PMCID string | Sentences string | ner list |
|---|---|---|
PMC11772585 | H The cell apoptosis was determined by Annexin V/PI double staining (n = 6). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"H",
"The",
"cell",
"apoptosis",
"was",
"determined",
... |
PMC11483468 | Early candidate peptides had high molecular weights and poor stability (26). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Early",
"candidate",
"peptides",
"had",
"high",
"molecular",
"weights",
"an... |
PMC11546117 | Considering the scarce scientific evidence on safely using medicines by pregnant and lactating women, the funded European project ConcePTION (https://www.imi-conception.eu/) supported and encouraged the development and validation of non-clinical in vitro, in vivo, and in silico models to predict the passage of medicine... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11106977 | Interestingly, O-GlcNAcylation modification functionally increased transcriptional activity in the Hh/ Gli pathway in tumor cells (Fig. 3) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Interestingly",
",",
"O-GlcN... |
PMC10291556 | As shown in Figure 3A, the concentration of lactate excreted by HeLa cells into media was considerably reduced by treatment with Pt(IV) complexes 3 and 4 containing DCF ligands; the effect was dependent on the number of coordinated DCF molecules. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11530949 | ROS Measurements The H2DCFDA kit was utilized to assess the ROS generated by the extract and the doped NPs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ROS",
"Measurements",
"The",
"H2D... |
PMC9429973 | In CAPTIVATE, pts received three 28-d cycles of I, followed by 12 cycles of I+V (I 420 mg/d orally; V ramp-up to 400 mg/d orally). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11724582 | First- and second-generation EGFR-TKIs have been listed successively, and great progress has been made in their clinical treatment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"First-",
"and",
"second-generation",
... |
PMC11225860 | Aneuploidy is a direct outcome of this instability. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Aneuploidy",
"is",
"a",
"direct",
"outcome",
"of",
"this",
"instability",
"."
]
}
] |
PMC8922418 | The pegRNA consists of three elements: a sgRNA corresponding to the target site, a primer binding sequence, and a reverse transcription template storing genetic information for targeting (Anzalone et al., 2019). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7229095 | Media in CLD have different requirements depending on the process step. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Media",
"in",
"CLD",
"have",
"different",
"requirements",
"depending",
"on",
"the",
"... |
PMC9512971 | It is considered that the epidemic strain at the time was a D614G strain, but no data on the type of strain were collected for this study. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11752767 | This phenomenon may result from the recognition of the MAGE-A12 protein expressed in a subset of neurons in the human brain, leading to a calamitous immune response to the white matter. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | CYT-338 bound MM cell lines with ~ 2-fold higher mean fluorescence intensity than anti-CD38 monoclonal antibody (mAb) or daratumumab alone. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CYT-338",
"b... |
PMC6379402 | In the main paper, we use initial solutions based on singular value decomposition of the average adjacency matrix , where a is the number of to be decomposed adjacency matrices, following the idea of Qiao. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC4270159 | KHM-3S: p-EGFR Y1068. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"KHM-3S",
":",
"p-EGFR",
"Y1068",
"."
]
}
] |
PMC9429973 | While retrospective data suggest PTCy show low rates of chronic GVHD, potential disadvantages of PTCy include increased risks of CMV reactivation, veno-occlusive disease (VOD), haemorrhagic cystitis and exposure of donor haematopoiesis to high-dose alkylator resulting in DNA damage and potential for secondary myeloid n... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10957991 | In the case of cardiac fibroblasts, TRPV4-dependent differentiation seems to be orchestrated by both biochemical and mechanical cues and involves actomyosin-regulating Rho kinase pathway. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC10976516 | In addition to boosting the trafficking of cells to tumors, cell carriers, and their viral payloads, can be altered to enhance many elements of cell-mediated OV delivery, such as loading capacity, virus generation, and delivery to tumor cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6160470 | The cell viability was evaluated by MTT assay after 72 h of incubation, and the percentage of viable cells was calculated. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"cell"... |
PMC9370419 | Twenty-four hours after transfection, the cells from one well were digested and cultured in a 10 cm dish, subjected to 300 µg/mL hygromycin, and selected for two weeks. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11737091 | For further analysis, the tumor tissue sections were stained for Ki-67 to enhance the validity of the vivo experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"further",
"analysis",... |
PMC9780037 | A recent review discusses the biochemical properties of cyt c that enable its repurposing as a proapoptotic chemotherapeutic drug and describes several cyt c cell delivery systems for cancer therapy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11626627 | In previous studies, we discovered that ERβ promotes the progression of ccRCC by regulating the circATP2B1/miR-204–3p signaling pathway. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"previous",
"studies",
",",
... |
PMC11306019 | MAC, was adopted from Br J Haematol. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"MAC",
",",
"was",
"adopted",
"from",
"Br",
"J",
"Haematol",
"."
]
}
] |
PMC11765988 | The underlying link remains uncertain but may involve chronic immune system activation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"underlying",
"link",
"remains",
"uncertain",
"but",
"may",
"involve",
"ch... |
PMC10914904 | vtRNAs may remain unprocessed and protected from methylation by the SRSF2 protein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"vtRNAs",
"may",
"remain",
"unprocessed",
"and",
"protected",
"from",
"methylation",
... |
PMC11515150 | Cytotoxicity of 12 C CAR-NK cells and NT-NK cells against normal T cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cytotoxicity",
"of",
"12",
"C",
"CAR-NK",
"cells",
"and",
"NT-NK",
"c... |
PMC11670407 | P < 0.05, **P < 0.01 vs. the corresponding control Since ROS are known to trigger or promote the mitochondrial apoptotic pathway under cisplatin treatment and GPX4 functions as a resistance molecule to ROS , we hypothesized that increased cisplatin-induced apoptosis due to OTULIN depletion in osteosarcoma cells is asso... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11679892 | In addition, no significant change was observed in Bcl-2 gene expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"addition",
",",
"no",
"significant",
"change",
"was",
"observed",
"in",
... |
PMC11093197 | To measure RAS activity, we performed a RAS‐GTP binding assay. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"measure",
"RAS",
"activity",
",",
"we",
"performed",
"a",
"RAS‐GTP",
"binding",... |
PMC10631132 | In short, cells were fixed using 4% PFA, washed, staining mix was added to the plate and incubated for 20 min at 37°C. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | For sITP, overall IRR was 1.37 [1.06; 1.74] for any fracture, and 1.65 [1.16; 2.29] for hip – and femoral fractures. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8633974 | Each of the experiments were performed in triplicate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Each",
"of",
"the",
"experiments",
"were",
"performed",
"in",
"triplicate",
"."
]
}
] |
PMC5925824 | GloResponse NFAT-luc2/PD1 Jurkat cells (Promega) were re-suspended in assay buffer at a concentration of 1.25 × 10 /ml and added to the plate at 40 μl per well. | [
{
"tags": [
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Although hematopoietic stem cell transplantation involves a high risk of mortality, it is nowadays the only curative treatment for MF. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Although",
"hematopoiet... |
PMC11787355 | Nevertheless, to experimentally assess potential off-targets, we applied ARDitox, an in silico artificial intelligence (AI)-based prediction tool for off-target TCR binding. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11719944 | As a result, further immunological assessments of the phenotype and function of relevant T cell subtypes are essential for more accurate prediction, monitoring, and classification of patients with T1D. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Clinical and laboratory features, as well as outcome measures (response rates, progression free and overall survival) were compared between patients with and without concomitant statin use. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11747885 | However, significant differences in viability levels were observed when cells were exposed to 40 μM menadione, a compound known to induce ROS-based cellular stress. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11594806 | This Gs signaling, initiated by extracellular ADO, activates adenylate cyclase, leading to intracellular accumulation of cyclic AMP (cAMP). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
... |
PMC5311252 | miR-372-3p or the reference small RNA RNU48 were reverse-transcribed using Bio-Rad MyCycler thermal cycler with TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, 4366596) according to product protocol, and miR-372-3p or RNU48 RT primer from TaqMan MicroRNA Assay (Life Technolgies, 4427975. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11502443 | Non-normalized Emin and Emax values are summarized in Supplementary Table S1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Non-normalized",
"Emin",
"and",
"Emax",
"values",
"are",
"summarized",
"in",
"Supplementary... |
PMC8345486 | The MTT assay was performed as described in the Supplementary Materials in some experiments with drugs for comparison with NR results. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"MTT",
"ass... |
PMC8903741 | Therefore, it was difficult to promptly confirm the transfection efficiency and to selectively differentiate the antibody gene-transfected clones. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"it",
"was",
... |
PMC11209164 | A slightly greater but statistically significant enhancement in impact on virus titers was observed with TPF-VSVΔ51 compared to DMF- VSVΔ51. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"slightly",
"greater",
... |
PMC11711127 | The study showed that NK cells in EAE mice can induce anergy in CD4+ T cells upon histidine triad nucleotide binding protein 1 (HINT1)/heat shock protein 70 (Hsp70) treatment rather than inducing necrosis or apoptosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | V. Bumbea, H. Bumbea, L. Ardelean, L. Radulescu, L. Damian, I. Dumitru, C. Lambert, V. Popov, C. Tomuleasa, A.-M. Vladareanu Dyalisis, Emergency Hospital Bucharest; University of Medicine and Pharmacy Carol Davila Bucharest; Hematology Blood and Marrow Transplant Unit; Nephrology; Blood Unit, Emergency University Hospi... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11632064 | ES, enrichment score; NES, normalized enrichment score; NOM p, nominal P-value; FDR q, false-discovery rate q-value. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ES",
... |
PMC11361748 | On day 2, cells were treated with 20 nM TPA in full serum medium for 6 h. After rinsing (1× PBS), 2 ml serum-reduced medium (0.1% FBS) was added cells incubated for another 24 h. CM was collected using a 3 ml syringe (BD Syringe) and filtered through a 0.22 μm PVDF syringe filter (Millipore #SLGVM33RS), divided into al... | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7192625 | In addition, Hi-C cannot easily assess the significance of inter-chromosomal interactions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"addition",
",",
"Hi-C",
"can",
"not",
"easily",
"assess",
"the"... |
PMC11774747 | Consequently, no immediate rejection of CAR-VST by recipient T cells was observed even after multiple infusions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Consequently",
",",
"no",
"immediate",
"rejection... |
PMC9429973 | Methods: Diagnostic bone marrow samples from 261 children with B-ALL and 22 matching samples drawn from 21 patients at first or second relapse were investigated by digital multiplex ligation-dependent probe amplification (digitalMLPA) using the ALL-specific D007 probemix. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9243326 | The numbers and lengths of 5′ UTRs, 3′ UTRs, and CDSs were identified using the ANGEL software. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"numbers",
"and",
"lengths"... |
PMC9164404 | The increased expression of ABAT in the Abplatin-treated cells might be the one of reasons for its cell killing effect. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"increased",
"expressi... |
PMC11350568 | As indicated in Figure 3a,b, by co-incubating AptGs with Cy5-Sgc8c or FAM-HG1–9, AptG-1 could still efficiently bind to CCRF-CEM, forming a stable TMPDS. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
... |
PMC10907726 | Importantly, numerous studies have reported the inhibitory effects of DATS in various cancers, including breast cancer, gastric cancer, glioblastoma, hepatocellular carcinoma, esophageal cancer, and bladder cancer [, , , , ]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11286266 | S1P and S2P cleavage sites were also mutated to increase expression yield. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"S1P",
"and",
"S2P",
"cleavage",
"sites",
"were",
"also",
"mutated",
"to",
... |
PMC11588008 | This finding indicated that HUC-MSCs had significant repair and clearance effects on abnormal ROS generated by PM-induced damage to ovarian cancer cells (Figure 5a and b). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11291490 | d The expression of E protein was measured in vivo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"d",
"The",
"expression",
"of",
"E",
"protein",
"was",
"measured",
"in",
"vivo",
"."
]
... |
PMC11277157 | PARK7 (DJ-1) was extensively studied for its function as an oxidative stress sensor and in executing the oxidative stress cellular response. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PARK7",... |
PMC10588957 | The Statistical Product and Service Solutions software (SPSS version 22.0) was used for data analyses. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"Statistical",
"Product",
"and",
"Service",... |
PMC10607604 | EMT, which is induced by PTPN13 KO/KD in our model, plays an important role in platinum salt resistance in various tumor types (for review, ), including ovarian cancer (for review, ). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | None of the controls had anti-PF4/polyanion antibodies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"None",
"of",
"the",
"controls",
"had",
"anti-PF4/polyanion",
"antibodies",
"."
]
}
] |
PMC11706776 | G Effect of GW542573X on CCE using Mn quenching assay and the normalized Mn quenching slope (N = 28 for Control and N = 20 for GW542573X condition). * | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11040965 | Similar effects are obtained with decitabine treatment of U266 and RPMI 8226 cells, suggesting that proteasome subunit genes are mainly regulated by methylation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC11335267 | All mice from either background were males of 16–20 weeks of age. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"mice",
"from",
"either",
"background",
"were",
"males",
"of",
"16–20",
... |
PMC6799808 | β-Tubulin served as a loading control. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"β-Tubulin",
"served",
"as",
"a",
"loading",
"control",
"."
]
}
] |
PMC11788920 | The sequence of the 27 nt long PQS of the c-Myc promoter is follows: TGGGGAGGGTGGGGAGGGTGGGGAAGG, with the underlined five G-tracts shown to form two different GQ structures . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Continuous variables are reported as means with standard deviations, while categorical variables are presented as percentages. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Continuous",
"variables",
"are",
"reported",
"as"... |
PMC9429973 | CD7-ablated CAR T cells (KO7CAR) were derived by electroporation of bulk T cells with CD7-targeting Cas9-gRNA RNP 24 hours before 7CAR transduction. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11013014 | Compound 22 exhibits activity on both HL60 and HCT116 cell lines at 10 µM with viabilities of 14% and 21%, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | Thus, treatment of MF pts with thrombocytopenia confers a unique challenge and unmet medical need. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"treatment",
"of",
"MF",
"pts",
"wit... |
PMC11694066 | For replication fork labeling, cells received prewarmed medium containing 100 μmol/L 5-chloro-2′-deoxyuridine and were incubated at 37°C and 5% CO2 for 30 minutes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11627398 | These results showed that SLC31A1, MTF1, LIAS and LIPT1 may serve as potential biomarkers for the diagnosis of septic shock. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"res... |
PMC11045125 | This is the first demonstration that latent EBV infection combined with Myc over-expression in normal human B cells is sufficient to induce Burkitt-like lymphomas in mice. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11607321 | The generation of large-scale multi-omic datasets is both time and resource-intensive, thereby positioning MOSA as a valuable tool for in silico testing and prioritization of drug targets for experimental validation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | All patients received the full dose as planned, except for 1 patient at the 36-month follow-up visit who experienced infusion/technical problems. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"patie... |
PMC7185206 | Additional cell lines, inhibitors, and concentrations shown in Supplemental Figures 3 and 4. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additional",
"cell",
"lines",
",",
"inhibitors",
",",
... |
PMC10482220 | Thus, the recruitment of domain D to SGs could simply be mediated by its affinity for RNA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"the",
"recruitment",
"of"... |
PMC11658074 | WB analysis confirmed the increased APN levels in AT-EVs (Fig. S14). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"WB",
"analysis",
"confirmed",
"the",
"increased",
"APN",
"levels",
"in",
... |
PMC5811757 | Based on the recommendations of the Cell Bank (ECACC) to maintain high P-gp levels, 10μM Doxorubicin (Tedec-Meiji Farma, S.A, Spain) was added to the culture medium once a week, usually after each passage. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11509309 | Thus, the level of luciferase expressed in these cells is proportional to the level of CHOP induction. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"the",
"level",
"of",
... |
PMC9429973 | ORR for 29 pts who crossed over to ZO was 24.1%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ORR",
"for",
"29",
"pts",
"who",
"crossed",
"over",
"to",
"ZO",
"was",
... |
PMC11720808 | Data are shown as mean ± SD (n=5). ** | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"are",
"shown",
"as",
"mean",
"±",
"SD",
"(",
"n=5",
")",
"."... |
PMC11472569 | It has been reported to transport several anticancer drugs, including mitoxantrone, topotecan, and irinotecan. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"has",
"been",
"reported",
"to",
"tran... |
PMC9429973 | Continuous variables were compared with Mann-Whitney U test, and categorical using Chi-square or Fisher´s exact tests. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Continuous",
"variables",
"were",
"compared",
"wi... |
PMC11742864 | Platinum-based drugs are the basic drugs for lung cancer chemotherapy, but resistance is also unavoidable. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Platinum-based",
"drugs",
"are",
"the",
"basic",
"drug... |
PMC11719944 | Exhausted T cells lose their normal functions, such as producing cytokines, killing cells, and multiplying, and start expressing multiple co-inhibitory receptors (CTLA-4, PD-1, LAG-3, TIM3, and TIGIT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Tumor CLL B-cells weakly express a B cell receptor (BCR) on the surface which is composed, in the vast majority of cases, of immunoglobulins (Ig) of the mu (µ) and delta (δ) isotypes and Ig class-switched CLL are rare, raising the question of abnormalities in the Ig gene recombination machinery in this B-cell cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8592717 | PCA can also be extracted from dried almond hulls (Prunus amygdalus Batsch) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PCA",
"can",
"also",
"be",
"extracted",
"from",
"dried",
"almond... |
PMC11746948 | After 30 s vortex, then the samples were sonicated for 10 min in ice-water bath. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"30",
"s",
"vortex",
",",
"then",
"the",... |
PMC11621565 | 16 µg/ml of curli CsgA and PSMα1 did not modify the mRNA levels of α-synuclein in dopaminergic-differentiated SH-SY5Y cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"16",
"µg/ml",
"of",
"cur... |
PMC10547921 | PDC is an equivalent antibody–drug conjugate that overcomes some of the limitations of ADC and has many unique advantages. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PDC",
"is",
"an",... |
PMC10831439 | Error bars show SD. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Error",
"bars",
"show",
"SD",
"."
]
}
] |
PMC10882807 | The relative expression level of hsa_circ_0005397 in HCC tissues were normalized to normal tissues (n = 57). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"relative",
"expressio... |
PMC11638255 | A single-cell dissociation was achieved by passing the mixture through a 70μm MACS SmartStrainer (Miltenyi Biotec, Germany; #130-110-916). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11552389 | FSIP1 expression was assessed in melanoma and normal tissue samples. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"FSIP1",
"expression",
"was",
"assessed",
"in",
"melanoma",
"and",
"normal",
"tissue",
... |
PMC11185260 | Mice with established tumors were injected twice a week for 6 injections of scL-SMARCB1 (30µg DNA/injection, intravenously administered). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Mice",
"with... |
PMC8903741 | Dysregulated MMP9 expression and its abnormal activity are involved in pathological processes that contribute in chronic inflammation, tumorigenesis, and metastasis [2–4]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.