PMCID string | Sentences string | ner list |
|---|---|---|
PMC9844987 | Bottom: Box-and-whisker plots of promoter expression split by each category of genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Bottom",
":",
"Box-and-whisker",
"plots",
"of",
"promoter",
"expression",
"... |
PMC11489351 | The subclass of proteins with activities, abundances, or binding affinities that are sensitive to physiological pHi changes are called pH sensors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
PMC8348645 | They were verified and received by the organic certified D and G Biotech company, which is FSSAI approved. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"They",
"were",
"verified",
"and",... |
PMC10297204 | The latency of the gastrocnemius muscles’ CMAP in the 99.5E group (2.2 ± 0.29 ms) was the highest among all the three groups (p < 0.01). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11279397 | Computational evaluation revealed that pulegone acted as a potent inhibitor of the SARS-CoV-2 spike protein, exerting antiviral effects . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Computational",
"evaluation",
"revealed... |
PMC11718109 | Fig. 2iNeurons show presence of classical SSVs while iPSC-derived DA neurons show size pleiomorphism in SV pools.(A) Fluorescence image of control iNeurons differentiated from KOLF2.1 iPSCs (day 19) immunolabeled with antibody directed against synaptophysin. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11476837 | As expected, HL-60/DR were more resistant to doxorubicin as evaluated by cell viability, apoptosis, and intracellular ROS induction assays. | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"As",
... |
PMC11502066 | Another natural flavone luteolin (Figure 1) reduced the expression of CXCR4 in human breast cancer cells MDA-MB-231, being associated with the suppression of cellular invasion. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11628904 | Identification of such pathways will benefit researchers working across the spectrum of model organisms. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Identification",
"of",
"such",
"pathways",
"will",
"benefit",
"researc... |
PMC9712534 | Previous studies have reported that ICRF treatment enhances the degradation of TOP2B, but not TOP2A. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Previous",
"studies",
"have",
"reported",
"that",
"ICR... |
PMC9688728 | To prepare cell samples for protein extraction, the cells were detached with 0.25% trypsin-EDTA solution (PanEko, Moscow, Russia), washed three times with PBS, and counted in Goryaev’s chamber. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11248911 | MCF-7 cells were seeded at 8 × 10 cells per mL. Cells were plated and treated with helichrysetin for 24, 48, and 72 hours. | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11723947 | Gray dots represent genes that failed to reach the FDR threshold of 0.05 and the absolute log2 fold change threshold of 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Gray",
"dots... |
PMC7351993 | Finally, the RIACS can be directly combined with a DNA/RNA sequencing machine to enable a large statistical study of the genotype-phenotype relations of intracellular molecules, in particular small molecules including metabolites, which are previously difficult to label with fluorescent probes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11122631 | The clinical development of a natural compound requires a sustainable source compound to be available at a reasonable cost , especially marine natural compounds . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC10745221 | In Figs 7 and 8, histones and non-histone supernatants were diluted in 2X sample buffer at a 1:1 ratio, and non-histone pellets were resuspended in 200 μL 2X sample buffer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9454852 | In our model system, we reproduced these results, showing that BOLD-100 leads to the induction of apoptotic cell death, as confirmed by caspase 3/7 activation (Figure 2A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | RNA-seq data were analyzed for reads alignment and transcripts quantification by CircComPara pipeline. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RNA-seq",
"data",
"were",
"analyzed",
"for",
"reads",
"alignment",
"and",
... |
PMC7887261 | Disease-associated genes have a higher Phevor score. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Disease-associated",
"genes",
"have",
"a",
"higher",
"Phevor",
"score",
"."
]
}
] |
PMC11437637 | Table 6PBLs comparison in patients with EC between before and after surgerySurgeryLaparoscopic surgeryOpen surgeryBefore operationAfter operationP valueBefore operationAfter operationP valueBefore operationAfter operationP valueBody immune function testN=79N=79N=59N=59N=20N=20 Total lymphocyte1844.27±575.581411.9±487.12<0.0011871.44±571.981404.46±504.27<0.0011764.12±593.521433.85±444.080.002 CD3+ lymphocyte1315.85±399.79993.99±354.48<0.0011234(1101, 1584)994(682, 1235)<0.0011223.12±373.93978.1±289.110.004 CD4+T cell820.67±269.99614.41±236.44<0.001835.12±268613.71±251.4<0.001778.05±278.27616.45±191.240.008 CD8+T cell430.41±176.27330.49±145.51<0.001441.71±186.71335.27±155.16<0.001397.05±139.91316.4±114.690.001 Double positive T cell6(4, 9)4(2, 7)<0.0015(4, 9)4(2, 7)0.0036(4, 7.75)4.5(2.25, 6.75)0.006 Double negative T cell67(46, 98)48(33, 71)<0.00177(51, 107)50(34, 91)<0.00159.1±34.5450.75±40.440.099 CD19+B lymphocyte282.1±148.48235.62±125.12<0.001257(182, 374)202(126, 324)<0.001279.8±175.96236.95±97.880.096 NK cell240.56±146.26175.34±120.35<0.001212(129, 302)148(109, 207)<0.001183.28(135, 350)164.5(115, 244)0.070 NKT cell35(16, 74)29(15, 55)0.03034(15, 70)25(14, 53)0.05338(19.75, 80.75)31.5(18.25, 61.5)0.262 CD4+/CD8+2.1±0.812.04±0.820.1652.13±0.872.03±0.90.0812.02±0.642.05±0.570.631Ratio of CD4+T subsetsN=38N=38N=28N=28N=10N=10 Th1/CD4+T27.75(24.19, 33.02)30.01(24, 34.36)0.10127.75(24.45, 32.82)30.1(23.84, 34.07)0.17529.81±8.8529.81±6.581.000 Th2/CD4+T38.38±10.8837.37±10.720.14638.82±11.5937.71±11.220.17937.13±936.41±9.660.602 Th17/CD4+T13.57±4.6113.83±4.970.43613.32±5.0613.67±5.250.36514.26±3.1314.27±4.320.990 Treg/CD4+T7.02±1.46.94±1.510.7437.26±1.347.06±1.310.4446.34±1.416.6±20.659 Th1/Th20.72(0.59, 1.03)0.76(0.62, 1.09)0.0930.72(0.59, 1.03)0.73(0.61, 1.08)0.1470.86±0.360.87±0.260.858This analysis was on the basis of 79 EC patients (59 with laparoscopic surgery, 20 with open surgery) for differences between groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The definition of hematologic and non-hematologic organ damage has evolved from World Health Organization (WHO) C-findings, to organ damage criteria specified by the International Working Group-Myeloproliferative Neoplasms Research and Treatment and European Competence Network on Mastocytosis (IWG). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7841189 | This study is the first to demonstrate the critical role of LTBP2 in thyroid carcinoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"study",
"is",
"the",
"first",
"to",
"demonstrate",
... |
PMC11721587 | Cl8 cells were treated with 1% fresh formaldehyde at room temperature with gentle shaking for 15 min. | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cl8",
"cells",
"were",
"treated",
... |
PMC10882807 | Cell proliferation ability was assessed by colony formation assays after HCCLM3 cells transfected with shNC + vector, shEIF4A3 + pcDNA or shEIF4A3 + pcDNA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],... |
PMC11310713 | The quantification of p53 (B), PTEN (C), and KI67 (D) positive mammary gland epithelial cell ratio in pharmaceutical hormone-treated OVX rats compared to GTB-injected rats. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11786600 | Therefore, kaempferol was added to PED2 to obtain the kaempferol-loaded PED4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"kaempferol",
"was",
"added",
"to",
"PED2",
"to",
"obtain",
... |
PMC9429973 | Currently, monoclonal antibodies (mAb) against CD20 are commonly used for immunotherapy of mature B-cell malignancies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Currently",
",",
"monoclonal",
"antibodies",... |
PMC11707577 | After irradiation, 10 µL of the WS was added in each well and left, in the dark, to incubate for 30 min at room temperature. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9454178 | E Immunoblotting analysis of cyclin-D1, CDK4 and γH2AX expression after CDK7 knockdown The CDK7 inhibitor THZ1 exerts antitumorigenic effects in various cancers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"E",
... |
PMC11806818 | The linear range of Apt/Fe-N-C SAzymes for detecting HepG2 tumor cells was 100 − 2 × 10 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"linear",
"range",
"of",
... |
PMC8992508 | Moreover, P-gp and BCRP are the two main ABC transporters placed at the BBB and reduce the ability to cross the BBB of many drugs that are substrates of these two proteins including chemotherapeutic agents. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7153288 | In the following steps, the stem sample was soaked in 70% ethanol for 5 min and then washed with sterile distilled water to remove residual ethanol. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11411131 | Depletion of Sec and resulting in a premature termination codon (PTC) at TGA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Depletion",
"of",
"Sec",
"and",
"resulting",
"in",
"a",
... |
PMC10125312 | At the same time, we confirm that increases of temperature are caused by the interaction of AuNR-PEGs with laser light, as cells irradiated in the absence of nanoparticles did not experience light-to-heat conversion. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | All patients gave written informed consent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"patients",
"gave",
"written",
"informed",
"consent",
"."
]
}
] |
PMC11719944 | Additionally, during activation, CD4+ T cells undergo less efficient metabolic reprogramming in aerobic glycolysis, similar to highly proliferative cancer cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC6267596 | In addition, as demonstrated by real-time single cell imaging, day-2 of recovering cells undergo reductive cell divisions (multipolar mitosis, meiosis-like or budding type division) confirming a defective spindle assembly checkpoint as a mechanism of alisertib induced polyploidy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11679892 | The data obtained from the optical analysis in real-time PCR were recorded as “Ct” (cycle of threshold), and the expression levels of the target genes were normalized with the GAPDH reference gene. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC4369959 | Weng et al. further supported their observation that 6-shogaol and 6-gingerol effectively inhibit invasion and metastasis of hepatocellular carcinoma by the inhibition of MMP-2/-9 and uPA, along with the suppression of MAPK and PI3k/Akt pathways, as well as downregulation of NF-κB and STAT3 activities. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11707832 | Additionally, MAN2B1 was identified as one of the causative mutations in an atypical and severe SLE patient . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additionally",
",",
"MAN2B1",
"was",
"... |
PMC5600151 | For example, G1 PAMAM is not able to complex nucleic acid because of the low positive charge density. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"example",
",",
"G1",
... |
PMC9577200 | NO: NM_000546), caspase-3 primers were F 5′GGAAGCGAATCAATGGACTCTGG3′ and R 5′GCATCGACATCTGTACCAGACC3′ (ACC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"NO",
":",
"NM_000546",
")",
",",
"caspase-3",
"primers",
... |
PMC9429973 | Pts’ disease burden in the 12 months prior to crizanlizumab initiation (baseline period) was provided by the treating physician. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Pts",
"’",
... |
PMC7602170 | AKT, an anti-apoptotic factor, mediates these PI3K-dependent cell survival responses . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"AKT",
",",
"an",
"anti-apoptotic",
"factor",
",",
"mediates",
"these",
"PI3K-dep... |
PMC11279598 | Estradiol binds and activates tumor cell estrogen receptors that act to promote proliferation and suppress apoptosis by both direct and indirect modulation of target gene transcription . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11781181 | The miR-375-3p binding sites in the FSP1 and FTH1 3ʹ-UTR were listed in Fig. 6A and Fig. 7A. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"miR-375",
"-",
... |
PMC11730305 | Cell inhibition percentage was calculated using the following formula and 50% inhibitory concentration (IC50) was determined by GraphPad Prism software (version 9.5.1, USA), and:[12pt] $$\:Inhibition\:()=\:100$$ The HepG2 cells were treated with the nanoparticles for 24 h. The cells without nanoparticle exposure were also considered negative control. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11459296 | In all humanization experiments, each dot represents one independent mouse. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"all",
"humanization",
"experiments",
",",
"each",
"dot",
"represents",
"one",
"... |
PMC9436459 | Morusalones A − D (154 − 159) from M. alba cell cultures , featuring unprecedented 6/7/6/6/6/6 hexacyclic core skeletons with a unique bridged cycloheptenone ring, could be regarded to be formed by Diels–Alder cycloaddition of quinostilbene dienophiles and dehydroprenyl-2-arylbenzofuran dienes and subsequent intramolecular nucleophilic addition. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11743316 | Numerous investigations have demonstrated that mitochondria-targeting medicines have good prospects as prospective therapies in the clinical treatment of ovarian cancer . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Numerous",
"investigations",
... |
PMC5833712 | 18S rRNA and Tubulin were used as controls. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"18S",
"rRNA",
"and",
"Tubulin",
"were",
"used",
"as",
"controls",
"."
]
}
] |
PMC10317042 | The role of SOX10 in CCS has not been clarified; however, ChIP-seq analysis revealed that SOX10 and EWSR1::ATF1 share 56%–83% of their binding site and cooperatively regulate MITF expression (49, 50). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11407042 | CRITICAL: Do not pipette up and down while transferring. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CRITICAL",
":",
"Do",
"not",
"pipette",
"up",
"and",
"down",
"while",
"transferring",
"."
... |
PMC11285179 | Fig. 4Retinoic acid signaling is activated by CCL28 in pericytes through CCR3 A, Volcano plot of changes in metabolic pathways after CCL28 stimulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11736898 | Vitamin D signaling through the VDR regulates the expression of genes involved in cellular proliferation, differentiation and inflammation, with generally anti-fibrotic and anti-inflammatory activities . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10411253 | The c.934C>T variant was novel, affecting the evolutionary conserved Arg312 (Figure 1f). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"c.934C",
">",
"T",
"variant",
"was",... |
PMC4695073 | As to tumor cells, XPA expression was detected in almost all samples (128/129), and high (H score ≥ 1.4) in 57.4% samples (Table 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | In terms of safety, 85.2% of the 196 patients presented adverse events [AEs, neutropenia (46.4%) and diarrhea (24.5%)], including 64.3% of AEs of grade ≥3 (including 32.7% neutropenia). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5034105 | A series of 10-fold dilutions equivalent to 1 × 10–1 × 10 copies/reaction mixture were prepared to generate calibration curves and run in parallel with the test samples. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The ED was due to a septic choc, a thrombotic event, and a leucostasis, for one patient each. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"ED",
"was"... |
PMC9429973 | Results: We have established that TET2 and TET3 synergize in stabilizing DNA methylation patterns and transcriptional programs that guard cell identity while B lymphocytes transit through developmental stages, allowing the generation of functional B lymphocytes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11180402 | C-E) Protein expression in indicated stable transfectants was analyzed by Western blot, normalized to GAPDH. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"C-E",
")",
"Protein",
"expression",
"in",
"... |
PMC11711127 | More challenging has been identifying any consistent surface molecules involved. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"More",
"challenging",
"has",
"been",
"identifying",
"any",
"consistent",
"surface",
"molecules",
... |
PMC11727638 | Cell Domes with cells incubated for 10 days and high-density Cell Domes with cells incubated for 3 days were immersed in a medium containing 2 µM hypoxia probe solution (Medical & Biological Laboratories, Nagoya, Japan) for 24 h. After washing with PBS twice, they were observed using the fluorescence microscope. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Variants present with a minor allele frequency (MAF) >1%, according to population databases (ExAc, 1000 genomes), were considered polymorphic changes without clinic relevance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11087055 | See also Video 4 and Figure 4—source data 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"See",
"also",
"Video",
"4",
"and",
"Figure",
"4—source",
"data",
"1",
"."
]
}
] |
PMC9895440 | All primary antibodies were used at a dilution of 1:1000 in TBS-T with 5% BSA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"primary",
"antibodies",
"were",
"used",
"at",
... |
PMC11686380 | The ratio of the intensity of RFP-positive axons in the contralateral cortex (yellow area) to that of the ipsilateral cortex was quantitatively analyzed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC6934009 | To investigate the effect of wogonin on A549 and A427 lung cancer cells and explore the mechanism involved. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"investigate",
"the",
... |
PMC11637284 | The linewidth reflects the mean +/- the standard deviation of n = 3 experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"linewidth",
"reflects",
"the",
"mean",
"+",
"/-",
... |
PMC11675244 | Fzd receptors have also become the focus of new anti-cancer agents. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fzd",
"receptors",
"have",
"also",
"become",
"the",
"focus",
"of",
"new",
"anti-cance... |
PMC9100622 | Uninformative reads (multimapped reads, duplicated reads, and reads with low mapping score) were filtered out with samtools 1.3 . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Uninformative",
... |
PMC9065483 | Despite the exciting multimodal therapeutic effects of OVs for cancer therapy, their success has yet to be fully realized due to variable response rates. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11687167 | They found that the inhibition of PCSK9 enhanced the tumor response to PD-1 inhibitors by promoting massive infiltration of CTLs within the tumor through a mechanism independent of the cholesterol regulatory function of PCSK9 . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11767725 | Metabolic disorders amplify these processes through systemic effects. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Metabolic",
"disorders",
"amplify",
"these",
"processes",
"through",
"systemic",
"effects",
"."
]
}
] |
PMC10957991 | Data represent mean + /− SEM, n(ctrl siRNA) = 20, n(TRPV4 siRNA) = 20; P < 0.05 *; P < 0.001 *** (unpaired two-sample Student’s t-test). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Toxicity: All patients were evaluated for toxicity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Toxicity",
":",
"All",
"patients",
"were",
"evaluated",
"for",
"toxicity",
"."
]
}
] |
PMC9429973 | 18.2% (2/11) of the patients had received other CAR-T therapies and relapsed before the enrolment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"18.2",
"%",
"(",
"2/11",
")",
"o... |
PMC8427838 | The median expression of TMIGD1 mRNA in pan kidney cancers (KIPAN) was 1.91 versus 3.42 normal (Additional file 1: Figure S4B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11547917 | A ratio of 1:5 (v/v) sample to reaction mixture containing 0.6 M sulphuric acid, 28 mM sodium phosphate dibasic and 4 mM ammonium molybdate tetrahydrate was combined in Eppendorf test tubes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11087055 | The initiation of the polonaise movements was set as Time 0 (t=0). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"initiation",
"of",
"the",
"polonaise",
"movements",
... |
PMC6267596 | Polyploidy was induced by treating cells with 50nM alisertib for 4 days, then 8n-cells were sorted based on H2B-GFP expression and utilized forward scatter plot which correspond to cell size by FACS sorting followed by recovery of 8n-cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9024365 | Lysates were then transferred to a rotator at 4C for 30 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Lysates",
"were",
"then",
"transferred",
"to",
"a",
"rotator",
"at",
"4C",
... |
PMC10654497 | The minimum and maximum number of gene sets was 5 and 5,000, respectively, and the resampling value was 1,000. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"minimum",
... |
PMC11011837 | For a clearer and more detailed lipidomic analysis, qualitative and semiquantitative differences within lipid classes will be studied at first, then among molecular species, and finally among lipid building blocks. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11742864 | Further investigations should be designed to examine the underlying mechanism of how they reduce cancer development and the incidence of cancer cachexia. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Further",
"i... |
PMC11224020 | cPLA2 is known to translocate to the nucleus and associate with the inner nuclear membrane after activation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"cPLA2",
"is",
"known",
"to",
"translocate",
... |
PMC11756937 | At the stage of DB freeze, one well was used for alkaline phosphatase (AP) staining. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"At",
"the",
"stage",
"of",
"DB",
... |
PMC11568601 | B Representative H&E staining images of the heart, liver, lung and kidney tissues from mice in each group (400×, n = 3, Scale bar = 20 μm). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9841531 | Compound 7, for example, has been assessed in two different assay systems (fluorescence-based vs radioactivity-based) revealing IC50 values between 1 and 85 nM—with almost 2 orders of magnitude difference. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Results: A total of 545 patients (293 males (53.8%)) were included in the study. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Results",
":",
"A",
"t... |
PMC10033453 | Tumor dimensions were measured by digital caliper three times per week and tumor volume calculated. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Tumor",
"dimensions",
"were",
"measured",
"by",
"digital",
... |
PMC11496491 | The bubble chart analysis of most significant in terms of biological processes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"bubble",
"chart",
"analysis",
"of",
"most",
"significant",
"in",
"terms",... |
PMC9429973 | Twelve (71%) pts had disease refractory to any prior line of therapy (LOT), including 10 (59%) refractory to any anti-CD20 Ab-containing regimen, and 9 (53%) to their last LOT. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | We therefore hypothesised that U-CLL ‘Non/Reverse Responders’ may have reached maximal stimulatory capacity through BCR-signalling alone, rendering them unresponsive to further activation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11742670 | The experiment was carried out in 3 replicates. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"experiment",
"was",
"carried",
"out",
"in",
"3",
"replicates",
"."
]
}
] |
PMC11116779 | Effects of PS-NPs on cellular senescence induction. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Effects",
"of",
"PS-NPs",
"on",
"cellular",
"senescence",
"induction",
"."
]
}
] |
PMC9621239 | Average entropy between amino acid 110 to amino acid140 within the transactivation region. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Average",
"entropy",
"between",
"amino",
"acid",
"110",
"to",
"a... |
PMC11477621 | H NMR (400 MHz, CDCl3) δ 7.27–7.23 (m, 1H), 7.22–7.19 (m, 1H), 7.10 (d, J = 3.1 Hz, 1H), 6.93 (td, J = 9.1, 2.5 Hz, 1H), 6.42 (dd, J = 3.1, 0.8 Hz, 1H), 4.13–4.04 (overlap, 4H), 2.26 (t, J = 7.4 Hz, 2H), 1.81 (p, J = 7.2 Hz, 2H), 1.63–1.55 (m, 2H), 1.37–1.27 (overlap, 4H), 1.24 (t, J = 7.1 Hz, 3H). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11321678 | The barplot in the top right corner indicates the statistics result of genes related to different counts of co‐accessible (cA) peak. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.