OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC11745600	Ins1 NOG mice injected with PBS under the renal capsule were used as controls (male, n = 2; female, n = 1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11225860	To determine effect of the combination therapy on different other cell types, MTS assays were performed on U2932, VAL, MDA-MB-231, Hela, Mia PaCa-2, U-2 OS, and Granta-519 cells treated with DMSO, Alisertib, Aurkin A, or a combination Alisertib and Aurkin A for four days.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-...
PMC10976516	OVs as a platform for transgene delivery.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "OVs", "as", "a", "platform", "for", "transgene", "delivery", "." ] } ]
PMC11122631	Compounds 3 (4.7 mg) and 8 (0.9 mg) were isolated from subfraction C6B4 (18.2 mg) by reverse-phase HPLC (C18 column) eluted with 60% methanol.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5035325	Co-expression of EGFR and NeuGcGM3 ganglioside on tumor samples (63) from 92 patients (68 %) is summarized in Table 1 and exemplified in Fig. 1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11594641	The tested melanoma cells differ substantially not only in the Rab27 expression but also in a variety of other features.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tested", "melanoma", ...
PMC11190062	Freshly isolated primary myeloma cells were obtained from the local hospital biobank (Biobank1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Freshly", "isolated", "primary", "myeloma", "cells", "were", ...
PMC11767817	In our experiment, the expression of DKK-4, a key regulator of the Wnt signaling pathway, was significantly modulated: it increased under normoxic conditions and decreased under hypoxic conditions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10778532	Briefly, 786-0 cells were transfected with a vector allowing the doxycycline-inducible expression of the full-length wild-type sequence VHL (786-0 WT VHL, VHL+/+ or WT VHL cells) or the sequence encoding the C162F mutant (786-0 C162F, VHL mutated or VHL-C162F cells).	[ { "tags": [ "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-Ce...
PMC9429973	Splenomegaly.	[ { "tags": [ "O", "O" ], "tokens": [ "Splenomegaly", "." ] } ]
PMC10898159	CHIP-seq of GIST tumor samples and cell lines identified the enhancer domain to be driving KIT gene expression, which is unique and essential for KIT gene expression and cell viability in GIST.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11401350	mean (SD); (A,B) No vector d3 n = 4, d6 n = 4; PGK-GFP d3 n = 5, d6 n = 3; PGK-CAR d3 n = 7, d6 n = 4; EF1a-GFP d3 n = 3, d6 n = 3; EF1a-CAR d3 n = 3, d6 n = 3 n = 4; p < 0.01; (C,D), No vector d3 n = 7, d6 n = 6; PGK-GFP d3 n = 5, d6 n = 5; PGK-CAR d3 n = 7, d6 n = 4; EF1a-GFP d3 n = 3, d6 n = 3; EF1a-CAR d3 n = 3, d6 n = 3; p < 0.01, ***p < 0.001; multiple t-test). (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8526701	C The viability of GIST-882 and GIST-T1 cells transfected with siRNA against BRD9 was determined by colony formation assay.	[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C", "The", "viability...
PMC10728200	Knowing that ferroptosis caused by lipid peroxidation is regulated by the key components of the cysteine-glutamate antiporter known as systemxc- and the antioxidant enzyme glutathione peroxidase 4 (GPX4), we investigated how IM induced ferroptosis and the result showed that the GSH/GSSG ratio was decreased in GIST-T1 and GIST-882 cells treated with IM as compared with those in the untreated cells (Fig. 2A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11772449	BEL-7404, Huh-7 and PLC/PRF/5 cells were treated with different concentrations of Sora (2.5/5/10/20 μM) and PFD (1/2/4 mM).	[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], ...
PMC11769516	It has been shown that changes in the ENS are the first symptoms of toxicity at low doses of DON .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "s...
PMC11612626	E, F, and G, Effect of compound A on FLAG-tagged β5/PSMB5 and FLAG-tagged β5i/PSMB8 high molecular weight proteasomal complexes in RPMI-8226 lysates.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11787381	Animals arrived on site 5 days before the experiment to allow optimal acclimation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Animals", "arrived", "on", "site", "5", "days", "before", "the", "exp...
PMC11635519	Genomic DNA (gDNA) from peptide-expressing cells at different time points was extracted using a QIAamp DNA Blood Mini Kit.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Genomic", "DNA", ...
PMC9429973	At 48 hours of arginine deprivation (range 1124-100 µM) GCN2 pathway was induced in HMCLs with consequent increase of basal levels of ATF4, p62, GABARAP and autophagy flux.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11087766	Certain phage proteins concentrate in the nucleus including RNA polymerase subunits, a RecA-related recombinase (henceforth RecA), DNA polymerase, and a number of proteins of unknown function (1, 3, 4, 13, 14).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11721295	.	[ { "tags": [ "O" ], "tokens": [ "." ] } ]
PMC9927933	A P value of less than 0.05 was considered significant.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "P", "value", "of", "less", "than", "0.05", "was", "considered", "significant", "." ...
PMC9429973	Aims: To present updated results of epcoritamab + rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) in previously untreated pts with DLBCL and IPI 3–5 (EPCORE NHL-2 arm 1; NCT04663347).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Previous studies have found that 6-Phosphofructo-2-Kinase/Fructose-2,6-Biphosphatase 4 (PFKFB4) is involved in glycolysis, cell cycle progression, autophagy, and metastasis in various tumor diseases and overexpression of PFKFB4 is associated with poor prognosis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11194678	Moreover, STAU1-KD STHdh cells expressing GFP-STAU1 WT but not the 5KE mutant showed impaired TFEB nuclear translocation and lysosomal acidification (Fig. 5, C–E).	[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11087766	PhiKZ gp104 and PhiPA3 gp108 have nearly identical N termini (amino acids 1 to 65) and are most divergent in the middle and C-terminal regions (Fig. 1 D and G).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7369657	As a new carbon-based nanomaterial, CQDs usage is a promising method for novel cancer treatments.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "a", "new", "carbon-based", "nanomaterial", ",", ...
PMC10391797	Interestingly, PD-L1 was also upregulated on THP-1 and MV411 after co-culture with CAR-T cells compared with co-culture with non-treated T cells (figure 2C).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC10812665	We hypothesize that compounds triggering similar cellular and metabolic effects would share a toxicological target pathway.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "hypothesize", "that", "compounds", "triggering", ...
PMC11799978	NIH3T3 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, C11995500BT, Gibco) supplemented with 10% special newborn calf serum (04–102–1A, BI) and 1% penicillin and streptomycin (15140122, Gibco), while 4T1(CL-0007, Pricella) cells were cultured in RPMI-1640 (C11875500BT, Gibco) medium containing 10% fetal bovine serum (BC-SE-FBS08, Bio Channel) and 1% penicillin and streptomycin.	[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11478724	This work is based upon research funder by Iran National Science Foundation (INSF) under project No. 4004225 and also was supported by grant No: biodc-35340-35342.2 of the Biotechnology Development Council of the Islamic Republic of Iran.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11519583	Scale bar: 50 μm.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bar", ":", "50", "μm", "." ] } ]
PMC9250505	Olaparib was the first FDA-approved PARPi and therefore the experimental approaches in this manuscript were largely performed using Olaparib.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Olaparib", "was", "the", "first",...
PMC11591052	Importantly, the master regulator of anabolic processes, mTOR, was also activated, because we detected its active form, phospho-mTOR (S2448), which results from phosphorylation by AKT.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10818573	A total of 10 EBV-positive cell lines were detected by the two assays, which showed consistent results.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "total", "of", "10", "EBV-positive...
PMC11748335	They exhibit the highest density of peaks, strongest intensity of peaks, lowest levels of DNA methylation, and the lowest expression levels in the nearest genes.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11257988	PI3K also activates the monomeric GTPase RAC involved in mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK1 and 2) and catalyzes cell migration.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11725127	Following the downregulation of KRAS, the levels of a downstream effector of KRAS, p-ERK were also significantly reduced (Fig. 4A and C).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC7171147	Knockdown of DDR2 dramatically abrogated COL11A1-induced AMPK phosphorylation (Fig. 3c), while knockdown of ITGA1 yielded a moderate reduction in AMPK phosphorylation (Fig. 3d), suggesting that DDR2 might be the predominant receptor that mediates COL11A1-induced AMPK activation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9878278	Cell viability was measured in SC at different time points post-transfection and post-infection using the Promega CellTiter 96 AQueous One Solution Cell Proliferation Assay (Cat.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10142392	Deepening our understanding of these formulations would be a good approach to improving optimal dosing and patient compliance.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Deepening", "our", "understanding", "of", ...
PMC8524093	Anti-E2 antibodies are able to attenuate the infection by targeting essential epitopes for virus entry and virus release processes (Jin et al., 2015; Tumkosit et al., 2020).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11119602	All the rendering and 3D structure visualisations were performed using the PyMOL (version 2.6.0) molecular visualisation system, distributed by Schrödinger, New York, NY, USA.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11322866	A Tecnai G20 TWIN transmission electron microscope (FEI, Eindhoven, Netherlands) was used for visual analysis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "Tecnai", "G20", "TWIN", ...
PMC11739484	Wound healing assay images at 0 and 24. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Wound", "healing", "assay", "images", "at", "0", "and", "24", ".", "(" ] } ]
PMC11295144	These data show that expression of NL2 increases the frequency of GABAergic IPSCs in the presence of synaptic α2β2γ2-GABAARs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "data", "show", "that", ...
PMC10891340	The cell supernatant was then collected to measure TCID50 (B) and the infected cells were collected to detect DPV UL30 expression by Q-RT-PCR (C). (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11532793	The divided counts can therefore be analyzed directly using the edgeR QL workflow originally developed for gene-level differential expression analyses.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "divided", "counts", ...
PMC10213179	Cells (A673) were plated on round coverslips (24-well plate) at a density of 75,000 cells per condition.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "(", "A67...
PMC11518994	This might further support the need for a larger screening of all children with ALL diagnosis in search of possible germline variants in cancer predisposing genes .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC2118063	In contrast, all GC were positive, with large centroblast-like cells staining most intensely.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", ",", "all", "GC", "were", "positive", ...
PMC11704834	Hence, it is likely that other molecular factors beyond EGFR mutations determine the sensitivity of lung cancer cells to EGFR-TKIs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hence", ",", "it"...
PMC11640247	To create the RAC3-R66W and constitutively active RAC3-Q61L (GTPase-deficient) variants, mutations were introduced as previously described and cloned into both pCAG-Myc and pTriEx-4 vectors (Merck, Darmstadt, Germany).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10808409	The drug amount (X3) had a significant effect on the EE %, where by increasing the drug amount (X3) the EE % decreased as shown by its negative coefficient (Eq. 5).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11402217	It further elucidated that XD23 thwarts osteosarcoma by suppressing DKK1 expression, which in turn activates the WNT-β/Catenin pathway.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "further", "elucidated", "th...
PMC11332076	Transphosphorylation is required for the activation of these tyrosine kinase receptors upon interaction with ligands.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transphosphorylation", "is", "required", "for", "the", "activatio...
PMC8567602	We next performed ChIP-seq for RNA Polymerase II (RNAPOLII) to determine the BAF-family relationship with transcription in each tumor genotype.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "next",...
PMC11787651	M344 is a selective HDAC6 inhibitor that is known to increase histone H3 and H4 acetylation (64).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "M344", "is", "a", "selective", ...
PMC11696576	We reported previously that the cell lines in the CCLS that were derived from hematopoietic cancers were more susceptible to cPLA2α inhibition than those derived from solid tumors.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3765139	NCG and FT supervised the project and edited the manuscript.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "NCG", "and", "FT", "supervised", "the", "project", "and", "edited", "the", "manuscript", "...
PMC7504302	Inactivation of the TP53 gene was found to correlate with a less favorable overall survival rate when compared to the wild type TP53, which would underscore that the MPMs with TP53 mutations have a more aggressive phenotype .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11026382	Horizontal error bars indicate standard deviation of three replicate experimental growth rate measurements, vertical error bars are the standard deviation in predicted growth rates estimated from 1000 bootstrap re-samplings (and model fits) of the data (points are mean-centered).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Of interest, this group of subjects was also characterized by significantly lower levels of PAI-1 both at baseline (7.18 ng/mL vs 17.53 ng/mL; p<0.0001), and at other time points (p<0.0001), and by an increase in F1 + 2 at D90 (p=0.02).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11789597	CAV1 inhibition in MM cells did not affect their sensitivity to bortezomib in the presence of glutamine, while it significantly increased the sensitivity to bortezomib in the absence of glutamine (Figure 6M; Figure S8F, Supporting Information).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11461833	Specifically, the accumulation of progerin causes defects in nuclear morphology, loss of protein homeostasis, increased DNA repair activity, telomere shortening, and chromatin disorganization, all of which limit the cellular proliferative capacity of cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Those who responded to ATG had a significantly better OS (12 vs 4 months, p=2.8x10).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Those", "who", "responded", "to", "ATG...
PMC11767725	HS is a chronic inflammatory skin condition primarily affecting intertriginous areas, including the armpits, groin, submammary folds, and perianal regions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11655536	SMM, smoldering multiple myeloma.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "SMM", ",", "smoldering", "multiple", "myeloma", "." ] } ]
PMC10578720	The innate and adaptive immune response disorders have been considered a critical obstacle to HBV clearance.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "innate", "and", "adaptive", "immune", "response...
PMC10993311	For the evolution of growth see Figure S1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "evolution", "of", "growth", "see", "Figure", "S1", "." ] } ]
PMC11656657	The targeting sequence for CXCL8 and CSF3 crRNA are listed below: CXCL8 crRNA: CUAAGUUCUUUAGCACUCCU and CSF3 crRNA: AGCUUGUAGGUGGCACACUG.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "targeting", ...
PMC9920575	Cells were incubated with the S. chinantlense extract at the IC50 value or with cisplatin for 72 h. All adhering and floating cells were harvested and then suspended in 1X binding buffer at a concentration of 1 × 10 cells/mL. This cell suspension was transferred to an Annexin V-7AAD conjugate solution, and propidium iodide (PE) was added.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11461833	Finally, the templates generated in step 1 (E1 to E11) and step 2 (I11 to E12) were overlapped by amplification with F1 and R1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	20 cases (22.73%) were infection-related.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "20", "cases", "(", "22.73", "%", ")", "were", "infection-related", "." ] } ]
PMC9429973	The screening experiments led to the top 10 depleted dropout genes for ALL and AML PDX samples.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "screening", "experiments", "led", "to", ...
PMC11471157	The dried product was pulverized into powder form using a crusher (Force Mill, OSAKA CHEMICAL, Osaka, Japan) (Fig. 1F).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11380454	FRET analysis was performed using a donor-sensitized acceptor fluorescence technique as previously described 42.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FRET", "analysis", "was", "performed", "using", "a", "donor-sensitized...
PMC9429973	Patients treated with midostaurin or cladribine were identified using inclusion/exclusion criteria similar to the trials and could contribute multiple lines of therapy (LOTs) to the analysis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	We found a significant correlation between a high mitochondrial ATP production and the resistance to proteasome inhibitor (P = 0.023, n= 12).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11774251	Heatmap of selected DEGs across NC, Con, and Tan-I groups. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Heatmap", "of", "selected", "DEGs", "across", "NC", ",", "Con", ",", ...
PMC11011020	This correction was approved by the Academic Editor.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "correction", "was", "approved", "by", "the", "Academic", "Editor", "." ] } ]
PMC9429973	Evaluations were performed using standard Wright-Giemsa and H&E staining, and IHC was performed on formalin-fixed EDTA-decalcified BMBs using standard techniques for CD25 and CD30.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11607764	Higher PTBP1 mRNA levels were associated with poorer survival probabilities in several cancer types.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Higher", "PTBP1", "mRNA", "levels", "were", "associated", "with", ...
PMC9684669	Intriguingly, terfenadine has been related to a decrease in calcium influx caused by L-type calcium channels (LTCC) activation in rat and human cells (22, 23), showing terfenadine can regulate intracellular calcium homeostasis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7305184	IRE is one of the rising technologies as minimally invasive ablation treatment in interventional electrophysiology as it has several benefits over other types of ablation (i.e. radiofrequency or cryoablation) such as short treatment time, reduced thermal injury and selectivity or sparing of surrounding tissue.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11583010	Human HEK293 cells were used for vector transfection and expression.	[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Human", "HEK293", "cells", "were", "used", "for", "vector", "transfection", "and", "exp...
PMC9429973	Beaton, B ASH 2021, 149348).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Beaton", ",", "B", "ASH", "2021", ",", "149348", ")", "." ] } ]
PMC11569208	Statistical tests were performed as indicated by figure legends including Student’s t-test, one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test, and two-way ANOVA with Sidak’s or Dunnett’s multiple correction test as appropriate.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC2247044	These properties suggest the establishment of a human neoplastic cell line which, with its ability to produce homotrimer collagen in vitro, will provide a useful model system for the study of tumour cell:stromal matrix interactions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9874064	Haiqin Song: Writing-Reviewing and Editing, Supervision, Funding acquisition.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Haiqin", "Song", ":", "Writing-Reviewing", "and", "Editing", ",", "Supervision", ",", ...
PMC10745221	While there may be slightly less substrates methylated by PRMT5 in the revertant cells, no major differences in substrate availability for the PRMT1, PRMT5, and PRMT7 enzymes were observed between the 143B-P and 143B-R cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7348793	The three longest (and most prominent) PCR products were cloned in the EcoRV site of pBluescriptII SK+, and sequenced with vector-specific T3 and T7 primers.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10079526	Taken together, our findings confirm that combining 5-Aza-2’ and TAK981 can efficiently be used to trap DNMT1 at the chromatin in Namalwa and U2OS.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLin...
PMC9429973	Standard Risk APL was diagnosed.	[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Standard", "Risk", "APL", "was", "diagnosed", "." ] } ]
PMC11697703	For quantification of MAPK8 signal across layers, intensity profiles were performed as described in.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "quantification", "of", "MAPK8", "signal", "across", ...
PMC11594074	Thus, the influence of compound 4 on the apoptotic behavior of leukemia cells was evaluated.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "influence", "of", "compound", ...
PMC5854676	The values of the polynomial constants are described in Table 1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "values", "of", "the", "polynomial", "constants", "are", "described", "in", "Ta...
PMC10698968	In fact, in the 2D proliferation assay, we observed an exponential growth with 5 PD in one week (Fig. 2A right), while in the myxospheres the number of cells retrieved after 17 days accounted for an equivalent of 6 PD (Fig. 3D bottom).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11518702	Reconstitution of HGAL-KO cells with HGAL-GFP or HGAL-Y107->F each restored calcium flux, with HGAL-Y107->F yielding calcium flux comparable to unmodified cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Reconstitution", ...

PMC11745600

Ins1 NOG mice injected with PBS under the renal capsule were used as controls (male, n = 2; female, n = 1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11225860

To determine effect of the combination therapy on different other cell types, MTS assays were performed on U2932, VAL, MDA-MB-231, Hela, Mia PaCa-2, U-2 OS, and Granta-519 cells treated with DMSO, Alisertib, Aurkin A, or a combination Alisertib and Aurkin A for four days.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-...

PMC10976516

OVs as a platform for transgene delivery.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "OVs", "as", "a", "platform", "for", "transgene", "delivery", "." ] } ]

PMC11122631

Compounds 3 (4.7 mg) and 8 (0.9 mg) were isolated from subfraction C6B4 (18.2 mg) by reverse-phase HPLC (C18 column) eluted with 60% methanol.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC5035325

Co-expression of EGFR and NeuGcGM3 ganglioside on tumor samples (63) from 92 patients (68 %) is summarized in Table 1 and exemplified in Fig. 1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11594641

The tested melanoma cells differ substantially not only in the Rab27 expression but also in a variety of other features.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tested", "melanoma", ...

PMC11190062

Freshly isolated primary myeloma cells were obtained from the local hospital biobank (Biobank1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Freshly", "isolated", "primary", "myeloma", "cells", "were", ...

PMC11767817

In our experiment, the expression of DKK-4, a key regulator of the Wnt signaling pathway, was significantly modulated: it increased under normoxic conditions and decreased under hypoxic conditions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10778532

Briefly, 786-0 cells were transfected with a vector allowing the doxycycline-inducible expression of the full-length wild-type sequence VHL (786-0 WT VHL, VHL+/+ or WT VHL cells) or the sequence encoding the C162F mutant (786-0 C162F, VHL mutated or VHL-C162F cells).

[ { "tags": [ "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-Ce...

PMC9429973

Splenomegaly.

[ { "tags": [ "O", "O" ], "tokens": [ "Splenomegaly", "." ] } ]

PMC10898159

CHIP-seq of GIST tumor samples and cell lines identified the enhancer domain to be driving KIT gene expression, which is unique and essential for KIT gene expression and cell viability in GIST.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11401350

mean (SD); (A,B) No vector d3 n = 4, d6 n = 4; PGK-GFP d3 n = 5, d6 n = 3; PGK-CAR d3 n = 7, d6 n = 4; EF1a-GFP d3 n = 3, d6 n = 3; EF1a-CAR d3 n = 3, d6 n = 3 n = 4; **p < 0.01; (C,D), No vector d3 n = 7, d6 n = 6; PGK-GFP d3 n = 5, d6 n = 5; PGK-CAR d3 n = 7, d6 n = 4; EF1a-GFP d3 n = 3, d6 n = 3; EF1a-CAR d3 n = 3, d6 n = 3; **p < 0.01, ***p < 0.001; multiple t-test). (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8526701

C The viability of GIST-882 and GIST-T1 cells transfected with siRNA against BRD9 was determined by colony formation assay.

[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C", "The", "viability...

PMC10728200

Knowing that ferroptosis caused by lipid peroxidation is regulated by the key components of the cysteine-glutamate antiporter known as systemxc- and the antioxidant enzyme glutathione peroxidase 4 (GPX4), we investigated how IM induced ferroptosis and the result showed that the GSH/GSSG ratio was decreased in GIST-T1 and GIST-882 cells treated with IM as compared with those in the untreated cells (Fig. 2A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11772449

BEL-7404, Huh-7 and PLC/PRF/5 cells were treated with different concentrations of Sora (2.5/5/10/20 μM) and PFD (1/2/4 mM).

[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], ...

PMC11769516

It has been shown that changes in the ENS are the first symptoms of toxicity at low doses of DON .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "s...

PMC11612626

E, F, and G, Effect of compound A on FLAG-tagged β5/PSMB5 and FLAG-tagged β5i/PSMB8 high molecular weight proteasomal complexes in RPMI-8226 lysates.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11787381

Animals arrived on site 5 days before the experiment to allow optimal acclimation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Animals", "arrived", "on", "site", "5", "days", "before", "the", "exp...

PMC11635519

Genomic DNA (gDNA) from peptide-expressing cells at different time points was extracted using a QIAamp DNA Blood Mini Kit.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Genomic", "DNA", ...

PMC9429973

At 48 hours of arginine deprivation (range 1124-100 µM) GCN2 pathway was induced in HMCLs with consequent increase of basal levels of ATF4, p62, GABARAP and autophagy flux.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11087766

Certain phage proteins concentrate in the nucleus including RNA polymerase subunits, a RecA-related recombinase (henceforth RecA), DNA polymerase, and a number of proteins of unknown function (1, 3, 4, 13, 14).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11721295

.

[ { "tags": [ "O" ], "tokens": [ "." ] } ]

PMC9927933

A P value of less than 0.05 was considered significant.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "P", "value", "of", "less", "than", "0.05", "was", "considered", "significant", "." ...

PMC9429973

Aims: To present updated results of epcoritamab + rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) in previously untreated pts with DLBCL and IPI 3–5 (EPCORE NHL-2 arm 1; NCT04663347).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Previous studies have found that 6-Phosphofructo-2-Kinase/Fructose-2,6-Biphosphatase 4 (PFKFB4) is involved in glycolysis, cell cycle progression, autophagy, and metastasis in various tumor diseases and overexpression of PFKFB4 is associated with poor prognosis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11194678

Moreover, STAU1-KD STHdh cells expressing GFP-STAU1 WT but not the 5KE mutant showed impaired TFEB nuclear translocation and lysosomal acidification (Fig. 5, C–E).

[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11087766

PhiKZ gp104 and PhiPA3 gp108 have nearly identical N termini (amino acids 1 to 65) and are most divergent in the middle and C-terminal regions (Fig. 1 D and G).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7369657

As a new carbon-based nanomaterial, CQDs usage is a promising method for novel cancer treatments.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "a", "new", "carbon-based", "nanomaterial", ",", ...

PMC10391797

Interestingly, PD-L1 was also upregulated on THP-1 and MV411 after co-culture with CAR-T cells compared with co-culture with non-treated T cells (figure 2C).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...

PMC10812665

We hypothesize that compounds triggering similar cellular and metabolic effects would share a toxicological target pathway.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "hypothesize", "that", "compounds", "triggering", ...

PMC11799978

NIH3T3 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, C11995500BT, Gibco) supplemented with 10% special newborn calf serum (04–102–1A, BI) and 1% penicillin and streptomycin (15140122, Gibco), while 4T1(CL-0007, Pricella) cells were cultured in RPMI-1640 (C11875500BT, Gibco) medium containing 10% fetal bovine serum (BC-SE-FBS08, Bio Channel) and 1% penicillin and streptomycin.

[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11478724

This work is based upon research funder by Iran National Science Foundation (INSF) under project No. 4004225 and also was supported by grant No: biodc-35340-35342.2 of the Biotechnology Development Council of the Islamic Republic of Iran.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11519583

Scale bar: 50 μm.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bar", ":", "50", "μm", "." ] } ]

PMC9250505

Olaparib was the first FDA-approved PARPi and therefore the experimental approaches in this manuscript were largely performed using Olaparib.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Olaparib", "was", "the", "first",...

PMC11591052

Importantly, the master regulator of anabolic processes, mTOR, was also activated, because we detected its active form, phospho-mTOR (S2448), which results from phosphorylation by AKT.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10818573

A total of 10 EBV-positive cell lines were detected by the two assays, which showed consistent results.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "total", "of", "10", "EBV-positive...

PMC11748335

They exhibit the highest density of peaks, strongest intensity of peaks, lowest levels of DNA methylation, and the lowest expression levels in the nearest genes.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11257988

PI3K also activates the monomeric GTPase RAC involved in mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK1 and 2) and catalyzes cell migration.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11725127

Following the downregulation of KRAS, the levels of a downstream effector of KRAS, p-ERK were also significantly reduced (Fig. 4A and C).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC7171147

Knockdown of DDR2 dramatically abrogated COL11A1-induced AMPK phosphorylation (Fig. 3c), while knockdown of ITGA1 yielded a moderate reduction in AMPK phosphorylation (Fig. 3d), suggesting that DDR2 might be the predominant receptor that mediates COL11A1-induced AMPK activation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9878278

Cell viability was measured in SC at different time points post-transfection and post-infection using the Promega CellTiter 96 AQueous One Solution Cell Proliferation Assay (Cat.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC10142392

Deepening our understanding of these formulations would be a good approach to improving optimal dosing and patient compliance.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Deepening", "our", "understanding", "of", ...

PMC8524093

Anti-E2 antibodies are able to attenuate the infection by targeting essential epitopes for virus entry and virus release processes (Jin et al., 2015; Tumkosit et al., 2020).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11119602

All the rendering and 3D structure visualisations were performed using the PyMOL (version 2.6.0) molecular visualisation system, distributed by Schrödinger, New York, NY, USA.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11322866

A Tecnai G20 TWIN transmission electron microscope (FEI, Eindhoven, Netherlands) was used for visual analysis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "Tecnai", "G20", "TWIN", ...

PMC11739484

Wound healing assay images at 0 and 24. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Wound", "healing", "assay", "images", "at", "0", "and", "24", ".", "(" ] } ]

PMC11295144

These data show that expression of NL2 increases the frequency of GABAergic IPSCs in the presence of synaptic α2β2γ2-GABAARs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "data", "show", "that", ...

PMC10891340

The cell supernatant was then collected to measure TCID50 (B) and the infected cells were collected to detect DPV UL30 expression by Q-RT-PCR (C). (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11532793

The divided counts can therefore be analyzed directly using the edgeR QL workflow originally developed for gene-level differential expression analyses.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "divided", "counts", ...

PMC10213179

Cells (A673) were plated on round coverslips (24-well plate) at a density of 75,000 cells per condition.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "(", "A67...

PMC11518994

This might further support the need for a larger screening of all children with ALL diagnosis in search of possible germline variants in cancer predisposing genes .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC2118063

In contrast, all GC were positive, with large centroblast-like cells staining most intensely.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", ",", "all", "GC", "were", "positive", ...

PMC11704834

Hence, it is likely that other molecular factors beyond EGFR mutations determine the sensitivity of lung cancer cells to EGFR-TKIs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hence", ",", "it"...

PMC11640247

To create the RAC3-R66W and constitutively active RAC3-Q61L (GTPase-deficient) variants, mutations were introduced as previously described and cloned into both pCAG-Myc and pTriEx-4 vectors (Merck, Darmstadt, Germany).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10808409

The drug amount (X3) had a significant effect on the EE %, where by increasing the drug amount (X3) the EE % decreased as shown by its negative coefficient (Eq. 5).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11402217

It further elucidated that XD23 thwarts osteosarcoma by suppressing DKK1 expression, which in turn activates the WNT-β/Catenin pathway.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "further", "elucidated", "th...

PMC11332076

Transphosphorylation is required for the activation of these tyrosine kinase receptors upon interaction with ligands.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transphosphorylation", "is", "required", "for", "the", "activatio...

PMC8567602

We next performed ChIP-seq for RNA Polymerase II (RNAPOLII) to determine the BAF-family relationship with transcription in each tumor genotype.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "next",...

PMC11787651

M344 is a selective HDAC6 inhibitor that is known to increase histone H3 and H4 acetylation (64).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "M344", "is", "a", "selective", ...

PMC11696576

We reported previously that the cell lines in the CCLS that were derived from hematopoietic cancers were more susceptible to cPLA2α inhibition than those derived from solid tumors.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC3765139

NCG and FT supervised the project and edited the manuscript.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "NCG", "and", "FT", "supervised", "the", "project", "and", "edited", "the", "manuscript", "...

PMC7504302

Inactivation of the TP53 gene was found to correlate with a less favorable overall survival rate when compared to the wild type TP53, which would underscore that the MPMs with TP53 mutations have a more aggressive phenotype .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11026382

Horizontal error bars indicate standard deviation of three replicate experimental growth rate measurements, vertical error bars are the standard deviation in predicted growth rates estimated from 1000 bootstrap re-samplings (and model fits) of the data (points are mean-centered).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Of interest, this group of subjects was also characterized by significantly lower levels of PAI-1 both at baseline (7.18 ng/mL vs 17.53 ng/mL; p<0.0001), and at other time points (p<0.0001), and by an increase in F1 + 2 at D90 (p=0.02).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11789597

CAV1 inhibition in MM cells did not affect their sensitivity to bortezomib in the presence of glutamine, while it significantly increased the sensitivity to bortezomib in the absence of glutamine (Figure 6M; Figure S8F, Supporting Information).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11461833

Specifically, the accumulation of progerin causes defects in nuclear morphology, loss of protein homeostasis, increased DNA repair activity, telomere shortening, and chromatin disorganization, all of which limit the cellular proliferative capacity of cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Those who responded to ATG had a significantly better OS (12 vs 4 months, p=2.8x10).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Those", "who", "responded", "to", "ATG...

PMC11767725

HS is a chronic inflammatory skin condition primarily affecting intertriginous areas, including the armpits, groin, submammary folds, and perianal regions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11655536

SMM, smoldering multiple myeloma.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "SMM", ",", "smoldering", "multiple", "myeloma", "." ] } ]

PMC10578720

The innate and adaptive immune response disorders have been considered a critical obstacle to HBV clearance.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "innate", "and", "adaptive", "immune", "response...

PMC10993311

For the evolution of growth see Figure S1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "evolution", "of", "growth", "see", "Figure", "S1", "." ] } ]

PMC11656657

The targeting sequence for CXCL8 and CSF3 crRNA are listed below: CXCL8 crRNA: CUAAGUUCUUUAGCACUCCU and CSF3 crRNA: AGCUUGUAGGUGGCACACUG.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "targeting", ...

PMC9920575

Cells were incubated with the S. chinantlense extract at the IC50 value or with cisplatin for 72 h. All adhering and floating cells were harvested and then suspended in 1X binding buffer at a concentration of 1 × 10 cells/mL. This cell suspension was transferred to an Annexin V-7AAD conjugate solution, and propidium iodide (PE) was added.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11461833

Finally, the templates generated in step 1 (E1 to E11) and step 2 (I11 to E12) were overlapped by amplification with F1 and R1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

20 cases (22.73%) were infection-related.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "20", "cases", "(", "22.73", "%", ")", "were", "infection-related", "." ] } ]

PMC9429973

The screening experiments led to the top 10 depleted dropout genes for ALL and AML PDX samples.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "screening", "experiments", "led", "to", ...

PMC11471157

The dried product was pulverized into powder form using a crusher (Force Mill, OSAKA CHEMICAL, Osaka, Japan) (Fig. 1F).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11380454

FRET analysis was performed using a donor-sensitized acceptor fluorescence technique as previously described 42.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FRET", "analysis", "was", "performed", "using", "a", "donor-sensitized...

PMC9429973

Patients treated with midostaurin or cladribine were identified using inclusion/exclusion criteria similar to the trials and could contribute multiple lines of therapy (LOTs) to the analysis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

We found a significant correlation between a high mitochondrial ATP production and the resistance to proteasome inhibitor (P = 0.023, n= 12).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11774251

Heatmap of selected DEGs across NC, Con, and Tan-I groups. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Heatmap", "of", "selected", "DEGs", "across", "NC", ",", "Con", ",", ...

PMC11011020

This correction was approved by the Academic Editor.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "correction", "was", "approved", "by", "the", "Academic", "Editor", "." ] } ]

PMC9429973

Evaluations were performed using standard Wright-Giemsa and H&E staining, and IHC was performed on formalin-fixed EDTA-decalcified BMBs using standard techniques for CD25 and CD30.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11607764

Higher PTBP1 mRNA levels were associated with poorer survival probabilities in several cancer types.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Higher", "PTBP1", "mRNA", "levels", "were", "associated", "with", ...

PMC9684669

Intriguingly, terfenadine has been related to a decrease in calcium influx caused by L-type calcium channels (LTCC) activation in rat and human cells (22, 23), showing terfenadine can regulate intracellular calcium homeostasis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7305184

IRE is one of the rising technologies as minimally invasive ablation treatment in interventional electrophysiology as it has several benefits over other types of ablation (i.e. radiofrequency or cryoablation) such as short treatment time, reduced thermal injury and selectivity or sparing of surrounding tissue.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11583010

Human HEK293 cells were used for vector transfection and expression.

[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Human", "HEK293", "cells", "were", "used", "for", "vector", "transfection", "and", "exp...

PMC9429973

Beaton, B ASH 2021, 149348).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Beaton", ",", "B", "ASH", "2021", ",", "149348", ")", "." ] } ]

PMC11569208

Statistical tests were performed as indicated by figure legends including Student’s t-test, one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test, and two-way ANOVA with Sidak’s or Dunnett’s multiple correction test as appropriate.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC2247044

These properties suggest the establishment of a human neoplastic cell line which, with its ability to produce homotrimer collagen in vitro, will provide a useful model system for the study of tumour cell:stromal matrix interactions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9874064

Haiqin Song: Writing-Reviewing and Editing, Supervision, Funding acquisition.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Haiqin", "Song", ":", "Writing-Reviewing", "and", "Editing", ",", "Supervision", ",", ...

PMC10745221

While there may be slightly less substrates methylated by PRMT5 in the revertant cells, no major differences in substrate availability for the PRMT1, PRMT5, and PRMT7 enzymes were observed between the 143B-P and 143B-R cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7348793

The three longest (and most prominent) PCR products were cloned in the EcoRV site of pBluescriptII SK+, and sequenced with vector-specific T3 and T7 primers.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10079526

Taken together, our findings confirm that combining 5-Aza-2’ and TAK981 can efficiently be used to trap DNMT1 at the chromatin in Namalwa and U2OS.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLin...

PMC9429973

Standard Risk APL was diagnosed.

[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Standard", "Risk", "APL", "was", "diagnosed", "." ] } ]

PMC11697703

For quantification of MAPK8 signal across layers, intensity profiles were performed as described in.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "quantification", "of", "MAPK8", "signal", "across", ...

PMC11594074

Thus, the influence of compound 4 on the apoptotic behavior of leukemia cells was evaluated.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "influence", "of", "compound", ...

PMC5854676

The values of the polynomial constants are described in Table 1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "values", "of", "the", "polynomial", "constants", "are", "described", "in", "Ta...

PMC10698968

In fact, in the 2D proliferation assay, we observed an exponential growth with 5 PD in one week (Fig. 2A right), while in the myxospheres the number of cells retrieved after 17 days accounted for an equivalent of 6 PD (Fig. 3D bottom).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11518702

Reconstitution of HGAL-KO cells with HGAL-GFP or HGAL-Y107->F each restored calcium flux, with HGAL-Y107->F yielding calcium flux comparable to unmodified cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Reconstitution", ...