PMCID string | Sentences string | ner list |
|---|---|---|
PMC9429973 | However, there are a few studies on the combined effect of HMAs with tyrosine kinase inhibitors (TKIs) in chronic myeloid leukemia (CML) and the mechanism by which HMAs enhance the efficacy of molecular targeting agents remain poorly understood. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11803918 | More importantly, we further demonstrated that γδ-T exosomes could be used to generate tumor vaccines when they are conjugated with tumor-associated antigens. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"More",
... |
PMC9429973 | Whilst the role of glucose metabolism in activated T cells is extensively studied, the contribution of other energy sources is less clear. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Whilst"... |
PMC11075223 | Due to the low mortality and weight changes in IFA group, it would be the potential drugs to treat pathogenic influenza virus pneumonia . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11490153 | Spectra of C. citratus EO, citral, AlgNPs, C. citratus-AlgNPs, and citral-AlgNPs were recorded at 450–4000 cm using Tensor II spectrometer (Bruker, Ettlingen, Germany). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11075223 | distributed in Yunnan of China), etc. . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"distributed",
"in",
"Yunnan",
"of",
"China",
")",
",",
"etc",
".",
"."
]
}
] |
PMC11060216 | Our previous study showed that overexpressed S100A6 inhibits tumorigenicity of Calu-6 lung cancer cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"previous",
"study",
"showed",
"that",
"overexpressed",
... |
PMC11799978 | While all studies focused on the effect of sodium bicarbonate on cancer cells, we propose that sodium bicarbonate could work on CAFs directly by converting them back to their quiescence state, therefore limiting tumor growth indirectly. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11627133 | SiRA has two tetraloops and we examined both positions for the introduction of AP3 (Figure S6A, C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"SiRA",
"has",
"two",
"... |
PMC11720808 | Scale bar, 20 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Scale",
"bar",
",",
"20",
"μm",
"."
]
}
] |
PMC11411131 | Next, the CMV promoter, SV40 promoter, and TK promoter were evaluated to examine luciferase expression (Fig. 5B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Next",
",",
... |
PMC9599726 | Recently, a series of links between the Hippo–YAP pathway and ferroptosis have been identified . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Recently",
",",
"a",
"series",
"of",
"links... |
PMC9429973 | A recent British survey showed inconsistencies in the same country about fertility preservation management, despite being recommended in local and international guidelines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
... |
PMC10454535 | A p value < 0.05 was considered statistically significant. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"p",
"value",
"<",
"0.05",
"was",
"considered",
"statistically",
"significant",
"."
]
}
] |
PMC9386809 | Several Zr(IV) compounds are employed as Lewis acid catalysts that activate carboxyl and imino groups effectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Several",
"Zr(IV",
")",
"compounds",
"are",
... |
PMC11730000 | After treatment, fresh medium containing 10 µM DHE was added to the cells and incubated for 20 min in the dark at room temperature. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC10926885 | 10% FBS (fetal bovine serum) and standard concentration of penicillin/streptomycin antibiotics were added to the medium. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"10",
"%",
"FBS",
"(",
"feta... |
PMC6312945 | The proliferation of BEL-7404 cells in BEL-7404 pSUPER.neo-miR-101 group was different from that in BEL-7404 pSUPER.neo-miR-345 group (P<0.05) (Fig. 5). | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC11777207 | Experiment was repeated four times with three to six technical replicates per experiment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Experiment",
"was",
"repeated",
"four",
"times",
"with",
"three",
"to",
... |
PMC11791478 | The target specificity of 25A3 on cancer cells was also assessed in two cell lines with different levels of TF expression: HCT-116 human colorectal carcinoma (20,000 copies of TF/cell) and A431 human squamous cell carcinoma (200,000 copies of TF/cell). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
... |
PMC10079526 | 100 cells per replicate were analyzed (n = 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"100",
"cells",
"per",
"replicate",
"were",
"analyzed",
"(",
"n",
"=",
"3",
")",... |
PMC11737091 | Furthermore, the diagnostic receiver operating characteristic (ROC) curve yielded area under the curve (AUC) values of 0.871, 0.845, and 0.835 on the basis of the TCGA cohort and two independent GEO datasets, respectively (Fig. 3L-N). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | These data suggest that the use of NRD could be considered for transplanted patients without risks of more infective events. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"data",
"suggest",
... |
PMC10813895 | Luminal epithelial cells are surrounded by myoepithelial cells, both derived from the same stem/bipotent progenitors, though luminal epithelial cells and myoepithelial cells show distinct functions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11391695 | For immunoprecipitation (IP) analysis, cell lysates were obtained and subsequently subjected to protease inhibitor-containing lysis buffer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"immunoprecipitation",
"(",
... |
PMC9739791 | The authors suggested that the main component of the prodrug 30 TA spectrum is the absorption of the polymer radical cation (PPE*+) , produced by the ultrafast electron transfer from the polymer to the Pt(IV) center. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5839394 | SKBR3 cells were treated for 24h with IC50 concentrations of AgNPs-EPS and with 200 µg/ml of free-metal EPS. | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"SKBR3",
"cells",
"were",
"treated",... |
PMC11693599 | Although characteristics such as the number and size of secreted EVs differed between ovarian cancer cell lines and patient-derived cells, these results suggest that CD109 is a marker of EVs secreted from CSCs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5673955 | RrA was added into TRAP assay to the final concentration 0.1 U/mL followed by detection of telomerase activity. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RrA",
"was",
"added",
"into",
... |
PMC10958426 | Fig. 5The change of cell-cell communication between tumor tissues and normal tissues. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"5The",
"change",
"of",
"cell-cell",
"communication",
"between",
"tu... |
PMC8382973 | The evaluation criteria were derived from the Biological evaluation of medical devices—part 5: test for in vitro cytotoxicity (GB/T 16886.5-2017/ISO 10993-5:2009, IDT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11377827 | The chromatin fraction was solubilized in a 2× SDS loading buffer containing 1:500 Benzonase or 1:200 Denarase. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"chromatin",
"fraction",
"was",
... |
PMC11769516 | The article aims to present the threats posed by common Fusarium mycotoxins in food as factors causing CNS disorders and methods of preventing and minimizing the effects of mycotoxin neurotoxicity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6642070 | We did not observe significant changes in glycolysis enzymes, like hexokinase-1 (HK1), aldolase A, pyruvate kinase isozymes M1/M2 (PKM1/M2) and lactate dehydrogenase A (LDHA) (Supplemental Fig. 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11377827 | Representative images (A) and quantification (B) are shown. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Representative",
"images",
"(",
"A",
")",
"and",
"quantification",
"(",
"B",
... |
PMC9100622 | Ewing sarcoma (EwS) is an aggressive, highly metastatic bone tumor in children. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Ewing",
"sarcoma",
"(",
"EwS",
")",
"is",
"an",
"aggr... |
PMC11531744 | The expression of KIF26B, STX18 and CACNA1C were positively correlated with the sensitivity of zoledronate, nelarabine and idelalisib, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"expre... |
PMC11789597 | High expression of CAV1 was significantly correlated with the shorter overall survival (OS) and progression‐free survival (PFS) of MM patients, especially those patients treated with bortezomib (Figure 1B; Figure S1B,C, Supporting Information). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | This change was mainly driven by corresponding changes in NRM over time (p < 0.001, Figure Panel B) rather than significant increases in the relapse rate over time (p = 0.16, Figure Panel C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11409031 | We obtained information from the GTEx database Obtained mRNA expression information from 88 normal samples to increase the number of normal samples. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"obtain... |
PMC11725127 | While ICU30 exhibited similar effects to GA, ICU30 had low activities in inhibiting MM cell proliferation, which may be attributed to its poor water solubility. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11297139 | The reads with poor mapping quality (MAPQ < 10) and putative self-ligated reads (genome distance <15 kb) were discarded. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | Image: Summary/Conclusion: Our results are in accordance with experimental data indicating that NF-κB stimulates gal-3 expression and that gal-3 potentiates the antiapoptotic effect of BCL2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11777207 | M and N) Number and percentage of KikRed cDC1s in the dLN 24 hours after intradermal polyI:C injection and violet photoconversion in isotype and PD-1 antibody–treated mice. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8041314 | ENAMINE ID: Z2214001359; H NMR (600 MHz, DMSO-d6) δ: 8.08 (s, 1H), 7.49–7.43 (m, 2H), 7.33–7.28 (m, 1H), 7.26–7.21 (m, 2H), 6.88–6.80 (m, 1H), 5.18 (s, 1H), 3.90–3.83 (m, 2H), 3.55–3.43 (m, 2H), 3.40–3.30 (m, 1H), 3.20–3.15 (m, 2H), 1.35–1.25 (m, 6H), 1.10–1.03 (m, 3H); LC-MS (m/z) calculated for C19H24N6S: 368.18; found: 369.0 [M + 1]; purity: 100%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11591052 | Differential expression and downstream analyses were performed with the edgeR 3.36.0 , clusterProfiler 4.2.2, topGO 2.46.0, and pathview 1.34 R packages , the STRINGdb database , and proprietary tools. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11546117 | Zhang et al. (2022) also reported that they failed to replicate the results from Kimura et al. (2006) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Zhang",
"et"... |
PMC11395280 | Current treatment protocols for pediatric T-ALL incorporate the use of glucocorticoids, vincristine, asparaginase, methotrexate, 6-mercaptopurine, and at times anthracyclines, cytosine arabinoside, and cyclophosphamide . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11754784 | To prepare Nb-DNA complex Nb-S, we here developed an efficient and indirect Nb labeling strategy to achieve accurate 1:1 and site-specific DNA modification by using the bifunctional molecule NH2-PEG-N3 as the linker. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7348793 | The CV1 cell line is parental to both the COS-7 and COS TS 1 cell lines, which were derived from CV1 at approximately the same time. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
... |
PMC10530622 | Nephrolithiasis is a relevant health issue that affects millions of people worldwide and is expected to happen at some stage in life in up to 10 to 15% of the population in the developed world . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11449273 | Plakoglobin can thus potentially be used for the development of effective therapeutic strategies in highly aggressive mutant p53-expressing cancer cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Plakoglobin",
"can",
"thus",... |
PMC6222635 | From the HSQC spectrum, we found the signal (72.79, 3.27) and can confirm that 72.29 represents the C4 carbon of (1→4)-linked mannose. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11694625 | 3d 1000 mg per kg per day (i.g.) | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"3d",
"1000",
"mg",
"per",
"kg",
"per",
"day",
"(",
"i.g",
".",
")"
]
}
] |
PMC11486946 | 5Effects of compounds on different cell lines.a Viabilities of cell lines treated with the hit compounds including EGFR-TKIs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"5Effects",
"of",
"compounds",
"on",
"d... |
PMC11201245 | The documentation and evaluation are carried out using the ISIS software (Vers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"documentation",
"and",
"evaluation",
"are",
"carried",
"out",
"using... |
PMC8316344 | Opposite to the effects by knocking TFRC out, the degree by which RSL3 and erastin-induced ferroptosis and ferroptosis-associated lipid ROS generation was significantly higher in βTrCP Bel-7404 and SK-Hep1 cells as compared to their parental control cells, this might because βTrCP deficiency increases TFRC stability to elevate labile iron. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9243326 | Meanwhile, an in vitro model using a 2.2.15 cell line of human hepatocellular carcinoma cells (HepG2) revealed the significant anti-hepatitis B virus effect of CCPS (Liu et al., 2013). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11095939 | Mechanistically, Mecp2 governs quiescence exit by transcriptionally orchestrating proliferative and metabolic gene expression, among which many nuclear receptor genes (NRs) emerge as novel Mecp2-activated genes in quiescent cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10006224 | This extra step reduced the amounts of both STAG1 and STAG2 on chromatin, but affected STAG2 more severely, further supporting their different behavior. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11615743 | DNA aptamer‐based logic devices provide a distinct advantage in this context, as they can logically analyze multiple cell surface markers with high efficiency. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11365983 | Measurements of PDGFRα and pY754 PDGFRα signal in the meninges were done with Fiji. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Measurements",
"of",
"PDGFRα",
"and",
"pY754",
"PDGFRα",
"signal",
... |
PMC11468365 | The CCLE gene expression data contains 57,820 gene features per cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"CCLE",
"gene",
"expression",
"data",
"contains",
"57,820",
"gene",
"featu... |
PMC11478724 | PMX reduced the viability and increased apoptosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PMX",
"reduced",
"the",
"viability",
"and",
"increased",
"apoptosis",
"."
]
}
] |
PMC10840195 | A recent global extended access trial showed that sunitinib can significantly prolong the progression-free survival times and overall survival times of patients . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"recent"... |
PMC11792740 | Fletcher et al. found that a pegylated form of the catabolic enzyme arginase I blocked proliferation and cell cycle progression in normal activated T cells without triggering apoptosis or impairing T-cell activation . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11612626 | Lysate was sonicated for 10 seconds using a microtip, centrifuged at 16,000 × g for 10 minutes, and the supernatant used for assays. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC5415764 | The interaction of the two drugs can be classified as synergistic (CI < 1), additive (CI = 1) or antagonistic (CI > 1)51. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11635519 | Notably, PepA3 and its two related variants, PepA and PepA2, activated the GLP-1R receptor with less potency but comparable efficacy to that of GLP-1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11481779 | Those studies have achieved high metrics, including the Pearson correlation coefficient and the stratum-adjusted correlation coefficient (SCC) between the real and predicted heatmaps. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11721587 | When coupled with Ci phosphorylation, roughly 100 to 200 ng of Flag-Ci and HA-Sufu (S321A) complex was incubated with either soluble Fu or Fu condensate in the same buffer with or without adding MPA at room temperature for 6 hours. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11566417 | 5Immortalization and passage of mammosphere derived epithelial cells (MDECs) does not change the effects of MDEC conditioned medium (CM) on neutrophil chemotaxis or reactive oxygen species (ROS) production. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11640419 | Tetradeca-5Z,9Z-diene-1,14-dicarboxylic acid was synthesized in two steps using the previously developed . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Tetradeca-5Z,9Z-diene-1,14-dicarboxylic",
"acid",
"was",
"synthesized",
"in",
"two",
"steps",
"us... |
PMC11551844 | Nocodazole was used as the positive control and its stock solution of 5 mg mL in DMSO was diluted to concentrations of 50 μg mL, 20 μg mL, 2 μg mL, 0.2 μg mL, 0.02 μg mL and 0.002 μg mL. Samples (50 μL) from each dilution point were added on the second day to the 96-well plates. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Secondary endpoints included cumulative incidences of leukemia relapse(CIR), GvHD, nonrelapse mortality (NRM), leukemia-free survival (LFS), overall survival (OS), and adverse events. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11539788 | Western blot assays revealed that forced ILK expression partially rescued the decreased levels of p-AKT, p-mTOR, and p-S6K1 caused by RNF19A overexpression (Fig. 6G-I). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11594074 | An increase in pro-apoptotic BCL-2 proteins after a DNMT1 blockade could restore cell death, which tumor cells would otherwise avoid. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"An",
"increase",
... |
PMC8973085 | Anal. | [
{
"tags": [
"O",
"O"
],
"tokens": [
"Anal",
"."
]
}
] |
PMC10545062 | Resuscitation Requirements and Hemodynamics During the CCP, the median proportion of time spent with MAP between 60 mm Hg and 70 mm Hg for SCC was 79% (IQR, 76–79%) compared with SCC+: 80% (IQR, 80–81%), p = 0.09. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7917457 | To assess the immunological effects of virally encoded OX40L and CD40L, we developed a mouse surrogate virus for VALO-D102 expressing murine OX40L and CD40L under the control of the cytomegalovirus (CMV) promoter. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | It is often associated with increased rates of malaria-related morbidity and mortality, especially in children and pregnant women. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"is",
"often",
"associated",... |
PMC9429973 | During a median follow-up of 10.5 (range, 2–36) months after transplantation, 15 of 18 patients were alive. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"During",
"a",
"me... |
PMC11095939 | The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 and pCMV-VsVg into LentiX-293T cells to generate virus. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"lentiviral",
"... |
PMC11796104 | Reverse transcription was performed with the PrimeScript RT Reagent Kit (Takara). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Reverse",
"transcription",
"was",
"performed",
"with",
"the",
"PrimeScript",
... |
PMC7153288 | Genomic DNA was converted into sequencing libraries using the PacBio Multiplex kit (Pacific Biosciences, Menlo Park, CA) and subsequently, sequenced with a PacBio Sequel using Sequencing Reagent Kit v2.1 by the University of Oregon GC3F facility. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11782780 | Prism software was utilized for data analysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Prism",
"software",
"was",
"utilized",
"for",
"data",
"analysis",
"."
]
}
] |
PMC11676169 | The presence of BCAT1 probably limits acetylation of cytoplasmic and nuclear KU70 by restricting the production of 3-HB from leucine (Figure 5). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11190538 | Human coronavirus replication, on the other hand, is characterized by a complex number of stages during which antiviral medications may be utilized. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11641630 | No bands corresponding to MMP-2 activity (72-kDa) were observed under the analyzed conditions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"No",
"bands",
"corresponding",
"to",
"MMP-2",
"activity",
"... |
PMC11060216 | The antigen was retrieved by hydration and deparaffinization. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"antigen",
"was",
"retrieved",
"by",
"hydration",
"and",
"deparaffinization",
"."
]
}
] |
PMC9739791 | To confirm the hypothesis, TCSPC and flash photolysis were utilized. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"confirm",
"the",
"hypothesis",
",",
"TCSPC",
"and",
"flash",
"photolysis",
"wer... |
PMC9559528 | This case was further complicated by unknown treatments from prior clinicians and a nine-month delay in treatment due to the patient’s decision to pursue East Asian Medicine alternatives. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11786767 | Our results show that the average diameters before and after expansion were 1.4 μm and 4.9 μm, respectively, representing an expansion index of 3.5 (Fig. 2C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11089031 | Table 1The qPCR primer pairs used in this studyTarget NamesRef sequences (NCBI accession number:)Forward sequences (5’ to 3’)Reverse sequences (5’ to 3’)ACTBNM_001101.5CACAGAGCCTCGCCTTTGCCCATCACGCCCTGGTGCZNF692NM_001136036.3TACCAGCACATCCACCAGAACGCAGAACTCACAGATGTAGTCCDK3NM_001258.4TCGCTGCTCAAGGAACTGAAGCGTCCTGGCTGAGGAACTCAAACG3BP2NM_203505.3 (all isoforms)GAGCTGAAACCACAAGTGGAGGGGTCACTGAAGCCCAGGAGAAATM9SF2NM_004800.3CCTCCAAGAAAAGGGATGCTGCACAGGACCACAGCACACGTCAT The qPCR primer pairs used in this study The cells were lysed with Radio immunoprecipitation assay lysis buffer (RIPA) (Pierce, 89,900), supplemented with a protease inhibitor ‘cocktail’ (Beyotime, Beijing, China). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11658074 | UVB irradiation was carried out as detailed in a previous publication . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"UVB",
"irradiation",
"was",
"carried",
"out",
"as",
"detailed",
"in",
"a",
"previous"... |
PMC10490530 | Substantial evidence suggests that in response to DNA damage, the p53 protein is activated, and the stabilized p53 thereby forms a complex with p300/CBP. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11544122 | Knockout was confirmed by SDS PAGE and immunoblotting. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Knockout",
"was",
"confirmed",
"by",
"SDS",
"PAGE",
"and",
"immunoblotting",
"."
]
}
] |
PMC9503541 | In the second purification step, fraction F15-16 exhibited the highest %cytotoxicity, followed by F15-15. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"seco... |
PMC11144200 | On days 7, 14, and 28 following treatment, three modeled mice had to be killed in both groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"On",
"days",
"7",... |
PMC7987994 | As mentioned in the standard ISO 10993-5, FBS has a protective effect since it may bind and thus mask toxic substances including Zn ions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.