Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
 Community
1
PMCID
string
Sentences
string
ner
list
PMC11792888
Accordingly, the ratio of Bax/Bcl-2 proteins was similar in untreated and scorpion venom-treated cells (Figure 5 F ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Accordingly", ",", "the", ...
PMC11476004
The aim of the study was to identify chromosome damage using the sister chromatid exchange assay and DNA fragmentation by the comet assay in dogs with cancer, as well as to determine the suitability of these techniques for assessing chromatin stability in healthy and sick dogs (with squamous cell carcinoma).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11473750
sgRNA1: AATCATTTTGCAGACCAACC; sgRNA2: TATCTGCCTATATGACCCCT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "sgRNA1", ":", "AATCATTTTGCAGACCAACC", ";", "sgRNA2", ":", "TATCTGCCTATATGACCCCT", "." ] } ]
PMC5311252
Plates were then left to dry at room temperature in normal air before pictures were taken.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Plates", "were", "then", "left", "to", "dry", "a...
PMC9429973
Most ever-transfused pts had received chelation therapy (18/20 [90.0%] adults, 28/29 [96.6%] pediatrics).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Most", "ever...
PMC11012012
The potential hematological toxicity of anti-SLAMF2/CD48 mAb should therefore be very carefully tested at the pre-clinical stage .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "potential", "hematological", "toxicity", "...
PMC11190238
Both models employed the Hi-C technique to interrogate the 3D genome organization.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "models", "employed", "the", "Hi-C", "technique", "to", "interrogate", "t...
PMC9429973
40 patients that did not require systemic treatment and 68 that did not have a PETINT evaluation were excluded.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "40", "patients", "that", "did", ...
PMC10578720
Liver macrophages were isolated from liver tissues (~purity: 89.7% assessed by flow cytometry; Figure 6C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Liver", "macrophages", "were...
PMC11545737
The authors of this study found that the lipid A in Neisseria OMVs is modified by phosphoethanolamine which masks phosphates important for caspase-11 recognition .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC7342409
The KIT phosphorylation level (p-kit/Kit) in the GIST882 imatinib-resistant group was lower than in the GIST882 group, but there was no significant difference (p>0.05).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9822769
In each experiment, cells were challenged with drug candidates at different concentrations, and the final data were calculated from at least three replicates of the same experiment performed in triplicate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11286266
Post immunoprecipitation using GFP-Trap Agarose, proteins were eluted by incubation with an excess of TEV protease (UK759, 16 μg) in 400 μl TEV cleavage buffer [(25 mM Tris–HCl pH 7.4, 150 mM NaCl, 0.05% NP-40, 0.05 mM CaCl2, 0.05 mM tris(2-carboxyethyl)phosphine (TCEP))] for 16 hr at 4°C with orbital rotation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11021472
Infection of BL cells with lentiviral vectors containing the miR-150 precursor sequence revealed a prominent induction of miR-150 levels in both BL cell lines (Fig. 1A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11541409
George, S., et al., A Phase I, Multicenter, Open-Label, First-in-Human Study of DS-6157a in Patients with Advanced Gastrointestinal Stromal Tumor.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11591052
In line with elevated glycolysis, we observed a 20E-dependent increase in glucose uptake, which was also reported by Chen and co-authors in Hep2G hepatoma cell lines .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLin...
PMC10818062
PS is synthesized by PTDSS1 from PC in the ER and transported to the PM by ORP5 and ORP8 via ER-PM contact sites in exchange for PI4P, which is dephosphorylated to PI by Sac1 at the ER.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11694346
Notably, the highest fluorescence intensity was achieved at a DMSO/PBS ratio of 9 : 1 (v/v).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "the", "highest", ...
PMC11420784
Cells attached to coverslips were fixed with paraformaldehyde and permeabilized, and then incubated with the primary antibodies anti-LC3, human NDP52, SQSTM1/p62, or LAMP-1 and fluorophore-conjugated secondary antibodies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10858941
As a result, HIF-1α is translocated to the nucleus where it binds HIF-1β to transcribe a myriad of genes involved in adaptation to hypoxia and cancer progression .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11746948
After sonication and centrifugation, the total protein concentration was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11699465
Using three-dimensional (3D) reconstructions by confocal microscopy, the nuclear localization of TMEM199 was exhibited (Figure 2C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "three-dimensio...
PMC9429973
Aims: To investigate the feasibility of a one-on-one peer support intervention in family caregivers of newly diagnosed hematologic patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "To", "inv...
PMC11321678
The CCAN spans over 50K genomic region and there are dozens of distal ATAC peaks linked to the GRIK3 promoter.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "CCAN", "sp...
PMC9429973
Results: The FLT3ITD/DNMT3A/NPM1c, DNMT3A/FLT3 and FLT3/NPM1 displayed a fully penetrant leukemic phenotype.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "The", "FLT3ITD/DNMT3A/NPM1c", ",", "DNMT3A/FLT3", "and...
PMC11269933
Further measurements of phosphorylation and expression levels in key kinases and regulatory factors of the classical MAPK pathway showed that C. angulata demonstrated a stronger activation pattern in classical MAPK pathway than C. gigas during heat stress and under increased wild environmental temperature, as evidenced by higher phosphorylation levels of CgERK1/2 at T187 and Y189 and CgMAP2K1/2 at S238 (corresponding to HmMAP2K1 S217), the protein content of MAP3K1, and the expression levels of CgBraf and CgMras.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10452486
Evidently, inflammation-induced oxidative stress to tissues may have released proteins containing di-tyrosine into circulation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Evidently", ",", "inflammation-induced", "oxidative", "stress", "...
PMC2193049
In an attempt to identify antigenic peptides, a series of 9-mer peptide sequences derived from the MAGE-3 protein and carrying anchor residues for HLA-A*0201 were chemically synthesized and tested for binding to HLA-A*0201.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10142392
The PCL-b-PS arm polymers, which have an A2B2 structure emerging from a pentaerythritol core, have shown lower thermal transition temperatures and lower crystallinity than linear AB analogues, demonstrating that the characteristics of PCL can be changed depending on the architecture in which it is introduced .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10125312
Statistical comparisons were made using Tukey/Wilcox post hoc tests. *
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "comparisons", "were", "made", "using", "Tukey/Wilcox", "post", "hoc", "tests", "....
PMC9429973
Aims: To study the variety of SARS-CoV-2 variants infecting employees during the outbreak and to reveal possible transmission routes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "To", "stu...
PMC5854676
Comparison of experimental and modelled cellular viability loss with its mathematical.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Comparison", "of", "experimental", "and", "modelled", "cellular", "viability", "loss", "wit...
PMC10823017
The Caki-1 cells are epithelial cells with adherent properties.
[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Caki-1", "cells", "are", "epithelial", "cells", "with", "adherent", "properties", "." ]...
PMC10813895
Progesterone plays a role in mammary gland differentiation through RankL-mediated induction of ELF5 in luminal progenitors .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Progesterone", "plays", "a", "role", "in", "mammary", ...
PMC11634027
The levels and localization of Ds appear like those of wild-type protein, and PCP is only mildly affected, but the increased wing size and elevated membrane Dachs levels indicate that Ds activity is compromised.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11696576
The MD simulation further supported strong interaction between Arg200 and the carboxyl group showing very high occupancy of hydrogen bonds for the entire 200 ns MD simulation (128% in total of side chain NH) (Fig. 4b and Movie S2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9454178
Next, we searched the gene expression profile in the Oncomine database and MediSapiens IST Online transcriptome database.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Next", ",", "we", "searched", "the", ...
PMC11772585
Importantly, dot blot results confirmed a significant increase in m7G methylation levels in total RNA and decapped mRNA of the cSCC cell lines (Fig. 1F).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11297139
c Left: a tornado plot illustrating published A673 EWS/FLI1 ChIP-seq signal on the upregulated cREs connecting to ARID1A LLPS-dependent upregulated genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "c", "Left", ...
PMC11332076
Quantification of ERK and AKT activation by F-iIR and F-iIGF1R.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Quantification", "of", "ERK", "and", "AKT", "activation", "by", "F-iIR", "and", "F-iIGF1R", ...
PMC6627640
Cells were frozen within 1 month of purchase and used within 2 months of resuscitation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "frozen", "within", "1", "month", "of", ...
PMC11119602
Wide differences in its effectiveness also stem from the variety of clinical approaches used for drug delivery .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Wide", "differences", "in", "its", "effectiveness...
PMC11506670
These RAS isoforms are also preferentially mutated in specific tumor types .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "RAS", "isoforms", "are", "also", "preferentially", "mutated", "in", "specific", ...
PMC11092382
-Mazz.
[ { "tags": [ "O", "O" ], "tokens": [ "-Mazz", "." ] } ]
PMC9118379
MSPIP and MSPBPI were used to generate simulated spectra based on variant peptide sequence and charge state.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MSPIP", "and", "MSPBPI", "were", "used", "t...
PMC11772585
Denaturation of the RNA was achieved by heating at 95 °C for 5 min, and 1 µl of each concentration was then applied onto a nitrocellulose membrane.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11155445
The short bond length of the C–N bond indicated the presence of strong delocalization in the acyl thiourea moiety of the molecule.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11502443
We also observed differences between the pharmacology of the GIP receptor variants with endogenous peptides, which may help to explain differences in phenotype.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11612508
The relatively narrow and high peak shape suggests that the crystals have fully grown and crystallization is complete.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relatively", "narrow", "and", "...
PMC9587298
ESI-MS spectra of flavonol standards identified by ESI-MS as [M−H]: before the trapping experiment: (a) quercetin; (b) quercetin-3-glucoside; (c) quercetin-3-rutinoside as well as the formation of mono-methylglyoxal (MGO) adduct of (d) quercetin-3-glucoside and (e) quercetin-3-rutinoside and formation of di-MGO adducts of (f) quercetin-3-glucoside and of (g) quercetin-3-rutinoside after the trapping experiment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10777969
The cells were passed every 2–3 days at 80% confluence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "passed", "every", "2–3", "days", "at", "80", "%", "conf...
PMC5363531
Expression and localization of TS and both total and activated (phospho Tyr 419, pSRC) SRC baseline levels were investigated in untreated MPM cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11765988
The rise of antiretroviral therapy has decreased the number of cases caused by the virus .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "rise", "of", "antiretroviral", "therapy", "has", "de...
PMC11628904
We found that larvae burned in control medium were effective in clearing C. albicans from the wound region by 72 hpb, with neutrophils and macrophages resolving after an initial peak at 24 hpb (Figure 3D–G).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11643361
The peculiar name of the ligands is due to the similarity between their metal-coordinating geometry and the way in which scorpions attack their prey with pincers and sting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9516447
GRP78 deficiency has been shown to suppress PI3K, AKT, TGF-β and CD44 signaling among many other signaling pathways, as well as EGFR expression, in various human cancer cell lines and cancer mouse models .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Methods: In this study, patients with lower-risk MDS(N=15), higher-risk MDS(N=15) and de novo acute myeloid leukaemia(AML)(N=15) and healthy donors(HDs)(N=15) were enrolled.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9672323
Consistent with these data, we observed decreased LDH activity in U-87 MG cells after treatment with piroxicam.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Consistent", "with", "these", ...
PMC9684669
An illustration of terfenadine function in combinational treatment with doxorubicin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "An", "illustration", "of", "terfenadine", "function", "in", "combinational", "treatment", "with", ...
PMC11381192
Correlation of TIDE score with CSI values. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "of", "TIDE", "score", "with", "CSI", "values", ".", "(" ] } ]
PMC9429973
D. Song, C. Song, Z. Ge Department of Hematology, Zhongda Hospital，Medical School of Southeast University, Institute of Hematology Southeast University, Nanjing, China; Hershey Medical Center, Pennsylvania State University Medical College, Hershey; Division of Hematology, The Ohio State University Wexner Medical Center, the James Cancer Hospital, Columbus, United States of America Background: Chidamide, an oral histone deacetylase (HDAC) inhibitor of the benzamide class that selectively inhibits HDAC1, 2, 3, and 10, is currently used for patients with peripheral T-cell lymphoma.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Image: Summary/Conclusion: There are few studies in MDS where QoL is the primary outcome, hence the paucity of evidence around best practice when prioritising this.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11489351
Hereafter, we refer to this collection of TFs as TFs with pH-dependent posttranslational activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hereafter", ",", "we", "refer", "to", "this", "collection",...
PMC11767817
To detect the J-aggregate form of JC-1, an excitation wavelength of 535 nm and an emission wavelength of 590 nm were used.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", ...
PMC11548041
HL-60 cells were grown in Iscove’s modified Dulbecco’s medium (Gibco, Billings, MT, USA) supplemented with 20% FBS.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ],...
PMC7823217
All of these will lead to precision medicine and better outcomes for the patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "of", "these", "will", "lead", "to", "precision", "medicin...
PMC11707577
Toluidine‐blue staining of tentacles showing the nematocytes organized in battery cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Toluidine‐blue", "staining", "of", "tentacles", "showing", "the", "nematocytes", "organized", ...
PMC10813895
Therefore, age-associated ELF5 downregulation may be correlated with progesterone levels.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "age-associated", "ELF5", "downregulation", "may", "be", "correlated", "wi...
PMC11604015
The antigen escape can still be divided into malignant cell gene mutations, promoter hypermethylation, and alternative splicing, which may occur during CAR-T cell surveillance .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5415764
After being seeded in a 96-well plate for 24 h, A2780/PTX cells (5.0 × 10 cells/well) were treated with various samples as mentioned above.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10582049
The role of these cytokines is controversial, and it is not clear how exactly they affect the tumor microenvironment of LUADs, especially at early stages.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11773391
Another study showed that TGF‐β1 decreased miR‐198 levels and increased MGMT accumulation to confer TMZ resistance .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Another", "study", "showed", "that", "TGF‐β1", "decrea...
PMC10873328
The blots have been cropped to improve the conciseness and clarity of the display.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "blots", "have", "been", "cropped", "to", "improve", "the"...
PMC11787381
These antibodies were revealed with Alexa Fluor 488 goat anti mouse IgG and Alexa Fluor 568 goat anti-rabbit IgG at the dilution 1/400 in PBS containing 1% FCS, 0.1% saponin, for 1 h at room temperature.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11791264
Conversely, the accumulation of LC3B-II and attenuation of p62 in response to Baf A1 were detected in SETD7 KD A2780 cells (Fig. 4B), suggesting that SETD7 blocks the autophagic flux.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", ...
PMC11306019
On day 4, an additional 5 mL of the drug-containing medium was added to the dishes, followed by a continued incubation for 4 days.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11063646
Confocal imaging had shown a significant time-dependent increase in in-vivo cellular uptake with enhanced, progressive penetration of the emulgel into the skin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Confoca...
PMC9429973
Oversight is provided by the Steering Committee of clinicians, data scientists, myeloma patients and Myeloma UK with patient involvement at every step.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC8735881
After posttransfection 20 h, the culture medium was replaced with fresh complete DMEM containing 10% FBS and cells were cultured for an additional 24 h. Then, the virus-containing supernatants were harvested and centrifuged at 4000 rpm and 4 °C for 15 min, followed by filtration through a 0.45-μm filter.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6617630
We also identified a unique group with no MYC rearrangements and BCL2 and BCL6 translocations (BCL2/BCL6) in OCILy3 and OCILY19 cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O" ], ...
PMC10728200
Significance denoted by: ns not significant, *P < 0.05, **P < 0.01, and ***P < 0.001.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC8557138
The advantages and disadvantages of various existing in vivo, in vitro, and ex vivo angiogenic models are summarized in Table 1.Recent advances in constructing vascular 3D models include (a) Tissue-engineered vascular models which utilize terminally differentiated endothelial cells or progenitor endothelial cells; (b) organoid models using endothelial progenitor cells; and (c) organ-on-chips that employ both terminally differentiated and endothelial progenitor cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Both genes are likely to play an important role in the pathogenesis of AML.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "genes", "are", "likely", "to", "play", "an", "important"...
PMC9429973
Frequent (≥10% incidence) Grade ≥3 treatment emergent adverse events were neutrophil count decreased (n=7 [15.6%]) and platelet count decreased (n=7 [15.6%]); the only SAE with a ≥10% incidence was pneumonia (n=5 [11.1%]).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11604830
Finally, the potential for a wide coverage area allows for the evaluation of the signal, and therefore the molecule of interest, in heterogeneous samples, such as living organisms.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7294030
The membrane was blocked and probed with primary antibody agents EGFR, pp38, Cyclin D, Cdk-4, Bax, Bcl-2, cleaved caspase-3 and β-actin, and then incubated with horseradish peroxidase-conjugated secondary antibody.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5916734
The procoagulant activity of FIX was determined by activated partial thromboplastin time (APTT) assay using a Factor IX assay (Renam, Russia).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC6948907
It should be noted that histone deacetylases are well characterized cellular oncogenes and an aberrant recruitment of these enzymes leading to tumorigenesis (Barneda-Zahonero et al., 2012; Song et al., 2000).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Assessment of normal B-cell subsets during ibrutinib-based treatment demonstrated a mix of naïve and memory B-cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Assessment", "of", "normal", "B-cell", "subsets", "dur...
PMC10812665
They were identified by STR typing and shown to have an intact chromosomal structure and ploidy by whole genome sequencing .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "were", "identified",...
PMC11762280
The statistic of average optical densities of MPO, MMP9, F4/80 positive staining were analyzed (n = 8).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "statistic", "of", ...
PMC10777969
The conjugate N-adducts of thio-1,3,4-diazole and 2-thiazoline with levoglucosenone were synthesized via a stereoselective, base-catalyzed conjugate N-Michael addition to levoglucosenone at C-4.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC6222635
The monosaccharide analysis graph is shown in Figure 2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "monosaccharide", "analysis", "graph", "is", "shown", "in", "Figure", "2", "." ] } ]
PMC11612508
In this context, MTT assay was employed to assess the cytotoxic effects of magnetic microspheres on T98, A172, and fibroblast L929 cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "B-CellLine", "O"...
PMC11711063
Low‐resolution microscopic cross‐section of hematoxylin‐stained xenograft of MDA‐MB‐231 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Low‐resolution", "microscopic", "cross‐section", "of", "hematoxylin‐stained", "xenograft", "of", "MDA‐MB‐231",...
PMC7351993
Then, the mask was used to extract morphological features of the event including area and shape as well as intensity information including the average, maximum, and standard deviation of the decomposed images.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11682172
Finally, intensity scores are based on the mean grey value per ROI’s and total area intensity ratio of each specific IHC coronin-1A staining.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11543853
The cells were harvested 1, 7, and 9 h post-infection.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "harvested", "1", ",", "7", ",", "and", "9", ...
PMC11429241
SMAD3 is involved in TGF-β signaling, which regulates extracellular matrix production and the EMT .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SMAD3", "is", "involved", "in", "TGF-β", "signaling", ",", ...
PMC11473750
This supports an important role for RNF121 in MYCN oncogenesis and potentially explains the observation that the two events of MYCN amplification and 11q deletion are mutually exclusive.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...