectively) achieved higher selectivity indexes than the drug doxorubicin (SI = 1.80).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Results: TDS was performed in a total of 78 samples from 67 patients.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "TDS", "was", "performed", "in", "a", "total", ...

PMC11001582

Intriguingly, using two complementary methods, namely two-photon calcium imaging and high-density Neuropixels recording, we observed hyperexcitability in polyGR mice in superficial cortical layers, which are affected in FTD, but not deeper layer 5 neurons which are vulnerable in ALS.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11610461

Considering the items with frequencies less than 5, Fisher’s exact test was used for verification, and p < 0.05 was considered as a statistically significant difference.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11012313

While viruses have developed many pathways to alter metabolisms, almost all oncogenic viruses increase HIF-1α levels via multiple pathways .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "viruses", "have", ...

PMC9268620

The damnacanthal-induced Ca was found to be mediated by voltage-dependent and voltage-independent Ca channels .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "damnacanthal-induced", "Ca", "was", "found", "to", "be", ...

PMC9429973

Median duration of FEDR therapy in the FEDR group was 3.7 (range, 0–12.2) months, and 47.1% (33/70) received 400 mg FEDR once/day.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10873328

The univariate Cox regression analysis of 12 hypoxia-related genes. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "univariate", "Cox", "regression", "analysis", "of", "12", "hypoxia-related", "genes", "."...

PMC10772747

The activity categories obtained from the cytotoxicity test indicate the potential of these compounds as effective anticancer agents (Kroll, 2001).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC11806182

F Leave-one-out sensitivity analysis for UCEC Two-sample Mendelian randomization analysis illustrating the causal effects of AURKA gene expression on PCOS and UCEC.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "F", "Leave-o...

PMC11363012

However, iridoid, flavonoid, and anthocyanin compounds show different colocalization patterns across these tissues.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "iridoid", ",", "flavonoid", ",", ...

PMC11756514

Thus, the host’s immune system needs to recognize and clear this bacterium when an infection is initiated.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "host", ...

PMC11525028

In bladder cancer, upregulated NAT10 increases the ac4C modification level on AHNAK mRNA, which suppresses its mRNA decay and further results in chemoresistance.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11388384

We cultured explanted E13.0 mouse limb tissue on top of sparsely plated SHH-Halo sender cells, and tracked SHH-Halo diffusing through the cultured primary limb tissue (Fig. 2F).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

To the best of our knowledge, we have first reported the changes in circulating CD34+ cells count during RUX, showing a parallel decrease in spleen diameter and circulating hematopoietic precursors.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC3122064

Taken together, these results indicate that targeting MDM2 in combination with cisplatin treatment overcomes both intrinsic as well as acquired-resistance to cisplatin in wild-type p53-expressing TC cells, and is largely dependent on activation of the Fas death receptor pathway.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11678130

Moreover, this combination had no toxic effect on human keratinocytes—HaCaT. This study also examined the non-irritating and angio-inhibiting effects of the QUE + 5-FU combinatorial treatment in ovo, representing a starting point for future studies.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11055323

These results provide the first case for condensate remodeling as a transforming event to generate oncogene and such condensates can be targeted for therapy.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11694625

As shown in Fig. S18,† the fluorescence spectra of 3a–3d were similar too.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "shown", "in", "Fig.", "S18,†", "the", "fluorescence", "spectra", ...

PMC5916734

The membrane was washed according to the manufacturer’s protocol; detection was performed using a Biotin Chromogenic Detection Kit (Fermentas, Lithuania).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11394112

A successful engraftment of DLBCL in NOD/scid mice was previously showing that subcutaneous passage enhanced the engraftment and metastatic capacity of various DLBCL cell lines .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11225860

The use of the TPX2/AK-A inhibitor Aurkin A disrupts the cell G2 phase of the cell cycle resulting in apoptosis during or shortly after G2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11377827

A cross-liking chromatin enrichment approach was used (Kustatscher et al, 2014) with some modifications.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "cross-liking", "chromatin", "enrichment", "a...

PMC11496728

Fig. 8Comparison of transient and stable expression levels and relative copy number of IL-3 in CHO-WT and CHO-KO cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O" ], "tokens": [ "Fig.", "8Comparison", ...

PMC10578720

Meanwhile, PGC-1α and SIRT3 expression was downregulated.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Meanwhile", ",", "PGC-1α", "and", "SIRT3", "expression", "was", "downregulated", "." ] } ]

PMC9024365

In SD4 KO mice, we observed significant reduction in both extrasynaptic GluA2 and extrasynaptic GluA1 puncta density (Matt et al., 2018), consistent with our observations in COS cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Methods: The EPICOVIDEHA registry is an online survey (www.clinicalsurveys.net) that has collected since April 2020 until January 2022 5,445 cases of COVID-19 in individuals with baseline haematological malignancies (Salmanton-García et al, 2021 Hemasphere) The survey is promoted by the European Hematology Association - Infectious Diseases Working Party (EHA-IDWP) and has been approved centrally by the Institutional Review Board and Ethics Committee of Fondazione Policlinico Universitario A. Gemelli – IRCCS – Università Cattolica del Sacro Cuore, Rome, Italy (Study ID: 3226).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11525028

RNA-seq revealed the differentially expressed genes in NAT10-KO compared to control cell lines (Figure 3A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RNA-seq", "revealed", "the", "differentially", "e...

PMC11257988

KS-58 was shown to selectively bind to KRASG12D and inhibit the in vitro proliferation of both the A427 human lung cancer cell line and the PANC-1 human pancreatic cancer cell line that expresses KRASG12D.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLin...

PMC11551844

JDE was not toxic at 0.1 μg mL but showed toxicity at 1, 10 and 100 μg mL. JDH was toxic at 100 μg mL only.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...