PMCID string | Sentences string | ner list |
|---|---|---|
PMC11806182 | Differential miRNA expression was analyzed in plasma exosomes from 15 PCOS and 15 control samples. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Differential",
"miRNA",
"expression",
"was",
"analyzed",
"in",
... |
PMC9429973 | Baseline frailty was measured during two years prior to date of MPN diagnosis using either (i) the Johns Hopkins Adjusted Clinical Groups frailty indicator (ACG-F), categorized as fit or frail if any of the ten frailty-defining diagnoses were present or (ii) the McIsaac’s cumulative deficit frailty index (mFI), categorized as fit, prefrail, or frail if mFI <0.10, 0.10-0.19, > 0.19 respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Subsequently, the cohort of patients with a variant in 5’UTR in ANKRD26 gene was analyzed with respect to clinical symptoms. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Subsequently",
",",
... |
PMC9739791 | Cytotoxicity tests on 3D cellular cultures showed that Coumaplatin 14, but not oxaliplatin, accumulated in the necrotic regions of spheroids, which was shown by confocal microscopy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11477621 | Chemical shifts are given in ppm with the solvent as internal standard or TMS, if added. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Chemical",
"shifts",
"are",
"given",
"in",
... |
PMC11777207 | Twenty-five milligrams of IMQ cream (5%, Perrigo) was applied to shaved dorsal skin, and application was repeated for five total days as previously described (58). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11267036 | Evidence suggests that modulating EMT-related signal transduction can mitigate cholangiocarcinoma , and regulating the expression of EMT markers can inhibit colorectal cancer . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Evidence",
"... |
PMC11592837 | Control cells were incubated in equivalent concentrations of DMSO. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Control",
"cells",
"were",
"incubated",
"in",
"equivalent",
"concentrations",
"of",
"DMSO",
"."
]
}
] |
PMC11106977 | Previous studies have shown that O-GlcNAc modification of NF-kB positively regulates its gene transcription functions in different cell types [81–84]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Previous",
"... |
PMC11767582 | in dry THF (1.10 M), EtMgCl 2 M in THF (1.25 equiv.) | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"in",
"dry",
"THF",
"(",
"1.10",
"M",
... |
PMC11635519 | In contrast, activation of Gαi inhibits cAMP production, and activation of Gαq increases calcium (Ca) accumulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"contrast",
",",
... |
PMC9429973 | The median follow-up was 4 (95% CI: 3.6-4.6) years. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"median",
"follow-up",
"was",
"4",
"(",
"95",
"... |
PMC11495567 | Similarly, treatment of the cells with NSL-YHJ-2-46 showed significant increases in the phosphorylation of these proteins by 190 ± 0.5, 150 ± 0.6, and 120 ± 0.8%, respectively (Fig 4D–4I). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5308810 | Our studies also showed that SDF-1/CXCR4 axis is involved in EMT of various cancers including lung, pancreatic, hepatic, and ovarian cancers [44–46]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11434983 | To a sealed glass vial containing a freshly prepared solution of fac-[Tc(CO)3(H2O)3] (450 μL, 37–370 MBq, pH 6), 450 μL of an methanol solution of imQz (2 × 10 M) was added. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11682172 | The number of the various comparisons are displayed in Fig. 2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"number",
"of",
"the",
"various",
"comparisons",
"are",
"displayed",
"in",
"Fig... |
PMC5311252 | In analogy, it has been shown that a set of miRNAs that target immediate early genes responsible for cell cycle entry are rapidly downregulated in response to growth factor stimulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11762280 | PrimerSequences (5’ → 3’)Zbp1-m-FACCTTCTGAGCTATGACGGACAGACZbp1-m-RGGCGTTTGAATTGGCAATGGAGActin-m-FGGCTGTATTCCCCTCCATCGActin-m-RCCAGTTGGTAACAATGCCATGT Primer sequences in this study. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PrimerSequences",
"(",
"5",
"’",
"→",
"3’)Zbp1-m-FACCTTCTGAGCTATGACGGACAGACZbp1-m-RGGCGTTTGAATTGGCAATGGAGActi... |
PMC7452526 | The SEM analysis was further employed to investigate the size and morphology of the synthesized EC-AgNPs as depicted in Figure 2(a). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"SEM",... |
PMC11477621 | C NMR (150 MHz, CDCl3) δ 172.0, 120.6 × 2, 107.9 × 2, 49.5, 32.7, 31.3, 28.6, 26.3, 25.2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11680982 | Tumor growth curves and (D) tumor inhibition rates of HR/HER2-low tumor-bearing mice in various groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Tumor",
"growth",
"curves",
"and",
"(",
"D"... |
PMC9596868 | Next, we treated OVCAR3 cells with different concentrations of quercetin (15, 30, 60 and 90 µM) and MST-312 (1 and 2 µM) alone and in combination for 72 h. As shown in Fig. 2E and F, the combinatorial treatment led to significant increase in cytotoxicity as compared to the compounds alone. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10890307 | In this study, most tumor cells cultured in glucose-containing media had specific rates of lactate production (qP Lactate) that were 15% to 100% higher under neutral conditions as compared to those under acidic conditions; likewise, qP Lactate was also 15% to 80% higher under hypoxic conditions as compared to normoxic conditions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11087055 | The centers of the left-right rotating cell flow of the polonaise movements in the averaged vector field were identified by streamlines and measured the distance between them by using ImageJ. Statistical analyses were performed using two-tailed Student’s t tests, one-way ANOVA in R (Ver3.5.0) and Excel 2022 (Microsoft). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8633974 | A combined effect of gRNA was detected at MOI of 1 with F(4,25)=4.95, P=0.004, and partial η effect size of 0.44 (Two way ANOVA, error bars depict Standard Error of Mean) (d). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10778532 | The severity of VHL disease associated with VHL-C162F mutation is one of the most severe . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"severity",
"of",
"VHL",
"disease",
"associated",
"wi... |
PMC9429973 | All 6 pts who achieved transfusion-free status in ACTIVATE-T maintained the status in the LTE up to 21.9 mos (Figure 1b). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
... |
PMC6461034 | MS/MS spectra are acquired in the orbitrap with a resolution of 17,500 (at m/z 200) using an AGC target value of 2 × 10 charges and an underfill ratio of 0.1%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11502443 | Interpretation of these studies is complicated by the use of modified receptors and signalling proteins, which can affect pharmacology and signalling behaviour (Bonneterre et al., 2016). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6337547 | High activation of platelets is one of the major causes of thrombosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"High",
"activation",
"of",
"platelets",
"is",
"one",
"of",
"the",
"major",
... |
PMC9429973 | Clinical data accumulation is needed to elucidate iron metabolism and prognostic features in PV patients with HFE mutations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Clinical",
"data",
"accumulation",
"is",
... |
PMC10907726 | This focus has permitted us to uncover the modulatory effects of DATS on autophagic processes, positioning our findings as a crucial addition to the body of knowledge. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8711270 | Chen et al., demonstrated that stable producer cell lines can be rapidly generated by the transfection of a single DNA construct carrying all required lentiviral vector components, cutting down the time taken to generate and identify stable producing clones form 6 months in the LentiPro26 system (Tomás et al., 2018), to approximately 4 months (Chen et al., 2020). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9545474 | Chemosensitivity studies were undertaken using a 24‐hour MTT assay, with a 72‐hour recovery period. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Chemosensitivity",
"studies",
"were",
"undertaken",
"using",
"a",... |
PMC11672881 | The broader impact of CU on gene expression is reflected in the heatmap, with the CU-treated samples exhibiting more significant expression changes than the TQ-treated samples. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11742231 | To ensure the coefficients are easily comparable across different nodes, the SoftMax function is used to normalize them for all choices of j:3[12pt] $$ _ = softmax_ (e_) = )}} exp(e_)} $$αij=softmaxj(eij)=exp(eij)∑k∈Niexp(eik)where is the set of node i’s neighbors in the graph. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11543853 | Here we show that the treatment of cells with bafilomycin A1 leads to a 15-fold reduction in the odds of rhinovirus 2 genome release in the endosomes (Fig. 4ce). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The induction regimen was 3 + 7 for 42/52 (80.8%) patients, among those, 3 (5.8%) received midostaurin along with the 3 + 7. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11621493 | In cases where the acyl acceptor is a lipid, this mechanism enables transacylase reactions that catalyze the transfer of FAs between different lipid molecules (5). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11321678 | Knockdown of LHX2 in Group 3 MB cells resulted in decreased GABRG2 expression, whereas overexpression of LHX2 compensated for this decrease in GABRG2 (Figure S8D, Supporting Information). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11609529 | Transfections were carried out using Effectene Transfection Reagent (Qiagen) according to the manufacturer’s instructions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Transfections",
"were",
"carried",
"out",
"using"... |
PMC9429973 | Half of this group was classified as high risk according to the Sanz score, 44% as intermediate risk, and 6% as low risk. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5673955 | Cells were lysed in 10 mmol/L Tris‐HCl, pH 7.5, 1 mmol/L MgCl2, 1 mmol/L EGTA, 0.1 mmol/L PMSF, 5 mmol/L 2‐Mercaptoethanol, 0.5% CHAPS и 10% glycerol (all from Sigma‐Aldrich) and centrifuged 30 min at 12,000g. Supernatants were stored at −80°C. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9219615 | In addition, caspase-8 inactivity (Figure S3) and statistically significant caspase-3/7 activation (Figure 3b), reactive oxygen species accumulation (Figure 3c), and loss of mitochondrial integrity (Figure 3d) were observed by flow cytometry after Tpz-1 exposure and suggest the involvement of the intrinsic apoptotic pathway in compound-induced cell death. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11476004 | In some disease syndromes in humans, very high SCE frequencies are observed as a result of mutation of genes responsible for maintaining stability. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | In a large series of primary samples (9N - 20MGUS - 33SMM - 170MM - 24PPCL - 12SPCL) and 18 MM cell lines, through bioinformatic analysis of previously published datasets (GENE1.0_BAv20_Neri-Gutierrez), we found that myeloma progression was associated to increased expression of UFMYlation targets ENO-1, PGK1 and DLD. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"I-Cel... |
PMC10538569 | Therefore, we tested the effect of DEAE-dextran on cell-free HIV-1 infection versus iDC- or mDC-mediated trans-infection of HIV-1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"we",
"tested",
... |
PMC11721295 | Less well understood is the extrinsic effect of modulating oncogenic KRAS on the tumor microenvironment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Less",
"well",
"understood",
"is",
"the",
"extrinsic",
"eff... |
PMC11536589 | RNA interference (RNAi) was used to perform the gene knockdown in AsPC1-MR cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"RNA",
"interference",
"(",
"RNAi",
")",
"was",
"us... |
PMC9611901 | The highest level of DNA damage was observed after exposure to the leather sample processed with vegetable tanning (label VEG-T), followed by the synthetic tanning (label SYN-T), and two chrome tanning procedures (labels CHR-T1 and CHR-T2). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9503541 | The chemical profiles of the metabolites obtained from LC-MS/MS analysis of GE fractions were analyzed using the integration of the following metabolomic tools: MS-DIAL (v.4.60, RIKEN), a spectral deconvolution software program for MS data; MetaboAnalyst (v.5.0, https://www.metaboanalyst.ca/, accessed on 5 September 2022), a web-based software program for comprehensive metabolomics data analysis; GNPS (https://gnps.ucsd.edu/, accessed on 5 September 2022), a web-based library for MS/MS spectra; and Cytoscape (v.3.8.2), a software platform for visualizing molecular interaction networks. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11513011 | The rate of late apoptosis cells in KK-47 significantly increased by DIB compared to control even though the rate of early apoptosis cells on KK-47 halved). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | However, for patients who relapse and/or become refractory after exposure to PIs and IMiDs, selecting the next regimen remains a challenge. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However... |
PMC10366908 | Epidermal Growth Factor Receptor (EGFR) overexpression or its mutation mediates the sustaining proliferative signaling, which is an important hallmark of cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11740207 | Studying interactions between VSELSCs and their microenvironment can reveal how these cells adapt to different conditions, which is crucial for understanding the mechanisms behind leukemia and cancer treatment resistance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11679892 | The study was conducted between 6 June 2023, and 29 May 2024. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"study",
"was",
"conducted",
"between",
"6",
"June",
"2023",
",... |
PMC9429973 | A paired samples t-test was conducted for significance testing on overall average number of correct responses and for confidence rating, and a McNemar’s test was conducted at the question or learning objective level (5% significance level, P <.05). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11489351 | We also performed a pathway enrichment analysis on this subset of TFs with pH-dependent posttranslational activity and found enrichment of mechanosensitive and developmental pathways (Fig. 7C and Table S7). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10079526 | The interaction network visualizes fold change via node color as indicated in the scale bar (fold change of: 0.63–8.2) and significance indicated with node size. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11337594 | A representative density plot of Annexin V-FITC/PI staining is shown in Fig. 6B. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"representative",
"density",
"plot",
"of",
"Annexin",
"V-FITC/PI",... |
PMC11621565 | Rotenone was used as a positive control for α-synuclein overexpression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Rotenone",
"was",
"used",
"as",
"a",
"positive",
"control",
"for",
"α-synuclein",
"overexpressio... |
PMC11607321 | All the top five drugs, except Daraprim (Pyrimethamine) which was not included in the dataset as an anti-cancer drug, were found to be related to EMT in recent studies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11055323 | SS, SS18-SSX1. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"SS",
",",
"SS18-SSX1",
"."
]
}
] |
PMC11629192 | The Phase III clinical trials of OFA, ASCLEPIOS I/II, demonstrated that patients receiving OFA treatment had lower ARR than those on teriflunomide. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | Only 6 CNS relapses were observed without difference between IT and non-IT groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Only",
"6",
"CNS",
"relapses",
"were",
"observed",
"without",
"difference",... |
PMC11400680 | MaxIoU, maximum intersection over union; MeanIoU, mean intersection over union; mAP, mean average precision. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"MaxIoU",
",",
"maximum",
"interse... |
PMC9429973 | Summary/Conclusion: These evidence-based consensus recommendations strongly support the use of a TA in R/R CLL patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Summary/Conclusion",
":",
"These",
"evidence-based",
... |
PMC6379402 | Interestingly, they also contain uncharacterized genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
"they",
"also",
"contain",
"uncharacterized",
"genes",
"."
]
}
] |
PMC9341513 | A, top) Cartoon showing an in silico genome rearrangement where an IGH region is inserted into the GM12878 CCND1 locus, and the GM12878 (healthy) chromatin states are retained (i.e., the hg19_u266 reference genome is used). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10571053 | Similarly, 24 h after oral administration of the BCR-ABL inhibitor ponatinib, brain concentrations were 2.2-fold, 1.9-fold and 25.5-fold higher in mice deficient in Abcg2, Abcb1a/b, or Abcg2;Abcb1a/b, respectively, compared to wild-type controls. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11075223 | Twenty-five compounds with significant antimalarial activity were screened out from Cimicifuga spp. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Twenty-five",
"compounds",
"with",
"significant",
"antimalarial",
"activity",
"were",
... |
PMC11457557 | Platelets have a crucial role in CVD, and their contribution to the onset of cardiovascular problems is enhanced in DM . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Platelets",
"have",
... |
PMC10994876 | YAP is primarily recognized for its role in promoting unrestricted cell growth and proliferation during the progression of tumors (Han et al. 2020; Park et al. 2016). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10940855 | Ephrin B2 reverse signaling mediated by endothelial cells directly regulates multiple myeloma progression and treatment resistance, which can be overcome through targeted inhibition of ephrin B2 to abolish myeloma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | There were 27 adults and 4 children (p<0.0001). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"There",
"were",
"27",
"adults",
"and",
"4",
"children",
"(",
"p<0.0001",
")",
"."
]
... |
PMC11388384 | This insight provided a framework for understanding how evolution can act on molecular diffusion to diversify animal body plans. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"insight",
"provided",
"a"... |
PMC10040136 | And recombinant TGF-β2 has similar effects to CM. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"And",
"recombinant",
"TGF-β2",
"has",
"similar",
"effects",
"to",
"CM",
"."
]
}
] |
PMC6889484 | Average from two independent infections is indicated. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Average",
"from",
"two",
"independent",
"infections",
"is",
"indicated",
"."
]
}
] |
PMC9429973 | Cytogenetic abnormalities detected via karyotyping and/or FISH were present in 9 of 12 evaluated patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cytogenetic",
"abnormalities",
"detected",
"via",
"karyotyping",
... |
PMC9509578 | The titanium carbide 2D nanomaterials also revealed excellent biocompatibility in a murine model, enhanced intracellular accumulation of cisplatin and suppression of tumor growth . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC5925824 | Data are representative of three independent experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"are",
"representative",
"of",
"three",
"independent",
"experiments",
"."
]
}
] |
PMC11770130 | As it has been reported that CERT was correlated to the abundance of C16 ceramide and its specificity for the length of acyl chain is still unresolved, it was unlikely to directly contribute to the effects of the NTS-NTSR2 signaling in the current context. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7090062 | P < 0.001. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"P",
"<",
"0.001",
"."
]
}
] |
PMC6222635 | D1–D6 exhibited no significant anti-proliferation activity in HeLa cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"D1–D6",
"exhibited",
"no",
"significant",
"anti-proliferation",
"activity",
"in",
"HeLa",
"cells",
... |
PMC11489351 | A, glycolytic pathway genes with transcripts that were upregulated (magenta) or downregulated (cyan) at low pHi (EIPA, left) or high pHi (NH4Cl, right) compared to the control (MetaCore pathway analysis; see Methods). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11422150 | The purpose was to expand the range of clinical indications, and therefore, the SCI model was also designed to avoid complete spinal cord amputation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC9964654 | bisdithiolate complexes have been reported as potential antimicrobial and antitumoral agents. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"bisdithiolate",
"complexes",
"have",
"been",
"reported",
"as",
"potential",
"antimicrobial",
... |
PMC11637284 | The evidence for this comes from the observation that the TAC is dispensable for normal growth of the L262P bloodstream form cell line, which due to a mutation in the γ-subunit of the ATP synthase, can grow in the absence of the kDNA . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11422150 | The fluorescent-labeled cells were analyzed by LSRFortessa X-20 (BD Biosciences) and BD FACSDiva software (BD Biosciences). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"fluorescent-labeled",
... |
PMC11683240 | Notably, the drug fondaparinux binds to antithrombin, enhancing its inhibition of factor Xa by 300-fold (34). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Notably",
",",
"the",
... |
PMC11352311 | Molecular docking results identified GAPDH as the most central target of esculin’s action on RCC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Molecular",
"docking",
"results",
"identified",
"GAPDH",
... |
PMC4816271 | T cells transduced with an anti-CD19 CAR were included as a further control for non-specific CAR-meditated cytotoxicity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"T",
"cells",
"transduced",
"with",
"an",
"a... |
PMC11721096 | The methanal extract of C. arabica (9 g) was fractionated with petroleum ether, which was then subjected to silica gel column chromatography (100–200 mesh), eluted with petroleum ether-ethyl acetate (200:1 to 50:1) to obtain the active fraction (3.5 g), as indexed by the ligand fishing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11656657 | Nevertheless, the identification of suitable antigens to target tumor cells is a crucial and challenging step in the successful development of CAR T-cell therapy for sarcomas. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | After a median follow-up of 26 months (range 3-72 months), 54 patients (82%) are alive and 12 (18%) died. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11687663 | The current research provides the evidence of presence of 17 phytoconstituents such as Vicenin 1, Violanthin, Schafroside, Coumarin, Quercetin, Angiopteroside, Corosolic acid, etc in A. helferiana extract. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8348645 | The standard acarbose has shown inhibition of α-amylase with an IC50 value of 2.288 µg/mL. Thus, W. somnifera shows high α-amylase activity compared to V. vinifera. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9813422 | Prior to the first round of EBV genome replication, the incoming EBV DNA rapidly circularizes and acquires nucleosomes in the infected cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Prior",... |
PMC2614415 | Triangles – cells treated with increasing concentrations of VE-465. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Triangles",
"–",
"cells",
"treated",
"with",
"increasing",
"concentrations",
"of",
"VE-465",
"."
]
}
... |
PMC11413393 | d Western blot analysis of H4R3me2a changes in acid histone extractions of 786-0 and RCC243 following MS023 treatment for indicated period of time. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.