PMCID
string
Sentences
string
ner
list
PMC11204465
One new compound was isolated from the secondary metabolites of an Aspergillus sp. fungus and identified as oxisterigmatocystin D (9) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "new", "compound", "was", "isolated", "from", "the", "secondary", "metabolites", "of", "an", "Aspergillus", "sp.", "fungus", "and", "identified", "as", "oxisterigmatocystin", "D", "(", "9", ")", "." ] } ]
PMC9910796
In the absence of pEP84R, core shell-like assemblies of unprocessed pp220 and pp62 precursors, termed zippers (z), attach to the cytosolic face of the PM (A) and endosomal-lysosomal membranes (B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "absence", "of", "pEP84R", ",", "core", "shell-like", "assemblies", "of", "unprocessed", "pp220", "and", "pp62", "precursors", ",", "termed", "zippers", "(", "z", ")", ",", "attach", "to", "the", "cytosolic", "face", "of", "the", "PM", "(", "A", ")", "and", "endosomal-lysosomal", "membranes", "(", "B", ")", "." ] } ]
PMC9429973
Median PLT recovery time was not significantly different between patients enrolled in this study and historical controls from our center (AML: median 20 days, p>0.1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Median", "PLT", "recovery", "time", "was", "not", "significantly", "different", "between", "patients", "enrolled", "in", "this", "study", "and", "historical", "controls", "from", "our", "center", "(", "AML", ":", "median", "20", "days", ",", "p>0.1", "." ] } ]
PMC11252553
treated with Taurine (100 µg.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "treated", "with", "Taurine", "(", "100", "µg", "." ] } ]
PMC11528603
After treatment time, cells were fixed in 4% paraformaldehyde (Scharlau, Spain) for 10 minutes and permeabilized with 0.05% Triton X100 (Pancreac AppliChem, Spain-Germany-Italia) for 5 minutes in a humid chamber at 37°C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "treatment", "time", ",", "cells", "were", "fixed", "in", "4", "%", "paraformaldehyde", "(", "Scharlau", ",", "Spain", ")", "for", "10", "minutes", "and", "permeabilized", "with", "0.05", "%", "Triton", "X100", "(", "Pancreac", "AppliChem", ",", "Spain-Germany-Italia", ")", "for", "5", "minutes", "in", "a", "humid", "chamber", "at", "37", "°", "C", "." ] } ]
PMC11538390
Statistical significance is determined by Student’s t test (two-tailed).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Statistical", "significance", "is", "determined", "by", "Student", "’s", "t", "test", "(", "two-tailed", ")", "." ] } ]
PMC11240448
We noted that even in the extreme case of highly noisy data with the added 50% noise (), there was no discernible change to the mean accuracy and the interquartile did not exceed 15% of the median (Supplementary Figure S7).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "noted", "that", "even", "in", "the", "extreme", "case", "of", "highly", "noisy", "data", "with", "the", "added", "50", "%", "noise", "(", ")", ",", "there", "was", "no", "discernible", "change", "to", "the", "mean", "accuracy", "and", "the", "interquartile", "did", "not", "exceed", "15", "%", "of", "the", "median", "(", "Supplementary", "Figure", "S7", ")", "." ] } ]
PMC9430052
Pts with active CNS involvement were excluded.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Pts", "with", "active", "CNS", "involvement", "were", "excluded", "." ] } ]
PMC9429973
In all, 113 patients (19.58%) had a vascular event during a median follow up of 94.3 months (range, 2.4-416.0).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "all", ",", "113", "patients", "(", "19.58", "%", ")", "had", "a", "vascular", "event", "during", "a", "median", "follow", "up", "of", "94.3", "months", "(", "range", ",", "2.4", "-", "416.0", ")", "." ] } ]
PMC8358006
In this study, we generated genome-wide maps of H3K27me3, H3K4me3, H3K27ac H3K4me1, and DNA methylation, as well as gene expression profiles in both normal (NE2) and cancer cell lines (KYSE450) of ESCC to investigate the role of the epigenetic alteration in oncogenesis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "study", ",", "we", "generated", "genome-wide", "maps", "of", "H3K27me3", ",", "H3K4me3", ",", "H3K27ac", "H3K4me1", ",", "and", "DNA", "methylation", ",", "as", "well", "as", "gene", "expression", "profiles", "in", "both", "normal", "(", "NE2", ")", "and", "cancer", "cell", "lines", "(", "KYSE450", ")", "of", "ESCC", "to", "investigate", "the", "role", "of", "the", "epigenetic", "alteration", "in", "oncogenesis", "." ] } ]
PMC11486946
For Fig. 1f and g, MSD at Δt = 500 ms was used.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "Fig.", "1f", "and", "g", ",", "MSD", "at", "Δt", "=", "500", "ms", "was", "used", "." ] } ]
PMC11470381
Add 1 mL of prewarmed post-nucleofection RPMI medium to the cuvettes containing nucleofected cells and let it stand for 2 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Add", "1", "mL", "of", "prewarmed", "post-nucleofection", "RPMI", "medium", "to", "the", "cuvettes", "containing", "nucleofected", "cells", "and", "let", "it", "stand", "for", "2", "min", "." ] } ]
PMC9960565
For total hemoglobin concentration in human blood assessment, a 250-fold dilution of blood was prepared in C reagent (in an amber bottle, cyanmethemoglobin (C) reagent was prepared by adding 50 mg potassium ferricyanide, 12.5 mg potassium cyanide, and 35 mg potassium dihydrogen phosphate to 250 mL of distilled water containing 250 µL Triton-X; pH was adjusted to 7.4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "total", "hemoglobin", "concentration", "in", "human", "blood", "assessment", ",", "a", "250-fold", "dilution", "of", "blood", "was", "prepared", "in", "C", "reagent", "(", "in", "an", "amber", "bottle", ",", "cyanmethemoglobin", "(", "C", ")", "reagent", "was", "prepared", "by", "adding", "50", "mg", "potassium", "ferricyanide", ",", "12.5", "mg", "potassium", "cyanide", ",", "and", "35", "mg", "potassium", "dihydrogen", "phosphate", "to", "250", "mL", "of", "distilled", "water", "containing", "250", "µL", "Triton-X", ";", "pH", "was", "adjusted", "to", "7.4", ")", "." ] } ]
PMC9429973
In contrast there was no reduction in new lymphoma diagnoses during or between lockdowns compared to 5 preceding years’ average (25 per quarter on average) Summary/Conclusion: The COVID pandemic led to around 1/4 reduction in new haem-onc diagnosis with the most significant impact occurring during times of national lockdown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", "there", "was", "no", "reduction", "in", "new", "lymphoma", "diagnoses", "during", "or", "between", "lockdowns", "compared", "to", "5", "preceding", "years", "’", "average", "(", "25", "per", "quarter", "on", "average", ")", "Summary/Conclusion", ":", "The", "COVID", "pandemic", "led", "to", "around", "1/4", "reduction", "in", "new", "haem-onc", "diagnosis", "with", "the", "most", "significant", "impact", "occurring", "during", "times", "of", "national", "lockdown", "." ] } ]
PMC11714165
LDH activity was measured at 490 nm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "LDH", "activity", "was", "measured", "at", "490", "nm", "." ] } ]
PMC11806106
The sYFP2 was inserted at four different positions in the ICL3: after M264, after L265, after S266, and after G267, and was enclosed by the restriction sides SacII and HpaI. The following primers were used (sequence 5’ → 3’): Sensor M264: fragment 1 fwd: GGAATTCACCATGGACAGCAGCACC; fragment 1 rev: CCCTTGCTCACCATCCGCGGCATGCGAACGCTCTTGAGT; YFP fwd: AGAGCGTTCGCATGCCGCGGATGGTGAGCAAGGGCGAG; YFP rev: TTGGAGCCCGATAGGTTAACCTTGTACAGCTCGTCCATGCC; fragment 2 fwd: ACGAGCTGTACAAGGTTAACCTATCGGGCTCCAAAGAAAAGGAC; fragment 2 rev: TCGCCCTTGCTCACACCGGTAGTGTTCTGACGGACTCGAGT; vector + mTurq fw: TCCGTCAGAACACTACCGGTGTGAGCAAGGG; vector + mTurq rev: TGCTGTCCATGGTGAATTCCACCACACTGGA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "sYFP2", "was", "inserted", "at", "four", "different", "positions", "in", "the", "ICL3", ":", "after", "M264", ",", "after", "L265", ",", "after", "S266", ",", "and", "after", "G267", ",", "and", "was", "enclosed", "by", "the", "restriction", "sides", "SacII", "and", "HpaI.", "The", "following", "primers", "were", "used", "(", "sequence", "5", "’", "→", "3", "’", "):", "Sensor", "M264", ":", "fragment", "1", "fwd", ":", "GGAATTCACCATGGACAGCAGCACC", ";", "fragment", "1", "rev", ":", "CCCTTGCTCACCATCCGCGGCATGCGAACGCTCTTGAGT", ";", "YFP", "fwd", ":", "AGAGCGTTCGCATGCCGCGGATGGTGAGCAAGGGCGAG", ";", "YFP", "rev", ":", "TTGGAGCCCGATAGGTTAACCTTGTACAGCTCGTCCATGCC", ";", "fragment", "2", "fwd", ":", "ACGAGCTGTACAAGGTTAACCTATCGGGCTCCAAAGAAAAGGAC", ";", "fragment", "2", "rev", ":", "TCGCCCTTGCTCACACCGGTAGTGTTCTGACGGACTCGAGT", ";", "vector", "+", "mTurq", "fw", ":", "TCCGTCAGAACACTACCGGTGTGAGCAAGGG", ";", "vector", "+", "mTurq", "rev", ":", "TGCTGTCCATGGTGAATTCCACCACACTGGA", "." ] } ]
PMC7642379
In addition, several HEK293 cell lines have been adapted to high-density suspension growth in serum-free medium, enabling large-scale cultivation and bioproduction in bioreactors.
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "several", "HEK293", "cell", "lines", "have", "been", "adapted", "to", "high-density", "suspension", "growth", "in", "serum-free", "medium", ",", "enabling", "large-scale", "cultivation", "and", "bioproduction", "in", "bioreactors", "." ] } ]
PMC10938336
The most prominent polyphenolic component is curcumin (diferuloylmethane), which has been isolated from the rhizomes of Curcuma longa by Vogel and Pelletier as early as 1815.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "most", "prominent", "polyphenolic", "component", "is", "curcumin", "(", "diferuloylmethane", ")", ",", "which", "has", "been", "isolated", "from", "the", "rhizomes", "of", "Curcuma", "longa", "by", "Vogel", "and", "Pelletier", "as", "early", "as", "1815", "." ] } ]
PMC11635519
Three most representative clusters extracted from the PepA3 (red) MD simulation bound to GLP-1R (pale cyan) are superimposed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Three", "most", "representative", "clusters", "extracted", "from", "the", "PepA3", "(", "red", ")", "MD", "simulation", "bound", "to", "GLP-1R", "(", "pale", "cyan", ")", "are", "superimposed", "." ] } ]
PMC11578343
Single‐cell suspensions were subsequently filtered with a 20 µm filter to remove cellular clumps and then placed on ice prior to being injected into prepared devices for measurement.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single‐cell", "suspensions", "were", "subsequently", "filtered", "with", "a", "20", "µm", "filter", "to", "remove", "cellular", "clumps", "and", "then", "placed", "on", "ice", "prior", "to", "being", "injected", "into", "prepared", "devices", "for", "measurement", "." ] } ]
PMC11708541
The recent advances in their synthesis have displayed innovative methodologies that enhance efficiency, selectivity, and yield, making these compounds more convenient for research and pharmaceutical applications.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "recent", "advances", "in", "their", "synthesis", "have", "displayed", "innovative", "methodologies", "that", "enhance", "efficiency", ",", "selectivity", ",", "and", "yield", ",", "making", "these", "compounds", "more", "convenient", "for", "research", "and", "pharmaceutical", "applications", "." ] } ]
PMC9019892
Briefly, the animals were housed in an air‐conditioned animal room at a temperature of 24 ± 2 °C and a relative humidity of 50 ± 10% in a specific pathogen‐free facility.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "the", "animals", "were", "housed", "in", "an", "air‐conditioned", "animal", "room", "at", "a", "temperature", "of", "24", "±", "2", "°", "C", "and", "a", "relative", "humidity", "of", "50", "±", "10", "%", "in", "a", "specific", "pathogen‐free", "facility", "." ] } ]
PMC9910796
Bars, 200 nm.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Bars", ",", "200", "nm", "." ] } ]
PMC11257988
Aredo et al. explored the impact of KRAS mutation and co-mutations in the prognosis of NSCLC patients and found that KRASG12D mutation was significantly associated with OS in multivariate analysis, and STK11 co-mutation was also significantly associated with OS .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aredo", "et", "al.", "explored", "the", "impact", "of", "KRAS", "mutation", "and", "co-mutations", "in", "the", "prognosis", "of", "NSCLC", "patients", "and", "found", "that", "KRASG12D", "mutation", "was", "significantly", "associated", "with", "OS", "in", "multivariate", "analysis", ",", "and", "STK11", "co-mutation", "was", "also", "significantly", "associated", "with", "OS", "." ] } ]
PMC11471157
In the present study, it was established that dried fish powder derived from Medaka fish is an effective culture carrier for spheroid cultures of both mammalian and fish cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "present", "study", ",", "it", "was", "established", "that", "dried", "fish", "powder", "derived", "from", "Medaka", "fish", "is", "an", "effective", "culture", "carrier", "for", "spheroid", "cultures", "of", "both", "mammalian", "and", "fish", "cells", "." ] } ]
PMC10976516
Hu et al.Attenuated NDV-HUJ strain derived from the original NDV B1 strainIntravenousNDV-HUJ was injected in a syngeneic model with metastasizing lung adenocarcinoma cell line 3LL-D122 as a subcutaneous and orthotopic lung transplant.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "I-CellLine", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hu", "et", "al.", "Attenuated", "NDV-HUJ", "strain", "derived", "from", "the", "original", "NDV", "B1", "strainIntravenousNDV-HUJ", "was", "injected", "in", "a", "syngeneic", "model", "with", "metastasizing", "lung", "adenocarcinoma", "cell", "line", "3LL-D122", "as", "a", "subcutaneous", "and", "orthotopic", "lung", "transplant", "." ] } ]
PMC10728200
H The prediction of the lysine site of ubiquitination of GPX4.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H", "The", "prediction", "of", "the", "lysine", "site", "of", "ubiquitination", "of", "GPX4", "." ] } ]
PMC11607764
Moreover, analysis of the PrognoScan database showed a significant correlation between PTBP1 expression and the poor prognosis for bladder transitional cell carcinoma, brain astrocytoma, breast cancer, lung adenocarcinoma, ovarian cancer and liposarcoma (Table S1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "analysis", "of", "the", "PrognoScan", "database", "showed", "a", "significant", "correlation", "between", "PTBP1", "expression", "and", "the", "poor", "prognosis", "for", "bladder", "transitional", "cell", "carcinoma", ",", "brain", "astrocytoma", ",", "breast", "cancer", ",", "lung", "adenocarcinoma", ",", "ovarian", "cancer", "and", "liposarcoma", "(", "Table", "S1", ")", "." ] } ]
PMC9917080
In our experiments, SeNPs and SeSo led to the increased expression of key ER stress genes in glioblastoma cells, which correlated with the increased expression of proapoptotic genes as well.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "our", "experiments", ",", "SeNPs", "and", "SeSo", "led", "to", "the", "increased", "expression", "of", "key", "ER", "stress", "genes", "in", "glioblastoma", "cells", ",", "which", "correlated", "with", "the", "increased", "expression", "of", "proapoptotic", "genes", "as", "well", "." ] } ]
PMC11472639
Notably, although the percentage increase was greater in our previous work, the absolute percentage of specific lysis was less when compared to the present study pre-exercise (6% vs. 19%, respectively) and post-exercise (14% vs 23%, respectively).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "although", "the", "percentage", "increase", "was", "greater", "in", "our", "previous", "work", ",", "the", "absolute", "percentage", "of", "specific", "lysis", "was", "less", "when", "compared", "to", "the", "present", "study", "pre-exercise", "(", "6", "%", "vs.", "19", "%", ",", "respectively", ")", "and", "post-exercise", "(", "14", "%", "vs", "23", "%", ",", "respectively", ")", "." ] } ]
PMC9031474
However, none of the components are used as a therapeutic agent or in a clinical trial so far.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "none", "of", "the", "components", "are", "used", "as", "a", "therapeutic", "agent", "or", "in", "a", "clinical", "trial", "so", "far", "." ] } ]
PMC11721096
The relative activity was displayed according to the ratio of the OD value of the sample to the blank control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relative", "activity", "was", "displayed", "according", "to", "the", "ratio", "of", "the", "OD", "value", "of", "the", "sample", "to", "the", "blank", "control", "." ] } ]
PMC10998613
The two excitation beams were microadjusted to ensure that they both illuminate the same spot of the flat, peripheral membrane area of the cell where the space between the apical and basal membranes is within a few hundred nanometers.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "two", "excitation", "beams", "were", "microadjusted", "to", "ensure", "that", "they", "both", "illuminate", "the", "same", "spot", "of", "the", "flat", ",", "peripheral", "membrane", "area", "of", "the", "cell", "where", "the", "space", "between", "the", "apical", "and", "basal", "membranes", "is", "within", "a", "few", "hundred", "nanometers", "." ] } ]
PMC2944824
Cells were seeded on poly-D-lysine -coated dishes at a density of 500 000 cells/cm2 and cultured in DMEM supplemented with 10% heat-inactivated fetal calf serum, 25 mm KCl, 0.5% (v/v) penicillin-streptomycin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "seeded", "on", "poly-D-lysine", "-coated", "dishes", "at", "a", "density", "of", "500", "000", "cells/cm2", "and", "cultured", "in", "DMEM", "supplemented", "with", "10", "%", "heat-inactivated", "fetal", "calf", "serum", ",", "25", "mm", "KCl", ",", "0.5", "%", "(", "v/v", ")", "penicillin-streptomycin", "." ] } ]
PMC9429973
Recurrence, even resistance to CART19 cell therapy, might be attributed to CAR-T cell dysfunction and suppressor cells in the microenvironment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Recurrence", ",", "even", "resistance", "to", "CART19", "cell", "therapy", ",", "might", "be", "attributed", "to", "CAR-T", "cell", "dysfunction", "and", "suppressor", "cells", "in", "the", "microenvironment", "." ] } ]
PMC11634027
Proximal (P) to distal (D) orientation is indicated. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Proximal", "(", "P", ")", "to", "distal", "(", "D", ")", "orientation", "is", "indicated", ".", "(" ] } ]
PMC11306331
Fig. 2Spatiotemporal control of condensate dissolution.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", "2Spatiotemporal", "control", "of", "condensate", "dissolution", "." ] } ]
PMC11756937
Approximately 7 days following the transduction for fibroblasts and 3 days following transduction for PBMCs, the cells were ready to be harvested and replated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Approximately", "7", "days", "following", "the", "transduction", "for", "fibroblasts", "and", "3", "days", "following", "transduction", "for", "PBMCs", ",", "the", "cells", "were", "ready", "to", "be", "harvested", "and", "replated", "." ] } ]
PMC11770130
e Schematic diagram of local NTS treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "e", "Schematic", "diagram", "of", "local", "NTS", "treatment", "." ] } ]
PMC9429973
Whole bone marrow from mice carrying a kinase-dead mutant of Cdk6 (Cdk6-K43M), Cdk6 knock-out (Cdk6-KO) or wildtype Cdk6 (Cdk6-WT) were retrovirally transduced with the BCR-ABL1 fusion gene.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Whole", "bone", "marrow", "from", "mice", "carrying", "a", "kinase-dead", "mutant", "of", "Cdk6", "(", "Cdk6-K43", "M", ")", ",", "Cdk6", "knock-out", "(", "Cdk6-KO", ")", "or", "wildtype", "Cdk6", "(", "Cdk6-WT", ")", "were", "retrovirally", "transduced", "with", "the", "BCR-ABL1", "fusion", "gene", "." ] } ]
PMC11122631
ECD spectra were computed using the parameters of B3LYP/6-311G++(d,p).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ECD", "spectra", "were", "computed", "using", "the", "parameters", "of", "B3LYP/6", "-", "311G++(d", ",", "p", ")", "." ] } ]
PMC11643491
Beyond cancer, this principle may also be applied to other areas of biomedical engineering, including tissue engineering and regenerative medicine, where cell deformation and particle uptake play critical roles in scaffolding, cell regeneration, and controlled delivery of bioactive molecules.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Beyond", "cancer", ",", "this", "principle", "may", "also", "be", "applied", "to", "other", "areas", "of", "biomedical", "engineering", ",", "including", "tissue", "engineering", "and", "regenerative", "medicine", ",", "where", "cell", "deformation", "and", "particle", "uptake", "play", "critical", "roles", "in", "scaffolding", ",", "cell", "regeneration", ",", "and", "controlled", "delivery", "of", "bioactive", "molecules", "." ] } ]
PMC5716223
Differentiation medium (DM) containing 2% FBS was utilized in 85%—confluent cells to induce myotubes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Differentiation", "medium", "(", "DM", ")", "containing", "2", "%", "FBS", "was", "utilized", "in", "85%—confluent", "cells", "to", "induce", "myotubes", "." ] } ]
PMC11802929
Number of cells: Naive (n = 68), CM (n = 133), Hybrid (n = 43), EM (n = 93), Cytotoxic (n = 384).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Number", "of", "cells", ":", "Naive", "(", "n", "=", "68", ")", ",", "CM", "(", "n", "=", "133", ")", ",", "Hybrid", "(", "n", "=", "43", ")", ",", "EM", "(", "n", "=", "93", ")", ",", "Cytotoxic", "(", "n", "=", "384", ")", "." ] } ]
PMC11788920
TracrRNA and crRNA of the c-Myc system were in vitro transcribed from T7 promoter containing template DNA by using T7 RNAP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "TracrRNA", "and", "crRNA", "of", "the", "c-Myc", "system", "were", "in", "vitro", "transcribed", "from", "T7", "promoter", "containing", "template", "DNA", "by", "using", "T7", "RNAP", "." ] } ]
PMC10988555
Western Blot bands used for the quantification of proteins BAX and BCL-2 in A2780 cells after their exposure to complexes 2–4 or DMSO.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Western", "Blot", "bands", "used", "for", "the", "quantification", "of", "proteins", "BAX", "and", "BCL-2", "in", "A2780", "cells", "after", "their", "exposure", "to", "complexes", "2–4", "or", "DMSO", "." ] } ]
PMC9429973
Further, we depleted AML cells of different snoRNA loci by CRISPR/Cas9-based knock-out and performed lentiviral rescue overexpression of the respective sdRNA or full-length snoRNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", ",", "we", "depleted", "AML", "cells", "of", "different", "snoRNA", "loci", "by", "CRISPR/Cas9-based", "knock-out", "and", "performed", "lentiviral", "rescue", "overexpression", "of", "the", "respective", "sdRNA", "or", "full-length", "snoRNA", "." ] } ]
PMC11342785
Our approach is based on the established “OptoDroplets” system for optically triggering condensation of Cry2-IDR fusion proteins in living cells (41, 42).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "approach", "is", "based", "on", "the", "established", "“", "OptoDroplets", "”", "system", "for", "optically", "triggering", "condensation", "of", "Cry2-IDR", "fusion", "proteins", "in", "living", "cells", "(", "41", ",", "42", ")", "." ] } ]
PMC9429973
There were strong correlations between the 2 questionnaires.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "There", "were", "strong", "correlations", "between", "the", "2", "questionnaires", "." ] } ]
PMC8414691
SRCAP staining clearly decorated the isolated midbodies and overlapped with that of α-Tubulin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SRCAP", "staining", "clearly", "decorated", "the", "isolated", "midbodies", "and", "overlapped", "with", "that", "of", "α-Tubulin", "." ] } ]
PMC8701144
The established impact of E1B-55k on both the cytoplasmic localization of key components of the WNT/β-catenin pathway and on the activity of WNT/β-catenin signaling in HEK293 cells asks for caution in the interpretation of data derived from this standard WNT signaling workhorse cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "established", "impact", "of", "E1B-55k", "on", "both", "the", "cytoplasmic", "localization", "of", "key", "components", "of", "the", "WNT/β-catenin", "pathway", "and", "on", "the", "activity", "of", "WNT/β-catenin", "signaling", "in", "HEK293", "cells", "asks", "for", "caution", "in", "the", "interpretation", "of", "data", "derived", "from", "this", "standard", "WNT", "signaling", "workhorse", "cell", "line", "." ] } ]
PMC8345486
In combination treatment, it was found that compound 23 significantly increased the cytotoxic effect of cisplatin on cells, regardless of cisplatin sensitivity (decrease in cell viability to 26 ± 3.9% in A2780, p < 0.001; 46 ± 3.1% in A2780cis, p < 0.001; 42 ± 2.1% in A2780cisR, p < 0.001; 22 ± 1.5% in SKOV-3, p < 0.001; the RLU values are shown in Figure S13A, Supplementary Materials).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "combination", "treatment", ",", "it", "was", "found", "that", "compound", "23", "significantly", "increased", "the", "cytotoxic", "effect", "of", "cisplatin", "on", "cells", ",", "regardless", "of", "cisplatin", "sensitivity", "(", "decrease", "in", "cell", "viability", "to", "26", "±", "3.9", "%", "in", "A2780", ",", "p", "<", "0.001", ";", "46", "±", "3.1", "%", "in", "A2780cis", ",", "p", "<", "0.001", ";", "42", "±", "2.1", "%", "in", "A2780cisR", ",", "p", "<", "0.001", ";", "22", "±", "1.5", "%", "in", "SKOV-3", ",", "p", "<", "0.001", ";", "the", "RLU", "values", "are", "shown", "in", "Figure", "S13A", ",", "Supplementary", "Materials", ")", "." ] } ]
PMC11794588
A serial dilution approach was used to test the active fractions against the HeLa cell line once more (Fig. 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "serial", "dilution", "approach", "was", "used", "to", "test", "the", "active", "fractions", "against", "the", "HeLa", "cell", "line", "once", "more", "(", "Fig.", "6", ")", "." ] } ]
PMC7351993
Since the width of vibrational signals is ~10 cm, which is much narrower than the width of fluorescence signals, >20 colors can be implemented by using a palette of triple-bond-conjugated near-infrared dyes or engineered polyynes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Since", "the", "width", "of", "vibrational", "signals", "is", "~10", "cm", ",", "which", "is", "much", "narrower", "than", "the", "width", "of", "fluorescence", "signals", ",", ">", "20", "colors", "can", "be", "implemented", "by", "using", "a", "palette", "of", "triple-bond-conjugated", "near-infrared", "dyes", "or", "engineered", "polyynes", "." ] } ]
PMC11622247
Notwithstanding the challenges, the observation that (i) JK2 designed to target an mRNA target present in Jurkat cells but not in CCRF CEM cells induces higher fluorescence in Jurkat cells than in CCRF CEM cells and that (ii) CEM14 targeted against mRNA expressed by CCRF CEM cells but not by Jurkat cells increases stronger fluorescence increases in CCRF CEM cells suggests that the probes engage on the target.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notwithstanding", "the", "challenges", ",", "the", "observation", "that", "(", "i", ")", "JK2", "designed", "to", "target", "an", "mRNA", "target", "present", "in", "Jurkat", "cells", "but", "not", "in", "CCRF", "CEM", "cells", "induces", "higher", "fluorescence", "in", "Jurkat", "cells", "than", "in", "CCRF", "CEM", "cells", "and", "that", "(", "ii", ")", "CEM14", "targeted", "against", "mRNA", "expressed", "by", "CCRF", "CEM", "cells", "but", "not", "by", "Jurkat", "cells", "increases", "stronger", "fluorescence", "increases", "in", "CCRF", "CEM", "cells", "suggests", "that", "the", "probes", "engage", "on", "the", "target", "." ] } ]
PMC11707577
Briefly, adherent A431 cells were washed, trypsinized, and resuspended in RPMI complete (RPMI 1640 medium supplemented with 10% heat‐inactivated fetal bovine serum (FBS), 1% penicillin–streptomycin 100 U mL and 1% L‐glutamine 200 mm).
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "adherent", "A431", "cells", "were", "washed", ",", "trypsinized", ",", "and", "resuspended", "in", "RPMI", "complete", "(", "RPMI", "1640", "medium", "supplemented", "with", "10", "%", "heat‐inactivated", "fetal", "bovine", "serum", "(", "FBS", ")", ",", "1", "%", "penicillin", "–", "streptomycin", "100", "U", "mL", "and", "1", "%", "L‐glutamine", "200", "mm", ")", "." ] } ]
PMC9429973
Their Transformation-Free Survival (TFS) is then calculated using SPSS and incorporated in the Kaplan Meier Method.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Their", "Transformation-Free", "Survival", "(", "TFS", ")", "is", "then", "calculated", "using", "SPSS", "and", "incorporated", "in", "the", "Kaplan", "Meier", "Method", "." ] } ]
PMC11766332
Recently, a whole-transcriptome serum analysis of serum neural cell adhesion molecule L1 (L1CAM)-captured extracellular vesicles (LCEVs) showed that most RNAs differently expressed in ASD patients vs. controls involved neuron- and glycan-related networks supporting glycosylation changes in ASD .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Recently", ",", "a", "whole-transcriptome", "serum", "analysis", "of", "serum", "neural", "cell", "adhesion", "molecule", "L1", "(L1CAM)-captured", "extracellular", "vesicles", "(", "LCEVs", ")", "showed", "that", "most", "RNAs", "differently", "expressed", "in", "ASD", "patients", "vs.", "controls", "involved", "neuron-", "and", "glycan-related", "networks", "supporting", "glycosylation", "changes", "in", "ASD", "." ] } ]
PMC10606998
10%) increase in the formation of additional reactive oxygen species after X-ray irradiation was found when nanoparticles were present.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "10", "%", ")", "increase", "in", "the", "formation", "of", "additional", "reactive", "oxygen", "species", "after", "X-ray", "irradiation", "was", "found", "when", "nanoparticles", "were", "present", "." ] } ]
PMC11473750
RNF121 expression increased human neuroblastoma cell growth via its transmembrane domain.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RNF121", "expression", "increased", "human", "neuroblastoma", "cell", "growth", "via", "its", "transmembrane", "domain", "." ] } ]
PMC10366908
The positive wells were screened by the selection of mEGFR-expressing cell-reactive and CHO-K1-non-reactive supernatants, using flow cytometry (Figure 1C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "positive", "wells", "were", "screened", "by", "the", "selection", "of", "mEGFR-expressing", "cell-reactive", "and", "CHO-K1-non-reactive", "supernatants", ",", "using", "flow", "cytometry", "(", "Figure", "1C", ")", "." ] } ]
PMC9429973
No difference between AML-LTS and normal adults was found for health-related life satisfaction (hLS).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "difference", "between", "AML-LTS", "and", "normal", "adults", "was", "found", "for", "health-related", "life", "satisfaction", "(", "hLS", ")", "." ] } ]
PMC11752740
In another study, Li et al. examined the effects of curcumin, the active compound in turmeric, on NF-κB and its target genes-including interleukin 8 (IL-8) and cyclooxygenase 2 (COX-2)-in various pancreatic cancer cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "another", "study", ",", "Li", "et", "al.", "examined", "the", "effects", "of", "curcumin", ",", "the", "active", "compound", "in", "turmeric", ",", "on", "NF-κB", "and", "its", "target", "genes-including", "interleukin", "8", "(", "IL-8", ")", "and", "cyclooxygenase", "2", "(COX-2)-in", "various", "pancreatic", "cancer", "cell", "lines", "." ] } ]
PMC5673060
Volcano plot depicting the phosphoproteome of DasR versus A204 parental cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Volcano", "plot", "depicting", "the", "phosphoproteome", "of", "DasR", "versus", "A204", "parental", "cells", "." ] } ]
PMC11519788
pCMV10-3×FLAG-SPOP, pCDH-3×FLAG-SPOP-T2A (puromycin), pCS2-1×Myc-Ub, pCS2-4×HA-STAT3 and pCDH-3×FLAG-VEZF1 (puromycin) were constructed using PrimeSTAR MAX DNA Polymerase (R045A; Takara) and ClonExpress MultiS One Step Cloning Kit (C113-02; Vazyme).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "pCMV10", "-", "3", "×", "FLAG-SPOP", ",", "pCDH-3", "×", "FLAG-SPOP-T2A", "(", "puromycin", ")", ",", "pCS2", "-", "1", "×", "Myc-Ub", ",", "pCS2", "-", "4", "×", "HA-STAT3", "and", "pCDH-3", "×", "FLAG-VEZF1", "(", "puromycin", ")", "were", "constructed", "using", "PrimeSTAR", "MAX", "DNA", "Polymerase", "(", "R045A", ";", "Takara", ")", "and", "ClonExpress", "MultiS", "One", "Step", "Cloning", "Kit", "(", "C113", "-", "02", ";", "Vazyme", ")", "." ] } ]
PMC11474209
In contrast, MCLR also affects the nuclear epigenome retrograde signaling where mitochondrially-derived metabolites or secondary messengers, comprising S-adenosylmethionine (SAM), acetyl coenzyme A (acetyl Co-A), nicotinamide adenine dinucleotide (NAD), ROS, flavin adenine dinucleotide (FAD), 2-oxoglutarate and calcium ions (Ca) affect DNA methylation and histone tail post-translational modifications, involving acetylation and methylation, in the nuclear epigenome as well as mitochondrial epigenome furthermore, it directly leads to the mtDNA depletion or heteroplasmy result from deleterious mtDNA mutations .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", ",", "MCLR", "also", "affects", "the", "nuclear", "epigenome", "retrograde", "signaling", "where", "mitochondrially-derived", "metabolites", "or", "secondary", "messengers", ",", "comprising", "S-adenosylmethionine", "(", "SAM", ")", ",", "acetyl", "coenzyme", "A", "(", "acetyl", "Co-A", ")", ",", "nicotinamide", "adenine", "dinucleotide", "(", "NAD", ")", ",", "ROS", ",", "flavin", "adenine", "dinucleotide", "(", "FAD", ")", ",", "2-oxoglutarate", "and", "calcium", "ions", "(", "Ca", ")", "affect", "DNA", "methylation", "and", "histone", "tail", "post-translational", "modifications", ",", "involving", "acetylation", "and", "methylation", ",", "in", "the", "nuclear", "epigenome", "as", "well", "as", "mitochondrial", "epigenome", "furthermore", ",", "it", "directly", "leads", "to", "the", "mtDNA", "depletion", "or", "heteroplasmy", "result", "from", "deleterious", "mtDNA", "mutations", "." ] } ]
PMC11694066
Synergy scores calculated according to the Bliss independence method showed a synergistic interaction of talazoparib plus M4344 combination in JN1 (Bliss synergy score = 15.69; Fig. 2C; Supplementary Fig. S6A) but not in R cells—in which a modest additive effect could be observed, consistent with the limited sensitivity of the latter cell line to PARPi monotherapy (Bliss synergy score = 3.96; Fig. 2D; Supplementary Fig. S6B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Synergy", "scores", "calculated", "according", "to", "the", "Bliss", "independence", "method", "showed", "a", "synergistic", "interaction", "of", "talazoparib", "plus", "M4344", "combination", "in", "JN1", "(", "Bliss", "synergy", "score", "=", "15.69", ";", "Fig.", "2C", ";", "Supplementary", "Fig.", "S6A", ")", "but", "not", "in", "R", "cells", "—", "in", "which", "a", "modest", "additive", "effect", "could", "be", "observed", ",", "consistent", "with", "the", "limited", "sensitivity", "of", "the", "latter", "cell", "line", "to", "PARPi", "monotherapy", "(", "Bliss", "synergy", "score", "=", "3.96", ";", "Fig.", "2D", ";", "Supplementary", "Fig.", "S6B", ")", "." ] } ]
PMC9429973
At a median follow up of 8 months (2-19months).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "At", "a", "median", "follow", "up", "of", "8", "months", "(", "2", "-", "19months", ")", "." ] } ]
PMC11684269
In this context, the therapeutic approach of targeting CPT1A to enhance cellular FAO, thereby improving T cell function, has emerged.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "context", ",", "the", "therapeutic", "approach", "of", "targeting", "CPT1A", "to", "enhance", "cellular", "FAO", ",", "thereby", "improving", "T", "cell", "function", ",", "has", "emerged", "." ] } ]
PMC10452486
They compared the conformation and surface expression of free HLA-C1 HCs in the absence of B2m in the kidney carcinoma cell line KJ29, which carries two apparently normal copies of chromosome 6 and a single chromosome 15, implying the loss of one copy of the B2m gene.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "compared", "the", "conformation", "and", "surface", "expression", "of", "free", "HLA-C1", "HCs", "in", "the", "absence", "of", "B2", "m", "in", "the", "kidney", "carcinoma", "cell", "line", "KJ29", ",", "which", "carries", "two", "apparently", "normal", "copies", "of", "chromosome", "6", "and", "a", "single", "chromosome", "15", ",", "implying", "the", "loss", "of", "one", "copy", "of", "the", "B2", "m", "gene", "." ] } ]
PMC9429973
J. Mascarenhas, M. Kremyanskaya, A. Patriarca, C. Harrison, P. Bose, R. K. Rampal, F Palandri, T. Devos, F. Passamonti, G. Hobbs, M. Talpaz, A. Vannucchi, J.-J. Kiladjian, S. Verstovsek, R. Hoffman, M. E. Salama, D. Chen, P. Taverna, A. Chang, G. Colak, S. Klein, V. Gupta Tisch Cancer Institute, Icahn School of Medicine at Mount Sinai, New York, NY, United States of America; Hematology Unit, Department of Translational Medicine, University of Eastern Piedmont and AOU Maggiore della Carità, Novara, Italy; Guy’s and St Thomas’ NHS Foundation Trust, London, United Kingdom; MD Anderson Cancer Center, Houston, TX; Memorial Sloan-Kettering Cancer Center, New York, NY, United States of America; IRCCS Azienda Ospedaliero-Universitaria di Bologna, Istituto di Ematologia “Seràgnoli”, Bologna, Italy; University Hospitals Leuven and Laboratory of Molecular Immunology (Rega Institute), KU Leuven, Leuven, Belgium; University of Insubria, Varese, Italy; Division of Hematology/Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, MA; University of Michigan Comprehensive Cancer Center, Ann Arbor, MI, United States of America; Azienda Ospedaliero-Universitaria Careggi, University of Florence, Florence, Italy; Hôpital Saint-Louis, Université de Paris, Paris, France; Leukemia Department, University of Texas MD Anderson Cancer Center, Houston, TX; Mayo Clinic, Rochester, MN; Constellation Pharmaceuticals a MorphoSys Company, Boston, MA, United States of America; Princess Margaret Cancer Centre, University of Toronto, Toronto, Canada Background: Myelofibrosis (MF) is characterized by bone marrow (BM) fibrosis, anemia, splenomegaly and constitutional symptoms.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "J.", "Mascarenhas", ",", "M.", "Kremyanskaya", ",", "A.", "Patriarca", ",", "C.", "Harrison", ",", "P.", "Bose", ",", "R.", "K.", "Rampal", ",", "F", "Palandri", ",", "T.", "Devos", ",", "F.", "Passamonti", ",", "G.", "Hobbs", ",", "M.", "Talpaz", ",", "A.", "Vannucchi", ",", "J.-J.", "Kiladjian", ",", "S.", "Verstovsek", ",", "R.", "Hoffman", ",", "M.", "E.", "Salama", ",", "D.", "Chen", ",", "P.", "Taverna", ",", "A.", "Chang", ",", "G.", "Colak", ",", "S.", "Klein", ",", "V.", "Gupta", "Tisch", "Cancer", "Institute", ",", "Icahn", "School", "of", "Medicine", "at", "Mount", "Sinai", ",", "New", "York", ",", "NY", ",", "United", "States", "of", "America", ";", "Hematology", "Unit", ",", "Department", "of", "Translational", "Medicine", ",", "University", "of", "Eastern", "Piedmont", "and", "AOU", "Maggiore", "della", "Carità", ",", "Novara", ",", "Italy", ";", "Guy", "’s", "and", "St", "Thomas", "’", "NHS", "Foundation", "Trust", ",", "London", ",", "United", "Kingdom", ";", "MD", "Anderson", "Cancer", "Center", ",", "Houston", ",", "TX", ";", "Memorial", "Sloan-Kettering", "Cancer", "Center", ",", "New", "York", ",", "NY", ",", "United", "States", "of", "America", ";", "IRCCS", "Azienda", "Ospedaliero-Universitaria", "di", "Bologna", ",", "Istituto", "di", "Ematologia", "“", "Seràgnoli", "”", ",", "Bologna", ",", "Italy", ";", "University", "Hospitals", "Leuven", "and", "Laboratory", "of", "Molecular", "Immunology", "(", "Rega", "Institute", ")", ",", "KU", "Leuven", ",", "Leuven", ",", "Belgium", ";", "University", "of", "Insubria", ",", "Varese", ",", "Italy", ";", "Division", "of", "Hematology/Oncology", ",", "Massachusetts", "General", "Hospital", ",", "Harvard", "Medical", "School", ",", "Boston", ",", "MA", ";", "University", "of", "Michigan", "Comprehensive", "Cancer", "Center", ",", "Ann", "Arbor", ",", "MI", ",", "United", "States", "of", "America", ";", "Azienda", "Ospedaliero-Universitaria", "Careggi", ",", "University", "of", "Florence", ",", "Florence", ",", "Italy", ";", "Hôpital", "Saint-Louis", ",", "Université", "de", "Paris", ",", "Paris", ",", "France", ";", "Leukemia", "Department", ",", "University", "of", "Texas", "MD", "Anderson", "Cancer", "Center", ",", "Houston", ",", "TX", ";", "Mayo", "Clinic", ",", "Rochester", ",", "MN", ";", "Constellation", "Pharmaceuticals", "a", "MorphoSys", "Company", ",", "Boston", ",", "MA", ",", "United", "States", "of", "America", ";", "Princess", "Margaret", "Cancer", "Centre", ",", "University", "of", "Toronto", ",", "Toronto", ",", "Canada", "Background", ":", "Myelofibrosis", "(", "MF", ")", "is", "characterized", "by", "bone", "marrow", "(", "BM", ")", "fibrosis", ",", "anemia", ",", "splenomegaly", "and", "constitutional", "symptoms", "." ] } ]
PMC3813807
Previously, it was observed that miR-372 and miR-373 act as oncogenes in the tumorigenesis of human testicular germ cell tumors (Tera-1 and 833KE cells), through the direct inhibition of LATS2 expression (11).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Previously", ",", "it", "was", "observed", "that", "miR-372", "and", "miR-373", "act", "as", "oncogenes", "in", "the", "tumorigenesis", "of", "human", "testicular", "germ", "cell", "tumors", "(", "Tera-1", "and", "833KE", "cells", ")", ",", "through", "the", "direct", "inhibition", "of", "LATS2", "expression", "(", "11", ")", "." ] } ]
PMC9985266
The MAPK signaling pathway plays a key role in fibrosis in many major organs, such as myocardial fibrosis, renal fibrosis, and PF .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "MAPK", "signaling", "pathway", "plays", "a", "key", "role", "in", "fibrosis", "in", "many", "major", "organs", ",", "such", "as", "myocardial", "fibrosis", ",", "renal", "fibrosis", ",", "and", "PF", "." ] } ]
PMC10452486
They also found that heterodimers (Face-4) formed between two different HLA-I alleles.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "also", "found", "that", "heterodimers", "(", "Face-4", ")", "formed", "between", "two", "different", "HLA-I", "alleles", "." ] } ]
PMC8193046
The inhibitory activity against ABCG2 was evaluated in a pheophorbide A assay as reported earlier , .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "inhibitory", "activity", "against", "ABCG2", "was", "evaluated", "in", "a", "pheophorbide", "A", "assay", "as", "reported", "earlier", ",", "." ] } ]
PMC9841531
Yellow solid; yield: 73%; melting point: 161–163 °C: FTIR (cm): 3279.55 (NH), 2213.31 (CN), 1661.61 (C=O), 1573.95 (C=O), 1516.34 (C=C); H NMR (400 MHz, DMSO-d6) δ 9.89 (s, 1H), 8.67 (s, 1H), 8.58 (s, 1H), 8.01 (d, J = 7.8 Hz, 1H), 7.64 (d, J = 8.1 Hz, 1H), 7.45–7.28 (m, 3H), 7.26–7.19 (m, 1H), 7.20–7.05 (m, 2H), 5.39 (s, 2H), 3.84 (s, 3H), 2.24 (s, 3H); MS (m/z) calculated for C22H19N3O3: 373.143, found: 374.400 [M + H] and 391.400 [M + H2O]; purity (HPLC): 98%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Yellow", "solid", ";", "yield", ":", "73", "%", ";", "melting", "point", ":", "161–163", "°", "C", ":", "FTIR", "(", "cm", "):", "3279.55", "(", "NH", ")", ",", "2213.31", "(", "CN", ")", ",", "1661.61", "(", "C", "=", "O", ")", ",", "1573.95", "(", "C", "=", "O", ")", ",", "1516.34", "(", "C", "=", "C", ")", ";", "H", "NMR", "(", "400", "MHz", ",", "DMSO-d6", ")", "δ", "9.89", "(", "s", ",", "1H", ")", ",", "8.67", "(", "s", ",", "1H", ")", ",", "8.58", "(", "s", ",", "1H", ")", ",", "8.01", "(", "d", ",", "J", "=", "7.8", "Hz", ",", "1H", ")", ",", "7.64", "(", "d", ",", "J", "=", "8.1", "Hz", ",", "1H", ")", ",", "7.45–7.28", "(", "m", ",", "3H", ")", ",", "7.26–7.19", "(", "m", ",", "1H", ")", ",", "7.20–7.05", "(", "m", ",", "2H", ")", ",", "5.39", "(", "s", ",", "2H", ")", ",", "3.84", "(", "s", ",", "3H", ")", ",", "2.24", "(", "s", ",", "3H", ")", ";", "MS", "(", "m/z", ")", "calculated", "for", "C22H19N3O3", ":", "373.143", ",", "found", ":", "374.400", "[", "M", "+", "H", "]", "and", "391.400", "[", "M", "+", "H2O", "]", ";", "purity", "(", "HPLC", "):", "98", "%", "." ] } ]
PMC9143157
The doses were administered seven times in five months and did not reveal any sign of toxicity, including cardiovascular failures.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "doses", "were", "administered", "seven", "times", "in", "five", "months", "and", "did", "not", "reveal", "any", "sign", "of", "toxicity", ",", "including", "cardiovascular", "failures", "." ] } ]
PMC9583612
As outlined above, understanding the distribution of methane emission event frequencies and durations is critical for accurate scaling to annualized inventories for production sites.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "outlined", "above", ",", "understanding", "the", "distribution", "of", "methane", "emission", "event", "frequencies", "and", "durations", "is", "critical", "for", "accurate", "scaling", "to", "annualized", "inventories", "for", "production", "sites", "." ] } ]
PMC5925824
As shown in Fig. 2b, only the variant K63 N and not N69H rescued the binding of LY3300054 to ca-PD-L1-Fc.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "shown", "in", "Fig.", "2b", ",", "only", "the", "variant", "K63", "N", "and", "not", "N69H", "rescued", "the", "binding", "of", "LY3300054", "to", "ca-PD-L1-Fc", "." ] } ]
PMC9429973
Results: Overall, 46 patients receiving sutimlimab were included in this analysis (CARDINAL, n=24; CADENZA, n=22) and mean (SD) time between last rituximab intake and sutimlimab treatment start date was 26.4 (24.0) months.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Overall", ",", "46", "patients", "receiving", "sutimlimab", "were", "included", "in", "this", "analysis", "(", "CARDINAL", ",", "n=24", ";", "CADENZA", ",", "n=22", ")", "and", "mean", "(", "SD", ")", "time", "between", "last", "rituximab", "intake", "and", "sutimlimab", "treatment", "start", "date", "was", "26.4", "(", "24.0", ")", "months", "." ] } ]
PMC11802855
Single-cell data from different patients were integrated and analyzed via the UMAP downscaling approach.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single-cell", "data", "from", "different", "patients", "were", "integrated", "and", "analyzed", "via", "the", "UMAP", "downscaling", "approach", "." ] } ]
PMC9429973
The hormone prolactin (PRL) exacerbates the symptoms of SLE, enhances lymphoid cell survival, and promotes the expression of MYC and BCL2 protooncogenes in lymphocytes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "hormone", "prolactin", "(", "PRL", ")", "exacerbates", "the", "symptoms", "of", "SLE", ",", "enhances", "lymphoid", "cell", "survival", ",", "and", "promotes", "the", "expression", "of", "MYC", "and", "BCL2", "protooncogenes", "in", "lymphocytes", "." ] } ]
PMC11423992
These results highlighted the improved safety profile of our approach.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "highlighted", "the", "improved", "safety", "profile", "of", "our", "approach", "." ] } ]
PMC10812665
Some exemplary findings are discussed below.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Some", "exemplary", "findings", "are", "discussed", "below", "." ] } ]
PMC11686380
GAP43 contains an IQ domain, which serves as a binding site for EF-hand proteins such as calmodulin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GAP43", "contains", "an", "IQ", "domain", ",", "which", "serves", "as", "a", "binding", "site", "for", "EF-hand", "proteins", "such", "as", "calmodulin", "." ] } ]
PMC11763126
To further investigate the interaction between YTHDF2 and TRPM3, we constructed overexpression plasmids and designed specific shRNAs of YTHDF2 and TRPM3.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "further", "investigate", "the", "interaction", "between", "YTHDF2", "and", "TRPM3", ",", "we", "constructed", "overexpression", "plasmids", "and", "designed", "specific", "shRNAs", "of", "YTHDF2", "and", "TRPM3", "." ] } ]
PMC9429973
3.
[ { "tags": [ "O", "O" ], "tokens": [ "3", "." ] } ]
PMC11139449
The mixture consisted of 1 μL of dNTP mixture (0.2 μM concentration), 2 μL of MgCl2 (2 mM), 2 μL of 1X PCR buffer, 0.25 μL of Taq DNA polymerase (Thermo Fisher Scientific, USA), 1 μL of Forward and 1 μL of Reverse primers (1 μM concentration), and 1 μL of DNA (50 ng concentration).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mixture", "consisted", "of", "1", "μL", "of", "dNTP", "mixture", "(", "0.2", "μM", "concentration", ")", ",", "2", "μL", "of", "MgCl2", "(", "2", "mM", ")", ",", "2", "μL", "of", "1X", "PCR", "buffer", ",", "0.25", "μL", "of", "Taq", "DNA", "polymerase", "(", "Thermo", "Fisher", "Scientific", ",", "USA", ")", ",", "1", "μL", "of", "Forward", "and", "1", "μL", "of", "Reverse", "primers", "(", "1", "μM", "concentration", ")", ",", "and", "1", "μL", "of", "DNA", "(", "50", "ng", "concentration", ")", "." ] } ]
PMC10965680
Moreover, the F ST was harnessed to evaluate the reduced heterozygosity exhibited by the Xiangdong goat population in comparison to that of a reference population.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "the", "F", "ST", "was", "harnessed", "to", "evaluate", "the", "reduced", "heterozygosity", "exhibited", "by", "the", "Xiangdong", "goat", "population", "in", "comparison", "to", "that", "of", "a", "reference", "population", "." ] } ]
PMC11627398
Furthermore, gene functional enrichment was then performed by GSEA and GSVA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "gene", "functional", "enrichment", "was", "then", "performed", "by", "GSEA", "and", "GSVA", "." ] } ]
PMC11720107
In the CACO-2 cell line, extracts from the Harnaś and Morado cultivars decreased CAT protein expression by 7.5 ng/mL and 12.1 ng/mL, respectively, compared with the control (Figure 8B).
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "CACO-2", "cell", "line", ",", "extracts", "from", "the", "Harnaś", "and", "Morado", "cultivars", "decreased", "CAT", "protein", "expression", "by", "7.5", "ng/mL", "and", "12.1", "ng/mL", ",", "respectively", ",", "compared", "with", "the", "control", "(", "Figure", "8B", ")", "." ] } ]
PMC11699465
Nuclear localization of TMEM199 (A) Gene Ontology -Cellular Component (GOCC) analysis of TMEM199 interacted proteins (TIPs).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Nuclear", "localization", "of", "TMEM199", "(", "A", ")", "Gene", "Ontology", "-Cellular", "Component", "(", "GOCC", ")", "analysis", "of", "TMEM199", "interacted", "proteins", "(", "TIPs", ")", "." ] } ]
PMC11366496
Based on functional tests, oeRNF122 advanced GBM cell proliferation, migration, and invasion (Figure 2A–C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Based", "on", "functional", "tests", ",", "oeRNF122", "advanced", "GBM", "cell", "proliferation", ",", "migration", ",", "and", "invasion", "(", "Figure", "2A", "–", "C", ")", "." ] } ]
PMC11618052
Table 1 indicates that none of the compounds analyzed exhibited cytotoxicity, with all hybrids maintaining above 84% cell viability at a concentration of 50 μM. The MTT assay was used to test the antiproliferative efficacy of hybrids 8a–t against four human cancer cell lines: colon cancer (HT-29), pancreatic cancer (Panc-1), lung cancer (A-549), and breast cancer (MCF-7), using Erlotinib as a control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Table", "1", "indicates", "that", "none", "of", "the", "compounds", "analyzed", "exhibited", "cytotoxicity", ",", "with", "all", "hybrids", "maintaining", "above", "84", "%", "cell", "viability", "at", "a", "concentration", "of", "50", "μM.", "The", "MTT", "assay", "was", "used", "to", "test", "the", "antiproliferative", "efficacy", "of", "hybrids", "8a", "–", "t", "against", "four", "human", "cancer", "cell", "lines", ":", "colon", "cancer", "(", "HT-29", ")", ",", "pancreatic", "cancer", "(", "Panc-1", ")", ",", "lung", "cancer", "(", "A-549", ")", ",", "and", "breast", "cancer", "(", "MCF-7", ")", ",", "using", "Erlotinib", "as", "a", "control", "." ] } ]
PMC11342785
Thus, TPPP’s in vitro MT binding and bundling activity correlates with its ability to form droplets.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "TPPP", "’s", "in", "vitro", "MT", "binding", "and", "bundling", "activity", "correlates", "with", "its", "ability", "to", "form", "droplets", "." ] } ]
PMC11367939
Thereafter, cells were blocked with 3% bovine serum albumin (BSA) and 0.2% Triton X-100 in PBS for 30 min at RT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thereafter", ",", "cells", "were", "blocked", "with", "3", "%", "bovine", "serum", "albumin", "(", "BSA", ")", "and", "0.2", "%", "Triton", "X-100", "in", "PBS", "for", "30", "min", "at", "RT", "." ] } ]
PMC11544122
SNX9 binds to plasma membrane phospholipids, AP2, and dynamin during the late stages of CME and has mostly been characterized in the context of constitutive CME.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SNX9", "binds", "to", "plasma", "membrane", "phospholipids", ",", "AP2", ",", "and", "dynamin", "during", "the", "late", "stages", "of", "CME", "and", "has", "mostly", "been", "characterized", "in", "the", "context", "of", "constitutive", "CME", "." ] } ]
PMC11342785
This intensity was then normalized by dividing it by the fluorescence intensity of single MTs within the same cell, yielding the normalized MT bundling intensity (69, 70).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "intensity", "was", "then", "normalized", "by", "dividing", "it", "by", "the", "fluorescence", "intensity", "of", "single", "MTs", "within", "the", "same", "cell", ",", "yielding", "the", "normalized", "MT", "bundling", "intensity", "(", "69", ",", "70", ")", "." ] } ]
PMC9429973
The effect of lockdowns and changed social behaviour impacted presentation to healthcare for all conditions, particularly new cancers, with potential harm through late or non-presentation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "effect", "of", "lockdowns", "and", "changed", "social", "behaviour", "impacted", "presentation", "to", "healthcare", "for", "all", "conditions", ",", "particularly", "new", "cancers", ",", "with", "potential", "harm", "through", "late", "or", "non-presentation", "." ] } ]
PMC11767725
By hydrolyzing triglycerides into free fatty acids, Malassezia disrupts keratinocyte membranes and activates PRRs, such as TLR2, triggering cytokine production and neutrophil recruitment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "hydrolyzing", "triglycerides", "into", "free", "fatty", "acids", ",", "Malassezia", "disrupts", "keratinocyte", "membranes", "and", "activates", "PRRs", ",", "such", "as", "TLR2", ",", "triggering", "cytokine", "production", "and", "neutrophil", "recruitment", "." ] } ]