OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC9777812	Bta-miR-106b belongs to the bta-miR-106b-25 cluster (containing bta-miR-106b, miR-93, and miR-25) and plays important roles in cancer , cell differentiation , cell proliferation processes , cell cycle , and breast cancer .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9516401	The hydro-alcoholic extract was then dried and crude extract was kept frozen at below −18C for the following use.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "hydro-alcoholic", "extract", ...
PMC11750161	The locations of the constitutively activating mutations (M410T, K469R, and D590Y) and two inactivating mutations (D417N and Y558F) are indicated.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10823017	β-actin; forward: AGAGCTACGAGCTGCCTGAC and reverse; AGCACTGTGTTGGCGTACAG was used as the housekeeping gene.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "β-actin", ";", "forward", ":", "AGAGCTACGAGCTGCCTGAC", "and", ...
PMC11806818	Fig. 2Aptasensors for the detection of MCF-7 CTCs. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "Fig.", "2Aptasensors", "for", "the", "detection", "of", "MCF-7", "CTCs", ".", "(" ] } ]
PMC10366908	A five-week-old Sprague–Dawley rat was purchased from CLEA Japan (Tokyo, Japan).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "five-week-old", "Sprague", "–", "Dawley", "rat", ...
PMC9429973	H. Dohner, P. Montesinos, S. Vives Polo, E. Zarzycka, J. Wang, G. Bertani, M. Heuser, R. Calado, A. Schuh, S.-P. Yeh, A. de la Fuente, C. Cerchione, S. Daigle, J. Hui, S. Pandya, D. Gianolio, C. Recher, S. de Botton Ulm University Hospital, Ulm, Germany; Hospital Universitari i Politècnic La Fe, València; Hospital Universitario Germans Trias i Pujol-ICO Badalona, Josep Carreras Research Institute, Badalona, Spain; Department of Hematology and Transplantology, Medical University of Gdansk, Gdansk, Poland; Institute of Hematology & Hospital of Blood Disease, Tianjin, China; ASST Grande Ospedale Metropolitano Niguarda, Milan, Italy; Hannover Medical School, Hannover, Germany; Ribeirão Preto School of Medicine, University of São Paulo, São Paulo, Brazil; Princess Margaret Cancer Centre, Toronto, Canada; China Medical University, Taichung, Taiwan; MD Anderson Cancer Center Madrid, Madrid, Spain; Hematology Unit, Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS, Meldola, Italy; Servier Pharmaceuticals, Boston, United States of America; Institut Universitaire du Cancer de Toulouse Oncopole, Toulouse; Institut Gustave Roussy, Villejuif, France Background: Ivosidenib (IVO) is a potent oral targeted inhibitor of mutant isocitrate dehydrogenase 1 (mIDH1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11462673	The shRNA was synthesized and its incorporation into the pLKO.1 vector were carried out by IGE Biotechnology LTD, China.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "shRNA", "was", ...
PMC11653533	Finally, the aqueous leaf extract of F. religiosa has exhibited anti-asthmatic activity on histamine and acetylcholine-induced bronchospasm in an animal model of guinea pig, where 300 mg extract increased latency of pre-convulsion time of histamine and acetylcholine by 167.0 ± 5.7 and 273.0 ± 5.7 s respectively (Kapoor et al., 2011).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11451829	On day 23, all animals were euthanized under anesthesia and an intracardiac overdose of embutramide (200 mg/kg) + mebezonium iodide (50 mg/kg) + tetracaine hydrochloride (5 mg/kg), (T61, MSD, Salud Animal, Mexico City, Mexico).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6617630	We also demonstrate that BET inhibition in DHL/THL cells, target BCL6 but has no inhibitory effect on BCL-2 protein.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "also", "demonstrate", ...
PMC11089031	The protein was separated on 10% polyacrylamide gel (PAGE) and transferred to 0.45 μm nitrocellulose (NC) filter membrane (Millipore, Massachusetts, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11190538	Transmission electron microscopy (TEM) was utilized to analyze and observe the morphology of nanophytosomes.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transmission", "electron", "microscopy", "(", "TEM", "...
PMC9031474	The reduced derivatives 55/56 still showed some antiproliferative activity suggesting that the presence of a dialdehyde structure causes a part of the cytotoxicity.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC10882807	Correlation between EIF4A3 and hsa_circ_0005397 mRNA expression in HCC tissues (n = 57). (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "between", "EIF4A3", "and", "hsa_circ_0005397"...
PMC11747949	To interrogate CCL2‐CCR2 axis blockade we selected a small organic molecule RS504393 (spiropiperidine), a selective antagonist of the CCR2 receptor, that does not induce chemotaxis and does not stimulate post‐receptor signaling (Mirzadegan et al. 2000).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11599565	On the next day, the slides were washed three times in PBST for 5 min each.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "next", "day", ",", "the", ...
PMC11695623	The infiltration of CD8+ T cells, B cells and DC decreased in the group with high expression of DCUN1D5 (Fig. 7E–G).Fig.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11686380	Neurons isolated at E16 were transfected with pCAG-EGFP vector together with Myc-GAP43 (WT) or GAP43-E111K, and cultured for 3 days.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11696659	Patient characteristics.	[ { "tags": [ "O", "O", "O" ], "tokens": [ "Patient", "characteristics", "." ] } ]
PMC11106977	During the adipogenic differentiation of BMSCs, Hh signaling is downregulated due to the decreased expression of transcription factor Gli .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "During", "the", "adipogenic"...
PMC11680049	The alteration of the internal organization of tissues under in vitro conditions affects the formation of secondary compounds while maintaining the growth characteristics and biosynthetic capacity of Sequoia tissues at a high level in vitro.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10443665	Interestingly, tragacanthin and bassorin followed two opposite trends in order to regulate MDR1 expression.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "tragacanthin", "and", "bassorin", "followed...
PMC10899471	ns: not significant. **	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ns", ":", "not", "significant", ".", "", "" ] } ]
PMC11525293	Actin was used as the loading control, and one representative experiment is shown.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Actin", "was", "used", "as", "the", "loading", "control", ",", ...
PMC11564322	The VGVAPG peptide decreased the KI67 protein expression by 15.51%, compared to the control, while the c-SRC inhibitor I increased the expression of this protein by 21.51%, compared to the control (Fig. 7C).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11476837	The results were expressed as a percentage of control cells (100%) incubated in medium only.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", "were", "expressed", ...
PMC10955424	GAPDH was used as a loading control.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GAPDH", "was", "used", "as", "a", "loading", "control", "." ] } ]
PMC9429973	No treatment related mortality (TRM) at 100 days post-SAT.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "treatment", "related", "mortality", "(", "TRM", ")", "at", "100", "days", ...
PMC11519583	MPs were transfected with siRNAs using Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, Waltham, MA) following the manufacturer’s instructions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MPs", ...
PMC11283030	Additionally, ACLY genetic knockdown and pharmacological inhibition could attenuate tumor progression and reduce LDs formation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "ACLY", "genetic", "knockdown", "a...
PMC9428827	All fluorochrome-conjugated mAbs used for flow cytometry measurement were from Thermo Fisher (Waltham, MA, USA) unless otherwise stated: fluorescein isothiocyanate (FITC) or BV-conjugated anti-CD3 (145-2C11), PE or APC-conjugated anti-CD4 (L3T4), PB or FITC-conjugated anti-Foxp3 (NRRF-30), PE-Cy7-conjugated anti-CD25(3C7), APC-Cy7-conjugated anti-CD8 (eBio H35-17.2), BV605 or APC anti-CD44 (IM7), PE-conjugated anti-CD122(5H4), and APC-conjugated anti-CD45(30-F11).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Mice injected with Cdk6-KO lines showed a significantly longer survival than mice injected with Cdk6-WT lines.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mice", "injected", "with", "Cdk6-KO", "lines", "showed...
PMC10387886	The cells were grown at 37 °C in 5% CO2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "grown", "at", "37", "°", "C", "in", "5", "%"...
PMC11704135	The present study assessed the minimum inhibitory concentration (MIC) of the pyrimidine compounds to determine their effectiveness against the tested microorganisms.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11541409	Clearly demonstrates that the non-KIT/PDGFRA mutants are one of the drug resistance mechenisms.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Clearly", "demonstrates", "that", "the", "non-KIT/PDGFRA", "mutants", "are", ...
PMC11540664	Compared with the difficulty and heterogeneity of tissue biopsy, peripheral blood lymphocytes are a simple clinical test index, based only on a simple routine blood test.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Additional analysis is ongoing.	[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Additional", "analysis", "is", "ongoing", "." ] } ]
PMC5311252	In fact, many different oncomotif-miRNAs have already been suggested as diagnostic and prognostic blood-based biomarkers for different cancer types.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "fact", ",", "man...
PMC2193049	The lyophilized samples were dissolved in 20 μl 1% TFA/ H2O.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "lyophilized", "samples", "were", "dissolved", "in", "20", "μl", "1", ...
PMC10968586	In an in vivo model of tumor xenograft (triple negative MDA-MB-231 cell line) in BALB/c OlaHsd-foxn1 mice, animals receiving 50 mg/kg OLE for 4 weeks showed a decrease in tumor size, together with a reduction in actors involved in cell growth/proliferation: transcription factor NF-κB and cyclin D1 .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC11320834	Liposomes are spherical phospholipid vesicles comprising one or more lipid bilayers with an internal aqueous cavity, creating hydrophilic and hydrophobic hollows .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Liposomes", ...
PMC11791478	Cytotoxicity activity of XB002 in A431 cells.	[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Cytotoxicity", "activity", "of", "XB002", "in", "A431", "cells", "." ] } ]
PMC8382973	Two common bacterial 16S rRNA gene amplification primers (purified by PAGE) were used: PCR forward primer 341F (5’-CCTACGGGNGGCWGCAC-3’) and PCR reverse primer 805R (5’-GACTACHVGGGTATCTAATCC-3’) (41).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11760643	The relative P2X7 expression on cells was determined as the difference between the MFI of anti‐P2X7 mAb and the isotype control mAb.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relat...
PMC5173112	The protein stability of IL-33 is maintained by USP21 through deubiquitination .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "protein", "stability", "of", "IL-33", "is", "maintained", "by", "USP21", "thro...
PMC4355729	The activated AKT positively regulates the expression of NCAD33, and the inhibition of the PI3K/AKT signaling inhibits the expression of NCAD39.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "activ...
PMC11768281	During malaria infection, a balance of Th1/Tfh is required to effectively control the parasite .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "During", "malaria", "infection", ",", "a", "balance", "of",...
PMC11767725	Together, these factors perpetuate the cycle of barrier dysfunction, immune activation, and microbial imbalance central to AD pathology .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Together", ",", "...
PMC11765988	In addition, BAFF, a pro-proliferative cytokine for B lymphocytes, is elevated (in correlation with ACE levels) and could trigger clonal proliferation .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10926885	Conversely, reduced expression levels in two specific tumour types (ALL, READ) were linked to bad prognosis(Figure S2A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Conversely", ...
PMC11486946	Single-molecule imaging began 1 min after the EGF addition.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single-molecule", "imaging", "began", "1", "min", "after", "the", "EGF", "addition", "." ] } ]
PMC11476837	In the case of SOD2 gene expression, a statistically significant change was observed only for the combination of 5 µM ML-385 and 1 nM doxorubicin (p < 0.05).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10812665	In order to detect a multitude of metabolites with wide-ranging physico-chemical properties, four different methods were used in parallel: (1) reverse phase (RP)/UPLC-MS/MS under positive ionization, (2) RP/UPLC-MS/MS under positive ionization optimized for more hydrophobic compounds, (3) RP/UPLC-MS/MS under negative ionization and (4) HILIC/UPLC-MS/MS (negative ionization).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9581083	In light of the safety and effectiveness profiles, NRICM101 can be considered as capable of ameliorating clinical symptoms of COVID-19 (Tsai et al., 2021).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11345828	The resultant compound was hydrogenated following General Procedure E to afford compound 60 (1.07 g, 83% yield), LCMS Method 2: RT = 1.639, 1.703 min, MS (ESI): m/z 798.2 (M + H).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11377827	Source data are available online for this figure.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Source", "data", "are", "available", "online", "for", "this", "figure", "." ] } ]
PMC9370419	The ability of HBx to regulate the cccDNA activity was limited until cccDNA was formed in the nucleus.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ability", "of", "HBx", "to", ...
PMC11661040	Compared with the CGREF1 knockdown group, activation of the wnt signaling pathway could restore the cell cycle blocking effect induced by CGREF1 knockdown (Fig. 5J-L).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9370419	We constructed and utilized an HBx-expressing SBHX21 cell line for drug library screening.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "constructed", "and", "utilized", "an", "HBx-expressing", "SBHX21",...
PMC9024365	Thresholds were determined such that all recognizable puncta were included in the analysis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thresholds", "were", "determined", "such", "that", "all", "recognizable", "...
PMC11604768	We then co-transfected HEK293 cells with a GPR91 expression plasmid and the AP1 reporters and measured firefly and Renilla luciferase activities after six hours of cis-epoxysuccinate treatment.	[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10728200	Statistical analyses were performed using GraphPad Prism (version 8.0.2, San Diego, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "analyses", "were", "performed", "using", ...
PMC9429973	Sex-ratio was 1.5.	[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Sex-ratio", "was", "1.5", "." ] } ]
PMC8009078	Furthermore, Gly97 was found to interact with 4′ hydroxyphenyl group linkage with chromone ring through one HB interaction with a distance of 1.86.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11730320	By 2 years of age, the number of circulating CD19+ B cells remained consistently normal or borderline high.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "2", "years", "of...
PMC10547921	Although SN-38 has the desired potency, the preparation of active conjugates is challenging due to its highly hydrophobic nature and the limited number of conjugation sites available.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Results: Considering that c-Fos was found to be controlled by BCR signalling in pre-B cells, we evaluated whether BCR signalling affect c-Fos also in CLL cells: we found that c-Fos expression increases in primary CLL cells after Ibrutinib treatment.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11765678	Samples were centrifuged for 15 min at 14,000× g at 4 °C, and supernatant aliquoted and stored at −80 °C.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973	Summary/Conclusion: The assessment of MRD by MFC showed predictive power at the different moments of follow-up evaluated.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "The", "assessment...
PMC7612475	Cells were then pelleted and resuspended gently in 10 mL prewarmed 0.075 mol/L KCl incubated at 37°C for 20 minutes, following which, 2 mL of Carnoy's fixative (3:1 methanol/acetic acid) was mixed in and the cells pelleted.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10957991	Such cells were cultured on 2D-space restricted patterns to reach rapid confluency of the epithelial sheets (Fig. 3A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Such", "cells", "were", ...
PMC3995603	These materials were confirmed taxonomically by Professor Je-Hyun Lee of Dongguk University, Korea.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "materials", "were", "confirmed", "taxonomically", "by", "Prof...
PMC9812014	In contrast, the positive control lamivudine showed only 29.6 and 35.4 percent inhibitory activity at a concentration of 1.0 μmol/mL against the HBsAg and HBeAg secretions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11261875	Targeting glycolysis as a therapeutic approach shows significant promise as a novel strategy for GIST treatment.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Targeting", "glycolysis", "as", "a", "therapeutic", "a...
PMC9503685	IC50 values were calculated using the Graphpad prism program and were shown in Table 2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "IC50", "values", "were", "calculated", "using", "the", "Gra...
PMC11412721	Means ± SEM from >3 experiments with ≥2 independent MEF clones. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Means", "±", "SEM", "from", ">", "3", "experiments", "with", "≥2", ...
PMC9848491	The ROC curve at 1-, 3-, and 5-year survival based on internal validation cohort. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ROC", "curve", "at", "1-", ",", ...
PMC11352746	were used, as directed by the manufacturers.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "were", "used", ",", "as", "directed", "by", "the", "manufacturers", "." ] } ]
PMC5810978	For the Cell Crown system, 1 mL serum-free medium with or without GCDCA was added to both the inside and outside of the membrane holding the intestinal tissues, and immediately inoculated with 100 μl of GIII.2 BoNoV filtrates (approx.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11766350	First, 10 µL of each sample was treated with 1.25 U/µL Benzonase (Merck, Darmstadt, Germany), followed by 6 U/mL proteinase K (Thermo Fisher Scientific, Dublin, Ireland) digestion.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740907	Ultimately, the microemulsion was slowly distributed in water chilled to a temperature of 2–4°C, with a volume ratio of 1:10, while stirring at a speed of 3000 rpm.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9964635	It has been linked to a number of human cancers .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "linked", "to", "a", "number", "of", "human", "cancers", "." ] }...
PMC10810426	Here we show that MLV requires cell division to efficiently enter the nucleus of NIH3T3 cells, although low levels of infection could be detected in quiescent cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10362265	Essential dynamics of the systems were extracted by principal component analysis (PCA) using Bio3D .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Essential", "dynamics", "of", "the", "systems", "were"...
PMC11143482	The animal room was kept under a constant 14/10 light-dark cycle (7:00 AM–9:00 PM) with a room temperature of 19 ± 2°C.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11495567	Here we report that NCI-H23 cells show similar sensitivity to PCAIs.	[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Here", "we", "report", "that", "NCI-H23", "cells", "show", "similar", "sensitivity...
PMC10154097	Henceforth, Huh7 and BEL-7404 cells were divided into different treatment groups.	[ { "tags": [ "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Henceforth", ",", "Huh7", "and", "BEL-7404", "cells", "were", "divid...
PMC9545474	H NMR (400 MHz, D2O): δ 8.26 (2H, d, J H‐H=10.6 Hz, H15), 8.01 (2H, d, J H‐H=5.0 Hz, H11), 7.66 (6H, m, H13, H14, and H18), 7.55 (2H, t, J H‐H=8.12 Hz, H17), 5.87 (2H, d, J H‐H=5.6 Hz, H3), 5.48 (2H, d, J H‐H=5.6 Hz, H4), 2.59 (1H, sept, J H‐H=6.6 Hz, H6), 1.70 (3H, s, H1), 1.12 (6H, d, J H‐H=6.8 Hz, H7) ppm.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10079526	F Total lysates of the panel of ten lymphoma cell lines were analyzed for protein expression levels of DNMT1, UBA2, MYC, UBC9, SUMO2/3 and SUMO1 by immunoblotting.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11661024	Finally, two isolates were randomly chosen to evaluate the morphology, motility, oxidase, catalase, and gram’s reaction.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",...
PMC11024707	Subsequent studies revealed the critical role of mi-RNA-125b-5p in the regulation of cell proliferation, apoptosis, and extracellular matrix .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Subsequent", "studies", "rev...
PMC10858941	Statistical significance was assessed by Student’s t-test and asterisks represent different significance levels in t-test (p < 0.05; p < 0.01; and **p < 0.001).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Summary/Conclusion: In our case report, we presented the rare and most severe variant of GBS, AMSAN, that complicated COVID-19-related disease in its recovery phase.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11731161	Lentiviral vector-mediated doxycycline (DOX)-inducible shRNA was constructed to knock down USP7 expression in MM cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lentiviral", "vector-mediated", "doxycycline", "(DOX)-inducible", "shRN...
PMC9250505	injection.	[ { "tags": [ "O", "O" ], "tokens": [ "injection", "." ] } ]
PMC9429973	There was no statistically significant difference in PCR results before and during/after infection (p>0.2).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "was", "no", "statistically", "significant", "...
PMC8922418	The other co-receptor of HIV-1, CXCR4, plays an important role in maintaining the normal physiological function of hematopoietic stem cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "other...
PMC11736898	To control intensity of color development, all sections were incubated with the substrate for the same length of time, 60 s. Primary antibody was omitted for the negative controls.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9592219	All cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 mg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA) in a controlled humidified incubator at 5% CO2 and 37°C.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9777812

Bta-miR-106b belongs to the bta-miR-106b-25 cluster (containing bta-miR-106b, miR-93, and miR-25) and plays important roles in cancer , cell differentiation , cell proliferation processes , cell cycle , and breast cancer .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9516401

The hydro-alcoholic extract was then dried and crude extract was kept frozen at below −18C for the following use.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "hydro-alcoholic", "extract", ...

PMC11750161

The locations of the constitutively activating mutations (M410T, K469R, and D590Y) and two inactivating mutations (D417N and Y558F) are indicated.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10823017

β-actin; forward: AGAGCTACGAGCTGCCTGAC and reverse; AGCACTGTGTTGGCGTACAG was used as the housekeeping gene.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "β-actin", ";", "forward", ":", "AGAGCTACGAGCTGCCTGAC", "and", ...

PMC11806818

Fig. 2Aptasensors for the detection of MCF-7 CTCs. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "Fig.", "2Aptasensors", "for", "the", "detection", "of", "MCF-7", "CTCs", ".", "(" ] } ]

PMC10366908

A five-week-old Sprague–Dawley rat was purchased from CLEA Japan (Tokyo, Japan).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "five-week-old", "Sprague", "–", "Dawley", "rat", ...

PMC9429973

H. Dohner, P. Montesinos, S. Vives Polo, E. Zarzycka, J. Wang, G. Bertani, M. Heuser, R. Calado, A. Schuh, S.-P. Yeh, A. de la Fuente, C. Cerchione, S. Daigle, J. Hui, S. Pandya, D. Gianolio, C. Recher, S. de Botton Ulm University Hospital, Ulm, Germany; Hospital Universitari i Politècnic La Fe, València; Hospital Universitario Germans Trias i Pujol-ICO Badalona, Josep Carreras Research Institute, Badalona, Spain; Department of Hematology and Transplantology, Medical University of Gdansk, Gdansk, Poland; Institute of Hematology & Hospital of Blood Disease, Tianjin, China; ASST Grande Ospedale Metropolitano Niguarda, Milan, Italy; Hannover Medical School, Hannover, Germany; Ribeirão Preto School of Medicine, University of São Paulo, São Paulo, Brazil; Princess Margaret Cancer Centre, Toronto, Canada; China Medical University, Taichung, Taiwan; MD Anderson Cancer Center Madrid, Madrid, Spain; Hematology Unit, Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS, Meldola, Italy; Servier Pharmaceuticals, Boston, United States of America; Institut Universitaire du Cancer de Toulouse Oncopole, Toulouse; Institut Gustave Roussy, Villejuif, France Background: Ivosidenib (IVO) is a potent oral targeted inhibitor of mutant isocitrate dehydrogenase 1 (mIDH1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11462673

The shRNA was synthesized and its incorporation into the pLKO.1 vector were carried out by IGE Biotechnology LTD, China.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "shRNA", "was", ...

PMC11653533

Finally, the aqueous leaf extract of F. religiosa has exhibited anti-asthmatic activity on histamine and acetylcholine-induced bronchospasm in an animal model of guinea pig, where 300 mg extract increased latency of pre-convulsion time of histamine and acetylcholine by 167.0 ± 5.7 and 273.0 ± 5.7 s respectively (Kapoor et al., 2011).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11451829

On day 23, all animals were euthanized under anesthesia and an intracardiac overdose of embutramide (200 mg/kg) + mebezonium iodide (50 mg/kg) + tetracaine hydrochloride (5 mg/kg), (T61, MSD, Salud Animal, Mexico City, Mexico).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC6617630

We also demonstrate that BET inhibition in DHL/THL cells, target BCL6 but has no inhibitory effect on BCL-2 protein.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "also", "demonstrate", ...

PMC11089031

The protein was separated on 10% polyacrylamide gel (PAGE) and transferred to 0.45 μm nitrocellulose (NC) filter membrane (Millipore, Massachusetts, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11190538

Transmission electron microscopy (TEM) was utilized to analyze and observe the morphology of nanophytosomes.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transmission", "electron", "microscopy", "(", "TEM", "...

PMC9031474

The reduced derivatives 55/56 still showed some antiproliferative activity suggesting that the presence of a dialdehyde structure causes a part of the cytotoxicity.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC10882807

Correlation between EIF4A3 and hsa_circ_0005397 mRNA expression in HCC tissues (n = 57). (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "between", "EIF4A3", "and", "hsa_circ_0005397"...

PMC11747949

To interrogate CCL2‐CCR2 axis blockade we selected a small organic molecule RS504393 (spiropiperidine), a selective antagonist of the CCR2 receptor, that does not induce chemotaxis and does not stimulate post‐receptor signaling (Mirzadegan et al. 2000).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11599565

On the next day, the slides were washed three times in PBST for 5 min each.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "next", "day", ",", "the", ...

PMC11695623

The infiltration of CD8+ T cells, B cells and DC decreased in the group with high expression of DCUN1D5 (Fig. 7E–G).Fig.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11686380

Neurons isolated at E16 were transfected with pCAG-EGFP vector together with Myc-GAP43 (WT) or GAP43-E111K, and cultured for 3 days.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11696659

Patient characteristics.

[ { "tags": [ "O", "O", "O" ], "tokens": [ "Patient", "characteristics", "." ] } ]

PMC11106977

During the adipogenic differentiation of BMSCs, Hh signaling is downregulated due to the decreased expression of transcription factor Gli .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "During", "the", "adipogenic"...

PMC11680049

The alteration of the internal organization of tissues under in vitro conditions affects the formation of secondary compounds while maintaining the growth characteristics and biosynthetic capacity of Sequoia tissues at a high level in vitro.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10443665

Interestingly, tragacanthin and bassorin followed two opposite trends in order to regulate MDR1 expression.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "tragacanthin", "and", "bassorin", "followed...

PMC10899471

ns: not significant. **

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ns", ":", "not", "significant", ".", "*", "*" ] } ]

PMC11525293

Actin was used as the loading control, and one representative experiment is shown.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Actin", "was", "used", "as", "the", "loading", "control", ",", ...

PMC11564322

The VGVAPG peptide decreased the KI67 protein expression by 15.51%, compared to the control, while the c-SRC inhibitor I increased the expression of this protein by 21.51%, compared to the control (Fig. 7C).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11476837

The results were expressed as a percentage of control cells (100%) incubated in medium only.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", "were", "expressed", ...

PMC10955424

GAPDH was used as a loading control.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GAPDH", "was", "used", "as", "a", "loading", "control", "." ] } ]

PMC9429973

No treatment related mortality (TRM) at 100 days post-SAT.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "treatment", "related", "mortality", "(", "TRM", ")", "at", "100", "days", ...

PMC11519583

MPs were transfected with siRNAs using Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, Waltham, MA) following the manufacturer’s instructions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MPs", ...

PMC11283030

Additionally, ACLY genetic knockdown and pharmacological inhibition could attenuate tumor progression and reduce LDs formation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "ACLY", "genetic", "knockdown", "a...

PMC9428827

All fluorochrome-conjugated mAbs used for flow cytometry measurement were from Thermo Fisher (Waltham, MA, USA) unless otherwise stated: fluorescein isothiocyanate (FITC) or BV-conjugated anti-CD3 (145-2C11), PE or APC-conjugated anti-CD4 (L3T4), PB or FITC-conjugated anti-Foxp3 (NRRF-30), PE-Cy7-conjugated anti-CD25(3C7), APC-Cy7-conjugated anti-CD8 (eBio H35-17.2), BV605 or APC anti-CD44 (IM7), PE-conjugated anti-CD122(5H4), and APC-conjugated anti-CD45(30-F11).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Mice injected with Cdk6-KO lines showed a significantly longer survival than mice injected with Cdk6-WT lines.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mice", "injected", "with", "Cdk6-KO", "lines", "showed...

PMC10387886

The cells were grown at 37 °C in 5% CO2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "grown", "at", "37", "°", "C", "in", "5", "%"...

PMC11704135

The present study assessed the minimum inhibitory concentration (MIC) of the pyrimidine compounds to determine their effectiveness against the tested microorganisms.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC11541409

Clearly demonstrates that the non-KIT/PDGFRA mutants are one of the drug resistance mechenisms.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Clearly", "demonstrates", "that", "the", "non-KIT/PDGFRA", "mutants", "are", ...

PMC11540664

Compared with the difficulty and heterogeneity of tissue biopsy, peripheral blood lymphocytes are a simple clinical test index, based only on a simple routine blood test.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Additional analysis is ongoing.

[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Additional", "analysis", "is", "ongoing", "." ] } ]

PMC5311252

In fact, many different oncomotif-miRNAs have already been suggested as diagnostic and prognostic blood-based biomarkers for different cancer types.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "fact", ",", "man...

PMC2193049

The lyophilized samples were dissolved in 20 μl 1% TFA/ H2O.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "lyophilized", "samples", "were", "dissolved", "in", "20", "μl", "1", ...

PMC10968586

In an in vivo model of tumor xenograft (triple negative MDA-MB-231 cell line) in BALB/c OlaHsd-foxn1 mice, animals receiving 50 mg/kg OLE for 4 weeks showed a decrease in tumor size, together with a reduction in actors involved in cell growth/proliferation: transcription factor NF-κB and cyclin D1 .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "...

PMC11320834

Liposomes are spherical phospholipid vesicles comprising one or more lipid bilayers with an internal aqueous cavity, creating hydrophilic and hydrophobic hollows .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Liposomes", ...

PMC11791478

Cytotoxicity activity of XB002 in A431 cells.

[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Cytotoxicity", "activity", "of", "XB002", "in", "A431", "cells", "." ] } ]

PMC8382973

Two common bacterial 16S rRNA gene amplification primers (purified by PAGE) were used: PCR forward primer 341F (5’-CCTACGGGNGGCWGCAC-3’) and PCR reverse primer 805R (5’-GACTACHVGGGTATCTAATCC-3’) (41).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11760643

The relative P2X7 expression on cells was determined as the difference between the MFI of anti‐P2X7 mAb and the isotype control mAb.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relat...

PMC5173112

The protein stability of IL-33 is maintained by USP21 through deubiquitination .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "protein", "stability", "of", "IL-33", "is", "maintained", "by", "USP21", "thro...

PMC4355729

The activated AKT positively regulates the expression of NCAD33, and the inhibition of the PI3K/AKT signaling inhibits the expression of NCAD39.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "activ...

PMC11768281

During malaria infection, a balance of Th1/Tfh is required to effectively control the parasite .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "During", "malaria", "infection", ",", "a", "balance", "of",...

PMC11767725

Together, these factors perpetuate the cycle of barrier dysfunction, immune activation, and microbial imbalance central to AD pathology .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Together", ",", "...

PMC11765988

In addition, BAFF, a pro-proliferative cytokine for B lymphocytes, is elevated (in correlation with ACE levels) and could trigger clonal proliferation .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC10926885

Conversely, reduced expression levels in two specific tumour types (ALL, READ) were linked to bad prognosis(Figure S2A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Conversely", ...

PMC11486946

Single-molecule imaging began 1 min after the EGF addition.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single-molecule", "imaging", "began", "1", "min", "after", "the", "EGF", "addition", "." ] } ]

PMC11476837

In the case of SOD2 gene expression, a statistically significant change was observed only for the combination of 5 µM ML-385 and 1 nM doxorubicin (p < 0.05).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10812665

In order to detect a multitude of metabolites with wide-ranging physico-chemical properties, four different methods were used in parallel: (1) reverse phase (RP)/UPLC-MS/MS under positive ionization, (2) RP/UPLC-MS/MS under positive ionization optimized for more hydrophobic compounds, (3) RP/UPLC-MS/MS under negative ionization and (4) HILIC/UPLC-MS/MS (negative ionization).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9581083

In light of the safety and effectiveness profiles, NRICM101 can be considered as capable of ameliorating clinical symptoms of COVID-19 (Tsai et al., 2021).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11345828

The resultant compound was hydrogenated following General Procedure E to afford compound 60 (1.07 g, 83% yield), LCMS Method 2: RT = 1.639, 1.703 min, MS (ESI): m/z 798.2 (M + H).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11377827

Source data are available online for this figure.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Source", "data", "are", "available", "online", "for", "this", "figure", "." ] } ]

PMC9370419

The ability of HBx to regulate the cccDNA activity was limited until cccDNA was formed in the nucleus.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ability", "of", "HBx", "to", ...

PMC11661040

Compared with the CGREF1 knockdown group, activation of the wnt signaling pathway could restore the cell cycle blocking effect induced by CGREF1 knockdown (Fig. 5J-L).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9370419

We constructed and utilized an HBx-expressing SBHX21 cell line for drug library screening.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "constructed", "and", "utilized", "an", "HBx-expressing", "SBHX21",...

PMC9024365

Thresholds were determined such that all recognizable puncta were included in the analysis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thresholds", "were", "determined", "such", "that", "all", "recognizable", "...

PMC11604768

We then co-transfected HEK293 cells with a GPR91 expression plasmid and the AP1 reporters and measured firefly and Renilla luciferase activities after six hours of cis-epoxysuccinate treatment.

[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10728200

Statistical analyses were performed using GraphPad Prism (version 8.0.2, San Diego, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "analyses", "were", "performed", "using", ...

PMC9429973

Sex-ratio was 1.5.

[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Sex-ratio", "was", "1.5", "." ] } ]

PMC8009078

Furthermore, Gly97 was found to interact with 4′ hydroxyphenyl group linkage with chromone ring through one HB interaction with a distance of 1.86.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11730320

By 2 years of age, the number of circulating CD19+ B cells remained consistently normal or borderline high.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "2", "years", "of...

PMC10547921

Although SN-38 has the desired potency, the preparation of active conjugates is challenging due to its highly hydrophobic nature and the limited number of conjugation sites available.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Results: Considering that c-Fos was found to be controlled by BCR signalling in pre-B cells, we evaluated whether BCR signalling affect c-Fos also in CLL cells: we found that c-Fos expression increases in primary CLL cells after Ibrutinib treatment.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11765678

Samples were centrifuged for 15 min at 14,000× g at 4 °C, and supernatant aliquoted and stored at −80 °C.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC9429973

Summary/Conclusion: The assessment of MRD by MFC showed predictive power at the different moments of follow-up evaluated.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "The", "assessment...

PMC7612475

Cells were then pelleted and resuspended gently in 10 mL prewarmed 0.075 mol/L KCl incubated at 37°C for 20 minutes, following which, 2 mL of Carnoy's fixative (3:1 methanol/acetic acid) was mixed in and the cells pelleted.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10957991

Such cells were cultured on 2D-space restricted patterns to reach rapid confluency of the epithelial sheets (Fig. 3A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Such", "cells", "were", ...

PMC3995603

These materials were confirmed taxonomically by Professor Je-Hyun Lee of Dongguk University, Korea.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "materials", "were", "confirmed", "taxonomically", "by", "Prof...

PMC9812014

In contrast, the positive control lamivudine showed only 29.6 and 35.4 percent inhibitory activity at a concentration of 1.0 μmol/mL against the HBsAg and HBeAg secretions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11261875

Targeting glycolysis as a therapeutic approach shows significant promise as a novel strategy for GIST treatment.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Targeting", "glycolysis", "as", "a", "therapeutic", "a...

PMC9503685

IC50 values were calculated using the Graphpad prism program and were shown in Table 2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "IC50", "values", "were", "calculated", "using", "the", "Gra...

PMC11412721

Means ± SEM from >3 experiments with ≥2 independent MEF clones. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Means", "±", "SEM", "from", ">", "3", "experiments", "with", "≥2", ...

PMC9848491

The ROC curve at 1-, 3-, and 5-year survival based on internal validation cohort. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ROC", "curve", "at", "1-", ",", ...

PMC11352746

were used, as directed by the manufacturers.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "were", "used", ",", "as", "directed", "by", "the", "manufacturers", "." ] } ]

PMC5810978

For the Cell Crown system, 1 mL serum-free medium with or without GCDCA was added to both the inside and outside of the membrane holding the intestinal tissues, and immediately inoculated with 100 μl of GIII.2 BoNoV filtrates (approx.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11766350

First, 10 µL of each sample was treated with 1.25 U/µL Benzonase (Merck, Darmstadt, Germany), followed by 6 U/mL proteinase K (Thermo Fisher Scientific, Dublin, Ireland) digestion.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11740907

Ultimately, the microemulsion was slowly distributed in water chilled to a temperature of 2–4°C, with a volume ratio of 1:10, while stirring at a speed of 3000 rpm.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9964635

It has been linked to a number of human cancers .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "linked", "to", "a", "number", "of", "human", "cancers", "." ] }...

PMC10810426

Here we show that MLV requires cell division to efficiently enter the nucleus of NIH3T3 cells, although low levels of infection could be detected in quiescent cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10362265

Essential dynamics of the systems were extracted by principal component analysis (PCA) using Bio3D .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Essential", "dynamics", "of", "the", "systems", "were"...

PMC11143482

The animal room was kept under a constant 14/10 light-dark cycle (7:00 AM–9:00 PM) with a room temperature of 19 ± 2°C.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11495567

Here we report that NCI-H23 cells show similar sensitivity to PCAIs.

[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Here", "we", "report", "that", "NCI-H23", "cells", "show", "similar", "sensitivity...

PMC10154097

Henceforth, Huh7 and BEL-7404 cells were divided into different treatment groups.

[ { "tags": [ "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Henceforth", ",", "Huh7", "and", "BEL-7404", "cells", "were", "divid...

PMC9545474

H NMR (400 MHz, D2O): δ 8.26 (2H, d, J H‐H=10.6 Hz, H15), 8.01 (2H, d, J H‐H=5.0 Hz, H11), 7.66 (6H, m, H13, H14, and H18), 7.55 (2H, t, J H‐H=8.12 Hz, H17), 5.87 (2H, d, J H‐H=5.6 Hz, H3), 5.48 (2H, d, J H‐H=5.6 Hz, H4), 2.59 (1H, sept, J H‐H=6.6 Hz, H6), 1.70 (3H, s, H1), 1.12 (6H, d, J H‐H=6.8 Hz, H7) ppm.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10079526

F Total lysates of the panel of ten lymphoma cell lines were analyzed for protein expression levels of DNMT1, UBA2, MYC, UBC9, SUMO2/3 and SUMO1 by immunoblotting.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11661024

Finally, two isolates were randomly chosen to evaluate the morphology, motility, oxidase, catalase, and gram’s reaction.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",...

PMC11024707

Subsequent studies revealed the critical role of mi-RNA-125b-5p in the regulation of cell proliferation, apoptosis, and extracellular matrix .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Subsequent", "studies", "rev...

PMC10858941

Statistical significance was assessed by Student’s t-test and asterisks represent different significance levels in t-test (*p < 0.05; **p < 0.01; and ***p < 0.001).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Summary/Conclusion: In our case report, we presented the rare and most severe variant of GBS, AMSAN, that complicated COVID-19-related disease in its recovery phase.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11731161

Lentiviral vector-mediated doxycycline (DOX)-inducible shRNA was constructed to knock down USP7 expression in MM cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lentiviral", "vector-mediated", "doxycycline", "(DOX)-inducible", "shRN...

PMC9250505

injection.

[ { "tags": [ "O", "O" ], "tokens": [ "injection", "." ] } ]

PMC9429973

There was no statistically significant difference in PCR results before and during/after infection (p>0.2).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "was", "no", "statistically", "significant", "...

PMC8922418

The other co-receptor of HIV-1, CXCR4, plays an important role in maintaining the normal physiological function of hematopoietic stem cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "other...

PMC11736898

To control intensity of color development, all sections were incubated with the substrate for the same length of time, 60 s. Primary antibody was omitted for the negative controls.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9592219

All cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 mg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA) in a controlled humidified incubator at 5% CO2 and 37°C.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...