Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11279397
The results of GO enrichment analysis indicated significant predicted enrichment of target genes of Perilla frutescens in biological processes, molecular functions, and cellular components mainly involving regulatory functions and response mechanisms.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", "of", "GO", "enrichment", "analysis", "indicated", "significant", "predicted", "enrichment", "of", "target", "genes", "of", "Perilla", "frutescens", "in", "biological", "processes", ",", "molecular", "functions", ",", "and", "cellular", "components", "mainly", "involving", "regulatory", "functions", "and", "response", "mechanisms", "." ] } ]
PMC9429973
18 oral evidences comprising approximately 286 person-hours were examined to extract themes addressing difficulties and dilemmas in clinical decision-making.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "18", "oral", "evidences", "comprising", "approximately", "286", "person-hours", "were", "examined", "to", "extract", "themes", "addressing", "difficulties", "and", "dilemmas", "in", "clinical", "decision-making", "." ] } ]
PMC9429973
It is a clinically validated target in therapies that have been developed to address unmet needs in MM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", "a", "clinically", "validated", "target", "in", "therapies", "that", "have", "been", "developed", "to", "address", "unmet", "needs", "in", "MM", "." ] } ]
PMC7802142
The underlying mechanism was indicated to be the activation of Wnt/β-catenin signaling pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "underlying", "mechanism", "was", "indicated", "to", "be", "the", "activation", "of", "Wnt/β-catenin", "signaling", "pathway", "." ] } ]
PMC11743414
The cell lines were cultured in RPMI 1640 medium containing 10% fetal bovine serum at 37 °C and 5% CO2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cell", "lines", "were", "cultured", "in", "RPMI", "1640", "medium", "containing", "10", "%", "fetal", "bovine", "serum", "at", "37", "°", "C", "and", "5", "%", "CO2", "." ] } ]
PMC11107915
This suggests that ChatGPT has the potential to effectively analyze and comprehend various psychiatric scenarios, providing correct assessments and demonstrating its utility as a tool for preliminary diagnostics in psychiatry.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "suggests", "that", "ChatGPT", "has", "the", "potential", "to", "effectively", "analyze", "and", "comprehend", "various", "psychiatric", "scenarios", ",", "providing", "correct", "assessments", "and", "demonstrating", "its", "utility", "as", "a", "tool", "for", "preliminary", "diagnostics", "in", "psychiatry", "." ] } ]
PMC11622247
Herein we present a new approach which involves coupling of light-collecting “auxiliary dyes” to create extremely bright FIT probes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Herein", "we", "present", "a", "new", "approach", "which", "involves", "coupling", "of", "light-collecting", "“", "auxiliary", "dyes", "”", "to", "create", "extremely", "bright", "FIT", "probes", "." ] } ]
PMC11732628
Additionally, in our previous study, we showed that NUSAP1 accelerates osteosarcoma cell proliferation and cell cycle progression via upregulating cell division cycle 20 homologue (CDC20) and Cyclin A2 (32).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "in", "our", "previous", "study", ",", "we", "showed", "that", "NUSAP1", "accelerates", "osteosarcoma", "cell", "proliferation", "and", "cell", "cycle", "progression", "via", "upregulating", "cell", "division", "cycle", "20", "homologue", "(", "CDC20", ")", "and", "Cyclin", "A2", "(", "32", ")", "." ] } ]
PMC9429973
Results: At the time of analysis (November 4, 2021), 100 patients were enrolled in the VenR arm of the VeRVe study and received at least one dose of Ven.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "At", "the", "time", "of", "analysis", "(", "November", "4", ",", "2021", ")", ",", "100", "patients", "were", "enrolled", "in", "the", "VenR", "arm", "of", "the", "VeRVe", "study", "and", "received", "at", "least", "one", "dose", "of", "Ven", "." ] } ]
PMC6889484
pcDNA-APO3GD128K expresses A3G mutant D128K and was used to PCR-amplify the A3G-D128K sequences used for construction of other vectors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "pcDNA-APO3GD128", "K", "expresses", "A3", "G", "mutant", "D128", "K", "and", "was", "used", "to", "PCR-amplify", "the", "A3G-D128", "K", "sequences", "used", "for", "construction", "of", "other", "vectors", "." ] } ]
PMC5415764
Interestingly, the PTX in the LPNs displayed a GSH-dependent release profile.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "the", "PTX", "in", "the", "LPNs", "displayed", "a", "GSH-dependent", "release", "profile", "." ] } ]
PMC11271278
ERBB2 was known to be an amplified and overexpressed gene in this cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ERBB2", "was", "known", "to", "be", "an", "amplified", "and", "overexpressed", "gene", "in", "this", "cell", "line", "." ] } ]
PMC10890055
We did not use G418 in this experiment to ensure the same conditions for both cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "did", "not", "use", "G418", "in", "this", "experiment", "to", "ensure", "the", "same", "conditions", "for", "both", "cell", "lines", "." ] } ]
PMC11727638
Muz et al. reported that CD19 expression on multiple myeloma cells differentiated from B cells was not affected by hypoxia .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Muz", "et", "al.", "reported", "that", "CD19", "expression", "on", "multiple", "myeloma", "cells", "differentiated", "from", "B", "cells", "was", "not", "affected", "by", "hypoxia", "." ] } ]
PMC11591030
Based on our results, we hypothesize that these beneficial effects may be related to the regulation of the Nrf2/Keap1 and TLR4/NF-κB signaling pathways by AOP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Based", "on", "our", "results", ",", "we", "hypothesize", "that", "these", "beneficial", "effects", "may", "be", "related", "to", "the", "regulation", "of", "the", "Nrf2/Keap1", "and", "TLR4/NF-κB", "signaling", "pathways", "by", "AOP", "." ] } ]
PMC11089031
We used the transfection of ZNF692 plasmid to overexpress (OE) ZNF692 and used siRNA methods to knockdown (KD) the expression of ZNF692.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "used", "the", "transfection", "of", "ZNF692", "plasmid", "to", "overexpress", "(", "OE", ")", "ZNF692", "and", "used", "siRNA", "methods", "to", "knockdown", "(", "KD", ")", "the", "expression", "of", "ZNF692", "." ] } ]
PMC6190245
The percentages of apoptotic cells in the HeLa cells are shown in Figure 5.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "percentages", "of", "apoptotic", "cells", "in", "the", "HeLa", "cells", "are", "shown", "in", "Figure", "5", "." ] } ]
PMC9398137
Concentrations of S63845 and VEN were chosen based on known sensitivity of particular cell lines to S63845 and VEN.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Concentrations", "of", "S63845", "and", "VEN", "were", "chosen", "based", "on", "known", "sensitivity", "of", "particular", "cell", "lines", "to", "S63845", "and", "VEN", "." ] } ]
PMC9429973
This discovery represents a new class of inhibitors for prevention of platelet activation and thrombosis and protection from myocardial infarction, stroke, VTE, and critical limb ischemia.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "discovery", "represents", "a", "new", "class", "of", "inhibitors", "for", "prevention", "of", "platelet", "activation", "and", "thrombosis", "and", "protection", "from", "myocardial", "infarction", ",", "stroke", ",", "VTE", ",", "and", "critical", "limb", "ischemia", "." ] } ]
PMC10957991
Immunofluorescence, IF, stainings of 184A1 mammary epithelial cells in 3D Matrigel after three weeks of incubation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Immunofluorescence", ",", "IF", ",", "stainings", "of", "184A1", "mammary", "epithelial", "cells", "in", "3D", "Matrigel", "after", "three", "weeks", "of", "incubation", "." ] } ]
PMC11297139
EWS/FLI1 peaks were called using MACS2 narrow callpeak, with q value a cutoff of 0.01.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "EWS/FLI1", "peaks", "were", "called", "using", "MACS2", "narrow", "callpeak", ",", "with", "q", "value", "a", "cutoff", "of", "0.01", "." ] } ]
PMC10887351
Moreover, β3-AR signaling controls the carbohydrate and lipid metabolism .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "β3-AR", "signaling", "controls", "the", "carbohydrate", "and", "lipid", "metabolism", "." ] } ]
PMC9429973
Recent studies from Rosshart et al (PMID: 31371577) has led to the generation of so-called “wildling” mice that carry a full spectrum of microbiota/pathogens found in wild mice, but on a full C57BL/6 genetic background.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "Recent", "studies", "from", "Rosshart", "et", "al", "(", "PMID", ":", "31371577", ")", "has", "led", "to", "the", "generation", "of", "so-called", "“", "wildling", "”", "mice", "that", "carry", "a", "full", "spectrum", "of", "microbiota/pathogens", "found", "in", "wild", "mice", ",", "but", "on", "a", "full", "C57BL/6", "genetic", "background", "." ] } ]
PMC9429973
J. L. Kaufman, S. Atrash, S. A. Holstein, O. Nadeem, D Benson, K. Suryanarayan, Y. Liu, C. Li, L. Yang, X. Parot, D. T. Vogl Winship Cancer Institute of Emory University, Atlanta; Haematology and blood disorders, Levine Cancer Institute, Charlotte; University of Nebraska Medical Center, Omaha; Dana-Farber Cancer Institute Boston, Boston; Hematology, Ohio State University Comprehensive Cancer Center, Columbus; Oncology Clinical Research; Statistical and Quantitative Sciences; Takeda Development Center Americas, Inc. (TDCA), Lexington; Hematologic Malignancies and Bone Marrow Transplant Program, Abramson Cancer Center, University of Pennsylvania, Philadelphia, United States of America Background: Modakafusp alfa (TAK-573) is a first-in-class immunocytokine designed to deliver attenuated interferon alpha-2b to CD38+ cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "J.", "L.", "Kaufman", ",", "S.", "Atrash", ",", "S.", "A.", "Holstein", ",", "O.", "Nadeem", ",", "D", "Benson", ",", "K.", "Suryanarayan", ",", "Y.", "Liu", ",", "C.", "Li", ",", "L.", "Yang", ",", "X.", "Parot", ",", "D.", "T.", "Vogl", "Winship", "Cancer", "Institute", "of", "Emory", "University", ",", "Atlanta", ";", "Haematology", "and", "blood", "disorders", ",", "Levine", "Cancer", "Institute", ",", "Charlotte", ";", "University", "of", "Nebraska", "Medical", "Center", ",", "Omaha", ";", "Dana-Farber", "Cancer", "Institute", "Boston", ",", "Boston", ";", "Hematology", ",", "Ohio", "State", "University", "Comprehensive", "Cancer", "Center", ",", "Columbus", ";", "Oncology", "Clinical", "Research", ";", "Statistical", "and", "Quantitative", "Sciences", ";", "Takeda", "Development", "Center", "Americas", ",", "Inc.", "(", "TDCA", ")", ",", "Lexington", ";", "Hematologic", "Malignancies", "and", "Bone", "Marrow", "Transplant", "Program", ",", "Abramson", "Cancer", "Center", ",", "University", "of", "Pennsylvania", ",", "Philadelphia", ",", "United", "States", "of", "America", "Background", ":", "Modakafusp", "alfa", "(", "TAK-573", ")", "is", "a", "first-in-class", "immunocytokine", "designed", "to", "deliver", "attenuated", "interferon", "alpha-2b", "to", "CD38", "+", "cells", "." ] } ]
PMC11155445
This activity was due to the interaction of transition metal with the thiol (–SH) group of enzymes, leading to deactivation of enzymes (Fig. 21).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "activity", "was", "due", "to", "the", "interaction", "of", "transition", "metal", "with", "the", "thiol", "(", "–SH", ")", "group", "of", "enzymes", ",", "leading", "to", "deactivation", "of", "enzymes", "(", "Fig.", "21", ")", "." ] } ]
PMC9841531
Particularly, the functional 3-BP cell viability assay that was used within our work is such a new assay that has not found its way into broad experimental use yet.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Particularly", ",", "the", "functional", "3-BP", "cell", "viability", "assay", "that", "was", "used", "within", "our", "work", "is", "such", "a", "new", "assay", "that", "has", "not", "found", "its", "way", "into", "broad", "experimental", "use", "yet", "." ] } ]
PMC11740399
3025@ML + OXA treated T24 and 5637 cells showed that combination therapy significantly reduced cell viability and increased cell death rate.
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "3025@ML", "+", "OXA", "treated", "T24", "and", "5637", "cells", "showed", "that", "combination", "therapy", "significantly", "reduced", "cell", "viability", "and", "increased", "cell", "death", "rate", "." ] } ]
PMC11173119
The disease is mainly caused by recessively inherited mutations in MEFV, which encodes pyrin protein, which plays an important role in inflammatory processes .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "disease", "is", "mainly", "caused", "by", "recessively", "inherited", "mutations", "in", "MEFV", ",", "which", "encodes", "pyrin", "protein", ",", "which", "plays", "an", "important", "role", "in", "inflammatory", "processes", "." ] } ]
PMC7961460
Because of the limited information available on this protein in the literature, further bioinformatics research was performed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Because", "of", "the", "limited", "information", "available", "on", "this", "protein", "in", "the", "literature", ",", "further", "bioinformatics", "research", "was", "performed", "." ] } ]
PMC9672323
In this study, dexamethasone downregulated 72% of the genes encoding the mitochondrial respiratory chain, and 29% of the genes related to antioxidant enzymes, with no effect on cell viability.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "study", ",", "dexamethasone", "downregulated", "72", "%", "of", "the", "genes", "encoding", "the", "mitochondrial", "respiratory", "chain", ",", "and", "29", "%", "of", "the", "genes", "related", "to", "antioxidant", "enzymes", ",", "with", "no", "effect", "on", "cell", "viability", "." ] } ]
PMC9429973
The primary endpoint is ORR by IRC assessment using the Lugano 2014 criteria; efficacy is assessed in all pts that received at least 1 dose of DUV.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "primary", "endpoint", "is", "ORR", "by", "IRC", "assessment", "using", "the", "Lugano", "2014", "criteria", ";", "efficacy", "is", "assessed", "in", "all", "pts", "that", "received", "at", "least", "1", "dose", "of", "DUV", "." ] } ]
PMC10914904
For instance, this protein is essential for controlling lymphocyte differentiation, signaling, and chemotaxis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "instance", ",", "this", "protein", "is", "essential", "for", "controlling", "lymphocyte", "differentiation", ",", "signaling", ",", "and", "chemotaxis", "." ] } ]
PMC11143482
It has been observed that after several days of cancer cell inoculation, the mice exhibited difficulty in walking and not moving much as the size of the tumour getting bigger.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "observed", "that", "after", "several", "days", "of", "cancer", "cell", "inoculation", ",", "the", "mice", "exhibited", "difficulty", "in", "walking", "and", "not", "moving", "much", "as", "the", "size", "of", "the", "tumour", "getting", "bigger", "." ] } ]
PMC11531744
Details of the steps were summarized in Fig. 1 through a flowchart.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Details", "of", "the", "steps", "were", "summarized", "in", "Fig.", "1", "through", "a", "flowchart", "." ] } ]
PMC11585587
The Pharm Mapper database (http://lilab-ecust.cn/pharmmapper/index.html) and Swiss Target Prediction database (http://swisstargetprediction.ch/) were consulted to predict RA targets, and repeats between the two databases were deleted.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Pharm", "Mapper", "database", "(", "http://lilab-ecust.cn/pharmmapper/index.html", ")", "and", "Swiss", "Target", "Prediction", "database", "(", "http://swisstargetprediction.ch/", ")", "were", "consulted", "to", "predict", "RA", "targets", ",", "and", "repeats", "between", "the", "two", "databases", "were", "deleted", "." ] } ]
PMC11711935
Senescent fibroblasts are the prominent participants in the sustained activation of melanocytes, which may lead to increased pigmentation in photoaging colored skin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Senescent", "fibroblasts", "are", "the", "prominent", "participants", "in", "the", "sustained", "activation", "of", "melanocytes", ",", "which", "may", "lead", "to", "increased", "pigmentation", "in", "photoaging", "colored", "skin", "." ] } ]
PMC11772449
Through the retrieval and analysis of the existing data in the Ualcan database website, we found that the mRNA level of p38γ synthetic gene in liver cancer tissues was higher than that in normal tissues, and the survival time of patients with high expression of p38γ was significantly different from that of patients with medium/low expression (Fig. 1 E, F).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Through", "the", "retrieval", "and", "analysis", "of", "the", "existing", "data", "in", "the", "Ualcan", "database", "website", ",", "we", "found", "that", "the", "mRNA", "level", "of", "p38γ", "synthetic", "gene", "in", "liver", "cancer", "tissues", "was", "higher", "than", "that", "in", "normal", "tissues", ",", "and", "the", "survival", "time", "of", "patients", "with", "high", "expression", "of", "p38γ", "was", "significantly", "different", "from", "that", "of", "patients", "with", "medium/low", "expression", "(", "Fig.", "1", "E", ",", "F", ")", "." ] } ]
PMC11342785
Scale bar represents 20 μm.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bar", "represents", "20", "μm", "." ] } ]
PMC11770130
Ceramide is a kind of lipid with diverse biological functions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ceramide", "is", "a", "kind", "of", "lipid", "with", "diverse", "biological", "functions", "." ] } ]
PMC7802142
b The skin thickness, c bulb diameter and d anagen follicle were measured in H&E-stained sections.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "b", "The", "skin", "thickness", ",", "c", "bulb", "diameter", "and", "d", "anagen", "follicle", "were", "measured", "in", "H&E-stained", "sections", "." ] } ]
PMC10747160
The Petri dishes or 6-well plates were returned to the humidified incubator, and lentiviral pseudotyping vectors were prepared as described by Crawford et al., 2020 .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Petri", "dishes", "or", "6-well", "plates", "were", "returned", "to", "the", "humidified", "incubator", ",", "and", "lentiviral", "pseudotyping", "vectors", "were", "prepared", "as", "described", "by", "Crawford", "et", "al.", ",", "2020", "." ] } ]
PMC11755624
IL-22 also induces the expression of the lncRNA MALAT1, which acts through miR-330-5p and SMAD7 to induce keratinocyte proliferation .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "IL-22", "also", "induces", "the", "expression", "of", "the", "lncRNA", "MALAT1", ",", "which", "acts", "through", "miR-330", "-", "5p", "and", "SMAD7", "to", "induce", "keratinocyte", "proliferation", "." ] } ]
PMC11634027
These phenotypes are shared by fat loss-of-function alleles or RNAi knockdown, but ds phenotypes are generally weaker than fat phenotypes (Bryant et al., 1988; Clark et al., 1995; Matakatsu and Blair, 2006).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "phenotypes", "are", "shared", "by", "fat", "loss-of-function", "alleles", "or", "RNAi", "knockdown", ",", "but", "ds", "phenotypes", "are", "generally", "weaker", "than", "fat", "phenotypes", "(", "Bryant", "et", "al.", ",", "1988", ";", "Clark", "et", "al.", ",", "1995", ";", "Matakatsu", "and", "Blair", ",", "2006", ")", "." ] } ]
PMC7709199
Initial refinement was performed in BUSTER (Blanc et al., 2004 ▸) using rigid-body refinement in the first macrocycle.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Initial", "refinement", "was", "performed", "in", "BUSTER", "(", "Blanc", "et", "al.", ",", "2004", "▸", ")", "using", "rigid-body", "refinement", "in", "the", "first", "macrocycle", "." ] } ]
PMC11781181
In addition, we validated the expression of ferroptosis genes through RNA-Seq and observed consistent trends (Fig. 2D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "we", "validated", "the", "expression", "of", "ferroptosis", "genes", "through", "RNA-Seq", "and", "observed", "consistent", "trends", "(", "Fig.", "2D", ")", "." ] } ]
PMC7841067
These data suggest that AKAP4 is involved in the carcinogenesis of thyroid cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "data", "suggest", "that", "AKAP4", "is", "involved", "in", "the", "carcinogenesis", "of", "thyroid", "cancer", "." ] } ]
PMC11441402
Suspension cells were centrifuged for 5 min at 1000 g to settle at the bottom of the plate before fixing with 80% (w/v) ice-cold TCA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Suspension", "cells", "were", "centrifuged", "for", "5", "min", "at", "1000", "g", "to", "settle", "at", "the", "bottom", "of", "the", "plate", "before", "fixing", "with", "80", "%", "(", "w/v", ")", "ice-cold", "TCA", "." ] } ]
PMC8348645
This study exhibited the inhibition of the HepG2 cell proliferation due to the upregulation of the BAX gene and decreased BCl2 gene expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "study", "exhibited", "the", "inhibition", "of", "the", "HepG2", "cell", "proliferation", "due", "to", "the", "upregulation", "of", "the", "BAX", "gene", "and", "decreased", "BCl2", "gene", "expression", "." ] } ]
PMC3813807
A more direct link between miRNA function and oncogenesis is supported by studies examining the expression of miRNAs in clinical samples (18–21).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "more", "direct", "link", "between", "miRNA", "function", "and", "oncogenesis", "is", "supported", "by", "studies", "examining", "the", "expression", "of", "miRNAs", "in", "clinical", "samples", "(", "18–21", ")", "." ] } ]
PMC11092382
Sophocarpine (C15H22N2O, CAS No. 145572-44-7) (Figure 1), also known as 13,14-didehydromatridin-15-one, is a tetracyclic matrine-type quinolizidine alkaloid found in Sophora flavescens Ait.,
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sophocarpine", "(", "C15H22N2O", ",", "CAS", "No.", "145572", "-", "44", "-", "7", ")", "(", "Figure", "1", ")", ",", "also", "known", "as", "13,14-didehydromatridin-15-one", ",", "is", "a", "tetracyclic", "matrine-type", "quinolizidine", "alkaloid", "found", "in", "Sophora", "flavescens", "Ait", ".", "," ] } ]
PMC11697065
Finally, cell pellets were resuspended in 1 ml of 1 % BSA in DPBS and 200 μL of each sample were transferred into a Nunc™ 96-Well polypropylene microplate (ThermoFisher Scientific, USA,Cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "cell", "pellets", "were", "resuspended", "in", "1", "ml", "of", "1", "%", "BSA", "in", "DPBS", "and", "200", "μL", "of", "each", "sample", "were", "transferred", "into", "a", "Nunc", "™", "96-Well", "polypropylene", "microplate", "(", "ThermoFisher", "Scientific", ",", "USA", ",", "Cat", "." ] } ]
PMC11679326
Using synthetic bioengineering techniques, MytiLec was used to construct a Mitsuba-1 lectin consisting of three identical carbohydrate-recognizing subdomains that specifically labeled Burkitt’s lymphoma Raji cells expressing Gb3 without affecting cell viability .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "synthetic", "bioengineering", "techniques", ",", "MytiLec", "was", "used", "to", "construct", "a", "Mitsuba-1", "lectin", "consisting", "of", "three", "identical", "carbohydrate-recognizing", "subdomains", "that", "specifically", "labeled", "Burkitt", "’s", "lymphoma", "Raji", "cells", "expressing", "Gb3", "without", "affecting", "cell", "viability", "." ] } ]
PMC10222971
Flow cytometry analysis under these optimal conditions for derivative 3 is shown in Figure 7.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Flow", "cytometry", "analysis", "under", "these", "optimal", "conditions", "for", "derivative", "3", "is", "shown", "in", "Figure", "7", "." ] } ]
PMC9960565
The H, C, and ⁹⁵Pt-NMR characterization were performed in a Bruker Avance II+ UltraShield 400 Plus Ultra Long Hold NMR spectrometer equipment at room temperature, using a 5 mm BBO multinuclear probe.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "H", ",", "C", ",", "and", "⁹⁵Pt-NMR", "characterization", "were", "performed", "in", "a", "Bruker", "Avance", "II+", "UltraShield", "400", "Plus", "Ultra", "Long", "Hold", "NMR", "spectrometer", "equipment", "at", "room", "temperature", ",", "using", "a", "5", "mm", "BBO", "multinuclear", "probe", "." ] } ]
PMC6379402
The empirical probability of observing k or more functional domains in an iCell by chance is defined as:17[12pt] $$p = }},$$=r+1n+1,where r is the number of randomized replicates which resulted in k or more functional domains.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "empirical", "probability", "of", "observing", "k", "or", "more", "functional", "domains", "in", "an", "iCell", "by", "chance", "is", "defined", "as:17[12pt", "]", "$", "$", "p", "=", "}", "}", ",", "$", "$", "=", "r+1n+1,where", "r", "is", "the", "number", "of", "randomized", "replicates", "which", "resulted", "in", "k", "or", "more", "functional", "domains", "." ] } ]
PMC11536589
Statistical analyses were performed using R version 4.0.2 (Vienna, Austria) or GraphPad Prism 8 (GraphPad, La Jolla, CA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "analyses", "were", "performed", "using", "R", "version", "4.0.2", "(", "Vienna", ",", "Austria", ")", "or", "GraphPad", "Prism", "8", "(", "GraphPad", ",", "La", "Jolla", ",", "CA", ")", "." ] } ]
PMC5311252
Importantly, all seven TS targets discussed here were found to inversely correlate with oncomotif-miRNA expression in LUAD (Figure 7a).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Importantly", ",", "all", "seven", "TS", "targets", "discussed", "here", "were", "found", "to", "inversely", "correlate", "with", "oncomotif-miRNA", "expression", "in", "LUAD", "(", "Figure", "7a", ")", "." ] } ]
PMC11750165
Upon coexpression of PEX1 with J2ICD, PEX1 was found to colocalize with J2ICD in P19 cells to a much higher extent than obtained upon coexpression of Flag-PEX1 with Myc-J2 in Cos cells (Fig. 2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Upon", "coexpression", "of", "PEX1", "with", "J2ICD", ",", "PEX1", "was", "found", "to", "colocalize", "with", "J2ICD", "in", "P19", "cells", "to", "a", "much", "higher", "extent", "than", "obtained", "upon", "coexpression", "of", "Flag-PEX1", "with", "Myc-J2", "in", "Cos", "cells", "(", "Fig.", "2", ")", "." ] } ]
PMC11300639
Overexpression of CDK4 increased the interaction between TSC1 and RNF26 (Fig. 2i), but CDK4 depletion or palbociclib treatment reduced this interaction (Fig. 2j, k).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Overexpression", "of", "CDK4", "increased", "the", "interaction", "between", "TSC1", "and", "RNF26", "(", "Fig.", "2i", ")", ",", "but", "CDK4", "depletion", "or", "palbociclib", "treatment", "reduced", "this", "interaction", "(", "Fig.", "2j", ",", "k", ")", "." ] } ]
PMC8414691
RNAi-mediated depletion of SRCAP was performed by double transfection (24 h + 48 h after seeding) with (i) a specific siRNA mix called SRCAP A (CCAGUUCCCUGACUUAAGATT + GGAUGGAUCUACUAGAGUUTT) targeting SRCAP transcripts at sequences CCAGTTCCCTGACTTAAGA and GGATGGATCTACTAGAGTT (sc-93293, Santa Cruz Biotechnology) and (ii) a single siRNA called SRCAP B (GCGUGAUGUUGAACUGGGAGAUGGA) targeting SRCAP transcript at sequence GCGTGATGTTGAACTGGGAGATGGA, already validated by Moreno-Andres et al. .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RNAi-mediated", "depletion", "of", "SRCAP", "was", "performed", "by", "double", "transfection", "(", "24", "h", "+", "48", "h", "after", "seeding", ")", "with", "(", "i", ")", "a", "specific", "siRNA", "mix", "called", "SRCAP", "A", "(", "CCAGUUCCCUGACUUAAGATT", "+", "GGAUGGAUCUACUAGAGUUTT", ")", "targeting", "SRCAP", "transcripts", "at", "sequences", "CCAGTTCCCTGACTTAAGA", "and", "GGATGGATCTACTAGAGTT", "(", "sc-93293", ",", "Santa", "Cruz", "Biotechnology", ")", "and", "(", "ii", ")", "a", "single", "siRNA", "called", "SRCAP", "B", "(", "GCGUGAUGUUGAACUGGGAGAUGGA", ")", "targeting", "SRCAP", "transcript", "at", "sequence", "GCGTGATGTTGAACTGGGAGATGGA", ",", "already", "validated", "by", "Moreno-Andres", "et", "al.", "." ] } ]
PMC11747885
Our results showed that inhibitor-treated cells exhibited significantly reduced viability for all tested compounds in the range of 15–60 μM inhibitor compared to cells without oxidative stress.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "results", "showed", "that", "inhibitor-treated", "cells", "exhibited", "significantly", "reduced", "viability", "for", "all", "tested", "compounds", "in", "the", "range", "of", "15–60", "μM", "inhibitor", "compared", "to", "cells", "without", "oxidative", "stress", "." ] } ]
PMC9429973
Results: In HL60, double inhibition during 48h of Hedgehog and Notch with 15 nM Glasdegib + 5 nM Nirogacestat reduced quiescent state in 67.27% compared with DMSO.
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "In", "HL60", ",", "double", "inhibition", "during", "48h", "of", "Hedgehog", "and", "Notch", "with", "15", "nM", "Glasdegib", "+", "5", "nM", "Nirogacestat", "reduced", "quiescent", "state", "in", "67.27", "%", "compared", "with", "DMSO", "." ] } ]
PMC11727000
Briefly, the beads were resuspended in a solution containing 8 M urea, 50 mM ammonium bicarbonate, and 10 mM tris(2-carboxyethyl)phosphine (TCEP).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "the", "beads", "were", "resuspended", "in", "a", "solution", "containing", "8", "M", "urea", ",", "50", "mM", "ammonium", "bicarbonate", ",", "and", "10", "mM", "tris(2-carboxyethyl)phosphine", "(", "TCEP", ")", "." ] } ]
PMC11767793
Such identification does not imply recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that the materials or equipment identified are necessarily the best available for the purpose.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Such", "identification", "does", "not", "imply", "recommendation", "or", "endorsement", "by", "the", "National", "Institute", "of", "Standards", "and", "Technology", ",", "nor", "does", "it", "imply", "that", "the", "materials", "or", "equipment", "identified", "are", "necessarily", "the", "best", "available", "for", "the", "purpose", "." ] } ]
PMC9388315
The cells were cultured in RPMI1640 (Gibco RL, Grand Island, NY) medium with 10% FBS (Gibco RL, Grand Island, NY), 20 mM HEPES, 2 mM glutamine, and 1% of penicillin-streptomycin in 37°C incubators under 5% CO2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "cultured", "in", "RPMI1640", "(", "Gibco", "RL", ",", "Grand", "Island", ",", "NY", ")", "medium", "with", "10", "%", "FBS", "(", "Gibco", "RL", ",", "Grand", "Island", ",", "NY", ")", ",", "20", "mM", "HEPES", ",", "2", "mM", "glutamine", ",", "and", "1", "%", "of", "penicillin-streptomycin", "in", "37", "°", "C", "incubators", "under", "5", "%", "CO2", "." ] } ]
PMC11786767
Figure 8A CDK1 inhibitor reduces Ki-67 phosphorylation, results in abnormal mitotic progression, and impairs microtubule organization and sister chromatin separation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Figure", "8A", "CDK1", "inhibitor", "reduces", "Ki-67", "phosphorylation", ",", "results", "in", "abnormal", "mitotic", "progression", ",", "and", "impairs", "microtubule", "organization", "and", "sister", "chromatin", "separation", "." ] } ]
PMC9429973
The regimen of rituximab, gemcitabine and oxaliplatin is used for the treatment of R/R DLBCL, which is recommend by current National Comprehensive Cancer Network guideline.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "regimen", "of", "rituximab", ",", "gemcitabine", "and", "oxaliplatin", "is", "used", "for", "the", "treatment", "of", "R/R", "DLBCL", ",", "which", "is", "recommend", "by", "current", "National", "Comprehensive", "Cancer", "Network", "guideline", "." ] } ]
PMC8922418
1Strategies for HIV-1/AIDS gene therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "1Strategies", "for", "HIV-1/AIDS", "gene", "therapy", "." ] } ]
PMC11699178
mRNA was enriched and fragmented using oligo(dT) magnetic beads (MS04T, Suzhou Walden Biotechnology Co., Ltd., Suzhou, China), followed by cDNA synthesis, adapter ligation, and PCR amplification.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "mRNA", "was", "enriched", "and", "fragmented", "using", "oligo(dT", ")", "magnetic", "beads", "(", "MS04", "T", ",", "Suzhou", "Walden", "Biotechnology", "Co.", ",", "Ltd.", ",", "Suzhou", ",", "China", ")", ",", "followed", "by", "cDNA", "synthesis", ",", "adapter", "ligation", ",", "and", "PCR", "amplification", "." ] } ]
PMC10976516
Deletion of ICP47 attenuates HSV virulence but this can be beneficial for the removal of infected tumor cells due to the more efficient presentation of tumor-associated antigens (TAAs) as we discuss below.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Deletion", "of", "ICP47", "attenuates", "HSV", "virulence", "but", "this", "can", "be", "beneficial", "for", "the", "removal", "of", "infected", "tumor", "cells", "due", "to", "the", "more", "efficient", "presentation", "of", "tumor-associated", "antigens", "(", "TAAs", ")", "as", "we", "discuss", "below", "." ] } ]
PMC11541241
The F. oxysporum mutant D122, which was disrupted in a BAH/PHD‐containing transcription factor SNT2, showed impaired pathogenicity in plants (Denisov et al., 2011).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "F.", "oxysporum", "mutant", "D122", ",", "which", "was", "disrupted", "in", "a", "BAH/PHD‐containing", "transcription", "factor", "SNT2", ",", "showed", "impaired", "pathogenicity", "in", "plants", "(", "Denisov", "et", "al.", ",", "2011", ")", "." ] } ]
PMC9596868
B-C) Following co-treatment with different concentrations of luteolin and MST-312, percentage cell viability was determined using alamar blue assay in PA-1 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "B-C", ")", "Following", "co-treatment", "with", "different", "concentrations", "of", "luteolin", "and", "MST-312", ",", "percentage", "cell", "viability", "was", "determined", "using", "alamar", "blue", "assay", "in", "PA-1", "cells", "." ] } ]
PMC10728200
E Nomogram for predicting the probability of recurrence in patients with GIST.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "E", "Nomogram", "for", "predicting", "the", "probability", "of", "recurrence", "in", "patients", "with", "GIST", "." ] } ]
PMC9429973
As the risk of developing neoplasms in the general population is greater in the elderly, the development of cancer in these patients can be considered to be similar to that in the general population.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "the", "risk", "of", "developing", "neoplasms", "in", "the", "general", "population", "is", "greater", "in", "the", "elderly", ",", "the", "development", "of", "cancer", "in", "these", "patients", "can", "be", "considered", "to", "be", "similar", "to", "that", "in", "the", "general", "population", "." ] } ]
PMC11755467
Several groups reported a selective modulation of the host miRNAs upon HIV-1 infection.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Several", "groups", "reported", "a", "selective", "modulation", "of", "the", "host", "miRNAs", "upon", "HIV-1", "infection", "." ] } ]
PMC11216402
All of the 10 STAD ATAC samples with more than 10,000 distal peaks and AUROC > 0.9 detect some activation of RUNX or AP-1 when trained against normal stomach DNase-seq (ENCODE: ENCSR782SSS): Seven detect AP-1 (TCGA.CD.A48C, TCGA.VQ.A94O, TCGA.VQ.A8PJ, TCGA.BR.A4J6, TCGA.BR.A4CS, TCGA.HF.A5NB, TCGA.BR.A4J4), and seven detect RUNX (TCGA.VQ.A94O, TCGA.VQ.A91W, TCGA.BR.A4J6, TCGA.BR.A4IY, TCGA.HF.A5NB, TCGA.BR.A4J4, TCGA.CD.A486) (Supplemental Fig. S5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "of", "the", "10", "STAD", "ATAC", "samples", "with", "more", "than", "10,000", "distal", "peaks", "and", "AUROC", ">", "0.9", "detect", "some", "activation", "of", "RUNX", "or", "AP-1", "when", "trained", "against", "normal", "stomach", "DNase-seq", "(", "ENCODE", ":", "ENCSR782SSS", "):", "Seven", "detect", "AP-1", "(", "TCGA.CD.A48C", ",", "TCGA.VQ.A94O", ",", "TCGA.VQ.A8PJ", ",", "TCGA.BR.A4J6", ",", "TCGA.BR.A4CS", ",", "TCGA.HF.A5NB", ",", "TCGA.BR.A4J4", ")", ",", "and", "seven", "detect", "RUNX", "(", "TCGA.VQ.A94O", ",", "TCGA.VQ.A91W", ",", "TCGA.BR.A4J6", ",", "TCGA.BR.A4IY", ",", "TCGA.HF.A5NB", ",", "TCGA.BR.A4J4", ",", "TCGA.CD.A486", ")", "(", "Supplemental", "Fig.", "S5", ")", "." ] } ]
PMC9412887
More importantly, the loss of PTEN expression has been shown to down-regulate autophagy , which can effectively support tumor development.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "More", "importantly", ",", "the", "loss", "of", "PTEN", "expression", "has", "been", "shown", "to", "down-regulate", "autophagy", ",", "which", "can", "effectively", "support", "tumor", "development", "." ] } ]
PMC11342785
Mean (points) and SEM (error bars) of three replicate bundling experiments for each TPPP concentration is shown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mean", "(", "points", ")", "and", "SEM", "(", "error", "bars", ")", "of", "three", "replicate", "bundling", "experiments", "for", "each", "TPPP", "concentration", "is", "shown", "." ] } ]
PMC9046263
Outliers were filtered using the R package survbootOutliers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Outliers", "were", "filtered", "using", "the", "R", "package", "survbootOutliers", "." ] } ]
PMC11228511
Mean ± SEM. ***
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mean", "±", "SEM", ".", "*", "*", "*" ] } ]
PMC11266100
Also, the extent and localization of metastases (Figure 7; third mouse on the right-hand side) can be characterized both quantitatively (intensity of luminescence) and qualitatively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Also", ",", "the", "extent", "and", "localization", "of", "metastases", "(", "Figure", "7", ";", "third", "mouse", "on", "the", "right-hand", "side", ")", "can", "be", "characterized", "both", "quantitatively", "(", "intensity", "of", "luminescence", ")", "and", "qualitatively", "." ] } ]
PMC9910796
Polyprotein pp62 was detected both in the nucleus and a variety of cytoplasmic compartments (ER, nuclear envelope, Golgi, mitochondria, PM) (Figs 5B and 6C S7B Fig), which suggests that it possesses an intrinsic capacity to bind lipid membranes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Polyprotein", "pp62", "was", "detected", "both", "in", "the", "nucleus", "and", "a", "variety", "of", "cytoplasmic", "compartments", "(", "ER", ",", "nuclear", "envelope", ",", "Golgi", ",", "mitochondria", ",", "PM", ")", "(", "Figs", "5B", "and", "6C", "S7B", "Fig", ")", ",", "which", "suggests", "that", "it", "possesses", "an", "intrinsic", "capacity", "to", "bind", "lipid", "membranes", "." ] } ]
PMC11803918
The cytolytic molecules, such as granzyme A, granzyme B, perforin, and granulysin from γδ-T exosomes, induced specific apoptosis of cancer cells without harming normal cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cytolytic", "molecules", ",", "such", "as", "granzyme", "A", ",", "granzyme", "B", ",", "perforin", ",", "and", "granulysin", "from", "γδ-T", "exosomes", ",", "induced", "specific", "apoptosis", "of", "cancer", "cells", "without", "harming", "normal", "cells", "." ] } ]
PMC11656657
Stacked bar graphs show the analysis of T Naïve (striped white bars), TCM (dark grey bars), TEM (light grey bars) and TEMRA (black bars) CD3 + subsets in the long-term “stressed” co-culture with NT T-cells F or CAR.GD2 T-cells G. The panel H shows the experimental design of “stressed” co-culture.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Stacked", "bar", "graphs", "show", "the", "analysis", "of", "T", "Naïve", "(", "striped", "white", "bars", ")", ",", "TCM", "(", "dark", "grey", "bars", ")", ",", "TEM", "(", "light", "grey", "bars", ")", "and", "TEMRA", "(", "black", "bars", ")", "CD3", "+", "subsets", "in", "the", "long-term", "“", "stressed", "”", "co-culture", "with", "NT", "T-cells", "F", "or", "CAR.GD2", "T-cells", "G.", "The", "panel", "H", "shows", "the", "experimental", "design", "of", "“", "stressed", "”", "co-culture", "." ] } ]
PMC10823017
ns indicates Not Significant, ** indicates P≤0.01, *** indicate P≤0.001).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ns", "indicates", "Not", "Significant", ",", "*", "*", "indicates", "P≤0.01", ",", "*", "*", "*", "indicate", "P≤0.001", ")", "." ] } ]
PMC11699042
Boxplots display the interquartile range and the mean, two-sided Wilcoxon signed-rank test.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Boxplots", "display", "the", "interquartile", "range", "and", "the", "mean", ",", "two-sided", "Wilcoxon", "signed-rank", "test", "." ] } ]
PMC11394730
Since then, numerous studies have shown its extensive prophylactic and curative benefits against a wide range of cancer types, including liver tumors, gastrointestinal tract, breast, lung, and prostate cancers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "then", ",", "numerous", "studies", "have", "shown", "its", "extensive", "prophylactic", "and", "curative", "benefits", "against", "a", "wide", "range", "of", "cancer", "types", ",", "including", "liver", "tumors", ",", "gastrointestinal", "tract", ",", "breast", ",", "lung", ",", "and", "prostate", "cancers", "." ] } ]
PMC3734024
The ability of B cells stimulated under these conditions to induce apoptosis in activated CD4 T cells was then assessed as in Figure 6.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "ability", "of", "B", "cells", "stimulated", "under", "these", "conditions", "to", "induce", "apoptosis", "in", "activated", "CD4", "T", "cells", "was", "then", "assessed", "as", "in", "Figure", "6", "." ] } ]
PMC11700247
The gene ontology analysis for a tumor treated with a single dose of 8 Gy revealed significant upregulation in genes associated with critical cellular processes such as the cell cycle, cell division, and DNA replication and repair, whereas treatment with 2 fractions of 4 Gy showed a distinct shift toward immune-related processes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "gene", "ontology", "analysis", "for", "a", "tumor", "treated", "with", "a", "single", "dose", "of", "8", "Gy", "revealed", "significant", "upregulation", "in", "genes", "associated", "with", "critical", "cellular", "processes", "such", "as", "the", "cell", "cycle", ",", "cell", "division", ",", "and", "DNA", "replication", "and", "repair", ",", "whereas", "treatment", "with", "2", "fractions", "of", "4", "Gy", "showed", "a", "distinct", "shift", "toward", "immune-related", "processes", "." ] } ]
PMC11787381
Using MTDL has emerged as a promising strategy among these approaches.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "MTDL", "has", "emerged", "as", "a", "promising", "strategy", "among", "these", "approaches", "." ] } ]
PMC10605143
Human HSF1 coding sequence was amplified by PCR on the template of the hHSF1-pLNCX2 vector .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Human", "HSF1", "coding", "sequence", "was", "amplified", "by", "PCR", "on", "the", "template", "of", "the", "hHSF1-pLNCX2", "vector", "." ] } ]
PMC9874064
The statistical graphs of apoptotic cell areas by Image J of the 3D cell tumor spheres.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "statistical", "graphs", "of", "apoptotic", "cell", "areas", "by", "Image", "J", "of", "the", "3D", "cell", "tumor", "spheres", "." ] } ]
PMC9429973
Among these five, three remain in remission with one in continued follow-up over 8 months.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Among", "these", "five", ",", "three", "remain", "in", "remission", "with", "one", "in", "continued", "follow-up", "over", "8", "months", "." ] } ]
PMC6461034
The labeled tube now contains the pooled lysate of all culture dishes with the same cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "labeled", "tube", "now", "contains", "the", "pooled", "lysate", "of", "all", "culture", "dishes", "with", "the", "same", "cells", "." ] } ]
PMC9429973
B. Alessandria, E. Genuardi, A. M. Civita, D. Drandi, B. Mantoan, M. Ferrante, M. Borriero, S. Ragaini, G. Bondielli, G. M. Zaccaria, D. Barbero, V. Peri, S. Hohaus, G. Musuraca, N. Cascavilla, C. Ghiggi, M. Tani, G. Gaidano, S. Volpetti, S. V. Usai, N. Di Renzo, S. Cortelazzo, M. Ladetto, S. Ferrero Department of Molecular Biotechnologies and Health Sciences, University of Torino; Città della Salute e della Scienza di Torino, Hematology Division, Torino; Unit of Hematology and Cell Therapy, IRCCS-Istituto Tumori ‘Giovanni Paolo II’, Bari; Dipartimento di Diagnostica per Immagini, Radioterapia Oncologica ed Ematologia, Fondazione Policlinico Universitario A. Gemelli, IRCCS; Dipartimento di Scienze Radiologiche ed Ematologiche, Università Cattolica del Sacro Cuore, Rome; IRCCS Istituto Romagnolo per lo Studio dei Tumori (IRST) “Dino Amadori”, Hematology unit, Meldola; IRCCS, Casa Sollievo della Sofferenza, Hematology Division, San Giovanni Rotondo; IRCCS San Martino, U.O. Ematologia e Terapie cellulari, Genova; UOC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B.", "Alessandria", ",", "E.", "Genuardi", ",", "A.", "M.", "Civita", ",", "D.", "Drandi", ",", "B.", "Mantoan", ",", "M.", "Ferrante", ",", "M.", "Borriero", ",", "S.", "Ragaini", ",", "G.", "Bondielli", ",", "G.", "M.", "Zaccaria", ",", "D.", "Barbero", ",", "V.", "Peri", ",", "S.", "Hohaus", ",", "G.", "Musuraca", ",", "N.", "Cascavilla", ",", "C.", "Ghiggi", ",", "M.", "Tani", ",", "G.", "Gaidano", ",", "S.", "Volpetti", ",", "S.", "V.", "Usai", ",", "N.", "Di", "Renzo", ",", "S.", "Cortelazzo", ",", "M.", "Ladetto", ",", "S.", "Ferrero", "Department", "of", "Molecular", "Biotechnologies", "and", "Health", "Sciences", ",", "University", "of", "Torino", ";", "Città", "della", "Salute", "e", "della", "Scienza", "di", "Torino", ",", "Hematology", "Division", ",", "Torino", ";", "Unit", "of", "Hematology", "and", "Cell", "Therapy", ",", "IRCCS-Istituto", "Tumori", "‘", "Giovanni", "Paolo", "II", "’", ",", "Bari", ";", "Dipartimento", "di", "Diagnostica", "per", "Immagini", ",", "Radioterapia", "Oncologica", "ed", "Ematologia", ",", "Fondazione", "Policlinico", "Universitario", "A.", "Gemelli", ",", "IRCCS", ";", "Dipartimento", "di", "Scienze", "Radiologiche", "ed", "Ematologiche", ",", "Università", "Cattolica", "del", "Sacro", "Cuore", ",", "Rome", ";", "IRCCS", "Istituto", "Romagnolo", "per", "lo", "Studio", "dei", "Tumori", "(", "IRST", ")", "“", "Dino", "Amadori", "”", ",", "Hematology", "unit", ",", "Meldola", ";", "IRCCS", ",", "Casa", "Sollievo", "della", "Sofferenza", ",", "Hematology", "Division", ",", "San", "Giovanni", "Rotondo", ";", "IRCCS", "San", "Martino", ",", "U.O.", "Ematologia", "e", "Terapie", "cellulari", ",", "Genova", ";", "UOC", "." ] } ]
PMC11765243
The β-tubulin gene was used as an internal control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "β-tubulin", "gene", "was", "used", "as", "an", "internal", "control", "." ] } ]
PMC8633974
To test the hypothesis that conserved gRNAs would most effectively limit viral replication, a plasmid co-transfection screen was implemented.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "test", "the", "hypothesis", "that", "conserved", "gRNAs", "would", "most", "effectively", "limit", "viral", "replication", ",", "a", "plasmid", "co-transfection", "screen", "was", "implemented", "." ] } ]
PMC11679326
However, this appears in gliomas after the initiation of O-glycosylation, so complete elongation of O-glycans does not occur, resulting in the formation of so-called truncated O-glycans.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "this", "appears", "in", "gliomas", "after", "the", "initiation", "of", "O-glycosylation", ",", "so", "complete", "elongation", "of", "O-glycans", "does", "not", "occur", ",", "resulting", "in", "the", "formation", "of", "so-called", "truncated", "O-glycans", "." ] } ]
PMC11737091
Wound healing assays for 786-O and A498 cells after DBF4 was knocked down. *,
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Wound", "healing", "assays", "for", "786-O", "and", "A498", "cells", "after", "DBF4", "was", "knocked", "down", ".", "*", "," ] } ]
PMC11680578
The gels were then subjected to electrophoresis at 100 V until the marker proteins (BioRad Laboratories, USA) were separated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "gels", "were", "then", "subjected", "to", "electrophoresis", "at", "100", "V", "until", "the", "marker", "proteins", "(", "BioRad", "Laboratories", ",", "USA", ")", "were", "separated", "." ] } ]