PMCID string | Sentences string | ner list |
|---|---|---|
PMC11437637 | Moreover, these findings indicate that in addition to blood pressure, glucose, and lipids, PBLs can also be used to predict EC risk in patients on medication to control underlying disease. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11805741 | In the analysis of the binding interactions with the BCL-2 protein, the ΔG for astaxanthin and sorafenib revealed notable differences. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"anal... |
PMC11075223 | In the Qing Dynasty, Shengma Decoction had good activity on the treatment of severe headache accompanied with ringing in the head (thunder headache in TCM theories) recorded in Yifang Jijie . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11594074 | All antibodies were purchased from Cell Signaling (Frankfurt a. M., Germany) and incubated overnight at 4 °C. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"antibodies",
... |
PMC8193813 | CO2 concentrations up to 10000 ppm were observed; the relatively lower average CO2 concentrations reflect the rapid mixing and entrainment of ambient air, causing dilution. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11483468 | Therefore, protein inhibitor therapy targeting telomerase may provide a new safe and effective cancer therapy approach. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"protein",
"inhibitor",
"therapy... |
PMC11541241 | We provide emerging roles of the plant TOR pathway in plant–phytopathogen interactions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"provide",
"emerging",
"roles",
"of",
"the",
"plant",
"TOR"... |
PMC11799620 | The cell viability was determining according the following formula: The capacity of OFAE extract to protect exposed cells against oxidative damage enhanced by Cd exposure was evaluated by the method found by (Athmouni et al. 2018b). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7433824 | Only the pro‐tumorigenic mitochondrial ornithine aminotransferase and anti‐apoptotic mitochondrial 60 kDa heat shock protein were downregulated in A172 cell line and U87 cell line when treated with P4, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"... |
PMC9429973 | Aims: To characterize the incidence and outcomes of isolated adult pLCH in the United States. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Aims",
":",
"To",
"characterize",
"the",
"incidence",
... |
PMC11720107 | The cells were maintained at 37 °C in a humidified atmosphere with 5% CO2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"cells",
"were",
"maintained",
"at",
"37",
... |
PMC3931643 | We also observed that VAL cells expressed the isoform 4EBP2, and that asTORi treatment did increase the amount of 4EBP2 bound to the cap complex. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11759751 | We found that tumor growth was slower in the Vehicle + CD19 CAR T group and Chidamide + CD19 CAR T group than in the Vehicle and Chidamide groups (Fig. 5B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9368503 | In contrast, ontologies upregulated in cell lines versus patient tissue specimens comprised proteins involved in the regulation of lipoprotein particle clearance and RNA splicing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11611077 | Such DNA fragments were inserted into two mammalian expression vectors, pBApo-EF1α Neo DNA and pBApo-CMV Neo DNA (Takara Bio, Shiga, Japan), using In-fusion cloning kit (Takara Bio). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11089031 | All those data indicated that ZNF692 negatively regulated G3BP2 and TM9SF2 expression in ccRCC.Fig. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"those",
"data",
"indicated",
"that",
"ZNF692",
"negatively",
... |
PMC10890307 | Here, we evaluated the growth rates, the specific rates of glucose and glutamine consumption, and lactate and glutamate production to determine if lung tumor cells proliferate under stressful culture conditions associated with the tumor microenvironment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6461034 | Phosphosites are filtered for class I phosphosites (localization probability > 75%; Olsen et al, 2006), coupled to phosphopeptide spectral count data, and used for substrate‐centric inference of kinases on the basis of kinase–substrate relationships that are either experimentally observed (provided by PhosphoSitePlus, “PSP”) or predicted by an algorithm using sequence motif and protein–protein network information (NetworKIN, “NWK”). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10114490 | A iHDF-T karyotype is not altered after more than 70 population doublings: 46XX,del (15) (q11.2q15). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"iHDF-T"... |
PMC10142392 | PCL nanoparticles (about 300 nm) loaded with carboplatin (hydrophilic chemotherapy) were prepared for this purpose. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PCL",
"nanoparticles",
"(",
"abou... |
PMC10196713 | Thus, the extent of lipid peroxidation in OVK18 and OVK18cis cells treated with cisplatin was examined by flow cytometric analysis using the fluorescent probe Liperfluo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC11653533 | Natural products are a vital source of new drugs, with many medications stemming from this highly-esteemed wellspring. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Natural",
"products",
"are",
"a",
"vit... |
PMC11718817 | Videos of 30 min length were recorded at 4 and 18 h after the start of coculturing PancOVA spheroids with ex vivo generated OT-I CD8 CTLs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11756907 | A culture medium (Dulbecco’s Modified Eagle’s Medium, low glucose, Sigma Aldrich (Poland)), supplemented with 10% heat-inactivated foetal calf serum (FBS), enriched with antibiotics (penicillin [100 μg/mL]/streptomycin [100 μg/mL] was used for breeding (Sigma Aldrich, Poland)). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8348645 | To this diluted mixture, hydrochloric acid was added. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"this",
"diluted",
"mixture",
",",
"hydrochloric",
"acid",
"was",
"added",
"."
]
}
] |
PMC4816271 | Indeed this phenomenon of CARs containing IgG1 CH2-CH3 spacers has previously been reported . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Indeed",
"this",
"phenomenon",
"of",
"CARs",
"containing",
"IgG1",
"CH2-CH3... |
PMC9429973 | Patients will be followed up from their end-of-induction treatment visit until the end of the study, including clinical evaluation every 3 months in the first year and every 6 months in the second year for patients undergoing ASCT and maintenance treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11348300 | For FaDu, BxPc3, and AsPc1 cell lines, tumors were imaged at 1 h, 3 h, and 6 h postinjection. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC9516447 | In contrast to pancreatic cancer, studies in non-small cell lung cancer showed that knockdown of mutant KRAS by itself may not be sufficient treatment due to compensatory oncogenic pathways, however this may offer opportunities to couple with other targeted therapeutic approaches . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11765879 | The first layer consisted of RPMI-1640 media solidified with 0.4% agar. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"first",
"layer",
"consisted",
"of",
"RPMI-1640",
"media",
"solidified",
"... |
PMC11257203 | Indomethacin, in addition to digestive tract ulcers, has other detrimental effects such as liver damage, kidney failure, blood abnormalities, and an increased risk of heart stroke (2). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9398137 | To assess the practical significance of treatment effectiveness, we plotted charts with growth curves indicating group mean tumor sizes accompanied by expert opinion on the differences observed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Duration of thrombocytopenia in CLV regimen – 9 days, LEAM and BeEAC -11 days. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Duration",
"of",
"thrombocytopenia",
"in",
"CLV",
"regimen",
... |
PMC11686380 | In addition, because the transfection efficiency depends on the cell surface area physically exposed to the ventricular lumen where plasmids are injected, neurons incorporating a low amount of a vector are expected to undergo partial effects. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11806818 | The sandwich structure was separated from the PSA mixture using the magnetic effect of the magnetic beads, and the PtNP@Co3O4 nanozymes were able to catalyze the redox reaction between H2O2 and TMB, which produced quantitative electrochemical and colorimetric reactions simultaneously in homogeneous solution. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11539788 | Bladder cancer (BCa), one of the most prevalent malignancies of the genitourinary system, ranks ninth in incidence and thirteenth in mortality among all cancers . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10213199 | Co-expression analysis and function enrichment of the HL60 cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O"
],
"tokens": [
"Co-expression",
"analysis",
"and",
"function",
"enrichment",
"of",
"the",
"HL60",
"cell",
... |
PMC11792888 | The effects of single and combined treatments on cell cycle phases in the A549 line were also analyzed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"effects",
"of",
"single",
... |
PMC9429973 | Screening and data extraction were conducted independently and in duplicate by 2 reviewers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Screening",
"and",
"data",
"extraction",
"were",
"conducted",
"independently",
... |
PMC9429973 | Key secondary endpoints are changes in Hb level, markers of hemolysis, ATP and 2,3-DPG levels, and Hb-oxygen affinity (p50, Hemox Analyzer). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11680562 | Pectin gels are usually created by a process called ionotropic gelation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Pectin",
"gels",
"are",
"usually",
"created",
"by",
"a",
"process",
"called",
"ionotr... |
PMC9577200 | Besides, CS significantly (p < 0.05) inhibits bacterial growth in the range of 0.2–1.5% compared to control. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Besides",
",",
"C... |
PMC8164677 | Patricia Cho et al. (2019) working at Harvard Medical School recently conducted a study in a 3D spheroid model where Nrf2 hyper-activation in lung cancer enabled the cancer cells to bypass the death program through enhanced antioxidant role of cancer cells; knocking down Nrf2 through CRISPR resulted in cell death in inner cells of spheroids which previously escaped death.35 Wedelolactone showed more inhibition of Nrf2 than standard as observed in silico (Table 3; Figure 9). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9684669 | The statistically significance between two curves were analyzed by extra sum-of-squares F test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"statistically",
"significance",
"between",
"two",
"curves",
"were",
... |
PMC11365983 | Immunoblots demonstrate that overexpressing Foxc1 induces faster accumulation of Gli1 protein in serum-starved NIH3T3 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"Immunoblots",
"demonstrate",
"that",
"overexpressing",
"Foxc1"... |
PMC6617630 | BCL6: BCL6-F (5′TAACATCGTTAACAGGTCCATGACG3′) BCL6-R (5′GCCCCGTTCTCACAGCTAGAATC3′) GAPDH: GAPDH-F (5′GAAGGTCGGAGTCAACGG ATTTG3′) GAPDH-R (5′ATGGCATGGACTGTGGTCATGAG3′). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"BCL6",
":",
"BCL6... |
PMC11693599 | Taxane/platinum-based or neoadjuvant chemotherapy, in combination with surgical resection, is the first-line treatment for ovarian cancer (4). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Taxane/platinum-based",
... |
PMC9878562 | Interfering with this axis by ACKR3 deletion impairs lymphoma cell migration towards CXCL12. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interfering",
"with",
"this",
"axis",
"by",
"ACKR3",
"deletion",
"impairs",... |
PMC11627060 | To complete the reaction, the solution was maintained at room temperature with constant magnetic stirring at 500 rpm for 18 h. The resulting NP suspension underwent centrifugation for 20 min at 12,000 rpm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Aims: The aim of this phase 2 study is to evaluate efficacy and tolerability of Ixazomib-Daratumumab (I-Dara) without Dexamethasone in elderly frail patients with relapsed myeloma (RRMM) (NCT03757221). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11752767 | Innovations in CAR design, transduction methodologies, and selection of the optimal antigens are bound to lead to improved responses and reach more patients with advanced melanoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11402217 | Data was analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"was",
"analyzed",
"by",
"one-way",
"ANOVA",
"followed",
"by",
... |
PMC9429973 | Aims: To investigate the safety and efficacy of esomeprazole in treatment of iron overload in patients with non-transfusion-dependent hereditary anemias. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Aims",
":",
"To",... |
PMC11471157 | In the analysis of the labeling indices for Ki67 and PCNA, over 500 cells from each experimental group were counted under high magnification, and their rates of positivity analyzed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11228511 | Our studies are consistent with earlier studies showing that NM ruptures are more frequent in cells with a nuclear bleb (27, 30), presumably due to a weakened nuclear envelope (28). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11352666 | The data for MERTK RNA expression in EWS patient samples were derived from the pediatric cancer data portal (PeCan) at https://pecan.stjude.cloud/ (accessed on 8 June 2023). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11637820 | In contrast to previous investigations, using CAP, gram-positive bacteria were more sensitive to CAP treatment when compared to gram-negative bacteria derived from DFUs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9429973 | 40% of patients received consolidation with autologous stem cell transplantation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"40",
"%",
"of",
"patients",
"received",
"consolidation",
"with",
"autologous",
"stem",
... |
PMC11525028 | The purified protein was loaded into cell and the inhibitor into a syringe. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"purified",
"protein",
"was",
"loaded",
"into",
"cell",
"and",
... |
PMC11628904 | Larvae exposed to far red‐expressing C. albicans were imaged using a Nikon Eclipse TE300 inverted fluorescent microscope with a Plan Apo NA 0.45/10× objective. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11190062 | TLR1–10 mRNA expression in CD138 cells isolated from MM patients (N = 772). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"TLR1–10",
"mRNA",
"expression",
"in",
"CD138",
"cells",
"is... |
PMC11576293 | This experiment examines the impact of the newly developed compounds 9–29 on normal cell lines to assess their safety level. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"experiment",
"examin... |
PMC11786704 | Fig. 1 Synthesis and Characterization of PC Capsules. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"1",
"Synthesis",
"and",
"Characterization",
"of",
"PC",
"Capsules",
".",
"("
]
}
] |
PMC3734024 | Histograms comparing surface expression of CD125 in CD19, CD19FasL and CD19FasL cells. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Histograms",
"comparing",
"surface",
"expression",
"of",
"CD125",
"in"... |
PMC9777812 | In this study, we further validated the regulatory role of bta-miR-106b on CDKN1A expression, thereby promoting mammary gland epithelial cell proliferation and activating the PI3K/AKT/mTOR pathways to regulate milk protein synthesis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10669128 | Nonetheless, cancer cell lines present several limitations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Nonetheless",
",",
"cancer",
"cell",
"lines",
"present",
"several",
"limitations",
"."
]
}
] |
PMC8711270 | This is because CHO cells do not express the enzymes β-galactoside α2,6-sialyltransferase, α1,3/4 fucosyl transferase or β-1,4-N-acetylglucosaminyltransferase III, which are expressed in human cell lines (Goh and Ng, 2017). | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11752767 | TILs sorted by MATIC require only 5 days of expansion to reach the necessary cell numbers for therapeutic use, with a purity of up to 95% and an isolation efficiency of 90% . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11594074 | Fifty poses were further refined with the GBVI/WSA dG scoring function and the receptor’s induced fit mode. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fifty",
"poses",
"were",
"further",
"r... |
PMC9429973 | Recently, cell-free DNA (cfDNA) has been proven to resume the heterogeneity of spatially distributed clones. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Recently",
",",
"cell-free",
"DNA",
"(... |
PMC9429973 | Summary/Conclusion: Our study highlights that tissue-specific transcription factors regulate cell cycle exit at the promotor level and lineage-specification and terminal differentiation at the enhancer level during hematopoietic development. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10297204 | In this stage, 45 animals were inoculated subcutaneously with HS-SY-II (1.0 × 10 cells per mouse). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"this",
"stage",
",",
... |
PMC11411004 | Next, the cells were centrifuged at low temperature, and the supernatant was collected for subsequent experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Next",
",",
"the",
"cells",
"were",
... |
PMC10093184 | Several authors described spheroid formation in canine and human osteosarcoma cells, including D-17 and COS4288 cells, which was confirmed in the present study, and additionally demonstrated for the other COS cells . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC11697065 | The secretory capacity of Chinese hamster ovary (CHO) cells remains a fundamental bottleneck in the manufacturing of protein-based therapeutics. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11486946 | Solid lines correspond to the indicated compound. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Solid",
"lines",
"correspond",
"to",
"the",
"indicated",
"compound",
"."
]
}
] |
PMC8524093 | Among neurological complications, the most prevalent symptoms seem to be abnormal mental status, headache, focal deficits, and seizures. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Among",
"neu... |
PMC10006224 | Four different samples were stained with increasing dilutions of Pacific Blue (Invitrogen) for 30 min in the dark at RT and then mixed into one tube. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Real-world data of patient outcomes post cBTKi and BCL2i exposure in CLL/SLL are limited to small retrospective studies, and the optimal treatment in this setting is unknown. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10125312 | Viability of cell lines for all studied concentrations shown as percent of controls (0 nM). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Viability",
"of",
"cell",
"lines",
"fo... |
PMC10213179 | injection of fluorescent-labeled aptamers with cyanine 7 (Cy7): Cy7-ATOP or Cy7-SCR at a concentration of 1.6 mg/kg. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"injection",
"of",
"fluorescent-labeled"... |
PMC10788478 | Pathway analysis was also conducted based on the mRNA sequencing data for both HCC15 and A427 cell lines (Tables S8 and S9), and “G‐protein coupled receptor signaling” (z‐score: −2.840 in HCC15; z‐score: −2.502 in A427), “Cardiac hypertrophy signaling (enhanced)” (z‐score: −2.111 in HCC15; z‐score: −2.065 in A427), and “Pulmonary fibrosis idiopathic signaling pathway” (z‐score: −2.309 in HCC15; z‐score: −2.065 in A427) were the commonly regulated pathways (Table 5) which are potentially associated with the progression of lung cancer exhibiting LGR6 overexpression through the Wnt/β‐catenin pathway activation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC11551844 | AuNPs-JC-2 showed enhanced cytotoxicity with a decrease in IC50 values from 3.37 ± 0.19 μg mL to 0.52 ± 0.09 μg mL in A172 and from 2.28 ± 0.20 μg mL to 0.78 ± 0.28 μg mL in TERA1 compared to JC-2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
... |
PMC11746948 | Our study initially aimed to identify critical metabolic regulators that affect ferroptosis sensitivity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"study",
"initially",
"aimed",
"to",
"identify",
"critical",
"metabol... |
PMC11483468 | In addition, apoptotic cells were observed, which became small and round with fragmented nuclei (Figure 4C, yellow arrows). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
... |
PMC9592219 | Taken together, our study unravels the hitherto unappreciated role of TOP2A in the Hippo signaling pathway. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Taken",
"together",
",",
"our",
"study",
"u... |
PMC9429973 | With a median follow-up of 26.5 (1.2-239) months, relapse was observed in 16 patients, 4 of whom presented only with isolated extramedullary disease. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11705484 | Repeated measures analysis of variance (ANOVA) was used to analyze mRNA stability at different time intervals for each group separately. * | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Repeate... |
PMC10170482 | Labeled cells were then imaged by confocal microscopy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Labeled",
"cells",
"were",
"then",
"imaged",
"by",
"confocal",
"microscopy",
"."
]
}
] |
PMC11621493 | The protein-containing fractions were pooled and desalted using the Econo-Pac® 10-DG Desalting Columns (732-2010, Bio-Rad). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"protein-containi... |
PMC11769516 | In summary, the studies conducted by Agahi et al. show that the antioxidant enzyme system in SH-SY5Y neuroblastoma cells plays a strong protective role against damage caused by α-ZEL, β-ZEL and BEA mycotoxins both when combining the discussed mycotoxins and in a single study . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC11597167 | This cleavage event generates a soluble fragment called β-C-terminal fragment (β-CTF), which is further processed by γ-secretase to produce Aβ peptides . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11687663 | In Bangladesh, the rhizome of A. helferiana was used in dysentery, infections, scabies, and muscular aches. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"Bangladesh",
",",
... |
PMC8711270 | In retroviral vector production, HEK293T is used due to the expression of the SV40 large T-antigen in the cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"... |
PMC11670407 | Statistical analysis of fluorescence intensity was performed using FlowJo V10 software (n = 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Statistical",
"analysis",
"of",
"fluorescence",
"intensity",... |
PMC11525028 | Cell viability was measured daily for four days following the manufacturer’s instructions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cell",
"viability",
"was",
"measured",
"daily",
"for",
"four",
"days",
... |
PMC11411131 | In addition to MeHg, electrophilic stress activates Nrf2-mediated transcription, which upregulates cellular defenses against toxicants. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"addition",
"to",
"MeHg",
",",
"electr... |
PMC11489351 | For these reasons, MCF10A cells are an ideal model of normal human epithelia to characterize the pHi-dependent transcriptome. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"these",
"reasons",
... |
PMC8973725 | The morbidity of RCC is rising by 2–4% each year . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"morbidity",
"of",
"RCC",
"is",
"rising",
"by",
"2–4",
"%",
"each",
"year... |
PMC11615218 | Age-related senescence involves telomere shortening, whereas premature senescence is telomere-independent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Age-related",
"senescence",
"involves",
"telomere",
"shortening",
",",
"whereas",
"premature",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.