OTAR3088/BioData-CellLine_annotated · Datasets at Hugging Face

PMCID string	Sentences string	ner list
PMC9429973	This drug binds to the scaffold proteins prohibitins (PHBs), but the mechanism for translation inhibition is still unclear.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "drug", "b...
PMC11264242	The expression levels of FYN in vehicle- and FK228-treated SYO-1 cells have also been validated by western blot assay in which 18-h exposure of FLAG-SSX2 cells to FK228 resulted in a major decrease in SS18-SSX2 level and increase in FYN protein abundance (Figure 3C).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11576293	2H, Ar-H, J = 2.1 and 6.9 Hz), 7.43 (d.d.,	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "2H", ",", "Ar-H", ",", "J", "=", "2.1", "a...
PMC10547921	First, they should have adequately high cytotoxicity.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "First", ",", "they", "should", "have", "adequately", "high", "cytotoxicity", "." ] } ]
PMC11707832	Under normal circumstances, the immune system responds to foreign antigen epitopes .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Under", "normal", "circumstances", ",", "the", "immune", "system", "responds", "...
PMC9512971	Cox proportional hazards model with randomization factors (age group and underlying diseases) as stratification factors and treatment group as the covariate.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cox", ...
PMC11745355	Correction for “Targeted degradation of Pin1 by protein-destabilizing compounds,” by Giulia Alboreggia, Parima Udompholkul, Isaac Rodriguez, Gregor Blaha, and Maurizio Pellecchia, which published November 12, 2024; 10.1073/pnas.2403330121 (Proc.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11352877	Recent studies have suggested that hypoxia or low oxygen levels in the pelvis activate HIF-1α, triggering a cascade of events that enhance the expression of VEGF and other angiogenic factors such as TGF-β1 and ANG1/2, among others .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11098378	In yeast, PSMC1 (RPT2) controls the gate of the proteasome and regulates the opening through an ATP-binding motif, allowing for substrates to enter .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11739484	No. 13778075) according to the manufacturer’s instructions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No.", "13778075", ")", "according", "to", "the", "manufacturer", "’s", "instructions", "." ] } ]
PMC11574029	N Lung tissue was observed, and (O) lung nodules were quantified using HE staining, followed by statistical analysis (P).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11721277	The dose-dependent biodistribution of [Tc]Tc-HYNIC-Chl showed common features at all doses studied, with minor exceptions in certain healthy organs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "dose-dependent", "bio...
PMC11461874	D-site binding protein, DBP, is a clock-controlled transcription factor and drives daily rhythms of physiological processes through the regulation of an array of genes harboring a DNA binding motif, D-box.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10713411	In the KIRC-training cohort (Figure 3D), the median value of risk scores divided all the patients into high- and low-PRPCDGs-risk groups and rising risk scores were accompanied by an increase in mortality.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11792090	This suggests that the SAP module may contribute to the therapeutic efficacy of SAP UCAR-T cells by upregulating PCSK6, thereby promoting Th1 cell differentiation and macrophage polarization.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740907	The percentage of cells treated throughout the cell cycle (D) with pure P5W30, P5W30-BW-SLNs, or a control. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "perce...
PMC11078693	Incubate at 20°C–23°C for 4 h. Rinse poly-lysine solution off the cover glasses under running Milli Q water.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Incubate", "...
PMC11653552	This event in mesenchymal stem cells (MSC) can downregulate TAZ levels with concomitant inhibition of osteoblastogenesis process	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "event", "in", "mesenchymal", "...
PMC7185206	ATZ-Alexa647-labeled 786-0-PDL1-GFP cells treated with control siRNA versus ADAM10/ADAM17 siRNA versus TAPI-2 were visualized for nuclei (DAPI, blue), C-terminus PD-L1 (PD-L1-GFP, green), lipid membranes (WGA-rhodamine, red), and N-terminus PD-L1 (Atezolizumab-A647, purple) by immunofluorescence at 24 h. Corresponding siRNA and flow cytometry data in Supplemental Figure 5A-D. Box plots quantifying flow cytometry shown, compared statistically by Student’s t-test. (	[ { "tags": [ "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC7192625	Similar observations regarding the 3D organization of RT have been made on Hi-C based datasets (39) mostly considering contacts within TADs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similar...
PMC11367146	Bubble plot showing the top twenty KEGG enrichment pathways of 149 common targets for OA.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Bubble", "plot", "showing", "the", "top", "twenty", "KEGG",...
PMC11707577	The fluorescence signal was converted to the concentration of peroxides generated upon irradiation, using a calibration curve created using standard solutions of H2O2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11656380	The RNA was mixed with TB Green Premix Ex TaqII (Takara, Tokyo, Japan) and specific primers for HES1, c-MYC, NOTCH1, and the internal control 18S rRNA (primer sets are listed in Table S3).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11367146	The Top 10 genes on the basis of score were selected as hub genes for subsequent studies.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Top", "10", "genes", "on", "the", ...
PMC9429973	Non-malignant diseases had a marked decrease (-14.9%), both in adults and children In adults, a similar decrease was observed in allo and auto-HCT (-6.1% vs -7%).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11774251	Volcano plot of down-regulated (blue) and up-regulated (red) DEGs in Tan-I vs Con. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Volcano", "plot", "of", "down-regulated", ...
PMC10454535	There were no significant differences between the DMSO control group versus the PIN, BTZ, and PIN/BTZ treatments, though there was a trend of slightly increased ROS production by BTZ and decreased ROS production by PIN and PIN/BTZ (Figure 6e).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7802142	All data were analyzed statistically using GraphPad Prim software (USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "data", "were", "analyzed", "statistically", "using", "GraphPad", "Prim", ...
PMC9096373	A dose of 150–300 µCi 18F-FDG was injected through the tail vein and fixed, and PET/CT scanning was conducted on the second day.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11721277	The activity in fractions containing medium and cells was measured using a gamma-spectrometer with a NaI (TI) detector (2480 Wizard2, Perkin Elmer, Waltham, MA, USA), and the percentage of cell-associated activity was calculated.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	The primary endpoint was ORR by BICR per Cheson 2007 IWG criteria in patients with SER.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "primary", "endpoint", "was", "ORR", "by", ...
PMC10440586	CD99 expression in the U78-MG cell line of the GSE45301 dataset. (	[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD99", "expression", "in", "the", "U78-MG", "cell", "line", "of", "the"...
PMC11707832	Interestingly, treatments involving vitD, IL-10, Nismesulide and IFNa failed to elicit changes in MAN2B1 expression.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "treatments", "involvin...
PMC10547921	Chemical structures of enediyne 46–52; (B) Binding mode of calicheamicin γ1 (46) in complex with DNA (PDB code 2PIK).Figure 9 Design and SAR analysis of enediyne. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11599565	The REPLI-g WTA single cell kit from QIAGEN was used to generate and amplify cDNA from the handpicked single cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "REPLI-g", "WTA", ...
PMC7642379	The loss of FH copies was previously observed for HEK293 by Lin and coworkers and was suggested to play an important part in the transformed phenotype of the cell line.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11679326	Despite their scrambled molecular etiology and phenotypic heterogeneity, gliomas and carcinomas demonstrate a shared mechanism of carcinogenesis, undergoing an epithelial–mesenchymal transition (EMT), as a result of which epithelial cells acquire mesenchymal properties.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8270637	T cells co-cultured with tumor cells are pre-activated, and then treated with TGF-β1 or PBS for 48 hours before co-cultivation, and then the treated T cells were co-cultured with HCC cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10936243	The reasons for not being able to add extra items to cages of recovering feline patients; cost client wishesbusy Multiple choice (multiple answer) question- Kipperman et al. 2017 - Kipperman et al. 2017 - Kinnison et al. 2015 What is the main reason for not adding anything extra to the cage?	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9019892	GIST‐882 and GIST‐48B were a gift from J. A. Fletcher (Brigham and Women’s Hospital in Boston, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GIST‐882", "and", ...
PMC11726848	The radiation dose rate varied from 0.25 to 3 Gy/h.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "radiation", "dose", "rate", "varied", "from", "0.25", "to", "3", "Gy/h", "." ] ...
PMC11472569	For instance, depleting membrane cholesterol pharmacologically impairs microvesicle shedding in activated neutrophils.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "instance", ",", "depleting", "membrane", "cholesterol", "pharmacologically...
PMC5261804	The 360 PPIs with an average essentiality score > 0.5 were used to cluster 165 cell lines used in the Achilles shRNA screening study using Cluster and Java Treeview software .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11127909	B The proliferation of 143BR-shV and 143BR-shEFHD1 cells was detected by EdU staining, N = 3.	[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", "The", "proliferation", "of", ...
PMC10523483	Consistently, under cisplatin treatment, overexpression of H1.2 led to better survival, lower ROS accumulation, increased nuclear NRF2 levels, promoted GCLC transcription, and up-regulated GSH content (Fig. 7 H–L and SI Appendix, Fig. S14 E and F).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10454535	To address the effect of bone microenvironment on MM cell resistance to drug treatment, the apoptotic effects of the 5 μM PIN and 5 nM BTZ combination on RPMI 8226 cells were further studied using the Transwell model, where RPMI 8226 cells were co-cultured with HS-5 cells using 6-well Transwell plates with 0.4 μM polycarbonate membrane inserts (Costar, Corning Inc., Corning, NY, USA).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	Comparison between number of copies and clinical variables (cytokine release syndrome -CRS-, immune effector-cell associated neurotoxicity syndrome -ICANS-, and relapse) was analyzed using Mann-Whitney U test.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10978090	One year after lung transplantation, she died of chronic allograft dysfunction and severe infection.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "year", "after", "lung", "transplantation", ",", "she...
PMC11484188	qPCR was performed employing a SYBR Green PCR Master Mix (Takara Bio, Inc.) and CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11672881	The downregulation of genes such as MMP9 leads to the inhibition of metastasis and migration .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "downregulation", "of", "genes", "such", "as", "MMP9"...
PMC10820104	The separation column was a Knauer Eurospher C18 analytical column (125 × 4 mm i.d.,	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "separation", "column", "was", "a", "...
PMC3888431	Due to the increased usage of CHO cells, knowledge about the transcriptome of the cell lines is an important need.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Due", "to", ...
PMC11283030	Mechanistically, we found that ACLY promoted tumor growth potentially through AKT/mTORC1 and EMT pathways (Fig. 6d).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mechanistically", ",", "we", "fou...
PMC5839394	The crosstalk between autophagy, redox signaling and mitochondrial dysfunction is not well understood and further efforts are necessary to analyze the oxidative stress-ER stress-mitochondria connectivity and apoptosis/autophagy.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11727638	To our knowledge, this is the first report to reproduce a hypoxic condition and an oxygen concentration gradient in the 3D culture of lymphoma-derived cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11412721	boxes: exons [brown box: translated region]; black line: intron 1); middle: p53 ChIP in doxorubicin-treated MEFs according to ChIP-Atlas (SRX270554) (Oki et al., 2018); bottom: p53 Response Element (p53RE) consensus sequence (R = G or A, W = A or T, Y = C or T), the putative p53RE and its mutated counterpart. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4443654	Peaks associated with active promoters were notable for both TAD and compartment boundaries in all cell types.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Peaks", "associated", "with", "active", "promoter...
PMC8759873	We prove that ultrasonic microbubble technology is safe and effective.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "prove", "that", "ultrasonic", "microbubble", "technology", "is", "safe", "and", "effective...
PMC11518702	DLBCL lines employed are *U2934 (HGAL negative, +/− HGAL ectopic expression) and Bjab (HGAL positive, +/− HGAL knockdown).	[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "...
PMC11487720	F Dominant negative (DN)-p53 significantly blocked UV/cold shock-mediated BCD.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "F", "Dominant", "negative", "(DN)-p53", "significantly", "blocked", "UV/cold", "shock-mediated", "BCD", "."...
PMC10854447	H NMR (400 MHz, δ ppm DMSO-d6): 8.80 (s, 1H, triazole-CH), 7.93 (d, J = 8.9 Hz, 2H, Ar–H), 7.90 (d, J = 7 Hz, 2H, Ar–H), 7.48 (t, J = 7.5 Hz, 2H, Ar–H), 7.37 (t, J = 7.4 Hz, 1H, Ar–H), 7.11 (d, J = 8.9 Hz, 2H, Ar–H), 6.26 (s, 2H, N–CH2), 3.83 (s, 3H, Ar–OCH3).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9412887	There are many reasons for treatment failure, such as poor oral bioavailability, and drug-related severe adverse reactions.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "are", "many", "reasons",...
PMC10093184	Gene expression analyses of selected genes linked to cellular immune checkpoints (CD270, CD274, CD276), kinase activity (MET, ERBB2), and metastatic potential (MMP-2, MMP-9) as well as selected long non-coding RNA (MALAT1) and microRNAs (miR-9, miR-34a, miR-93) are provided.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9541067	e–g Overexpression SUCLG1, PCK2, GLDC suppressed wound healing of OSRC-2 and A498 cell line.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "e", "–", "g", "Overexpress...
PMC11743316	Additionally, antioxidants have been shown to suppress the growth of tumor cells when tested in vitro and in vivo via inhibiting HIF1 .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additio...
PMC11623887	GATA1 used primers was; forward: 5′ATGCCTGTAATCCCAGCACT3′ and reverse: 5′TCATGGTGGTAGCTGGTAGC-3′. GAPDH (ΔCt) was used to normalize relative target genes expression; fold changes in the target genes mRNA expression were calculated using 2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9776316	To further prove that the phosphorylation of cJUN is important for its role in XRCC4 expression, we generated the cJUN mutant constructs, the constitutively active phospho-mimetic mutant form SD (S63D/S73D) and the constitutively inactive ¬¬ mutant form SA (S63A/S73A) of cJUN, respectively (Figure 6e).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10605143	p = 0.05 was selected as a statistical significance threshold.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p", "=", "0.05", "was", "selected", "as", "a", "statistical", "significance", "threshold", ...
PMC11267036	p < 0.05 indicates marked difference.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p", "<", "0.05", "indicates", "marked", "difference", "." ] } ]
PMC3765139	D10, Me39, RE, and WM115 cells expressed at least 2 of the 3 regulatory core transcription factors SOX2, NANOG, and OCT4 involved in the maintenance of stemness in mesenchymal stem cells.	[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11243198	MOE predicted that GANT61-D also interacted in the same region of GLI1-ZF, forming two H-bonds, one with Arg348 and one with Glu334 (Supplemental Figure S6).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10421378	The ML module is a part of the IDEAS 6.3.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ML", "module", "is", "a", "part", "of", "the", "IDEAS", "6.3", "." ] } ]
PMC3734024	While perhaps unexpected, this result is consistent with what is known regarding the complex and unusual regulation of FasL. Killer cells such as cytotoxic T cells and NK cells keep most FasL protein sequestered in the secretory lysosome, an endosomal-like intracellular compartment , .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7229095	Inversely, the final productivity was 186.4 ± 31.0 mg/L for CDM1 comparing with 267.4 ± 59.2 mg/L for CDM2, indicating the advantage of developing a production process with richer CDM2.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11594641	Furthermore, double RAB27A and RAB27B KO in the A375 cell line did not lead to the inhibition of the number of sEVs released into the culture medium; thus, Rab27B did not compensate for the loss of Rab27A in these melanoma cells, even though Rab27B expression was enhanced significantly in RAB27A KO.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10831439	CD19-CAR-iNKT cells use both CAR and CD1d pathways to kill target cells. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD19-CAR-iNKT", "cells", "use", "both", "CAR", "and", "CD1d", "pathways", ...
PMC11484188	Protein expression of p62 was significantly decreased and relative expression of Beclin-1 was significantly elevated in MM cells transfected with the miR-1343-3p inhibitor (Fig. 3A).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11653168	no. 3700S; Cell Signaling Technology, Inc.), followed by incubation with an antimouse IgG, HRP-linked secondary antibody (1:7,000; cat.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973	This panel included 81 genes recurrently mutated in myeloid malignancies.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "panel", "included", "81", "genes", "recurrently", "mutated", "in", "myeloid", "malignanc...
PMC11406030	Due to a lack of early detection biomarkers, it is generally diagnosed at an advanced stage, and it also carries a high risk of recurrence after standard treatment, which consists of surgery and chemotherapy.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10899471	During sarcoma initiation and progression, changes in the expression patterns of certain miRNAs significantly impact sarcoma cell proliferation, invasion, and apoptosis (8).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC7305184	Looking overall at the permeabilization results obtained (Fig. 2), only one (15 generation at 1250 V cm) out of 15 experimental points show statistical difference between CTRL and EP group in experiment 1.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973	89%).	[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "89", "%", ")", "." ] } ]
PMC9927933	Consistently, the tumor suppression by Ube2c KO in the Kras lung cancer model could be largely abrogated by simultaneous Deptor KO, indicating a causal relationship between UBE2C and DEPTOR.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11643491	For our cell models, human melanoma cell lines that were previously generated and characterized were used .	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "our", "cell", "models", ",", "human"...
PMC7570809	The major life-threatening event in cancer patients is the metastasis formation which involves different events, such as cell migration and invasion into blood or lymphatic vessels in distal organs.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11371627	Here, we report a novel deletion in XK in a patient with elevated creatine kinase, signs of myopathy and neuropathy as well as raised levels of activated T-lymphocytes in CSF.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11495567	The FITC Annexin V/ Dead Cell apoptosis kit (Cat. #	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "FITC", "Annexin", "V/", "Dead", "Cell", "apoptosis", "kit", "(", "Cat", ...
PMC11464982	Adverse effects caused by the possible presence of secondary metabolites other than those examined is addressed by the toxicological examination of the food enzyme–TOS.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11257988	Wahl et al. investigated the correlation between KRAS status (KRAS wt vs. KRAS mut), KRASG12 status (KRAS wt vs. KRASG12C vs. KRAS non-G12C mutations), and KRAS mutation type (G12C, G12V, G12D, and G12A) and survival in multivariate analysis, entire cohorts, curative resection patients, or advanced patients, and none of the control groups showed any correlation with survival (Table 1).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11779605	Gene hierarchical clustering is depicted on the left of the graph, green: upregulated in the tumor compared to the ascites, purple: downregulated in the tumor compared to the ascites. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3730428	Because of these difficulties, we and others have examined a number of approaches to targeting FLIP expression.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Because", "of", "these", "difficulties", ...
PMC7338939	Based on the aforementioned results and the mathematical modeling, five tumors were selected to evaluate the pattern of Notch, Wnt, and intermediate genes (Table 5).	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10587429	Experimental timeline showing that 4 weeks after hCD34+ HSCs implantation, the humanized mice were injected with luciferase expressing A673 cells orthotopically and the tumor bearing mice were treated with control IgG or MAG at a priming dose of 6 ug/animal followed by dose escalation from 12-100 ug/animal from day 12-22 post A673 injection.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", ...
PMC9895440	Size indicates the -log10 adjusted p-value and color the mean log2 fold change.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Size", "indicates", "the", "-log10", "adjusted", "p-value", "and", "color",...
PMC11718817	Motility analysis demonstrated specific Treg and CTL migration patterns in a dorsal skinfold chamber model.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Motility", "analysis", "demonstrated", "specific", "Treg", "and",...
PMC10761571	9The effect of Fe3O4@Glu-Gingerol and Fe3O4 NPs on expression of CASP8, BCL2, and BAX genes in lung adenocarcinoma cells.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "9The", "effect", ...
PMC11627398	The Box plots displayed the proportions of 22 immune cells between control and septic shock groups. (	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Box", "plots", "displayed", "the", "...
PMC10798140	Furthermore, compound 3e can significantly inhibit cell migration and decrease cell adhesion.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "compound", "3e", "can", "significantly", "inhibit", "ce...
PMC4355729	In order to confirm the function of PIK3R1 in renal cancer cells, we analyzed the expression of ECAD, NCAD, VIM, SNAIL, and TWIST in normal renal cell (HK2) and RCC cell lines (786-O, A498, A704, and ACHN) with RT-PCR.	[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

This drug binds to the scaffold proteins prohibitins (PHBs), but the mechanism for translation inhibition is still unclear.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "drug", "b...

PMC11264242

The expression levels of FYN in vehicle- and FK228-treated SYO-1 cells have also been validated by western blot assay in which 18-h exposure of FLAG-SSX2 cells to FK228 resulted in a major decrease in SS18-SSX2 level and increase in FYN protein abundance (Figure 3C).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11576293

2H, Ar-H, J = 2.1 and 6.9 Hz), 7.43 (d.d.,

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "2H", ",", "Ar-H", ",", "J", "=", "2.1", "a...

PMC10547921

First, they should have adequately high cytotoxicity.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "First", ",", "they", "should", "have", "adequately", "high", "cytotoxicity", "." ] } ]

PMC11707832

Under normal circumstances, the immune system responds to foreign antigen epitopes .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Under", "normal", "circumstances", ",", "the", "immune", "system", "responds", "...

PMC9512971

Cox proportional hazards model with randomization factors (age group and underlying diseases) as stratification factors and treatment group as the covariate.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cox", ...

PMC11745355

Correction for “Targeted degradation of Pin1 by protein-destabilizing compounds,” by Giulia Alboreggia, Parima Udompholkul, Isaac Rodriguez, Gregor Blaha, and Maurizio Pellecchia, which published November 12, 2024; 10.1073/pnas.2403330121 (Proc.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11352877

Recent studies have suggested that hypoxia or low oxygen levels in the pelvis activate HIF-1α, triggering a cascade of events that enhance the expression of VEGF and other angiogenic factors such as TGF-β1 and ANG1/2, among others .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11098378

In yeast, PSMC1 (RPT2) controls the gate of the proteasome and regulates the opening through an ATP-binding motif, allowing for substrates to enter .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11739484

No. 13778075) according to the manufacturer’s instructions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No.", "13778075", ")", "according", "to", "the", "manufacturer", "’s", "instructions", "." ] } ]

PMC11574029

N Lung tissue was observed, and (O) lung nodules were quantified using HE staining, followed by statistical analysis (P).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC11721277

The dose-dependent biodistribution of [Tc]Tc-HYNIC-Chl showed common features at all doses studied, with minor exceptions in certain healthy organs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "dose-dependent", "bio...

PMC11461874

D-site binding protein, DBP, is a clock-controlled transcription factor and drives daily rhythms of physiological processes through the regulation of an array of genes harboring a DNA binding motif, D-box.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10713411

In the KIRC-training cohort (Figure 3D), the median value of risk scores divided all the patients into high- and low-PRPCDGs-risk groups and rising risk scores were accompanied by an increase in mortality.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11792090

This suggests that the SAP module may contribute to the therapeutic efficacy of SAP UCAR-T cells by upregulating PCSK6, thereby promoting Th1 cell differentiation and macrophage polarization.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11740907

The percentage of cells treated throughout the cell cycle (D) with pure P5W30, P5W30-BW-SLNs, or a control. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "perce...

PMC11078693

Incubate at 20°C–23°C for 4 h. Rinse poly-lysine solution off the cover glasses under running Milli Q water.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Incubate", "...

PMC11653552

This event in mesenchymal stem cells (MSC) can downregulate TAZ levels with concomitant inhibition of osteoblastogenesis process

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "event", "in", "mesenchymal", "...

PMC7185206

ATZ-Alexa647-labeled 786-0-PDL1-GFP cells treated with control siRNA versus ADAM10/ADAM17 siRNA versus TAPI-2 were visualized for nuclei (DAPI, blue), C-terminus PD-L1 (PD-L1-GFP, green), lipid membranes (WGA-rhodamine, red), and N-terminus PD-L1 (Atezolizumab-A647, purple) by immunofluorescence at 24 h. Corresponding siRNA and flow cytometry data in Supplemental Figure 5A-D. Box plots quantifying flow cytometry shown, compared statistically by Student’s t-test. (

[ { "tags": [ "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...

PMC7192625

Similar observations regarding the 3D organization of RT have been made on Hi-C based datasets (39) mostly considering contacts within TADs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similar...

PMC11367146

Bubble plot showing the top twenty KEGG enrichment pathways of 149 common targets for OA.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Bubble", "plot", "showing", "the", "top", "twenty", "KEGG",...

PMC11707577

The fluorescence signal was converted to the concentration of peroxides generated upon irradiation, using a calibration curve created using standard solutions of H2O2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11656380

The RNA was mixed with TB Green Premix Ex TaqII (Takara, Tokyo, Japan) and specific primers for HES1, c-MYC, NOTCH1, and the internal control 18S rRNA (primer sets are listed in Table S3).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11367146

The Top 10 genes on the basis of score were selected as hub genes for subsequent studies.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Top", "10", "genes", "on", "the", ...

PMC9429973

Non-malignant diseases had a marked decrease (-14.9%), both in adults and children In adults, a similar decrease was observed in allo and auto-HCT (-6.1% vs -7%).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11774251

Volcano plot of down-regulated (blue) and up-regulated (red) DEGs in Tan-I vs Con. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Volcano", "plot", "of", "down-regulated", ...

PMC10454535

There were no significant differences between the DMSO control group versus the PIN, BTZ, and PIN/BTZ treatments, though there was a trend of slightly increased ROS production by BTZ and decreased ROS production by PIN and PIN/BTZ (Figure 6e).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7802142

All data were analyzed statistically using GraphPad Prim software (USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "data", "were", "analyzed", "statistically", "using", "GraphPad", "Prim", ...

PMC9096373

A dose of 150–300 µCi 18F-FDG was injected through the tail vein and fixed, and PET/CT scanning was conducted on the second day.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...

PMC11721277

The activity in fractions containing medium and cells was measured using a gamma-spectrometer with a NaI (TI) detector (2480 Wizard2, Perkin Elmer, Waltham, MA, USA), and the percentage of cell-associated activity was calculated.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

The primary endpoint was ORR by BICR per Cheson 2007 IWG criteria in patients with SER.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "primary", "endpoint", "was", "ORR", "by", ...

PMC10440586

CD99 expression in the U78-MG cell line of the GSE45301 dataset. (

[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD99", "expression", "in", "the", "U78-MG", "cell", "line", "of", "the"...

PMC11707832

Interestingly, treatments involving vitD, IL-10, Nismesulide and IFNa failed to elicit changes in MAN2B1 expression.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "treatments", "involvin...

PMC10547921

Chemical structures of enediyne 46–52; (B) Binding mode of calicheamicin γ1 (46) in complex with DNA (PDB code 2PIK).Figure 9 Design and SAR analysis of enediyne. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11599565

The REPLI-g WTA single cell kit from QIAGEN was used to generate and amplify cDNA from the handpicked single cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "REPLI-g", "WTA", ...

PMC7642379

The loss of FH copies was previously observed for HEK293 by Lin and coworkers and was suggested to play an important part in the transformed phenotype of the cell line.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11679326

Despite their scrambled molecular etiology and phenotypic heterogeneity, gliomas and carcinomas demonstrate a shared mechanism of carcinogenesis, undergoing an epithelial–mesenchymal transition (EMT), as a result of which epithelial cells acquire mesenchymal properties.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC8270637

T cells co-cultured with tumor cells are pre-activated, and then treated with TGF-β1 or PBS for 48 hours before co-cultivation, and then the treated T cells were co-cultured with HCC cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10936243

The reasons for not being able to add extra items to cages of recovering feline patients; cost client wishesbusy Multiple choice (multiple answer) question- Kipperman et al. 2017 - Kipperman et al. 2017 - Kinnison et al. 2015 What is the main reason for not adding anything extra to the cage?

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9019892

GIST‐882 and GIST‐48B were a gift from J. A. Fletcher (Brigham and Women’s Hospital in Boston, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GIST‐882", "and", ...

PMC11726848

The radiation dose rate varied from 0.25 to 3 Gy/h.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "radiation", "dose", "rate", "varied", "from", "0.25", "to", "3", "Gy/h", "." ] ...

PMC11472569

For instance, depleting membrane cholesterol pharmacologically impairs microvesicle shedding in activated neutrophils.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "instance", ",", "depleting", "membrane", "cholesterol", "pharmacologically...

PMC5261804

The 360 PPIs with an average essentiality score > 0.5 were used to cluster 165 cell lines used in the Achilles shRNA screening study using Cluster and Java Treeview software .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11127909

B The proliferation of 143BR-shV and 143BR-shEFHD1 cells was detected by EdU staining, N = 3.

[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", "The", "proliferation", "of", ...

PMC10523483

Consistently, under cisplatin treatment, overexpression of H1.2 led to better survival, lower ROS accumulation, increased nuclear NRF2 levels, promoted GCLC transcription, and up-regulated GSH content (Fig. 7 H–L and SI Appendix, Fig. S14 E and F).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10454535

To address the effect of bone microenvironment on MM cell resistance to drug treatment, the apoptotic effects of the 5 μM PIN and 5 nM BTZ combination on RPMI 8226 cells were further studied using the Transwell model, where RPMI 8226 cells were co-cultured with HS-5 cells using 6-well Transwell plates with 0.4 μM polycarbonate membrane inserts (Costar, Corning Inc., Corning, NY, USA).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

Comparison between number of copies and clinical variables (cytokine release syndrome -CRS-, immune effector-cell associated neurotoxicity syndrome -ICANS-, and relapse) was analyzed using Mann-Whitney U test.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10978090

One year after lung transplantation, she died of chronic allograft dysfunction and severe infection.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "year", "after", "lung", "transplantation", ",", "she...

PMC11484188

qPCR was performed employing a SYBR Green PCR Master Mix (Takara Bio, Inc.) and CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11672881

The downregulation of genes such as MMP9 leads to the inhibition of metastasis and migration .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "downregulation", "of", "genes", "such", "as", "MMP9"...

PMC10820104

The separation column was a Knauer Eurospher C18 analytical column (125 × 4 mm i.d.,

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "separation", "column", "was", "a", "...

PMC3888431

Due to the increased usage of CHO cells, knowledge about the transcriptome of the cell lines is an important need.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Due", "to", ...

PMC11283030

Mechanistically, we found that ACLY promoted tumor growth potentially through AKT/mTORC1 and EMT pathways (Fig. 6d).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mechanistically", ",", "we", "fou...

PMC5839394

The crosstalk between autophagy, redox signaling and mitochondrial dysfunction is not well understood and further efforts are necessary to analyze the oxidative stress-ER stress-mitochondria connectivity and apoptosis/autophagy.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11727638

To our knowledge, this is the first report to reproduce a hypoxic condition and an oxygen concentration gradient in the 3D culture of lymphoma-derived cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11412721

boxes: exons [brown box: translated region]; black line: intron 1); middle: p53 ChIP in doxorubicin-treated MEFs according to ChIP-Atlas (SRX270554) (Oki et al., 2018); bottom: p53 Response Element (p53RE) consensus sequence (R = G or A, W = A or T, Y = C or T), the putative p53RE and its mutated counterpart. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC4443654

Peaks associated with active promoters were notable for both TAD and compartment boundaries in all cell types.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Peaks", "associated", "with", "active", "promoter...

PMC8759873

We prove that ultrasonic microbubble technology is safe and effective.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "prove", "that", "ultrasonic", "microbubble", "technology", "is", "safe", "and", "effective...

PMC11518702

DLBCL lines employed are *U2934 (HGAL negative, +/− HGAL ectopic expression) and Bjab (HGAL positive, +/− HGAL knockdown).

[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "...

PMC11487720

F Dominant negative (DN)-p53 significantly blocked UV/cold shock-mediated BCD.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "F", "Dominant", "negative", "(DN)-p53", "significantly", "blocked", "UV/cold", "shock-mediated", "BCD", "."...

PMC10854447

H NMR (400 MHz, δ ppm DMSO-d6): 8.80 (s, 1H, triazole-CH), 7.93 (d, J = 8.9 Hz, 2H, Ar–H), 7.90 (d, J = 7 Hz, 2H, Ar–H), 7.48 (t, J = 7.5 Hz, 2H, Ar–H), 7.37 (t, J = 7.4 Hz, 1H, Ar–H), 7.11 (d, J = 8.9 Hz, 2H, Ar–H), 6.26 (s, 2H, N–CH2), 3.83 (s, 3H, Ar–OCH3).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9412887

There are many reasons for treatment failure, such as poor oral bioavailability, and drug-related severe adverse reactions.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "are", "many", "reasons",...

PMC10093184

Gene expression analyses of selected genes linked to cellular immune checkpoints (CD270, CD274, CD276), kinase activity (MET, ERBB2), and metastatic potential (MMP-2, MMP-9) as well as selected long non-coding RNA (MALAT1) and microRNAs (miR-9, miR-34a, miR-93) are provided.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9541067

e–g Overexpression SUCLG1, PCK2, GLDC suppressed wound healing of OSRC-2 and A498 cell line.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "e", "–", "g", "Overexpress...

PMC11743316

Additionally, antioxidants have been shown to suppress the growth of tumor cells when tested in vitro and in vivo via inhibiting HIF1 .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additio...

PMC11623887

GATA1 used primers was; forward: 5′ATGCCTGTAATCCCAGCACT3′ and reverse: 5′TCATGGTGGTAGCTGGTAGC-3′. GAPDH (ΔCt) was used to normalize relative target genes expression; fold changes in the target genes mRNA expression were calculated using 2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9776316

To further prove that the phosphorylation of cJUN is important for its role in XRCC4 expression, we generated the cJUN mutant constructs, the constitutively active phospho-mimetic mutant form SD (S63D/S73D) and the constitutively inactive ¬¬ mutant form SA (S63A/S73A) of cJUN, respectively (Figure 6e).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10605143

p = 0.05 was selected as a statistical significance threshold.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p", "=", "0.05", "was", "selected", "as", "a", "statistical", "significance", "threshold", ...

PMC11267036

p < 0.05 indicates marked difference.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p", "<", "0.05", "indicates", "marked", "difference", "." ] } ]

PMC3765139

D10, Me39, RE, and WM115 cells expressed at least 2 of the 3 regulatory core transcription factors SOX2, NANOG, and OCT4 involved in the maintenance of stemness in mesenchymal stem cells.

[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11243198

MOE predicted that GANT61-D also interacted in the same region of GLI1-ZF, forming two H-bonds, one with Arg348 and one with Glu334 (Supplemental Figure S6).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10421378

The ML module is a part of the IDEAS 6.3.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ML", "module", "is", "a", "part", "of", "the", "IDEAS", "6.3", "." ] } ]

PMC3734024

While perhaps unexpected, this result is consistent with what is known regarding the complex and unusual regulation of FasL. Killer cells such as cytotoxic T cells and NK cells keep most FasL protein sequestered in the secretory lysosome, an endosomal-like intracellular compartment , .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC7229095

Inversely, the final productivity was 186.4 ± 31.0 mg/L for CDM1 comparing with 267.4 ± 59.2 mg/L for CDM2, indicating the advantage of developing a production process with richer CDM2.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11594641

Furthermore, double RAB27A and RAB27B KO in the A375 cell line did not lead to the inhibition of the number of sEVs released into the culture medium; thus, Rab27B did not compensate for the loss of Rab27A in these melanoma cells, even though Rab27B expression was enhanced significantly in RAB27A KO.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10831439

CD19-CAR-iNKT cells use both CAR and CD1d pathways to kill target cells. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD19-CAR-iNKT", "cells", "use", "both", "CAR", "and", "CD1d", "pathways", ...

PMC11484188

Protein expression of p62 was significantly decreased and relative expression of Beclin-1 was significantly elevated in MM cells transfected with the miR-1343-3p inhibitor (Fig. 3A).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11653168

no. 3700S; Cell Signaling Technology, Inc.), followed by incubation with an antimouse IgG, HRP-linked secondary antibody (1:7,000; cat.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...

PMC9429973

This panel included 81 genes recurrently mutated in myeloid malignancies.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "panel", "included", "81", "genes", "recurrently", "mutated", "in", "myeloid", "malignanc...

PMC11406030

Due to a lack of early detection biomarkers, it is generally diagnosed at an advanced stage, and it also carries a high risk of recurrence after standard treatment, which consists of surgery and chemotherapy.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10899471

During sarcoma initiation and progression, changes in the expression patterns of certain miRNAs significantly impact sarcoma cell proliferation, invasion, and apoptosis (8).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC7305184

Looking overall at the permeabilization results obtained (Fig. 2), only one (15 generation at 1250 V cm) out of 15 experimental points show statistical difference between CTRL and EP group in experiment 1.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC9429973

89%).

[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "89", "%", ")", "." ] } ]

PMC9927933

Consistently, the tumor suppression by Ube2c KO in the Kras lung cancer model could be largely abrogated by simultaneous Deptor KO, indicating a causal relationship between UBE2C and DEPTOR.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11643491

For our cell models, human melanoma cell lines that were previously generated and characterized were used .

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "our", "cell", "models", ",", "human"...

PMC7570809

The major life-threatening event in cancer patients is the metastasis formation which involves different events, such as cell migration and invasion into blood or lymphatic vessels in distal organs.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11371627

Here, we report a novel deletion in XK in a patient with elevated creatine kinase, signs of myopathy and neuropathy as well as raised levels of activated T-lymphocytes in CSF.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11495567

The FITC Annexin V/ Dead Cell apoptosis kit (Cat. #

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "FITC", "Annexin", "V/", "Dead", "Cell", "apoptosis", "kit", "(", "Cat", ...

PMC11464982

Adverse effects caused by the possible presence of secondary metabolites other than those examined is addressed by the toxicological examination of the food enzyme–TOS.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...

PMC11257988

Wahl et al. investigated the correlation between KRAS status (KRAS wt vs. KRAS mut), KRASG12 status (KRAS wt vs. KRASG12C vs. KRAS non-G12C mutations), and KRAS mutation type (G12C, G12V, G12D, and G12A) and survival in multivariate analysis, entire cohorts, curative resection patients, or advanced patients, and none of the control groups showed any correlation with survival (Table 1).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC11779605

Gene hierarchical clustering is depicted on the left of the graph, green: upregulated in the tumor compared to the ascites, purple: downregulated in the tumor compared to the ascites. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC3730428

Because of these difficulties, we and others have examined a number of approaches to targeting FLIP expression.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Because", "of", "these", "difficulties", ...

PMC7338939

Based on the aforementioned results and the mathematical modeling, five tumors were selected to evaluate the pattern of Notch, Wnt, and intermediate genes (Table 5).

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...

PMC10587429

Experimental timeline showing that 4 weeks after hCD34+ HSCs implantation, the humanized mice were injected with luciferase expressing A673 cells orthotopically and the tumor bearing mice were treated with control IgG or MAG at a priming dose of 6 ug/animal followed by dose escalation from 12-100 ug/animal from day 12-22 post A673 injection.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", ...

PMC9895440

Size indicates the -log10 adjusted p-value and color the mean log2 fold change.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Size", "indicates", "the", "-log10", "adjusted", "p-value", "and", "color",...

PMC11718817

Motility analysis demonstrated specific Treg and CTL migration patterns in a dorsal skinfold chamber model.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Motility", "analysis", "demonstrated", "specific", "Treg", "and",...

PMC10761571

9The effect of Fe3O4@Glu-Gingerol and Fe3O4 NPs on expression of CASP8, BCL2, and BAX genes in lung adenocarcinoma cells.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "9The", "effect", ...

PMC11627398

The Box plots displayed the proportions of 22 immune cells between control and septic shock groups. (

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Box", "plots", "displayed", "the", "...

PMC10798140

Furthermore, compound 3e can significantly inhibit cell migration and decrease cell adhesion.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "compound", "3e", "can", "significantly", "inhibit", "ce...

PMC4355729

In order to confirm the function of PIK3R1 in renal cancer cells, we analyzed the expression of ECAD, NCAD, VIM, SNAIL, and TWIST in normal renal cell (HK2) and RCC cell lines (786-O, A498, A704, and ACHN) with RT-PCR.

[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...