Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11588008
After co-culturing with HUC-MSCs, the level of γ-GCS in cells increased significantly compared with the model group (P < 0.05) (Figure 6b).
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10571053
While P-gp does not appear to confer resistance to erastin in our studies, erastin does stimulate ATPase activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "P-gp", "does", "not", ...
PMC10006224
Total RNA samples (500 ng) were processed with the “NEBNext Single Cell/Low Input RNA Library Prep” kit (NEB #E6420) by following manufacturer instructions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7504302
The findings of this study suggest that ZEB1 may serve as a promising therapeutic target in MPM .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "findings", "of", "this", "study", "s...
PMC7961460
Interestingly, SDS-PAGE revealed the presence of several bands.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "SDS-PAGE", "revealed", "the", "presence", "of", "several", "bands", "." ] } ]
PMC7192625
DNA methylation was found to be assortative in the PCHi-C PP subnetwork of neutrophils but not in the Hi-C networks for a lymphoblastoid cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC6642070
The p53RRE of CD44 gene was used as a positive control. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "p53RRE", "of", "CD44", "gene", "was", "used", "as", "a", "positive"...
PMC10891340
In recent years, CCCP has been widely used to induce autophagic degradation of damaged mitochondria (Youle and Narendra, 2011), mechanically CCCP could induce autophagy and reduce apoptosis through a ROS-mediated pathway (Ding et al., 2010).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10988808
Quantification of protein expression revealed that knocking down LATS1 inhibited YAP phosphorylation, while the effect of LATS2 was relatively low.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Quantification", "of", ...
PMC11413393
The establishment of differentially methylated states for substrate interactors of PRMT1 has traditionally been achieved through chemical inhibition of type I PRMTs, which lacks specificity for PRMT1, or via genetic depletion of the enzyme, which is prone to off-target effects.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Median FU was 9.9 months [4.5-17.2].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "FU", "was", "9.9", "months", "[", "4.5", "-", "17.2", "]", "." ] } ]
PMC11522251
p < 0.001, ** p < Lo0.01 and ns (not significant) for cetuximab experimental group relative to control group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p", ...
PMC6742971
After an incubation of 1 h at RT, the plates were washed 3x with wash buffer and 3x with distilled water (both sides of the membrane, peeling off the plate bottom).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4839679
We performed a comprehensive RNA-Seq analysis using a ccRCC cell line engineered with and without PBRM1 re-expression in order to specifically identify PBRM1 regulated genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11765243
Altered differentiation and function of some mature T cell subsets including Tfh and Treg can also be observed in vitro and in immune responses to protein antigens in vivo.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3813807
miR-21 has been shown to be correlated with Helicobacter pylori infection and gastric cancer progression (10).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "miR-21", "has", "been", "shown", "to",...
PMC10391797
All experiments were repeated three times.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "experiments", "were", "repeated", "three", "times", "." ] } ]
PMC11244823
The supernatant of gD1(83)-nLuc-V5-H6X was precipitated with four volumes of acetone and resuspended in 25 μl of Laemmli sample buffer (8% SDS, 40% glycerol, 10% mercaptoethanol, 200 mM Tris pH 6.8, 0.4% bromophenol blue).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11306331
We also note that fewer cells expressing high levels of MBP showed very high enrichment scores prior to illumination compared to cells with low MBP levels (Fig. 3B, top row), which could result from baseline dark-state binding between solubilizer and condensate partially limiting 3xFUS condensation in these cells, or from other effects of high intracellular MBP expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11271800
This skews the functional expression of M2 TAMs and allows for a significant increase in the number of M2 TAMs and Treg cells to promote immune evasion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Dosing continues in these patients and the study is actively enrolling.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dosing", "continues", "in", "these", "patients", "and", "the", "study", "is", "active...
PMC9429973
Our survey consisted in a first questionnaire concerning patients, disease characteristics and treatments including allogeneic stem cell transplant (allo-HSCT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "surve...
PMC11792766
The viability and number of bacterial cells were determined via trypan blue staining and light microscopy counting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "viability", "and", "number", "of", "...
PMC11799978
Single cells were resuspended in cell staining solution (1% bovine serum albumin in PBS) at a density of 5–10 × 10 cell/mL. The TruStain fcX PLUS antimouse CD16/32 antibody (dilution 1:100, #156603, BioLegend) was used to block nonspecific receptor.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11715644
We fabricate substrates with unconfined (open) regions adjacent to confined (narrow or wide) channels to study monolayer migration into confinement.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11754094
g, Schematic of potential cellular mechanisms generating DNA large deletion by BEs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "g", ",", "Schematic", "of", "potential", "cellular", "mechanisms", "generat...
PMC10490530
Non-immunoprecipitated chromatin was used as total input control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Non-immunoprecipitated", "chromatin", "was", "used", "as", "total", "input", "control", "." ] } ]
PMC8358006
b H3K27me3, H3K4me3, H3K4me1, and H3K27ac density at the tumor-suppressor TP53 and oncogene RSPO3 in NE2 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "b", "H3K27me3", ","...
PMC11618052
0.56 (hexane : ethyl acetate, 1 : 2, v/v).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "0.56", "(", "hexane", ":", "ethyl", "acetate", ",", "1", ":", "...
PMC7823217
The major advantage of bioprinting is the ability to precisely control and define the desired structure of the tissue construct according to the 3D design .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11306331
Cells were harvested after six hours of illumination for RNASeq.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "harvested", "after", "six", "hours", "of", "illumination", "for", "RNASeq", ...
PMC6222726
The leaflets are up to 1.5 cm long.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "leaflets", "are", "up", "to", "1.5", "cm", "long", "." ] } ]
PMC10998613
Autocorrelation function applied for fluorescence signal in green and red channels, represents fluctuations in fluorescence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Autocorrelation", "function", "applied", "for", "fluorescenc...
PMC11185260
Compared to normal cells, tumor cells maintain many times higher level of TfR expression on their surface in response to increased iron demand.30 It was also shown that TfR level can be correlated with tumor stage or cancer progression.31 In our study, TfR serves as the binding target for receptor-mediated endocytosis into rhabdoid tumor cells via the TfRscFv targeting moiety that decorates the surface of scL-SMARCB1 nanocomplex.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10291556
However, due to the complex intracellular environment consisting of many enzymes, identifying the product(s) is a complicated problem whose detailed study is beyond the scope of this work and deserves a separate study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11093197
We observed a reduction of EGFR expression and phosphorylation in RB1‐knockout MCF10A cells (Figure 4C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "observed", "a", "reduction", "of",...
PMC11747949
In agreement with this notion, we observe that 143B cells have high expression of both markers, PD‐L1 and CD44, and hypoxia causes downregulation of both, PD‐L1 and CD44 expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9100622
We then showed that this increase can be rescued by MEV and GGpp but not by Fpp in A673 cells (Figure 5D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "token...
PMC11687663
Every segment of the global population is impacted by HCC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Every", "segment", "of", "the", "global", "population", "is", "impacted", "by", "HCC", "."...
PMC11413393
Proteins were separated on 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels (BioRad, #4568084) using the Mini-PROTEAN® Electrophoresis System (BioRad).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11438317
Proteins were transferred to nitrocellulose membranes after SDS-PAGE, and the presence of potential substrates in the precipitates was detected by Western Blot.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Protein...
PMC11365427
The differential gene selection criteria were |log2FC| > 1 and P < 0.05.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "differential", "gene", "selection", "criteria", "were", "|log2FC|", ...
PMC6742971
High and low avidity T cells seem to participate both in immune responses against tumors in humans and animals.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "High", "and", "low", "avidity", ...
PMC10849234
Thus, using HSCs is technically intensive.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "using", "HSCs", "is", "technically", "intensive", "." ] } ]
PMC11786767
Since miR constructs coexpress GFP, GFP signals were used to label transfected cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "miR", "constructs", "coexpress", "GFP", ",", "GFP", "si...
PMC11747467
After exposing RC48, we found that the JAK/STAT3 pathway showed a higher activation ( Figure 4H ; Supplementary Tables S6 , S7 ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11759543
The other is grade 3, stage C papillary urothelial carcinoma, originating from a female of Asian descent in an area endemic to Blackfoot disease in Taiwan .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9712534
FRAP analysis was performed on EGFP-TOP2B H58Y as described in (a). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FRAP", "analysis", "was", "performed", "on", "EGFP-TOP2B", "H58Y", ...
PMC10965315
However, excessive ROS production can produce adverse effects on cellular components including proteins, lipids, and nucleic acids, which results in the induction of cell death signaling pathways (Li et al., 2018; Siddiqui et al., 2017).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11695623
Lung cancer is the leading cause of cancer death in men and women aged 50 and older, with far more deaths than breast, prostate and colorectal cancer combined.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC2193049
For metabolic labeling, 3 × 10 cells were transfected with 4 μg plasmid DNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "metabolic", "labeling", ",", "3", "×", "10", "...
PMC11787355
f Detection of LDH released into the medium after 24 h coculture of TCR-T cells and target cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "f", "Detection", "of", "LDH", "release...
PMC11519567
This suggests that remodeling of the oncogenic fusion protein SS18-SSX condensates is associated with H2AK119ub in cells compared with wild-type SS18.Fig.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "suggests", ...
PMC11310713
Therefore, we induced a mechanical gradient of GTBs by crosslinking different calcium solutions under each preparation step.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "we", "induced", "a",...
PMC11750712
Source data AUTO4 CAR T cell expansion and persistence were assessed in all infused patients in PB by flow cytometry and digital droplet polymerase chain reaction (ddPCR), and in lymph nodes by ddPCR and immunofluorescence (IF).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8041314
Hence, multitarget ABC transporter inhibition might be a novel and promising approach to treat multidrug-resistant cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hence", ",", "multitarget", "ABC", "transporter",...
PMC11684297
Thioflavin T (ThT) is a dye that specifically binds to amyloids, gives enhanced fluorescence, and is used as a gold standard to detect the presence of amyloids.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11551844
HT-29 cells were treated with the samples at 0.1, 1, 10 and 100 μg mL, and light microscopic images were acquired (Fig. 7).
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11694066
Altogether, these results suggested that the combination of PARPi and ATRi could act synergistically in DSRCT cells that express PARP1, both in vitro and in vivo.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8345486
In the abdominal cavity of patients with advanced-stage ovarian cancer, single cancer cells are suspended in the peritoneal cavity fluid (ascites), whereas multicellular aggregates cover the peritoneum.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8068766
The use of computational methods to analyze the regulation of gene expression values in cancer cells is a powerful guide to develop novel targeted-therapeutic strategies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC7136814
Plates were then washed with PBS to remove nonadherent dead cells, and live adherent cells were harvested with 0.25% Trypsin/10 mM EDTA in PBS, stained for intracellular markers, and analyzed by flow cytometry.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11706776
KCNN1 is overexpressed in ES patient biopsies, and its expression is inversely correlated with patient survival.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "KCNN1", "is", "overexpressed", "in", "ES", ...
PMC11277157
As an example is the set of ANKRD36 family members, which was implicated in the pathology of immune and metabolic diseases , and considered as a potential diagnosis marker of Chronic myeloid leukemia .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11422497
C-D) RT-qPCR analysis demonstrating the downregulation of miR-494-3p in GIST-T1 and GIST-882 cells lines and tissues, compared to HGSMC cells and adjacent tissues. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC11470999
Subsequent immunoblot assays analysis confirmed that CIP2A is a binding protein of PF. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Subsequent", "immunoblot", "assays", "analysis", "confirmed", "that", ...
PMC11476837
Our results showed that HL-60/DR cells were resistant toward doxorubicin and the cytotoxic effect was observed only at 100 nM doxorubicin (p < 0.001) (Figure 4).
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9268620
Exactly 12 kg of powdered M. elliptica root provided 142 g of residue.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Exactly", "12", "kg", "of", "powdered", "M.", "elliptica", "root", "p...
PMC9812014
After 2 days of incubation of ZIKV with palmatine, qRT-PCR assays showed that palmatine doses ranging from 10 to 80 μM repressed and inhibited ZIKV RNA synthesis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11770199
Fragments of PARP1 were measured by immunoblotting. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fragments", "of", "PARP1", "were", "measured", "by", "immunoblotting", ".", "(" ] } ]
PMC6160470
This is in line with previously published activities on other tumour cell lines and could be related to crown ether affinity for alkali cations (especially for potassium ion), better extraction capabilities and lipophilicity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11583010
Internalization of 15A7.5 and HA22 in SUM190 was detected at a concentration of 0.04 and 0.008 μg/mL, respectively, and was maximal at 1 μg/mL for both (Supplementary Fig. S3A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11545737
Nevertheless, the crucial role of pyroptosis in the outcome of some bacterial infections and recent evidence in mouse models suggest that these inhibitors could represent a valuable weapon for the treatment of inflammation associated with many infectious diseases.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11698348
Sorted SCs were then used for subsequent colony forming assays and qRT-PCR analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sorted", "SCs", "were", "then", "used", "for", "subsequent", "colony", ...
PMC11678448
The ‘MCODE’ plug-in was utilized to pinpoint the most essential functional modules in the PPI network based on default parameters.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "‘", ...
PMC9429973
Patients who had experienced mild or asymptomatic COVID-19 compared with moderate to severe COVID-19 also demonstrated raised markers of hypercoagulability, endothelial dysfunction and inflammation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9454178
The mice were sacrificed when the tumour volume in the control group reached approximately 500 mm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mice", "were", "sacrificed", "when", "the", ...
PMC11470381
The protocol describes the examination of polarity in chemokine-treated Jurkat cells transfected with Piezo1-mCherry and actin-GFP constructs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "protocol", "describes", "the", "e...
PMC11773391
Within the scope of our investigation, we explored signalling pathways that regulate MGMT expression in melanoma cells and found that TMZ stimulation promoted p‐ERK1/2 protein expression and increased MGMT promoter transcriptional activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Reasons to initiate switching were categorized as resistance (primary and secondary) or intolerance (hematological or non-hematological).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Reasons", "to", "initiate", ...
PMC11473750
The PCR product (10 µL) was mixed with exonuclease I (2 µL) and shrimp alkaline phosphatase (2 µL) in a PCR tube and incubated at 37 °C for 15 min to degrade primers and nucleotides, followed by 80 °C for 15 min to inactivate the ExoSAP-IT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11635087
Furthermore, the Fv/Fm value determined according to the respective fluorescence decay curves did not differ significantly between isolated chloroplasts (average 0.32) and whole cells (average 0.39) (Fig. 2B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11344246
On the final day of drug treatment, nuclei were stained for 60 min at room temperature with Hoechst 33 342 (10 mg/ml) at 1:1000 (Thermo Fisher) using the D300e Digital Dispenser and plates were incubated for 60 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11763764
To better understand the mechanism of SORL1 and its potential as a therapeutic target, we still need to fill the knowledge gap regarding the involvement of immune cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Summary/Conclusion: Reduced TEAM is a feasible and valid regimen prior to auto-SCT, with low toxicity and NRM and acceptable survival rates.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary...
PMC11745823
In addition, we analysed the TCGA database and found that RIT1 was positively correlated with molecules related to the PI3K‐AKT signalling pathway (Figure 4C,D; Figures S4B and S5A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11525293
At the indicated times, cells were lysed in 100 μL of Loading Buffer 2X (2% sodium dodecyl sulfate, 30% glycerol, 144 mM β-mercaptoethanol, 100 mM Tris–HCl pH 6.8, and 0.1% bromophenol blue).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11696576
The combined organic layers were washed consecutively with 5% aqueous citric acid (10 mL) containing KI (40 mg), 10% aqueous Na2S2O3 (10 mL), and brine and dried over Na2SO4.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9960565
IC50 values were achieved using linear interpolation between the two experimental points closer to the point corresponding to 50% of the control’s cellular metabolic activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
We showed that Wnt10b activates the canonical Wnt/β-catenin signaling pathway and promotes myeloid differentiation of Linc-KitSca-1 cells in vitro.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "showed", "that", "Wnt10b", ...
PMC11569208
Altogether, this study represents a proof-of-concept for incorporating RNAi targeting PPs for increased viral infectivity and oncolysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Altogether", ",", "this", "study", "re...
PMC6835428
Among these, we focused herein on polymers and lipids, which show high biocompatibility and the ability to deliver siRNAs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Among", "these", ...
PMC11055510
These results were similar to previous study (Fan et al., 2019).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "were", "similar", "to", "previous", "study", ...
PMC11634794
In the migration experiment, 10 786-O and A498 cells were suspended in 200 μl of serum-free medium and added to the upper compartment.
[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC5173112
For the IL-8 promoter, primers for amplification of the USP21 binding, uH2A and H3K4me3 status (nucleotides −134 to +45) were CATCAGTTGCAAATCGTGGA and GTTCCTTCCGGTGGTTTCTT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5311252
Cells were lysed with CHAPS buffer (1% CHAPS, 0.1% Triton X-100, 20 mM HEPES pH 7.5, 150 mM NaCl) and protein concentration was determined by Bio-Rad Quick Start Bradford protein assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6222726
Cole et al. showed that burseran has cytotoxic activity against human epidermoid carcinoma of the nasopharynx (9KB cell line) in a Cancer Chemotherapy National Service Center (CCNSC) test (ED50 < 10 μg/mL) acting as a spindle poison.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "...
PMC9429973
The outcomes between the 2 groups were comparable (Table).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "outcomes", "between", "the", "2", "groups", "were", "comparable", "(", "Table"...
PMC11634794
The specific sequence for LAMP1 siRNA1 was 5 ‘-CAGGGCAGAUAUAGAUAAATT-3’.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "specific", "sequence", "for", "LAMP1", "siRNA1", "was", "5", "‘", "-CAGGGCAGAU...
PMC11380329
Pinocembrin is a compound that was isolated from propolis and has anticancer properties on two different types of human colon cancer cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Pinocembrin", ...