PMCID
string
Sentences
string
ner
list
PMC9429973
However, there are a few studies on the combined effect of HMAs with tyrosine kinase inhibitors (TKIs) in chronic myeloid leukemia (CML) and the mechanism by which HMAs enhance the efficacy of molecular targeting agents remain poorly understood.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11803918
More importantly, we further demonstrated that γδ-T exosomes could be used to generate tumor vaccines when they are conjugated with tumor-associated antigens.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "More", ...
PMC9429973
Whilst the role of glucose metabolism in activated T cells is extensively studied, the contribution of other energy sources is less clear.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Whilst"...
PMC11075223
Due to the low mortality and weight changes in IFA group, it would be the potential drugs to treat pathogenic influenza virus pneumonia .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11490153
Spectra of C. citratus EO, citral, AlgNPs, C. citratus-AlgNPs, and citral-AlgNPs were recorded at 450–4000 cm using Tensor II spectrometer (Bruker, Ettlingen, Germany).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11075223
distributed in Yunnan of China), etc. .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "distributed", "in", "Yunnan", "of", "China", ")", ",", "etc", ".", "." ] } ]
PMC11060216
Our previous study showed that overexpressed S100A6 inhibits tumorigenicity of Calu-6 lung cancer cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O" ], "tokens": [ "Our", "previous", "study", "showed", "that", "overexpressed", ...
PMC11799978
While all studies focused on the effect of sodium bicarbonate on cancer cells, we propose that sodium bicarbonate could work on CAFs directly by converting them back to their quiescence state, therefore limiting tumor growth indirectly.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11627133
SiRA has two tetraloops and we examined both positions for the introduction of AP3 (Figure S6A, C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SiRA", "has", "two", "...
PMC11720808
Scale bar, 20 μm.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bar", ",", "20", "μm", "." ] } ]
PMC11411131
Next, the CMV promoter, SV40 promoter, and TK promoter were evaluated to examine luciferase expression (Fig. 5B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Next", ",", ...
PMC9599726
Recently, a series of links between the Hippo–YAP pathway and ferroptosis have been identified .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Recently", ",", "a", "series", "of", "links...
PMC9429973
A recent British survey showed inconsistencies in the same country about fertility preservation management, despite being recommended in local and international guidelines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", ...
PMC10454535
A p value < 0.05 was considered statistically significant.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "p", "value", "<", "0.05", "was", "considered", "statistically", "significant", "." ] } ]
PMC9386809
Several Zr(IV) compounds are employed as Lewis acid catalysts that activate carboxyl and imino groups effectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Several", "Zr(IV", ")", "compounds", "are", ...
PMC11730000
After treatment, fresh medium containing 10 µM DHE was added to the cells and incubated for 20 min in the dark at room temperature.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10926885
10% FBS (fetal bovine serum) and standard concentration of penicillin/streptomycin antibiotics were added to the medium.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "10", "%", "FBS", "(", "feta...
PMC6312945
The proliferation of BEL-7404 cells in BEL-7404 pSUPER.neo-miR-101 group was different from that in BEL-7404 pSUPER.neo-miR-345 group (P<0.05) (Fig. 5).
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC11777207
Experiment was repeated four times with three to six technical replicates per experiment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Experiment", "was", "repeated", "four", "times", "with", "three", "to", ...
PMC11791478
The target specificity of 25A3 on cancer cells was also assessed in two cell lines with different levels of TF expression: HCT-116 human colorectal carcinoma (20,000 copies of TF/cell) and A431 human squamous cell carcinoma (200,000 copies of TF/cell).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", ...
PMC10079526
100 cells per replicate were analyzed (n = 3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "100", "cells", "per", "replicate", "were", "analyzed", "(", "n", "=", "3", ")",...
PMC11737091
Furthermore, the diagnostic receiver operating characteristic (ROC) curve yielded area under the curve (AUC) values of 0.871, 0.845, and 0.835 on the basis of the TCGA cohort and two independent GEO datasets, respectively (Fig. 3L-N).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
These data suggest that the use of NRD could be considered for transplanted patients without risks of more infective events.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "data", "suggest", ...
PMC10813895
Luminal epithelial cells are surrounded by myoepithelial cells, both derived from the same stem/bipotent progenitors, though luminal epithelial cells and myoepithelial cells show distinct functions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11391695
For immunoprecipitation (IP) analysis, cell lysates were obtained and subsequently subjected to protease inhibitor-containing lysis buffer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "immunoprecipitation", "(", ...
PMC9739791
The authors suggested that the main component of the prodrug 30 TA spectrum is the absorption of the polymer radical cation (PPE*+) , produced by the ultrafast electron transfer from the polymer to the Pt(IV) center.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5839394
SKBR3 cells were treated for 24h with IC50 concentrations of AgNPs-EPS and with 200 µg/ml of free-metal EPS.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SKBR3", "cells", "were", "treated",...
PMC11693599
Although characteristics such as the number and size of secreted EVs differed between ovarian cancer cell lines and patient-derived cells, these results suggest that CD109 is a marker of EVs secreted from CSCs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5673955
RrA was added into TRAP assay to the final concentration 0.1 U/mL followed by detection of telomerase activity. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RrA", "was", "added", "into", ...
PMC10958426
Fig. 5The change of cell-cell communication between tumor tissues and normal tissues. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", "5The", "change", "of", "cell-cell", "communication", "between", "tu...
PMC8382973
The evaluation criteria were derived from the Biological evaluation of medical devices—part 5: test for in vitro cytotoxicity (GB/T 16886.5-2017/ISO 10993-5:2009, IDT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11377827
The chromatin fraction was solubilized in a 2× SDS loading buffer containing 1:500 Benzonase or 1:200 Denarase.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "chromatin", "fraction", "was", ...
PMC11769516
The article aims to present the threats posed by common Fusarium mycotoxins in food as factors causing CNS disorders and methods of preventing and minimizing the effects of mycotoxin neurotoxicity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6642070
We did not observe significant changes in glycolysis enzymes, like hexokinase-1 (HK1), aldolase A, pyruvate kinase isozymes M1/M2 (PKM1/M2) and lactate dehydrogenase A (LDHA) (Supplemental Fig. 3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11377827
Representative images (A) and quantification (B) are shown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Representative", "images", "(", "A", ")", "and", "quantification", "(", "B", ...
PMC9100622
Ewing sarcoma (EwS) is an aggressive, highly metastatic bone tumor in children.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ewing", "sarcoma", "(", "EwS", ")", "is", "an", "aggr...
PMC11531744
The expression of KIF26B, STX18 and CACNA1C were positively correlated with the sensitivity of zoledronate, nelarabine and idelalisib, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "expre...
PMC11789597
High expression of CAV1 was significantly correlated with the shorter overall survival (OS) and progression‐free survival (PFS) of MM patients, especially those patients treated with bortezomib (Figure 1B; Figure S1B,C, Supporting Information).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
This change was mainly driven by corresponding changes in NRM over time (p < 0.001, Figure Panel B) rather than significant increases in the relapse rate over time (p = 0.16, Figure Panel C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11409031
We obtained information from the GTEx database Obtained mRNA expression information from 88 normal samples to increase the number of normal samples.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "obtain...
PMC11725127
While ICU30 exhibited similar effects to GA, ICU30 had low activities in inhibiting MM cell proliferation, which may be attributed to its poor water solubility.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11297139
The reads with poor mapping quality (MAPQ < 10) and putative self-ligated reads (genome distance <15 kb) were discarded.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973
Image: Summary/Conclusion: Our results are in accordance with experimental data indicating that NF-κB stimulates gal-3 expression and that gal-3 potentiates the antiapoptotic effect of BCL2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11777207
M and N) Number and percentage of KikRed cDC1s in the dLN 24 hours after intradermal polyI:C injection and violet photoconversion in isotype and PD-1 antibody–treated mice. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8041314
ENAMINE ID: Z2214001359; H NMR (600 MHz, DMSO-d6) δ: 8.08 (s, 1H), 7.49–7.43 (m, 2H), 7.33–7.28 (m, 1H), 7.26–7.21 (m, 2H), 6.88–6.80 (m, 1H), 5.18 (s, 1H), 3.90–3.83 (m, 2H), 3.55–3.43 (m, 2H), 3.40–3.30 (m, 1H), 3.20–3.15 (m, 2H), 1.35–1.25 (m, 6H), 1.10–1.03 (m, 3H); LC-MS (m/z) calculated for C19H24N6S: 368.18; found: 369.0 [M + 1]; purity: 100%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11591052
Differential expression and downstream analyses were performed with the edgeR 3.36.0 , clusterProfiler 4.2.2, topGO 2.46.0, and pathview 1.34 R packages , the STRINGdb database , and proprietary tools.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11546117
Zhang et al. (2022) also reported that they failed to replicate the results from Kimura et al. (2006) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Zhang", "et"...
PMC11395280
Current treatment protocols for pediatric T-ALL incorporate the use of glucocorticoids, vincristine, asparaginase, methotrexate, 6-mercaptopurine, and at times anthracyclines, cytosine arabinoside, and cyclophosphamide .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11754784
To prepare Nb-DNA complex Nb-S, we here developed an efficient and indirect Nb labeling strategy to achieve accurate 1:1 and site-specific DNA modification by using the bifunctional molecule NH2-PEG-N3 as the linker.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7348793
The CV1 cell line is parental to both the COS-7 and COS TS 1 cell lines, which were derived from CV1 at approximately the same time.
[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", ...
PMC10530622
Nephrolithiasis is a relevant health issue that affects millions of people worldwide and is expected to happen at some stage in life in up to 10 to 15% of the population in the developed world .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11449273
Plakoglobin can thus potentially be used for the development of effective therapeutic strategies in highly aggressive mutant p53-expressing cancer cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Plakoglobin", "can", "thus",...
PMC6222635
From the HSQC spectrum, we found the signal (72.79, 3.27) and can confirm that 72.29 represents the C4 carbon of (1→4)-linked mannose.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11694625
3d 1000 mg per kg per day (i.g.)
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "3d", "1000", "mg", "per", "kg", "per", "day", "(", "i.g", ".", ")" ] } ]
PMC11486946
5Effects of compounds on different cell lines.a Viabilities of cell lines treated with the hit compounds including EGFR-TKIs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "5Effects", "of", "compounds", "on", "d...
PMC11201245
The documentation and evaluation are carried out using the ISIS software (Vers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "documentation", "and", "evaluation", "are", "carried", "out", "using...
PMC8316344
Opposite to the effects by knocking TFRC out, the degree by which RSL3 and erastin-induced ferroptosis and ferroptosis-associated lipid ROS generation was significantly higher in βTrCP Bel-7404 and SK-Hep1 cells as compared to their parental control cells, this might because βTrCP deficiency increases TFRC stability to elevate labile iron.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9243326
Meanwhile, an in vitro model using a 2.2.15 cell line of human hepatocellular carcinoma cells (HepG2) revealed the significant anti-hepatitis B virus effect of CCPS (Liu et al., 2013).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11095939
Mechanistically, Mecp2 governs quiescence exit by transcriptionally orchestrating proliferative and metabolic gene expression, among which many nuclear receptor genes (NRs) emerge as novel Mecp2-activated genes in quiescent cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10006224
This extra step reduced the amounts of both STAG1 and STAG2 on chromatin, but affected STAG2 more severely, further supporting their different behavior.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11615743
DNA aptamer‐based logic devices provide a distinct advantage in this context, as they can logically analyze multiple cell surface markers with high efficiency.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11365983
Measurements of PDGFRα and pY754 PDGFRα signal in the meninges were done with Fiji.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Measurements", "of", "PDGFRα", "and", "pY754", "PDGFRα", "signal", ...
PMC11468365
The CCLE gene expression data contains 57,820 gene features per cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "CCLE", "gene", "expression", "data", "contains", "57,820", "gene", "featu...
PMC11478724
PMX reduced the viability and increased apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PMX", "reduced", "the", "viability", "and", "increased", "apoptosis", "." ] } ]
PMC10840195
A recent global extended access trial showed that sunitinib can significantly prolong the progression-free survival times and overall survival times of patients .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "recent"...
PMC11792740
Fletcher et al. found that a pegylated form of the catabolic enzyme arginase I blocked proliferation and cell cycle progression in normal activated T cells without triggering apoptosis or impairing T-cell activation .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11612626
Lysate was sonicated for 10 seconds using a microtip, centrifuged at 16,000 × g for 10 minutes, and the supernatant used for assays.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC5415764
The interaction of the two drugs can be classified as synergistic (CI < 1), additive (CI = 1) or antagonistic (CI > 1)51.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11635519
Notably, PepA3 and its two related variants, PepA and PepA2, activated the GLP-1R receptor with less potency but comparable efficacy to that of GLP-1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11481779
Those studies have achieved high metrics, including the Pearson correlation coefficient and the stratum-adjusted correlation coefficient (SCC) between the real and predicted heatmaps.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11721587
When coupled with Ci phosphorylation, roughly 100 to 200 ng of Flag-Ci and HA-Sufu (S321A) complex was incubated with either soluble Fu or Fu condensate in the same buffer with or without adding MPA at room temperature for 6 hours.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11566417
5Immortalization and passage of mammosphere derived epithelial cells (MDECs) does not change the effects of MDEC conditioned medium (CM) on neutrophil chemotaxis or reactive oxygen species (ROS) production.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11640419
Tetradeca-5Z,9Z-diene-1,14-dicarboxylic acid was synthesized in two steps using the previously developed .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Tetradeca-5Z,9Z-diene-1,14-dicarboxylic", "acid", "was", "synthesized", "in", "two", "steps", "us...
PMC11551844
Nocodazole was used as the positive control and its stock solution of 5 mg mL in DMSO was diluted to concentrations of 50 μg mL, 20 μg mL, 2 μg mL, 0.2 μg mL, 0.02 μg mL and 0.002 μg mL. Samples (50 μL) from each dilution point were added on the second day to the 96-well plates.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Secondary endpoints included cumulative incidences of leukemia relapse(CIR), GvHD, nonrelapse mortality (NRM), leukemia-free survival (LFS), overall survival (OS), and adverse events.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11539788
Western blot assays revealed that forced ILK expression partially rescued the decreased levels of p-AKT, p-mTOR, and p-S6K1 caused by RNF19A overexpression (Fig. 6G-I).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11594074
An increase in pro-apoptotic BCL-2 proteins after a DNMT1 blockade could restore cell death, which tumor cells would otherwise avoid.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "An", "increase", ...
PMC8973085
Anal.
[ { "tags": [ "O", "O" ], "tokens": [ "Anal", "." ] } ]
PMC10545062
Resuscitation Requirements and Hemodynamics During the CCP, the median proportion of time spent with MAP between 60 mm Hg and 70 mm Hg for SCC was 79% (IQR, 76–79%) compared with SCC+: 80% (IQR, 80–81%), p = 0.09.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7917457
To assess the immunological effects of virally encoded OX40L and CD40L, we developed a mouse surrogate virus for VALO-D102 expressing murine OX40L and CD40L under the control of the cytomegalovirus (CMV) promoter.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
It is often associated with increased rates of malaria-related morbidity and mortality, especially in children and pregnant women.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", "often", "associated",...
PMC9429973
During a median follow-up of 10.5 (range, 2–36) months after transplantation, 15 of 18 patients were alive.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "During", "a", "me...
PMC11095939
The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 and pCMV-VsVg into LentiX-293T cells to generate virus.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O" ], "tokens": [ "The", "lentiviral", "...
PMC11796104
Reverse transcription was performed with the PrimeScript RT Reagent Kit (Takara).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Reverse", "transcription", "was", "performed", "with", "the", "PrimeScript", ...
PMC7153288
Genomic DNA was converted into sequencing libraries using the PacBio Multiplex kit (Pacific Biosciences, Menlo Park, CA) and subsequently, sequenced with a PacBio Sequel using Sequencing Reagent Kit v2.1 by the University of Oregon GC3F facility.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11782780
Prism software was utilized for data analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Prism", "software", "was", "utilized", "for", "data", "analysis", "." ] } ]
PMC11676169
The presence of BCAT1 probably limits acetylation of cytoplasmic and nuclear KU70 by restricting the production of 3-HB from leucine (Figure 5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11190538
Human coronavirus replication, on the other hand, is characterized by a complex number of stages during which antiviral medications may be utilized.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11641630
No bands corresponding to MMP-2 activity (72-kDa) were observed under the analyzed conditions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "bands", "corresponding", "to", "MMP-2", "activity", "...
PMC11060216
The antigen was retrieved by hydration and deparaffinization.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "antigen", "was", "retrieved", "by", "hydration", "and", "deparaffinization", "." ] } ]
PMC9739791
To confirm the hypothesis, TCSPC and flash photolysis were utilized.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "confirm", "the", "hypothesis", ",", "TCSPC", "and", "flash", "photolysis", "wer...
PMC9559528
This case was further complicated by unknown treatments from prior clinicians and a nine-month delay in treatment due to the patient’s decision to pursue East Asian Medicine alternatives.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786767
Our results show that the average diameters before and after expansion were 1.4 μm and 4.9 μm, respectively, representing an expansion index of 3.5 (Fig. 2C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11089031
Table 1The qPCR primer pairs used in this studyTarget NamesRef sequences (NCBI accession number:)Forward sequences (5’ to 3’)Reverse sequences (5’ to 3’)ACTBNM_001101.5CACAGAGCCTCGCCTTTGCCCATCACGCCCTGGTGCZNF692NM_001136036.3TACCAGCACATCCACCAGAACGCAGAACTCACAGATGTAGTCCDK3NM_001258.4TCGCTGCTCAAGGAACTGAAGCGTCCTGGCTGAGGAACTCAAACG3BP2NM_203505.3 (all isoforms)GAGCTGAAACCACAAGTGGAGGGGTCACTGAAGCCCAGGAGAAATM9SF2NM_004800.3CCTCCAAGAAAAGGGATGCTGCACAGGACCACAGCACACGTCAT The qPCR primer pairs used in this study The cells were lysed with Radio immunoprecipitation assay lysis buffer (RIPA) (Pierce, 89,900), supplemented with a protease inhibitor ‘cocktail’ (Beyotime, Beijing, China).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11658074
UVB irradiation was carried out as detailed in a previous publication .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "UVB", "irradiation", "was", "carried", "out", "as", "detailed", "in", "a", "previous"...
PMC10490530
Substantial evidence suggests that in response to DNA damage, the p53 protein is activated, and the stabilized p53 thereby forms a complex with p300/CBP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11544122
Knockout was confirmed by SDS PAGE and immunoblotting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Knockout", "was", "confirmed", "by", "SDS", "PAGE", "and", "immunoblotting", "." ] } ]
PMC9503541
In the second purification step, fraction F15-16 exhibited the highest %cytotoxicity, followed by F15-15.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "seco...
PMC11144200
On days 7, 14, and 28 following treatment, three modeled mice had to be killed in both groups.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "days", "7",...
PMC7987994
As mentioned in the standard ISO 10993-5, FBS has a protective effect since it may bind and thus mask toxic substances including Zn ions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...