PMCID string | Sentences string | ner list |
|---|---|---|
PMC11650848 | The Elekta Neuromag 306-channel MEG system was used to record MEG responses. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"Elekta",
"Neuromag",
"306-channel",
"MEG",
"system",
"was",
"used",
"to",... |
PMC11345828 | Low-resolution mass spectra were obtained on an Agilent 1200 series 6140 mass spectrometer with electrospray ionization. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Low-resolution",
"mass",
"spectra",
"were",
"obtained",
... |
PMC10587429 | Trypsin-EDTA (0.25%) (25-200-114, Fisher Scientific, Waltham, MA). - | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Trypsin-EDTA",
"(",
"0.25",
... |
PMC11767817 | Additionally, given that 2a-B reduced Akt phosphorylation, we were also interested in whether this reduction could potentiate its activity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additionally",
",",
... |
PMC11380454 | The cells were collected and stained with 5 µl of propidium iodide (PI). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"cells",
"were",
"collected",
"and",
"stained",
"with... |
PMC11047729 | It presents various anti-cancer effects, such as growth inhibition, apoptosis activation, and the differentiation of several kinds of malignant cells . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
... |
PMC9429973 | None of the socio-economic variables was associated with higher TRM in the MVA adjusted. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"None",
"of",
"the",
"socio-economic",
"variables",
"was",
"associated"... |
PMC9429973 | J Clin Oncol. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"J",
"Clin",
"Oncol",
"."
]
}
] |
PMC9429973 | Image: Summary/Conclusion: In this large study, robust biological and clinical predictive factors of CRS and ICANS were identified. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Image",
":",
"Sum... |
PMC11610461 | Successive slides of the same renal carcinoma tissue were stained and observed in the same field of view. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Successive",
"slides",
"of",
"the",
"s... |
PMC11740508 | A–E Values indicate mean ± SEM. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"–",
"E",
"Values",
"indicate",
"mean",
"±",
"SEM",
"."
]
}
] |
PMC10443665 | Although the high dose of MTX can significantly increase cure rates and improve patients' prognosis (30), increased MTX plasma concentration leads to numerous adverse effects (10). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8481254 | A The chemical structure of CA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"The",
"chemical",
"structure",
"of",
"CA",
"."
]
}
] |
PMC8592717 | It significantly controlled the serum levels of MDA and TNF-α, and renal MDA level; while on the other hand, it upregulated the serum and renal total antioxidant status (TAS) and SOD levels, and histopathological scores . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10955424 | Cell lysate samples were prepared for loading by adding lysis buffer (#9803 Cell Signaling Technology, MA, USA) containing protease inhibitors (P8340 and P5726, Sigma, Germany) and phosphatase inhibitor (P-1517, AG Scientific, CA, USA) to the cell pellets. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11679033 | This observation underscores the selective nature of cannabinoid-induced cytotoxicity, which can vary based on cell type, exposure duration, and concentration, as cannabinoids may selectively trigger intracellular death mechanisms while maintaining overall cell membrane stability . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11750712 | One patient (dosed at 25 × 10) developed grade 2 EBV reactivation on study day 27 in the context of immune-mediated thrombocytopenia. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9878562 | The finding suggested that VAL-ko and VAL-wt might perform a secondary migration, which could be triggered either by microgradients of CXCL12 created by ACKR3 VAL-wt or by another stimulus that is released during the migration of VAL-wt along a CXCL12 gradient. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10850553 | Scale bar: 50 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Scale",
"bar",
":",
"50",
"μm",
"."
]
}
] |
PMC11787355 | To evaluate protein abundance, we analyzed n = 20 matched primary and recurrent glioblastoma samples and found patient-individual PTPRZ1 levels without temporal alterations between primary and recurrent tumors (Fig. 1e, f). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11802855 | The results demonstrated that both p-STAT3 expression and cell proliferative capacity were significantly suppressed (Fig. 7G–J). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"results",
"demonstrat... |
PMC8345486 | All hydrogen atoms were localized on a difference Fourier map. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"hydrogen",
"atoms",
"were",
"localized",
"on",
"a",
"difference",
"Fourier",
"map",
... |
PMC10823017 | In addition, atypical PKCs (PKC-ί and PKC ζ) are overexpressed in most cancer cells, and they play a central role in tumor progression and the metastasis of different types of cancers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10631132 | A total of 10 µM of Rho-associated, coiled-coil containing protein kinase (ROCK) inhibitor Y-276432 was used when defrosting to improve cell survival. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11365427 | RT-qPCR shows mRNA expression of ERS related genes ATF3, DDIT3, and apoptosis related gene TNFRSF10B in NCI-H929 and RPMI-8226 cells after 48 h of phenylalanine deprivation. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"... |
PMC11106977 | However, our current understanding of this topic is limited, and further research is needed to better understand the role of O-GlcNAcylation in regulating chondrogenic differentiation and development. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | iMCD and non-iMCD cohorts were matched (1:50) by age group (0-17, 18-44, 45-54, 55-64, >65 years), sex, insurance type, history in database, and region. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | In 08.2019, a Global Expanded Access Program (EAP) was implemented to provide access to patients (pts) prior to regulatory authorization of TAG in real-world practice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11683240 | Third and fourth, PT was preincubated on cells for 15 min at 37 °C and was either present in the medium while α1AT or solvent control were added or washed away before adding α1AT or water. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Frail pts experienced more G3 TEAEs and treatment discontinuations with PVd vs Vd, but treatment duration was longer with PVd vs Vd. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Frail",... |
PMC11525028 | ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001, by two-way ANOVA with Dunnett’s multiple comparisons test (C) and one-way ANOVA with Dunnett’s multiple comparisons test (D, E, F, K, and L). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11319300 | When the fragment baits containing the promoters of CCND1 (pink arrow in Figure 2B) and LTO1 (blue arrow in Figure 2B) were taken as the viewpoints, interactions with the MYEOV-3′-putative enhancer were observed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6901583 | Overall, our findings indicated that BRD4 is likely to be involved in angiogenesis in GIST. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Overall",
",",
"our",
"findings",
"indicated",
"that",... |
PMC6461034 | Tumor biopsies were taken both before and after 2 weeks of erlotinib treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Tumor",
"biopsies",
"were",
"taken",
"both",
"before",
"and",
"after",
... |
PMC5035325 | Breast ductal carcinoma is positive tissue for human EGFR and NeuGcGM3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Breast",
"ductal",
"carcinoma",
"is",
"positive",
"tissue",
"for",
"human",
"EGFR",
"... |
PMC10820104 | For cell cycle analyses, the cells were suspended in 100 µL of hypotonic buffer (1% sodium citrate, 0.1% Triton X-100, and 50 µg/mL propidium iodide in double-distilled water). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11286266 | Assuming the endoplasmic reticulum (ER) constitutes 10% of cell total volume (Alberts et al., 2002), the concentration of CRT in the ER of CHO-K1 cells was estimated to be around 7 µM. To examine a possible interaction between CRT and ATF6α in cells, HEK293T cells were transfected with either GFP-ATF6α_LD or GFP-ATF6α_LD, followed by selective recovery using GFP-Trap Agarose and subsequent immunoblotting with an anti-CRT antibody. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11127909 | Experiments were performed three times (N = 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Experiments",
"were",
"performed",
"three",
"times",
"(",
"N",
"=",
"3",
")",
"."
]
... |
PMC11703896 | The current study aimed to demonstrate the potential variability of rapamycin treatment effects among different cancer receptors (Fig. 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"current",
... |
PMC11742231 | Several computational models have been developed to predict miRNA-disease associations by integrating heterogeneous biological data and employing advanced machine-learning techniques. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Several",
"computational",
"... |
PMC6461034 | Add 1 ml cold IP buffer per 10 mg protein input to the bead pellet and mix by inverting five times. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Add",
"1",
"ml",
... |
PMC11718817 | Since then, migration pattern analysis has been clearly linked to effector function of CTLs . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Since",
"then",
",",
"migration",
"pattern",
"analysis",
"h... |
PMC9429973 | Therefore, we will investigate how the microbiota at diagnosis differs in patients who achieve MRD negativity and those who still are MRD positive after treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11723947 | crRNA guides targeting Cbx3 (GCTTGAGCTGTAGGCGCGGA, GACCCGGAGCAGCTCGGAGG and GGCCTCCAACAAAACTACA) were provided by IDT. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"crRNA",
"guides",
"targeting",
"Cbx3",
"(",
"GCTTGAGCTGTAGGCGCGGA... |
PMC11789597 | All these findings indicate that targeting CAV1 in MM cells boosts NK cell‐mediated cytotoxicity and antibody‐dependent cellular cytotoxicity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"these",
"findings",
"indicate",
... |
PMC11612794 | CENP-T is shown as a cartoon. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CENP-T",
"is",
"shown",
"as",
"a",
"cartoon",
".",
"("
]
}
] |
PMC11489351 | For C and E, significance was determined using Kruskal–Wallis with Dunn’s multiple comparisons correction: ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11741906 | The miRNA expression profiles of a cisplatin-sensitive A2780 cell line and two cisplatin-resistant cell lines, A2780cis and SK-OV-3, were analyzed using PCR array and qPCR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC4270159 | SDS-PAGE separation: a. Prepare the lysate sample by adding SDS reducing loading dye to ∼25–30 µg of protein sample and boiling at 95°C–100°C for 5 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11705547 | Interestingly, the type of TIME can influence the response to cisplatin . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
"the",
"type",
"of",
"TIME",
"can",
"influence",
"the",
... |
PMC11547917 | Four out of the five assays were chosen to compare our extract with the literature data: 1,1-diphenyl-2-picrylhydrazyl radical (DPPH), total antioxidant capacity (TAC), total flavonoids content (TFC) and total polyphenolic content (TPC). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Treatment by free dendritic molecules led to increasing of expression of PD-L1, TIM-3 and CD47 on Jurkat cells, but decreased the IL-10 secretion. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],... |
PMC10142392 | In the study by W. Zhang et al. , another multi-arm structure was described in detail and named toothbrush-type amphiphilic copolymer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"stud... |
PMC11544771 | Lung cancer, including small cell lung cancer and non-small cell lung cancer (NSCLC), is the leading cause of cancer-related deaths worldwide . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11698348 | Our data suggest that Elf5 expression found in the epidermis and HFs indicates the importance of Elf5 to balance and regulate proliferative potential of stem/progenitors, the transition of keratinocytes from proliferation to early differentiation and to also regulate the suprabasal expression of basal genes, thereby potentially acting as a switch between proliferation and differentiation of keratinocytes, a role similarly undertaken by Elf5 in mammary gland development . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10376064 | Differences were considered statistically significant when p < 0.05. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Differences",
"were",
"considered",
"statistically",
"significant",
"when",
"p",
"<",
"0.05",
"."
]
}... |
PMC11476004 | In the present study, tumour occurrence and the various diagnosed forms of damage to genetic material were not found to be associated with the sex of the animals. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | CARD11 mutations were not detected. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CARD11",
"mutations",
"were",
"not",
"detected",
"."
]
}
] |
PMC5330095 | Cannabidiol exhibited in vitro activity against viral hepatitis C. Cannabidiol exhibited in vitro activity against viral hepatitis C. Abbreviations Used: CB2: Cannabis receptor 2, CBD: Cannabidiol, DNA: Deoxyribonucleic acid, HBV: Hepatitis B virus, HCV: Hepatitis C virus, HIV/AIDS: Human immunodeficiency virus/acquired immune deficiency syndrome, HSC: Hepatic stellate cells, MTS: 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2Htetrazolium, PCR: Polymerase chain reactionViral hepatitis is caused by a group of viruses divided into five types (A, B, C, D, and E), and they are primarily known to attach to the liver. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9100622 | A total of 24 h after being seeded, cells were pre-treated for 2 h with NAC at 3 mM before the addition of Atorvastatin (1 µM) and collected 48 h post treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11530949 | ROS Measurements In this study, ROS levels was significantly increased after treatment with extracts and IC50 concentrations of the Ag-doped CuO NPs compared to the control cells (P<0.01 and P<0.001, respectively). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11754432 | Images were acquired using Zeiss LSM 800 Axio-Observer with Plan-Apochromat 40×/1.4 Oil DIC M27 objective and GaAsP detector. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Images",
"were",
"acquired",... |
PMC11622247 | In addition, in the single stranded state, the probe can adopt conformations that allow direct contact of the two dyes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"additi... |
PMC7841067 | Silencing of AKAP4 attenuated xenografted tumor growth in nude mice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Silencing",
"of",
"AKAP4",
"attenuated",
"xenografted",
"tumor",
"growth",
"in",
"nude",
"mice",... |
PMC11634027 | Conversely, most Dachs:GFP clones in ds mutant wing discs had mispolarized Dachs (Fig. 5F,F′). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Conversely",
",",
... |
PMC9429973 | Results: Median age was 65,5 [27-92] years and 60,5% (75) of patients were male. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Results",
":... |
PMC10932641 | lncRNA GPRC5D-AS1 can serve as a biomarker in clinical applications and the prognosis of lung squamous cell carcinoma. • | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"lncRNA",
"GPRC5D-AS1",
"can",
"se... |
PMC11489351 | Data presented here show that pHi changes are sufficient drivers of signaling and metabolic changes associated with pH-dependent cell behaviors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"presented",
"here",
... |
PMC11739670 | The purified material was analyzed by SDS‐PAGE and Coomassie staining and quantified by measuring absorbance at 280 nm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"purified",
"material",
"was",
"... |
PMC11391695 | It is categorized as one of the most preponderant malignancies . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"is",
"categorized",
"as",
"one",
"of",
"the",
"most",
"preponderant",
"malignancies",
... |
PMC6487404 | According to the FDA guidance for industry, there is an involvement of a drug efflux transporter in Caco-2 cells if the efflux ratio is ≥2 and if a significant (>50%) reduction in the efflux ratio is observed in the presence of an inhibitor of the corresponding transporter (27). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11694066 | Second, the difference in PARP1 expression between our models led to discrepant observations, notably in terms of synergistic or additive cytotoxic effects of the PARPi plus ATRi combination, in which PARP1 expression and trapping play a crucial role (21, 51). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | All CBCs were performed on a Sysmex XN Analyzer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"CBCs",
"were",
"performed",
"on",
"a",
"Sysmex",
"XN",
"Analyzer",
"."
]
}
] |
PMC3675084 | We checked the caspase-2 activation after treatment with BPR0L075, caspase-2 cleavage was not detected in both parental and resistant cells (Figure 6A, B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | A changing trend of CAR proteins from dropping to rising after encountering target cells was observed in 3 CAR-T cell group except in 8D7 CAR-T. 13C3 CAR was the most suitable construct from the perspective of basic and dynamic expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11317131 | Delivery of large therapeutic genes such as vWF can be intractable for current methods. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Delivery",
"of",
"large",
"therapeutic",
"genes",
"such",
"as",
... |
PMC11544122 | Data were analyzed by Student’s t-test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"were",
"analyzed",
"by",
"Student",
"’s",
"t-test",
"."
]
}
] |
PMC11564322 | However, given the different origins of the studied cell lines, the mechanism may be slightly different. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"given",
"the",
"differ... |
PMC9429973 | Peripheral blood hematopoietic stem cell (PBSC) transplantation has the advantages of convenient collection, small impact on donors, good tolerance of donors and recipients, fast and durable recovery of hematopoietic function and immune function of patients after transplantation, and low transplantation-related mortality. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | An elevated baseline CAR-HEMATOTOX was noted for patients with severe infections (median 5 vs. 2, p=0.002). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"An",
"elevated",
"baseline",
"CAR... |
PMC11643491 | This distinction has broad implications for the design of targeted therapies, as it can inform the development of particles optimized for specific cell types, such as those in tumors versus healthy tissues. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11705630 | Little is known regarding the function of GLDC in tumorigenesis; moreover, the function of GLDC in tumorigenesis may seemingly vary in a cancer-type dependent manner. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11449273 | When co-expressed, plakoglobin resulted in a significant reduction (60%) in nuclear β-catenin levels in H1299-p53-175 and control p53-WT cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O"... |
PMC2944824 | Brains were made hyperosmotic with sucrose and sections (25 microns) were stained for TUNEL (green) and nuclei were stained with DAPI. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9878562 | Genetic deletion of ACKR3 on VAL cells had no effect on CXCR4 expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Genetic",
"deletion",
"of",
"ACKR3",
"on",
"VAL",
"cells",
"had",
... |
PMC10237474 | The preferred system to manufacture antibody and secreted protein-based therapeutics and target proteins is mammalian host cell expression, which allows the secretion of complex proteins in large quantities without the need for cell lysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11740508 | However, clinical responses are often not durable and treatment may be detrimental in advanced cancer due to excessive toxicities. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"clinical",
... |
PMC6102174 | Hsiao or A. membranaceus (Fisch.) | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Hsiao",
"or",
"A.",
"membranaceus",
"(",
"Fisch",
".",
")"
]
}
] |
PMC8873393 | 3Dynamic transcriptional programs of mRNAs in response to UV-C irradiation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"3Dynamic",
"transcriptional",
"programs",
"of",
"mRNAs",
"in",
"response",
"to",
"UV-C",
"irradi... |
PMC10812665 | This again may contribute to cell death processes such as ferroptosis . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"again",
"may",
"contribute",
"to",
"cell",
"death",
"processes",
"such",
"as"... |
PMC10965315 | Additionally, Figure 4b demonstrates that NAC reversed the decrease in cell viability observed in harmaline‐treated cells at 24 h. These results suggest that ROS plays a significant role in harmaline‐induced cytotoxicity in A2780 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11155445 | A novel series of N-(phenylcarbamothioyl)-2-napthamides (129.1–129.39) were synthesized as Claudin-1 inhibitors by Mashinson et al. All synthesized compounds were investigated against colorectal cancer cells SW620. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellL... |
PMC7342409 | Compared with the normal group, there was a significant decrease in the body weight of mice in the resistant group on day 0, day 3, and day 6 (p<0.05, p<0.01). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10335954 | All other experiments were conducted with 3 replicates in each group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"other",
"experiments",
"were",
"conducted",
"with",
"3",
"replicates",
"in",
"... |
PMC11798926 | Fluorescent immunoblot images were acquired on a Sapphire Bioimager (Azure Biosystems Model #Sapphire RGBNIR) and quantified with Azure spot software (ver 2.0). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC3035438 | While the parental CX13 cells are mostly IgM+ as shown previously (upper graph), 95% of the CstF-64+ cells appear IgM– (bottom graph). ( | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11411131 | The effect of additional Krab on the MeHg sensor was examined using Krabx2-Sec, which includes TetR, Sec, and a Krab tandem repeat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9429973 | Patients with elevated Hb A2 compatible with β-thalassemia or increased Hb F were discarded. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Patients",
"with",
"elevated",
"Hb",
"A2",
"compatible",
"with",
... |
PMC10055960 | Among the various strategies to improve selectivity, multinuclearity is often used to selectively target cancer cells through a phenomenon known as the enhanced permeability and retention (EPR) effect . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11012012 | Here, it should be noted that the expression of SLAMF1/CD150 in Burkitt lymphoma could depend on the presence of Epstein–Barr virus infection. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.