PMCID string | Sentences string | ner list |
|---|---|---|
PMC9014716 | The intensity of the regulation between miRNA and mRNA seems to be mild. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"intensity",
"of",
"the",
"regulation",
"between",
"miRNA",
"and",
... |
PMC9429973 | The 5-year OS rates for pts age 60-69 without poor-risk cytogenetics (n=37), age 60-69 with poor-risk cytogenetics (n=13), age ≥70 without poor-risk cytogenetics (n=24), and age ≥70 with poor-risk cytogenetics (n=6) were 69%, 39%, 36% and 0% respectively (Figure 1C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10933092 | Antisense: AATTCAAAAAAGGCACTCAGTTGACCTTATTCTCTTGAAATAAGGTCAACTGAGTGCCG. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Antisense",
":",
"AATTCAAAAAAGGCACTCAGTTGACCTTATTCTCTTGAAATAAGGTCAACTGAGTGCCG",
"."
]
}
] |
PMC11310713 | Representative immunohistochemistry images of the expression of p53 and PTEN as cancer markers and the expression of KI67 as a proliferation marker. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Representative",
... |
PMC11459296 | This study establishes a fast, efficient, and reliable in vivo platform for various applications in cancer immunotherapy, particularly for exploring the complex interactions between cancer cells, immune cells, and the tumor microenvironment in vivo, prior to clinical development. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | SPINK2 associated with IR cytogenetics (P=0.014), normal karyotype (P=0.019) and NPM1 mutation (P<0.001), while SPINK2 with t(8;21) and CEBPA double-mutation (both P<0.001). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9351137 | Spastin is a key player in microtubule severing, ensuring the final cut at the midbody , whereas α-tubulin is a major component of spindle and midbody microtubules. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10253553 | This was associated with a significant reduction in 786-0 cell viability compared with 786-0 cells transfected with non-targeting control siRNA (Figure 5D). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
... |
PMC11127909 | B–D WB was used to detect BAX expression in the mitochondrial and cytosolic fractions of 143B-V, 143B-EFHD1, 143BR-shV and 143BR-shEFHD1 cells, N = 3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"B-CellLine",
... |
PMC11707577 | Because of their excellent electron transport properties, optical properties, soft material nature, stability, solution processability, and water dispersibility, TNPs have recently demonstrated their enormous potential as therapeutic , , , , , , , (photodynamic, PDT; sonodynamic, SDT and photothermal, PTT) and imaging , , , , , (fluorescent and photoacoustic imaging) agents in nanomedicine. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11448304 | Subsequently, we adopted transcriptome, quantitative proteome and lysine 2-hydroxyisobutyrylome to construct a differential profile on the transcriptional to post-tanslational levels on A549 and RA549 cell lines, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLin... |
PMC11621493 | The human PLA2G4D gene was first identified and cloned in a study investigating differently expressed genes in psoriatic skin (30). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"human... |
PMC5311252 | Protein extracts were digested using trypsin (Thermo Fisher Scientific, 90058) using a filter-aided sample preparation protocol. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Protein",
"extracts",
"were",
"di... |
PMC6461034 | In this context, with heterogeneity and plasticity of kinase signaling in a specific tumor at a specific time, it is essential to have an overview of hyperactive kinases and prioritize ones that (help) drive malignancy to maximize therapeutic success and minimize expensive failures and unnecessary burden for the patient. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11727145 | One of these growth factors, EGF, plays a crucial role in promoting cutaneous healing through its high capacity for stimulating cellular proliferation, as demonstrated in our previous experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11755624 | The increased expression of nuclear paraspeckle assembly transcript 1 (NEAT1) in the skin cells of psoriasis patients affects the activity of transcription factors during epithelial differentiation . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11499381 | In the absence of RAMP co-expression, CLR is trapped intracellularly and unable to respond to peptide stimulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"absence",
"of",
"RAMP",
... |
PMC11686380 | Coronal sections were prepared and stained for GFP at P7. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Coronal",
"sections",
"were",
"prepared",
"and",
"stained",
"for",
"GFP",
"at",
"P7",
"."
... |
PMC4270159 | Mix Super Signal West Pico Chemiluminescent Substrate solutions in equal proportions and add it to the blot.c. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Mix",
"Super",
"Signal",
"West",
"Pico",
"C... |
PMC9429973 | Each cohort will initially enroll 6 pts for 1 cycle (28 days) to assess dose-limiting toxicities and determine the recommended phase 2 dose (RP2D). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | As incorporation of AZA into DNA is S-phase-restricted, extended Oral-AZA dosing regimens (> 7d/28d Tx cycle) increase drug incorporation into cycling tumor cells to prolong epigenetic activity throughout the Tx cycle [Laille 2015]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8806312 | In summary, we developed a 4-gene-based risk model for OS prognosis prediction via a thorough analysis of IRGs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"summary",
",",
"we",
... |
PMC8992508 | Therefore, they can be considered dual P-gp/BCRP inhibitors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"they",
"can",
"be",
"considered",
"dual",
"P-gp/BCRP",
"inhibitors",
"."
]
}
] |
PMC11395280 | Following receptor internalization, the cells were plunged into 10-fold ice-cold cRPMI/2% bovine serum albumin and allowed to rest on ice for 10 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11190062 | First-line treatment often includes a combination of drugs of different classes, including proteasome inhibitors (PIs), immunomodulating drugs, monoclonal antibodies targeting CD38, and corticosteroids (1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Treatment-emergent AEs were graded per Common Terminology Criteria for AEs v5.0. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Treatment-emergent",
"AEs",
"were",
"graded",
"per",
"Common",
"Terminology",
"Criteria",
"... |
PMC11683240 | Therefore, CHO cells were seeded in 10 cm culture dishes and grown for two to three days. | [
{
"tags": [
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"CHO",
"cells",
... |
PMC9429973 | Image: Summary/Conclusion: With the continuing improvement in OS, a higher proportion of MM patients are likely to develop SPM. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Image",
":",... |
PMC9739791 | Photoabsorbers with different maximum absorption wavelengths were used to obtain Pt(IV) prodrugs with controllable photoactivation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Photoabsorbers",
"with",
"different",
"maximum",
"absorption... |
PMC11541241 | Even so, we have much yet to learn. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Even",
"so",
",",
"we",
"have",
"much",
"yet",
"to",
"learn",
"."
]
}
] |
PMC11738017 | All cases of disease progression as a consequence of antigen escape occurred after an initial response that lasted at least 6 months (median PFS, 10 months; Figure 1D). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC4005030 | Safety of the whole plant was concluded in the review. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Safety",
"of",
"the",
"whole",
"plant",
"was",
"concluded",
"in",
"the",
"review",
"."
... |
PMC11723947 | i Percentage of Foxp3 cells among WT or HP1γ KO TCR Vβ6 Tconv, as determined in the spleen 21 days after engraftment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"i",
... |
PMC5415764 | The intracellular concentration of PTX was decreased in the presence of P-gp which led to a reduction of anticancer efficacy in cancer cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
PMC11547972 | However, superior effects, compared to the monodrug treatment, were only reflected in a G0/G1 increase and loss of G2/M in A498 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],... |
PMC8740518 | Based on all differential metabolites, 19 metabolic pathways were enriched. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Based",
"on",
"all",
"differential",
"metabolites",
",",
"19",
"metabolic",
"pathways",
... |
PMC11013014 | Compounds 2 and 3 are more stable in the human glutathione S-transferase P1-1 pocket than EA because the binding affinity value of the reference compound is greater than the binding affinity values of the synthesised compounds 2 and 3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Total activation frequency of at least one herpesvirus was 80%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Total",
"activation",
"frequency",
"of",
"at",
"least",
"one",
"herpesvirus",
"was",
... |
PMC9429973 | In addition, as shown in figure, age at onset ≥ 49 years (HR=2.54, 95%CI 1.51-4.27, p<0.001) and SRC (HR=3.27, 95%CI 1.37-7.79, p=0.008) were proved to be the independent predictors to determine the 20-year incidence of anemia in SSc, while positive anti-centromere proteins (HR=0.42, 95%CI 0.24-0.76, p=0.003) seemed to be a protective factor. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Around 16% of hem/oncs improved and 64% reinforced (confirmed) their knowledge regarding the most recent data with epigenetic agents in patients with B-cell lymphomas, with 81% knowing this information post-education (P=0.251). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10530622 | For instance, in vitro models of renal epithelial cells, including the MDCK cell line and human proximal tubular epithelial cells (RPTEC), were used to demonstrate that oxalate exposure (0.35 mM) promotes inflammation by increasing cyclooxygenase 2 (COX-2) and facilitating NF-κB activation via the degradation of IκB-α, respectively . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"... |
PMC11367146 | Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genome (KEGG) analysis were carried out on intersecting targets to understand the biological functions of the target genes in OA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | It is perhaps not surprising as these two disease groups also had the highest mean patient ages. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"is",
"perhaps",
"not",
"surprising",
... |
PMC11412721 | Right, comparison of the ACKR4 proteins encoded by WT alleles from BL Raji control cells (center), or by the 4.14a (top) and 4.14b mutated alleles (bottom). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8270637 | All animal studies were approved by the Institutional Animal Care and Use Committee of Anhui Medical University. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"animal",
"studies",
"were",
"approved",
... |
PMC7602170 | Two rapamycin analogs used in clinic are everolimus (RAD001) and temsirolimus. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Two",
"rapamycin",
"analogs",
"used",
"in",
"clinic",
"are",
"everolimus",
... |
PMC11257988 | G12D continuously activates downstream pathways, mainly through the RAF/MEK/ERK signaling pathway, leading to abnormal cell proliferation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"G12D",
"continuously",
"activates",
"downstr... |
PMC11381192 | The discriminative performance of the nomogram model was evaluated using receiver operating characteristic (ROC) curves. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"discriminative",
"performance",
"of",
"the... |
PMC9927933 | Importantly, UBE2C is expressed at relatively low levels in many normal tissues, but at high levels in human carcinomas derived from the lung, uterus, bladder, and stomach (12), and high UBE2C expression is associated with worse overall survival of lung cancer patients (17–20). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11476837 | Although the NRF2–KEAP1 signaling pathway plays a cytoprotective role in normal cells and tissues, its aberrant activation has been demonstrated in many types of tumors such as lung, breast, head and neck, ovarian, and endometrial cancers . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10391797 | Percentages of CD123 and CLL-1 expression on PBMCs/BMMCs of patients with AML (n=40) and healthy donors (n=5) detected by flow cytometry. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC6600253 | Other studies demonstrated that the inhibition of HSP90 could lead hTERT to be ubiquitinated and degraded by the proteasomal pathway, and reduce DNA extension by telomerase . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Likewise, no differences were shown in Ly subsets of R before and one month after the third dose (Fig.1H). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Likewise",
"... |
PMC9429973 | Associations were investigated by Chi-square or Fisher exact test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Associations",
"were",
"investigated",
"by",
"Chi-square",
"or",
"Fisher",
"exact",
"test",
"."
]
}
] |
PMC9429973 | The survey was conducted in France, Germany, Italy, Spain, the United Kingdom (UK) and Canada between Jan-May 2021. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11286266 | All statistical analysis was performed by a two-sided unpaired Welch’s t-test and significance is indicated by asterisks (****p < 0.0001; ns: non-significant). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10654497 | We used consensus clustering to classify patients with lung cancer into two subgroups (cluster1 and cluster2). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"used",
"consensus",
"clustering",
... |
PMC7823217 | Bioprinted cancer models containing patient-derived cancer and stromal cells is promising for personalized cancer therapy screening 3D bioprinted constructs form physiologically relevant cell–cell and cell–matrix interactions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11298021 | The data revealed that more than 75% of Jurkat cells were successfully transfected with FAM-labeled Scramble (Fig. 4B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"data",
... |
PMC6160470 | Data analysis was performed using FlowJo software (TreeStar Inc.). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"analysis",
"was",
"performed",
"using",
"FlowJo",
"software",
"(",
"TreeStar",
... |
PMC9516447 | Fig. S2B, C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"S2B",
",",
"C",
")",
"."
]
}
] |
PMC9512971 | This study was conducted to investigate whether camostat mesilate is an effective treatment for SARS-CoV-2 infection (COVID-19). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"study",
"was",
"conducted... |
PMC11342785 | To explore this systematically, we built a blue-light triggered TPPP clustering system in 3T3 cells to reconstitute TPPP activity from the bottom-up (Fig. 3A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7185206 | Wild-type 786–0 renal cancer cells were grown in conditions known to induce sPD-L1 production (density 10 cells/ml with interferon-γ or density 10 cells/ml with vehicle control) in the absence or presence of ADAM10/ADAM17 inhibitor TAPI-0 over 48 h. Supernatants were collected and assayed for sPD-L1 by ELISA. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | RFS was significant when adjusting for NPM1 mutation status or FLT3 mutation status using multivariable cox regression model with RFS being better with CPX-351 compared to FLAG-Ida (HR:0.58, 95% CI0.36-0.95, p=0.03). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8875242 | However, both approaches had limitations, indicating that inhibitory potency should be tested with at least these two ABCB1 probes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"b... |
PMC9429973 | The differences between sperm concentration, % progressive motility and % total motility were all non-statistically significant (p = 0.457, 0.535, and 0.574, respectively). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11798926 | Regardless of treatment, all cells were then rinsed three times with ice cold PBS (+1 mM CaCl2, 0.5 mM MgCl2) and fixed with prechilled 3% glyoxal solution (Richter et al., 2018) for 30 min at RT, followed by one rinse with PBS, quenching with ammonium chloride (50 mM) for 15 min, permeabilization with 0.1% Triton X-100 and blocking with BSA for 60 min (all diluted in PBS). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11748363 | In general, for all groups, derivatives with non‐chlorinated pyridine (R = H) were the least cytotoxic against the HepG2 cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine"... |
PMC9454178 | CDK inhibitors are of great interest as novel therapeutic agents against cancer, and several CDK inhibitors have been applied in the clinic. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CDK",
... |
PMC11790971 | Second, the classification performance may benefit from larger datasets and further refinement of ML models. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Second",
",",
"the",
"classification",
"performance",
... |
PMC11644761 | It suggests that an abnormal re-entry of neurons into the cell division cycle may precede the pathological changes leading to neurodegeneration . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"suggests",
... |
PMC11224020 | d, Pathway analysis of differentially expressed genes in confined versus LPS-treated DCs; arrow width corresponds to the enrichment score from the significantly enriched (P < 0.05) genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Summary/Conclusion: In our series, the DIC rates are correlated with that of the literature, as well as early death rate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Summary... |
PMC11496491 | In the context of angiogenesis, CXC chemokines are a unique family of cytokines known for their expression in different ways in the regulation of angiogenesis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11461874 | Proteins (24 µg) in the solution were reduced with final 10 mM DTT at 60 °C for 30 min, and then alkylated by incubation with final 22 mM iodoacetamide [IAA] at 37 °C for 30 min in the dark. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10898159 | Other new drugs targeting KIT mutations in gastrointestinal stromal tumors: Avapritinib, Larotrectinib, Entrectinib, Bezuclastinib, Carbozantinib, Sorafenib. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Other",
"new... |
PMC10914904 | In the serum of patients with hematological malignancies, vtRNA 1-1 and 2-1 are predominantly expressed . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"serum",
"... |
PMC9429973 | Statistical analyses were performed using SPSS. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Statistical",
"analyses",
"were",
"performed",
"using",
"SPSS",
"."
]
}
] |
PMC9429973 | Methods: Splenectomized 4.2 mice (2.5 months of age) were either treated with vehicle or mitapivat at dosages of 100 mg/kg/day over 4 months. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11640555 | Furthermore, knowing that CK2 controls NFs by the direct activation of cascade transduction signaling and BDNF or NGF released by glioma cells promoting tumor growth depending on the presence of microglia , we found a link that exists between neurotrophins-induced signals and regulation of CK2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Mean age was 59±12.7 and 51±15.6 respectively; 68.2% male, 31.8% female. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Mean",
"age",
"was",
"59±12.7",
"and",
"51±15.6",
"respecti... |
PMC11767725 | Neural inputs that regulate microvascular tone and glandular activity are also disrupted, creating patchy areas of skin with distinct microbial communities. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Neural",
"in... |
PMC11222184 | SOD1 is an important antioxidant with oncogenic effects in many cancers and is overexpressed in various cancers. . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"SOD1",
"is",
"an",
"important",
"antio... |
PMC9429973 | However, TKI resistance occurs frequently while the underlying mechanisms remain incompletely understood. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"TKI",
"resistance",
"occurs",
"frequently",
"while",
"the",... |
PMC11277157 | We transfected HEK293 cells by siRNA as a negative control (using esiRNA-RLUC, see Section 3) and the siRNA methodology for PARK7 (see Section 3). | [
{
"tags": [
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11754432 | In addition to ALA, treatment of skin equivalents with ω-3 PUFAs is associated with reduced inflammation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"addition",
"to",
"ALA",
",",
"treatme... |
PMC9429973 | Image: Summary/Conclusion: Both the IPSS-R cytogenetic risk group and the complexity of the 5q- karyotype showed prognostic impact in patients with del(5q). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC10820104 | In contrast to the standard-of-care treatment paclitaxel, for which IC50 values in the low nanomolar range are reported , compounds 1 and 4 display only moderate cytotoxic efficacy levels, with IC50 values of 25.8 and 23.4 µM, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9352806 | L1 worms were supplemented with BMS (100 μg/mL) for 48 h in daf-16 and hlh-30 deficient mutants, and hlh-30 interfered worms. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11116779 | The samples were thermostated for 2 min at 25°C before measurements, which were performed in a 2.5-mL disposable cuvette and then analyzed in triplicate using a 175° detection angle. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11789597 | Most drugs promote the expression of CAV1, but one to two dozen drugs inhibit it (Figure S9A, Supporting Information). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Most",
... |
PMC11388384 | Immunoblotting was performed using standard procedures. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immunoblotting",
"was",
"performed",
"using",
"standard",
"procedures",
"."
]
}
] |
PMC8633974 | The research received support from National Institutes of Health grants T32 NS105594, 5R01MH121402, 1R01Al158160, R01 DA054535, PO1 DA028555, R01 NS126089, R01 NS36126, PO1 MH64570, P30 MH062261, and 2R01 NS034239.Research in contextEvidence before this studyClustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 9 (Cas9) approaches were used to eliminate latent integrated proviral DNA from human cells in infected humanized mice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11623887 | We previously showed B19V decreases the BFU-E and CFU-E progenitors that produced by hematopoietic stem cells that were cocultured with infected mesenchymal stem cells with the virus. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10440586 | gray lines connect the samples before and after the treatment of the same patient. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"gray",
"lines",
"connect",
"the",
"samples",
"before",
"and... |
PMC7351993 | Here we demonstrate Raman image-activated cell sorting by directly probing chemically specific intracellular molecular vibrations via ultrafast multicolor stimulated Raman scattering (SRS) microscopy for cellular phenotyping. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11705862 | Cells were grown in BDNF-containing neurobasal medium for a minimum of 4 days, and the medium was refreshed daily. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"grown",
... |
PMC5308810 | When compared to CXCR4, CXCR4 also produced larger and more colonies in a soft agar assay. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"When",
"compared",
"to",
"CXCR4",
",",
"CXC... |
PMC9429973 | Four of the patients had no difference in the mean telomere length between diagnosis and remission and these are the only with disease relapse. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.