PMCID string | Sentences string | ner list |
|---|---|---|
PMC10840195 | In our study, we first constructed sunitinib-resistant RCC strains and Twist-overexpressing cells and then studied the changes in biological function and mechanisms by determining the protein expression levels of key nodes of the Wnt/β-catenin signalling pathway. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"our",
"study",
",",
"we",
"first",
"constructed",
"sunitinib-resistant",
"RCC",
"strains",
"and",
"Twist-overexpressing",
"cells",
"and",
"then",
"studied",
"the",
"changes",
"in",
"biological",
"function",
"and",
"mechanisms",
"by",
"determining",
"the",
"protein",
"expression",
"levels",
"of",
"key",
"nodes",
"of",
"the",
"Wnt/β-catenin",
"signalling",
"pathway",
"."
]
}
] |
PMC9429973 | Hybridization capture allows the comparison of the number of reads per position between samples to identify structural variants as PTDs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Hybridization",
"capture",
"allows",
"the",
"comparison",
"of",
"the",
"number",
"of",
"reads",
"per",
"position",
"between",
"samples",
"to",
"identify",
"structural",
"variants",
"as",
"PTDs",
"."
]
}
] |
PMC11731614 | KDEVs analyzed with dynamic light scattering had a size range of 59.2 ± 14.5 nm (mean ± StDev). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"KDEVs",
"analyzed",
"with",
"dynamic",
"light",
"scattering",
"had",
"a",
"size",
"range",
"of",
"59.2",
"±",
"14.5",
"nm",
"(",
"mean",
"±",
"StDev",
")",
"."
]
}
] |
PMC11267036 | Fig. 2C revealed that the mRNA expression levels of RIG-I in MM cell lines (U266, RPMI-8226, NCI-H929) were notably lower than those in nPCs, especially in U266 cells (p < 0.05). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"2C",
"revealed",
"that",
"the",
"mRNA",
"expression",
"levels",
"of",
"RIG-I",
"in",
"MM",
"cell",
"lines",
"(",
"U266",
",",
"RPMI-8226",
",",
"NCI-H929",
")",
"were",
"notably",
"lower",
"than",
"those",
"in",
"nPCs",
",",
"especially",
"in",
"U266",
"cells",
"(",
"p",
"<",
"0.05",
")",
"."
]
}
] |
PMC11615828 | The local and random movement of TGN38‐mNeon‐FKBP vesicles caused by MT disassembly was further suppressed by trapping them on LifeAct‐FRB‐labeled actin filaments (Figure S11 and Video S11, Supporting Information). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"local",
"and",
"random",
"movement",
"of",
"TGN38‐mNeon‐FKBP",
"vesicles",
"caused",
"by",
"MT",
"disassembly",
"was",
"further",
"suppressed",
"by",
"trapping",
"them",
"on",
"LifeAct‐FRB‐labeled",
"actin",
"filaments",
"(",
"Figure",
"S11",
"and",
"Video",
"S11",
",",
"Supporting",
"Information",
")",
"."
]
}
] |
PMC9100622 | After release of thymidine, we observed a delay of around 2 h in the progression into the S-phase of cells treated with Atorvastatin (Figure S4C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"release",
"of",
"thymidine",
",",
"we",
"observed",
"a",
"delay",
"of",
"around",
"2",
"h",
"in",
"the",
"progression",
"into",
"the",
"S-phase",
"of",
"cells",
"treated",
"with",
"Atorvastatin",
"(",
"Figure",
"S4C",
")",
"."
]
}
] |
PMC11389534 | Investigating the influence of UFL1 on ovarian hormone levels is essential for a comprehensive understanding of female reproductive health. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Investigating",
"the",
"influence",
"of",
"UFL1",
"on",
"ovarian",
"hormone",
"levels",
"is",
"essential",
"for",
"a",
"comprehensive",
"understanding",
"of",
"female",
"reproductive",
"health",
"."
]
}
] |
PMC5963610 | Several anti-EGFR therapeutic approaches have demonstrated antitumor effect [4–6], however; clinic benefits in terms of overall survival has been limited. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Several",
"anti-EGFR",
"therapeutic",
"approaches",
"have",
"demonstrated",
"antitumor",
"effect",
"[",
"4–6",
"]",
",",
"however",
";",
"clinic",
"benefits",
"in",
"terms",
"of",
"overall",
"survival",
"has",
"been",
"limited",
"."
]
}
] |
PMC11772585 | D, E The expression of METTL1 in HaCaT keratinocytes and cSCC cell lines (HSC-1 and A431) were detected by western blot and qRT-PCR, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"D",
",",
"E",
"The",
"expression",
"of",
"METTL1",
"in",
"HaCaT",
"keratinocytes",
"and",
"cSCC",
"cell",
"lines",
"(",
"HSC-1",
"and",
"A431",
")",
"were",
"detected",
"by",
"western",
"blot",
"and",
"qRT-PCR",
",",
"respectively",
"."
]
}
] |
PMC6684588 | Data represent 200 fibers per muscle (n = 10 mice). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"represent",
"200",
"fibers",
"per",
"muscle",
"(",
"n",
"=",
"10",
"mice",
")",
".",
"("
]
}
] |
PMC9503669 | These interactions account for many Nef activities, including downregulation of cell-surface major histocompatibility complexes (MHC-I/II) and viral receptors (CD4/CXCR4/CCR5) , counteracting host cell restriction factors (e.g., SERINC proteins) , actin cytoskeleton remodeling , and stimulation of host cell signaling pathways (e.g., Tec- and Src-family kinases, ). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"interactions",
"account",
"for",
"many",
"Nef",
"activities",
",",
"including",
"downregulation",
"of",
"cell-surface",
"major",
"histocompatibility",
"complexes",
"(",
"MHC-I/II",
")",
"and",
"viral",
"receptors",
"(",
"CD4/CXCR4/CCR5",
")",
",",
"counteracting",
"host",
"cell",
"restriction",
"factors",
"(",
"e.g.",
",",
"SERINC",
"proteins",
")",
",",
"actin",
"cytoskeleton",
"remodeling",
",",
"and",
"stimulation",
"of",
"host",
"cell",
"signaling",
"pathways",
"(",
"e.g.",
",",
"Tec-",
"and",
"Src-family",
"kinases",
",",
")",
"."
]
}
] |
PMC11742231 | Similarly, in vitro cell line models , while useful for screening drug sensitivity, fail to capture the complex biological characteristics of tumors in patients, limiting their clinical relevance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Similarly",
",",
"in",
"vitro",
"cell",
"line",
"models",
",",
"while",
"useful",
"for",
"screening",
"drug",
"sensitivity",
",",
"fail",
"to",
"capture",
"the",
"complex",
"biological",
"characteristics",
"of",
"tumors",
"in",
"patients",
",",
"limiting",
"their",
"clinical",
"relevance",
"."
]
}
] |
PMC11496491 | Red dots indicate up-regulated genes, green dots indicate down-regulated genes, and black dots indicate non-significant differentially expressed genes. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Red",
"dots",
"indicate",
"up-regulated",
"genes",
",",
"green",
"dots",
"indicate",
"down-regulated",
"genes",
",",
"and",
"black",
"dots",
"indicate",
"non-significant",
"differentially",
"expressed",
"genes",
".",
"("
]
}
] |
PMC10335954 | However, the results from western blotting in our study showed that IL-6 expression increased when TRIP13 was knocked down, indicating that other pathways may affect the expression of IL-6. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"the",
"results",
"from",
"western",
"blotting",
"in",
"our",
"study",
"showed",
"that",
"IL-6",
"expression",
"increased",
"when",
"TRIP13",
"was",
"knocked",
"down",
",",
"indicating",
"that",
"other",
"pathways",
"may",
"affect",
"the",
"expression",
"of",
"IL-6",
"."
]
}
] |
PMC11291490 | When DEFs reached approximately 90% confluence, they were individually transfected with the following plasmids, pVAX1, pVAX-prM-E, and pVAX-prM-E-dusCD40L. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"When",
"DEFs",
"reached",
"approximately",
"90",
"%",
"confluence",
",",
"they",
"were",
"individually",
"transfected",
"with",
"the",
"following",
"plasmids",
",",
"pVAX1",
",",
"pVAX-prM-E",
",",
"and",
"pVAX-prM-E-dusCD40L",
"."
]
}
] |
PMC10218459 | One of the observed effects of CPP treatments on cancer cells is that some cells die immediately as a result of the CPP application. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"One",
"of",
"the",
"observed",
"effects",
"of",
"CPP",
"treatments",
"on",
"cancer",
"cells",
"is",
"that",
"some",
"cells",
"die",
"immediately",
"as",
"a",
"result",
"of",
"the",
"CPP",
"application",
"."
]
}
] |
PMC11628309 | An alternative cellular model is the neuroblastoma BE (2)-M17 which exhibits a high basal expression of numerous dopaminergic markers such as tyrosine hydroxylase (TH), vesicular monoamine transporter 2 (VMAT2), and dopamine transporter (DAT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"An",
"alternative",
"cellular",
"model",
"is",
"the",
"neuroblastoma",
"BE",
"(2)-M17",
"which",
"exhibits",
"a",
"high",
"basal",
"expression",
"of",
"numerous",
"dopaminergic",
"markers",
"such",
"as",
"tyrosine",
"hydroxylase",
"(",
"TH",
")",
",",
"vesicular",
"monoamine",
"transporter",
"2",
"(",
"VMAT2",
")",
",",
"and",
"dopamine",
"transporter",
"(",
"DAT",
")",
"."
]
}
] |
PMC11047729 | In vivo studies showed decreased levels of this secosteroid circulating in the bloodstream. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"vivo",
"studies",
"showed",
"decreased",
"levels",
"of",
"this",
"secosteroid",
"circulating",
"in",
"the",
"bloodstream",
"."
]
}
] |
PMC11740508 | Poly (ADP-Ribose) polymerase inhibitors are approved for treatment of tumors with BRCA1/2 and other homologous recombination repair (HRR) mutations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Poly",
"(",
"ADP-Ribose",
")",
"polymerase",
"inhibitors",
"are",
"approved",
"for",
"treatment",
"of",
"tumors",
"with",
"BRCA1/2",
"and",
"other",
"homologous",
"recombination",
"repair",
"(",
"HRR",
")",
"mutations",
"."
]
}
] |
PMC11012313 | LMP2A has historically been considered purely a BCR mimic due to the activation of Lyn and Syk through its ITAM motifs that are also found in the signaling molecules Igα and Igβ associated with surface immunoglobulin . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"LMP2A",
"has",
"historically",
"been",
"considered",
"purely",
"a",
"BCR",
"mimic",
"due",
"to",
"the",
"activation",
"of",
"Lyn",
"and",
"Syk",
"through",
"its",
"ITAM",
"motifs",
"that",
"are",
"also",
"found",
"in",
"the",
"signaling",
"molecules",
"Igα",
"and",
"Igβ",
"associated",
"with",
"surface",
"immunoglobulin",
"."
]
}
] |
PMC11531744 | Risk curves showing the distribution of survival status of TCGA OC patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Risk",
"curves",
"showing",
"the",
"distribution",
"of",
"survival",
"status",
"of",
"TCGA",
"OC",
"patients",
"."
]
}
] |
PMC8427838 | A Immunohistochemistry staining of human kidney tissues with control antibody or with anti-TMIGD1 antibody. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"Immunohistochemistry",
"staining",
"of",
"human",
"kidney",
"tissues",
"with",
"control",
"antibody",
"or",
"with",
"anti-TMIGD1",
"antibody",
"."
]
}
] |
PMC11656380 | Consequently, these results suggest that Tat-Ram13 is a tumor-selective, nonapoptotic cell death-inducing agent for treating refractory leukemia and lymphomas with apoptosis resistance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Consequently",
",",
"these",
"results",
"suggest",
"that",
"Tat-Ram13",
"is",
"a",
"tumor-selective",
",",
"nonapoptotic",
"cell",
"death-inducing",
"agent",
"for",
"treating",
"refractory",
"leukemia",
"and",
"lymphomas",
"with",
"apoptosis",
"resistance",
"."
]
}
] |
PMC11792766 | The involvement of food simulants at the concentrations specified in Table 3 did not present any background effects or interference with the assay's function, neither in the presence nor absence of the microsomes, as shown in Figure 8a,b. Effect of food simulants on the bacterial reverse mutation assay in the absence (a) and presence (b) of rat liver S9 mix. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"involvement",
"of",
"food",
"simulants",
"at",
"the",
"concentrations",
"specified",
"in",
"Table",
"3",
"did",
"not",
"present",
"any",
"background",
"effects",
"or",
"interference",
"with",
"the",
"assay",
"'s",
"function",
",",
"neither",
"in",
"the",
"presence",
"nor",
"absence",
"of",
"the",
"microsomes",
",",
"as",
"shown",
"in",
"Figure",
"8a",
",",
"b.",
"Effect",
"of",
"food",
"simulants",
"on",
"the",
"bacterial",
"reverse",
"mutation",
"assay",
"in",
"the",
"absence",
"(",
"a",
")",
"and",
"presence",
"(",
"b",
")",
"of",
"rat",
"liver",
"S9",
"mix",
"."
]
}
] |
PMC11655536 | The tumor volume in the experimental group was significantly smaller than that in the control group, and the expression of the proliferation marker Ki67 was also significantly reduced compared to the control group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"tumor",
"volume",
"in",
"the",
"experimental",
"group",
"was",
"significantly",
"smaller",
"than",
"that",
"in",
"the",
"control",
"group",
",",
"and",
"the",
"expression",
"of",
"the",
"proliferation",
"marker",
"Ki67",
"was",
"also",
"significantly",
"reduced",
"compared",
"to",
"the",
"control",
"group",
"."
]
}
] |
PMC9429973 | A patient was defined as relapsed/refractory (R/R) if they had commenced a drug which was in a different therapeutic category, or if they re-started the same regimen after a gap of more than 180 days. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"patient",
"was",
"defined",
"as",
"relapsed/refractory",
"(",
"R/R",
")",
"if",
"they",
"had",
"commenced",
"a",
"drug",
"which",
"was",
"in",
"a",
"different",
"therapeutic",
"category",
",",
"or",
"if",
"they",
"re-started",
"the",
"same",
"regimen",
"after",
"a",
"gap",
"of",
"more",
"than",
"180",
"days",
"."
]
}
] |
PMC11541241 | Moreover, MoGAP1 was also involved in cell wall stress and carbon source stress. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"MoGAP1",
"was",
"also",
"involved",
"in",
"cell",
"wall",
"stress",
"and",
"carbon",
"source",
"stress",
"."
]
}
] |
PMC11711871 | In humans, glucocorticoid resistance is attributed to mutations in the glucocorticoid receptor (GR). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"humans",
",",
"glucocorticoid",
"resistance",
"is",
"attributed",
"to",
"mutations",
"in",
"the",
"glucocorticoid",
"receptor",
"(",
"GR",
")",
"."
]
}
] |
PMC9429973 | Fourteen patients received the murinized CAR-T cells at a median dose of 2.18×10/kg (1-3×10/kg) CAR19 and 1.75×10/kg (1-3×10/kg) CAR22, while 12 patients received the does of the humanized CAR-T cells consisting of 2×10kg CAR19 and 5×10/kg CAR22. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fourteen",
"patients",
"received",
"the",
"murinized",
"CAR-T",
"cells",
"at",
"a",
"median",
"dose",
"of",
"2.18",
"×",
"10/kg",
"(",
"1",
"-",
"3",
"×",
"10/kg",
")",
"CAR19",
"and",
"1.75",
"×",
"10/kg",
"(",
"1",
"-",
"3",
"×",
"10/kg",
")",
"CAR22",
",",
"while",
"12",
"patients",
"received",
"the",
"does",
"of",
"the",
"humanized",
"CAR-T",
"cells",
"consisting",
"of",
"2",
"×",
"10",
"kg",
"CAR19",
"and",
"5",
"×",
"10/kg",
"CAR22",
"."
]
}
] |
PMC9429973 | Despite literature indicating that patient QoL and cost of tx should both be key considerations for physicians when choosing FL tx, our study highlights these are less commonly reported attributes for treatment selection. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Despite",
"literature",
"indicating",
"that",
"patient",
"QoL",
"and",
"cost",
"of",
"tx",
"should",
"both",
"be",
"key",
"considerations",
"for",
"physicians",
"when",
"choosing",
"FL",
"tx",
",",
"our",
"study",
"highlights",
"these",
"are",
"less",
"commonly",
"reported",
"attributes",
"for",
"treatment",
"selection",
"."
]
}
] |
PMC11740907 | Beeswax is a substance that lacks polarity, while Tween 80 is a surfactant that has polarity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Beeswax",
"is",
"a",
"substance",
"that",
"lacks",
"polarity",
",",
"while",
"Tween",
"80",
"is",
"a",
"surfactant",
"that",
"has",
"polarity",
"."
]
}
] |
PMC10440586 | The patients were divided into two groups based on the CD99 expression level of the first-onset sample. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"patients",
"were",
"divided",
"into",
"two",
"groups",
"based",
"on",
"the",
"CD99",
"expression",
"level",
"of",
"the",
"first-onset",
"sample",
"."
]
}
] |
PMC10938336 | These networks were merged to create a comprehensive compound–target–disease network. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"networks",
"were",
"merged",
"to",
"create",
"a",
"comprehensive",
"compound",
"–",
"target",
"–",
"disease",
"network",
"."
]
}
] |
PMC6442998 | GIST882 cells present a phenotype close to the ICC phenotype (KIT+, PDE3A+, αSMA-) while the GIST48 cells phenotype may be closer to the phenotype of ICC/SMC mesenchymal precursors (Kit+, PDE3A low, αSMA+). | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"GIST882",
"cells",
"present",
"a",
"phenotype",
"close",
"to",
"the",
"ICC",
"phenotype",
"(",
"KIT+",
",",
"PDE3A+",
",",
"αSMA-",
")",
"while",
"the",
"GIST48",
"cells",
"phenotype",
"may",
"be",
"closer",
"to",
"the",
"phenotype",
"of",
"ICC/SMC",
"mesenchymal",
"precursors",
"(",
"Kit+",
",",
"PDE3A",
"low",
",",
"αSMA+",
")",
"."
]
}
] |
PMC11291697 | To date, disruption of GTDC1, as a consequence of a de novo chromosome translocation t(2;8), was reported in only one individual with developmental and speech/language delay . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"date",
",",
"disruption",
"of",
"GTDC1",
",",
"as",
"a",
"consequence",
"of",
"a",
"de",
"novo",
"chromosome",
"translocation",
"t(2;8",
")",
",",
"was",
"reported",
"in",
"only",
"one",
"individual",
"with",
"developmental",
"and",
"speech/language",
"delay",
"."
]
}
] |
PMC10094992 | The immunostained MCSs were counterstained with Diamidino-2-phenylindole (DAPI), rinsed with PBS and mounted on slides using fluorescent aqueous mounting medium (Agilent Dako, Santa Clara, CA, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"immunostained",
"MCSs",
"were",
"counterstained",
"with",
"Diamidino-2-phenylindole",
"(",
"DAPI",
")",
",",
"rinsed",
"with",
"PBS",
"and",
"mounted",
"on",
"slides",
"using",
"fluorescent",
"aqueous",
"mounting",
"medium",
"(",
"Agilent",
"Dako",
",",
"Santa",
"Clara",
",",
"CA",
",",
"USA",
")",
"."
]
}
] |
PMC10114490 | RT-qPCR expression was determined by the 2 using PBGD gene (HMBS) as normalizer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RT-qPCR",
"expression",
"was",
"determined",
"by",
"the",
"2",
"using",
"PBGD",
"gene",
"(",
"HMBS",
")",
"as",
"normalizer",
"."
]
}
] |
PMC8708099 | After 24 h, the medium was removed and replaced with the medium with tested compounds. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"24",
"h",
",",
"the",
"medium",
"was",
"removed",
"and",
"replaced",
"with",
"the",
"medium",
"with",
"tested",
"compounds",
"."
]
}
] |
PMC11335267 | After this, vehicle (0.9% NaCl) or recombinant mouse leptin (3 µg/g) (Peprotech catalogue nº 450−31) was injected i.p. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"this",
",",
"vehicle",
"(",
"0.9",
"%",
"NaCl",
")",
"or",
"recombinant",
"mouse",
"leptin",
"(",
"3",
"µg/g",
")",
"(",
"Peprotech",
"catalogue",
"nº",
"450−31",
")",
"was",
"injected",
"i.p",
"."
]
}
] |
PMC11695623 | Through the data of TCGA, the correlation between DCUN1D5 and other mRNA in LUAD is analyzed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Through",
"the",
"data",
"of",
"TCGA",
",",
"the",
"correlation",
"between",
"DCUN1D5",
"and",
"other",
"mRNA",
"in",
"LUAD",
"is",
"analyzed",
"."
]
}
] |
PMC11777207 | We also observed less surface-associated PD-L1 on DCs after PD-L1 43H12 antibody treatment, likely due to the steric hindrance of these antibodies (fig. S9). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"also",
"observed",
"less",
"surface-associated",
"PD-L1",
"on",
"DCs",
"after",
"PD-L1",
"43H12",
"antibody",
"treatment",
",",
"likely",
"due",
"to",
"the",
"steric",
"hindrance",
"of",
"these",
"antibodies",
"(",
"fig.",
"S9",
")",
"."
]
}
] |
PMC11739504 | Taken together, these findings highlight the novel role of Kat2b in regulating primary cilium function and its pathological effects on the kidney. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Taken",
"together",
",",
"these",
"findings",
"highlight",
"the",
"novel",
"role",
"of",
"Kat2b",
"in",
"regulating",
"primary",
"cilium",
"function",
"and",
"its",
"pathological",
"effects",
"on",
"the",
"kidney",
"."
]
}
] |
PMC9429973 | Among the 35 pts with ND Ph+ ALL, 12 were in CR at enrollment (including 2 pts in CMR). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Among",
"the",
"35",
"pts",
"with",
"ND",
"Ph+",
"ALL",
",",
"12",
"were",
"in",
"CR",
"at",
"enrollment",
"(",
"including",
"2",
"pts",
"in",
"CMR",
")",
"."
]
}
] |
PMC10178190 | Manhattan distance, which is the absolute sum of log 2 of fold changes and -log 10 of p value, was determined for high signal dots and is shown in a heatmap. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Manhattan",
"distance",
",",
"which",
"is",
"the",
"absolute",
"sum",
"of",
"log",
"2",
"of",
"fold",
"changes",
"and",
"-log",
"10",
"of",
"p",
"value",
",",
"was",
"determined",
"for",
"high",
"signal",
"dots",
"and",
"is",
"shown",
"in",
"a",
"heatmap",
"."
]
}
] |
PMC11644761 | Their capacity to survive in culture for extended periods enables prolonged experiments with high reproducibility, thereby minimizing experimental variability. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Their",
"capacity",
"to",
"survive",
"in",
"culture",
"for",
"extended",
"periods",
"enables",
"prolonged",
"experiments",
"with",
"high",
"reproducibility",
",",
"thereby",
"minimizing",
"experimental",
"variability",
"."
]
}
] |
PMC5916734 | Genomic DNA was isolated using a Wizard SV Genomic DNA Purification System kit (Promega, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Genomic",
"DNA",
"was",
"isolated",
"using",
"a",
"Wizard",
"SV",
"Genomic",
"DNA",
"Purification",
"System",
"kit",
"(",
"Promega",
",",
"USA",
")",
"."
]
}
] |
PMC11300639 | m 786-O and A498 cells were harvested for immunoprecipitation by using the CDK4 or RNF26 antibodies. | [
{
"tags": [
"B-CellLine",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"m",
"786-O",
"and",
"A498",
"cells",
"were",
"harvested",
"for",
"immunoprecipitation",
"by",
"using",
"the",
"CDK4",
"or",
"RNF26",
"antibodies",
"."
]
}
] |
PMC10728200 | The relative GSH/GSSG ratios were assayed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"relative",
"GSH/GSSG",
"ratios",
"were",
"assayed",
"."
]
}
] |
PMC5963610 | Each point represents mean±SD per animals/group. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Each",
"point",
"represents",
"mean±SD",
"per",
"animals/group",
"."
]
}
] |
PMC9424261 | Interestingly, we found that CA has almost no effect on normal liver cells at low concentrations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
"we",
"found",
"that",
"CA",
"has",
"almost",
"no",
"effect",
"on",
"normal",
"liver",
"cells",
"at",
"low",
"concentrations",
"."
]
}
] |
PMC8358006 | calculated from night replicates. *** | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"calculated",
"from",
"night",
"replicates",
".",
"*",
"*",
"*"
]
}
] |
PMC9429973 | The plasma concentration of CCL17/TARC was elevated in both LIM and ADV cHL compared to controls (median 5256 (p=0.0002) and 9165 (p<0.0001) vs. 61.03 pg/mL, respectively) (Figure 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"plasma",
"concentration",
"of",
"CCL17/TARC",
"was",
"elevated",
"in",
"both",
"LIM",
"and",
"ADV",
"cHL",
"compared",
"to",
"controls",
"(",
"median",
"5256",
"(",
"p=0.0002",
")",
"and",
"9165",
"(",
"p<0.0001",
")",
"vs.",
"61.03",
"pg/mL",
",",
"respectively",
")",
"(",
"Figure",
"1",
")",
"."
]
}
] |
PMC10040136 | The VEGF mRNA forward primer was TTGCCTTGCTGCTCTACCTCCA, and the VEGF mRNA reverse primer was GATGGCAGTAGCTGCGCTGATA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"VEGF",
"mRNA",
"forward",
"primer",
"was",
"TTGCCTTGCTGCTCTACCTCCA",
",",
"and",
"the",
"VEGF",
"mRNA",
"reverse",
"primer",
"was",
"GATGGCAGTAGCTGCGCTGATA",
"."
]
}
] |
PMC10748106 | All the iridoids fell within the applicability domain of the model, suggesting the application of the model for predicting the cytotoxic activity of new iridoids with remarkably high molecular and structural similarity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"the",
"iridoids",
"fell",
"within",
"the",
"applicability",
"domain",
"of",
"the",
"model",
",",
"suggesting",
"the",
"application",
"of",
"the",
"model",
"for",
"predicting",
"the",
"cytotoxic",
"activity",
"of",
"new",
"iridoids",
"with",
"remarkably",
"high",
"molecular",
"and",
"structural",
"similarity",
"."
]
}
] |
PMC11747949 | Interestingly, we observed two populations having either low or high expression of CD44. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
"we",
"observed",
"two",
"populations",
"having",
"either",
"low",
"or",
"high",
"expression",
"of",
"CD44",
"."
]
}
] |
PMC9429973 | Treatment for symptomatic and/or predominantly haemolytic PNH patients is associated with an improvement in survival and quality of life (QoL). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Treatment",
"for",
"symptomatic",
"and/or",
"predominantly",
"haemolytic",
"PNH",
"patients",
"is",
"associated",
"with",
"an",
"improvement",
"in",
"survival",
"and",
"quality",
"of",
"life",
"(",
"QoL",
")",
"."
]
}
] |
PMC11621493 | The “count” (dot size) reflects the total number of genes in the gene set and the color coding highlights the FDR-adjusted P value of the gene set. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"“",
"count",
"”",
"(",
"dot",
"size",
")",
"reflects",
"the",
"total",
"number",
"of",
"genes",
"in",
"the",
"gene",
"set",
"and",
"the",
"color",
"coding",
"highlights",
"the",
"FDR-adjusted",
"P",
"value",
"of",
"the",
"gene",
"set",
".",
"("
]
}
] |
PMC11248911 | Cell pellets were fixed with 70% ethanol on ice for 15 min and collected again. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cell",
"pellets",
"were",
"fixed",
"with",
"70",
"%",
"ethanol",
"on",
"ice",
"for",
"15",
"min",
"and",
"collected",
"again",
"."
]
}
] |
PMC11453018 | D Quantification of intensity of Annexin V staining. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"D",
"Quantification",
"of",
"intensity",
"of",
"Annexin",
"V",
"staining",
"."
]
}
] |
PMC11435360 | After cysteine is converted to mercaptopyruvate, the enzyme 3-MST, localized in the mitochondria, further breaks the substrate down into H2S and pyruvate . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"cysteine",
"is",
"converted",
"to",
"mercaptopyruvate",
",",
"the",
"enzyme",
"3-MST",
",",
"localized",
"in",
"the",
"mitochondria",
",",
"further",
"breaks",
"the",
"substrate",
"down",
"into",
"H2S",
"and",
"pyruvate",
"."
]
}
] |
PMC10940855 | To determine the effect of silencing EFNB2 reverse signaling on multiple myeloma growth in vivo, we compared the repopulation of U266 multiple myeloma cells following transplantation into NSG mice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"determine",
"the",
"effect",
"of",
"silencing",
"EFNB2",
"reverse",
"signaling",
"on",
"multiple",
"myeloma",
"growth",
"in",
"vivo",
",",
"we",
"compared",
"the",
"repopulation",
"of",
"U266",
"multiple",
"myeloma",
"cells",
"following",
"transplantation",
"into",
"NSG",
"mice",
"."
]
}
] |
PMC11755624 | lncRNAs play important roles in skin functionality, such as keratinocyte differentiation . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"lncRNAs",
"play",
"important",
"roles",
"in",
"skin",
"functionality",
",",
"such",
"as",
"keratinocyte",
"differentiation",
"."
]
}
] |
PMC10847511 | Association between HR-related gene alterations with locus-specific LOH and HRD score. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Association",
"between",
"HR-related",
"gene",
"alterations",
"with",
"locus-specific",
"LOH",
"and",
"HRD",
"score",
"."
]
}
] |
PMC9429973 | Aims: To evaluate the efficacy, treatment administration satisfaction and safety of SC ravulizumab through the first 1 year (day 351) of treatment in adult patients with PNH previously treated with eculizumab. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Aims",
":",
"To",
"evaluate",
"the",
"efficacy",
",",
"treatment",
"administration",
"satisfaction",
"and",
"safety",
"of",
"SC",
"ravulizumab",
"through",
"the",
"first",
"1",
"year",
"(",
"day",
"351",
")",
"of",
"treatment",
"in",
"adult",
"patients",
"with",
"PNH",
"previously",
"treated",
"with",
"eculizumab",
"."
]
}
] |
PMC11188874 | Peptides were loaded directly and eluted using 50/50 acetonitrile/water (0.1% trifluoroacetic acid [TFA]). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Peptides",
"were",
"loaded",
"directly",
"and",
"eluted",
"using",
"50/50",
"acetonitrile/water",
"(",
"0.1",
"%",
"trifluoroacetic",
"acid",
"[",
"TFA",
"]",
")",
"."
]
}
] |
PMC5417661 | The leukemia cell line CCRF-CEM (RPMI 1640), the ovarian carcinoma cell lines A2780 and A2780/Adr (RPMI 1640), the pancreatic adenocarcinoma cell line BXPC-3 (RPMI 1640), the lymphoma cell line U-937 (RPMI 1640), the myeloma cell line RPMI 8226 (RPMI 1640) and the colon carcinoma cell lines HT29 (McCoy’s medium) and HCT116 (McCoy’s medium) were purchased from European Collection of Cell Cultures (ECACC, Salisbury, UK). | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"I-CellLine",
"B-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"I-CellLine",
"B-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"leukemia",
"cell",
"line",
"CCRF-CEM",
"(",
"RPMI",
"1640",
")",
",",
"the",
"ovarian",
"carcinoma",
"cell",
"lines",
"A2780",
"and",
"A2780/Adr",
"(",
"RPMI",
"1640",
")",
",",
"the",
"pancreatic",
"adenocarcinoma",
"cell",
"line",
"BXPC-3",
"(",
"RPMI",
"1640",
")",
",",
"the",
"lymphoma",
"cell",
"line",
"U-937",
"(",
"RPMI",
"1640",
")",
",",
"the",
"myeloma",
"cell",
"line",
"RPMI",
"8226",
"(",
"RPMI",
"1640",
")",
"and",
"the",
"colon",
"carcinoma",
"cell",
"lines",
"HT29",
"(",
"McCoy",
"’s",
"medium",
")",
"and",
"HCT116",
"(",
"McCoy",
"’s",
"medium",
")",
"were",
"purchased",
"from",
"European",
"Collection",
"of",
"Cell",
"Cultures",
"(",
"ECACC",
",",
"Salisbury",
",",
"UK",
")",
"."
]
}
] |
PMC10968586 | OLE and HT are also found in the fruit of Olea europaea L. and in olive oil; thus, they are easily ingested as part of a routine diet, but they can also be obtained from other sources, e.g., olive mill wastewater . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"OLE",
"and",
"HT",
"are",
"also",
"found",
"in",
"the",
"fruit",
"of",
"Olea",
"europaea",
"L.",
"and",
"in",
"olive",
"oil",
";",
"thus",
",",
"they",
"are",
"easily",
"ingested",
"as",
"part",
"of",
"a",
"routine",
"diet",
",",
"but",
"they",
"can",
"also",
"be",
"obtained",
"from",
"other",
"sources",
",",
"e.g.",
",",
"olive",
"mill",
"wastewater",
"."
]
}
] |
PMC11713679 | in alleviating these changes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"in",
"alleviating",
"these",
"changes",
"."
]
}
] |
PMC11768281 | However, the complexity of immune evasion strategies employed by Plasmodium necessitates further research into enhancing T-cell activation and sustaining their efficacy . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"the",
"complexity",
"of",
"immune",
"evasion",
"strategies",
"employed",
"by",
"Plasmodium",
"necessitates",
"further",
"research",
"into",
"enhancing",
"T-cell",
"activation",
"and",
"sustaining",
"their",
"efficacy",
"."
]
}
] |
PMC11787381 | Effects of formulated bambuterol on the total distance swum in the Morris water maze (B), on swim velocity (C), time spent around the supposed location of the platform (ring area) during the retention phase (D) and the latency to reach the ring area (E) [control (white), bambuterol (green)]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Effects",
"of",
"formulated",
"bambuterol",
"on",
"the",
"total",
"distance",
"swum",
"in",
"the",
"Morris",
"water",
"maze",
"(",
"B",
")",
",",
"on",
"swim",
"velocity",
"(",
"C",
")",
",",
"time",
"spent",
"around",
"the",
"supposed",
"location",
"of",
"the",
"platform",
"(",
"ring",
"area",
")",
"during",
"the",
"retention",
"phase",
"(",
"D",
")",
"and",
"the",
"latency",
"to",
"reach",
"the",
"ring",
"area",
"(",
"E",
")",
"[",
"control",
"(",
"white",
")",
",",
"bambuterol",
"(",
"green",
")",
"]",
"."
]
}
] |
PMC11732523 | Early administration of antiviral therapy during the initial stages of infection may benefit GS patients, and immunoglobulin replacement therapy could serve as the cornerstone of infection prevention and management in this population . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Early",
"administration",
"of",
"antiviral",
"therapy",
"during",
"the",
"initial",
"stages",
"of",
"infection",
"may",
"benefit",
"GS",
"patients",
",",
"and",
"immunoglobulin",
"replacement",
"therapy",
"could",
"serve",
"as",
"the",
"cornerstone",
"of",
"infection",
"prevention",
"and",
"management",
"in",
"this",
"population",
"."
]
}
] |
PMC9429973 | Summary/Conclusion: Our study concludes to a worsening of MPN symptoms when associated to comorbidities. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Summary/Conclusion",
":",
"Our",
"study",
"concludes",
"to",
"a",
"worsening",
"of",
"MPN",
"symptoms",
"when",
"associated",
"to",
"comorbidities",
"."
]
}
] |
PMC11670954 | Fourth, while we robustly demonstrated that BA mitigates barrier impairment in epithelial cells following LPS injury through the up-regulation of ZO-1 and Occludin, elucidating the ability of BA to significantly increase cell viability is crucial. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fourth",
",",
"while",
"we",
"robustly",
"demonstrated",
"that",
"BA",
"mitigates",
"barrier",
"impairment",
"in",
"epithelial",
"cells",
"following",
"LPS",
"injury",
"through",
"the",
"up-regulation",
"of",
"ZO-1",
"and",
"Occludin",
",",
"elucidating",
"the",
"ability",
"of",
"BA",
"to",
"significantly",
"increase",
"cell",
"viability",
"is",
"crucial",
"."
]
}
] |
PMC7762347 | This is in line with the previously reported MCLR induced lesions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"is",
"in",
"line",
"with",
"the",
"previously",
"reported",
"MCLR",
"induced",
"lesions",
"."
]
}
] |
PMC10291556 | A thorough inspection of the data in Tables 1 and 3 revealed the correlation between log P values, amount of intracellular Pt, and antiproliferative activity (IC50). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"thorough",
"inspection",
"of",
"the",
"data",
"in",
"Tables",
"1",
"and",
"3",
"revealed",
"the",
"correlation",
"between",
"log",
"P",
"values",
",",
"amount",
"of",
"intracellular",
"Pt",
",",
"and",
"antiproliferative",
"activity",
"(",
"IC50",
")",
"."
]
}
] |
PMC10898159 | KIT D816V and KIT N882 both are situated closely on the KIT receptor activation loop activating the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway, but in KIT N822K it is also the downstream activation of the MAPK . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"KIT",
"D816V",
"and",
"KIT",
"N882",
"both",
"are",
"situated",
"closely",
"on",
"the",
"KIT",
"receptor",
"activation",
"loop",
"activating",
"the",
"Janus",
"kinase/signal",
"transducers",
"and",
"activators",
"of",
"transcription",
"(",
"JAK/STAT",
")",
"pathway",
",",
"but",
"in",
"KIT",
"N822",
"K",
"it",
"is",
"also",
"the",
"downstream",
"activation",
"of",
"the",
"MAPK",
"."
]
}
] |
PMC10654497 | Ferroptosis is a distinct form of iron-dependent programmed cell death that is characterized by the buildup of lipid peroxides and intracellular reactive oxygen species. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Ferroptosis",
"is",
"a",
"distinct",
"form",
"of",
"iron-dependent",
"programmed",
"cell",
"death",
"that",
"is",
"characterized",
"by",
"the",
"buildup",
"of",
"lipid",
"peroxides",
"and",
"intracellular",
"reactive",
"oxygen",
"species",
"."
]
}
] |
PMC11742670 | These descriptors could pertain to structural attributes, chemical properties, Morgan fingerprint that represent molecular structure in binary format for similarity analysis, or any other physicochemical properties that play a pivotal role in the drug’s efficacy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"descriptors",
"could",
"pertain",
"to",
"structural",
"attributes",
",",
"chemical",
"properties",
",",
"Morgan",
"fingerprint",
"that",
"represent",
"molecular",
"structure",
"in",
"binary",
"format",
"for",
"similarity",
"analysis",
",",
"or",
"any",
"other",
"physicochemical",
"properties",
"that",
"play",
"a",
"pivotal",
"role",
"in",
"the",
"drug",
"’s",
"efficacy",
"."
]
}
] |
PMC9581083 | Many Chinese herbal formulas have emerged from these theoretical foundations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Many",
"Chinese",
"herbal",
"formulas",
"have",
"emerged",
"from",
"these",
"theoretical",
"foundations",
"."
]
}
] |
PMC11534377 | Dark-field microscopy was performed using an Olympus B × 43 microscope (Olympus, Tokyo, Japan) equipped with a CytoViva Enhanced Dark-Field Condenser (Cytoviva, USA), a Dual Mode Fluorescence (DMF) module, an UPlanFLN60×, NA = 1.2 oil immersion objective (Olympus, Tokyo, Japan) and a 6.4 μm/pixel CCD camera (QImaging, Canada). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Dark-field",
"microscopy",
"was",
"performed",
"using",
"an",
"Olympus",
"B",
"×",
"43",
"microscope",
"(",
"Olympus",
",",
"Tokyo",
",",
"Japan",
")",
"equipped",
"with",
"a",
"CytoViva",
"Enhanced",
"Dark-Field",
"Condenser",
"(",
"Cytoviva",
",",
"USA",
")",
",",
"a",
"Dual",
"Mode",
"Fluorescence",
"(",
"DMF",
")",
"module",
",",
"an",
"UPlanFLN60",
"×",
",",
"NA",
"=",
"1.2",
"oil",
"immersion",
"objective",
"(",
"Olympus",
",",
"Tokyo",
",",
"Japan",
")",
"and",
"a",
"6.4",
"μm/pixel",
"CCD",
"camera",
"(",
"QImaging",
",",
"Canada",
")",
"."
]
}
] |
PMC11075223 | The quality control of TCMs is the foundation for ensuring the effectiveness and safety of clinical medication. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"quality",
"control",
"of",
"TCMs",
"is",
"the",
"foundation",
"for",
"ensuring",
"the",
"effectiveness",
"and",
"safety",
"of",
"clinical",
"medication",
"."
]
}
] |
PMC10850553 | Scale bar: 50 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Scale",
"bar",
":",
"50",
"μm",
"."
]
}
] |
PMC5839394 | Interestingly, these evidences were confirmed by a differential proteomic analysis that highlighted important pathways involved in AgNPs-EPS toxicity, including endoplasmic reticulum stress, oxidative stress and mitochondrial impairment triggering cell death trough apoptosis and/or autophagy activation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
"these",
"evidences",
"were",
"confirmed",
"by",
"a",
"differential",
"proteomic",
"analysis",
"that",
"highlighted",
"important",
"pathways",
"involved",
"in",
"AgNPs-EPS",
"toxicity",
",",
"including",
"endoplasmic",
"reticulum",
"stress",
",",
"oxidative",
"stress",
"and",
"mitochondrial",
"impairment",
"triggering",
"cell",
"death",
"trough",
"apoptosis",
"and/or",
"autophagy",
"activation",
"."
]
}
] |
PMC10976516 | For at least 2 days, viral genomes remained throughout the body. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"at",
"least",
"2",
"days",
",",
"viral",
"genomes",
"remained",
"throughout",
"the",
"body",
"."
]
}
] |
PMC11766350 | An important benefit is that the toxic transgene can be easily exchanged without the need to re-design the anti-shRNA cassette. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"An",
"important",
"benefit",
"is",
"that",
"the",
"toxic",
"transgene",
"can",
"be",
"easily",
"exchanged",
"without",
"the",
"need",
"to",
"re-design",
"the",
"anti-shRNA",
"cassette",
"."
]
}
] |
PMC10094992 | The monoclonal antibody anti human MPO and the PE conjugated goat anti-mouse were from eBiosciences-ThermoFisher, while the polyclonal antibody anti human Cit-Histone H3 (Arg2, Arg8, Arg17) was from Abbomax (San Jose, CA, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"monoclonal",
"antibody",
"anti",
"human",
"MPO",
"and",
"the",
"PE",
"conjugated",
"goat",
"anti-mouse",
"were",
"from",
"eBiosciences-ThermoFisher",
",",
"while",
"the",
"polyclonal",
"antibody",
"anti",
"human",
"Cit-Histone",
"H3",
"(",
"Arg2",
",",
"Arg8",
",",
"Arg17",
")",
"was",
"from",
"Abbomax",
"(",
"San",
"Jose",
",",
"CA",
",",
"USA",
")",
"."
]
}
] |
PMC7136814 | However, we addressed primary resistance associated with each marker by calculating the absolute cell number of each cell subpopulation by flow cytometry in the whole population treated with scalar doses of Vincristine (Supplementary Figures and and supplementary methods). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"we",
"addressed",
"primary",
"resistance",
"associated",
"with",
"each",
"marker",
"by",
"calculating",
"the",
"absolute",
"cell",
"number",
"of",
"each",
"cell",
"subpopulation",
"by",
"flow",
"cytometry",
"in",
"the",
"whole",
"population",
"treated",
"with",
"scalar",
"doses",
"of",
"Vincristine",
"(",
"Supplementary",
"Figures",
"and",
"and",
"supplementary",
"methods",
")",
"."
]
}
] |
PMC10297204 | Chronic exposure to ethanol, which is metabolically converted to acetaldehyde by alcohol dehydrogenase, P4502E1(CYP2E1), and catalase inside the body , is thought to cause axonal damage and demyelinating changes by decreasing myelin basic protein, neurofilament protein . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Chronic",
"exposure",
"to",
"ethanol",
",",
"which",
"is",
"metabolically",
"converted",
"to",
"acetaldehyde",
"by",
"alcohol",
"dehydrogenase",
",",
"P4502E1(CYP2E1",
")",
",",
"and",
"catalase",
"inside",
"the",
"body",
",",
"is",
"thought",
"to",
"cause",
"axonal",
"damage",
"and",
"demyelinating",
"changes",
"by",
"decreasing",
"myelin",
"basic",
"protein",
",",
"neurofilament",
"protein",
"."
]
}
] |
PMC2777936 | Where a value for statistical significance is indicated a two sample two-tailed t-test assuming unequal sample variances was performed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Where",
"a",
"value",
"for",
"statistical",
"significance",
"is",
"indicated",
"a",
"two",
"sample",
"two-tailed",
"t-test",
"assuming",
"unequal",
"sample",
"variances",
"was",
"performed",
"."
]
}
] |
PMC11021472 | We analyzed BL cells with and without miR-150 overexpression to determine whether miR-150 overexpression has an effect on the subcellular localization of the three ZDHHC11 transcripts. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"analyzed",
"BL",
"cells",
"with",
"and",
"without",
"miR-150",
"overexpression",
"to",
"determine",
"whether",
"miR-150",
"overexpression",
"has",
"an",
"effect",
"on",
"the",
"subcellular",
"localization",
"of",
"the",
"three",
"ZDHHC11",
"transcripts",
"."
]
}
] |
PMC11665555 | The data were analyzed using DESeq2 (RRID:SCR_000154) R package (v. 3.3) to identify differentially expressed genes (DEGs), enrichment analysis, and Gene Ontology biological processes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"data",
"were",
"analyzed",
"using",
"DESeq2",
"(",
"RRID",
":",
"SCR_000154",
")",
"R",
"package",
"(",
"v.",
"3.3",
")",
"to",
"identify",
"differentially",
"expressed",
"genes",
"(",
"DEGs",
")",
",",
"enrichment",
"analysis",
",",
"and",
"Gene",
"Ontology",
"biological",
"processes",
"."
]
}
] |
PMC11264242 | In this regard, we compared the SS18-SSX2 cases with the SS18-SSX2 cases but observed no difference in FYN gene expression between the two fusion types (Supplementary Figure S7). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"this",
"regard",
",",
"we",
"compared",
"the",
"SS18-SSX2",
"cases",
"with",
"the",
"SS18-SSX2",
"cases",
"but",
"observed",
"no",
"difference",
"in",
"FYN",
"gene",
"expression",
"between",
"the",
"two",
"fusion",
"types",
"(",
"Supplementary",
"Figure",
"S7",
")",
"."
]
}
] |
PMC11665584 | The resources produced by this study, including the scRNA-Seq data, Xenium in situ data, and CUT&Tag-Seq data sets, will be helpful for future studies and serve as a model of how these newer technologies and comparative studies may be combined to glean deeper insights into biological processes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"resources",
"produced",
"by",
"this",
"study",
",",
"including",
"the",
"scRNA-Seq",
"data",
",",
"Xenium",
"in",
"situ",
"data",
",",
"and",
"CUT&Tag-Seq",
"data",
"sets",
",",
"will",
"be",
"helpful",
"for",
"future",
"studies",
"and",
"serve",
"as",
"a",
"model",
"of",
"how",
"these",
"newer",
"technologies",
"and",
"comparative",
"studies",
"may",
"be",
"combined",
"to",
"glean",
"deeper",
"insights",
"into",
"biological",
"processes",
"."
]
}
] |
PMC9429973 | The TE was an initial symptom of APL for 4 patients (40%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"TE",
"was",
"an",
"initial",
"symptom",
"of",
"APL",
"for",
"4",
"patients",
"(",
"40",
"%",
")",
"."
]
}
] |
PMC10957991 | On the right side panel, differences in junction protein area, interface occupancy and area of the junction protein, coverage index, intensity per interface, and cluster density in between ctrl and TRPV4 siRNA-treated 184A1 epithelial sheets are shown with box blots with inner and outer points and mean. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"On",
"the",
"right",
"side",
"panel",
",",
"differences",
"in",
"junction",
"protein",
"area",
",",
"interface",
"occupancy",
"and",
"area",
"of",
"the",
"junction",
"protein",
",",
"coverage",
"index",
",",
"intensity",
"per",
"interface",
",",
"and",
"cluster",
"density",
"in",
"between",
"ctrl",
"and",
"TRPV4",
"siRNA-treated",
"184A1",
"epithelial",
"sheets",
"are",
"shown",
"with",
"box",
"blots",
"with",
"inner",
"and",
"outer",
"points",
"and",
"mean",
"."
]
}
] |
PMC9429973 | These results have since been verified in vitro using BTKi-treated patient samples, where we found a subset of U-CLL ‘Non/Reverse Responders’ to become ‘Sensitised’ to TLR9 activation in the presence of ibrutinib. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"results",
"have",
"since",
"been",
"verified",
"in",
"vitro",
"using",
"BTKi-treated",
"patient",
"samples",
",",
"where",
"we",
"found",
"a",
"subset",
"of",
"U-CLL",
"‘",
"Non/Reverse",
"Responders",
"’",
"to",
"become",
"‘",
"Sensitised",
"’",
"to",
"TLR9",
"activation",
"in",
"the",
"presence",
"of",
"ibrutinib",
"."
]
}
] |
PMC9596868 | Primary antibodies used are as follows: mouse monoclonal anti-p53 (DO-1) from Santa Cruz Biotechnology, USA (Cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Primary",
"antibodies",
"used",
"are",
"as",
"follows",
":",
"mouse",
"monoclonal",
"anti-p53",
"(",
"DO-1",
")",
"from",
"Santa",
"Cruz",
"Biotechnology",
",",
"USA",
"(",
"Cat",
"."
]
}
] |
PMC10237474 | Cells were co-transfected with the PB vector and expression vector(s) that encodes GOI using Lipofectamine LTX (cat. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"co-transfected",
"with",
"the",
"PB",
"vector",
"and",
"expression",
"vector(s",
")",
"that",
"encodes",
"GOI",
"using",
"Lipofectamine",
"LTX",
"(",
"cat",
"."
]
}
] |
PMC11489175 | DUB enzymatic activity is regulated in a complex manner through allosteric and substrate-mediated effects 112. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"DUB",
"enzymatic",
"activity",
"is",
"regulated",
"in",
"a",
"complex",
"manner",
"through",
"allosteric",
"and",
"substrate-mediated",
"effects",
"112",
"."
]
}
] |
PMC10606998 | The micrograph contrast is caused by the magnetite cores, while the dextran shells around the cores are only slightly noticeable as thin gaps (~1.5 nm) between dark spots. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"micrograph",
"contrast",
"is",
"caused",
"by",
"the",
"magnetite",
"cores",
",",
"while",
"the",
"dextran",
"shells",
"around",
"the",
"cores",
"are",
"only",
"slightly",
"noticeable",
"as",
"thin",
"gaps",
"(",
"~1.5",
"nm",
")",
"between",
"dark",
"spots",
"."
]
}
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.