Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC9429973
For disease stage, 32 (52.4%) were prefibrotic, but 29(47.5%) were fibrotic.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "disease", "stage", ",", "32", ...
PMC11718109
High magnification of an axon from the boxed area is shown in (B’).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "High", "magnification", "of", "an", "axon", "from", ...
PMC11297139
Photomicrographs of the spheroid growth were captured at each day until day 4 using JuLI Stage Real-time live-cell imaging system (NanoEntek; http://www.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC8584319
Dysregulation in the upstream kinase rat sarcoma (Ras) may contribute to ERK-mediated oncogenesis .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dysregulation", "in", "the", "upstream", "kinase", "rat", "...
PMC7348793
We established that COS-7 cells are heteroplasmic with at least two variants being present: with four and five repeat units.
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "establis...
PMC11700523
For the multiple comparisons, Tukey’s honestly significant difference was utilized as the post hoc analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "multiple", "comparisons", ",", ...
PMC10919056
p < 0.05, **p < 0.001, ***p < 0.01). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p", "<", "0.05", ",", "*", "*", ...
PMC9429973
There have been conflicting reports in the literature on its expression’s frequencies in AML and whether it may impact treatment response and survival.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC5386478
In this study, we measured TG2 expression and enzymatic activity in MPM cell lines in the adaptation to the hypoxic environment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this",...
PMC11126803
An approximately 3kb promoter of ZEB1 (ENST00000361642) was cloned into the PGL3 basic vector (Promega).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "An", "approximately", "3", ...
PMC10547921
Despite the recent advancements in immunotherapy and cell therapies, chemotherapy remains to be the most used strategy in cancer treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "the", ...
PMC11768927
The treatment also improved T cell effector functions and increased IFNγ production, highlighting the potential of targeting IFN-I signaling to potentiate oncolytic virotherapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC3734024
Despite this, relatively little is known about FasL B cells in comparison to IL-10-producing B cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "this", ",", "relatively", "little", ...
PMC11792740
For example, disrupting the MondoA-TXNIP axis or adjusting the CXCR3 axis can enhance T-cell metabolism and infiltration, respectively, thereby improving the efficacy of immune checkpoint inhibitors like anti-PD1 therapies .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11590870
The main reason for this is that the product of their degradation is amino acids that cells can use as nutrients .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "main", "re...
PMC9429973
Of 30 pts with PD events (occurring between 16 and 53 mos after start of treatment), 22 (73%) had baseline mutations in genes of interest and 27 (90%) had ≥1 baseline genomic risk feature.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7759933
The HepG2 spheroids were formed by the forced floating method and cultured under static conditions for several days.
[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "HepG2", "spheroids", "were",...
PMC9429973
We also noted that, in the subgroup of patients tested also at the hospitalization and at the discharge, no initially positive patient became negative after the transplantation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6222726
B. simaruba or “gumbo-limbo” (Bursera simaruba var.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B.", "simaruba", "or", "“", "gumbo-limbo", "”", "(", "Bursera", "simaruba", "var", "." ...
PMC11409031
The proportion of 8 cell types between the OV sample group and the normal sample group. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "proportion", "of", "8", "cell", "typ...
PMC11747885
Differences in cell morphology were also observed using light microscopy for treated cells with compound 1, 26 and 47, displaying poor adherence and cell shrinkage, which are characteristics of menadione induced cell death previously noted in the Rlig1-deficient HEK293 cell line (Fig. 4B and S7B†).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8164677
Cytotoxic Activity in Terms of Inhibitory Concentration (IC50) and Resistance Factor (RF) of Cisplatin and Wedelolactone (A) Illustrates IC50 (n=7) values while (B) illustrates RF values. ###
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11770746
All in vivo behavioral studies were carried out at The Hebrew University of Jerusalem (HUJI) in accordance with Responsible Care and Use of Laboratory Animals (RCULA) guidelines via two approved Institutional Animal Care & Use Committee (IACUC) protocol.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9268620
Using a transmission electron microscopy technique, the control (untreated) cells were viewed to have different, irregular shapes and sizes, as shown in Figure 10.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11802855
The emergence of osteolytic lesions and the consequent occurrence of pathological fractures represent one of the crucial factors affecting the quality of life and prognosis of patients with myeloma.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11718031
Therefore, these feeds may be suitable for mAb production requiring lower galactosylation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "these", "feeds", "may", "be", "suitable", "for", "m...
PMC9268620
The World Health Organization (WHO) estimated that at least 80 percent of the world’s population relies mainly, if not totally, on natural medicines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11746948
The next day, the cells were treated with 2-BP for 24 h, followed by RSL3 to induce ferroptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "next", "day", "...
PMC9844987
Weighted average cross correlations were calculated either across all promoters (A,B) or separately for promoter groups split based on their minimum correlation between contained decomposed promoter pairs (high Pearson’s correlation >0.39: top panel, low Pearson’s correlation ≤ 0.39: bottom panel) (C,D). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9436459
The acetyl protected diene S28 was obtained over four steps by the Horner-Wadsworth-Emmons reaction of S25 with S26 followed by deprotection of the silyl protecting groups and reprotection with acetyl groups, and then via the Suzuki–Miyaura reaction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
The frequency of DEL or DHL were higher in patients who received IV-MTX (41.1%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "frequency", "of", "DEL", "or", "DHL"...
PMC11271278
Vice versa, MYC also has most of the enhancer activity contributed in trans from other chromosomal regions on the same ecDNA (Fig. 4G–I).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7022782
As argued below, TEM analysis showed spherical systems, indicating that the loading process did not change the shape of NPs compared to the unloaded NPs previously described .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11680982
Targeted genes were stably knocked down via lentivirus-delivered short-hairpin RNA (shRNA) delivery.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Targeted", "genes", "were", "stably", "knocked", "down", "via", ...
PMC11774112
miRNA 34a was diluted with diethyl pyrocarbonate (DEPC) water and blank-PHRD or PHRD/DTIC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "miRNA", "34a", "was", "diluted", "with", "diethyl", "pyroca...
PMC11615828
Schematic representation of rapidly halting intraflagellar transport (IFT) in the primary cilium.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Schematic", "representation", "of", "rapidly", "halting", "intraflagellar", ...
PMC11594641
Three RAB27A-targeted sgRNAs (ATATTTCTCTGCGAGTGCTA, GTTCCATTCGCTTCATTATC, GCGTTCTTCAGAGATGCTAT), three sgRNAs targeting RAB27B (TGACTTCCCTCTGATCTGGT, TATAGTATTAATTGGCAACA, TTGCCAATTAATACTATATC), positive control (sgRNA targeting human PPIB gene—GGTGTATTTTGACCTACGAAT), and negative control (sgRNA not targeting human genome—CAAAACAGCATAGCTCTAAAAC) were resuspended according to the manufacturer’s protocol in 10 mM Tris-HCl buffer at pH 7.4 and stored in aliquots at −20 °C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11471157
Fig. 2 Morphology of various cell spheroids with or without DFP Phase contrast microscopy revealed that HaCaT cells, NIH/3T3 cells and CAF cells initiate cell spheroid formation from Day 1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "...
PMC9250505
A significantly decreased level of KI67 and increased levels of cleaved CASP7 were observed in CAOV2 cells after treatment with NPB.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "significa...
PMC11714165
Next, we examined the impact of NBD‐F on the p65 phosphorylation and IκBα in RANKL‐stimulated bone marrow‐derived macrophage (BMM) cells by treating them with the peptide for 24 h. Compared to the PBS group, NBD‐F successfully reduced the phosphorylation of p65 and IκBα, while the NBD peptide and TAT‐NBD (NBD‐T) showed limited biofunctions (Figure 3B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Patients who experience worsening wAIHA (defined as a ≥1-g/dL decrease in Hgb from prior assessment or development of new or worsening symptoms) can use rescue therapy (new or increased dose of corticosteroids, transfusions, intravenous immunoglobulin, or epoetin alfa); those who continue on rescue therapy after Week 6 will be considered nonresponders in the primary efficacy analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Statistical differences were analyzed using the Mann-Whitney test with a significance level of p<0.05.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "differences", "were", "analyzed", "using", "the", "Mann...
PMC11471176
Zuo et al. eloquently showcase the specific upregulation of ACE2 within drug-resistant breast cancer cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Zuo", "et", "al.", "eloquently", "showcase", "the", "specif...
PMC11269792
To investigate circAPP/miR-6838-5p/CDV3 affecting GIST biological behavior, this study co-transfected pcDNA 3.1-circAPP and si-CDV3 into GIST-882 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "To", "investigate", ...
PMC10582828
As new evidence continues to emerge, our understanding of the origin of SARS-CoV-2 will continue to evolve.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "new", "evidence", "continues", "...
PMC11307990
Jayapal et al. used chitosan nanoparticles formed by cross-linking chitosan with sodium tripolyphosphate cross-linker to load SUN.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Jayapal", "et", "al.", "used", "chitosan", ...
PMC7987994
Cytotoxicity of the extracts was depicted as a percentage of metabolic activity of the control, i.e., as relative metabolic activity (RMA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11794847
For RNA sequencing data, differentially expressed genes were identified using the DESeq2 package with a false discovery rate (FDR) adjusted p-value < 0.05 as the threshold.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11592008
However, a UVB dose-dependent decrease in unprocessed IL-1β levels was detected only in the lysates of PKs but not in the lysates of HaSKpw cells (Figure 2A,C), in accordance with the lack of activated caspase-1 in the supernatant of irradiated HaSKpw and the low endogenous caspase-1 expression in this cell line (Figure 1F and Figure 2C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "B-CellLine", "...
PMC11247842
Recent gene editing techniques may offer a way to test the functional effects of candidate variants to further confirm effects at the cellular or animal level.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10547921
To demonstrate the possible benefits of the dual-payloads drug ADC, Levengood et al. prepared a class of ADCs containing two different tubulin polymerization inhibitors in 2017.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9024365
These data indicate mutually dependent clustering of SD4 and AMPAR subunits both in COS cells and primary hippocampal neurons, suggesting a mechanism for increased synaptic strength during chemical LTP.Neurons form precise connections known as synapses that are necessary for cell–cell communication.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
The caregiver’s burden level was assessed by Zarit Burden Interview-22 (ZBI-22).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "caregiver", "’s", "burden", "level", "was", "assessed", "...
PMC5035325
Pulmonary metastases were measured as lung weight on both lung metastasis models: 3LL-model (c) and 4T1-model (g).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O" ], "tokens": [ "...
PMC9429973
The most recurrently somatic mutated genes were RUNX1 (5 variants) and TP53 (4 variants).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "most", "recurrently", "somatic", ...
PMC11422150
First, BMS and BBB tests were conducted according to our protocol (Figure 1A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "First", ",", "BMS", "and", "BBB", "tests", "were...
PMC11714165
Confocal image of the DN‐F nanoparticles after 1‐hour incubation in culture medium.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Confocal", "image", "of", "the", "DN‐F", "nanoparticles", "after", "1‐hour", "in...
PMC11575040
In this process, lncRNAs with differential expression in melanoma cells were filtered at a fold change of ≥ 2 or < 0.5.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", ...
PMC11243198
GANT61 analogs in 100% DMSO were then added to the cell plates in a 10-point 2-fold dose–response format, and normalization performed using a D300 digital dispenser (HP).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8170755
Finally, the absorbance of the released pNA was measured at 405 nm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "the", "absorbance", "of", "the", "released", "pNA", "...
PMC9684669
This type of protein instability may cause aggregation and degradation of target proteins in cells, resulting in further protein reduction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "type", "o...
PMC11413393
Additionally, since MS023 shows high potency against PRMT1 activity, the type I enzyme solely responsible for the histone mark H4R3me2a, we also used this post translational modification (PTM) as a proxy for PRMT1 inhibition.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11585254
The adjusted P values are shown. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "adjusted", "P", "values", "are", "shown", ".", "(" ] } ]
PMC8010066
Inconsistent with the MIC results, carbapenems' inhibition zone increased more significantly for pathogenic strains than the MDR strain.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Inconsistent", "with", "the"...
PMC9429973
Results: Despite the mice without treatment developing severe GVHD after transplantation, guanosine and deoxyguanosine were hardly detected in the plasma, suggesting that purine nucleosides released from damaged tissues were rapidly degraded by PNP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9874064
On the other hand, the released C527 could further inhibit the USP1 protein activity, degrade ID1 protein, and inhibit the HR of tumor cells, thereby promoting the DNA damage, and increasing the anti-tumor effect of cisplatin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Low-grade gastrointestinal TEAEs and respiratory infections in Arm 3 and 2 were observed but rarely a reason for treatment discontinuation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Low-grade", "gastrointestinal", ...
PMC11621493
For immunocytochemistry, 5 × 10 COS7 cells with stable PLA2G4D overexpression were seeded into 8-well culture chamber slides (94.6190.802, Sarstedt, Nümbrecht, Germany).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740207
Notable factors that induce transdifferentiation include Myoblast determination protein 1 (MyoD1), which can convert fibroblasts into muscle cells, and Pancreas/duodenum homeobox protein 1 (PDX1), which can transform pancreatic alpha cells into insulin-producing beta cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
A. Oryshchuk, R. Desai, P. Kakadiya, S. Bohlander Molecular medicine and pathology, University of Auckland, Auckland, New Zealand Background: Acute myeloid leukaemia (AML) is a devastating disease with poor prognosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11806818
In addition, they can be used for signal amplification in combination with various sensing technologies such as electrochemical , fluorescence , colorimetric , and photoelectrochemical methods.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
IFM 2010-02, Pd in advanced HR RRMM, had demonstrated limited activity with no addition of a proteasome inhibitor (PI), and a good safety profile.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7305184
Afterwards cells were transferred in new culture growing flask and placed in an incubator until a new generation of cells grew to obtain 70% of confluency was reached (2–4 days).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11477621
Herein, we report the discovery, biological evaluation, kinetic binding analysis, and ADME prediction of the synthesized HDACis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Herein", ",", "we...
PMC2196094
Only filters with the high density were used for the screenings, and the filters were used only up to a maximum of four consecutive rounds of hybridizations.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6803987
HBV DNA was amplified using small-scale real-time PCR system.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HBV", "DNA", "was", "amplified", "using", "small-scale", "real-time", "PCR", "system", "." ] } ]
PMC9429973
Median time from diagnosis was 2.2 years (range 0.2 – 8.6), 14 (58.3%) were HTB.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "time", ...
PMC11742290
The TGFβ pathway has a dual role in cancer , in advanced cancer, the TGFβ pathway promotes tumor progression by enhancing EMT and tumor invasion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC6450504
Given the versatility of the formulation developed in this study, particularly its ability to carry siRNA and PTX simultaneously, the experimental design was intended to co-administer both approaches throughout the experiment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11745823
The PI3K converts PIP2 (phosphatidylinositol 4,5‐bisphosphate) into PIP3 (phosphatidylinositol 3,4,5‐triphosphate), which is an important signalling molecule .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "PI3",...
PMC11718817
Inflammasomes are large protein complexes that control caspase-1-mediated cleavage of the precursor molecules of cytokines IL-1β and IL-18, as well as Gasdermin D (GSDMD) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9895440
For Ca flux measurements, Teff were used (1x T2-peptide stimulation of the repetitive stimulation procedure described above, then used on day 3 post stimulation).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Overall survival (OS) differed among patients with different degrees of splenomegaly (15-year OS: 100%, 78.6%, 71.7%, and 51.9%, respectively, P = 0.021).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11449273
The number of migrated/invaded cells was counted in five random fields for each membrane using NIH ImageJ Cell Counter software.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "number", "of", ...
PMC10996034
Through KEGG pathway analysis, the enrichment pathways of MMP1, ZYX and UNC5C was identified.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Through", "KEGG", "pathway", "analysis", ",", "the", ...
PMC11599565
A limit of 29 cycles was established, with ΔCt values above this limit excluded from consideration.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "limit", "of", "29", "cycles", "was", ...
PMC11714165
Quantification of the TRAP‐positive multinucleated cells showed that NBD‐F significantly suppressed osteoclast formation compared to the other groups (Figure 3D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Quantification", ...
PMC6889484
Control vector pCMV-A3G(DK) expressed an untagged A3G-D128K from a cytomegalovirus (CMV) promoter, whereas the pCMV-A3G(DK)-P2A-eYFP vector expressed A3G-D128K-P2A fusion protein and eYFP after cleavage between P2A and eYFP (Figure 1C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10495912
≠≠P<0.05, ≠≠P<0.01 and ≠≠≠P<0.001 vs. control group; *P<0.05, *P<0.01 and ***P<0.001 vs. hydrogen peroxide group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "≠≠P<0.0...
PMC10907726
To elucidate the role of autophagy in modulating the anti-tumor activity of DATS in OS cells, we employed 3-methyladenine (3-MA), a known PI3K and autophagy inhibitor, to impede autophagic processes and assessed the consequent alterations in DATS-induced autophagy markers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11538390
It is possible that different mutations in MCS-9.7 differentially affect its enhancer activity in basal and periderm layers and thereby differentially influence risk for CP versus CL/P. Our rationale is based on the overlapping genetics and function between IRF6 and GRHL3.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9910796
In this context, ASFV core formation seems conceptually analogous in some aspects to that of retroviruses, in which the Gag polyprotein precursor acts as a primary driver for both the nucleocapsid assembly and its anchoring to the viral envelope [38–40].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11222184
Then, the effect of these HSP90 inhibitors on the expression of important genes in cancer was revealed by Quantitative Real Time Polymerase Chain Reaction (qRT-PCR) method.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Educational effect was assessed using a repeated-pair design with pre-/post-assessment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Educational", "effect", "was", "assessed", "using", "a", "repeated-pair", "design", "with", "pre...
PMC9841531
Ribbon structure of human MCT1 (red) in the outward-open conformation in complex with basagin-2 (yellow; PDB ID 7CKR) with the embedded MCT1 inhibitor 7.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8662250
Results are expressed as the mean ± SD of the mean of n = 6 experiments in triplicate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", "are", "expressed", "as", "t...
PMC11541409
The most common exon 11 KIT mutations in GIST, found in about 65% of cases, are highly sensitive to imatinib.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11607764
Our study reveals the expression pattern, genetic alterations, immune infiltration, associated genes and signaling pathways of PTBP1 in pan-cancer, which provides strong bioinformatic support for an in-depth understanding of the role of PTBP1 in cancer development and progression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11700247
F-G) IFN-γ spots after overnight stimulation of tumor or spleen cell suspensions with AH1 peptide with or without anti–MHC I antibody.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC7823217
Holograph X bioprinter is intended to facilitate the in-lab manufacturing of vascularized tissue constructs for organ transplant, via holographic projection printing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Holograph", ...