OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC10812665	Image acquisition of LUHMES cells live-stained with 1 µg/mL Hoechst H-33342 (Sigma Aldrich, Steinheim, Germany) and 1 µM calcein-AM (Biomol GmbH, Hamburg, Germany) was conducted by an automated high-content imager (Cellomics VTI, Waltham, MA, USA), as described previously .	[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8978939	After treatment, proteins or RNA was extracted.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "treatment", ",", "proteins", "or", "RNA", "was", "extracted", "." ] } ]
PMC10938336	Additionally, these compounds exhibit a synergistic effect, enhancing their anticancer properties when used in combination.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "these", "compounds", "exhibi...
PMC11754784	d Confocal imaging results of cell mixtures treated with DNP1 and DNP3.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "d", "Confocal", "imaging", "results", "of", "cell", "mixtures", "treated", "with...
PMC11380454	Finally, AS101 or SAS, biologically active tellurium compounds, can effectively enhance the therapeutic efficacy of αPD-1-based cancer immunotherapy.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "A...
PMC11502962	The maximum tumor diameter in the patient G01 was 10 cm, and the mitotic index was 12/50 high-power fields (HPF).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11021472	Exogenous expression levels of miR-150 in ST486 and DG75 upon infection with a lentiviral control vector (-) or miR-150 overexpression vector ( +). (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC9429973	Aims: Given the absence of a control arm in MajesTEC-1, the efficacy outcomes of patients treated with tec at the recommended phase 2 dose in MajesTEC-1 were compared with those treated with belamaf in the phase 2 DREAMM-2 study (NCT03525678).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11551844	Glass support (silica gel 60G F254) plates of dimensions 20 × 20 cm, suitable for thin-layer chromatography (TLC) were obtained from Merck, Germany.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11394112	Tissue sections were incubated 30 min at room temperature with a polyclonal rabbit anti-human CD20 (PIPA532313, Fisher Scientific, Waltham, MA, USA) at a 1:200 dilution.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Of them, 17 were unvaccinated, 18 had received 2 doses of vaccine, while 8 had received 3 doses of the vaccine.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973	Methods: Erythroid cell differentiation and immune cells activation were evaluated by flow cytometry.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Methods", ":", "Erythroid", "cell", "differentiation", "and", "immune"...
PMC11591052	The results are shown as the mean ± SEM and as a percentage of glucose uptake intensity in comparison to the control group (cells treated with DMSO).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7887261	Large conserved networks of E. coli and human proteins were recently discovered to promote endogenous DNA damage when overproduced.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Large", "conserved", "networks", ...
PMC11271278	Understanding the functional consequences of structural variants is key to uncovering the mechanisms of tumorigenesis and developing therapeutic strategies.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Understanding", "the", "functional", ...
PMC7685376	Heat map showing the differentially expressed proteins between the control group (n = 3) and Huaier group (n = 3) detected using proteomics. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8427838	Identification of TMIGD1 as an upstream receptor capable of regulating the activity of ERM family proteins offers new insights into the mechanisms of TMIGD1 tumor suppressor signaling and tumorigenesis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11696659	Patients in the cancer cohort presented a lower proportion of long telomeres compared with the control cohort (Fig. 2A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "in", ...
PMC8978939	Nuclei were dyed with 5 μg/ml Hoechst as shown in blue.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Nuclei", "were", "dyed", "with", "5", "μg/ml", "Hoechst", "as", "shown", "in", ...
PMC9429973	Further FISH analysis using the whole chromosome 9, 20 and 22 painting probe will be significant to delineate the complex chromosomal rearrangement involved in our B-ALL case.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7433824	In the present study, we assessed the changes in growth and proteomic profiles when high‐dose P4 (100 and 300 µM) was administered in human U87 and A172 GBM cell lines.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4277423	These had -1 nucleotide/+1 nucleotide mutations and −2 nucleotides/+2 nucleotide mutations, respectively.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "had", "-1", "nucleotide/+1", "nucleotide", "mutations", "and", "−2...
PMC8009078	From Fig. 5, it can be seen that initially the RMSD deviated but afterward all complexes achieved stability.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "From", "Fig.", "5", ",", "i...
PMC4360730	Ontologies are networks of controlled vocabulary terms (nodes) and relationships (edges) between the terms.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ontologies", "are", "networks", "of", ...
PMC9429973	Results: Of 112 patients reviewed, 48 were transplant-eligible and had complete data for analysis.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Of", "112", "patients", "reviewed", ...
PMC11638255	For each tumor core, geometric regions of interest (ROIs) were selected (n = 120) and were binarily defined as having high or low immune infiltration, determined by the respective presence or absence of CD45 staining (Supp.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	T. Ionova, O. Vinogradova, E. Markova, L. Mukha, N. Novitskaya, M. Pankrashkina, T. Shelekhova, D. Sherstnev, A. Proydakov, E. Lyurova, T. Pospelova, T. Babaeva, N. Bulieva, G. Kuchma, E. Andreevskaya, M. Frolova, E. Zinina, K. Trizna, I. Shestopalova, T. Shneyder, L. Khvorostenko, A. Kuchin, I. Mulina, S. Volkova, S. Zakharov, N. Porfirieva, T. Nikitina, S. Gritsaev Multinational Center for Quality of Life Research, Saint-Petersburg; Hematology Center of Botkin Hospital, Moscow; Saratov State Medical University named after V.I. Razumovsky, Saratov; Komi Republican Oncology Center, Syktyvkar; Federal State Budgetary Educational Institution of Higher Education «Novosibirsk State Medical University» of the Ministry of Health of the Russian Federation, Novosibirsk; Regional Clinical Hospital of the Kaliningrad Region, Kaliningrad; Regional Clinical Hospital, Orenburg; Regional Clinical Hospital №1, Chita; Regional Hospital № 1, Vologda; Surgut Regional Clinical Hospital, Surgut; Regional Clinical Hospital, Tomsk; Kray Clinical Hospital, Khabarovsk; Leningrad Regional Clinical Hospital, Saint-Petersburg; Regional Clinical Hospital, Tyumen’; Republican Clinical Hospital, Petrozavodsk; Republican Clinical Hospital №1, Yakutsk; Federal State Budgetary Educational Institution of Higher Education «Privolzhsky Research Medical University» of the Ministry of Health of the Russian Federation, Nizhny Novgorod; Moscow Regional Research and Clinical Institute (“MONIKI”), Moscow; Russian Research Institute of Hematology and Transfusiology, Saint-Petersburg, Russia Background: Chronic primary immune thrombocytopenia (cITP) is a rare autoimmune disease which needs lifelong therapy to prevent bleeding and is accompanied with impaired quality of life (QoL) due to hemorrhagic syndrome, psychological concerns and limitations in patients’ daily life.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11699042	To reduce empirical bias prior to our (epi)genomic, transcriptomic, and phenotypical analyses, we cultured all strains in the same cell culture conditions (see Materials and Methods section).Fig.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11650848	This was largely due to lower average methylation in the G/G homozygotes (55% at 11 years of age compared to 75% at birth) rather than changes in the heterozygotes (50% at 11 years of age compared to 55%, respectively).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11742231	However, after a certain number of layers, the performance begins to decline.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "after", "a", "certain", "number", "of", "layers"...
PMC11701801	Simultaneous inhibitors of the CBP/p300 paralog pair show promise for cBAF-deficient lung cancer, as well as rare cancers such as malignant rhabdoid tumors, epithelioid sarcomas, and synovial sarcomas.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11683240	B, white blood cell count was determined in peripheral blood.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", ",", "white", "blood", "cell", "count", "was", "determined", "in", "peripheral", ...
PMC11766309	To further determine the substantial differences in high YKT6 and low YKT6 expression, we characterized the landscape of genomic alterations and structural variation in the YKT6 gene across cancers.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11759543	B–C) Actual tumor volume (mm) (B) and weight (mg) (C) after removal of subcutaneous tumor after euthanized. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	In contrast, the combination of CIi+VEN resulted in enhanced cell death in all AML cells, regardless of their metabolic state.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contra...
PMC9429973	Baseline data collected included the following: age, sex, FLIPI stage, hemoglobin level, lymphocyte and platelet count, serum LDH and beta-2 microglobulin level.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7602170	Besides, TSC2 can be phosphorylated through other pathways.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Besides", ",", "TSC2", "can", "be", "phosphorylated", "through", "other", "pathways", "." ] } ]
PMC9429973	Results: Ninety-five patients (pts) were included, 63.2% males with median age of 64 (20-95) years old.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973	It has shown anti-myeloma (MM) activity in different preclinical models both in monotherapy and in combination with bortezomib.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "shown", "...
PMC10454535	We would expect the BTZ component to exhibit some toxicity in these cells, as BTZ has been shown to increase NF-κB activity in PBMC cells .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC7192625	This might be useful, for example, when one wants to permute features distinguishing promoters from other-ends, thus preserving the mean abundance for each of these two specific node subsets.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11055323	The upper panels were the magnified corresponding local surfaces.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "upper", "panels", "were", "the", "magnified", "corresponding", "local", "surfaces", "." ] } ]
PMC11764090	bHLH-type transcription factors are positive regulatory factors of CBF .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "bHLH-type", "transcription", "factors", "are", "positive", "regulatory", "factors", "of", "CBF", "." ] ...
PMC11461874	Collectively, it is most probable that TRAF7 mediates K48-linked polyubiquitination of DBP, thereby leading to its proteasomal degradation.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Collectively", ",", "it", ...
PMC11574271	D In total, 5637 cells were transduced with an overexpression plasmid for MMP12 and a shRON plasmid.	[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D", "In", "total", ",", "5637...
PMC11185260	To assess the level of apoptosis, cells were stained using the Annexin V/Dead Cell Apoptosis kit with propidium iodide (PI, Thermo Fisher) according to the manufacturer’s protocol.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11703896	The findings of this study suggest that rapamycin may possess multifaceted inhibitory effects on various receptors beyond mTORC1, showcasing potential applications in inhibiting EGFR, MET, FGFR, ROS1, and ALK-mediated pathways in lung cancer cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11451829	Progression of pterygium-like lesion of different grades during the study period. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Progression", "of", "pterygium-like", "lesion", "of", "different", "grades", "during",...
PMC11615101	The RAFLS cells were grown on coverslips (Thermo Fisher Scientific) in 6 well plates.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "RAFLS", "cells", "were", "grown", "on", "...
PMC9429973	The Kaplan-Meier method was used to estimate median OS and RFS, with pts censored at the time of stem cell transplantation (SCT).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11699042	Created in BioRender.	[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Created", "in", "BioRender", "." ] } ]
PMC10729469	Untreated non-transgenic mice served as controls.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Untreated", "non-transgenic", "mice", "served", "as", "controls", "." ] } ]
PMC8041314	Concerning ABCC1, 147 were active, while 902 were found to be inactive.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Concerning", "ABCC1", ",", "147", "were", "active", ",", "while"...
PMC9368503	These ontologies include the “cytoplasmic translation”, “peptide biosynthetic”, “peptide metabolic”, “amide biosynthesis”, and “organonitrogen compound biosynthesis” ontologies.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8973085	However, thieno[2,3-b]pyridine derivatives 5a–5h could also be synthesized directly through the action of sodium ethoxide on pyridinethione 3 with α-halocarbonyl compounds.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",...
PMC10482220	These proteins possess three RNA recognition motifs (RRMs) at the NH2 terminus and a glutamine-rich, prion-related domain at the COOH terminus (Tian et al., 1991).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Strikingly, patients that were positive by both tests presented a 2-yr PFS of only 10%.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Strikingly", ",", "patients", "that", "were", ...
PMC10788478	Previously, we found CTNNB1 exon 3 mutations in a subset of NSCLC tumor specimens and that NSCLC cell lines exhibit constitutive activation of the Wnt/β‐catenin signaling. ,	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7723249	The fixed cells were incubated with a CCHFV anti-N antibody (In-house, Agrisera) for 1 hour followed by incubation with Alexa Fluor 488 anti-rabbit antibody (Thermofisher).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11537649	It is consistent that we also found that miR-152-3p was also downregulated in our melanoma samples (Fig. 4A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", ...
PMC11634027	Wing roundness, measured as 4×[(area)/π×(major axis)]), was increased in ds wings compared to ds controls, but was slightly reduced in ds and ds wings (Fig. 1P).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11525293	A The schematic representation of the experiment is shown in B. B Immunofluorescent staining of A431 cells treated with Thal 100 µM; after 24-h treatment, 50 µL of pseudo-SARS-CoV-2 suspensions was added to the cells following the manufacturer’s instructions; the viral titer was 2 × 10 viral genes (VG) per mL. After 24 h post-infection, cells were washed with PBS and fixed with 4% formaldehyde in 1X PBS for 10 min at room temperature.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9812014	Upon further studies on the alkaloids present in this plant, it was found that Cherylline was the most active alkaloid with repressive activity on ZIKV.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11583010	Two replicate slide sets were screened.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Two", "replicate", "slide", "sets", "were", "screened", "." ] } ]
PMC10530622	Lessons learned from PH brought knowledge about metabolic and toxic pathways of oxalate.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lessons", "learned", "from", "PH", "brought", "knowledge", "about", "metabo...
PMC11509224	A total of four diterpenes were obtained from Svenzea sponges.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "total", "of", "four", "diterpenes", "were", "obtained", "from", "Svenzea", "sponges", ...
PMC11301242	The reconstructed Hi-C map in HL60 cells.	[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "The", "reconstructed", "Hi-C", "map", "in", "HL60", "cells", "." ] } ]
PMC9429973	Notably, distribution of the IGH gene repertoire in controls was normal.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "distribution", "of", "the", "IGH", "gene", "repertoire", "in", ...
PMC9848491	The internal verification proves that the predictive signature has excellent predictive performance value.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "internal", "verification", "proves", "that", "the", "predictive", "s...
PMC11279397	Additionally, CA exhibited remarkable therapeutic effects against coxsackie virus B3 (CVB3)-induced viral myocarditis (VMC) .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "CA", "exhibited", "remarkabl...
PMC11240052	Ovarian cancer is the deadliest gynecological malignancy and accounts for 5% of estimated cancer deaths (1–3).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ovarian", "cancer", "is", "the", ...
PMC6450504	Moreover, Ehrenberg et al. showed that the capacity of nanoparticle surfaces to adsorb protein is an indication of their cellular association and that cellular interaction is not dependent on the adsorbed protein type (Ehrenberg et al., 2009).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11727907	Borgotaro (PR), Italy).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Borgotaro", "(", "PR", ")", ",", "Italy", ")", "." ] } ]
PMC9429973	Results: Eight patients diagnosed at a median age of 11 months (range 4-36 months) with SAMD9L (n=7) or SAMD9 (n=1) germline mutation were studied.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11770130	Fig. 2NTS-NTSR2 signaling in the adipose tissue regulated food intake.a Food intake of control and Ntsr2 AKO mice (n = 7–8).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", ...
PMC8735881	After cotransfection 12 h, the cell culture supernatants were replaced with fresh DMEM and incubated for an additional 36 h. The virus-containing supernatants were harvested and centrifuged at 4,000 rpm and 4°C for 15 min, followed by filtration with a 0.45-μm filter.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11779993	We next investigated whether SPEE promotes in vitro wound-healing potential by using a scratch wound model.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "next", "investigated", "whether", "SPEE", "promo...
PMC11770746	The tumor and organs (liver, kidney, and spleen) were collected after the mice.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tumor", "and", "organs", "(", "liver...
PMC9429973	The International Prognostic Index distribution was comparable between groups.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "International", "Prognostic", "Index", "distribution", "was", "comparable", "between", "groups", "."...
PMC7171147	Therefore, we questioned whether AMPK is activated by COL11A1 to upregulate FAO in ovarian cancer cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "we", "questioned", "whether", ...
PMC11063646	Fig. 9 shows the 1st lane as untreated cells and 2nd lane indicates the FG formulation conjugated with FITC and the 3rd lane indicates merged image of both untreated and FG-treated histograms.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11745600	These findings indicate that the C96Y mutation in the Ins1 gene not only causes ER stress-mediated β-cell apoptosis but also impairs normal insulin synthesis and β-cell insulin secretion.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11792888	Finally, the concentrated fractions were stored at -20°C until use.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "the", "concentrated", "fractions", "were", "stored", "at", ...
PMC11777207	In contrast, treatment with IMQ, at the same route and dose of PD-L1 43H12 antibody that decreased DC migration (Fig. 3), resulted in significantly less epidermal thickening after IMQ treatment compared to isotype control–treated mice (Fig. 7, B and C).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11635087	Chloroplasts were visualized according to chlorophyll autofluorescence. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Chloroplasts", "were", "visualized", "according", "to", "chlorophyll", "autofluorescence", ".", "(" ] } ]
PMC4816271	Administration of tumor-specific T-cells (adoptive immunotherapy) has proven to be an effective cancer treatment for Epstein Barr virus-driven lymphomas and melanoma with responses in bulky resistant disease.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9100622	Inhibition of EWSR1-FLI1 or EGR2 in A673, SKNMC, TC71, POE, CHLA10, MHHES1, and EWIma1 was achieved by transfection with 50 nM of the siRNA targeting EWSR1-FLI1, 5′-AAGGCAGCAGAACCCTTCTTA-3′; with 15 nM of #1 5′CACCTAGAAACCAGACCTTCA3′ and #2 5′GCTACCCAGAAGGCATAATCAATAT3′, targeting EGR2; or EWSR1-FLi1 type 2, 5′-GGCAGCAGAGTTCACTGCTCG-3′, for EW1 cells using RNAiMAX Reagent (Thermofisher Scientific) according to the manufacturer’s instructions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", ...
PMC11790971	The PIMP scores were calculated on the test set of one cross-validation fold.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "PIMP", "scores", "were", "calculated", "on", "the", "test", "s...
PMC2118063	Those of +/+ mice were compact and well defined, with centrocytes and centroblasts exhibiting characteristic nuclear staining for BCL6 and surface staining for PNA (Fig. 5).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11806613	We previously showed that OST-01, a NP derived from B. coridifolia, has in vivo efficacy in acute myeloid leukemia (AML) by disrupting c-Myc-dependent ribogenesis of leukemic stem cells .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11752740	Ohady that had not been exposed to harmful chemicals.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ohady", "that", "had", "not", "been", "exposed", "to", "harmful", "chemicals", "." ] } ]
PMC10919056	ROC curve analysis of the RS Prognostic model in the testing Set.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ROC", "curve", "analysis", "of", "the", "RS", "Prognostic", "model", "in", ...
PMC5415764	In untreated cells, a well-organized tubulin network with green fluorescence was observed, whereas more green fluorescence dots were observed around the nucleus in cells exposed to formulations containing PTX (Fig. 7C).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	The time-varying area under the curve (AUC), integrated Brier score (IBS), and concordance index (C-Index) were used to measure performance of the new model as well as the IPS and a simplified version containing three risk-factors (IPS-3).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11588085	By controlling the cellular plasticity of ovarian cancer cells, XIST plays a critical role in ovarian cancer progression.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "controlling", "the", "cellu...
PMC11763126	A p-value 0.05 was considered statistically significant.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "p-value", "0.05", "was", "considered", "statistically", "significant", "." ] } ]
PMC9429973	Results: A total of 61 CLL patients and 30 healthy individuals were included in the study.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "A", "total", "of", "61", ...
PMC11674441	In two patients (BC4, BC5), the background IFN-γ production was remarkably enhanced after vaccination, so we used PBMCs, not mDC+ lymphocytes, as a control.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11190238	The quantitative reduction in H3K9me2 is due to LSD1 demethylation the LOCKs, leading to the recruitment of H3K4me3 within the LOCKs and the enrichment of H3K36me3 at the boundaries of the LOCKs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11770130	To select cDNA fragments with 250–300 bp, the library fragments were purified using the AMPure XP system (Beckman Coulter).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "select...

PMC10812665

Image acquisition of LUHMES cells live-stained with 1 µg/mL Hoechst H-33342 (Sigma Aldrich, Steinheim, Germany) and 1 µM calcein-AM (Biomol GmbH, Hamburg, Germany) was conducted by an automated high-content imager (Cellomics VTI, Waltham, MA, USA), as described previously .

[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8978939

After treatment, proteins or RNA was extracted.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "treatment", ",", "proteins", "or", "RNA", "was", "extracted", "." ] } ]

PMC10938336

Additionally, these compounds exhibit a synergistic effect, enhancing their anticancer properties when used in combination.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "these", "compounds", "exhibi...

PMC11754784

d Confocal imaging results of cell mixtures treated with DNP1 and DNP3.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "d", "Confocal", "imaging", "results", "of", "cell", "mixtures", "treated", "with...

PMC11380454

Finally, AS101 or SAS, biologically active tellurium compounds, can effectively enhance the therapeutic efficacy of αPD-1-based cancer immunotherapy.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "A...

PMC11502962

The maximum tumor diameter in the patient G01 was 10 cm, and the mitotic index was 12/50 high-power fields (HPF).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...

PMC11021472

Exogenous expression levels of miR-150 in ST486 and DG75 upon infection with a lentiviral control vector (-) or miR-150 overexpression vector ( +). (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...

PMC9429973

Aims: Given the absence of a control arm in MajesTEC-1, the efficacy outcomes of patients treated with tec at the recommended phase 2 dose in MajesTEC-1 were compared with those treated with belamaf in the phase 2 DREAMM-2 study (NCT03525678).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11551844

Glass support (silica gel 60G F254) plates of dimensions 20 × 20 cm, suitable for thin-layer chromatography (TLC) were obtained from Merck, Germany.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11394112

Tissue sections were incubated 30 min at room temperature with a polyclonal rabbit anti-human CD20 (PIPA532313, Fisher Scientific, Waltham, MA, USA) at a 1:200 dilution.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Of them, 17 were unvaccinated, 18 had received 2 doses of vaccine, while 8 had received 3 doses of the vaccine.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC9429973

Methods: Erythroid cell differentiation and immune cells activation were evaluated by flow cytometry.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Methods", ":", "Erythroid", "cell", "differentiation", "and", "immune"...

PMC11591052

The results are shown as the mean ± SEM and as a percentage of glucose uptake intensity in comparison to the control group (cells treated with DMSO).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7887261

Large conserved networks of E. coli and human proteins were recently discovered to promote endogenous DNA damage when overproduced.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Large", "conserved", "networks", ...

PMC11271278

Understanding the functional consequences of structural variants is key to uncovering the mechanisms of tumorigenesis and developing therapeutic strategies.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Understanding", "the", "functional", ...

PMC7685376

Heat map showing the differentially expressed proteins between the control group (n = 3) and Huaier group (n = 3) detected using proteomics. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8427838

Identification of TMIGD1 as an upstream receptor capable of regulating the activity of ERM family proteins offers new insights into the mechanisms of TMIGD1 tumor suppressor signaling and tumorigenesis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11696659

Patients in the cancer cohort presented a lower proportion of long telomeres compared with the control cohort (Fig. 2A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "in", ...

PMC8978939

Nuclei were dyed with 5 μg/ml Hoechst as shown in blue.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Nuclei", "were", "dyed", "with", "5", "μg/ml", "Hoechst", "as", "shown", "in", ...

PMC9429973

Further FISH analysis using the whole chromosome 9, 20 and 22 painting probe will be significant to delineate the complex chromosomal rearrangement involved in our B-ALL case.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7433824

In the present study, we assessed the changes in growth and proteomic profiles when high‐dose P4 (100 and 300 µM) was administered in human U87 and A172 GBM cell lines.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC4277423

These had -1 nucleotide/+1 nucleotide mutations and −2 nucleotides/+2 nucleotide mutations, respectively.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "had", "-1", "nucleotide/+1", "nucleotide", "mutations", "and", "−2...

PMC8009078

From Fig. 5, it can be seen that initially the RMSD deviated but afterward all complexes achieved stability.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "From", "Fig.", "5", ",", "i...

PMC4360730

Ontologies are networks of controlled vocabulary terms (nodes) and relationships (edges) between the terms.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ontologies", "are", "networks", "of", ...

PMC9429973

Results: Of 112 patients reviewed, 48 were transplant-eligible and had complete data for analysis.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Of", "112", "patients", "reviewed", ...

PMC11638255

For each tumor core, geometric regions of interest (ROIs) were selected (n = 120) and were binarily defined as having high or low immune infiltration, determined by the respective presence or absence of CD45 staining (Supp.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

T. Ionova, O. Vinogradova, E. Markova, L. Mukha, N. Novitskaya, M. Pankrashkina, T. Shelekhova, D. Sherstnev, A. Proydakov, E. Lyurova, T. Pospelova, T. Babaeva, N. Bulieva, G. Kuchma, E. Andreevskaya, M. Frolova, E. Zinina, K. Trizna, I. Shestopalova, T. Shneyder, L. Khvorostenko, A. Kuchin, I. Mulina, S. Volkova, S. Zakharov, N. Porfirieva, T. Nikitina, S. Gritsaev Multinational Center for Quality of Life Research, Saint-Petersburg; Hematology Center of Botkin Hospital, Moscow; Saratov State Medical University named after V.I. Razumovsky, Saratov; Komi Republican Oncology Center, Syktyvkar; Federal State Budgetary Educational Institution of Higher Education «Novosibirsk State Medical University» of the Ministry of Health of the Russian Federation, Novosibirsk; Regional Clinical Hospital of the Kaliningrad Region, Kaliningrad; Regional Clinical Hospital, Orenburg; Regional Clinical Hospital №1, Chita; Regional Hospital № 1, Vologda; Surgut Regional Clinical Hospital, Surgut; Regional Clinical Hospital, Tomsk; Kray Clinical Hospital, Khabarovsk; Leningrad Regional Clinical Hospital, Saint-Petersburg; Regional Clinical Hospital, Tyumen’; Republican Clinical Hospital, Petrozavodsk; Republican Clinical Hospital №1, Yakutsk; Federal State Budgetary Educational Institution of Higher Education «Privolzhsky Research Medical University» of the Ministry of Health of the Russian Federation, Nizhny Novgorod; Moscow Regional Research and Clinical Institute (“MONIKI”), Moscow; Russian Research Institute of Hematology and Transfusiology, Saint-Petersburg, Russia Background: Chronic primary immune thrombocytopenia (cITP) is a rare autoimmune disease which needs lifelong therapy to prevent bleeding and is accompanied with impaired quality of life (QoL) due to hemorrhagic syndrome, psychological concerns and limitations in patients’ daily life.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11699042

To reduce empirical bias prior to our (epi)genomic, transcriptomic, and phenotypical analyses, we cultured all strains in the same cell culture conditions (see Materials and Methods section).Fig.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11650848

This was largely due to lower average methylation in the G/G homozygotes (55% at 11 years of age compared to 75% at birth) rather than changes in the heterozygotes (50% at 11 years of age compared to 55%, respectively).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11742231

However, after a certain number of layers, the performance begins to decline.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "after", "a", "certain", "number", "of", "layers"...

PMC11701801

Simultaneous inhibitors of the CBP/p300 paralog pair show promise for cBAF-deficient lung cancer, as well as rare cancers such as malignant rhabdoid tumors, epithelioid sarcomas, and synovial sarcomas.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11683240

B, white blood cell count was determined in peripheral blood.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", ",", "white", "blood", "cell", "count", "was", "determined", "in", "peripheral", ...

PMC11766309

To further determine the substantial differences in high YKT6 and low YKT6 expression, we characterized the landscape of genomic alterations and structural variation in the YKT6 gene across cancers.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11759543

B–C) Actual tumor volume (mm) (B) and weight (mg) (C) after removal of subcutaneous tumor after euthanized. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

In contrast, the combination of CIi+VEN resulted in enhanced cell death in all AML cells, regardless of their metabolic state.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contra...

PMC9429973

Baseline data collected included the following: age, sex, FLIPI stage, hemoglobin level, lymphocyte and platelet count, serum LDH and beta-2 microglobulin level.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7602170

Besides, TSC2 can be phosphorylated through other pathways.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Besides", ",", "TSC2", "can", "be", "phosphorylated", "through", "other", "pathways", "." ] } ]

PMC9429973

Results: Ninety-five patients (pts) were included, 63.2% males with median age of 64 (20-95) years old.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC9429973

It has shown anti-myeloma (MM) activity in different preclinical models both in monotherapy and in combination with bortezomib.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "shown", "...

PMC10454535

We would expect the BTZ component to exhibit some toxicity in these cells, as BTZ has been shown to increase NF-κB activity in PBMC cells .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC7192625

This might be useful, for example, when one wants to permute features distinguishing promoters from other-ends, thus preserving the mean abundance for each of these two specific node subsets.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11055323

The upper panels were the magnified corresponding local surfaces.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "upper", "panels", "were", "the", "magnified", "corresponding", "local", "surfaces", "." ] } ]

PMC11764090

bHLH-type transcription factors are positive regulatory factors of CBF .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "bHLH-type", "transcription", "factors", "are", "positive", "regulatory", "factors", "of", "CBF", "." ] ...

PMC11461874

Collectively, it is most probable that TRAF7 mediates K48-linked polyubiquitination of DBP, thereby leading to its proteasomal degradation.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Collectively", ",", "it", ...

PMC11574271

D In total, 5637 cells were transduced with an overexpression plasmid for MMP12 and a shRON plasmid.

[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D", "In", "total", ",", "5637...

PMC11185260

To assess the level of apoptosis, cells were stained using the Annexin V/Dead Cell Apoptosis kit with propidium iodide (PI, Thermo Fisher) according to the manufacturer’s protocol.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11703896

The findings of this study suggest that rapamycin may possess multifaceted inhibitory effects on various receptors beyond mTORC1, showcasing potential applications in inhibiting EGFR, MET, FGFR, ROS1, and ALK-mediated pathways in lung cancer cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11451829

Progression of pterygium-like lesion of different grades during the study period. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Progression", "of", "pterygium-like", "lesion", "of", "different", "grades", "during",...

PMC11615101

The RAFLS cells were grown on coverslips (Thermo Fisher Scientific) in 6 well plates.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "RAFLS", "cells", "were", "grown", "on", "...

PMC9429973

The Kaplan-Meier method was used to estimate median OS and RFS, with pts censored at the time of stem cell transplantation (SCT).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11699042

Created in BioRender.

[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Created", "in", "BioRender", "." ] } ]

PMC10729469

Untreated non-transgenic mice served as controls.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Untreated", "non-transgenic", "mice", "served", "as", "controls", "." ] } ]

PMC8041314

Concerning ABCC1, 147 were active, while 902 were found to be inactive.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Concerning", "ABCC1", ",", "147", "were", "active", ",", "while"...

PMC9368503

These ontologies include the “cytoplasmic translation”, “peptide biosynthetic”, “peptide metabolic”, “amide biosynthesis”, and “organonitrogen compound biosynthesis” ontologies.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8973085

However, thieno[2,3-b]pyridine derivatives 5a–5h could also be synthesized directly through the action of sodium ethoxide on pyridinethione 3 with α-halocarbonyl compounds.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",...

PMC10482220

These proteins possess three RNA recognition motifs (RRMs) at the NH2 terminus and a glutamine-rich, prion-related domain at the COOH terminus (Tian et al., 1991).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Strikingly, patients that were positive by both tests presented a 2-yr PFS of only 10%.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Strikingly", ",", "patients", "that", "were", ...

PMC10788478

Previously, we found CTNNB1 exon 3 mutations in a subset of NSCLC tumor specimens and that NSCLC cell lines exhibit constitutive activation of the Wnt/β‐catenin signaling. ,

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7723249

The fixed cells were incubated with a CCHFV anti-N antibody (In-house, Agrisera) for 1 hour followed by incubation with Alexa Fluor 488 anti-rabbit antibody (Thermofisher).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11537649

It is consistent that we also found that miR-152-3p was also downregulated in our melanoma samples (Fig. 4A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", ...

PMC11634027

Wing roundness, measured as 4×[(area)/π×(major axis)]), was increased in ds wings compared to ds controls, but was slightly reduced in ds and ds wings (Fig. 1P).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11525293

A The schematic representation of the experiment is shown in B. B Immunofluorescent staining of A431 cells treated with Thal 100 µM; after 24-h treatment, 50 µL of pseudo-SARS-CoV-2 suspensions was added to the cells following the manufacturer’s instructions; the viral titer was 2 × 10 viral genes (VG) per mL. After 24 h post-infection, cells were washed with PBS and fixed with 4% formaldehyde in 1X PBS for 10 min at room temperature.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9812014

Upon further studies on the alkaloids present in this plant, it was found that Cherylline was the most active alkaloid with repressive activity on ZIKV.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11583010

Two replicate slide sets were screened.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Two", "replicate", "slide", "sets", "were", "screened", "." ] } ]

PMC10530622

Lessons learned from PH brought knowledge about metabolic and toxic pathways of oxalate.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lessons", "learned", "from", "PH", "brought", "knowledge", "about", "metabo...

PMC11509224

A total of four diterpenes were obtained from Svenzea sponges.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "total", "of", "four", "diterpenes", "were", "obtained", "from", "Svenzea", "sponges", ...

PMC11301242

The reconstructed Hi-C map in HL60 cells.

[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "The", "reconstructed", "Hi-C", "map", "in", "HL60", "cells", "." ] } ]

PMC9429973

Notably, distribution of the IGH gene repertoire in controls was normal.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "distribution", "of", "the", "IGH", "gene", "repertoire", "in", ...

PMC9848491

The internal verification proves that the predictive signature has excellent predictive performance value.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "internal", "verification", "proves", "that", "the", "predictive", "s...

PMC11279397

Additionally, CA exhibited remarkable therapeutic effects against coxsackie virus B3 (CVB3)-induced viral myocarditis (VMC) .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "CA", "exhibited", "remarkabl...

PMC11240052

Ovarian cancer is the deadliest gynecological malignancy and accounts for 5% of estimated cancer deaths (1–3).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ovarian", "cancer", "is", "the", ...

PMC6450504

Moreover, Ehrenberg et al. showed that the capacity of nanoparticle surfaces to adsorb protein is an indication of their cellular association and that cellular interaction is not dependent on the adsorbed protein type (Ehrenberg et al., 2009).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11727907

Borgotaro (PR), Italy).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Borgotaro", "(", "PR", ")", ",", "Italy", ")", "." ] } ]

PMC9429973

Results: Eight patients diagnosed at a median age of 11 months (range 4-36 months) with SAMD9L (n=7) or SAMD9 (n=1) germline mutation were studied.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11770130

Fig. 2NTS-NTSR2 signaling in the adipose tissue regulated food intake.a Food intake of control and Ntsr2 AKO mice (n = 7–8).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", ...

PMC8735881

After cotransfection 12 h, the cell culture supernatants were replaced with fresh DMEM and incubated for an additional 36 h. The virus-containing supernatants were harvested and centrifuged at 4,000 rpm and 4°C for 15 min, followed by filtration with a 0.45-μm filter.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11779993

We next investigated whether SPEE promotes in vitro wound-healing potential by using a scratch wound model.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "next", "investigated", "whether", "SPEE", "promo...

PMC11770746

The tumor and organs (liver, kidney, and spleen) were collected after the mice.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "tumor", "and", "organs", "(", "liver...

PMC9429973

The International Prognostic Index distribution was comparable between groups.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "International", "Prognostic", "Index", "distribution", "was", "comparable", "between", "groups", "."...

PMC7171147

Therefore, we questioned whether AMPK is activated by COL11A1 to upregulate FAO in ovarian cancer cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "we", "questioned", "whether", ...

PMC11063646

Fig. 9 shows the 1st lane as untreated cells and 2nd lane indicates the FG formulation conjugated with FITC and the 3rd lane indicates merged image of both untreated and FG-treated histograms.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11745600

These findings indicate that the C96Y mutation in the Ins1 gene not only causes ER stress-mediated β-cell apoptosis but also impairs normal insulin synthesis and β-cell insulin secretion.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11792888

Finally, the concentrated fractions were stored at -20°C until use.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "the", "concentrated", "fractions", "were", "stored", "at", ...

PMC11777207

In contrast, treatment with IMQ, at the same route and dose of PD-L1 43H12 antibody that decreased DC migration (Fig. 3), resulted in significantly less epidermal thickening after IMQ treatment compared to isotype control–treated mice (Fig. 7, B and C).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11635087

Chloroplasts were visualized according to chlorophyll autofluorescence. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Chloroplasts", "were", "visualized", "according", "to", "chlorophyll", "autofluorescence", ".", "(" ] } ]

PMC4816271

Administration of tumor-specific T-cells (adoptive immunotherapy) has proven to be an effective cancer treatment for Epstein Barr virus-driven lymphomas and melanoma with responses in bulky resistant disease.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9100622

Inhibition of EWSR1-FLI1 or EGR2 in A673, SKNMC, TC71, POE, CHLA10, MHHES1, and EWIma1 was achieved by transfection with 50 nM of the siRNA targeting EWSR1-FLI1, 5′-AAGGCAGCAGAACCCTTCTTA-3′; with 15 nM of #1 5′CACCTAGAAACCAGACCTTCA3′ and #2 5′GCTACCCAGAAGGCATAATCAATAT3′, targeting EGR2; or EWSR1-FLi1 type 2, 5′-GGCAGCAGAGTTCACTGCTCG-3′, for EW1 cells using RNAiMAX Reagent (Thermofisher Scientific) according to the manufacturer’s instructions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", ...

PMC11790971

The PIMP scores were calculated on the test set of one cross-validation fold.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "PIMP", "scores", "were", "calculated", "on", "the", "test", "s...

PMC2118063

Those of +/+ mice were compact and well defined, with centrocytes and centroblasts exhibiting characteristic nuclear staining for BCL6 and surface staining for PNA (Fig. 5).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11806613

We previously showed that OST-01, a NP derived from B. coridifolia, has in vivo efficacy in acute myeloid leukemia (AML) by disrupting c-Myc-dependent ribogenesis of leukemic stem cells .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11752740

Ohady that had not been exposed to harmful chemicals.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ohady", "that", "had", "not", "been", "exposed", "to", "harmful", "chemicals", "." ] } ]

PMC10919056

ROC curve analysis of the RS Prognostic model in the testing Set.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ROC", "curve", "analysis", "of", "the", "RS", "Prognostic", "model", "in", ...

PMC5415764

In untreated cells, a well-organized tubulin network with green fluorescence was observed, whereas more green fluorescence dots were observed around the nucleus in cells exposed to formulations containing PTX (Fig. 7C).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

The time-varying area under the curve (AUC), integrated Brier score (IBS), and concordance index (C-Index) were used to measure performance of the new model as well as the IPS and a simplified version containing three risk-factors (IPS-3).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11588085

By controlling the cellular plasticity of ovarian cancer cells, XIST plays a critical role in ovarian cancer progression.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "controlling", "the", "cellu...

PMC11763126

A p-value 0.05 was considered statistically significant.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "p-value", "0.05", "was", "considered", "statistically", "significant", "." ] } ]

PMC9429973

Results: A total of 61 CLL patients and 30 healthy individuals were included in the study.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "A", "total", "of", "61", ...

PMC11674441

In two patients (BC4, BC5), the background IFN-γ production was remarkably enhanced after vaccination, so we used PBMCs, not mDC+ lymphocytes, as a control.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11190238

The quantitative reduction in H3K9me2 is due to LSD1 demethylation the LOCKs, leading to the recruitment of H3K4me3 within the LOCKs and the enrichment of H3K36me3 at the boundaries of the LOCKs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11770130

To select cDNA fragments with 250–300 bp, the library fragments were purified using the AMPure XP system (Beckman Coulter).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "select...