Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
 Community
1
PMCID
string
Sentences
string
ner
list
PMC8922418
As HIV-1 enters immune cells through co-receptors CCR5 and CXCR4, the most effective method is using gene-editing technology to silent or mutate co-receptors and confer cell resistance against HIV-1 infection. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10073922
Specific overexpression of SP1 protein, a transcription factor that directly binds to Sur-P, results in high transcriptional activity of Sur-P in lung tumor cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973
In FL setting, pts were divided according to their induction regimen with (n:5) or without FLT3-i (n:48).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "FL", ...
PMC8956657
Statistical significance was determined by a one-way ANOVA followed by Tukey’s test; n.s.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "significance", "was", "determined", "by", "a", ...
PMC10204952
The cellular concentration of S1P is in the low nanomolar range, which is much lower than its serum level (~0.5 μM) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11314247
In addition, combining several HDACis and cisplatin increases the number of apoptotic cells, as described in .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "combining", "se...
PMC10218459
The greatest limitations and dangers for the patient are attributed to the unwanted side effects of chemotherapy, most commonly nephrotoxicity , cardiotoxicity , neurotoxicity, and hepatotoxicity .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9587298
Only one sample of R. geoides from Las Raíces showed a significant protective effect at lower concentrations (62.5, 125 and 200 µg/mL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10955424
Immunoblot experiments were performed twice with comparable results.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Immunoblot", "experiments", "were", "performed", "twice", "with", "comparable", "results", "." ] } ]
PMC11247842
During quality control of summary statistics, we observed consistency in the direction of allele effect estimates in each breed for most of the significant SNPs (see Additional file 2: Figure S1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
The median RFS and OS was 17.6 and 26.6 mos, respectively (Fig. 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "median", "RFS", "and", "OS", "was", "17.6...
PMC11592008
These molecules are substrates of active caspase-1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "molecules", "are", "substrates", "of", "active", "caspase-1", "." ] } ]
PMC11618052
H NMR (400 MHz, δ ppm DMSO-d6): 8.82 (s, 1H, triazole CH), 8.08 (d, J = 7.7 Hz, 1H, Ar–H), 7.86 (d, J = 7.0 Hz, 1H, Ar–H), 7.68–7.60 (m, 4H, Ar–H), 7.48 (t, J = 7.2 Hz, 1H, Ar–H), 7.30 (d, J = 8.4 Hz, 2H, Ar–H), 4.70 (s, 2H, S–CH2), 4.08 (q, J = 6.8 Hz, 2H, N–CH2), 1.16 (t, J = 6.8 Hz, 3H, CH3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11672142
X-ray diffraction analysis was carried out using a Rigaku XtalLAB SuperNOVA single microfocus Cu-Kα radiation (λ = 1.5417 Å) source equipped with a HyPix3000 X-ray detector in transmission mode operating at 50 kV and 1 mA within the CrystallizPRO software ver.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11748618
However, it remains unclear if HIV spVL associated variants are associated with CHD1L gene expression changes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "it", "remains", "unclear", ...
PMC11794847
The groundbreaking development of immune checkpoint inhibitors, targeting proteins like PD-1 and CTLA-4, has revitalized the field of cancer immunotherapy .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "groun...
PMC11545868
While research into the specific anticancer properties of prunetin is ongoing and not as extensive as that on other isoflavones such as genistein and daidzein, some studies suggest that these isoflavone glycosides may exert their anticancer effects through multiple mechanisms .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Summary/Conclusion: Alternative splicing and back-splicing mechanisms of the primary BAX and BCL2L12 transcripts produce multiple distinct circRNAs in this B-cell CLL cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11742290
LGR5 forms a curved solenoid structure with the 17 LRR domains structure and does not interact with small-molecule ligands, hormones, or neurotransmitters like typical GPCRs .Fig.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11714165
The fluorous‐tagged NBD peptide is further co‐assembled with an oligo (aspartic acid) terminated fluoropeptide to form bone‐targeted peptide nanoparticles for osteosarcoma treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11506827
However, pre-treatment with Z-VAD-FMK, a pan-caspase inhibitor, neutralized this effect (Figure 6A), indicating the involvement of caspase activation in apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10877303
The 5’ end of the MERS-CoV genome is translated to generate a large polyprotein, which is subsequently cleaved in cis into 16 functional nonstructural proteins by two viral proteases.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11682224
After being planted in 6-well plates with 800 μL per well, A431 cells were cultivated for a full day.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "being", "p...
PMC6182045
10,000 colonies of cells transfected with a plasmid encoding TZ97008-rgp120 were analyzed for rgp120 expression using the ClonePix 2 robot.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "10,000", "colonies", "of", ...
PMC10165258
Figure 3Droplet drug library production for toxicity screening(A) Schematic side view of the microfluidic channel geometry that allows for the droplet drug library production.(B) Top view of the chip used for creating secondary droplets.(C) Schematic side view of the steps toward droplet fusion: secondary droplets with a content of interest are trapped in secondary traps next to the primary trapped droplets, subsequently fusion on droplets is induced.(D) Photographs of droplets doing the steps shown in (c).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11782508
The high morbidity and mortality associated with cancer highlight the critical need for novel therapeutic options.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "high", "morbidity", "and", "mortality", "associ...
PMC10713411
Mechanisms of PRPCDGs risk signature in KIRC. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mechanisms", "of", "PRPCDGs", "risk", "signature", "in", "KIRC", ".", "(" ] } ]
PMC11676169
For experiments mapping the regions of interaction between BCAT1 and XRCC5 or XRCC6, HEK 293T cells stably expressing BCAT1 myc/DDK were transfected with expression vectors for XRCC6 (pcDNA-HAXRCC6 (full-length: 1–609), N-terminal (1–350), Ku domain (351–500), C-terminal (501–609)) or XRCC5 (pLenti-HAXRCC5 (full-length: 1–732), N-terminal (1–240), Ku domain (241–550), C-terminal (551–732)).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC11271800
Tumor-associated macrophages have dual potential in the tumor microenvironment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Tumor-associated", "macrophages", "have", "dual", "potential", "in", "the", "tumor", "microenvironment", "....
PMC6600253
Therefore, targeting and inhibiting SASP might serve to mitigate the deleterious outcomes of TIS. .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "targeting", "and", "inhibiting", "SA...
PMC11705547
Mechanism of action for cisplatin. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mechanism", "of", "action", "for", "cisplatin", ".", "(" ] } ]
PMC11634027
These plasmids were used as a template to amplify Ds-ICD sequence with different conserved motif deletions by using the following primer set: Fwd Primer: GGCAATTGGTCTACTGGTAGC; Rev Primer: GGAAATGTGGGGACACGGATGGGCGGAGGCGGATCCGGAAAACCCATCCCAAACCCCCTCTTGGGTTTGGACAGCACTCGTACCGGTCATCATCACCATCACCATTAAAATTCGTTAACAGATCTGCG.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4369959
Native Americans have also used wild ginger rhizome to regulate menstruation and heartbeat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Native", "Americans", "have", "also", "used", "wild", "ginger", "rhizome", ...
PMC11604768
Surprisingly, no promoters were differentially active upon D2R agonism.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Surprisingly", ",", "no", "promoters", "were", "differentially", "active", "upon", "D2R", "agoni...
PMC11574029
In various solid tumors, Notch acts as an oncogenic pathway involved in malignant progression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "various", "solid", "tumors", ",", "Notch", "acts", ...
PMC8389560
From Thermo Fisher Scientific (Waltham, MA, USA): Fura-2AM (Cat. #
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "From", "Thermo", "Fisher", "Scientific", "(", "Waltham", ",...
PMC2193049
A fragment encoding yeast ubiquitin (Ub) carrying a lysine48 to arginine mutation (to preclude that the COOH-terminal Ub moiety could serve as a ubiquitylation/degradation signal) and an influenza hemagglutinin epitope (ha) recognized by a monoclonal antibody was obtained by PCR, using the plasmid pRc/dUb–Met–βgal as template (20).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11247842
The SNP BTA6: 86,951,401 (rs110813063) and BTA6:86,956,804 (rs110611635), which were high ranking SNP in MTAG_CM and MTAG_SCS, had perfect LD with the CNV.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Results: Out of 881 pts who met the eligibility criteria, 142 (16.1%) received HDCT/HSCT and 739 (83.9%) did not.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11352666
The BCL-2 family includes anti-apoptotic proteins (BCL-2, BCL-XL, MCL-1, BCL-W, BFL-1), pro-apoptotic effector proteins (BAX, BAK, BOK), and pro-apoptotic BH3-only proteins (BAD, BIM, BID, NOXA, PUMA, BIK, and HRK) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11723947
f Relationship between the genes more highly expressed and the genes associated with peaks more open in HP1α KO Tconv than in WT Tconv exposed to Treg.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6892818
Moreover, the ‘quality’ of the CD40 signal may determine whether CD40L–CD40 interactions are pro-apoptotic: extensive receptor cross-linking by membrane-presented CD40L (mCD40L) causes extensive apoptosis, while soluble agonists (e.g. agonistic antibodies) cause little apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11615743
The gel electrophoresis results confirmed the assembly of the associative toehold structure and the activation of the L‐HCR in solution (Figure 2A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC6487404
BA to papp.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "BA", "to", "papp", "." ] } ]
PMC3931643
Our results agree with recent findings that the 4EBP/eIF4E ratio is a crucial determinant of asTORi sensitivity in cancer cells , , and extend this model to a naturally occurring DLBCL line deficient in 4EBP1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11413393
Protein A Sepharose beads (Abcam, #ab193256) were washed with 1 mL of RIPA buffer and added to each sample tube to facilitate pre-clearing of the samples.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9596868
PA-1 cells were treated with 1µM MST-312, 10 µM quercetin and their combination for 24 h. Control group was treated with DMSO.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC7519871
In this experiment, combined drug action was studied through the median effect principle to determine whether combinations resulted in antagonistic, synergistic or additive effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11706491
Scheme depicting all the fluorescent markers and their status along the cell cycle.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scheme", "depicting", "all", "the", "fluorescent", "markers", "and", "their...
PMC11768927
To counteract this effect, the authors utilized dendritic cells engineered to express antigens against CSDE1 as a vaccination strategy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "counteract", "this", ...
PMC8345486
However, compound 23 together with cisplatin decreased the viability of the A2780cis and A2780cisR spheroids, thereby sensitizing them to the cytotoxicity of the drug (Figure 12A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11476837
We observed a tendency toward increased ROS level in HL-60/DR cells pre-incubated with NRF2 inhibitors compared to doxorubicin itself (Figure 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11760643
Anti‐P2X7 and isotype control mAbs were purified as described .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Anti‐P2X7", "and", "isotype", "control", "mAbs", "were", "purified", "as", "described", "." ] } ]
PMC9275501
Cao et al. (2019a) developed a pH-sensitive nanostructured lipid carrier (DOX/ELE Hyd NLCs) loaded with DOX and β-ELE for the treatment of lung cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11792740
For instance, depleted T cells exhibit reduced responsiveness to immune checkpoint inhibitor therapy, necessitating alternative therapeutic approaches for these patients .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "insta...
PMC10196713
To monitor lipid peroxidation or mitochondrial membrane potential, Liperfluo or MT-1 (both from Dojindo Laboratories, Inc.) reagent was added to each dish and incubated for 30 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9592219
These results indicate that TOP2A enhances HCC cell invasion and migration via epithelial-mesenchymal transition (EMT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "indicate", "that", "TOP2A", ...
PMC11643361
This ROS-mediated cytotoxicity is a central mechanism in the activity of metal complexes against cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "ROS-mediated", "cytotoxicity", "is", "a", "central", ...
PMC11087766
We found that the import pathways of PhiPA3 and PhiKZ are highly effective at discriminating between each other’s proteins.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "found", "that", ...
PMC11224020
Right, box plot showing the minimum to maximum range of cPLA2 intensity (N = 2; n = 59 cells in Arpin at 4 µm, n = 87 cells in Arpin at 4 µm, n = 75 cells in Arpin at 3 µm).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11252553
Taurine effectively protects human peripheral blood lymphocytes from radiation-based apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Taurine", "effectively", "protects", "human", "peripheral", "blood", "lymphocytes", "from", "radiation...
PMC9429973
For ACA Index, 30, 45, 45, and 18 patients were categorized into Excellent, Good, Moderate, and Poor group, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11788920
C and D) GQ and CRISPR–dCas9 could stall RNAP progression, resulting in truncated RNA products.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C", "and", "D", ")", "GQ", ...
PMC11394112
Cells were treated with human IL6 at 50 ng/mL for 2 to 48 h. Viable cells were counted at each time point using trypan blue exclusion on a DeNovix CellDrop BF (DeNovix, Wilmington, DE, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Positive cases were subjected to immunosequencing of the light chain locus via amplicon based next-generation sequencing and characterized for typical chromosomal deletions and driver gene mutations.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973
Results: NGS-based FLT3-ITD MRD was present in 43 of 176 (24%) AML patients with a median variant allele frequency of 0.01% (range 3.1x10% to 3.10%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11672617
Subsequently, all experimental and control samples were analyzed on a NovoCyte Penteon flow cytometer (Agilent, Santa Clara, CA, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10547921
By analyzing the binding mode and the related SAR between various payloads and proteins, we hope to clarify how the structures determine their biological activity and characteristics and provide a valuable reference for the generation of more new ADC payloads in the future.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11240448
These negative feedback mechanisms contribute to the robustness of this cascade against inhibition .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "negative", "feedback", "mechanisms", "contribute", "to", "the", "r...
PMC11472639
For example, it is important to determine whether there is a preferential killing of CD38 NK-cells over myeloma cells during bouts of exercise, and to assess this impact of exercise in a larger, more diverse cohort of patients before recommendations of exercise timing during therapy can be made.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
96 charts were analysed as a sample (Apixaban 50, Rivaroxaban 46).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "96", "charts", "were", "analysed", "as", "a", "sample", "(", ...
PMC9985266
Subsequently, the cells were placed at 37 °C and cultured under 5% CO2, and the transfection efficiency was measured for subsequent experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11228511
NM ruptures were identified by live-cell imaging in progerin-SMCs that expressed a nuclear-targeted green fluorescent protein reporter (nls-GFP) (19, 27).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11078693
CRITICAL: A small amount of conjugated antibodies will attach to the poly-lysine at glass surface, staining it weakly (Video S1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC2614415
While mechanisms of resistance are being discovered, novel treatment options and a better understanding of disease resistance are sorely needed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "mechanisms", ...
PMC9429973
The prognostic risk was established according to MRC, ELN2010 and ELN2017 classification.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "prognostic", "risk", "was", "established", "according", "to", "MRC",...
PMC11674441
The remaining adherent cells were cultured in DC-specific medium supplemented with 100 ng/mL granulocyte-macrophage colony-stimulating factor (Primmune Inc., Kobe, Japan) and 50 ng/mL interleukin 4 (Primmune Inc.).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10551595
While T‐ALL is not as common as B‐ALL, it is more invasive and associated with a worse prognosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "T‐ALL", "is", "not", ...
PMC9351137
Pairwise sequence alignment was performed using EMBOSS Needle and QIAGEN CLC Main Workbench 21.0.1 (https://digitalinsights.qiagen.com/).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Pairwise", "sequence", "alignment", "was", "perfo...
PMC11129910
Additionally, the formation of primary and secondary mammospheres confirmed the stem-like nature of these cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "the", "formation", "of", "primary...
PMC11754094
To this end, we employed CGBE1 and measured large-deletion frequencies in various KO cell lines (LIG IV KO, POLQ KO, RAD52 KO HeLa cell line) used in Fig. 3e.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellL...
PMC9428827
IL-2 is a cytokine with a pivotal role in the control of immune system homeostasis, acting on both effector and regulatory lymphocytes (1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11762280
C Proteins of N-GSDMD, cleaved PARP, cleaved caspase-3, and p-MLKL were detected by western blotting assay in epidermal lysates of human skin explants from 3 samples.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11437637
Avoid blood touching the upper part of the tube wall.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Avoid", "blood", "touching", "the", "upper", "part", "of", "the", "tube", "wall", "." ...
PMC9583612
There are several ways to perform verification.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "are", "several", "ways", "to", "perform", "verification", "." ] } ]
PMC11767725
In inflammatory skin diseases, cytokines such as TNF-α and IL-6 play a dual role in influencing skin microbiota dynamics and being modulated by microbial shifts.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973
Next, we evaluated the utility of the 4-PI in recategorizing patients from the ELN-risk subgroups in a best-fitted risk category.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Next", ",", "we",...
PMC9429973
Receipt of RBC/platelet transfusion was also significantly associated with HMA prescribing, suggesting physicians may be influenced by the potential to avoid or reduce the need for RBC/platelet transfusion with HMA therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11532793
Bootstrap sampling will result in no variation in transcript assignment for those reads, resulting in simple multinomial variation over the technical replicates for the dominant transcript and zero counts for other transcripts.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11012012
This review summarizes current knowledge on the expression of SLAMF receptors and their adaptor proteins SAP and EAT-2 in B-CLPD.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "review", "summarizes...
PMC11787355
j Cytotoxicity upon serial diluting CD8 T cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "j", "Cytotoxicity", "upon", "serial", "diluting", "CD8", "T", "cells", "." ] } ]
PMC9429973
Taken together with data suggesting immune surveillance is a driver of maintenance therapy efficacy and a desire to increase IBER tolerability with long-term treatment, doses of 0.75, 1.0, and 1.3 mg were selected for dose optimization of IBER monotherapy in the newly diagnosed MM maintenance setting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10440586
CD99 expression was demonstrated in the Neftel single-cell dataset.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD99", "expression", "was", "demonstrated", "in", "the", "Neftel", "single-cell", "dataset", "." ] } ...
PMC11394227
The excitation wavelength for flow cytometry was 488 nm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "excitation", "wavelength", "for", "flow", "cytometry", "was", "488", "nm", "." ] } ]
PMC10877303
Fig. 1 Flow chart showing the main steps of the study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", "1", "Flow", "chart", "showing", "the", "main", "steps", "of", "the", "s...
PMC11756937
The modifications have often involved the addition of reprogramming factors to the conventional Yamanaka factors, tailored with specific combinations of promoters to boost reprogramming efficiencies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10547921
Nicolaou et al. synthesized Calicheamicin θ1 (48), an analog of calicheamicin γ1, which has an IC50 value of <1 pmol/L for a variety of tumor cells and is also suitable for use as an ADC payload.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11126803
The cartoon illustrates the LncRNA-SERB can enhance the expression of intracellular ZEB1 through upregulating ERβ.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cartoon", "illustrates", "the", "LncRNA-SERB", "can", ...
PMC9693627
After addition of 2.5xMS Buffer (525 mM mannitol, 175 mM sucrose, 2.5 mM EDTA, 12.5 mM Tris-HCl, pH 7.5), cell debris was pelleted at 1300× g for 5 min at 4 °C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11754784
We also characterized the expression of SIRPα on M1 macrophages as shown in Supplementary Fig. 38.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "also", "characterized", "the", "expression", "of...