Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC9545714
According to published data and our own experience, RNA with a RIN number >8 is of sufficient quality for gene expression profiling experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11546117
The integrity of the epithelial cell layer(s) was confirmed after the transport experiments via measurement of transepithelial electrical resistance (TEER) and sodium fluorescein leakage, as described previously for the determination of the barrier function.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11674834
In contrast, R187Q increased affinity towards 4-aminobiphenyl and N-hydroxy-4-aminobiphenyl .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", ",", "R187Q", "increased", "affinity", "towards", "4-aminobiphenyl", "and", "N-...
PMC9429973
S. Stankovikj, S. Stojanovska, N. Ridova, T. Ristevska, M. Cvetanoski Hemato-oncologyy; University Clinic of hematology, SKOPJE, North Macedonia, Republic of Background: A rare but potentially life-threatening hemorrhage can occur as a result of development of autoantibodies against coagulation factors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8567602
SMARCB1 at reduced protein levels in synovial sarcoma cells resides in BAF complexes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SMARCB1", "at", "reduced", "protein", "levels", "in", "synovial", "sarcoma"...
PMC6379402
The clinical outcome of each group is characterized by its Kaplan–Meier survival curve (that indicates the percentage of patients from the group that are still alive over time).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Differential baseline platelet count had minimal impact on the ITC results, with similar RRs regardless of simulated median baseline platelet count.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Differential", ...
PMC11365427
Cell vitality of MM cell lines after supplementing the phenylalanine-free medium with varying concentrations of phenylalanine (0, 10 nmol/L, 10 μmol/L, 100 μmol/L) for 48 h of culture. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9780037
Cyt c (represented in blue) can be detected in the serum through its electron transfer to cyt c oxidase, which generates a measurable electrical current. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11774112
Since DTIC is nonfluorescent, PE, a fluorescence probe, was placed into micelles as a substitute for DTIC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "DTIC", "is", ...
PMC11240448
Recent advances in single cell RNA sequencing (scRNAseq) led to the development of elegant machine learning (ML) and dynamics-based approaches to predict cell trajectories in the RNA space and extract information about gene interactions .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
70 (17%) pts experienced SARS-Cov2 positivity: 47 (19%) vs 23 (13%) in group A vs B, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10243817
Collagen abundance decreased and edema scores increased in CRSwNP compared with control, again more prominently in the eosinophilic type.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Collagen", "abundance", "dec...
PMC9429973
Early relapse rate (RR) was significantly lower in G1 pts (2.8%(1/35) in HSCT vs 21.4%(15/70) in G2, p=0,027).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973
However, the disease remains incurable, due to therapy resistance, even to the promising Venetoclax and Ibrutinib combination.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "the", ...
PMC10734950
We performed a mitochondrial depolarization assay (JC-1) to assess the integrity of the mitochondria, an indication observed during apoptosis triggered through the intrinsic apoptotic pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11594806
Targeting adenosine receptors and associated pathways offers a novel approach to enhancing immune responses against tumors, potentially improving immunotherapy outcomes in cancers, including sarcomas.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973
One of the patients had contracted COVID 8 weeks prior to his vaccination.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "of", "the", "patients", "had", "contracted", "COVID", "8", "we...
PMC11535726
These specimens were initially stored in Ziploc bags and observed using a stereomicroscope (Motic SMZ-171).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "specimens", "were", "initially", "stored...
PMC10589262
Cell growth was measured by MTT analysis 72 h after BLZF1 shRNA treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cell", "growth", "was", "measured", "by", "MTT", "analysis", "72", "h...
PMC10507284
Also, we observed that KEGG, GSEA, and flow cytometry results all exhibit that TROAP can interfere with the cell cycle of STS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11758416
If using a staining plate, prepare FACS tubes for each well and transfer volume in wells to FACS tubes.f.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "If", "using", "a", "st...
PMC10813895
Epigenetic aging rates can be measured by DNA methylation profiles, as indicated by earlier studies .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Epigenetic", "aging", "rates", "can", "be", "measured"...
PMC11476106
Digital analysis was applied to monitor Ewing sarcoma cell line growth and morphology in response to the 3D model composition and different culture times, opening the possibility of its use to study other proteins of interest and tumor types.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11745823
Collectively, RIT1 overexpression significantly diminishes cellular apoptosis and facilitates tumour progression in vitro and in vivo.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Collectively", ",", "RIT1", "overexpression", "si...
PMC9429973
Results: At a median follow up of 156 days, overall response was 75% for the entire cohort with 2/6,1/7 and 1/7 patients not responding in cohorts 1, 2 and 3, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
As of 21Jan2022, 16/60 patients in the main study population had proceeded to LTE, of whom 11 were ongoing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "of", "21Jan...
PMC11679892
Conclusions: P. sidoides extract induces apoptosis in neuroblastoma cells through oxidative stress and mitochondrial- and death receptor-mediated pathways.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Conclusions", ":", "P.", "sidoide...
PMC11746948
This increase was further amplified by the presence of 2-BP, underscoring the role of 2-BP in enhancing IKE-induced ferroptosis in vivo (Supplementary Fig. 2d, e).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10470467
Meanwhile, the pathway activity study discovered that RIPK1 was significantly associated with RAS / MAPK and RTK pathway activation, while JAK1 was significantly associated with cell cycle pathway inhibition (Figure 7B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC2777936
Independent repression of FZD5, FZD7 and WNT5A using transient as well as stable methods of RNA interference (RNAi) inhibited cell growth of pluripotent NT2/D1 human EC cells, but did not appreciably induce differentiation or repress key pluripotency genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellL...
PMC8345486
The plates were frozen in −70 °C for at least 20 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "plates", "were", "frozen", "in", "−70", "°", "C", "for", ...
PMC9672323
To evaluate the effects of drugs on the cell cycle distribution, we analyzed the DNA content per cell using PI staining.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "evalua...
PMC11637284
Low Shannon’s entropy values correspond to a high homology, whereas high values indicate high degree of divergence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Low", "Shannon", "’s", "entropy",...
PMC11467964
Consensus clustering was employed to identify subgroups related to differentially expressed basement membrane‐related genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Consensus", "clustering", "was", "employed", "to", "identify", "subgro...
PMC9429973
Results: In T-ALL, TET2 mutations are sporadically identified.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "In", "T-ALL", ",", "TET2", "mutations", "are", "sporadically", "identified", ...
PMC11748335
Media for both cell lines were supplemented with 10% FBS (Omega Scientific, #FB-02) and 1% penicillin–streptomycin sulfate (Gibco, #10378016).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10142392
This has driven the development of a new polymer design with a reasonable structure that could be an effective means to increase release efficiency.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973
In the RT group, most patients had a residual tumor after the biopsy, and the orbit was the most frequent site of lymphoma, which caused treatment-emergent symptoms that potentially impair visual function.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11320834
Based on the mechanism of action proposed by Kaplan et al., cediranib not only interrupts tumor blood supply but also sensitizes cancer cells to PARPi.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11585994
Molt4 and CEM cells were treated with G5, G5-siNC, G5-sgc8, G5-siBCL11B, and G5-sgc8-siBCL11B nanoparticles for 48 hours.
[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9952933
CAP treatment led to an increase in oxidative stress in HOB and A673 (Figure 4A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CAP", "treatment", "led", "to", "an", "incr...
PMC9516401
This new insight into the effects of herbal medicines on IDE activity can help future studies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "new", "insight", "into", "the", "effects", ...
PMC11144382
Written informed consent was obtained from patients or their legal guardians, using protocols approved by the local and national ethics committees.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Written", "i...
PMC11680049
During the first and second cycles of culturing the cell suspension of Sequoia in media containing mineral salts according to the MS and WPM recipes in darkness, medium- or large-aggregated cultures formed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10976516
Ultimately, all these efforts should be combined to create optimal oncolytic viral therapies that can be safely used in the clinic for eradicating lung solid tumors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11731614
There is also evidence that keratinocytes may contribute to persistent neuropathic pain.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "is", "also", "evidence", "that", "keratinocytes", "may", "contribute", ...
PMC11455164
P. Nelson: None.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "P.", "Nelson", ":", "None", "." ] } ]
PMC9429973
A significant sgRNA dropout was characterized by a p-value below 0.05 and a FDR below 0.1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "significant", "sgRNA", "dropout", "was", "charact...
PMC11794568
Transwell invasion assay was performed to assess the invasive ability of cutaneous melanoma cells with both CRIP1 and TFAM knocked down (scale bar 50 μm).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9926039
Furthermore, the conformation with the lowest estimated free energy was visualized by AutoDockTools v. 1.5.6 and BioVia Discovery Studio v. 16.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ...
PMC11745823
Glioma constitutes a primary tumour originating from glial cells in the brain and a prevalent intracranial tumour .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Glioma", "constitutes", "a", "primary", "tumour",...
PMC5854676
The dried product was monitored using simultaneous TGA (thermogravimetry) and DSC (differential scanning calorimeter) analysis to identify the temperature where Mg(OH)2 completely transforms into pure MgO. After thermal analysis, the dried powder was calcined at 450 °C for 2 h to achieve MgO nanopowder and was studied using diverse analysing tools.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11087766
A volume of 100 μL of P. aeruginosa K2733 gp210-GFPmut1 (OD600 ~0.4) was infected with 10 μL of PhiKZ lysate, and the plaque assay was performed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11088135
However, the role and molecular mechanism of lncRNA NUTM2A-AS1 in glioma have not been reported.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "the", "role", "and", "molecular", ...
PMC9429973
Finally, we tested whether DUSP1/6 inhibition is efficacious in drug-resistant CLL by using BCI to treat therapy-naive and ibrutinib refractory CLL samples, and we discovered that DUSP1/6 inhibition is extremely successful in targeting treatment-resistant CLL.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11777207
Consistent with prior studies, we observed chemokine-mediated DC migration upon activation with lipopolysaccharide (LPS) (Fig. 1B) (34).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973
Image: Summary/Conclusion: Overall, the goal of HARBOR is to investigate the safety and efficacy of the selective, targeted KIT inhibitor BLU-263 as a potential treatment option to reduce symptom burden for patients with ISM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
All iron measured in serum is total bound iron, which is the basis for calculating TSAT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "iron", "measured", "in", "serum", "i...
PMC9429973
Epeleuton treated SCD mice exposed to H/R stress showed down-regulation of VCAM-1 and E-selectin, markers of inflammatory vasculopathy as well as reduction of lung protein oxidation and expression of anti-oxidant systems such as heme-oxygenase-1 (HO-1) or peroxiredoxin-2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11128598
After transfection, cells were incubated again with the same concentration of Panobinostat for 48 h. Live cells were selected by FSC/SSC gating, and live GFP+ and DsRed+ cells were quantified by flow cytometry (BD Accuri C6 Plus Flow Cytometer).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11477621
Among them, compound 20 exhibited potential inhibitory activity on HDAC1, and demonstrated notable potency against RPMI-8226 cells with an IC50 value of 2.89 ± 0.43 μM, which was better than chidamide (IC50 = 10.23 ± 1.02 μM).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7917457
PeptiCRAd improves tumor growth control and induces systemic tumor-specific T cell responses in a syngeneic mouse model of B16.F10.9/K1 (A) 1 × 10 VP of VALO-mD901 or PeptiCRAd VALO-mD901-Trp2 was given intratumorally 6, 7, 8, 9, 10, 22, and 34 days post-tumor implantation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
CRS was observed in 35% of pts, 32% of whom experienced grade 3 and no grade ≥4.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CRS", "was", "observed", ...
PMC11607764
PTBP1 expression was significantly positively correlated with Tregs cell, B cell, T cell CD8 and T cell CD4 in LGG (Figure 5, Figure S4), which might help explain the differences in LGG patient survival by influencing immune infiltration in the tumor microenvironment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11592837
As with γH2AX, the logically expected constant plateau in fact leveled off after longer exposure times, albeit less so than with γH2AX.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC8751435
A549 was purchased from the Shanghai Institute of Cell Biology and was cultured using Dulbecco's Modified Eagle's medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS) (Bovogen), 100 U/ml penicillin, and 100 μg/ml streptomycin (Gibco) in 37℃ in incubator with 5% CO2 saturation.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Clinical and laboratory data were obtained by clinical files review Results: We included 235 patients, 47.2% (n=111) male.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Clinica...
PMC11727000
Briefly, cells recovered from a 25 cm flask were incubated with colcemid (0.05 μg/mL) for 6 h. After collecting the media to capture any floating cells, adherent cells were collected using trypsin EDTA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
All obtained PCR products (n=215) were subjected to paired-end NGS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "obtained", "PCR", "products", "(", "n=215", ")", "were", "subjected", ...
PMC11638255
Data are presented as mean ± SEM, n = 4 (both groups) biological replicates, one independent experiment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "pr...
PMC11794588
To determine the relative activity, the percentage of the average movement over 24 h of test samples with extract compared to the DMSO control was employed.. For large-scale extraction, a big container containing 2000 mL of ethanol HPLC grade from Sigma (Germany) was filled with 200 g of plant powder (C. aurantiacum).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11629461
Perifused CHO‐K1 cells did not respond to UVA irradiation (Figure 6C), DUOX2‐CHO‐K1 cells in the dark similarly showed flat baseline calcium (Figure 6D).
[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC5311252
Furthermore, in lung adenocarcinoma (LUAD) and breast cancer (BRCA), our analysis indicates that high expression of oncomotif-miRNAs is connected with shorter relapse-free survival.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11711063
These studies were funded by grant K129218 from the National Research, Development and Innovation Office of Hungary (IPU).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "studies", ...
PMC11419566
These results indicated that PA could regulate the apoptosis of tumor cells through intrinsic and extrinsic pathways.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "indicated", "that", "PA", ...
PMC11762280
D Representative images of H&E staining and TUNEL staining of skin sections from Ac-DEVD-CHO or PBS treated mice after UVB irradiation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D", "Representative", ...
PMC11591030
The expression of CAT, SOD, and GPx is mainly regulated by nuclear factor-erythroid 2-related factor 2 (Nrf2) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "expression", ...
PMC8777939
Moreover, etravirine induced LC3B formation in A2780-ADR cells (Figure 1f).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "etravirine", "induced", "LC3B", "formation", "in", ...
PMC6487404
For more clarification, the gut sac experiments were repeated in the presence of known inhibitors of P-gp.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "more", "clarification", ",", "t...
PMC9454178
THZ1, a CDK7 inhibitor, exhibits a dose-dependent inhibitory effect in various cancers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "THZ1", ",", "a", "CDK7", "inhibitor", ",", "exhibits", "a", ...
PMC11759543
In the same period, a dosage of 25 mg/kg of vorinostat was injected daily for 10 days.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "same", "period", ",", ...
PMC9118379
In the HEK293 cell line MS data set, using both search strategies, 375 variant PSMs corresponding to 135 variant peptides and 121 variant events were reported.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11021472
Vectors contained GFP, RFP or BFP, and these reporters were used to follow the percentages of infected cells by flow cytometry over time on a BD Accuri C6 Plus Cell Analyzer (BD Biosciences), Calibur flow cytometer (BD Biosciences) or NovoCyte Quanteon flow cytometer (Agilent Technologies, Santa Clara, CA, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9503541
GE extract was subjected to column chromatography over silica gel 60 (0.063–0.200 mm).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GE", "extract", "was", "subjected", "to", "column", "chroma...
PMC11759543
It also induces a DNA double strand break signal (γHAX) (Fig. 2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "also", "induces", "a", "DNA", "double", "s...
PMC9429973
Analysis of additional lymphoid populations in PB from this patient revealed that naïve T, but not NK cells were also predominantly wild-type, suggesting specific impairment of B- and T-lineage maturation in the mutated cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
D. Cattaneo, N. Galli, C. Bucelli, S. Artuso, A. Iurlo Oncology and Hemato-Oncology, University of Milan; Hematology, Foundation IRCCS Ca’ Granda Ospedale Maggiore Policlinico; Hematology, Foundation IRCCS Ca’ Granda Policlinico, Milano, Italy Background: BCR-ABL1-negative myeloproliferative neoplasms (MPNs) are variably characterized by an increase in peripheral blood (PB) and bone marrow (BM) progenitor cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11590005
Data were analysed using the Statistical Package for the Social Sciences (version 21.0, SPSS Inc., Chicago IL, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", ...
PMC11533140
Ames test of compound 17p.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ames", "test", "of", "compound", "17p", "." ] } ]
PMC11637276
TIFs were incubated at 37°C in 5% CO2 until being fully confluent.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "TIFs", "were", "incubated", "at", "37", "°", "C", "in...
PMC11453690
C.C. Alston: None.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "C.C.", "Alston", ":", "None", "." ] } ]
PMC10823017
In turn, this reduces cell proliferation, invasion, and resistance, which eventually induces apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "turn", ",", "this", "reduces", "cell"...
PMC10213179
The set of primers used were either the SEL2 set of primers or the SEL1 set of primers used for amplifying the aptamer reference control M12-13 (SEL1 FW: GGGGGAATTCTAATACGACTCACTATAGGGAGAGAGGAAGAGGGATGGG, SEL1 RV: GGGGGGATCCAGTACTATCGACCTCTGGGTTATG; SEL2 FW: TAATACGACTCACTATAGGGAGGACGATGCGG, SEL2 RV: TCGGGCGAGTCGTCTG), or the SCR set of primers used to amplify the scramble sequence (SCR FW: ACCGAAAAAGACCTGGC, SCR RV: GGAACGTAGACTTAGTATAG).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11612794
By coordination of CENP-T and Dsn1 dual phosphorylation, the Nsl1 acidic surface associates with binding region 1 of CENP-T. A model of the regulatory mechanism of the CENP-T-Mis12C interaction during interphase and M phase A model of the regulatory mechanism of the CENP-T-Mis12C interaction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11634027
Schematic of Ds, depicting cadherin domains (magenta rectangles) in the extracellular domain (ECD), transmembrane domain (TM), and intracellular domain (ICD).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9622879
is the energy cost which all buying homes must pay for EP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "is", "the", "energy", "cost", "which", "all", "buying", "homes", "must", "...
PMC10529414
To identify statistically significant differences, nonparametric tests were employed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "identify", "statistically", "significant", "differences", ",", "nonparametric", "tests", "were",...
PMC11047729
Melatonin is a hormone widely known for its control of the sleep–wake cycle .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Melatonin", "is", "a", "hormone", "widely", "known", "for",...
PMC11590005
The first campaign took place on November 20, the Brazilian day of Black Aware-ness, and the second was launched on March 21, the United Nations International Day for the Elimina-tion of Racial Discrimination.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...