PMCID string | Sentences string | ner list |
|---|---|---|
PMC11635519 | Cells were incubated overnight at 37 °C in 5% CO2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"incubated",
"overnight",
"at",
"37",
"°",
"C",
"in",
"5",... |
PMC11612794 | Error bars show the mean ± SD; p-values were calculated by one-way ANOVA (F (2,27) = 245.1; p < 0.0001) followed by Tukey’s test.(F) Immunoprecipitation using anti-FLAG antibody in AID-based CENP-T conditional knockdown CENP-C/CENP-T cells or CENP-C/CENP-T cells expressing GFP-Dsn1 or GFP-Dsn1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11541241 | In conclusion, SNT2 function and pathogen pathogenicity are connected to the TOR pathway and autophagosome abundance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"conclusion",
",",
"SNT2",
"function",
... |
PMC11791203 | These findings offer valuable insights into the molecular mechanisms underlying the cytotoxicity and indicate the possibility of utilizing these compounds as drug candidates the treatment of colorectal carcinoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | L. Dumas, A. Sissoko, A. Fricot, N. Salama, L. Joseph, S. Manceau, S. Dokmak, A. Michel, B. Maitre, C. Gachet, M. Cavazzana, C. Roussel, P. Buffet Université de Paris, UMR1134; Assistance publique des hôpitaux de Paris (APHP); Université de Strasbourg, UMR 1255, Paris, France Background: Defective spleen function (hyposplenism) affects subjects with sickle cell disease (SCD) and is associated with complications. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10877303 | The molecular dynamics simulation study was conducted using the YASARA dynamics software package , assisted by the AMBER14 force field . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"molecular",
"dynamics... |
PMC11344246 | Following this quality control measure, target gene knockdown cell counts were normalised to the average of non-targeting control siOTP wells on the plate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11629461 | In the transiently transfected NOX5‐CHO‐K1 cells, NOX5 was found to be located at the plasma membrane and cytosol (red, Figure 1A, right, transfection rate was 34.7% ± 0.09%, calculated out of 3 independent experiments). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11413393 | The nuclear:cytoplasmic ratio of post-spliced RNA also shows an increase over time for some of the tested genes (Supplementary Fig. S9d). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC3888431 | Both interfaces provide comprehensive search functionality. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Both",
"interfaces",
"provide",
"comprehensive",
"search",
"functionality",
"."
]
}
] |
PMC11583690 | This is probably because MSN@DTX does not significantly enhance DTX solubility in the test conditions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"is",
"probably",
"because",
"MSN@DTX",
"does",
"not... |
PMC10170482 | It is proposed here that soft 3D collagen scaffolds can serve as a useful model for future studies of mechanically regulated cellular functions of various liver (potentially other tissues as well) tumor cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC3915447 | Most anticancer agents exert their anticancer effects by inducing apoptosis (12). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Most",
"anticancer",
"agents",
"exert",
"their",
"anticancer",
"effects",
"... |
PMC10606998 | To establish cytotoxicity, we operated as described in Section 4.6. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"establish",
"cytotoxicity",
",",
"we",
"operated",
"as",
"described",
"in",
"Se... |
PMC11300085 | For cell growth detection, both cells were cultured on 96-well plates and were treated with different doses of chemerin (0, 25, 50, and 100 ng/ml) for 24, 48, and 72 h. For western blot analysis, both cells were cultured on 6-well plates and were stimulated with chemerin (50 ng/ml) for 24 h. SK-OV-3 cells were pretreated with the RhoA inhibitor, C3T (1.5 μg/ml), or the ROCK1 inhibitor, Y27632 (30 μM), for 2 h and then were treated with chemerin (50 ng/ml) for another 24 h. The siRNAs for CMKLR1 (two silencing sequences) and negative control (NC) were synthesized by GenePharma (Shanghai, China). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11397654 | The drug release was found to be strongly pH-dependent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"drug",
"release",
"was",
"found",
"to",
"be",
"strongly",
"pH-dependent",
"."
]
}
] |
PMC11551844 | GraphPad Prism™ version 8.4.3 was used for statistical analyses. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"GraphPad",
"Prism",
"™",
"version",
"8.4.3",
"was",
"used",
"for",
"statistical",
"analyses",
... |
PMC11794568 | It was found by EDU proliferation assay that rotenone reversed the proliferative ability of melanoma cells promoted by silencing CRIP1 (Fig. 7B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | Median time to peak YTB323 expansion was ~16 d and coincided with cytokine peak. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Median",
"time",
"to",
"peak",
"YTB323",
"expansion",
"was",
"~1... |
PMC7642379 | Tracing the origin of the 293E cell line, the Large T expression of 293E may be derived from the pRSVneo plasmid that was used to co-transfect HEK293 cells along with the pCMV-EBNA plasmid for the generation of the stable EBNA-1 expressing clone (293c18) by geneticin (G418) selection. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8557138 | The complex molecular interplay between the tumor cells and non-tumor cells such as fibroblasts, adipocytes, monocytes, macrophages, endothelial cells, and cancer stem cells leads to the synthesis of these angiocrine molecules and result in the development of blood vessels with aberrant morphology and functionality. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Kaplan-Meier survival curves show lower overall survival in DEK patients in the entire cohort. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Kaplan-Meier",
"survival",
"curves",
"show",
"lower",
"overall",
"surv... |
PMC9429973 | The availability of liposomal Doxorubicin, oral CHOP regimen and Dexrazoxane could change the outcome of this group of patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"availability",
"of",
... |
PMC9895440 | Despite impressive clinical results, the efficacy of adoptively transferred T cells can likewise be compromised by an exhausted state. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Despite",
"impressive",
"cli... |
PMC8759873 | We activate Raf/MEK/ERK and PBK/Akt/mTOR pathways through autophosphorylation of receptor tyrosine kinases, causing uncontrolled cell division, proliferation, and transformation, stimulating neovascularization, and promoting tumor growth and metastasis . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8427838 | E Schematic of GST moesin constructs encompassing the N-terminal GST-FERM or the C-terminal GST-C-ERMAD domains. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"E",
"Schematic",
"of",
"GST",
"moesin",
"constructs",
"enco... |
PMC11680562 | In-vitro drug release showed xanthan gum extended the release up to 8 h. The MTT assay revealed PXFCu6 gel's IC50 at 11.82 ± 0.22 μg/mL, significantly more cytotoxic to HeLa cells, being 3.62 times potent than CuO NPs (IC50: 42.8 ± 0.24 μg/mL) and 1.63 times potent than 5-Fu alone (IC50: 19.3 ± 0.49 μg/mL). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6650823 | By using the same warhead and the same recruited E3 ligase while modifying only the linker length and its attaching point on the E3 ligase-recruiting moiety, Crews and co-workers were able to identify two PROTACs that targeted individual isoforms of the p38 MAPK family . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8164677 | Knowing that cisplatin has an RF value of about 5, anything less than that means that the compound would be better able than cisplatin to overcome drug resistance.33 Thus, RF value of 1.1 for wedelolactone compared with 5.3 for cisplatin indicates its greater relative ability to cause more cell death than cisplatin in cisplatin-resistant cell line A2780 (Table 2). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11742231 | GNNs are an effective approach for extracting knowledge from data that is structured as graphs . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"GNNs",
"are",
"an",
"effective",
"approach",
"for",
"extrac... |
PMC10204952 | In this study, we used DAPI staining method to evaluate how AD-CM and CAA-CM would affect the apoptotic effect of high-concentration S1P. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
... |
PMC11656380 | A Gly-Gly linker connects RAM13 or mutant RAM13 to the HIV-1 TAT (48–57). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"Gly-Gly",
"linker",
"connects",
"RAM13",
"or",
... |
PMC9429973 | Methods: We used the HEL erythroleukemia cell line which carries several copies of the JAK2V617F mutated gene. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Methods",
":",
"We",
"used",
... |
PMC11247842 | In this study, we collected the largest dataset for mastitis traits, CM and SCS, in dairy cattle. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"this",
"study",
... |
PMC10419319 | Alteration in cellular metabolism regarding glycolysis was measured using the Glucose-Glo ™ Assay and Lactate-Glo ™ Assay (Promega, Madison, WI, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11779876 | Consequently, our results challenge the binary assumption of restricted TRBC1, or TRBC2 expression of peripheral T cell lymphomas proposed by Ferrari and Righi et al.. This binary view on TRBC expression is fundamental to TRBC-directed therapies, yet the employed screening methods in the ongoing clinical trial may lack the sensitivity to detect subclonal TRBC heterogeneity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Recovery to baseline was within 3 months in 91% and within 1 month in 67%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Recovery",
"to",
"baseline",
"was",
"within",
... |
PMC11269933 | The wild type and S11A mutant of CgPK was used as substrate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"wild",
"type",
"and",
"S11A",
"mutant",
"of",
"CgPK",
"was",
"used"... |
PMC11089031 | The ZNF692 transcript level was significantly increased (fold change = 3.02) in tumors compared with adjacent normal tissues (n = 72). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9917080 | Increasing the time of incubation of A-172 cells with SeSo to 48 h did not lead to a significant increase in the number of cells in the early stages of apoptosis, compared with 24 h of exposure. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10854447 | Also, docking results revealed that 7l and 7k exhibited the best binding mode within both active sites. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Also",
",",
"docking",
"results",
"rev... |
PMC9429973 | Lower rates of nipocalimab infusion were associated with fewer TEAEs, while participants receiving 4 mg/kg/min (as either 30 mg/kg infused over 7.5 min or 60 mg/kg infused over 15 min) reported more TEAEs (Table). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11638255 | Primers used are as follows: ISG15 (F: AAGAGGCAGCGAACTCATCT and R: AGCTTCAGCTCTGACACCG), MT1X (F: GCTTCTCCTTGCCTCGAAA and R: GCAGCAGCTCTTCTTGCAG), S100A8 (F: AAGGGGAATTTCCATGCCGT and R: ACGTCTGCACCCTTTTTCCT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Exploratory multivariate Cox regression models were adjusted for treatment, stratification factors (International Prognostic Index, bulky disease, geographic region), age >60 years, cell of origin, and biomarker evaluated, as appropriate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11267830 | SBE-β-CD was added to saline in advance to obtain a 20% cosolvent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"SBE-β-CD",
"was",
"added",
"to",
"saline",
"in",
"advance",
"to",
"ob... |
PMC10522430 | Following this, the Tukey test was administered to highlight significant disparities between groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Following",
"this",
",",
"the",
"Tukey",
"test",
"was",
"adminis... |
PMC11774747 | Retronectin-coated-plates are usually employed to enhance virus and cells contacts, with spinoculation utilized to maintain virus adherence and contact. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Retronectin-coated-plates",
"are",... |
PMC2777936 | The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/9/383/prepub | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"pre-publication",
"history",
"for",
"this",
"paper",
"can",
"be",
... |
PMC11495567 | The mean area of the cells was determined using the BZ-800 analyzer and graphed using GraphPad Prism 8.4.3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"mean",
"area",
"of",
"the",
... |
PMC11746948 | According to the KEGG enrichment pathway analysis, the impact of 2-BP treatment on ferroptosis was not substantial, indicating 2-BP alone was not sufficient to induce ferroptosis in vitro (Supplementary Fig. 4b). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11422497 | CircRNAs modulate key cellular processes in GISTs development, including proliferation, apoptosis, migration, invasion, and epithelial-to-mesenchymal transition (EMT), functioning as ceRNAs by sequestering miRNAs and influencing target gene expression in oncogenic pathways. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10582049 | Expression of canonical marker genes of CAFs (FAPACTA2; ADH1B, CTHRC1FAP), pericytes (RGS5TINAGL), and smooth muscle cells (DESMYH11) in stromal cell subpopulations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11802929 | Gene counts for each cell were normalized by total expression, multiplied by a scale factor of 10,000, and transformed to log scale. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11761919 | The expression level of Fiber2 protein in E. faecalis/Fiber2 treated with 1% PINs was larger than that with 0.5% PINs, suggesting that the application of 1% PINs to recombinant E. faecalis can significantly enhance the expression of the target protein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11320834 | These factors significantly increase the disease’s lifetime risk and account for most hereditary cases and 10%–15% of all cases. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"factors",
... |
PMC11535726 | The observed features were measured using Tarosoft (R) Image Frame Work (version IFW 0.97) and photoplates were constructed using Adobe Photoshop 2019 (Adobe Systems, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11568601 | p < 0.01, vs. the control group TGT attenuates the growth of osteosarcoma cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"p",
"<",
"0.01",
",",
"vs.",
"the",
"control",
"group... |
PMC11720107 | Interestingly, in the CACO-2 cell line, the Ornak cultivar decreased LDH release across a wide range of concentrations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
... |
PMC2196094 | In both rodents and man, MC heterogeneity is associated with differential expression of the various granule proteases. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"both",
"rodents",
"and",
"man",
... |
PMC11549062 | However, the expression of Rab5 was not affected by overexpression or knockdown of PDGFR‐β (Figure 3C–E). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"t... |
PMC11742290 | A cervical cancer study found that LGR5 promoted CSCs traits and chemo-resistance through the WNT/β-catenin signaling pathway . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"cervical",
"cancer",
"study",
"found",
... |
PMC11345828 | This prediction was born out in observation, as only small substituents (Me, Et, OMe, OEt) at the indole 4-position maintained good binding affinity and cellular potency. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11742670 | Drug repurposing is the development of new drugs for previously identified medications. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Drug",
"repurposing",
"is",
"the",
"development",
"of",
"new",
"drugs",
"for",
... |
PMC11337594 | Then, the cells were fixed with anhydrous ethanol at room temperature for 15 min and washed twice with PBS. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Then",
",",
"the",
"ce... |
PMC11750712 | Interpretation of efficacy from LibraT1 must, however, be interpreted with caution given this is a small, single-arm study. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interpretation",
"of",
... |
PMC11788920 | Even though both dCas9 and GQs can independently block RNAP progression, dCas9 alone may also stabilize or destabilize the GQs (depending on whether the G-rich or C-rich strand is targeted) ; thus, consolidating the two effects and potentially providing a broader range for transcription regulation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8270637 | Scheipers et al. (12) reported that CTLA-4 can mediate T cell apoptosis independently of the Fas pathway, reduce IL-2 secretion by T cells, and inhibit IL-2R expression, thereby inhibiting T cell proliferation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10587429 | The primary ES xenograft tumors quickly grow to the size that necessitates sacrifice or metastasize to the lung that causes death of the animal 8 weeks after tumor implantation if not sooner. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11264242 | However, patients with synovial sarcoma do not gain significant benefits, as the tumors commonly reoccur in primary lesions or metastasize to different organs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9693627 | After clarification at 25,000× g for 30 min, lysates were applied to 10–40% linear sucrose gradient prepared on the same buffer without detergent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC9684669 | Half maximal inhibitory concentrations (IC50) of doxorubicin or compounds were calculated using Prism software (version 7, GraphPad Software, San Diego, CA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Results: WGS/WES revealed a complex genomic landscape in PMBCL with a median of 85 structural variants, a mutational burden of 5 mutations/Mb, 12 mutated coding candidate driver genes (CDG) and 4 focal somatic copy-number aberrations per sample (Fig.1a). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9024365 | To identify the GluA1 AMPAR domain sufficient for clustering with SD4, we used GluK2/GluA1 chimeras which swap homologous protein domains between receptors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
... |
PMC11755624 | lncRNA molecules induce protective mechanisms regarding keratinocyte proliferation as well. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"lncRNA",
"molecules",
"induce",
"protective",
"mechanisms",
"regarding",
"keratinocyte",
"proliferation",
... |
PMC9429973 | Methods: The study was performed on adults of three families with JAK2-negative erythrocytosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Methods",
":",
"The",
"study",
"was",
"performed",
"on",
"adults... |
PMC11531744 | RNA in cells was greater than 50; 3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"RNA",
"in",
"cells",
"was",
"greater",
"than",
"50",
";",
"3",
"."
]
}
] |
PMC11474209 | The initial suppression of PP2A via MC treatment and the hyperphosphorylation of proteins like p53 results in various events that lead to cellular death through apoptosis or necrosis . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11742431 | Data were depicted as mean values ± standard deviation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"were",
"depicted",
"as",
"mean",
"values",
"±",
"standard",
"deviation",
"."
]
}
] |
PMC11451829 | Histopathological analysis throughout the study period and its correlation with the different grades of the lesion: (A) normal conjunctiva; (B–D) grade 1; (E) grade 2; (F) grade 3; and (G–I) grade 4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Methods: We retrospectively studied AML patients undergoing 3 + 7 + GO induction and Ara-C + Daunorubicine + GO, consolidation (doses are derived from label instructions and ALFA0701 study) and mobilization on day +20 using G-CSF 10µg/kg. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8759873 | 786-0 cells were cultured in RPMI1640 with 100 g/m 1 penicillin, 100 g/ml streptomycin, and 10% fetal bovine serum in a 37°C, 5% CO2 incubator, whereby the cells used were all in the logarithmic growth phase. | [
{
"tags": [
"B-CellLine",
"I-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC11569208 | Since its discovery as a potent anti-tumor agent in the 1950s, the development of viruses as a cancer immunotherapy has escalated in recent decades highlighted by the clinical approval of talimogene laherparepvec (T-VEC) for the treatment of melanoma in 2015. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | First CDK8/CDK19 inhibitor RVU120 has reached clinical development phase Ib (NCT04021368) in AML and HR-MDS patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"First",
"CDK8/CDK19",
"inhibitor",
"RVU120",... |
PMC10914904 | For example, during the active lytic phase of Kaposi's sarcoma-associated herpesvirus (KSHV) infection in the B-lymphocyte line BC-3, 5ʹ-PPP-vtRNA accumulates due to reduced DUSP11, leading to activation of the antiviral response. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Subcutaneous (SC) delivery would optimize convenience of administration. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Subcutaneous",
"(",
"SC",
")",
"delivery",
"would",
"optimize",
"convenience",
"of",
"administra... |
PMC5963610 | In the metastasis, of mice treated with the combination, both EGFR and uPAR/α5β1 integrin pathways are turn off; and tumor angiogenesis, a process influenced by these pathways, is reduced. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Increases in platelets were observed in HTB patients achieving HI-E or TI (Panel D). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Increases",
"in",
"platelets",
"were",
"observed",
"in... |
PMC11394730 | Consequently, the primary enzyme for identifying the glycolytic phenotype of tumor cells is lactate dehydrogenase (LDH), which catalyzes the conversion of pyruvate to lactate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9100622 | Moreover, NAC treatment also allowed a partial reversion of γH2AX induction by Atorvastatin (Figure 5G). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"NAC",
"treatment... |
PMC11476106 | To start the polymerization process, 2 µL of hydrogen peroxide (0.01%) was placed in the center of each well in a 24-well plate and mixed with aliquots of 60 μL of the mix solution. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6364197 | After digestion, cells were harvested by gently pipetting the cell suspension up and down five times within the scaffold. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"digestion",
",",
... |
PMC11746948 | o GPX4 detected by immunoblots in A375 cells infected with Flag-GPX4-WT or Flag-GPX4-C66S, treated with or without MG132 for 12 h. p, q Immunoblots of GPX4 in A375 cells infected with various GPX4 constructs, followed by 48 h 2-BP treatment (p). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10329074 | YBX silencing reduced the proportion of A549 cells in G2/M phases and increased cells in G1 phase, suggesting cell cycle arrest at either G1 phase (Fig. 6C-D, ***P < 0.001). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9545714 | Fibroblasts play significant roles in innate immunity of the skin by producing cytokines to attract leukocytes to the dermis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fibroblasts",
"play",
"significant",
... |
PMC11713609 | X.Y. and W.G wrote the manuscript.] | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"X.Y.",
"and",
"W.G",
"wrote",
"the",
"manuscript",
".",
"]"
]
}
] |
PMC11697703 | F–J′) Images of electroporated neurons for each condition: single miR-scramble sequence (miR-Cnt) (F and F′), miR-365 (G and G′), miR-193b (H and H′), co-electroporation of miR-scramble sequences of miR-193b and miR-365 (miR-Cnt-double) (I and I′), and co-electroporation of miR-193b-miR-365 (J and J′). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11243198 | These three residues are found within ZF4 of GLI1 (Figure 6). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"three",
"residues",
"are",
"found",
"within",
"ZF4",
"of",
"... |
PMC7342409 | Detection of KIT and PDGFRA gene mutations in the transplanted imatinib-resistant GIST was done by denaturing high performance liquid chromatography (DHPLC) and direct sequencing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10812665 | In LUHMES cells with impaired c-I function, we observed a > 40-fold increase in saccharopine, which was by far the most up-regulated metabolite measured here. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11787355 | Hence, we adapted our ACT regime to two doses of intracerebroventricular (i.cv.) | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Hence",
",",
"we",
"adapted",
"our",
"ACT",
"regime",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.