Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11635519
The library was amplified using PCR with the oligonucleotides containing Gibson Assembly primers with BsrGI-HF and PstI-HF restriction sites and purified with a gel.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "library", "was", "amplified", "using", "PCR", "with", "the", "oligonucleotides", "containing", "Gibson", "Assembly", "primers", "with", "BsrGI-HF", "and", "PstI-HF", "restriction", "sites", "and", "purified", "with", "a", "gel", "." ] } ]
PMC9429973
The median age was 65 years old (range 60-74) and 41 (43.2%) were female.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "median", "age", "was", "65", "years", "old", "(", "range", "60", "-", "74", ")", "and", "41", "(", "43.2", "%", ")", "were", "female", "." ] } ]
PMC11095939
Despite 11 identified ubiquitination sites in Mecp2, our knowledge about the E3 ligases that catalyze the covalent attachment of ubiquitin to these sites remains scarce (Lamonica et al., 2017; Bellini et al., 2014).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "11", "identified", "ubiquitination", "sites", "in", "Mecp2", ",", "our", "knowledge", "about", "the", "E3", "ligases", "that", "catalyze", "the", "covalent", "attachment", "of", "ubiquitin", "to", "these", "sites", "remains", "scarce", "(", "Lamonica", "et", "al.", ",", "2017", ";", "Bellini", "et", "al.", ",", "2014", ")", "." ] } ]
PMC10748106
These lines represent the warning leverage (h*, dashed horizontal line), and three times the standard deviation in the prediction error (3×SDEP, dashed vertical lines).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "lines", "represent", "the", "warning", "leverage", "(", "h", "*", ",", "dashed", "horizontal", "line", ")", ",", "and", "three", "times", "the", "standard", "deviation", "in", "the", "prediction", "error", "(", "3", "×", "SDEP", ",", "dashed", "vertical", "lines", ")", "." ] } ]
PMC11761919
β-actin was used as reference gene.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "β-actin", "was", "used", "as", "reference", "gene", "." ] } ]
PMC11499381
We did not investigate the alternative combination (V155–238 attached to CLR, V1–154 attached to RAMP1) and it is possible that alternative positioning or alternative linker sequences may allow for further optimization.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "did", "not", "investigate", "the", "alternative", "combination", "(", "V155–238", "attached", "to", "CLR", ",", "V1–154", "attached", "to", "RAMP1", ")", "and", "it", "is", "possible", "that", "alternative", "positioning", "or", "alternative", "linker", "sequences", "may", "allow", "for", "further", "optimization", "." ] } ]
PMC11772449
Western Blot was used to detect the expression of LC3B-II in four hepatocellular carcinoma cell lines BEL-7404, PLC/PRF/5 and Huh-7 after 48 hours of culture in the control group, Sora (10 μM) single drug group, pirfenidone (1 mM) single drug group and combined drug group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Western", "Blot", "was", "used", "to", "detect", "the", "expression", "of", "LC3B-II", "in", "four", "hepatocellular", "carcinoma", "cell", "lines", "BEL-7404", ",", "PLC/PRF/5", "and", "Huh-7", "after", "48", "hours", "of", "culture", "in", "the", "control", "group", ",", "Sora", "(", "10", "μM", ")", "single", "drug", "group", ",", "pirfenidone", "(", "1", "mM", ")", "single", "drug", "group", "and", "combined", "drug", "group", "." ] } ]
PMC10669128
This model recapitulated the histology of the original tumor better than the same subcutaneous ectopic model .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "model", "recapitulated", "the", "histology", "of", "the", "original", "tumor", "better", "than", "the", "same", "subcutaneous", "ectopic", "model", "." ] } ]
PMC9429973
Aims: To develop an automated statistical analysis pipeline combined with machine learning techniques to derive robust patient clusters representative of novel molecular AML subtypes significantly associated with clinical variables and survival outcomes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "To", "develop", "an", "automated", "statistical", "analysis", "pipeline", "combined", "with", "machine", "learning", "techniques", "to", "derive", "robust", "patient", "clusters", "representative", "of", "novel", "molecular", "AML", "subtypes", "significantly", "associated", "with", "clinical", "variables", "and", "survival", "outcomes", "." ] } ]
PMC10968586
However, even at high concentrations, OLE and HT seem to be selectively cytotoxic for cancer cells, with no or negligible/minimal effects on non-cancer cells, as demonstrated for embryonic rat cardiomyoblasts H9c2(2-1), human breast epithelial cell line MCF-10A , nonmalignant human bronchial epithelial BEAS-2B cell line , normal colonic cell line CCD-841CoN , human normal liver cell line (HL-7702) , human normal prostate epithelial cells PWLE2 , human bile duct cell line HIBEpiC , human fibroblasts WI-38 , normal skin fibroblast cell line WS1 , human GN61 gingival fibroblasts , human lymphocytes , human PBMCs , and normal human fibroblasts .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "even", "at", "high", "concentrations", ",", "OLE", "and", "HT", "seem", "to", "be", "selectively", "cytotoxic", "for", "cancer", "cells", ",", "with", "no", "or", "negligible/minimal", "effects", "on", "non-cancer", "cells", ",", "as", "demonstrated", "for", "embryonic", "rat", "cardiomyoblasts", "H9c2(2", "-", "1", ")", ",", "human", "breast", "epithelial", "cell", "line", "MCF-10A", ",", "nonmalignant", "human", "bronchial", "epithelial", "BEAS-2B", "cell", "line", ",", "normal", "colonic", "cell", "line", "CCD-841CoN", ",", "human", "normal", "liver", "cell", "line", "(", "HL-7702", ")", ",", "human", "normal", "prostate", "epithelial", "cells", "PWLE2", ",", "human", "bile", "duct", "cell", "line", "HIBEpiC", ",", "human", "fibroblasts", "WI-38", ",", "normal", "skin", "fibroblast", "cell", "line", "WS1", ",", "human", "GN61", "gingival", "fibroblasts", ",", "human", "lymphocytes", ",", "human", "PBMCs", ",", "and", "normal", "human", "fibroblasts", "." ] } ]
PMC11721277
The reaction mixture was stirred for 35 min at 25 °C, after which tert-butyl (2-aminoethyl)carbamate (24 µL, 0.152 mmol) was added and the resulting solution was stirred for 5 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "reaction", "mixture", "was", "stirred", "for", "35", "min", "at", "25", "°", "C", ",", "after", "which", "tert-butyl", "(2-aminoethyl)carbamate", "(", "24", "µL", ",", "0.152", "mmol", ")", "was", "added", "and", "the", "resulting", "solution", "was", "stirred", "for", "5", "min", "." ] } ]
PMC11725127
Then, 50 ng of total cDNA was used for real-time PCR with the SYBR Premix Ex Taq Kit (TaKaRa).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Then", ",", "50", "ng", "of", "total", "cDNA", "was", "used", "for", "real-time", "PCR", "with", "the", "SYBR", "Premix", "Ex", "Taq", "Kit", "(", "TaKaRa", ")", "." ] } ]
PMC9672323
The effect of two different concentrations of dexamethasone (a) and piroxicam (b) on the proliferation of T cells in PBMCs was compared in stimulated and non-stimulated conditions (n = 3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "effect", "of", "two", "different", "concentrations", "of", "dexamethasone", "(", "a", ")", "and", "piroxicam", "(", "b", ")", "on", "the", "proliferation", "of", "T", "cells", "in", "PBMCs", "was", "compared", "in", "stimulated", "and", "non-stimulated", "conditions", "(", "n", "=", "3", ")", "." ] } ]
PMC11725127
C+ represents the Cysteine residue bound by GA. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C+", "represents", "the", "Cysteine", "residue", "bound", "by", "GA", ".", "(" ] } ]
PMC11055323
Total RNAs were prepared with TRIzol.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Total", "RNAs", "were", "prepared", "with", "TRIzol", "." ] } ]
PMC11785489
We then used the R package Harmony (v1.0) to remove batch effects from the per-cell principal component scores.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "then", "used", "the", "R", "package", "Harmony", "(", "v1.0", ")", "to", "remove", "batch", "effects", "from", "the", "per-cell", "principal", "component", "scores", "." ] } ]
PMC11490153
Both C. citratus EO and its primary component, citral, have been previously recognized in the literature for their anticancer properties, and they were thus utilized in this study as anticancer agents.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "C.", "citratus", "EO", "and", "its", "primary", "component", ",", "citral", ",", "have", "been", "previously", "recognized", "in", "the", "literature", "for", "their", "anticancer", "properties", ",", "and", "they", "were", "thus", "utilized", "in", "this", "study", "as", "anticancer", "agents", "." ] } ]
PMC10588957
Simultaneously, the level of SIRT1 also showed an upward trend, consistent with the expression of p-AMPK.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Simultaneously", ",", "the", "level", "of", "SIRT1", "also", "showed", "an", "upward", "trend", ",", "consistent", "with", "the", "expression", "of", "p-AMPK", "." ] } ]
PMC9000591
Therefore, the fractions obtained in the current study may be a potential source for the development of cancer treatments, since they could eliminate tumors by activating the apoptotic process.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "the", "fractions", "obtained", "in", "the", "current", "study", "may", "be", "a", "potential", "source", "for", "the", "development", "of", "cancer", "treatments", ",", "since", "they", "could", "eliminate", "tumors", "by", "activating", "the", "apoptotic", "process", "." ] } ]
PMC11721587
NIH3T3 cell was electroporated with the PX458 vector containing SgRNA GCTCCATCCGCTGCTCCTTC (−) targeting mouse Ulk3 and SpCas9, and a pUC19 vector with the following cassette inserted: left arm (Ulk3 C-terminal coding sequencing with stop codon mutated) – 3× HA tag – P2A – blasticidin resistant gene – right arm.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "NIH3T3", "cell", "was", "electroporated", "with", "the", "PX458", "vector", "containing", "SgRNA", "GCTCCATCCGCTGCTCCTTC", "(", "−", ")", "targeting", "mouse", "Ulk3", "and", "SpCas9", ",", "and", "a", "pUC19", "vector", "with", "the", "following", "cassette", "inserted", ":", "left", "arm", "(", "Ulk3", "C-terminal", "coding", "sequencing", "with", "stop", "codon", "mutated", ")", "–", "3", "×", "HA", "tag", "–", "P2A", "–", "blasticidin", "resistant", "gene", "–", "right", "arm", "." ] } ]
PMC6742971
Melanoma tumors are often enriched in melanoma-reactive TILs of both high and low avidity, whereby Melan-A-specific T cells are frequently detectable among the melanoma-reactive TILs in HLA-A2 positive patients (36).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Melanoma", "tumors", "are", "often", "enriched", "in", "melanoma-reactive", "TILs", "of", "both", "high", "and", "low", "avidity", ",", "whereby", "Melan-A-specific", "T", "cells", "are", "frequently", "detectable", "among", "the", "melanoma-reactive", "TILs", "in", "HLA-A2", "positive", "patients", "(", "36", ")", "." ] } ]
PMC11726848
When irradiated with a higher dose rate, a lower dose is required to achieve the effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "When", "irradiated", "with", "a", "higher", "dose", "rate", ",", "a", "lower", "dose", "is", "required", "to", "achieve", "the", "effect", "." ] } ]
PMC11552389
FOXN3 GSEA analyses in melanoma.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "FOXN3", "GSEA", "analyses", "in", "melanoma", "." ] } ]
PMC11694066
Stable pools of transfectants were generated by selection with hygromycin B, and the resulting three selected populations were submitted to clonal isolation using the limiting dilution method.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Stable", "pools", "of", "transfectants", "were", "generated", "by", "selection", "with", "hygromycin", "B", ",", "and", "the", "resulting", "three", "selected", "populations", "were", "submitted", "to", "clonal", "isolation", "using", "the", "limiting", "dilution", "method", "." ] } ]
PMC6442998
Imatinib showed an IC50 of 2.5μM, comparable with previously published data (IC50 >1μM), while cilostazol alone did not affect GIST48 viability in the 0 to 25 μM range (Figure 1A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Imatinib", "showed", "an", "IC50", "of", "2.5μM", ",", "comparable", "with", "previously", "published", "data", "(", "IC50", ">", "1μM", ")", ",", "while", "cilostazol", "alone", "did", "not", "affect", "GIST48", "viability", "in", "the", "0", "to", "25", "μM", "range", "(", "Figure", "1A", ")", "." ] } ]
PMC11721295
Next, we looked at transcriptional differences between the ON and OFF groups through differential expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Next", ",", "we", "looked", "at", "transcriptional", "differences", "between", "the", "ON", "and", "OFF", "groups", "through", "differential", "expression", "." ] } ]
PMC10813895
As individuals age, the population of ER+ luminal epithelial cells in normal breast tissue increases, but these cells show minimal proliferation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "individuals", "age", ",", "the", "population", "of", "ER+", "luminal", "epithelial", "cells", "in", "normal", "breast", "tissue", "increases", ",", "but", "these", "cells", "show", "minimal", "proliferation", "." ] } ]
PMC11092382
alopecuroides seeds on morphine withdrawal syndrome was evaluated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "alopecuroides", "seeds", "on", "morphine", "withdrawal", "syndrome", "was", "evaluated", "." ] } ]
PMC11754094
f, The effect of ART558 (POLQ inhibitor) in reducing large-deletion events mediated by the PE3 approach in HeLa cells measured by long-range amplicon sequencing (n = 3, mean ± s.e.m.).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "f", ",", "The", "effect", "of", "ART558", "(", "POLQ", "inhibitor", ")", "in", "reducing", "large-deletion", "events", "mediated", "by", "the", "PE3", "approach", "in", "HeLa", "cells", "measured", "by", "long-range", "amplicon", "sequencing", "(", "n", "=", "3", ",", "mean", "±", "s.e.m", ".", ")", "." ] } ]
PMC3888431
In order to extend and improve this transcript set, NGS technologies from Roche/454 and Illumina were applied to sequence normalized cDNA libraries constructed from CHO-K1 mRNA samples.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "In", "order", "to", "extend", "and", "improve", "this", "transcript", "set", ",", "NGS", "technologies", "from", "Roche/454", "and", "Illumina", "were", "applied", "to", "sequence", "normalized", "cDNA", "libraries", "constructed", "from", "CHO-K1", "mRNA", "samples", "." ] } ]
PMC5363531
To this purpose, REN were treated for 72 hours with increasing concentrations of dasatinib (1 nM to 1 μM).
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "this", "purpose", ",", "REN", "were", "treated", "for", "72", "hours", "with", "increasing", "concentrations", "of", "dasatinib", "(", "1", "nM", "to", "1", "μM", ")", "." ] } ]
PMC9985266
Our data suggest that hypomethylation of the MEG3 promoter can weaken PF because IL-27 can inhibit the methylation of the MEG3 gene mediated by DNMT1, which inhibits the ERK/p38 pathway to induce autophagy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "data", "suggest", "that", "hypomethylation", "of", "the", "MEG3", "promoter", "can", "weaken", "PF", "because", "IL-27", "can", "inhibit", "the", "methylation", "of", "the", "MEG3", "gene", "mediated", "by", "DNMT1", ",", "which", "inhibits", "the", "ERK/p38", "pathway", "to", "induce", "autophagy", "." ] } ]
PMC11705484
Fluorescence imaging of xenografted tumours in live mice was taken 30 days post‐treatment (left), and tumour size was monitored during the 30 days of treatment (right). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fluorescence", "imaging", "of", "xenografted", "tumours", "in", "live", "mice", "was", "taken", "30", "days", "post‐treatment", "(", "left", ")", ",", "and", "tumour", "size", "was", "monitored", "during", "the", "30", "days", "of", "treatment", "(", "right", ")", ".", "(" ] } ]
PMC11026382
Each point represents one triplicate experimental measurement.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Each", "point", "represents", "one", "triplicate", "experimental", "measurement", "." ] } ]
PMC9792775
Six–eight weeks Institute of Cancer Research (ICR) male mice were subcutaneously inoculated in the backside region with 5 × 10 S180 sarcoma cells suspended in 0.1 ml PBS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Six", "–", "eight", "weeks", "Institute", "of", "Cancer", "Research", "(", "ICR", ")", "male", "mice", "were", "subcutaneously", "inoculated", "in", "the", "backside", "region", "with", "5", "×", "10", "S180", "sarcoma", "cells", "suspended", "in", "0.1", "ml", "PBS", "." ] } ]
PMC9250505
The mice were euthanized when xenografts reached the humane endpoint (volume ≥ 1100 mm) as a surrogate for lifespan.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mice", "were", "euthanized", "when", "xenografts", "reached", "the", "humane", "endpoint", "(", "volume", "≥", "1100", "mm", ")", "as", "a", "surrogate", "for", "lifespan", "." ] } ]
PMC10999934
Table 2NumberSequencestB0001215ACACTGGCAGCAGTTCTACTstB0001215BACGAGCTCACCGTTAAGCTstB0001215CGATGAGAGCGTCAAGAAGT The sequence of the siRNA in the study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Table", "2NumberSequencestB0001215ACACTGGCAGCAGTTCTACTstB0001215BACGAGCTCACCGTTAAGCTstB0001215CGATGAGAGCGTCAAGAAGT", "The", "sequence", "of", "the", "siRNA", "in", "the", "study", "." ] } ]
PMC11064533
Disseminated infections may require treatment with antibiotics and although E. coli is inherently sensitive to almost all classes of antibiotics, frequent acquisition of resistance genes through horizontal gene transfer complicates treatment and contributes to resistance in other pathogens (2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Disseminated", "infections", "may", "require", "treatment", "with", "antibiotics", "and", "although", "E.", "coli", "is", "inherently", "sensitive", "to", "almost", "all", "classes", "of", "antibiotics", ",", "frequent", "acquisition", "of", "resistance", "genes", "through", "horizontal", "gene", "transfer", "complicates", "treatment", "and", "contributes", "to", "resistance", "in", "other", "pathogens", "(", "2", ")", "." ] } ]
PMC9412887
The particle size of SSB NMs was approximately 130 nm and the zeta potential of SSB NMs was approximately −5.32 mV. In their study, the cytotoxicity of NK92 cells to HCC1937 cells and MMDA-MB-468 cells were significantly increased by SSB NMs pretreatment for 12 h. Moreover, activated NK cells obtained from patients were further used to evaluate the immunosensitization triggered by SSB NMs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "particle", "size", "of", "SSB", "NMs", "was", "approximately", "130", "nm", "and", "the", "zeta", "potential", "of", "SSB", "NMs", "was", "approximately", "−5.32", "mV.", "In", "their", "study", ",", "the", "cytotoxicity", "of", "NK92", "cells", "to", "HCC1937", "cells", "and", "MMDA-MB-468", "cells", "were", "significantly", "increased", "by", "SSB", "NMs", "pretreatment", "for", "12", "h.", "Moreover", ",", "activated", "NK", "cells", "obtained", "from", "patients", "were", "further", "used", "to", "evaluate", "the", "immunosensitization", "triggered", "by", "SSB", "NMs", "." ] } ]
PMC11409031
In OV, the complex interaction between malignant tumors and the tumor microenvironment (TME) plays a crucial role in cancer progression, metastasis, and the development of resistance to various therapies .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "OV", ",", "the", "complex", "interaction", "between", "malignant", "tumors", "and", "the", "tumor", "microenvironment", "(", "TME", ")", "plays", "a", "crucial", "role", "in", "cancer", "progression", ",", "metastasis", ",", "and", "the", "development", "of", "resistance", "to", "various", "therapies", "." ] } ]
PMC11243198
To assess the six GANT61 analogs, the Gli-luciferase NIH3T3 cells were stimulated with SAG at its EC50 concentration (26 nM, Supplemental Figure S1B), compounds added in dose–response (with KAAD-cyc as a positive control inhibitor (IC50 = 8.8 nM); Supplemental Figure S1B), and the luciferase activity measured.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "assess", "the", "six", "GANT61", "analogs", ",", "the", "Gli-luciferase", "NIH3T3", "cells", "were", "stimulated", "with", "SAG", "at", "its", "EC50", "concentration", "(", "26", "nM", ",", "Supplemental", "Figure", "S1B", ")", ",", "compounds", "added", "in", "dose", "–", "response", "(", "with", "KAAD-cyc", "as", "a", "positive", "control", "inhibitor", "(", "IC50", "=", "8.8", "nM", ")", ";", "Supplemental", "Figure", "S1B", ")", ",", "and", "the", "luciferase", "activity", "measured", "." ] } ]
PMC11190538
Similar letters are not significant while different letters are significant at P ≤ 0.05.Fig.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similar", "letters", "are", "not", "significant", "while", "different", "letters", "are", "significant", "at", "P", "≤", "0.05.Fig", "." ] } ]
PMC11116779
On the other hand, the expression of the anti-apoptotic gene BCL-2 decreased at the lowest concentrations, namely 10 and 100 μg/mL, and showed a slight increase at the highest concentration, i.e., 500 μg/mL. Future investigations involving pyroptosis, autophagy, and ferroptosis are necessary for a comprehensive understanding of lung cell death induced by PS-NPs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "other", "hand", ",", "the", "expression", "of", "the", "anti-apoptotic", "gene", "BCL-2", "decreased", "at", "the", "lowest", "concentrations", ",", "namely", "10", "and", "100", "μg/mL", ",", "and", "showed", "a", "slight", "increase", "at", "the", "highest", "concentration", ",", "i.e.", ",", "500", "μg/mL.", "Future", "investigations", "involving", "pyroptosis", ",", "autophagy", ",", "and", "ferroptosis", "are", "necessary", "for", "a", "comprehensive", "understanding", "of", "lung", "cell", "death", "induced", "by", "PS-NPs", "." ] } ]
PMC9429973
FFM analysis of consecutive PBS samples obtained from 26 R/R DLBCL patients, treated either with tisagenlecleucel (tisa-cel) or axicabtagene ciloleucel (axi-cel) at the Tel Aviv Sourasky Medical Center between October 2019-October 2020 was performed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FFM", "analysis", "of", "consecutive", "PBS", "samples", "obtained", "from", "26", "R/R", "DLBCL", "patients", ",", "treated", "either", "with", "tisagenlecleucel", "(", "tisa-cel", ")", "or", "axicabtagene", "ciloleucel", "(", "axi-cel", ")", "at", "the", "Tel", "Aviv", "Sourasky", "Medical", "Center", "between", "October", "2019-October", "2020", "was", "performed", "." ] } ]
PMC11711935
Skin exposure to ultraviolet radiation (UVR) can cause an increase in reactive oxygen species (ROS), thereby activating signaling pathways involving epidermal keratinocytes and dermal fibroblasts, as well as activating of inflammatory genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Skin", "exposure", "to", "ultraviolet", "radiation", "(", "UVR", ")", "can", "cause", "an", "increase", "in", "reactive", "oxygen", "species", "(", "ROS", ")", ",", "thereby", "activating", "signaling", "pathways", "involving", "epidermal", "keratinocytes", "and", "dermal", "fibroblasts", ",", "as", "well", "as", "activating", "of", "inflammatory", "genes", "." ] } ]
PMC10452486
They immunostained with mAb HC10 to confirm that the emergence of Face-2 is due to dissociation of B2m from Face-1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "immunostained", "with", "mAb", "HC10", "to", "confirm", "that", "the", "emergence", "of", "Face-2", "is", "due", "to", "dissociation", "of", "B2", "m", "from", "Face-1", "." ] } ]
PMC9596868
Similarly, we treated A2780 cells with different concentrations of quercetin (15, 35 and 55 µM) and MST-312 (2, 3 and 4 µM) alone and in combination for 72 h. As shown in Fig. 2C and D, the combinatorial treatment led to significant increase in cytotoxicity as compared to individual compounds.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similarly", ",", "we", "treated", "A2780", "cells", "with", "different", "concentrations", "of", "quercetin", "(", "15", ",", "35", "and", "55", "µM", ")", "and", "MST-312", "(", "2", ",", "3", "and", "4", "µM", ")", "alone", "and", "in", "combination", "for", "72", "h.", "As", "shown", "in", "Fig.", "2C", "and", "D", ",", "the", "combinatorial", "treatment", "led", "to", "significant", "increase", "in", "cytotoxicity", "as", "compared", "to", "individual", "compounds", "." ] } ]
PMC9250505
The sections were dehydrated through graded alcohols, immersed in xylene, mounted with coverslips, and analyzed under a light microscope (CX31, Olympus, Japan) with ×4, ×10, or ×20 magnifications.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "sections", "were", "dehydrated", "through", "graded", "alcohols", ",", "immersed", "in", "xylene", ",", "mounted", "with", "coverslips", ",", "and", "analyzed", "under", "a", "light", "microscope", "(", "CX31", ",", "Olympus", ",", "Japan", ")", "with", "×4", ",", "×10", ",", "or", "×20", "magnifications", "." ] } ]
PMC9118379
The remaining 79 spectra were unidentified or assigned to nonvariant peptides by all of the three OMS tools.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "remaining", "79", "spectra", "were", "unidentified", "or", "assigned", "to", "nonvariant", "peptides", "by", "all", "of", "the", "three", "OMS", "tools", "." ] } ]
PMC10454535
Flow cytometric analysis showed a decrease of the viable cell population and an increase in early apoptotic cells with the individual 5 μM PIN and 5 nM BTZ treatments (Figure 4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Flow", "cytometric", "analysis", "showed", "a", "decrease", "of", "the", "viable", "cell", "population", "and", "an", "increase", "in", "early", "apoptotic", "cells", "with", "the", "individual", "5", "μM", "PIN", "and", "5", "nM", "BTZ", "treatments", "(", "Figure", "4", ")", "." ] } ]
PMC7294030
Aurisin A was dissolved in DMSO to a concentration of 16 mM and further diluted to appropriate concentrations in the experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aurisin", "A", "was", "dissolved", "in", "DMSO", "to", "a", "concentration", "of", "16", "mM", "and", "further", "diluted", "to", "appropriate", "concentrations", "in", "the", "experiments", "." ] } ]
PMC9429973
Logistic regression analysis and Cox regression analysis was applied to identify the risk factors independently associated with anemia in SSc.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Logistic", "regression", "analysis", "and", "Cox", "regression", "analysis", "was", "applied", "to", "identify", "the", "risk", "factors", "independently", "associated", "with", "anemia", "in", "SSc", "." ] } ]
PMC11790971
Using a linear support vector machine classifier, RFE recursively selected a smaller set of features by pruning the least important features based on the feature weights (i.e., coefficients of the support vector) assigned by the classifier.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "a", "linear", "support", "vector", "machine", "classifier", ",", "RFE", "recursively", "selected", "a", "smaller", "set", "of", "features", "by", "pruning", "the", "least", "important", "features", "based", "on", "the", "feature", "weights", "(", "i.e.", ",", "coefficients", "of", "the", "support", "vector", ")", "assigned", "by", "the", "classifier", "." ] } ]
PMC11228511
Mean ± SEM.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Mean", "±", "SEM", "." ] } ]
PMC7685376
Differential expression levels of MCM family members were enriched in DNA replication pathways.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Differential", "expression", "levels", "of", "MCM", "family", "members", "were", "enriched", "in", "DNA", "replication", "pathways", "." ] } ]
PMC11770746
By protecting the Pt(IV) complex in their inner lipophilic core, these slightly charged nanoparticles, with sizes of about 16 nm, particle concentration of 10 particles/mL and desirable polydispersity index (PDI) of 0.09, were stable for about 1 week upon storage at 4 °C and able to stably circulate in the bloodstream, while preventing the premature recognition by the immune system thanks to their surface decoration with hydrophilic poly(ethylene glycol) (PEG) chains. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "protecting", "the", "Pt(IV", ")", "complex", "in", "their", "inner", "lipophilic", "core", ",", "these", "slightly", "charged", "nanoparticles", ",", "with", "sizes", "of", "about", "16", "nm", ",", "particle", "concentration", "of", "10", "particles/mL", "and", "desirable", "polydispersity", "index", "(", "PDI", ")", "of", "0.09", ",", "were", "stable", "for", "about", "1", "week", "upon", "storage", "at", "4", "°", "C", "and", "able", "to", "stably", "circulate", "in", "the", "bloodstream", ",", "while", "preventing", "the", "premature", "recognition", "by", "the", "immune", "system", "thanks", "to", "their", "surface", "decoration", "with", "hydrophilic", "poly(ethylene", "glycol", ")", "(", "PEG", ")", "chains", ".", "(" ] } ]
PMC9429973
Of note, the phosphatase SHP-1 has recently been shown to be required for the TGFβ-induced quiescence of HSCs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Of", "note", ",", "the", "phosphatase", "SHP-1", "has", "recently", "been", "shown", "to", "be", "required", "for", "the", "TGFβ-induced", "quiescence", "of", "HSCs", "." ] } ]
PMC11680982
These findings provide significant insights into the development of effective and tolerable three-drug combination regimens applying “medium-dose Ner + ET + CDK4/6i” for clinical HR/HER2-low breast cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "findings", "provide", "significant", "insights", "into", "the", "development", "of", "effective", "and", "tolerable", "three-drug", "combination", "regimens", "applying", "“", "medium-dose", "Ner", "+", "ET", "+", "CDK4/6i", "”", "for", "clinical", "HR/HER2-low", "breast", "cancer", "." ] } ]
PMC11680562
These peaks are attributed to Cu–O bands.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "peaks", "are", "attributed", "to", "Cu", "–", "O", "bands", "." ] } ]
PMC11718817
Crosstalk between NLRP3 and T cells has been suggested by demonstrating that activation of DC through ATP leakage from dead cells can result in production of IL-1β and IL-18, which in turn triggers secretion of IFN-γ from CD8 T cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Crosstalk", "between", "NLRP3", "and", "T", "cells", "has", "been", "suggested", "by", "demonstrating", "that", "activation", "of", "DC", "through", "ATP", "leakage", "from", "dead", "cells", "can", "result", "in", "production", "of", "IL-1β", "and", "IL-18", ",", "which", "in", "turn", "triggers", "secretion", "of", "IFN-γ", "from", "CD8", "T", "cells", "." ] } ]
PMC11655498
Four EBV miR-BARTs (BART5-5p, BART7-3p, BART9-3p, and BART14-3p) cooperatively regulate and suppress ATM, resulting in the disruption of EBV reactivation (Lung et al., 2018).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Four", "EBV", "miR-BARTs", "(", "BART5", "-", "5p", ",", "BART7", "-", "3p", ",", "BART9", "-", "3p", ",", "and", "BART14", "-", "3p", ")", "cooperatively", "regulate", "and", "suppress", "ATM", ",", "resulting", "in", "the", "disruption", "of", "EBV", "reactivation", "(", "Lung", "et", "al.", ",", "2018", ")", "." ] } ]
PMC11279397
Additionally, the results of molecular docking research have also shown Eugenol’s inhibitory effects on Dengue virus by interacting with the NS1 and NS5 proteins .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "the", "results", "of", "molecular", "docking", "research", "have", "also", "shown", "Eugenol", "’s", "inhibitory", "effects", "on", "Dengue", "virus", "by", "interacting", "with", "the", "NS1", "and", "NS5", "proteins", "." ] } ]
PMC7582629
Single-point Raman spectra were acquired to specifically characterize the biochemical fingerprint of ambiguous structures within the OCT tissue image .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single-point", "Raman", "spectra", "were", "acquired", "to", "specifically", "characterize", "the", "biochemical", "fingerprint", "of", "ambiguous", "structures", "within", "the", "OCT", "tissue", "image", "." ] } ]
PMC10873328
The regression coefficient (β) was derived from multivariate Cox regression analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "regression", "coefficient", "(", "β", ")", "was", "derived", "from", "multivariate", "Cox", "regression", "analysis", "." ] } ]
PMC11741906
Furthermore, gene expression of miRNAs that was confirmed to be changed in A2780cis cells were also studied in SK-OV-3 ovarian cancer cell line, which was used as another model for chemoresistance using qPCR as mentioned above.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "B-CellLine", "I-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "gene", "expression", "of", "miRNAs", "that", "was", "confirmed", "to", "be", "changed", "in", "A2780cis", "cells", "were", "also", "studied", "in", "SK-OV-3", "ovarian", "cancer", "cell", "line", ",", "which", "was", "used", "as", "another", "model", "for", "chemoresistance", "using", "qPCR", "as", "mentioned", "above", "." ] } ]
PMC11730311
Five hαCGRP8-37 analogues conjugated with C20DA-γGlu at position 14, 17, 19, 20, or 25 were analysed for in vivo exposure in male NMRI mice.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Five", "hαCGRP8", "-", "37", "analogues", "conjugated", "with", "C20DA-γGlu", "at", "position", "14", ",", "17", ",", "19", ",", "20", ",", "or", "25", "were", "analysed", "for", "in", "vivo", "exposure", "in", "male", "NMRI", "mice", "." ] } ]
PMC11001582
Several of the top predicted regulators were common between our DPR knock-in mice and human C9orf72 iPS cell-derived motor neurons, including TGF-β1 and its intracellular mediator SMAD2/3, as well as AGT, CCR2 and SORL1 (Fig. 6a).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Several", "of", "the", "top", "predicted", "regulators", "were", "common", "between", "our", "DPR", "knock-in", "mice", "and", "human", "C9orf72", "iPS", "cell-derived", "motor", "neurons", ",", "including", "TGF-β1", "and", "its", "intracellular", "mediator", "SMAD2/3", ",", "as", "well", "as", "AGT", ",", "CCR2", "and", "SORL1", "(", "Fig.", "6a", ")", "." ] } ]
PMC9429973
Secondary endpoints include progression-free survival (PFS) rate, overall survival (OS) rate of 2 years and toxicity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Secondary", "endpoints", "include", "progression-free", "survival", "(", "PFS", ")", "rate", ",", "overall", "survival", "(", "OS", ")", "rate", "of", "2", "years", "and", "toxicity", "." ] } ]
PMC6461034
Elute bound peptides by adding 40 μl 0.15% TFA to the bead pellet and mix by gently flicking the bottom of the tube.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Elute", "bound", "peptides", "by", "adding", "40", "μl", "0.15", "%", "TFA", "to", "the", "bead", "pellet", "and", "mix", "by", "gently", "flicking", "the", "bottom", "of", "the", "tube", "." ] } ]
PMC6267596
The RNA-Seq, kinome profiling and proteomic data are available from corresponding author upon request.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "RNA-Seq", ",", "kinome", "profiling", "and", "proteomic", "data", "are", "available", "from", "corresponding", "author", "upon", "request", "." ] } ]
PMC11721587
Both Fu/Ulk3 and Sufu co-bind with Ci/Gli2 on Hh target promoters, and their chromatin association depends on Ci/Gli2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "Fu/Ulk3", "and", "Sufu", "co-bind", "with", "Ci/Gli2", "on", "Hh", "target", "promoters", ",", "and", "their", "chromatin", "association", "depends", "on", "Ci/Gli2", "." ] } ]
PMC11763111
The right diagram depicts the ratio of GFP-positive tumor cells lysed after 48 h of reaction in comparison to the control group, which comprised NK cells and tumor cells without CAR-T cells (n = 3).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "right", "diagram", "depicts", "the", "ratio", "of", "GFP-positive", "tumor", "cells", "lysed", "after", "48", "h", "of", "reaction", "in", "comparison", "to", "the", "control", "group", ",", "which", "comprised", "NK", "cells", "and", "tumor", "cells", "without", "CAR-T", "cells", "(", "n", "=", "3", ")", "." ] } ]
PMC9105697
The patient presented with a 38 cm large SS in his right lower leg.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "patient", "presented", "with", "a", "38", "cm", "large", "SS", "in", "his", "right", "lower", "leg", "." ] } ]
PMC11575040
In nondiabetic patients with melanoma, the overall survival of high LINC00094 expression group was shorter than the low LINC00094 expression group with borderline statistical significance (log-rank test, P = 0.057).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "nondiabetic", "patients", "with", "melanoma", ",", "the", "overall", "survival", "of", "high", "LINC00094", "expression", "group", "was", "shorter", "than", "the", "low", "LINC00094", "expression", "group", "with", "borderline", "statistical", "significance", "(", "log-rank", "test", ",", "P", "=", "0.057", ")", "." ] } ]
PMC11730311
Data were acquired in data-dependent acquisition mode at an MS1 resolution of 60.000, and an MS2 resolution of 30.000 in positive mode (Top4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "were", "acquired", "in", "data-dependent", "acquisition", "mode", "at", "an", "MS1", "resolution", "of", "60.000", ",", "and", "an", "MS2", "resolution", "of", "30.000", "in", "positive", "mode", "(", "Top4", ")", "." ] } ]
PMC10890307
Traditional chemotherapeutic agents kill cells that divide rapidly .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Traditional", "chemotherapeutic", "agents", "kill", "cells", "that", "divide", "rapidly", "." ] } ]
PMC9429973
Started on the date of the allogeneic HSCT, the survival analysis showed that the average survival period of the low Reg3α group was 472 days, and the average survival of the high Reg3α group was 94 days, and the difference between the two groups was statistically significant (P<0.05) Image: Summary/Conclusion: High serum Reg3α level in patients after CART treatment before hematopoietic stem cell transplantation is associated with poor prognosis, which can be used as a marker to prompt clinical selection of appropriate therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Started", "on", "the", "date", "of", "the", "allogeneic", "HSCT", ",", "the", "survival", "analysis", "showed", "that", "the", "average", "survival", "period", "of", "the", "low", "Reg3α", "group", "was", "472", "days", ",", "and", "the", "average", "survival", "of", "the", "high", "Reg3α", "group", "was", "94", "days", ",", "and", "the", "difference", "between", "the", "two", "groups", "was", "statistically", "significant", "(", "P<0.05", ")", "Image", ":", "Summary/Conclusion", ":", "High", "serum", "Reg3α", "level", "in", "patients", "after", "CART", "treatment", "before", "hematopoietic", "stem", "cell", "transplantation", "is", "associated", "with", "poor", "prognosis", ",", "which", "can", "be", "used", "as", "a", "marker", "to", "prompt", "clinical", "selection", "of", "appropriate", "therapy", "." ] } ]
PMC11803149
These results suggest that an impaired Epas1-dependent pathway is a major age-related defect in tumor-specific CD8 T responses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "suggest", "that", "an", "impaired", "Epas1-dependent", "pathway", "is", "a", "major", "age-related", "defect", "in", "tumor-specific", "CD8", "T", "responses", "." ] } ]
PMC11539788
In addition, analysing the associations among RNF19A, ILK, and the AKT/mTOR signalling pathway in human BCa samples would be more useful.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "analysing", "the", "associations", "among", "RNF19A", ",", "ILK", ",", "and", "the", "AKT/mTOR", "signalling", "pathway", "in", "human", "BCa", "samples", "would", "be", "more", "useful", "." ] } ]
PMC11772585
cSCC, with its high glycolytic metabolism , is the second most prevalent form of skin cancer, accounting for approximately 20% of all skin malignancies, following closely behind basal cell carcinoma in terms of incidence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "cSCC", ",", "with", "its", "high", "glycolytic", "metabolism", ",", "is", "the", "second", "most", "prevalent", "form", "of", "skin", "cancer", ",", "accounting", "for", "approximately", "20", "%", "of", "all", "skin", "malignancies", ",", "following", "closely", "behind", "basal", "cell", "carcinoma", "in", "terms", "of", "incidence", "." ] } ]
PMC9429973
Modakafusp alfa concentrations were determined via a validated enzyme-linked immunosorbent assay; ADA were detected using a validated bridging electrochemiluminescence assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Modakafusp", "alfa", "concentrations", "were", "determined", "via", "a", "validated", "enzyme-linked", "immunosorbent", "assay", ";", "ADA", "were", "detected", "using", "a", "validated", "bridging", "electrochemiluminescence", "assay", "." ] } ]
PMC9429973
Aims: This study in pediatric pts with relapsed/resistant Ph+ ALL or with the T315I mutation aims to establish the recommended Phase 2 dose (RP2D) of PON and assess the pharmacokinetics, safety, and efficacy of PON in combination with chemotherapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "This", "study", "in", "pediatric", "pts", "with", "relapsed/resistant", "Ph+", "ALL", "or", "with", "the", "T315I", "mutation", "aims", "to", "establish", "the", "recommended", "Phase", "2", "dose", "(", "RP2D", ")", "of", "PON", "and", "assess", "the", "pharmacokinetics", ",", "safety", ",", "and", "efficacy", "of", "PON", "in", "combination", "with", "chemotherapy", "." ] } ]
PMC11694625
The intermediate 2b was also obtained by the same method, yield ca.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "intermediate", "2b", "was", "also", "obtained", "by", "the", "same", "method", ",", "yield", "ca", "." ] } ]
PMC11683130
As mentioned earlier, SerpinB13 is highly expressed in psoriasis lesions (139).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "mentioned", "earlier", ",", "SerpinB13", "is", "highly", "expressed", "in", "psoriasis", "lesions", "(", "139", ")", "." ] } ]
PMC11185260
Mice received total 6 injections of scL-SMARCB1 (30μg/injection, twice weekly for 3 weeks) and/or total 3 injections of cisplatin (2 mg/kg, weekly for 3 weeks). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mice", "received", "total", "6", "injections", "of", "scL-SMARCB1", "(", "30μg/injection", ",", "twice", "weekly", "for", "3", "weeks", ")", "and/or", "total", "3", "injections", "of", "cisplatin", "(", "2", "mg/kg", ",", "weekly", "for", "3", "weeks", ")", ".", "(" ] } ]
PMC10723784
There are approximately 7500 new cases every year and approximately 35% of women diagnosed with ovarian cancer survive for 10 years.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "are", "approximately", "7500", "new", "cases", "every", "year", "and", "approximately", "35", "%", "of", "women", "diagnosed", "with", "ovarian", "cancer", "survive", "for", "10", "years", "." ] } ]
PMC9429973
ABT-199, a selective Bcl-2 inhibitor, was effective in reducing leukemic burden in vitro and in vivo in B-ALL.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ABT-199", ",", "a", "selective", "Bcl-2", "inhibitor", ",", "was", "effective", "in", "reducing", "leukemic", "burden", "in", "vitro", "and", "in", "vivo", "in", "B-ALL", "." ] } ]
PMC11743414
HL60 cells at a density of 10/100 µL were inoculated into 24-well plates and treated with cytarabine and daunorubicin at different concentrations for 24 h. Annexin V-FITC/PI (5 μL) was added to 100 µL of cell suspension and incubated at room temperature in the dark for 10 min, then cell apoptosis was detected by flow cytometry.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HL60", "cells", "at", "a", "density", "of", "10/100", "µL", "were", "inoculated", "into", "24-well", "plates", "and", "treated", "with", "cytarabine", "and", "daunorubicin", "at", "different", "concentrations", "for", "24", "h.", "Annexin", "V-FITC/PI", "(", "5", "μL", ")", "was", "added", "to", "100", "µL", "of", "cell", "suspension", "and", "incubated", "at", "room", "temperature", "in", "the", "dark", "for", "10", "min", ",", "then", "cell", "apoptosis", "was", "detected", "by", "flow", "cytometry", "." ] } ]
PMC11464609
The viral enrichment panel includes probes targeting > 3000 viral genomes, including EBV, HSV-1, JCPyV, TBEV, HIV-1 and HSV-1 (samples #1–14).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "viral", "enrichment", "panel", "includes", "probes", "targeting", ">", "3000", "viral", "genomes", ",", "including", "EBV", ",", "HSV-1", ",", "JCPyV", ",", "TBEV", ",", "HIV-1", "and", "HSV-1", "(", "samples", "#", "1–14", ")", "." ] } ]
PMC11206251
After blocking with a rapid blocking solution at room temperature for 10 min, the membranes were incubated with the primary antibodies at 4 °C overnight.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "blocking", "with", "a", "rapid", "blocking", "solution", "at", "room", "temperature", "for", "10", "min", ",", "the", "membranes", "were", "incubated", "with", "the", "primary", "antibodies", "at", "4", "°", "C", "overnight", "." ] } ]
PMC10006224
Then, cohesin peaks called for any of the three subunits were merged and intersected with CTCF peaks to define two clusters of cohesin positions with or without CTCF.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Then", ",", "cohesin", "peaks", "called", "for", "any", "of", "the", "three", "subunits", "were", "merged", "and", "intersected", "with", "CTCF", "peaks", "to", "define", "two", "clusters", "of", "cohesin", "positions", "with", "or", "without", "CTCF", "." ] } ]
PMC9429973
Results: We revealed that in patient AML samples at the stage of MRD there is clonogenic capacity of leukemic stem/progenitors (Figure 1A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "We", "revealed", "that", "in", "patient", "AML", "samples", "at", "the", "stage", "of", "MRD", "there", "is", "clonogenic", "capacity", "of", "leukemic", "stem/progenitors", "(", "Figure", "1A", ")", "." ] } ]
PMC11714165
143B cells were incubated with various concentrations of peptides in serum‐free medium for 6 h. Subsequently, cells were supplemented with 100 µL of medium (10% FBS).
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "143B", "cells", "were", "incubated", "with", "various", "concentrations", "of", "peptides", "in", "serum‐free", "medium", "for", "6", "h.", "Subsequently", ",", "cells", "were", "supplemented", "with", "100", "µL", "of", "medium", "(", "10", "%", "FBS", ")", "." ] } ]
PMC11521786
Since this receptor lacks tyrosine kinase activity (21), it cannot be specifically targeted with the tyrosine kinase inhibitors that have been successful against HER1 and HER2 (1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "this", "receptor", "lacks", "tyrosine", "kinase", "activity", "(", "21", ")", ",", "it", "can", "not", "be", "specifically", "targeted", "with", "the", "tyrosine", "kinase", "inhibitors", "that", "have", "been", "successful", "against", "HER1", "and", "HER2", "(", "1", ")", "." ] } ]
PMC9985266
The fluorescence intensity of LC3 and Beclin1 was again significantly decreased when IL-27 and 3-MA were cotreated compared with the IL-27-treated group (Fig. 2C; Additional file 1: Fig. S5B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "fluorescence", "intensity", "of", "LC3", "and", "Beclin1", "was", "again", "significantly", "decreased", "when", "IL-27", "and", "3-MA", "were", "cotreated", "compared", "with", "the", "IL-27-treated", "group", "(", "Fig.", "2C", ";", "Additional", "file", "1", ":", "Fig.", "S5B", ")", "." ] } ]
PMC9429973
No differences were observed between patients with or without secondary neoplasm (Figure 1) in terms of overall survival neither according to the type of cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "differences", "were", "observed", "between", "patients", "with", "or", "without", "secondary", "neoplasm", "(", "Figure", "1", ")", "in", "terms", "of", "overall", "survival", "neither", "according", "to", "the", "type", "of", "cancer", "." ] } ]
PMC11752767
As a reaction to off-tumor toxicities and cross-reactivity, groups have developed a mutational positioning scan (X-scan) with a peptide library where each epitope residue is consecutively replaced by all other amino acids.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "a", "reaction", "to", "off-tumor", "toxicities", "and", "cross-reactivity", ",", "groups", "have", "developed", "a", "mutational", "positioning", "scan", "(", "X-scan", ")", "with", "a", "peptide", "library", "where", "each", "epitope", "residue", "is", "consecutively", "replaced", "by", "all", "other", "amino", "acids", "." ] } ]
PMC11743316
This carrier demonstrates toxicity towards cancer cells with an IC50 value (4.25 ± 0.16 μM) similar to that of free cisplatin (3.87 ± 0.37 μM) and releases cisplatin in a pH-dependent manner.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "carrier", "demonstrates", "toxicity", "towards", "cancer", "cells", "with", "an", "IC50", "value", "(", "4.25", "±", "0.16", "μM", ")", "similar", "to", "that", "of", "free", "cisplatin", "(", "3.87", "±", "0.37", "μM", ")", "and", "releases", "cisplatin", "in", "a", "pH-dependent", "manner", "." ] } ]
PMC10154881
At 9 days after initial viral injection, OVA tetramer CD8 T cells were analyzed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "At", "9", "days", "after", "initial", "viral", "injection", ",", "OVA", "tetramer", "CD8", "T", "cells", "were", "analyzed", "." ] } ]
PMC11344246
This investigation highlighted CCNA2, TRIP13, CDK1, CDC20 and PRC1 as viable targets for our structure-based drug discovery campaign, as they all had a crystallised structure available in the Protein Data Bank, strong evidence of a role in ovarian cancer and known inhibitors (Table 2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "investigation", "highlighted", "CCNA2", ",", "TRIP13", ",", "CDK1", ",", "CDC20", "and", "PRC1", "as", "viable", "targets", "for", "our", "structure-based", "drug", "discovery", "campaign", ",", "as", "they", "all", "had", "a", "crystallised", "structure", "available", "in", "the", "Protein", "Data", "Bank", ",", "strong", "evidence", "of", "a", "role", "in", "ovarian", "cancer", "and", "known", "inhibitors", "(", "Table", "2", ")", "." ] } ]