Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11264242
These findings imply that FK228 induction of FYN expression likely plays a protective role in synovial sarcoma biology, and that blocking FYN activity by PP2 can improve the efficacy of FK228 in synovial sarcoma treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "findings", "imply", "that", "FK228", "induction", "of", "FYN", "expression", "likely", "plays", "a", "protective", "role", "in", "synovial", "sarcoma", "biology", ",", "and", "that", "blocking", "FYN", "activity", "by", "PP2", "can", "improve", "the", "efficacy", "of", "FK228", "in", "synovial", "sarcoma", "treatment", "." ] } ]
PMC11696576
For plate-based assays, 10,000 cells were seeded in ≥3 technical replicates in 100 µL growth media.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "plate-based", "assays", ",", "10,000", "cells", "were", "seeded", "in", "≥3", "technical", "replicates", "in", "100", "µL", "growth", "media", "." ] } ]
PMC10440586
In mice bearing glioma xenografts treated with bevacizumab, the expression of CD99 after treatment was significantly down-regulated compared with two control groups (placebo group and dibenzazepine-treated group) (Fig. 5C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "mice", "bearing", "glioma", "xenografts", "treated", "with", "bevacizumab", ",", "the", "expression", "of", "CD99", "after", "treatment", "was", "significantly", "down-regulated", "compared", "with", "two", "control", "groups", "(", "placebo", "group", "and", "dibenzazepine-treated", "group", ")", "(", "Fig.", "5C", ")", "." ] } ]
PMC10421378
The distribution of these groups for samples containing three strains of probiotic bacteria cultured under optimal conditions and after heat shock is presented in Figure 5, and the numbers of cells counted using the pour plate method is shown in Table 2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "distribution", "of", "these", "groups", "for", "samples", "containing", "three", "strains", "of", "probiotic", "bacteria", "cultured", "under", "optimal", "conditions", "and", "after", "heat", "shock", "is", "presented", "in", "Figure", "5", ",", "and", "the", "numbers", "of", "cells", "counted", "using", "the", "pour", "plate", "method", "is", "shown", "in", "Table", "2", "." ] } ]
PMC11539788
Furthermore, we revealed that RNF19A could directly interact with ILK, promote ILK ubiquitination and inactivate the AKT/mTOR signalling pathway, thereby impeding cell proliferation, migration, and invasion in BCa.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "we", "revealed", "that", "RNF19A", "could", "directly", "interact", "with", "ILK", ",", "promote", "ILK", "ubiquitination", "and", "inactivate", "the", "AKT/mTOR", "signalling", "pathway", ",", "thereby", "impeding", "cell", "proliferation", ",", "migration", ",", "and", "invasion", "in", "BCa", "." ] } ]
PMC10745221
MTAP-deleted cell lines are more sensitive to methioninase treatment than those containing the MTAP gene, so it is surprising that the 143B-P and 143B-R cells did not have any major differences in PRMT5 activity .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MTAP-deleted", "cell", "lines", "are", "more", "sensitive", "to", "methioninase", "treatment", "than", "those", "containing", "the", "MTAP", "gene", ",", "so", "it", "is", "surprising", "that", "the", "143B-P", "and", "143B-R", "cells", "did", "not", "have", "any", "major", "differences", "in", "PRMT5", "activity", "." ] } ]
PMC8193046
This lack of synthetic approaches is explained by the absence of lead structures as starting point for potential synthesis and lead optimization.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "lack", "of", "synthetic", "approaches", "is", "explained", "by", "the", "absence", "of", "lead", "structures", "as", "starting", "point", "for", "potential", "synthesis", "and", "lead", "optimization", "." ] } ]
PMC10079526
Elutions obtained for immunoblot analysis were supplemented with LDS sample buffer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Elutions", "obtained", "for", "immunoblot", "analysis", "were", "supplemented", "with", "LDS", "sample", "buffer", "." ] } ]
PMC10988808
The relationship between the expression of CCDC25 and the tumor grade of ccRCC was analyzed by UALCAN (https://ualcan.path.uab.edu/).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relationship", "between", "the", "expression", "of", "CCDC25", "and", "the", "tumor", "grade", "of", "ccRCC", "was", "analyzed", "by", "UALCAN", "(", "https://ualcan.path.uab.edu/", ")", "." ] } ]
PMC9429973
Methods: DHX9 expression was analyzed in 120 MDS patients and 42 non-MDS benign controls by quantitative PCR.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Methods", ":", "DHX9", "expression", "was", "analyzed", "in", "120", "MDS", "patients", "and", "42", "non-MDS", "benign", "controls", "by", "quantitative", "PCR", "." ] } ]
PMC11612508
It is clear that the release percentage of TMZ molecules in the presence of 100 Hz reached a maximum of about 52.2% in 90 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", "clear", "that", "the", "release", "percentage", "of", "TMZ", "molecules", "in", "the", "presence", "of", "100", "Hz", "reached", "a", "maximum", "of", "about", "52.2", "%", "in", "90", "min", "." ] } ]
PMC11049294
Before the FACS measurements, the cells were washed twice and were resuspended in trypan blue solution (end concentration 0.2%) in order to quench the exofacial attached fluorescence substrate .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Before", "the", "FACS", "measurements", ",", "the", "cells", "were", "washed", "twice", "and", "were", "resuspended", "in", "trypan", "blue", "solution", "(", "end", "concentration", "0.2", "%", ")", "in", "order", "to", "quench", "the", "exofacial", "attached", "fluorescence", "substrate", "." ] } ]
PMC11549062
The efficiency of lentiviral transfection was confirmed using western blot analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "efficiency", "of", "lentiviral", "transfection", "was", "confirmed", "using", "western", "blot", "analysis", "." ] } ]
PMC9429973
Thromboembolic events occurred in 3 patients during the evolution.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thromboembolic", "events", "occurred", "in", "3", "patients", "during", "the", "evolution", "." ] } ]
PMC9841531
Finally, the fluorescence was spectrophotometrically determined (excitation: 430/90 nm; emission: 535 nm) using a SpectraMax iD3 multi-mode microplate reader (Molecular Devices, San Jose, CA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "the", "fluorescence", "was", "spectrophotometrically", "determined", "(", "excitation", ":", "430/90", "nm", ";", "emission", ":", "535", "nm", ")", "using", "a", "SpectraMax", "iD3", "multi-mode", "microplate", "reader", "(", "Molecular", "Devices", ",", "San", "Jose", ",", "CA", ")", "." ] } ]
PMC11025866
Another role for xCT has been identified as a mediator of entry of the oncogenic Kaposi’s sarcoma-associated herpesvirus (KSHV), a human gamma-herpesvirus related to EBV, into target cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Another", "role", "for", "xCT", "has", "been", "identified", "as", "a", "mediator", "of", "entry", "of", "the", "oncogenic", "Kaposi", "’s", "sarcoma-associated", "herpesvirus", "(", "KSHV", ")", ",", "a", "human", "gamma-herpesvirus", "related", "to", "EBV", ",", "into", "target", "cells", "." ] } ]
PMC11697189
Then, a risk model of HSP prognostic signature was constructed in the training cohort by LASSO regression analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Then", ",", "a", "risk", "model", "of", "HSP", "prognostic", "signature", "was", "constructed", "in", "the", "training", "cohort", "by", "LASSO", "regression", "analysis", "." ] } ]
PMC4816271
Initially we sought to compare the expression and function of this humanized CAR (HuK666) with its murine counterpart (MuK666).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Initially", "we", "sought", "to", "compare", "the", "expression", "and", "function", "of", "this", "humanized", "CAR", "(", "HuK666", ")", "with", "its", "murine", "counterpart", "(", "MuK666", ")", "." ] } ]
PMC9243326
To analyze AS events in the transcript unigenes, COding GENome reconstruction Tool (Cogent) was first used to partition transcripts into gene families based on k-mer similarity and reconstruct each family into a coding reference genome based on De Bruijn graph methods (Li et al., 2017).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "analyze", "AS", "events", "in", "the", "transcript", "unigenes", ",", "COding", "GENome", "reconstruction", "Tool", "(", "Cogent", ")", "was", "first", "used", "to", "partition", "transcripts", "into", "gene", "families", "based", "on", "k-mer", "similarity", "and", "reconstruct", "each", "family", "into", "a", "coding", "reference", "genome", "based", "on", "De", "Bruijn", "graph", "methods", "(", "Li", "et", "al.", ",", "2017", ")", "." ] } ]
PMC9621239
Based on the fact that the nucleotide sequence diverges from the entire genome by 8%, HBV has been classified into 10 genotypes (A – J), among which genotypes B and C are the most prevalent in Asia and Oceania.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Based", "on", "the", "fact", "that", "the", "nucleotide", "sequence", "diverges", "from", "the", "entire", "genome", "by", "8", "%", ",", "HBV", "has", "been", "classified", "into", "10", "genotypes", "(", "A", "–", "J", ")", ",", "among", "which", "genotypes", "B", "and", "C", "are", "the", "most", "prevalent", "in", "Asia", "and", "Oceania", "." ] } ]
PMC11752740
Statistical significance is indicated as follows: P < 0.05 * for all treatment groups compared to the control group (Tukey-HSD test); • P < 0.05 for tumor cell line compared to normal cell line (T-test); c P < 0.05 for comparisons among treatment groups (Tukey-HSD test); † P < 0.05 for comparisons between 24- and 48-hours within each category (T-test); ² P < 0.005; and ³ P < 0.001 To evaluate the effects of CFZ and pistachio hull extract, both individually and in combination, on the intracellular levels of the NF-κB p65 transcription factor, we treated SK-BR3 and MCF10A cell lines with various concentrations of the extract and CFZ, determined based on their IC50 values.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "significance", "is", "indicated", "as", "follows", ":", "P", "<", "0.05", "*", "for", "all", "treatment", "groups", "compared", "to", "the", "control", "group", "(", "Tukey-HSD", "test", ")", ";", "•", "P", "<", "0.05", "for", "tumor", "cell", "line", "compared", "to", "normal", "cell", "line", "(", "T-test", ")", ";", "c", "P", "<", "0.05", "for", "comparisons", "among", "treatment", "groups", "(", "Tukey-HSD", "test", ")", ";", "†", "P", "<", "0.05", "for", "comparisons", "between", "24-", "and", "48-hours", "within", "each", "category", "(", "T-test", ")", ";", "²", "P", "<", "0.005", ";", "and", "³", "P", "<", "0.001", "To", "evaluate", "the", "effects", "of", "CFZ", "and", "pistachio", "hull", "extract", ",", "both", "individually", "and", "in", "combination", ",", "on", "the", "intracellular", "levels", "of", "the", "NF-κB", "p65", "transcription", "factor", ",", "we", "treated", "SK-BR3", "and", "MCF10A", "cell", "lines", "with", "various", "concentrations", "of", "the", "extract", "and", "CFZ", ",", "determined", "based", "on", "their", "IC50", "values", "." ] } ]
PMC9429973
Summary/Conclusion: This study has demonstrated the advantage of targeting fusion genes with a therapeutic siRNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "This", "study", "has", "demonstrated", "the", "advantage", "of", "targeting", "fusion", "genes", "with", "a", "therapeutic", "siRNA", "." ] } ]
PMC11730000
The protein levels of mTOR, which plays a significant role in oxidative stress, were assessed using western blotting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "protein", "levels", "of", "mTOR", ",", "which", "plays", "a", "significant", "role", "in", "oxidative", "stress", ",", "were", "assessed", "using", "western", "blotting", "." ] } ]
PMC11641532
Doublets identified by DoubletFinder (v2.0.4) were excluded, with an 8% doublet expectation .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Doublets", "identified", "by", "DoubletFinder", "(", "v2.0.4", ")", "were", "excluded", ",", "with", "an", "8", "%", "doublet", "expectation", "." ] } ]
PMC11740508
Guide Oligo nameSequence (5′—>3′)BRCA1 sgRNA ForwardCACCGAACTCTGAGGACAAAGCAGBRCA1 sgRNA ReverseAAACCTGCTTTGTCCTCAGAGTTCBRCA2 sgRNA ForwardCACCGCTGTACCAATCTCCTGTAAABRCA2 sgRNA ReverseAAACTTTACAGGAGATTGGTACAGCBRCA1 CRISPR target zone ForwardCACTCTGTTGCTTATGCTGGBRCA1 CRISPR target zone ReverseTTCACTTCCCAAAGCTGCCTACBRCA2 CRISPR target zone ForwardAGCTCCACCCTATAATTCTGAACCBRCA2 CRISPR target zone ReverseCAGAGAGACTGATTTGCCCAGC Six to seven week old female NOD.Cg-Rag1 Il2rg/SzJ mice (Strain #007799, The Jackson Laboratory) were used to avoid sensitivity to DNA damaging therapies associated with other immune compromised strains.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Guide", "Oligo", "nameSequence", "(5′—>3′)BRCA1", "sgRNA", "ForwardCACCGAACTCTGAGGACAAAGCAGBRCA1", "sgRNA", "ReverseAAACCTGCTTTGTCCTCAGAGTTCBRCA2", "sgRNA", "ForwardCACCGCTGTACCAATCTCCTGTAAABRCA2", "sgRNA", "ReverseAAACTTTACAGGAGATTGGTACAGCBRCA1", "CRISPR", "target", "zone", "ForwardCACTCTGTTGCTTATGCTGGBRCA1", "CRISPR", "target", "zone", "ReverseTTCACTTCCCAAAGCTGCCTACBRCA2", "CRISPR", "target", "zone", "ForwardAGCTCCACCCTATAATTCTGAACCBRCA2", "CRISPR", "target", "zone", "ReverseCAGAGAGACTGATTTGCCCAGC", "Six", "to", "seven", "week", "old", "female", "NOD.Cg-Rag1", "Il2rg/SzJ", "mice", "(", "Strain", "#", "007799", ",", "The", "Jackson", "Laboratory", ")", "were", "used", "to", "avoid", "sensitivity", "to", "DNA", "damaging", "therapies", "associated", "with", "other", "immune", "compromised", "strains", "." ] } ]
PMC10565698
In addition, miR-154 regulated by wt-p53 could inhibit the migration, invasion, and EMT of glioblastoma multiforme cells by targeting TCF12 .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "miR-154", "regulated", "by", "wt-p53", "could", "inhibit", "the", "migration", ",", "invasion", ",", "and", "EMT", "of", "glioblastoma", "multiforme", "cells", "by", "targeting", "TCF12", "." ] } ]
PMC9429973
Summary/Conclusion: Of all the cases in the literature, our approach to this condition was different, choosing Obinutuzumab and Venetoclax therapy, obtaining the complete response after the first cycle.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "Of", "all", "the", "cases", "in", "the", "literature", ",", "our", "approach", "to", "this", "condition", "was", "different", ",", "choosing", "Obinutuzumab", "and", "Venetoclax", "therapy", ",", "obtaining", "the", "complete", "response", "after", "the", "first", "cycle", "." ] } ]
PMC11286266
FURIN cleavage resulted in an MBP5 mass of 42.8 kDa and a mass of 27.8 kDa.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FURIN", "cleavage", "resulted", "in", "an", "MBP5", "mass", "of", "42.8", "kDa", "and", "a", "mass", "of", "27.8", "kDa", "." ] } ]
PMC7612475
Cells were sequentially labeled with CldU and IdU for 20 minutes, respectively, the IdU washed off, and the cells incubated with 4 mmol/L HU for 5 hours prior to harvesting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "sequentially", "labeled", "with", "CldU", "and", "IdU", "for", "20", "minutes", ",", "respectively", ",", "the", "IdU", "washed", "off", ",", "and", "the", "cells", "incubated", "with", "4", "mmol/L", "HU", "for", "5", "hours", "prior", "to", "harvesting", "." ] } ]
PMC8345486
Synthesis of 8-(5-azido-3-oxa-pentoxy)-3,3′-chroma bis(1,2-dicarba-closo-undekaborate](-1) (11).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Synthesis", "of", "8-(5-azido-3-oxa-pentoxy)-3,3′-chroma", "bis(1,2-dicarba-closo-undekaborate](-1", ")", "(", "11", ")", "." ] } ]
PMC9429973
Once daily (QD) LANRA was well-tolerated at doses up to 50mg for 7 days and 30mg for up to 12 weeks in healthy volunteers and pts with autoimmune disorders.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Once", "daily", "(", "QD", ")", "LANRA", "was", "well-tolerated", "at", "doses", "up", "to", "50", "mg", "for", "7", "days", "and", "30", "mg", "for", "up", "to", "12", "weeks", "in", "healthy", "volunteers", "and", "pts", "with", "autoimmune", "disorders", "." ] } ]
PMC9587866
In this study, we have obtained a list of medicinal compounds from the NuBBE database and downloaded their structural information.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "study", ",", "we", "have", "obtained", "a", "list", "of", "medicinal", "compounds", "from", "the", "NuBBE", "database", "and", "downloaded", "their", "structural", "information", "." ] } ]
PMC7039683
Genome browser view focused on IRF6-9.7, also known as IRF6 multispecies conserved sequence 9.7 (MCS9.7) (hg19 chr1:209989050–209989824).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Genome", "browser", "view", "focused", "on", "IRF6", "-", "9.7", ",", "also", "known", "as", "IRF6", "multispecies", "conserved", "sequence", "9.7", "(", "MCS9.7", ")", "(", "hg19", "chr1:209989050–209989824", ")", "." ] } ]
PMC11774112
Additionally, tissue H&E staining images showed that the administration of all therapeutic agents caused no significant damage to major organs, including the heart, liver, spleen, lungs, and kidneys (Figure 6F).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "tissue", "H&E", "staining", "images", "showed", "that", "the", "administration", "of", "all", "therapeutic", "agents", "caused", "no", "significant", "damage", "to", "major", "organs", ",", "including", "the", "heart", ",", "liver", ",", "spleen", ",", "lungs", ",", "and", "kidneys", "(", "Figure", "6F", ")", "." ] } ]
PMC11774112
The drugs were injected through the tail vein every 4 days from D14.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "drugs", "were", "injected", "through", "the", "tail", "vein", "every", "4", "days", "from", "D14", "." ] } ]
PMC11323699
Correlation of CD47 with immune features after NACT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "of", "CD47", "with", "immune", "features", "after", "NACT", "." ] } ]
PMC10988555
To further examine the DNA damage induced by complexes 2–4 in in vitro A2780 cells, the comet assay was performed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "further", "examine", "the", "DNA", "damage", "induced", "by", "complexes", "2–4", "in", "in", "vitro", "A2780", "cells", ",", "the", "comet", "assay", "was", "performed", "." ] } ]
PMC11721587
This phospho-specific antibody was purified by positive and negative selection using affinity column conjugated with the antigen peptide and corresponding nonphosphorylated peptide sequentially.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "phospho-specific", "antibody", "was", "purified", "by", "positive", "and", "negative", "selection", "using", "affinity", "column", "conjugated", "with", "the", "antigen", "peptide", "and", "corresponding", "nonphosphorylated", "peptide", "sequentially", "." ] } ]
PMC11697703
Since MAPK8 is regulated by the miR-193b∼365 cluster, which is differentially expressed by corticospinal vs. callosal projection neurons, we posited that miR-193b∼365 may control neurite outgrowth and dendritic branching in a neuron subtype-specific manner via differential regulation of MAPK8.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "MAPK8", "is", "regulated", "by", "the", "miR-193b∼365", "cluster", ",", "which", "is", "differentially", "expressed", "by", "corticospinal", "vs.", "callosal", "projection", "neurons", ",", "we", "posited", "that", "miR-193b∼365", "may", "control", "neurite", "outgrowth", "and", "dendritic", "branching", "in", "a", "neuron", "subtype-specific", "manner", "via", "differential", "regulation", "of", "MAPK8", "." ] } ]
PMC11545737
IpaH7.8 mimics host E3 ubiquitin ligase, binding and ubiquitinating GSDMB and GSDMD on multiple Lys residues.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "IpaH7.8", "mimics", "host", "E3", "ubiquitin", "ligase", ",", "binding", "and", "ubiquitinating", "GSDMB", "and", "GSDMD", "on", "multiple", "Lys", "residues", "." ] } ]
PMC11237030
Beads were washed 3 times with RIPA buffer and eluted adding 1× Laemmli buffer (membrane fraction).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Beads", "were", "washed", "3", "times", "with", "RIPA", "buffer", "and", "eluted", "adding", "1", "×", "Laemmli", "buffer", "(", "membrane", "fraction", ")", "." ] } ]
PMC10873328
Our results showed that these six hub HRGs were independent factors for evaluating the prognosis of OC with great predictive performance.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "results", "showed", "that", "these", "six", "hub", "HRGs", "were", "independent", "factors", "for", "evaluating", "the", "prognosis", "of", "OC", "with", "great", "predictive", "performance", "." ] } ]
PMC11549612
This finding implies a potential link between hypomethylation events and the increased expression of BOLA1, BOLA2, and BOLA3 genes in KIRC, emphasizing the importance of epigenetic regulation in KIRC pathogenesis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "finding", "implies", "a", "potential", "link", "between", "hypomethylation", "events", "and", "the", "increased", "expression", "of", "BOLA1", ",", "BOLA2", ",", "and", "BOLA3", "genes", "in", "KIRC", ",", "emphasizing", "the", "importance", "of", "epigenetic", "regulation", "in", "KIRC", "pathogenesis", "." ] } ]
PMC9964654
Since it is assumed that the therapeutic effect could depend on the amount of gold complexes within cells, the net uptake of both [Au(cdc)2] and BCM-[Au(cdc)2] in whole A2780 cells was evaluated using the PIXE technique (Table 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "it", "is", "assumed", "that", "the", "therapeutic", "effect", "could", "depend", "on", "the", "amount", "of", "gold", "complexes", "within", "cells", ",", "the", "net", "uptake", "of", "both", "[", "Au(cdc)2", "]", "and", "BCM-[Au(cdc)2", "]", "in", "whole", "A2780", "cells", "was", "evaluated", "using", "the", "PIXE", "technique", "(", "Table", "6", ")", "." ] } ]
PMC11569208
Following 48 h of incubation, samples were titered using a previously established high-throughput method and relative cell viability was established using resazurin metabolic dye (Fig. 1A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Following", "48", "h", "of", "incubation", ",", "samples", "were", "titered", "using", "a", "previously", "established", "high-throughput", "method", "and", "relative", "cell", "viability", "was", "established", "using", "resazurin", "metabolic", "dye", "(", "Fig.", "1A", ")", "." ] } ]
PMC9429973
Summary/Conclusion: The response-based dose-reduction strategy in OPTIC resulted in comparable or better efficacy outcomes, fewer dose reductions related to AEs, fewer exposure-adjusted TE-AOEs, and longer median time on therapy compared with PACE.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "The", "response-based", "dose-reduction", "strategy", "in", "OPTIC", "resulted", "in", "comparable", "or", "better", "efficacy", "outcomes", ",", "fewer", "dose", "reductions", "related", "to", "AEs", ",", "fewer", "exposure-adjusted", "TE-AOEs", ",", "and", "longer", "median", "time", "on", "therapy", "compared", "with", "PACE", "." ] } ]
PMC7452526
Figure 6Figure 7A linear regression for a dose-dependent curve of colloidal nanosilver on Caco-2 cell line at different concentrations 5, 10 and 30 μgmL and various exposure times 24, 48 and 72 h.Figure 7 A) Morphological changes by inverted microscope (x40) in Caco-2 cells treated with colloidal nanosilver after 48h.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Figure", "6Figure", "7A", "linear", "regression", "for", "a", "dose-dependent", "curve", "of", "colloidal", "nanosilver", "on", "Caco-2", "cell", "line", "at", "different", "concentrations", "5", ",", "10", "and", "30", "μgmL", "and", "various", "exposure", "times", "24", ",", "48", "and", "72", "h.", "Figure", "7", "A", ")", "Morphological", "changes", "by", "inverted", "microscope", "(", "x40", ")", "in", "Caco-2", "cells", "treated", "with", "colloidal", "nanosilver", "after", "48h", "." ] } ]
PMC11569208
In the case of PP1, the target PPP1R14A is responsible for negative control of the PP1 catalytic subunit; therefore, its knockdown allows for dysregulated PP1 activity and impedance of the IFN response to ultimately allow for increased viral infection.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "case", "of", "PP1", ",", "the", "target", "PPP1R14A", "is", "responsible", "for", "negative", "control", "of", "the", "PP1", "catalytic", "subunit", ";", "therefore", ",", "its", "knockdown", "allows", "for", "dysregulated", "PP1", "activity", "and", "impedance", "of", "the", "IFN", "response", "to", "ultimately", "allow", "for", "increased", "viral", "infection", "." ] } ]
PMC10079526
To investigate synergy between these drugs in Burkitt lymphoma, we treated Namalwa with 5-Aza-2’ and/or inhibited SUMOylation (Fig. 1B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "investigate", "synergy", "between", "these", "drugs", "in", "Burkitt", "lymphoma", ",", "we", "treated", "Namalwa", "with", "5-Aza-2", "’", "and/or", "inhibited", "SUMOylation", "(", "Fig.", "1B", ")", "." ] } ]
PMC10142392
In some cases, it is essential to modify the surfaces of fibers to improve drug attachment to nanofibers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "some", "cases", ",", "it", "is", "essential", "to", "modify", "the", "surfaces", "of", "fibers", "to", "improve", "drug", "attachment", "to", "nanofibers", "." ] } ]
PMC11683240
This illness can lead to secondary problems like vomiting and pneumothorax, and in more severe instances, may cause leukocytosis, pneumonia, encephalopathy, seizures, or apnea.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "illness", "can", "lead", "to", "secondary", "problems", "like", "vomiting", "and", "pneumothorax", ",", "and", "in", "more", "severe", "instances", ",", "may", "cause", "leukocytosis", ",", "pneumonia", ",", "encephalopathy", ",", "seizures", ",", "or", "apnea", "." ] } ]
PMC11680982
To determine the reason behind the efficacy difference between the two-drug regimen of CDK 4/6 inhibitor combined with endocrine therapy and the three-drug regimen comprising CDK 4/6 inhibitor, endocrine therapy combined with neratinib in HR/HER2-low breast cancer, we also analyzed HER2 mRNA levels.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "determine", "the", "reason", "behind", "the", "efficacy", "difference", "between", "the", "two-drug", "regimen", "of", "CDK", "4/6", "inhibitor", "combined", "with", "endocrine", "therapy", "and", "the", "three-drug", "regimen", "comprising", "CDK", "4/6", "inhibitor", ",", "endocrine", "therapy", "combined", "with", "neratinib", "in", "HR/HER2-low", "breast", "cancer", ",", "we", "also", "analyzed", "HER2", "mRNA", "levels", "." ] } ]
PMC11633763
Therefore, we speculated that USP22 can regulate HK2 expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "we", "speculated", "that", "USP22", "can", "regulate", "HK2", "expression", "." ] } ]
PMC11770746
The results, expressed in terms of IC50 values (μM) (IC50 – concentration of the compound inhibiting cell growth by 50%), are reported in Table 2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", ",", "expressed", "in", "terms", "of", "IC50", "values", "(", "μM", ")", "(", "IC50", "–", "concentration", "of", "the", "compound", "inhibiting", "cell", "growth", "by", "50", "%", ")", ",", "are", "reported", "in", "Table", "2", "." ] } ]
PMC11612626
Summary plots were prepared using GraphPad Prism 10.1.0 (316) or Excel.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary", "plots", "were", "prepared", "using", "GraphPad", "Prism", "10.1.0", "(", "316", ")", "or", "Excel", "." ] } ]
PMC11752767
Although a combination of nivolumab and ipilimumab has been proven efficient in patients and leads to improved survival , the development of required resistance over time remains a major hurdle .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "a", "combination", "of", "nivolumab", "and", "ipilimumab", "has", "been", "proven", "efficient", "in", "patients", "and", "leads", "to", "improved", "survival", ",", "the", "development", "of", "required", "resistance", "over", "time", "remains", "a", "major", "hurdle", "." ] } ]
PMC11297139
The representative images supported by the relevant statistics have been chosen upon three independent preparations with similar outcomes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "representative", "images", "supported", "by", "the", "relevant", "statistics", "have", "been", "chosen", "upon", "three", "independent", "preparations", "with", "similar", "outcomes", "." ] } ]
PMC11618052
H NMR (400 MHz, δ ppm CDCl3): 8.28 (d, J = 7.2 Hz, 1H, Ar–H), 8.05 (s, 1H, triazole CH), 7.76 (t, J = 6.4 Hz, 1H, Ar–H), 7.69 (d, J = 7.6 Hz, 1H, Ar–H), 7.64 (d, J = 7.8 Hz, 2H, Ar–H p-Cl C6H4), 7.48 (d, J = 7.8 Hz, 2H, Ar–H p-Cl C6H4), 7.40 (d, J = 8.0 Hz, 1H, Ar–H), 7.33 (d, J = 7.2 Hz, 2H, Ar–H p-CH3 C6H4), 7.19 (d, J = 7.2 Hz, 2H, Ar–H p-CH3 C6H4), 4.59 (s, 2H, S–CH2), 2.45 (s, 3H, CH3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H", "NMR", "(", "400", "MHz", ",", "δ", "ppm", "CDCl3", "):", "8.28", "(", "d", ",", "J", "=", "7.2", "Hz", ",", "1H", ",", "Ar", "–", "H", ")", ",", "8.05", "(", "s", ",", "1H", ",", "triazole", "CH", ")", ",", "7.76", "(", "t", ",", "J", "=", "6.4", "Hz", ",", "1H", ",", "Ar", "–", "H", ")", ",", "7.69", "(", "d", ",", "J", "=", "7.6", "Hz", ",", "1H", ",", "Ar", "–", "H", ")", ",", "7.64", "(", "d", ",", "J", "=", "7.8", "Hz", ",", "2H", ",", "Ar", "–", "H", "p-Cl", "C6H4", ")", ",", "7.48", "(", "d", ",", "J", "=", "7.8", "Hz", ",", "2H", ",", "Ar", "–", "H", "p-Cl", "C6H4", ")", ",", "7.40", "(", "d", ",", "J", "=", "8.0", "Hz", ",", "1H", ",", "Ar", "–", "H", ")", ",", "7.33", "(", "d", ",", "J", "=", "7.2", "Hz", ",", "2H", ",", "Ar", "–", "H", "p-CH3", "C6H4", ")", ",", "7.19", "(", "d", ",", "J", "=", "7.2", "Hz", ",", "2H", ",", "Ar", "–", "H", "p-CH3", "C6H4", ")", ",", "4.59", "(", "s", ",", "2H", ",", "S", "–", "CH2", ")", ",", "2.45", "(", "s", ",", "3H", ",", "CH3", ")", "." ] } ]
PMC10823017
indicates P≤0.05). (
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "indicates", "P≤0.05", ")", ".", "(" ] } ]
PMC10719213
Concentrations up to 1 nM did not have any effect on steady-state proteins and/or cleavage of the proapoptotic protease CASPASE3 in CCRF-CEM cells (Fig. 2a).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Concentrations", "up", "to", "1", "nM", "did", "not", "have", "any", "effect", "on", "steady-state", "proteins", "and/or", "cleavage", "of", "the", "proapoptotic", "protease", "CASPASE3", "in", "CCRF-CEM", "cells", "(", "Fig.", "2a", ")", "." ] } ]
PMC11476106
Cells were trypsinized from the previous 2D culture, quantified with trypan blue using a TC20 Automated Cell Counter (Bio Rad, Hercules, CA, USA), and resuspended in the HG mix to obtain an amount of 1.25 × 10 commercial cells or 2.5 × 10 PDX cells per HG.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "trypsinized", "from", "the", "previous", "2D", "culture", ",", "quantified", "with", "trypan", "blue", "using", "a", "TC20", "Automated", "Cell", "Counter", "(", "Bio", "Rad", ",", "Hercules", ",", "CA", ",", "USA", ")", ",", "and", "resuspended", "in", "the", "HG", "mix", "to", "obtain", "an", "amount", "of", "1.25", "×", "10", "commercial", "cells", "or", "2.5", "×", "10", "PDX", "cells", "per", "HG", "." ] } ]
PMC9429973
Patients were excluded if they were missing baseline Hb levels, Hb values at 91-180 days or received a transfusion between 0-180 days post-index.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "were", "excluded", "if", "they", "were", "missing", "baseline", "Hb", "levels", ",", "Hb", "values", "at", "91", "-", "180", "days", "or", "received", "a", "transfusion", "between", "0", "-", "180", "days", "post-index", "." ] } ]
PMC7987994
This could also influence the results of cytotoxicity testing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "could", "also", "influence", "the", "results", "of", "cytotoxicity", "testing", "." ] } ]
PMC11655498
BGLF2 can recruit the SHP1 phosphatase to STAT1 and inhibit the phosphorylation of STAT1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "BGLF2", "can", "recruit", "the", "SHP1", "phosphatase", "to", "STAT1", "and", "inhibit", "the", "phosphorylation", "of", "STAT1", "." ] } ]
PMC11352311
In A498, the closure rate decreased to 80.63 ± 1.68%, 69.17 ± 2.22%, and 46.75 ± 3.03% with 50 μM, 100 μM, and 150 μM esculin, respectively (Figure 4D).
[ { "tags": [ "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "A498", ",", "the", "closure", "rate", "decreased", "to", "80.63", "±", "1.68", "%", ",", "69.17", "±", "2.22", "%", ",", "and", "46.75", "±", "3.03", "%", "with", "50", "μM", ",", "100", "μM", ",", "and", "150", "μM", "esculin", ",", "respectively", "(", "Figure", "4D", ")", "." ] } ]
PMC10344560
Our PD patient demonstrated R. glutinis that caused peritonitis, the first ever reported case of peritonitis PD patient.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "PD", "patient", "demonstrated", "R.", "glutinis", "that", "caused", "peritonitis", ",", "the", "first", "ever", "reported", "case", "of", "peritonitis", "PD", "patient", "." ] } ]
PMC3122064
MDM2, as transcriptional target of p53, is the main negative feedback regulator of p53.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MDM2", ",", "as", "transcriptional", "target", "of", "p53", ",", "is", "the", "main", "negative", "feedback", "regulator", "of", "p53", "." ] } ]
PMC11173119
As a positive control of mycoplasma contamination (Mico+), we used DNA fragments of Mycoplasma spp.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "a", "positive", "control", "of", "mycoplasma", "contamination", "(", "Mico+", ")", ",", "we", "used", "DNA", "fragments", "of", "Mycoplasma", "spp", "." ] } ]
PMC11594806
The vascular microenvironment has been extensively studied in sarcomas and osteosarcoma (OS), revealing that the expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 correlates with poor outcomes in OS patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "vascular", "microenvironment", "has", "been", "extensively", "studied", "in", "sarcomas", "and", "osteosarcoma", "(", "OS", ")", ",", "revealing", "that", "the", "expression", "of", "vascular", "endothelial", "growth", "factor", "(", "VEGF", ")", "and", "its", "receptor", "VEGFR-2", "correlates", "with", "poor", "outcomes", "in", "OS", "patients", "." ] } ]
PMC11599565
Panel D: In regular ovarian tissues, some few ChgA-PNMA1 resident cells are noticeable (A-H).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Panel", "D", ":", "In", "regular", "ovarian", "tissues", ",", "some", "few", "ChgA-PNMA1", "resident", "cells", "are", "noticeable", "(", "A-H", ")", "." ] } ]
PMC9219615
For DNS analysis, cells were first seeded in 96-well plates at a density of 10,000 cells/well in 100 μL of complete medium and incubated overnight to facilitate cell attachment and acclimation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "DNS", "analysis", ",", "cells", "were", "first", "seeded", "in", "96-well", "plates", "at", "a", "density", "of", "10,000", "cells/well", "in", "100", "μL", "of", "complete", "medium", "and", "incubated", "overnight", "to", "facilitate", "cell", "attachment", "and", "acclimation", "." ] } ]
PMC11765879
Here we used two HER2-positive breast cancer cell lines, ZR-75-1 and SK-BR-3, and the chorioallantoic membrane as an angiogenesis model.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Here", "we", "used", "two", "HER2-positive", "breast", "cancer", "cell", "lines", ",", "ZR-75", "-", "1", "and", "SK-BR-3", ",", "and", "the", "chorioallantoic", "membrane", "as", "an", "angiogenesis", "model", "." ] } ]
PMC10125312
Two cell lines may have a similar number of internalized nanoparticles when the metrics used are nanoparticle/cell; however, a larger cell will have a greater dispersion of nanoparticles inside the cell, affecting the collective thermal effects and intracellular heat dissipation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Two", "cell", "lines", "may", "have", "a", "similar", "number", "of", "internalized", "nanoparticles", "when", "the", "metrics", "used", "are", "nanoparticle/cell", ";", "however", ",", "a", "larger", "cell", "will", "have", "a", "greater", "dispersion", "of", "nanoparticles", "inside", "the", "cell", ",", "affecting", "the", "collective", "thermal", "effects", "and", "intracellular", "heat", "dissipation", "." ] } ]
PMC10919056
The expression of GJA5 in the 786-O cell line and GJB1 in the A498 cell line were specifically targeted and knocked down by chemically synthesized siRNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "expression", "of", "GJA5", "in", "the", "786-O", "cell", "line", "and", "GJB1", "in", "the", "A498", "cell", "line", "were", "specifically", "targeted", "and", "knocked", "down", "by", "chemically", "synthesized", "siRNA", "." ] } ]
PMC11786600
PED4 showed kaempferol UV absorption peaks at wavelengths of 267.8 nm and 371.0 nm, and the rapid release of kaempferol in PED4 turned the solution into yellow (Figure S5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PED4", "showed", "kaempferol", "UV", "absorption", "peaks", "at", "wavelengths", "of", "267.8", "nm", "and", "371.0", "nm", ",", "and", "the", "rapid", "release", "of", "kaempferol", "in", "PED4", "turned", "the", "solution", "into", "yellow", "(", "Figure", "S5", ")", "." ] } ]
PMC8584666
Therefore, in this study, PC3 cells were used to investigate the function of GPI-80 in tumor cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "in", "this", "study", ",", "PC3", "cells", "were", "used", "to", "investigate", "the", "function", "of", "GPI-80", "in", "tumor", "cells", "." ] } ]
PMC11577421
Therefore, we performed additional experiments where we directly compared NP internalization between pristine and enzyme-treated CHO-K1 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Therefore", ",", "we", "performed", "additional", "experiments", "where", "we", "directly", "compared", "NP", "internalization", "between", "pristine", "and", "enzyme-treated", "CHO-K1", "cells", "." ] } ]
PMC10940855
Here, silencing EFNB2 expression in multiple myeloma cells inhibited multiple myeloma survival and proliferation, increased sensitivity to chemotherapy and abrogated multiple myeloma cell engraftment in vivo.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Here", ",", "silencing", "EFNB2", "expression", "in", "multiple", "myeloma", "cells", "inhibited", "multiple", "myeloma", "survival", "and", "proliferation", ",", "increased", "sensitivity", "to", "chemotherapy", "and", "abrogated", "multiple", "myeloma", "cell", "engraftment", "in", "vivo", "." ] } ]
PMC9473868
BAI-treated groups at 15 μM, 25 μM, and 50 μM promoted apoptosis of SW982 cells in a dose-dependent manner compared to the control group by FITC/PI double staining flow cytometry (Figures 2(a) and 2(b)).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "BAI-treated", "groups", "at", "15", "μM", ",", "25", "μM", ",", "and", "50", "μM", "promoted", "apoptosis", "of", "SW982", "cells", "in", "a", "dose-dependent", "manner", "compared", "to", "the", "control", "group", "by", "FITC/PI", "double", "staining", "flow", "cytometry", "(", "Figures", "2(a", ")", "and", "2(b", ")", ")", "." ] } ]
PMC4369959
Besides 6-gingerol, 6-shogaol also reduced the viability of gastric cancer cells by damaging microtubules .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Besides", "6-gingerol", ",", "6-shogaol", "also", "reduced", "the", "viability", "of", "gastric", "cancer", "cells", "by", "damaging", "microtubules", "." ] } ]
PMC9429973
Aims: The aim of this work is to report the presence of acquired coagulopathy at the debut of Multiple Myeloma, specifically the presence of an acquired factor X deficiency.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "The", "aim", "of", "this", "work", "is", "to", "report", "the", "presence", "of", "acquired", "coagulopathy", "at", "the", "debut", "of", "Multiple", "Myeloma", ",", "specifically", "the", "presence", "of", "an", "acquired", "factor", "X", "deficiency", "." ] } ]
PMC8469018
The concentration of each sample was determined by means of a linear equation calculated from the surface area.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "concentration", "of", "each", "sample", "was", "determined", "by", "means", "of", "a", "linear", "equation", "calculated", "from", "the", "surface", "area", "." ] } ]
PMC11750165
Previous study showed that Jagged-mediated Notch signaling is the key component of these mechanisms and plays an important role in maintaining pluripotency of neural progenitors in the ventral spinal cord until they assume a specific fate (Yeo & Chitnis, 2007).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Previous", "study", "showed", "that", "Jagged-mediated", "Notch", "signaling", "is", "the", "key", "component", "of", "these", "mechanisms", "and", "plays", "an", "important", "role", "in", "maintaining", "pluripotency", "of", "neural", "progenitors", "in", "the", "ventral", "spinal", "cord", "until", "they", "assume", "a", "specific", "fate", "(", "Yeo", "&", "Chitnis", ",", "2007", ")", "." ] } ]
PMC7602170
The authors did not describe the expression of phosphor-S6K1 when the GIST882 cell line received RAD001 plus imatinib as a combination.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "authors", "did", "not", "describe", "the", "expression", "of", "phosphor-S6K1", "when", "the", "GIST882", "cell", "line", "received", "RAD001", "plus", "imatinib", "as", "a", "combination", "." ] } ]
PMC11674891
qRT-PCR was performed in triplicate on a LightCycler 480 (Roche, Basel, Switzerland) using SYBR Green I Master Mix (Roche, Switzerland).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "qRT-PCR", "was", "performed", "in", "triplicate", "on", "a", "LightCycler", "480", "(", "Roche", ",", "Basel", ",", "Switzerland", ")", "using", "SYBR", "Green", "I", "Master", "Mix", "(", "Roche", ",", "Switzerland", ")", "." ] } ]
PMC10734950
F8 compound-induced apoptosis in CEM cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "F8", "compound-induced", "apoptosis", "in", "CEM", "cells", "." ] } ]
PMC11509309
In the context of prion diseases, some studies have explored the potential of bromotyrosine metabolites as inhibitors of prion protein aggregation and propagation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "context", "of", "prion", "diseases", ",", "some", "studies", "have", "explored", "the", "potential", "of", "bromotyrosine", "metabolites", "as", "inhibitors", "of", "prion", "protein", "aggregation", "and", "propagation", "." ] } ]
PMC6190245
Radiosensitivity determination using MTT assay HeLa cells were cultured as described above.
[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Radiosensitivity", "determination", "using", "MTT", "assay", "HeLa", "cells", "were", "cultured", "as", "described", "above", "." ] } ]
PMC11574271
B–D The mRNA expression levels of HIF-2α in 5637-shRON, 5637-NC, J82-oeRON, and J82-NC cells were quantified using quantitative real-time polymerase chain reaction (qRT-PCR), and confirmed by immunofluorescence staining and western blot analysis, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", "–", "D", "The", "mRNA", "expression", "levels", "of", "HIF-2α", "in", "5637-shRON", ",", "5637-NC", ",", "J82-oeRON", ",", "and", "J82-NC", "cells", "were", "quantified", "using", "quantitative", "real-time", "polymerase", "chain", "reaction", "(", "qRT-PCR", ")", ",", "and", "confirmed", "by", "immunofluorescence", "staining", "and", "western", "blot", "analysis", ",", "respectively", "." ] } ]
PMC10667689
A total of 6 × 10 cells from each cell line for each test were grown under indicated treatments (Ctrl, PMA, and Gal-9 groups) with three replicates in six-well plates.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "total", "of", "6", "×", "10", "cells", "from", "each", "cell", "line", "for", "each", "test", "were", "grown", "under", "indicated", "treatments", "(", "Ctrl", ",", "PMA", ",", "and", "Gal-9", "groups", ")", "with", "three", "replicates", "in", "six-well", "plates", "." ] } ]
PMC9429973
H. Einsele, P. Moreau, V. De Stefano, D. Dytfeld, E. Angelucci, R. Benjamin, H. Goldschmidt, N. W. van de Donk, B. Besemer, C. Scheid, R. Vij, E. I. ’.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H.", "Einsele", ",", "P.", "Moreau", ",", "V.", "De", "Stefano", ",", "D.", "Dytfeld", ",", "E.", "Angelucci", ",", "R.", "Benjamin", ",", "H.", "Goldschmidt", ",", "N.", "W.", "van", "de", "Donk", ",", "B.", "Besemer", ",", "C.", "Scheid", ",", "R.", "Vij", ",", "E.", "I.", "’", "." ] } ]
PMC9429973
Median overall survival (OS) after sCNSi was 1.3 years, with 2-year OS of 39.3%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "overall", "survival", "(", "OS", ")", "after", "sCNSi", "was", "1.3", "years", ",", "with", "2-year", "OS", "of", "39.3", "%", "." ] } ]
PMC9712534
We then inquired whether the H58Y substitution affects the sensitivity of TOP2B to ICRF-187 in living cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "then", "inquired", "whether", "the", "H58Y", "substitution", "affects", "the", "sensitivity", "of", "TOP2B", "to", "ICRF-187", "in", "living", "cells", "." ] } ]
PMC11075223
The level of HBV DNA in cytoplasm core particles of HepG2-2.2.15 cell line also decreased .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O" ], "tokens": [ "The", "level", "of", "HBV", "DNA", "in", "cytoplasm", "core", "particles", "of", "HepG2", "-", "2.2.15", "cell", "line", "also", "decreased", "." ] } ]
PMC8875242
The stock solutions were stored at −20 °C before use.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "stock", "solutions", "were", "stored", "at", "−20", "°", "C", "before", "use", "." ] } ]
PMC9429973
Patients also excluded is they were admitted for less than 24 hours.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "also", "excluded", "is", "they", "were", "admitted", "for", "less", "than", "24", "hours", "." ] } ]
PMC11740207
The hypothetical M_HPCs may represent a malignant stage, resembling early progenitors or tissue-specific precursors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "hypothetical", "M_HPCs", "may", "represent", "a", "malignant", "stage", ",", "resembling", "early", "progenitors", "or", "tissue-specific", "precursors", "." ] } ]
PMC8973085
Found: C, 62.64; H, 4.59; N, 8.77.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Found", ":", "C", ",", "62.64", ";", "H", ",", "4.59", ";", "N", ",", "8.77", "." ] } ]
PMC8358006
A significant negative correlation was found between H3K27me3 domain breadth and gene expression, which indicated grand H3K27me3 domains thoroughly repressed gene expression in NE2 cells (Fig. 1h, R = −0.76, P = 8.8 × 10, Spearman’s rank correlation).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "significant", "negative", "correlation", "was", "found", "between", "H3K27me3", "domain", "breadth", "and", "gene", "expression", ",", "which", "indicated", "grand", "H3K27me3", "domains", "thoroughly", "repressed", "gene", "expression", "in", "NE2", "cells", "(", "Fig.", "1h", ",", "R", "=", "−0.76", ",", "P", "=", "8.8", "×", "10", ",", "Spearman", "’s", "rank", "correlation", ")", "." ] } ]
PMC9503541
In the first purification step, a total of 18 fractions were obtained, with fraction F15 having the best anticancer activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "first", "purification", "step", ",", "a", "total", "of", "18", "fractions", "were", "obtained", ",", "with", "fraction", "F15", "having", "the", "best", "anticancer", "activity", "." ] } ]