PMCID string | Sentences string | ner list |
|---|---|---|
PMC9429973 | Aims: To explore the clonality relatedness, clinical and molecular characteristics of patients with RS. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Aims",
":",
"To",
"explore",
"the",
"clonality",
... |
PMC4443654 | Importantly, each Hi-C dataset was re-analyzed to provide comparable identically processed data, which was complementary to the identically processed, locus-level ENCODE data. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC10213199 | The HL60 cell line showed the same characteristics as the JYL low conc. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"HL60",
"cell",
"line",
"showed",
"the",
"same",
"characteri... |
PMC11321678 | For immunofluorescence staining, a blocking solution containing normal sheep serum (5%) was applied to the sections. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"immunofluorescence",
... |
PMC9872547 | Various experiments have been performed to solve this problem, many of which have performed nano-carriers (26). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Various",
"experiments",
"have",
... |
PMC11138140 | These results show that during the 24 h imaging duration, the untreated cardiomyocytes did not exhibit any meaningful increase in optical volume (0.98-fold), while the volume of the norepinephrine-treated cardiomyocytes increased by approximately 1.39-fold. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10376064 | As DMF has been demonstrated before to easily form glutathione conjugates under near-physiological conditions , we also analyzed its glutathione conjugate (dimethyl succinate-SG, DMS-SG, 9; Figure 7A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10440586 | The TAMs fraction in Supplementary Figure 3 was estimated by three algorithms (xCell , EPIC , and quanTIseq ) and scored by three gene sets , , . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7334607 | In addition to the nine drugs displayed in this figure, two additional drugs (Pazopanib and Vincristine) and a drug activation reagent (sodium thiosulfate) were included in the drug sensitivity assays. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | All patients provided informed consent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"patients",
"provided",
"informed",
"consent",
"."
]
}
] |
PMC5261804 | Unsupervised hierarchical clustering revealed strong clusters of some subsets of PPIs (S1 Fig). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Unsupervised",
"hierarchical",
"clustering",
"revealed",
"strong",
... |
PMC11453018 | Particularly notable changes were observed in the Hippo, Wnt, and Hedgehog pathways, indicating the widespread effects of P300/CBP inhibition on regulatory networks crucial for tumorigenesis and cell differentiation (Fig. 3I). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11240052 | Cell transfection The synthetic circ-0008285 sequence was subcloned into the pcDNA3.1 vector (Invitrogen). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cell",
"transfection",
"The",
"synthetic",
"circ-0008285",
"seque... |
PMC11701801 | Data are presented as the mean ± SEM; n = 3 independent experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"are",
"presented",
"as",
"the",
"mean",
"±",
"SEM",
... |
PMC9429973 | Up to 3% of transplant recipients develop a stroke; however, despite the relationship between thrombocytopenia and bleeding at any level, ischemic strokes have also been described in patients with thrombocytopenia. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11461874 | The cell lysates were immunoblotted using antibodies against DBP. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"cell",
"lysates",
"were",
"immunoblotted",
"using",
"antibodies",
"against",
"DBP",
"."
]
}
] |
PMC9429973 | Aims: Here we investigated whether the combination of externally administered immunoglobulins (Ig) via CP therapy and specific inhibition of viral replication might be sufficient to effectively treat B-cell depleted patients with COVID-19. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11244823 | Serum No. 29 was no longer used because of its low reaction against the smaller gD1 antigens. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Serum",
"No.",
"29",
"was",
"no",
"longer",... |
PMC10421378 | The results clearly show that the damage sustained by bacterial cells influences their ability to adhere to Caco-2 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"The",
"results",
"clearly",
... |
PMC11222184 | However, unexpectedly, HSP90 inhibition caused an increase in the expression of DNA damage repair genes ERCC3 and LIG4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"unexpectedly... |
PMC9429973 | Image: Summary/Conclusion: Regardless the difficulties linked to the COVD-19 pandemic, the TCP2 is recruiting very well and allow us in better understanding the outcome of patients with PTCL classified according to the 2016 WHO in the real world. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7582629 | It was shown that, even for the lowest mixture, i.e., 1/100, the prediction based on the HTS-RS measurements provides highly accurate results, and the sampling of nearly 1000 cells could be achieved in 38 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8956657 | ORF4b PDE activity inhibits the innate antiviral 2′-5′ oligoadenylate (2–5 A) synthetase (OAS)-RNase L pathway by degrading 2–5 A produced by OAS, thus preventing activation of the antiviral enzyme RNase L via the 2–5A second messenger molecule. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11591794 | It has been reported that they exhibit anticancer properties by controlling important mechanisms of cancer, such as cell proliferation, angiogenesis, and metastasis and by activating the apoptosis mechanism . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11789597 | Specifically, MM cells adhere to the extracellular matrix or BMSCs in the bone marrow through adhesion molecules, such as integrin family members, CD138, CD44, , vascular cell adhesion molecule‐1, lymphocyte function‐associated antigen‐1, and intercellular adhesion molecule‐1, leading to the enhancement of their survival and CAM‐DR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Navitoclax is a first-in-class, oral, small molecule that binds with high affinity to BCL-XL and BCL-2, key pro-survival proteins in the apoptotic pathway, and has a synergistic effect when used in combination with JAK inhibitors to enhance malignant cell death in MF. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10669128 | Krump-Konvalinkova and Bittinger were able to establish the human endothelial AS-M cell line from a cutaneous angiosarcoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Krump-Konvalinkova",
"and",
"Bittinger",
"were... |
PMC10237474 | Our studies demonstrate the versatility of the PB transposon system for stable pool generation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"studies",
"demonstrate",
"the",
"versatility",
"of",
"the",
... |
PMC8996378 | The property of interaction of compound 6 with ABCB1 was studied by ATPase assay (Reis et al., 2016). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"property",
... |
PMC3931643 | These findings prompted us to test the effects of asTORi on more common human blood cancers such as DLBCL. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"findings",
"prompted",
"... |
PMC9592219 | Collectively, these results illustrated that TOP2A enhance the motility of HCC cells through EMT. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Collectively",
",",
"these",
"results",
"illustrated",
"that",
... |
PMC10440586 | mesenchymal. ****, | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"mesenchymal",
".",
"*",
"*",
"*",
"*",
","
]
}
] |
PMC11779605 | Whole protein lysates were mixed with Simple Western Sample Buffer (0.1×) (Bio-Techne R&D Systems #PS-ST01EZ, Minneapolis, MN, USA) to a final concentration of 1.5 µg/µl and then denatured through heating at 96°C for 5 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8777939 | A recent report revealed that proteasome inhibitor MG132/bortezomib suppressed AGR2 expression in an ER stress-independent manner and proteasome inhibitor-induced AGR2 degradation via activation of autophagy in lung cancer . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10748106 | The 5-deoxypulchelloside has two extras’ hydroxyls at C6 and C7, lacks the double bond in C7–C8, and has a methyl instead of the hydroxymethyl at C8. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11764090 | cv. | [
{
"tags": [
"O",
"O"
],
"tokens": [
"cv",
"."
]
}
] |
PMC9479186 | The results support the results of the bioinformatics analysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"results",
"support",
"the",
"results",
"of",
"the",
"bioinformatics",
"analysis",
"."
]
}
] |
PMC11621493 | The protein content in each fraction was determined with Pierce BCA reagent (23225, Thermo Fisher Scientific) using BSA standard dilutions for each buffer condition. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11585254 | Agonist-stimulated internalization of CXCR5 and phospho-site cluster variants. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Agonist-stimulated",
"internalization",
"of",
"CXCR5",
"and",
"phospho-site",
"cluster",
"variants",
".",
"... |
PMC11271800 | They also promote tumor cell survival and proliferation, angiogenesis, and inhibit innate and adaptive immune responses through a variety of mechanisms to promote tumor progression and metastasis (Figure 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11138140 | Then, 10 imaging positions were selected per treatment using the HOLOMONITOR App Suite software. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Then",
",",
"10",
"imaging",
"positions",
"were",
"selected... |
PMC10976516 | Just as viral gene deletion has been applied to increase the selective infection of tumor cells by OVs, the insertion of therapeutic genes through genetic engineering has been utilized to increase OVs' anti-tumoral responses. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11502962 | Two patients (G01 and G02) were recruited for single-cell transcriptome analysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Two",
"patients",
"(",
"G01",
"and",
"G02",
")",
"were",
"recruited",... |
PMC11502327 | Another interesting study showed that a polymer-loaded system of curcumin can double the uptake of cisplatin-resistant A2780CP cells and sixfold increase the uptake of metastatic MDA-MB-231 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLin... |
PMC11591794 | When compared with other groups, no significance could be found in P53 gene expression in only the GA-applied group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"When",
"compared",
"with",
... |
PMC11409031 | These findings contribute to our comprehension of the immune microenvironment in OV, underscoring the vital functions of T cells and macrophages in tumor immune evasion as well as anti-tumor immune reactions . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11122631 | Subfraction C6B3 (25.4 mg) was purified by reverse-phase HPLC (C18 column) with 75% methanol to yield compound 5 (6.1 mg). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11402217 | Promising clinical and preclinical results have been observed with several DKK1 inhibitors, such as DKN-01, BHQ-880, JS015, and IIIC3, in treating advanced solid tumors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8735881 | Data are expressed as the means ±standard deviations (SD). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"are",
"expressed",
"as",
"the",
"means",
"±standard",
"deviations",
"(",
"SD"... |
PMC10823017 | PKC-ι; forward: TTGCAATGAGGTTCGAGACA; reverse: CTGAGATGATACTGTACACGGG. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PKC-ι",
";",
"forward",
":",
"TTGCAATGAGGTTCGAGACA",
";",
"reverse",
":",
"CTGAGATGATACTGTACACGGG",
"."
... |
PMC11423992 | Schematic representation of TFAB002s, which consist of three chains that specifically target CD20 and CD3ε in a monovalent binding mode. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Schematic",
"representa... |
PMC11411131 | The amino terminal-fused FLAG tag allowed detection of both the full-length and truncated forms, while the carboxyl terminal-fused HA tag allowed detection of only the full-length form. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11628309 | Staurosporine, for instance, significantly elevates the levels of TH and VMAT2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Staurosporine",
",",
"for",
"instance",
",",
"significantly",
"elevates",
"... |
PMC10729469 | Notably, our TCRAβ lentiviral constructs while successfully transducing CEMSS, 3T3 and human PBMC’s with the TCRAβ, were less effective at transducing mouse Tregs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8701144 | Next, the effect of E1B-55k siRNA treatment on β-catenin-mediated transcriptional activation was tested using a HEK293 cell line incorporating the well-established SuperTopFlash (STF) reporter system . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11721587 | Our study reveals a unified mechanism for Hh signal transduction from Drosophila to mammals despite their differential requirement for primary cilia. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"study",
"r... |
PMC11741577 | We showed that HaCaT cell migration was promoted more effectively by HMC-1 CM stimulated with the TLR 2/6 agonist FSL-1 than by other TLR-stimulated HMC-1 CM for 24 h. (A) A comprehensive table shows Toll-like receptors (TLRs) and their agonists. | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11470381 | B. Resulting binary masks and outline of analyzed cell ROI at each time frame. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"B.",
"Resulting",
"binary",
"masks",
"and",
"outline",
"of",
"an... |
PMC4485786 | Quantitative values are given as mean fluorescence intensity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Quantitative",
"values",
"are",
"given",
"as",
"mean",
"fluorescence",
"intensity",
"."
]
}
] |
PMC11742670 | Cell LineDRY LABWET LABA-5495.09 6.97 A-37524.27 25.78 A-43160.58 > 100 Vidarabine IC50 comparison between the DL model prediction and pharmacological studies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cell",
"LineDRY",
... |
PMC11655536 | We established subcutaneous MM mouse model by injecting s.c. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"established",
"subcutaneous",
"MM",
"mouse",
"model",
"by",
"injecting",
"s.c",
"."
]
}
] |
PMC8873393 | Here in this study, we identified “recovered” genes and “not recovered” genes within the time window we accessed using the DNA repair sufficient cells, and observed that shorter genes are preferred to be recovered first (Fig. 4). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10919056 | qRT-PCR results of GJA5 and GJB1 expression at the RNA level. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"qRT-PCR",
"results",
"of",
"GJA5",
"and",
"GJB1",
"expression",
"at",
"the",
... |
PMC10170482 | Here, we report that the soft 3D collagen scaffolds cause metabolic rewiring of liver tumor cells resulting in the upregulation of glycolysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Here",
... |
PMC9429973 | So if in the group of cyclophosphamide CD34+ cells in 1 mkL of blood of patients with MRD (-) status and MRD (+) status were 97 and 90, respectively; p=0.540, then when prescribing vinirelbine 276 and 109, respectively; p=0.116 and 117 and 47, respectively, with the introduction of G-SCF; p=0.173. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11519583 | b Representative images of MPs, taken at 3 days after transfection with the indicated siRNAs, were obtained following staining with an anti-lamin B1 antibody (red) and DAPI (blue). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8992508 | In the last two decades, after the discovery of BCRP, many new molecules acting as BCRP-dependent MDR modulators were reported, but also in this field sound SARs are lacking. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Median time to ≤1% BCR::ABL1 response was 5.6 months in PACE and 6 months in OPTIC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Median",
"time",
"to",
"≤1",
"%",
"BCR::ABL... |
PMC9429973 | Thrombophilia and prothrombotic alleles polymorphism in women with various obstetric history (%) The data of our study showed that there were no differences in the distribution of polymorphism of genes associated with thrombophilia and prothrombotic conditions between the group with recurrent pregnancy loss and the comparison group (p>0.05). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10956161 | The cell lines used in this study were all from our laboratory. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"cell",
"lines",
"used",
"in",
"this",
"study",
"were",
"all",
"from... |
PMC11730320 | E Maintenance of CCR7+ central memory (Tcm) and CCR7- transitional memory (Ttm) subpopulations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"E",
"Maintenance",
"of",
"CCR7",
"+",
... |
PMC7185206 | Additional flow diagrams in Supplemental Figure 8. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additional",
"flow",
"diagrams",
"in",
"Supplemental",
"Figure",
"8",
"."
]
}
] |
PMC11449273 | To characterize the molecular players that may contribute to the observed differential anti-tumorigenic effects of plakoglobin on p53-R175H and -R273H, we investigated the effect of plakoglobin on the expression of two well-studied growth-regulating and proapoptotic p53-WT target genes–PUMA (p53 upregulated modulator of apoptosis) and BAX (Bcl2-associated X protein) [38–47] that is known to be dysregulated in mutant p53 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5035325 | Primary tumor volume in 4T1-model (f). | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O"
],
"tokens": [
"Primary",
"tumor",
"volume",
"in",
"4T1-model",
"(",
"f",
")",
"."
]
}
] |
PMC10154881 | At 9 dpi, the CD8 T‐cell response to rMV‐SLAMblind treatment differed between the E.G‐7/N4 model and the B16/N4 model (Figure 3F,G). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10123657 | Quality control charts and statistics for mass spectrometry data are shown in Supplementary Figure S1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Quality",
"control",
"charts",
"and",
"statistics",
"for",
... |
PMC11703992 | The GCA RNA-seq dataset GSE174694 was used to conduct validation on DDIT4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"GCA",
"RNA-seq",
"dataset",
"GSE174694",
"was",
"used",
"to",
"conduct",
... |
PMC11763111 | Mice were sacrificed based on predefined humane endpoints, including stooped posture, significant weight loss, or mobility difficulties. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Mice",
"were",
"sacrificed",... |
PMC9429973 | Finally, the patterns of TNF-alpha and TGF-beta production were differently distributed considering the number of therapy lines: the first both in all AIHA and in CAD patients (p=0.004 and p=0.01, respectively), the second only in CAD patients (p=0.03). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11615218 | Their data identified threefold higher frequencies of TCM (CCR7CD27SELL) subsets in patients who achieved CR than in those with partial response or progressive disease . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC9429973 | This negative effect was mitigated by adding EPAG to the post-ATG sera (223 ± 100; p=0.036). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"negative",
"effect",
"was... |
PMC10759659 | In addition, quantitative reverse transcription-PCR (qRT‒PCR) was performed using TB Green® Premix Ex Taq™ II (RR820A; Takara) on a quantitative PCR machine (qTOWER3G, Analytik Jena, Jena, Germany). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11680562 | These natural compounds played a crucial role in reducing copper nitrate to CuO NPs and stabilizing the NPs during formation (Fig. 1) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC10454535 | The membrane was washed with PBST again. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"membrane",
"was",
"washed",
"with",
"PBST",
"again",
"."
]
}
] |
PMC11317131 | Primers are listed in Supplementary Table S6. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Primers",
"are",
"listed",
"in",
"Supplementary",
"Table",
"S6",
"."
]
}
] |
PMC11805741 | The PCR product was sequenced and analyzed using BioEdit and BLAST n tools, respectively, with a phylogenetic tree constructed using MEGA X software, for further information, please refer to supplementary, Section 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6114978 | Additional studies to identify this ubiquitin ligase is needed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additional",
"studies",
"to",
"identify",
"this",
"ubiquitin",
"ligase",
"is",
"needed",
"."
]
}
] |
PMC7022782 | Figure 7A,B show untreated Caco-2 cells (control). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Figure",
"7A",
",",
"B",
"show",
"untreated",
"Caco-2",
"cells",
"(",
"contr... |
PMC11674146 | For the intervention assays, the small interfering RNAs (siRNAs) against CLP36 (si-CLP36#1, target sequence: 5′-TGGGGAAAATACTAGCAATATGA-3′; si-CLP36#2, target sequence: 5′-GTCATCCATACAAGATGAATTTA-3′) and the corresponding negative control with scramble target sequences (5′-ATTAGTGCAGATACATCTTACAA-3′) were all synthesized by GenePharma (Shanghai, China) and transfected into BJAB and RA 1 cells using Invitrogen™ Lipofectamine 2000 transfection reagent (11668027; ThermoFisher Scientific, Waltham, MA, USA) for 48 h, as recommended by the protocols of the producer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8973085 | The molecular docking studies have been performed using MOE (2014.0901) (Molecular Operating Environment software). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"molecular",
"docking",
"studies",
... |
PMC9504875 | RLRs are broadly expressed in most cell types, and can recognize infection of a variety of RNA viruses . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RLRs",
"are",
"broadly",
"express... |
PMC11791264 | C, alignment of the consensus amino acid residues adjacent to lysine targeted by SETD7, and the identification of a putative SETD7 methylation site in LC3B. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11774112 | Furthermore, the micelle system shows substantial potential for application in the combined treatment of human cancers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Furthermore",
",",
"the",
"micelle",
"system",
... |
PMC11638255 | Interestingly, statistically significant changes were restricted to the tumor microenvironment except for KC and IFN-γ, suggesting that copper chelation can induce a “finely tuned” local shift in immune response. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10669966 | cDNA was synthesized from RNA with SuperScript™ IV VILO™ Master Mix (Cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"cDNA",
"was",
"synthesized",
"from",
"RNA",
"with",
"SuperS... |
PMC11687663 | Liver cancer is one of the most prevalent malignant diseases in humans and the second leading cause of cancer-related mortality globally. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Liver",
"cancer",
... |
PMC10523483 | 293T cells were cultured in a DMEM/HG medium. | [
{
"tags": [
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"293",
"T",
"cells",
"were",
"cultured",
"in",
"a",
"DMEM/HG",
"medium",
"."
]
}
] |
PMC11033180 | We collected data employing a HEKA amplifier (EPC10 USB double) along with the PATCHMASTER software (HEKA Instrument Inc., New York, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11472569 | These properties make EVs a promising tool for cancer immunotherapy and diagnostics. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"properties",
"make",
"EVs",
"a",
"promising",
"tool",
"for",
"cancer",
... |
PMC10291556 | ATP concentrations were obtained from the standard curve and normalized to cell counts and control. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ATP",
"concentrations",
"were",
"obtained",
"from",
"the",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.