PMCID string | Sentences string | ner list |
|---|---|---|
PMC9429973 | Viability was 97,0% (85-99) and 96,5 % (70-99) respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Viability",
"was",
"97,0",
"%",
"(",
... |
PMC11655536 | Mice with palpable tumors were randomly divided into three groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Mice",
"with",
"palpable",
"tumors",
"were",
"randomly",
"divided",
"into",
"three",
"groups",
... |
PMC10936243 | Of course, we always try to do things that don’t create more work for ourselves. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Of",
"course",
",",
"we",
"always",
"try",
... |
PMC11285179 | Human CC motif chemokine ligands 28 (CCL28) can recruit various cell types, including lymphatic endothelial cells , T cells, and plasma cells, through its receptors CCR3 or CCR10. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11592008 | CTTCTACCTGGAGACCTACG; Rev. TATAAAGTGCAGGCCCTGGT, CASP1 (For. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CTTCTACCTGGAGACCTACG",
";",
"Rev.",
"TATAAAGTGCAGGCCCTGGT",
",",
"CASP1",
"(",
"For",
"."
]
}
] |
PMC11525028 | Immunoprecipitated DNA was amplified by PCR and separated by DNA gel electrophoresis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immunoprecipitated",
"DNA",
"was",
"amplified",
"by",
"PCR",
"and",
"separated",
... |
PMC11502962 | The infiltration of immune cells and their roles of the infiltrating-immune cells in gastrointestinal stromal tumor (GIST) is still unclear. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"infil... |
PMC10055960 | The new low-valent metallodendrimer compounds (8–10) evaluated in this study were obtained in good to excellent yields (76–84%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
PMC11194678 | Thus, STAU1 phase separation seems to be driven by both electrostatic and hydrophobic interactions from residues in RBD23, with electrostatic interaction as the dominant force. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6835428 | Notably, because of the specific biology of HGSOC, metastasis removal can improve overall survival. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Notably",
",",
"because",
"of",
"the",
"specific",
... |
PMC10547921 | In the C-terminal modification, Doronina et al. described MMAF analogs 11 and 12 where the carboxylic acid of phenylalanine was replaced by tetrazoles and phosphonates. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC3035438 | Overexpression of exogenous FLAG-tagged CstF-64 shown by anti-FLAG western blot analysis of 5 µl WCE from the parental chimera CX13 and two transfected clones (CstF-64+). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10253973 | They show the importance of theoretical chemistry in modern drug design, whether virtual screening is used to prescreen a huge library of potential drug candidates and drug targets, to further investigate the interactions between the drug candidate and target or just to support experimental findings. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10654497 | Second, the fundamental experiments were insufficient to fully investigate our model. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Second",
",",
"the",
"fundamental",
"experiments",
"were",
"insufficient",
"to",
... |
PMC11317131 | To maximize PE efficiency, we used engineered pegRNA (epegRNA) containing a structured RNA motif to prevent degradation (22,32), an optimized cr772 guide scaffold (33) and expressed PE5 from the PE5max plasmid with an optimized editor architecture that includes a dominant negative mutant of human mutL homolog 1 (MLH1) ... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7759933 | However, the major limitations of hepatic cells cultured in two (2D) dimensions are the low expression of CYP450 enzymes, xenobiotic receptors, and phase II enzymes and thus, inadequate expression of liver cell function in vivo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11544771 | We found that CPX alone downregulated the expression of Cdc25A and Cdc25B in a dose-dependent manner in A549 and A427 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"We",
... |
PMC11367146 | Statistical significance was calculated by using one-way ANOVA followed by the Tukey test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Statistical",
"significance",
"was",
"calculated",
"by",
"using",
"one-way",
... |
PMC11594806 | Binding oleclumab to CD73 induces CD73 aggregation and internalization, which reduces free adenosine levels and prevents immunosuppression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Binding",
"oleclumab",
"to",
"CD73",
"... |
PMC9118379 | Such spectra were not assigned to variant peptides by the specific search engine when searching against RefP_V and against SuperPep_V, but they were assigned to variant peptides by other search engine(s) and could represent medium-confidence variant PSMs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11513571 | However, TSLP can activate Th2 type immune responses and cause allergic reactions in vaccinated individuals.27 However, further studies are required to determine the precise role of TSLP as a vaccine adjuvant. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11687663 | Furthermore, the amount of time, money, and effort needed to screen natural products for biological activity has decreased significantly thanks to developments in computational biology . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11224206 | Various mathematical models have been proposed to describe this relationship, with ‘Q10’ perhaps being the most established. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Various",
"mathematical",
"m... |
PMC11144200 | It might be due to that the modification of RGD on the surface of liposomes, as well as the signal enhancement caused by some activated CD8 T cells that bind the LPS‑RGD-Nb36-DOX to target the tumor site. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9895440 | If indicated, samples were washed again as above and incubated with 1:500 dilution of DAPI in blocking buffer for 5 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"If",
"indica... |
PMC11087055 | Embryos were then washed in TBST 5 X for 1 hr each at RT, followed by 10 min with 0.05 M Tris-HCl (pH 7.6), and incubated for 30 min with DAB (3,3′-Diaminobenzidine)/Tris-HCl (pH7.6) 0.0003% Hydrogen peroxide in the dark. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11409031 | Jianqiao Liu: Writing – review & editing, Conceptualization. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Jianqiao",
"Liu",
":",
"Writing",
"–",
"review",
"&",
"editing",
",",
"Conceptualization",
... |
PMC11541409 | However, from a practical viewpoint, inhibiting the initiator alone is often inadequate for the long-term suppression of GIST cells both in vitro and in vivo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The relative efficacy of cilta-cel versus RWCP was assessed using relative response rates (RR) for binary outcomes and hazard ratios (HR) for time-to-event outcomes, using weighted logistic regression and proportional hazards modeling, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11471176 | Mechanistically, ACE2 exhibits a distinctive transcription signature concerning tumor immune infiltration (TIL) markers, encompassing pro-tumorigenic and anti-tumorigenic facets within each molecular breast cancer subtype. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10809689 | Table 1Primer sequencesNo. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Table",
"1Primer",
"sequencesNo",
"."
]
}
] |
PMC11754291 | Lower blue light intensities maintained α-MSH levels similar to the control, indicating minimal melanogenic stimulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Lower",
"blue",
"light",
"intensities",
"maintained",
... |
PMC11740207 | The corresponding morphological features of these stage transformations should be visible in scatter dot plots, representing the resting phase (around 5–7 µm), SD (up to 10–14 μm, although it might also be 5–7 µm), and AD (up to 13–16 µm), leading to an increase in size through developmental stages. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11769522 | ELISAs for the keratinocyte-derived cytokines IL-10, IL-1ß, IL-12, IL-8/C-X-C motif CXCL8, and the C-C motif chemokine ligand 2 (CCL2) were performed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11422150 | The total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"total",
"RNA",
"was",
"extracted",
"using",
"TRIzol",
"reagent",
... |
PMC9822769 | Complexes (SP-4-2)-diammine dichlorido platinum(II) (cisplatin) , (OC-6-33)-diamminedichloridodihydroxidoplatinum(IV) (1) , (OC-6-44)-acetatodiamminedichloridohydroxidoplatinum(IV) (2) , and (OC-6-33)-diamminedichloridodiacetatoplatinum(IV) (3) were prepared and characterized according to previously published procedure... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6182045 | MGAT1 CHO cells were transfected via electroporation with a pCDNA3.1 expression vector containing the TZ97008-rgp120 gene. | [
{
"tags": [
"B-CellLine",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"MGAT1",
"CHO",
"cells",
"were",
"transfect... |
PMC11763111 | D The expression of CD62L in CAR-T cells (n = 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"D",
"The",
"expression",
"of",
"CD62L",
"in",
"CAR-T",
"cells",
"(",
... |
PMC4355729 | The membranes were blocked, then probed with corresponding primary antibody and HRP-conjugated secondary antibodies (Beyotime Biotech), and detected using BeyoECL PLUS Kit (Beyotime Biotech). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11670407 | b Mitochondrial ROS were detected by MitoSOX after treatment, and fluorescence intensity was assessed via flow cytometry (n = 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"b",
... |
PMC8345486 | Acquired resistance to platinum therapy remains a major problem in gynecological oncology. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Acquired",
"resistance",
"to",
"platinum",
"therapy",
"remains",
"a",
"major",
"... |
PMC8414691 | Control samples were treated in the same way without addition of dsRNA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Control",
"samples",
"were",
"treated",
"in",
"the",
"same",
"way",
"without",
... |
PMC11683240 | Enclosed in squares are those residues interacting at least 50% (5 ns) of the time of the simulations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Enclosed",
"in",
... |
PMC11634027 | MyoID binds to the Ds-ICD, but specific regions responsible for this binding have not been identified (González-Morales et al., 2015). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC8992508 | The inhibitory activity against BCRP was evaluated by the Hoechst 33342 accumulation assay using the MDCK II BCRP cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"inhibitor... |
PMC9429973 | Standard statistical methods were applied. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Standard",
"statistical",
"methods",
"were",
"applied",
"."
]
}
] |
PMC11765678 | Cells were then treated with various concentrations of drugs and incubated for 72 h, and cytotoxicity was determined according to the manufacturer’s instructions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11806106 | For the NOP BRET senor the following primers were used: vector fwd: GTGCGAACGCATTCTGGCGTGATATCTAGCTCGAGTCTAGAGGGC; vector rev: TCTTCGAGTGTGAAGACCATACCGGTTGACCTCACTCTGTCT; nLuc fwd: ACAGAGTGAGGTCAACCGGTATGGTCTTCACACTCGAAGATTTCGT; nLuc rev: same as used for MOR-nLuc: Insert nLuc rev. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11387401 | Our data confirms that Gag has a high preference for tRNA binding, including: (1) tRNA, the primer used by HIV-1 during reverse transcription (Zhang, 2021; Telesnitsky and Wolin 2016), (2) its non-primer lysine tRNA isoacceptor tRNA was also found to bind Nucleocapsid, a tRNA that had been reported to be preferentially... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11228511 | While the expression of progerin promotes nuclear blebs and NM ruptures, the mechanisms have not been clear. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"While",
"the",
"expression",
"of",
"pr... |
PMC11740399 | This indicates that compound 3K inhibited the expression of PKM2 and FASN and induced cell apoptosis pathway, thereby promoting cell apoptosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
... |
PMC9386809 | Final evidence for such coordination and cone conformation came from the single-crystal structure of 2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Final",
"evidence",
"for",
"such",
"coordination",
"and",
"... |
PMC11588008 | ROS was detected by using a fluorescent probe DCFH-DA by flow cytometry. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ROS",
"was",
"detected",
"by",
"using",
"a",
"fluorescent",
"probe",
"DCFH-DA",
... |
PMC7757104 | The RNA was reverse-transcribed using SuperScript™ II Reverse Transcriptase kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11739484 | In this study, we conducted a comprehensive analysis of MMPs in SKCM, incorporating multiple layers of investigation, including their expression profiles, promoter methylation status, prognostic and diagnostic significance, regulatory networks, functional roles, and associations with immune modulation and drug sensitiv... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5034105 | Fifteen nonhuman cell lines were tested (Table 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fifteen",
"nonhuman",
"cell",
"lines",
"were",
"tested",
"(",
"Table",
"1",
")",
"."
]... |
PMC9429973 | Response profiles for individual pts are shown in Figure 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Response",
"profiles",
"for",
"individual",
"pts",
"are",
"shown",
"in",
"Figure",
"1",
".... |
PMC11666785 | Intensity analysis based on the number of molecules suggests that corrSMLM better corroborates the raw data and preserves finer features (e.g., edges), which are wiped out in standard SMLM. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11489351 | These biochemical analyses of protein abundance show that pH-dependent Notch1 expression is conserved across various normal epithelial tissues and species. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"biochemical",
"anal... |
PMC9429973 | NB4/NB4R2 (RA-resistant) cell lines were transduced with PML A216V. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"NB4/NB4R2",
"(",
"RA-resistant",
")",
"cell",
"lines",
"were",
"transduced",
"with",
... |
PMC11621493 | DAG subspecies are labeled according to their acyl-chain composition. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"DAG",
"subspecies",
"are",
"labeled",
"according",
"to",
"their",
"acyl-chain",
"composition",
"... |
PMC11185260 | A compilation of the IC50 values is shown (lower panel). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"compilation",
"of",
"the",
"IC50",
"values",
"is",
"shown",
"(",... |
PMC9926039 | In summary, it was observed that methadone enhanced the expression of TLR4 in the A549 cell line. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O"
],
"tokens": [
"In",
"summary",
",",
"it",
"w... |
PMC9512971 | Another large-scale study conducted in Denmark and Sweden also reported no benefit of administering camostat mesilate at a dose of 200 mg three times daily (lower than the dose used in our study, 600 mg qid) or placebo for 5 days in hospitalized patients . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11066331 | Altogether, this experimental design represents a highly suitable model for optimization of intact cell mass spectrometry and analysis of spectral data. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Altogether",
... |
PMC11525028 | Scale bars: 50 μm (left), 25 μm (right).(L) Kaplan-Meier analysis showing overall survival and LMFS curves generated for patients stratified according to the protein levels of NAT10, ATF4, and ASNS, by log-rank test.(M) ROC analysis of three marker combinations (NAT10, ATF4, and ASNS) and NAT10 in OS (left) (combinatio... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11144200 | In a reverse verification, the binding effectiveness of CTLA-4 in LPS-RGD-Nb36-DOX incubated CD8 T cells was examined using CTLA-4 mAb. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"a",
"revers... |
PMC11615101 | The bar graph showing TNF-α concentration in the rat’s plasma sample measured by ELISA, found downregulated in the knockdown group. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
PMC11759751 | NSG mice received an intravenous injection of 1 × 10⁶ GFP + Luciferase + Raji cells on day − 10. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"NSG",
"mice",
"rece... |
PMC10218459 | The prognosis of patients with ES depends on the histological grading, extent of metastasis, tumor localization, and adequate surgical margins of resection . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11021472 | This indicates that MYB is still targeted by miR-150 despite the high exogenous circZDHHC11 levels. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"indicates",
"that",
"MYB",
"is",
"still",
"targeted... |
PMC11730320 | At the DN3 stage, cells expressing TCRβ chain genes continue to develop as αβ lineage cells and later express pTCRα which is needed for development of a diverse TCR repertoire and progression to CD4+CD8+ double positive (DP) thymocytes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9895440 | d UMAP of single-cell RNA sequencing data from OTI cells isolated from MC38-OVA tumors 13 days post-transfer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"d",
"UMAP",
"of",
"single-cell",
"RNA",
... |
PMC9429973 | Aims: Using data from the Lymphoma Coalition (LC) 2020 Global Patient Survey (GPS) on Lymphomas and CLL, this study examines the impact of countries’ health expenditure (as a percentage of the Gross Domestic Product (GDP)) on the diagnostic experiences of patients with lymphoma in Europe. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | All patients received Aza 75mg/m2 on D1-5. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"patients",
"received",
"Aza",
"75mg/m2",
"on",
"D1",
"-",
"5",
"."
]
}
] |
PMC9429973 | Results: A total of 61 patients in CARTITUDE-1 and 202 patients in LocoMMotion had PRO assessments at baseline and during follow-up. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Results",
":... |
PMC11774251 | To assess the cell cycle, we utilized the BD Cycletest™ Plus kit. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"assess",
"the",
"cell",
"cycle",
",",
"we",
"utilized",
... |
PMC6160470 | To validate that the sensitization of A2780/Adr by crown ethers is a consequence of P-gp inhibition and consequent effect of PTX, we analysed the effect on cell cycle perturbations in resistant cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9587298 | The main product ions observed for these anthocyanins correspond to the cyanidin aglycone (m/z = 287), resulting from the loss of the sugar substituents in the O-3 position for cyanidin-3-glucoside (–162 Da, –Glc) and cyanidin-3-sambubioside (–294 Da, –XylGlc) and the sequential loss of the sugars from O-3 and O-5 posi... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11754436 | Furthermore, overexpression of DHRS4-AS1 inhibited the decrease in proliferation and increase in apoptosis caused by upregulation of miR-362-5p (Fig. 5F-H). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11499381 | The brightness of images was modified to facilitate visualization on screen and in print; modifications were kept consistent within experiments and channels and care was taken during the acquisition process to make sure data did not saturate the detector. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11727145 | The substitution of insulin with EGF (Figure 4, #6–7) resulted in an increase of attached cells and cell invagination on the DED construct. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11755624 | lncRNAs also mediate Th17 cell differentiation, thus indirectly affecting IL-17 secretion . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"lncRNAs",
"also",
"mediate",
"Th17",
"cell",
"differentiation",
",",
"thus",
"in... |
PMC11705484 | Although some reports are consistent with our previous results, the biological functions and potential mechanisms of action of mA methylation in BLCA remain unknown. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9429973 | Twenty-six patients were eligible for chemotherapy: 20 were treated with DHAP and 6 with ICE regimen. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Twenty-six",
"patients",
"were",
"eligible",
"for... |
PMC5034105 | For DENV-2 detection, forward primer (5′-GCA TAT TGA CGC TGG GAR AGA C-3′), reverse primer (5′-CGY TCT GTG CCT GGA WWG ATG-3′) and probe (5′-FAM-CAG AGA TCC TGC TGT C-MGB-NFQ-3′) targeting the DENV-2 3'-untranslated region were used. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11665584 | PITX1 drastically reshapes the morphology and molecular networks of the skin, but what crucial signaling networks are influencing mucosal biology compared with healthy skin is not well characterized. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11481779 | We have calculated the Pearson correlation coefficients for each of the examples in the testing set (for each model), SCC (Stratum-adjusted correlation coefficient), and the FID score. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10329237 | Our results align with the findings of Liu et al. who used 0.5 μg/ml BLM to treat A549 cells without causing excessive cell death (35). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8922418 | HIV-1 provirus could either be cleaved by gene-editing tools or activated by CRISPRa for the “shock and kill” strategy. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"HIV-1",
"pro... |
PMC11721096 | The calculation method is detailed in the Supplementary Data, Part S2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"calculation",
"method",
"is",
"detailed",
"in",
"the",
"Supplementary",
"... |
PMC10490530 | SKOV3 cell line transiently transfected with pNF-κB-hLuz and pPIK3CA-FLuc2-tdT constructs was denoted as SKOV3 NP, and when transfected with pNF-κB-hLuz, pPIK3CA-FLuc2-tdT, and p53NanoLuc fusion plasmid was denoted as SKOV3 NPp. | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC10094992 | The phenotype and the effects of neutrophils recruited inside MCSs need to be further characterized. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"phenotype",
"and",
"the",
"effects",
"of",
"neutroph... |
PMC11789597 | Despite surviving the disturbance of redox homeostasis, these CAV1‐deficient MM cells were more sensitive to autophagy induction, glutamine depletion, and glutamine transporter inhibition, which partly explains their reduced growth and increased sensitivity to bortezomib in vivo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11285179 | Moreover, the number of DC cells remains unchanged, but their proportion decreased (Fig. 5D). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"the",
"number",
"of",... |
PMC9712534 | Following antibodies were used in this study: mouse anti-TOP2B antibody (#611492, BD Biosciences, USA), rabbit anti-TOP2A antibody (12286S, Cell Signaling Technology, USA), anti-mouse HRP-linked IgG (7076S, Cell Signaling Technology), anti-rabbit HRP-linked IgG (7074S, Cell Signaling Technology). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6182045 | After 14 days, white light and fluorescent images were acquired using the ClonePix2 (Figure 3A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"14",
"days",
",",
"white",
... |
PMC11271800 | Programmed death receptor-1/programmed death ligand-1 (PD-1/PD-L1) blockers are one of the most widely investigated therapies to date. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Programmed",
"death",
"receptor-1/progr... |
PMC11723947 | In contrast, the expression of 176 genes was significantly upregulated in HP1α-deficient Tconv isolated from mice adoptively transferred with CD4 T cells (and the mix of bone marrow) only. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8916024 | Flavobacterium is a Gram-negative bacillus widely found in sediment and water (Chen et al., 2018b; Kim & Yu, 2020). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.