Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11772585
H The cell apoptosis was determined by Annexin V/PI double staining (n = 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H", "The", "cell", "apoptosis", "was", "determined", "by", "Annexin", "V/PI", "double", "staining", "(", "n", "=", "6", ")", "." ] } ]
PMC11483468
Early candidate peptides had high molecular weights and poor stability (26).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Early", "candidate", "peptides", "had", "high", "molecular", "weights", "and", "poor", "stability", "(", "26", ")", "." ] } ]
PMC11546117
Considering the scarce scientific evidence on safely using medicines by pregnant and lactating women, the funded European project ConcePTION (https://www.imi-conception.eu/) supported and encouraged the development and validation of non-clinical in vitro, in vivo, and in silico models to predict the passage of medicines across the blood–milk barrier .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Considering", "the", "scarce", "scientific", "evidence", "on", "safely", "using", "medicines", "by", "pregnant", "and", "lactating", "women", ",", "the", "funded", "European", "project", "ConcePTION", "(", "https://www.imi-conception.eu/", ")", "supported", "and", "encouraged", "the", "development", "and", "validation", "of", "non-clinical", "in", "vitro", ",", "in", "vivo", ",", "and", "in", "silico", "models", "to", "predict", "the", "passage", "of", "medicines", "across", "the", "blood", "–", "milk", "barrier", "." ] } ]
PMC11106977
Interestingly, O-GlcNAcylation modification functionally increased transcriptional activity in the Hh/ Gli pathway in tumor cells (Fig. 3) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "O-GlcNAcylation", "modification", "functionally", "increased", "transcriptional", "activity", "in", "the", "Hh/", "Gli", "pathway", "in", "tumor", "cells", "(", "Fig.", "3", ")", "." ] } ]
PMC10291556
As shown in Figure 3A, the concentration of lactate excreted by HeLa cells into media was considerably reduced by treatment with Pt(IV) complexes 3 and 4 containing DCF ligands; the effect was dependent on the number of coordinated DCF molecules.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "shown", "in", "Figure", "3A", ",", "the", "concentration", "of", "lactate", "excreted", "by", "HeLa", "cells", "into", "media", "was", "considerably", "reduced", "by", "treatment", "with", "Pt(IV", ")", "complexes", "3", "and", "4", "containing", "DCF", "ligands", ";", "the", "effect", "was", "dependent", "on", "the", "number", "of", "coordinated", "DCF", "molecules", "." ] } ]
PMC11530949
ROS Measurements The H2DCFDA kit was utilized to assess the ROS generated by the extract and the doped NPs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ROS", "Measurements", "The", "H2DCFDA", "kit", "was", "utilized", "to", "assess", "the", "ROS", "generated", "by", "the", "extract", "and", "the", "doped", "NPs", "." ] } ]
PMC9429973
In CAPTIVATE, pts received three 28-d cycles of I, followed by 12 cycles of I+V (I 420 mg/d orally; V ramp-up to 400 mg/d orally).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "CAPTIVATE", ",", "pts", "received", "three", "28-d", "cycles", "of", "I", ",", "followed", "by", "12", "cycles", "of", "I+V", "(", "I", "420", "mg/d", "orally", ";", "V", "ramp-up", "to", "400", "mg/d", "orally", ")", "." ] } ]
PMC11724582
First- and second-generation EGFR-TKIs have been listed successively, and great progress has been made in their clinical treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "First-", "and", "second-generation", "EGFR-TKIs", "have", "been", "listed", "successively", ",", "and", "great", "progress", "has", "been", "made", "in", "their", "clinical", "treatment", "." ] } ]
PMC11225860
Aneuploidy is a direct outcome of this instability.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aneuploidy", "is", "a", "direct", "outcome", "of", "this", "instability", "." ] } ]
PMC8922418
The pegRNA consists of three elements: a sgRNA corresponding to the target site, a primer binding sequence, and a reverse transcription template storing genetic information for targeting (Anzalone et al., 2019).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "pegRNA", "consists", "of", "three", "elements", ":", "a", "sgRNA", "corresponding", "to", "the", "target", "site", ",", "a", "primer", "binding", "sequence", ",", "and", "a", "reverse", "transcription", "template", "storing", "genetic", "information", "for", "targeting", "(", "Anzalone", "et", "al.", ",", "2019", ")", "." ] } ]
PMC7229095
Media in CLD have different requirements depending on the process step.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Media", "in", "CLD", "have", "different", "requirements", "depending", "on", "the", "process", "step", "." ] } ]
PMC9512971
It is considered that the epidemic strain at the time was a D614G strain, but no data on the type of strain were collected for this study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", "considered", "that", "the", "epidemic", "strain", "at", "the", "time", "was", "a", "D614", "G", "strain", ",", "but", "no", "data", "on", "the", "type", "of", "strain", "were", "collected", "for", "this", "study", "." ] } ]
PMC11752767
This phenomenon may result from the recognition of the MAGE-A12 protein expressed in a subset of neurons in the human brain, leading to a calamitous immune response to the white matter.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "phenomenon", "may", "result", "from", "the", "recognition", "of", "the", "MAGE-A12", "protein", "expressed", "in", "a", "subset", "of", "neurons", "in", "the", "human", "brain", ",", "leading", "to", "a", "calamitous", "immune", "response", "to", "the", "white", "matter", "." ] } ]
PMC9429973
CYT-338 bound MM cell lines with ~ 2-fold higher mean fluorescence intensity than anti-CD38 monoclonal antibody (mAb) or daratumumab alone.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CYT-338", "bound", "MM", "cell", "lines", "with", "~", "2-fold", "higher", "mean", "fluorescence", "intensity", "than", "anti-CD38", "monoclonal", "antibody", "(", "mAb", ")", "or", "daratumumab", "alone", "." ] } ]
PMC6379402
In the main paper, we use initial solutions based on singular value decomposition of the average adjacency matrix , where a is the number of to be decomposed adjacency matrices, following the idea of Qiao.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "main", "paper", ",", "we", "use", "initial", "solutions", "based", "on", "singular", "value", "decomposition", "of", "the", "average", "adjacency", "matrix", ",", "where", "a", "is", "the", "number", "of", "to", "be", "decomposed", "adjacency", "matrices", ",", "following", "the", "idea", "of", "Qiao", "." ] } ]
PMC4270159
KHM-3S: p-EGFR Y1068.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "KHM-3S", ":", "p-EGFR", "Y1068", "." ] } ]
PMC9429973
While retrospective data suggest PTCy show low rates of chronic GVHD, potential disadvantages of PTCy include increased risks of CMV reactivation, veno-occlusive disease (VOD), haemorrhagic cystitis and exposure of donor haematopoiesis to high-dose alkylator resulting in DNA damage and potential for secondary myeloid neoplasia.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "retrospective", "data", "suggest", "PTCy", "show", "low", "rates", "of", "chronic", "GVHD", ",", "potential", "disadvantages", "of", "PTCy", "include", "increased", "risks", "of", "CMV", "reactivation", ",", "veno-occlusive", "disease", "(", "VOD", ")", ",", "haemorrhagic", "cystitis", "and", "exposure", "of", "donor", "haematopoiesis", "to", "high-dose", "alkylator", "resulting", "in", "DNA", "damage", "and", "potential", "for", "secondary", "myeloid", "neoplasia", "." ] } ]
PMC10957991
In the case of cardiac fibroblasts, TRPV4-dependent differentiation seems to be orchestrated by both biochemical and mechanical cues and involves actomyosin-regulating Rho kinase pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "case", "of", "cardiac", "fibroblasts", ",", "TRPV4-dependent", "differentiation", "seems", "to", "be", "orchestrated", "by", "both", "biochemical", "and", "mechanical", "cues", "and", "involves", "actomyosin-regulating", "Rho", "kinase", "pathway", "." ] } ]
PMC10976516
In addition to boosting the trafficking of cells to tumors, cell carriers, and their viral payloads, can be altered to enhance many elements of cell-mediated OV delivery, such as loading capacity, virus generation, and delivery to tumor cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", "to", "boosting", "the", "trafficking", "of", "cells", "to", "tumors", ",", "cell", "carriers", ",", "and", "their", "viral", "payloads", ",", "can", "be", "altered", "to", "enhance", "many", "elements", "of", "cell-mediated", "OV", "delivery", ",", "such", "as", "loading", "capacity", ",", "virus", "generation", ",", "and", "delivery", "to", "tumor", "cells", "." ] } ]
PMC6160470
The cell viability was evaluated by MTT assay after 72 h of incubation, and the percentage of viable cells was calculated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cell", "viability", "was", "evaluated", "by", "MTT", "assay", "after", "72", "h", "of", "incubation", ",", "and", "the", "percentage", "of", "viable", "cells", "was", "calculated", "." ] } ]
PMC9370419
Twenty-four hours after transfection, the cells from one well were digested and cultured in a 10 cm dish, subjected to 300 µg/mL hygromycin, and selected for two weeks.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Twenty-four", "hours", "after", "transfection", ",", "the", "cells", "from", "one", "well", "were", "digested", "and", "cultured", "in", "a", "10", "cm", "dish", ",", "subjected", "to", "300", "µg/mL", "hygromycin", ",", "and", "selected", "for", "two", "weeks", "." ] } ]
PMC11737091
For further analysis, the tumor tissue sections were stained for Ki-67 to enhance the validity of the vivo experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "further", "analysis", ",", "the", "tumor", "tissue", "sections", "were", "stained", "for", "Ki-67", "to", "enhance", "the", "validity", "of", "the", "vivo", "experiments", "." ] } ]
PMC9780037
A recent review discusses the biochemical properties of cyt c that enable its repurposing as a proapoptotic chemotherapeutic drug and describes several cyt c cell delivery systems for cancer therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "recent", "review", "discusses", "the", "biochemical", "properties", "of", "cyt", "c", "that", "enable", "its", "repurposing", "as", "a", "proapoptotic", "chemotherapeutic", "drug", "and", "describes", "several", "cyt", "c", "cell", "delivery", "systems", "for", "cancer", "therapy", "." ] } ]
PMC11626627
In previous studies, we discovered that ERβ promotes the progression of ccRCC by regulating the circATP2B1/miR-204–3p signaling pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "previous", "studies", ",", "we", "discovered", "that", "ERβ", "promotes", "the", "progression", "of", "ccRCC", "by", "regulating", "the", "circATP2B1/miR-204–3p", "signaling", "pathway", "." ] } ]
PMC11306019
MAC, was adopted from Br J Haematol.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MAC", ",", "was", "adopted", "from", "Br", "J", "Haematol", "." ] } ]
PMC11765988
The underlying link remains uncertain but may involve chronic immune system activation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "underlying", "link", "remains", "uncertain", "but", "may", "involve", "chronic", "immune", "system", "activation", "." ] } ]
PMC10914904
vtRNAs may remain unprocessed and protected from methylation by the SRSF2 protein.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "vtRNAs", "may", "remain", "unprocessed", "and", "protected", "from", "methylation", "by", "the", "SRSF2", "protein", "." ] } ]
PMC11515150
Cytotoxicity of 12 C CAR-NK cells and NT-NK cells against normal T cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cytotoxicity", "of", "12", "C", "CAR-NK", "cells", "and", "NT-NK", "cells", "against", "normal", "T", "cells", "." ] } ]
PMC11670407
P < 0.05, **P < 0.01 vs. the corresponding control Since ROS are known to trigger or promote the mitochondrial apoptotic pathway under cisplatin treatment and GPX4 functions as a resistance molecule to ROS , we hypothesized that increased cisplatin-induced apoptosis due to OTULIN depletion in osteosarcoma cells is associated with GPX4 deficiency and increased mitochondrial oxidative stress.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P", "<", "0.05", ",", "*", "*", "P", "<", "0.01", "vs.", "the", "corresponding", "control", "Since", "ROS", "are", "known", "to", "trigger", "or", "promote", "the", "mitochondrial", "apoptotic", "pathway", "under", "cisplatin", "treatment", "and", "GPX4", "functions", "as", "a", "resistance", "molecule", "to", "ROS", ",", "we", "hypothesized", "that", "increased", "cisplatin-induced", "apoptosis", "due", "to", "OTULIN", "depletion", "in", "osteosarcoma", "cells", "is", "associated", "with", "GPX4", "deficiency", "and", "increased", "mitochondrial", "oxidative", "stress", "." ] } ]
PMC11679892
In addition, no significant change was observed in Bcl-2 gene expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "no", "significant", "change", "was", "observed", "in", "Bcl-2", "gene", "expression", "." ] } ]
PMC11093197
To measure RAS activity, we performed a RAS‐GTP binding assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "measure", "RAS", "activity", ",", "we", "performed", "a", "RAS‐GTP", "binding", "assay", "." ] } ]
PMC10631132
In short, cells were fixed using 4% PFA, washed, staining mix was added to the plate and incubated for 20 min at 37°C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "short", ",", "cells", "were", "fixed", "using", "4", "%", "PFA", ",", "washed", ",", "staining", "mix", "was", "added", "to", "the", "plate", "and", "incubated", "for", "20", "min", "at", "37", "°", "C", "." ] } ]
PMC9429973
For sITP, overall IRR was 1.37 [1.06; 1.74] for any fracture, and 1.65 [1.16; 2.29] for hip – and femoral fractures.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "sITP", ",", "overall", "IRR", "was", "1.37", "[", "1.06", ";", "1.74", "]", "for", "any", "fracture", ",", "and", "1.65", "[", "1.16", ";", "2.29", "]", "for", "hip", "–", "and", "femoral", "fractures", "." ] } ]
PMC8633974
Each of the experiments were performed in triplicate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Each", "of", "the", "experiments", "were", "performed", "in", "triplicate", "." ] } ]
PMC5925824
GloResponse NFAT-luc2/PD1 Jurkat cells (Promega) were re-suspended in assay buffer at a concentration of 1.25 × 10 /ml and added to the plate at 40 μl per well.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "GloResponse", "NFAT-luc2/PD1", "Jurkat", "cells", "(", "Promega", ")", "were", "re-suspended", "in", "assay", "buffer", "at", "a", "concentration", "of", "1.25", "×", "10", "/ml", "and", "added", "to", "the", "plate", "at", "40", "μl", "per", "well", "." ] } ]
PMC9429973
Although hematopoietic stem cell transplantation involves a high risk of mortality, it is nowadays the only curative treatment for MF.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "hematopoietic", "stem", "cell", "transplantation", "involves", "a", "high", "risk", "of", "mortality", ",", "it", "is", "nowadays", "the", "only", "curative", "treatment", "for", "MF", "." ] } ]
PMC11787355
Nevertheless, to experimentally assess potential off-targets, we applied ARDitox, an in silico artificial intelligence (AI)-based prediction tool for off-target TCR binding.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Nevertheless", ",", "to", "experimentally", "assess", "potential", "off-targets", ",", "we", "applied", "ARDitox", ",", "an", "in", "silico", "artificial", "intelligence", "(AI)-based", "prediction", "tool", "for", "off-target", "TCR", "binding", "." ] } ]
PMC11719944
As a result, further immunological assessments of the phenotype and function of relevant T cell subtypes are essential for more accurate prediction, monitoring, and classification of patients with T1D.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "a", "result", ",", "further", "immunological", "assessments", "of", "the", "phenotype", "and", "function", "of", "relevant", "T", "cell", "subtypes", "are", "essential", "for", "more", "accurate", "prediction", ",", "monitoring", ",", "and", "classification", "of", "patients", "with", "T1D", "." ] } ]
PMC9429973
Clinical and laboratory features, as well as outcome measures (response rates, progression free and overall survival) were compared between patients with and without concomitant statin use.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Clinical", "and", "laboratory", "features", ",", "as", "well", "as", "outcome", "measures", "(", "response", "rates", ",", "progression", "free", "and", "overall", "survival", ")", "were", "compared", "between", "patients", "with", "and", "without", "concomitant", "statin", "use", "." ] } ]
PMC11747885
However, significant differences in viability levels were observed when cells were exposed to 40 μM menadione, a compound known to induce ROS-based cellular stress.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "significant", "differences", "in", "viability", "levels", "were", "observed", "when", "cells", "were", "exposed", "to", "40", "μM", "menadione", ",", "a", "compound", "known", "to", "induce", "ROS-based", "cellular", "stress", "." ] } ]
PMC11594806
This Gs signaling, initiated by extracellular ADO, activates adenylate cyclase, leading to intracellular accumulation of cyclic AMP (cAMP).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "Gs", "signaling", ",", "initiated", "by", "extracellular", "ADO", ",", "activates", "adenylate", "cyclase", ",", "leading", "to", "intracellular", "accumulation", "of", "cyclic", "AMP", "(", "cAMP", ")", "." ] } ]
PMC5311252
miR-372-3p or the reference small RNA RNU48 were reverse-transcribed using Bio-Rad MyCycler thermal cycler with TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, 4366596) according to product protocol, and miR-372-3p or RNU48 RT primer from TaqMan MicroRNA Assay (Life Technolgies, 4427975.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "miR-372", "-", "3p", "or", "the", "reference", "small", "RNA", "RNU48", "were", "reverse-transcribed", "using", "Bio-Rad", "MyCycler", "thermal", "cycler", "with", "TaqMan", "MicroRNA", "Reverse", "Transcription", "Kit", "(", "Thermo", "Fisher", "Scientific", ",", "4366596", ")", "according", "to", "product", "protocol", ",", "and", "miR-372", "-", "3p", "or", "RNU48", "RT", "primer", "from", "TaqMan", "MicroRNA", "Assay", "(", "Life", "Technolgies", ",", "4427975", "." ] } ]
PMC11502443
Non-normalized Emin and Emax values are summarized in Supplementary Table S1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Non-normalized", "Emin", "and", "Emax", "values", "are", "summarized", "in", "Supplementary", "Table", "S1", "." ] } ]
PMC8345486
The MTT assay was performed as described in the Supplementary Materials in some experiments with drugs for comparison with NR results.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "MTT", "assay", "was", "performed", "as", "described", "in", "the", "Supplementary", "Materials", "in", "some", "experiments", "with", "drugs", "for", "comparison", "with", "NR", "results", "." ] } ]
PMC8903741
Therefore, it was difficult to promptly confirm the transfection efficiency and to selectively differentiate the antibody gene-transfected clones.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "it", "was", "difficult", "to", "promptly", "confirm", "the", "transfection", "efficiency", "and", "to", "selectively", "differentiate", "the", "antibody", "gene-transfected", "clones", "." ] } ]
PMC11209164
A slightly greater but statistically significant enhancement in impact on virus titers was observed with TPF-VSVΔ51 compared to DMF- VSVΔ51.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "slightly", "greater", "but", "statistically", "significant", "enhancement", "in", "impact", "on", "virus", "titers", "was", "observed", "with", "TPF-VSVΔ51", "compared", "to", "DMF-", "VSVΔ51", "." ] } ]
PMC11711127
The study showed that NK cells in EAE mice can induce anergy in CD4+ T cells upon histidine triad nucleotide binding protein 1 (HINT1)/heat shock protein 70 (Hsp70) treatment rather than inducing necrosis or apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "study", "showed", "that", "NK", "cells", "in", "EAE", "mice", "can", "induce", "anergy", "in", "CD4", "+", "T", "cells", "upon", "histidine", "triad", "nucleotide", "binding", "protein", "1", "(HINT1)/heat", "shock", "protein", "70", "(", "Hsp70", ")", "treatment", "rather", "than", "inducing", "necrosis", "or", "apoptosis", "." ] } ]
PMC9429973
V. Bumbea, H. Bumbea, L. Ardelean, L. Radulescu, L. Damian, I. Dumitru, C. Lambert, V. Popov, C. Tomuleasa, A.-M. Vladareanu Dyalisis, Emergency Hospital Bucharest; University of Medicine and Pharmacy Carol Davila Bucharest; Hematology Blood and Marrow Transplant Unit; Nephrology; Blood Unit, Emergency University Hospital Bucharest, Bucharest, Romania; CHU de Saint Etienne, Saint Etienne, France; Hematology, Clinical Colentina Hospital Bucharest, Bucharest; Hematology, Institute of Onclology Cluj Napoca; University of Medicine and Pharmacy Iuliu Hateganu, Cluj Napoca; Hematology, Emergency University Hospital Bucharest, Bucharest, Romania Background: COVID-19 infection is known to associate an important inflammatory response with high risk for organ damages and thrombotic events.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "V.", "Bumbea", ",", "H.", "Bumbea", ",", "L.", "Ardelean", ",", "L.", "Radulescu", ",", "L.", "Damian", ",", "I.", "Dumitru", ",", "C.", "Lambert", ",", "V.", "Popov", ",", "C.", "Tomuleasa", ",", "A.-M.", "Vladareanu", "Dyalisis", ",", "Emergency", "Hospital", "Bucharest", ";", "University", "of", "Medicine", "and", "Pharmacy", "Carol", "Davila", "Bucharest", ";", "Hematology", "Blood", "and", "Marrow", "Transplant", "Unit", ";", "Nephrology", ";", "Blood", "Unit", ",", "Emergency", "University", "Hospital", "Bucharest", ",", "Bucharest", ",", "Romania", ";", "CHU", "de", "Saint", "Etienne", ",", "Saint", "Etienne", ",", "France", ";", "Hematology", ",", "Clinical", "Colentina", "Hospital", "Bucharest", ",", "Bucharest", ";", "Hematology", ",", "Institute", "of", "Onclology", "Cluj", "Napoca", ";", "University", "of", "Medicine", "and", "Pharmacy", "Iuliu", "Hateganu", ",", "Cluj", "Napoca", ";", "Hematology", ",", "Emergency", "University", "Hospital", "Bucharest", ",", "Bucharest", ",", "Romania", "Background", ":", "COVID-19", "infection", "is", "known", "to", "associate", "an", "important", "inflammatory", "response", "with", "high", "risk", "for", "organ", "damages", "and", "thrombotic", "events", "." ] } ]
PMC11632064
ES, enrichment score; NES, normalized enrichment score; NOM p, nominal P-value; FDR q, false-discovery rate q-value.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ES", ",", "enrichment", "score", ";", "NES", ",", "normalized", "enrichment", "score", ";", "NOM", "p", ",", "nominal", "P-value", ";", "FDR", "q", ",", "false-discovery", "rate", "q-value", "." ] } ]
PMC11361748
On day 2, cells were treated with 20 nM TPA in full serum medium for 6 h. After rinsing (1× PBS), 2 ml serum-reduced medium (0.1% FBS) was added cells incubated for another 24 h. CM was collected using a 3 ml syringe (BD Syringe) and filtered through a 0.22 μm PVDF syringe filter (Millipore #SLGVM33RS), divided into aliquots and stored at −20°C until use.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "day", "2", ",", "cells", "were", "treated", "with", "20", "nM", "TPA", "in", "full", "serum", "medium", "for", "6", "h.", "After", "rinsing", "(", "1", "×", "PBS", ")", ",", "2", "ml", "serum-reduced", "medium", "(", "0.1", "%", "FBS", ")", "was", "added", "cells", "incubated", "for", "another", "24", "h.", "CM", "was", "collected", "using", "a", "3", "ml", "syringe", "(", "BD", "Syringe", ")", "and", "filtered", "through", "a", "0.22", "μm", "PVDF", "syringe", "filter", "(", "Millipore", "#", "SLGVM33RS", ")", ",", "divided", "into", "aliquots", "and", "stored", "at", "−20", "°", "C", "until", "use", "." ] } ]
PMC7192625
In addition, Hi-C cannot easily assess the significance of inter-chromosomal interactions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "Hi-C", "can", "not", "easily", "assess", "the", "significance", "of", "inter-chromosomal", "interactions", "." ] } ]
PMC11774747
Consequently, no immediate rejection of CAR-VST by recipient T cells was observed even after multiple infusions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Consequently", ",", "no", "immediate", "rejection", "of", "CAR-VST", "by", "recipient", "T", "cells", "was", "observed", "even", "after", "multiple", "infusions", "." ] } ]
PMC9429973
Methods: Diagnostic bone marrow samples from 261 children with B-ALL and 22 matching samples drawn from 21 patients at first or second relapse were investigated by digital multiplex ligation-dependent probe amplification (digitalMLPA) using the ALL-specific D007 probemix.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Methods", ":", "Diagnostic", "bone", "marrow", "samples", "from", "261", "children", "with", "B-ALL", "and", "22", "matching", "samples", "drawn", "from", "21", "patients", "at", "first", "or", "second", "relapse", "were", "investigated", "by", "digital", "multiplex", "ligation-dependent", "probe", "amplification", "(", "digitalMLPA", ")", "using", "the", "ALL-specific", "D007", "probemix", "." ] } ]
PMC9243326
The numbers and lengths of 5′ UTRs, 3′ UTRs, and CDSs were identified using the ANGEL software.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "numbers", "and", "lengths", "of", "5′", "UTRs", ",", "3′", "UTRs", ",", "and", "CDSs", "were", "identified", "using", "the", "ANGEL", "software", "." ] } ]
PMC9164404
The increased expression of ABAT in the Abplatin-treated cells might be the one of reasons for its cell killing effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "increased", "expression", "of", "ABAT", "in", "the", "Abplatin-treated", "cells", "might", "be", "the", "one", "of", "reasons", "for", "its", "cell", "killing", "effect", "." ] } ]
PMC11350568
As indicated in Figure 3a,b, by co-incubating AptGs with Cy5-Sgc8c or FAM-HG1–9, AptG-1 could still efficiently bind to CCRF-CEM, forming a stable TMPDS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "indicated", "in", "Figure", "3a", ",", "b", ",", "by", "co-incubating", "AptGs", "with", "Cy5-Sgc8c", "or", "FAM-HG1–9", ",", "AptG-1", "could", "still", "efficiently", "bind", "to", "CCRF-CEM", ",", "forming", "a", "stable", "TMPDS", "." ] } ]
PMC10907726
Importantly, numerous studies have reported the inhibitory effects of DATS in various cancers, including breast cancer, gastric cancer, glioblastoma, hepatocellular carcinoma, esophageal cancer, and bladder cancer [, , , , ].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Importantly", ",", "numerous", "studies", "have", "reported", "the", "inhibitory", "effects", "of", "DATS", "in", "various", "cancers", ",", "including", "breast", "cancer", ",", "gastric", "cancer", ",", "glioblastoma", ",", "hepatocellular", "carcinoma", ",", "esophageal", "cancer", ",", "and", "bladder", "cancer", "[", ",", ",", ",", ",", "]", "." ] } ]
PMC11286266
S1P and S2P cleavage sites were also mutated to increase expression yield.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "S1P", "and", "S2P", "cleavage", "sites", "were", "also", "mutated", "to", "increase", "expression", "yield", "." ] } ]
PMC11588008
This finding indicated that HUC-MSCs had significant repair and clearance effects on abnormal ROS generated by PM-induced damage to ovarian cancer cells (Figure 5a and b).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "finding", "indicated", "that", "HUC-MSCs", "had", "significant", "repair", "and", "clearance", "effects", "on", "abnormal", "ROS", "generated", "by", "PM-induced", "damage", "to", "ovarian", "cancer", "cells", "(", "Figure", "5a", "and", "b", ")", "." ] } ]
PMC11291490
d The expression of E protein was measured in vivo.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "d", "The", "expression", "of", "E", "protein", "was", "measured", "in", "vivo", "." ] } ]
PMC11277157
PARK7 (DJ-1) was extensively studied for its function as an oxidative stress sensor and in executing the oxidative stress cellular response.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PARK7", "(", "DJ-1", ")", "was", "extensively", "studied", "for", "its", "function", "as", "an", "oxidative", "stress", "sensor", "and", "in", "executing", "the", "oxidative", "stress", "cellular", "response", "." ] } ]
PMC10588957
The Statistical Product and Service Solutions software (SPSS version 22.0) was used for data analyses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Statistical", "Product", "and", "Service", "Solutions", "software", "(", "SPSS", "version", "22.0", ")", "was", "used", "for", "data", "analyses", "." ] } ]
PMC10607604
EMT, which is induced by PTPN13 KO/KD in our model, plays an important role in platinum salt resistance in various tumor types (for review, ), including ovarian cancer (for review, ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "EMT", ",", "which", "is", "induced", "by", "PTPN13", "KO/KD", "in", "our", "model", ",", "plays", "an", "important", "role", "in", "platinum", "salt", "resistance", "in", "various", "tumor", "types", "(", "for", "review", ",", ")", ",", "including", "ovarian", "cancer", "(", "for", "review", ",", ")", "." ] } ]
PMC9429973
None of the controls had anti-PF4/polyanion antibodies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "None", "of", "the", "controls", "had", "anti-PF4/polyanion", "antibodies", "." ] } ]
PMC11706776
G Effect of GW542573X on CCE using Mn quenching assay and the normalized Mn quenching slope (N = 28 for Control and N = 20 for GW542573X condition). *
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "G", "Effect", "of", "GW542573X", "on", "CCE", "using", "Mn", "quenching", "assay", "and", "the", "normalized", "Mn", "quenching", "slope", "(", "N", "=", "28", "for", "Control", "and", "N", "=", "20", "for", "GW542573X", "condition", ")", ".", "*" ] } ]
PMC11040965
Similar effects are obtained with decitabine treatment of U266 and RPMI 8226 cells, suggesting that proteasome subunit genes are mainly regulated by methylation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similar", "effects", "are", "obtained", "with", "decitabine", "treatment", "of", "U266", "and", "RPMI", "8226", "cells", ",", "suggesting", "that", "proteasome", "subunit", "genes", "are", "mainly", "regulated", "by", "methylation", "." ] } ]
PMC11335267
All mice from either background were males of 16–20 weeks of age.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "mice", "from", "either", "background", "were", "males", "of", "16–20", "weeks", "of", "age", "." ] } ]
PMC6799808
β-Tubulin served as a loading control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "β-Tubulin", "served", "as", "a", "loading", "control", "." ] } ]
PMC11788920
The sequence of the 27 nt long PQS of the c-Myc promoter is follows: TGGGGAGGGTGGGGAGGGTGGGGAAGG, with the underlined five G-tracts shown to form two different GQ structures .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "sequence", "of", "the", "27", "nt", "long", "PQS", "of", "the", "c-Myc", "promoter", "is", "follows", ":", "TGGGGAGGGTGGGGAGGGTGGGGAAGG", ",", "with", "the", "underlined", "five", "G-tracts", "shown", "to", "form", "two", "different", "GQ", "structures", "." ] } ]
PMC9429973
Continuous variables are reported as means with standard deviations, while categorical variables are presented as percentages.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Continuous", "variables", "are", "reported", "as", "means", "with", "standard", "deviations", ",", "while", "categorical", "variables", "are", "presented", "as", "percentages", "." ] } ]
PMC9429973
CD7-ablated CAR T cells (KO7CAR) were derived by electroporation of bulk T cells with CD7-targeting Cas9-gRNA RNP 24 hours before 7CAR transduction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD7-ablated", "CAR", "T", "cells", "(", "KO7CAR", ")", "were", "derived", "by", "electroporation", "of", "bulk", "T", "cells", "with", "CD7-targeting", "Cas9-gRNA", "RNP", "24", "hours", "before", "7CAR", "transduction", "." ] } ]
PMC11013014
Compound 22 exhibits activity on both HL60 and HCT116 cell lines at 10 µM with viabilities of 14% and 21%, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "22", "exhibits", "activity", "on", "both", "HL60", "and", "HCT116", "cell", "lines", "at", "10", "µM", "with", "viabilities", "of", "14", "%", "and", "21", "%", ",", "respectively", "." ] } ]
PMC9429973
Thus, treatment of MF pts with thrombocytopenia confers a unique challenge and unmet medical need.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "treatment", "of", "MF", "pts", "with", "thrombocytopenia", "confers", "a", "unique", "challenge", "and", "unmet", "medical", "need", "." ] } ]
PMC11694066
For replication fork labeling, cells received prewarmed medium containing 100 μmol/L 5-chloro-2′-deoxyuridine and were incubated at 37°C and 5% CO2 for 30 minutes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "replication", "fork", "labeling", ",", "cells", "received", "prewarmed", "medium", "containing", "100", "μmol/L", "5-chloro-2′-deoxyuridine", "and", "were", "incubated", "at", "37", "°", "C", "and", "5", "%", "CO2", "for", "30", "minutes", "." ] } ]
PMC11627398
These results showed that SLC31A1, MTF1, LIAS and LIPT1 may serve as potential biomarkers for the diagnosis of septic shock.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "showed", "that", "SLC31A1", ",", "MTF1", ",", "LIAS", "and", "LIPT1", "may", "serve", "as", "potential", "biomarkers", "for", "the", "diagnosis", "of", "septic", "shock", "." ] } ]
PMC11045125
This is the first demonstration that latent EBV infection combined with Myc over-expression in normal human B cells is sufficient to induce Burkitt-like lymphomas in mice.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "is", "the", "first", "demonstration", "that", "latent", "EBV", "infection", "combined", "with", "Myc", "over-expression", "in", "normal", "human", "B", "cells", "is", "sufficient", "to", "induce", "Burkitt-like", "lymphomas", "in", "mice", "." ] } ]
PMC11607321
The generation of large-scale multi-omic datasets is both time and resource-intensive, thereby positioning MOSA as a valuable tool for in silico testing and prioritization of drug targets for experimental validation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "generation", "of", "large-scale", "multi-omic", "datasets", "is", "both", "time", "and", "resource-intensive", ",", "thereby", "positioning", "MOSA", "as", "a", "valuable", "tool", "for", "in", "silico", "testing", "and", "prioritization", "of", "drug", "targets", "for", "experimental", "validation", "." ] } ]
PMC9429973
All patients received the full dose as planned, except for 1 patient at the 36-month follow-up visit who experienced infusion/technical problems.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "patients", "received", "the", "full", "dose", "as", "planned", ",", "except", "for", "1", "patient", "at", "the", "36-month", "follow-up", "visit", "who", "experienced", "infusion/technical", "problems", "." ] } ]
PMC7185206
Additional cell lines, inhibitors, and concentrations shown in Supplemental Figures 3 and 4. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additional", "cell", "lines", ",", "inhibitors", ",", "and", "concentrations", "shown", "in", "Supplemental", "Figures", "3", "and", "4", ".", "(" ] } ]
PMC10482220
Thus, the recruitment of domain D to SGs could simply be mediated by its affinity for RNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "recruitment", "of", "domain", "D", "to", "SGs", "could", "simply", "be", "mediated", "by", "its", "affinity", "for", "RNA", "." ] } ]
PMC11658074
WB analysis confirmed the increased APN levels in AT-EVs (Fig. S14).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "WB", "analysis", "confirmed", "the", "increased", "APN", "levels", "in", "AT-EVs", "(", "Fig.", "S14", ")", "." ] } ]
PMC5811757
Based on the recommendations of the Cell Bank (ECACC) to maintain high P-gp levels, 10μM Doxorubicin (Tedec-Meiji Farma, S.A, Spain) was added to the culture medium once a week, usually after each passage.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Based", "on", "the", "recommendations", "of", "the", "Cell", "Bank", "(", "ECACC", ")", "to", "maintain", "high", "P-gp", "levels", ",", "10μM", "Doxorubicin", "(", "Tedec-Meiji", "Farma", ",", "S.A", ",", "Spain", ")", "was", "added", "to", "the", "culture", "medium", "once", "a", "week", ",", "usually", "after", "each", "passage", "." ] } ]
PMC11509309
Thus, the level of luciferase expressed in these cells is proportional to the level of CHOP induction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "level", "of", "luciferase", "expressed", "in", "these", "cells", "is", "proportional", "to", "the", "level", "of", "CHOP", "induction", "." ] } ]
PMC9429973
ORR for 29 pts who crossed over to ZO was 24.1%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ORR", "for", "29", "pts", "who", "crossed", "over", "to", "ZO", "was", "24.1", "%", "." ] } ]
PMC11720808
Data are shown as mean ± SD (n=5). **
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "shown", "as", "mean", "±", "SD", "(", "n=5", ")", ".", "*", "*" ] } ]
PMC11472569
It has been reported to transport several anticancer drugs, including mitoxantrone, topotecan, and irinotecan.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "reported", "to", "transport", "several", "anticancer", "drugs", ",", "including", "mitoxantrone", ",", "topotecan", ",", "and", "irinotecan", "." ] } ]
PMC9429973
Continuous variables were compared with Mann-Whitney U test, and categorical using Chi-square or Fisher´s exact tests.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Continuous", "variables", "were", "compared", "with", "Mann-Whitney", "U", "test", ",", "and", "categorical", "using", "Chi-square", "or", "Fisher´s", "exact", "tests", "." ] } ]
PMC11742864
Platinum-based drugs are the basic drugs for lung cancer chemotherapy, but resistance is also unavoidable.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Platinum-based", "drugs", "are", "the", "basic", "drugs", "for", "lung", "cancer", "chemotherapy", ",", "but", "resistance", "is", "also", "unavoidable", "." ] } ]
PMC11719944
Exhausted T cells lose their normal functions, such as producing cytokines, killing cells, and multiplying, and start expressing multiple co-inhibitory receptors (CTLA-4, PD-1, LAG-3, TIM3, and TIGIT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Exhausted", "T", "cells", "lose", "their", "normal", "functions", ",", "such", "as", "producing", "cytokines", ",", "killing", "cells", ",", "and", "multiplying", ",", "and", "start", "expressing", "multiple", "co-inhibitory", "receptors", "(", "CTLA-4", ",", "PD-1", ",", "LAG-3", ",", "TIM3", ",", "and", "TIGIT", ")", "." ] } ]
PMC9429973
Tumor CLL B-cells weakly express a B cell receptor (BCR) on the surface which is composed, in the vast majority of cases, of immunoglobulins (Ig) of the mu (µ) and delta (δ) isotypes and Ig class-switched CLL are rare, raising the question of abnormalities in the Ig gene recombination machinery in this B-cell cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Tumor", "CLL", "B-cells", "weakly", "express", "a", "B", "cell", "receptor", "(", "BCR", ")", "on", "the", "surface", "which", "is", "composed", ",", "in", "the", "vast", "majority", "of", "cases", ",", "of", "immunoglobulins", "(", "Ig", ")", "of", "the", "mu", "(", "µ", ")", "and", "delta", "(", "δ", ")", "isotypes", "and", "Ig", "class-switched", "CLL", "are", "rare", ",", "raising", "the", "question", "of", "abnormalities", "in", "the", "Ig", "gene", "recombination", "machinery", "in", "this", "B-cell", "cancer", "." ] } ]
PMC8592717
PCA can also be extracted from dried almond hulls (Prunus amygdalus Batsch) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PCA", "can", "also", "be", "extracted", "from", "dried", "almond", "hulls", "(", "Prunus", "amygdalus", "Batsch", ")", "." ] } ]
PMC11746948
After 30 s vortex, then the samples were sonicated for 10 min in ice-water bath.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "30", "s", "vortex", ",", "then", "the", "samples", "were", "sonicated", "for", "10", "min", "in", "ice-water", "bath", "." ] } ]
PMC11621565
16 µg/ml of curli CsgA and PSMα1 did not modify the mRNA levels of α-synuclein in dopaminergic-differentiated SH-SY5Y cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "16", "µg/ml", "of", "curli", "CsgA", "and", "PSMα1", "did", "not", "modify", "the", "mRNA", "levels", "of", "α-synuclein", "in", "dopaminergic-differentiated", "SH-SY5Y", "cells", "." ] } ]
PMC10547921
PDC is an equivalent antibody–drug conjugate that overcomes some of the limitations of ADC and has many unique advantages.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PDC", "is", "an", "equivalent", "antibody", "–", "drug", "conjugate", "that", "overcomes", "some", "of", "the", "limitations", "of", "ADC", "and", "has", "many", "unique", "advantages", "." ] } ]
PMC10831439
Error bars show SD.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Error", "bars", "show", "SD", "." ] } ]
PMC10882807
The relative expression level of hsa_circ_0005397 in HCC tissues were normalized to normal tissues (n = 57). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relative", "expression", "level", "of", "hsa_circ_0005397", "in", "HCC", "tissues", "were", "normalized", "to", "normal", "tissues", "(", "n", "=", "57", ")", ".", "(" ] } ]
PMC11638255
A single-cell dissociation was achieved by passing the mixture through a 70μm MACS SmartStrainer (Miltenyi Biotec, Germany; #130-110-916).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "single-cell", "dissociation", "was", "achieved", "by", "passing", "the", "mixture", "through", "a", "70μm", "MACS", "SmartStrainer", "(", "Miltenyi", "Biotec", ",", "Germany", ";", "#", "130", "-", "110", "-", "916", ")", "." ] } ]
PMC11552389
FSIP1 expression was assessed in melanoma and normal tissue samples. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FSIP1", "expression", "was", "assessed", "in", "melanoma", "and", "normal", "tissue", "samples", ".", "(" ] } ]
PMC11185260
Mice with established tumors were injected twice a week for 6 injections of scL-SMARCB1 (30µg DNA/injection, intravenously administered).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mice", "with", "established", "tumors", "were", "injected", "twice", "a", "week", "for", "6", "injections", "of", "scL-SMARCB1", "(", "30", "µg", "DNA/injection", ",", "intravenously", "administered", ")", "." ] } ]
PMC8903741
Dysregulated MMP9 expression and its abnormal activity are involved in pathological processes that contribute in chronic inflammation, tumorigenesis, and metastasis [2–4].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dysregulated", "MMP9", "expression", "and", "its", "abnormal", "activity", "are", "involved", "in", "pathological", "processes", "that", "contribute", "in", "chronic", "inflammation", ",", "tumorigenesis", ",", "and", "metastasis", "[", "2–4", "]", "." ] } ]