text
stringlengths
0
868k
The metabolic syndrome (mets) is a clustering of metabolic and cardiovascular risk factors that have been widely discussed for at least 20 years . Although some have questioned the clinical utility of metabolic syndrome, there are many reasons to believe that this entity is useful . Identification of metabolic syndrome is a simple measure of finding people with a clustering of risk factors that put them at increased risk of diabetes and cardiovascular disease (cvd). Furthermore, such individuals need more intensive lifestyle interventions at an early stage to delay the disease progression to a still higher - risk category . Also, the identification of metabolic syndrome will attract attention to various other related conditions such as fatty liver, polycystic ovary syndrome, and obstructive sleep apnea . Since the first official definition of the metabolic syndrome put forward by a working group of the world health organization (who) in 1998, a number of different definitions have been proposed . The latest definition given by international diabetes federation (idf) takes into account the evidence that abdominal obesity is an important component of the metabolic syndrome and proposes gender- and race - specific cut - offs for waist circumference (wc). Although the need for different wc is attributed to ethnic variation, it was observed that even within the same population, people with identical wc but different heights have different risks for metabolic syndrome . Several studies from asia indicate that waist - to - height ratio (whtr) is more strongly associated with cvd risk factors than other anthropometric measures such as wc, body mass index (bmi), and waist hip ratio (whr). The aim of our study was to perform a comparative validation of wc, bmi, whr, and whtr for defining the metabolic syndrome in indian population living in the urban and rural areas of rohtak district, haryana, india . We used the idf definition of metabolic syndrome, excluding the measure of obesity, to determine which obesity measure among wc, bmi, whr, and whtr, and what appropriate cut - off value are most closely predictive of the non - adipose components of the idf's definition of metabolic syndrome . Informed consent was obtained after explaining the details of the procedure to all subjects . In rural population of these two rural blocks, 85 anganwadi centers (awc) were selected by the random selection method . From the population survey register of awc, male and female patients were randomly selected and called at the awc on a specified date and time after an overnight fast . In urban areas, two out of total six urban health centers were selected randomly, and from the survey registers of these two health centers, male and female patients were selected randomly . A day before the study, all subjects were advised to observe overnight fasting (at least 8 hours) and called at the nearest health center / awc in the morning . Initial evaluation included detailed history and clinical examination of the subjects to exclude any systemic diseases . Anthropometric indices including height (without shoes and socks), weight, wc, and hip circumference were recorded for the subjects . Height was measured to the nearest 0.1 cm using a portable stadiometer and weight measured to the nearest 0.1 kg using calibrated platform scales . Waist circumference was measured to the nearest 0.1 cm at the midpoint between the subcostal margin and the margin of the supracristal plane according to the idf diagnostic criteria . Hip circumference was measured to the nearest 0.1 cm around the thighs, at the height of the greater trochanter, with the patients in the standing position . Blood pressure was recorded after patients were made to sit and rest for at least half an hour . Blood pressure was recorded thrice at 5-minute intervals in a sitting position in the non - dominant arm, with the value to the nearest 2 mm hg, using a standard adult mercury sphygmomanometer . Patients suffering from chronic renal, pancreatic or other severe illness, pregnant women, and women who delivered 2 months or less preceding the study, patients on lipid lowering agents, steroids, nicotinic acid, or other medications likely to cause dysglycemia, were excluded from the study . In the morning after an overnight fasting period, blood samples were obtained from the antecubital vein and transfused into vacuum tubes containing edta . All patients were allowed to sit and rest for at least half an hour before the blood samples were taken . Plasma glucose, total cholesterol, triglycerides, and hdl - cholesterol were measured . According to the idf definition for the indian population, for an individual to be defined as having the metabolic syndrome, he / she must be diagnosed as having central obesity defined as waist circumference 90 cm in males or 80 cm in females plus any two of the following four factors: (1) triglycerides 150 mg / dl or specific treatment for this lipid abnormality; (2) hdl - cholesterol <40 mg / dl in males or <50 mg / dl in females or specific treatment for this lipid abnormality; (3) sbp 130 mmhg, or dbp 85 mmhg or treatment for previously diagnosed hypertension; (4) fasting plasma glucose 100 mg / dl or previously diagnosed type 2 diabetes . All analyses were done separately for men and women and according to their place of residence . Continuous data were expressed as mean sd . The optimal cut - off points for bmi, wc, whr, and whtr were obtained by selecting a point on the roc curve, which represented the largest sum of sensitivity and specificity . The area under the roc curve (aurc) was used as a measure of discrimination of a predictor . It measures the effectiveness of a diagnostic marker and enables the selection of an optimal threshold value (cut - off point) for the marker . According to the idf definition for the indian population, for an individual to be defined as having the metabolic syndrome, he / she must be diagnosed as having central obesity defined as waist circumference 90 cm in males or 80 cm in females plus any two of the following four factors: (1) triglycerides 150 mg / dl or specific treatment for this lipid abnormality; (2) hdl - cholesterol <40 mg / dl in males or <50 mg / dl in females or specific treatment for this lipid abnormality; (3) sbp 130 mmhg, or dbp 85 mmhg or treatment for previously diagnosed hypertension; (4) fasting plasma glucose 100 mg / dl or previously diagnosed type 2 diabetes . All analyses were done separately for men and women and according to their place of residence . Continuous data were expressed as mean sd . The optimal cut - off points for bmi, wc, whr, and whtr were obtained by selecting a point on the roc curve, which represented the largest sum of sensitivity and specificity . The area under the roc curve (aurc) was used as a measure of discrimination of a predictor . It measures the effectiveness of a diagnostic marker and enables the selection of an optimal threshold value (cut - off point) for the marker . The statistical program for social sciences, version 17.0 (spss inc ., chicago il), was used for all statistical analyses . In the present study, 3,042 individuals were screened for the prevalence of metabolic syndrome and their baseline characteristics, as shown in table 1 . Out of the 3,042 individuals selected, 1,693 were from rural areas (male, 814; and female, 879) and 1,349 from urban areas (male, 704; and female, 645). In our study participants, the prevalence of metabolic syndrome according to the idf criteria was 23.8% and 42.6% in urban men and women, respectively, while it was 14.9% and 36.3% in rural men and women, respectively . In males, high blood pressure was the most common abnormality, followed by low hdl and hypertriglyceridemia . In females, impaired fasting glucose and diabetes mellitus were seen in 23.2% and 10.7% of the men, respectively, while these were seen in 22.7% and 8.7% of the women, respectively . Baseline characteristics of study subjects stratified by gender the roc curve analysis was performed to find out optimal cut - off points for bmi, wc, whr, and whtr . The point on the roc, which represented the largest sum of sensitivity and specificity, was chosen to obtain the optimal cut - off point for each of these four measurements in predicting metabolic syndrome . Figure 1 shows the roc curves of bmi, wc, whr, and whtr for predicting the presence of two or more non - adipose components of metabolic syndrome as defined for both men and women . The optimal cut - off value of wc in urban and rural males was> 89 cm, which was higher than that in urban and rural females, i.e. 83 cm and 79 cm, respectively, while the optimal cut - off for whtr was> 0.51 in rural females, 0.52 in rural males, and 0.53 in both urban males and females . Whr cut - off for the prediction of metabolic syndrome was 0.87 and 0.93, respectively, in rural females and males and 0.92 and 0.95, respectively, in urban females and males . Kg / m in both urban and rural males as well as urban females, while it was> 21 kg / m in rural females . Table 2 shows aurc, optimal cut - off values, and the associated measure of each cut - off value . In both men and women, irrespective of their place of residence, wc was found to be a better predictor of metabolic syndrome than whtr [table 2]. (a) roc curves of bmi, wc, whr, and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in urban females . (b) roc curves of bmi, wc, whr, and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in urban males . (c) roc curves of bmi, wc, whr, and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in rural females . (d) roc curves of bmi, wc, whr, and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in rural males . (e) roc curves of bmi, wc, whr, and whtr to predict the presence of two or more non - adipose components of metabolic syndrome in the entire study population irrespective of gender and place of living areas under the roc curve, cut offs, sensitivity, specificity of wc, bmi, whr and whtr when we compared these anthropometric variables as a predictor of metabolic syndrome irrespective of the place of living and gender, whtr was found to have the best aurc as a predictor of metabolic syndrome at a cut - off value of 0.52 [table 2], and it scored over wc as a predictor of metabolic syndrome (p = 0.001). Varying degree of prevalence of metabolic syndrome is reported from various regions of the world and the indian subcontinent, but very few data is available regarding the prevalence of metabolic syndrome separately in the urban and rural population of haryana and also regarding which anthropometric parameter of adiposity is best suited for urban and rural population . We found a prevalence of 23.8% (168/704), 14.9% (122/814), 42.6% (275/645), and 36.3% (319/879) in urban men, rural men, urban women, and rural women, respectively, using the idf diagnostic criteria . Moreover, the prevalence is more common in urban population than in rural population, which is likely due to the higher educational status and sedentary lifestyle of urban population . We evaluated and compared the extent to which four different anthropometric variables of adiposity (bmi, wc, whr, and whtr) are able to predict two or more non - adipose components of metabolic syndrome using the idf criteria . It was observed that in both urban and rural men and women, wc is a better predictor of metabolic syndrome than the other three anthropometric variables (bmi, whr, and whtr). However, when the entire population was clubbed together and analyzed irrespective of their place of residence and gender, it was found that whtr scored over wc as a predictor of metabolic syndrome . The optimal cut - off of whtr for this prediction was 0.52, which is in accordance with several reports from other asian countries where a cut - off value of whtr> 0.5 appears to offer a simple and reliable index of identifying individuals who face increased future risk of metabolic complications . Traditionally, bmi is a widely popular index of obesity used . Wang et al ., in their study of chinese population, found that bmi and wc are more useful than whr for predicting two or more non - adipose components of metabolic syndrome . However, the majority of asian population is obese and at risk of developing metabolic complications even at bmi cut - off level of 25 kg / m, which is not in accordance with the who bmi cut - off level used to define obesity . This has prompted experts across the globe to redefine bmi standards for asian population, and which is now set at 23 kg / m or above for asian population . In the present study, the bmi cut - off of> 23 kg / m was also predictive of metabolic syndrome, except in rural females where optimal cut - off for bmi was> 21 kg / m . Despite this change in bmi criteria, its use a large number of studies clearly suggest that the degree of central fat distribution is more clearly related to metabolic risk than bmi . In the present study, the comparison of roc of bmi with that of wc showed that bmi is inferior to wc in predicting metabolic syndrome (p = 0.0001). Wc and whr have been used as measures of central adiposity and evidences suggest a greater association of these anthropometric variables with a future metabolic risk than bmi, which is a measure of general obesity . Between wc and whr, several studies have shown that that wc is a better predictor of metabolic syndrome because of variations in the level of hip measurements, differences in cut - off values between men and women and among different ethnic groups, and the possibility of embarrassment to both examiner and examinee when measuring hip circumference . However, the ability of wc to be used as a universal predictor of central adiposity is limited by the use of different methods for the measurement of wc and different cut - offs used for men and women and for different ethnic groups . In the present study, the optimal cut - off value of wc is> 89 cm each in urban and rural males and> 83 cm and> 79 cm in urban and rural females, respectively, and is clearly superior to whr in the prediction of metabolic syndrome (p = 0.0001). Whtr is another anthropometric variable that has been used and found to be a better predictor of metabolic complications in various studies . This is because the height of an individual influences the distribution of body fat, and this factor should be taken into consideration before adopting any anthropometric variable as a measure of adiposity . On average, men are taller than women and have larger waist circumferences . This means that average whtr values are closer for men and women than average wc values because of adjustments for height, and the same value can be used for both genders to indicate increased risk . Earlier reported that whtr is a better parameter of central obesity and obviates the need for numerous wc cut - offs; it may be useful in children where existing parameters are not useful . They also reported that using the average height in various countries and their respective wc cut - offs as defined by the idf consensus definition, the range of whtr varies from 0.51 to 0.58 among males and from 0.47 to 0.54 among females . In the present study, we also observed that a single value of whtr at more than 0.52 is a better predictor of metabolic syndrome in both genders . Moreover, for the first time in the present study, we compared both urban and rural population and found that irrespective of the place of living, a single value of whtr can be used as a marker to identify individuals with a high likelihood of contracting central adiposity and metabolic syndrome . A study conducted on adult females from singapore demonstrated that whtr can act as the best screening tool for cardiovascular risk . In japanese men and women, whtr was found to be a better predictor of metabolic risk compared to other anthropometric indices . Other studies also reported that the whtr is a simple and effective screening tool for cardiovascular risk factors in both men and women . In contrast, a dutch study revealed that height did not significantly influence the differences in measures of adiposity or intra - abdominal fat volume in women, or intra - abdominal fat areas in both genders . Nakamura et al . Reported that whtr did not confer an improved discriminatory performance compared to wc . Kato et al . Concluded that the predictive power of wc was not inferior to whtr, and wc is practically the most convenient measure for predicting metabolic syndrome because of its simplicity . In the present study, the roc and aurc values for wc are better than that for whtr in case of men and women in both urban and rural areas (p = 0.0054), but if one has to use a single value for the ease and simplicity of prediction of metabolic syndrome, irrespective of gender and place of residence, then at a value of 0.52, whtr is a good predictor of metabolic syndrome in comparison to wc where one has to use different values for different gender and place of residence . Also, for disease with a high prevalence in population, such as metabolic syndrome, there is the need for a test with high specificity to ensure all true negative cases are picked up and the test will have a high positive predictive value . The same is true for whtr, when used irrespective of gender and place of residence, which has high specificity as well as youden's index . To conclude, although the predictive value of different gender - specific wc values is clearly superior to other anthropometric measures for the diagnosis of metabolic syndrome in both urban and rural population of both genders, a single value of whtr> 0.52 irrespective of gender and area of residence can be used as a universal screening tool for the identification of individuals at high risk to the development of metabolic complications.
The constructive, or synthetic, biology approach is a fascinating avenue for exploring the boundary between living and nonliving matter . Because the cell is the minimum unit required for life as we currently understand it, various researchers have attempted to construct artificial cells from simple, well - understood chemicals so that phenomena that occur within such artificial cells can be studied, with the ultimate goal of elucidating the origins of life and studying the fundamental functions of living cells123 . In particular, vesicles4, which are spherical microcompartments made of amphiphilic molecules and can encapsulate biological molecules such as proteins56 and dna78910, have often been used as models of biological membranes . Vesicles can be classified as small (defined as having a diameter of <100 nm), large (diameter <1 m), or giant (diameter> 1 m). Giant vesicles (gvs) have been studied extensively because they are similar to living cells in size, shape, and structure . Owing to the size of gvs, morphological changes in gv membranes several methods for preparing gvs have been reported11, including the hydration method1213, the freeze - thaw method14, the electroformation method1516, and the fluidic device method1718 . However, encapsulating proteins and other macromolecules in gvs at high concentrations by means of these methods is difficult . In particular, it is extremely challenging to encapsulate biological materials in sufficient quantity (20 - 30 vol%) to mimic the crowded environment inside cells1920 . To form gvs instantly, weitz and coworkers established a water - in - oil (w / o) emulsion centrifugation method2122 . First, because gvs prepared by this method have low lamellarity2324, their membranes are so thin that they can be deformed easily . Gv membrane deformation induced by ftsz (a bacterial cell division protein), tubulin, and other macromolecules has been studied25262728, and we observed polyhedron - like deformation of gv membranes induced by encapsulation of microspheres2930 . Second, membrane proteins can be inserted into the vesicular membrane by this method, albeit with difficulty31 . For example, the yomo group used this method to study the in vitro synthesis and pore - forming activity of the membrane protein -hemolysin32 . Third, it is possible to generate asymmetric gvs in which the lipid components of the inner and outer leaflets are different22 . Generated asymmetric gvs with cationic lipids in the inner leaflet to encapsulate negatively charged polynucleotides, and with neutral lipids on the outer leaflet to decrease toxicity and nonspecific cellular uptake33 . Fourth, the concentration and volume fraction of substances inside the gvs can be relatively high2834 . For example, nishimura et al . Encapsulated an in vitro transcription - translation system into gvs and used the system to express green fluorescent protein (gfp) within the gvs36 . These five features make w / o emulsion centrifugation an indispensable method for generating cell - mimicking gvs . In previous work, gvs generated by centrifugation were collected by means of a syringe equipped with a long 16 g stainless steel needle containing some of the final aqueous solution22 . In the hands of inexperienced technicians, this collection method could easily result in contamination of the gv with some of the oil . In this study, we used the w / o emulsion centrifugation protocol developed by the yomo group2337, in which precipitated gvs are collected through a hole opened at the bottom of the centrifuge tube in which they are prepared . We prepared gvs encapsulating 1.0 m microspheres, which are similar in size to intracellular organelles . The use of microspheres allowed us to estimate their concentration by calculating their volume fraction . Establishment of a method for preparation of gvs in which materials are densely packed is an important step for creating artificial cells . To confirm the utility of our protocol for various types of inner materials, we also demonstrated that gfp and a small water - soluble fluorescent molecule (uranine) could be encapsulated in the gvs . Prepare a stock solution of 1,2-dioleoyl - sn - glycero-3-phosphocholine (dopc, 25 mm) and a stock solution of texas red 1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine, triethylammonium salt (texas red dhpe, 0.20 mm) in chloroform and store the stock solutions at -20 c . Form a lipid film on the inside surface of a 5 ml glass vial by evaporating a mixture of the dopc stock solution (51.0 l and the texas red dhpe stock solution (19.2 l) under flowing nitrogen gas.incubate the film under reduced pressure overnight and then add 1.0 ml of liquid paraffin (0.86 - 0.89 g / cm) to the vial . Wrap the vial in aluminum foil and incubate it at 80 c o / n at rest . The final concentrations of dopc and texas red dhpe are 1.3 and 3.8 x 10 mm, respectively, and the dopc: texas red dhpe molar ratio is 100:0.3 . Form a lipid film on the inside surface of a 5 ml glass vial by evaporating a mixture of the dopc stock solution (51.0 l and the texas red dhpe stock solution (19.2 l) under flowing nitrogen gas . Incubate the film under reduced pressure overnight and then add 1.0 ml of liquid paraffin (0.86 - 0.89 g / cm) to the vial . Wrap the vial in aluminum foil and incubate it at 80 c o / n at rest . The final concentrations of dopc and texas red dhpe are 1.3 and 3.8 x 10 mm, respectively, and the dopc: texas red dhpe molar ratio is 100:0.3 . Lidded microtube, mix 237.5 l of a dispersion of 1.0 m nonfluorescent microspheres (2.5 vol%) and 12.5 l of a dispersion of 1.0 m fluorescent microspheres (2.5 vol%); this corresponds to a 95:5 (v / v) ratio of nonfluorescent to fluorescent microspheres.add 64 mg of sucrose followed by 125 l of tris - buffered solution (tbs, 1 m) and 875 l of deionized water . The final volume fraction of microspheres is 0.5 vol%, and the final concentrations of tris - hcl (ph 7.5) and sucrose are 0.1 and 0.15 m, respectively.vortex the microtube for 30 sec and then sonicate it for 10 min . In a 1.5 ml lidded microtube, mix 237.5 l of a dispersion of 1.0 m nonfluorescent microspheres (2.5 vol%) and 12.5 l of a dispersion of 1.0 m fluorescent microspheres (2.5 vol%); this corresponds to a 95:5 (v / v) ratio of nonfluorescent to fluorescent microspheres . Add 64 mg of sucrose followed by 125 l of tris - buffered solution (tbs, 1 m) and 875 l of deionized water . The final volume fraction of microspheres is 0.5 vol%, and the final concentrations of tris - hcl (ph 7.5) and sucrose are 0.1 and 0.15 m, respectively . After preparation of 10 ml of a tris - buffered solution (0.1 m tris - hcl [ph 7.5], 0.15 m glucose) in the same procedure as inner aqueous media, place 1 ml of the solution in a 1.5 ml lidded microtube . After preparation of 10 ml of a tris - buffered solution (0.1 m tris - hcl [ph 7.5], 0.15 m glucose) in the same procedure as inner aqueous media, place 1 ml of the solution in a 1.5 ml lidded microtube . Vortex the microtube for 30 sec and then sonicate it for 10 min . Prepare a w / o emulsion containing microspheres . Mix 1 ml of the oil solution (liquid paraffin containing dopc and texas red dhpe) with 300 l of the inner aqueous solution in a 1.5 ml microtube.emulsify the two components in the microtube by using a mechanical homogenizer (an agitator with blades that rotate at high speed) operated at 10,000 rpm for 2 min at rt . Mix 1 ml of the oil solution (liquid paraffin containing dopc and texas red dhpe) with 300 l of the inner aqueous solution in a 1.5 ml microtube . Emulsify the two components in the microtube by using a mechanical homogenizer (an agitator with blades that rotate at high speed) operated at 10,000 rpm for 2 min at rt . Gently layer 300 l of the w / o emulsion on the upper surface of 1 ml of the outer aqueous solution at 4 c in a 1.5 ml lidded microtube . Gently layer 300 l of the w / o emulsion on the upper surface of 1 ml of the outer aqueous solution at 4 c in a 1.5 ml lidded microtube . Collect the gvs . Immediately after chilling the microtube, centrifuge it at 18,000 x g for 30 min . Obtain the precipitated gvs by piercing the bottom of the microtube with a pushpin and collecting one droplet in a sterilized 1.5 ml microtube.dilute the precipitated gv droplet 10 - 100 fold by volume with the outer aqueous solution if the obtained gvs are obtained in quantities large enough to make observation difficult . Immediately after chilling the microtube, obtain the precipitated gvs by piercing the bottom of the microtube with a pushpin and collecting one droplet in a sterilized 1.5 ml microtube . Dilute the precipitated gv droplet 10 - 100 fold by volume with the outer aqueous solution if the obtained gvs are obtained in quantities large enough to make observation difficult . Place an adhesive incubation chamber for in situ polymerase chain reaction and hybridization (chamber size 9 mm x 9 mm x 0.3 mm thick) on top of a microscope cover glass.using a micropipette, deposit 25 l of the diluted precipitated gvs on the specimen area and immediately place another cover glass (approximately 0.15 mm thick) on top of the incubation chamber . Place an adhesive incubation chamber for in situ polymerase chain reaction and hybridization (chamber size 9 mm x 9 mm x 0.3 mm thick) on top of a microscope cover glass . Using a micropipette, deposit 25 l of the diluted precipitated gvs on the specimen area and immediately place another cover glass (approximately 0.15 mm thick) on top of the incubation chamber . Record microscopy images of the vesicles with a microscope (10x, 20x, and 40x objectives) equipped with a 12v100whal - l halogen lamp . Record microscopy images of the vesicles with a microscope (10x, 20x, and 40x objectives) equipped with a 12v100whal - l halogen lamp . Conduct fluorescence microscopy observations . Fit the units with 470 - 495 nm and 565 - 585 nm excitation filters, respectively, and with emission filters that transmit 510 - 550 nm and 600 - 690 nm light, respectively . Fit the units with 470 - 495 nm and 565 - 585 nm excitation filters, respectively, and with emission filters that transmit 510 - 550 nm and 600 - 690 nm light, respectively . Prepare a stock solution of 1,2-dioleoyl - sn - glycero-3-phosphocholine (dopc, 25 mm) and a stock solution of texas red 1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine, triethylammonium salt (texas red dhpe, 0.20 mm) in chloroform and store the stock solutions at -20 c . Form a lipid film on the inside surface of a 5 ml glass vial by evaporating a mixture of the dopc stock solution (51.0 l and the texas red dhpe stock solution (19.2 l) under flowing nitrogen gas.incubate the film under reduced pressure overnight and then add 1.0 ml of liquid paraffin (0.86 - 0.89 g / cm) to the vial . Wrap the vial in aluminum foil and incubate it at 80 c o / n at rest . The final concentrations of dopc and texas red dhpe are 1.3 and 3.8 x 10 mm, respectively, and the dopc: texas red dhpe molar ratio is 100:0.3 . Form a lipid film on the inside surface of a 5 ml glass vial by evaporating a mixture of the dopc stock solution (51.0 l and the texas red dhpe stock solution (19.2 l) under flowing nitrogen gas . Incubate the film under reduced pressure overnight and then add 1.0 ml of liquid paraffin (0.86 - 0.89 g / cm) to the vial . Wrap the vial in aluminum foil and incubate it at 80 c o / n at rest . The final concentrations of dopc and texas red dhpe are 1.3 and 3.8 x 10 mm, respectively, and the dopc: texas red dhpe molar ratio is 100:0.3 . Lidded microtube, mix 237.5 l of a dispersion of 1.0 m nonfluorescent microspheres (2.5 vol%) and 12.5 l of a dispersion of 1.0 m fluorescent microspheres (2.5 vol%); this corresponds to a 95:5 (v / v) ratio of nonfluorescent to fluorescent microspheres.add 64 mg of sucrose followed by 125 l of tris - buffered solution (tbs, 1 m) and 875 l of deionized water . The final volume fraction of microspheres is 0.5 vol%, and the final concentrations of tris - hcl (ph 7.5) and sucrose are 0.1 and 0.15 m, respectively.vortex the microtube for 30 sec and then sonicate it for 10 min . In a 1.5 ml lidded microtube, mix 237.5 l of a dispersion of 1.0 m nonfluorescent microspheres (2.5 vol%) and 12.5 l of a dispersion of 1.0 m fluorescent microspheres (2.5 vol%); this corresponds to a 95:5 (v / v) ratio of nonfluorescent to fluorescent microspheres . Add 64 mg of sucrose followed by 125 l of tris - buffered solution (tbs, 1 m) and 875 l of deionized water . The final volume fraction of microspheres is 0.5 vol%, and the final concentrations of tris - hcl (ph 7.5) and sucrose are 0.1 and 0.15 m, respectively . After preparation of 10 ml of a tris - buffered solution (0.1 m tris - hcl [ph 7.5], 0.15 m glucose) in the same procedure as inner aqueous media, place 1 ml of the solution in a 1.5 ml lidded microtube . After preparation of 10 ml of a tris - buffered solution (0.1 m tris - hcl [ph 7.5], 0.15 m glucose) in the same procedure as inner aqueous media, place 1 ml of the solution in a 1.5 ml lidded microtube . Vortex the microtube for 30 sec and then sonicate it for 10 min . Prepare a w / o emulsion containing microspheres . Mix 1 ml of the oil solution (liquid paraffin containing dopc and texas red dhpe) with 300 l of the inner aqueous solution in a 1.5 ml microtube.emulsify the two components in the microtube by using a mechanical homogenizer (an agitator with blades that rotate at high speed) operated at 10,000 rpm for 2 min at rt . Mix 1 ml of the oil solution (liquid paraffin containing dopc and texas red dhpe) with 300 l of the inner aqueous solution in a 1.5 ml microtube . Emulsify the two components in the microtube by using a mechanical homogenizer (an agitator with blades that rotate at high speed) operated at 10,000 rpm for 2 min at rt . Gently layer 300 l of the w / o emulsion on the upper surface of 1 ml of the outer aqueous solution at 4 c in a 1.5 ml lidded microtube . Gently layer 300 l of the w / o emulsion on the upper surface of 1 ml of the outer aqueous solution at 4 c in a 1.5 ml lidded microtube . Collect the gvs . Immediately after chilling the microtube, centrifuge it at 18,000 x g for 30 min . Obtain the precipitated gvs by piercing the bottom of the microtube with a pushpin and collecting one droplet in a sterilized 1.5 ml microtube.dilute the precipitated gv droplet 10 - 100 fold by volume with the outer aqueous solution if the obtained gvs are obtained in quantities large enough to make observation difficult . Immediately after chilling the microtube, obtain the precipitated gvs by piercing the bottom of the microtube with a pushpin and collecting one droplet in a sterilized 1.5 ml microtube . Dilute the precipitated gv droplet 10 - 100 fold by volume with the outer aqueous solution if the obtained gvs are obtained in quantities large enough to make observation difficult . Place an adhesive incubation chamber for in situ polymerase chain reaction and hybridization (chamber size 9 mm x 9 mm x 0.3 mm thick) on top of a microscope cover glass.using a micropipette, deposit 25 l of the diluted precipitated gvs on the specimen area and immediately place another cover glass (approximately 0.15 mm thick) on top of the incubation chamber . Place an adhesive incubation chamber for in situ polymerase chain reaction and hybridization (chamber size 9 mm x 9 mm x 0.3 mm thick) on top of a microscope cover glass . Using a micropipette, deposit 25 l of the diluted precipitated gvs on the specimen area and immediately place another cover glass (approximately 0.15 mm thick) on top of the incubation chamber . Record microscopy images of the vesicles with a microscope (10x, 20x, and 40x objectives) equipped with a 12v100whal - l halogen lamp . Record microscopy images of the vesicles with a microscope (10x, 20x, and 40x objectives) equipped with a 12v100whal - l halogen lamp . Conduct fluorescence microscopy observations . Fit the units with 470 - 495 nm and 565 - 585 nm excitation filters, respectively, and with emission filters that transmit 510 - 550 nm and 600 - 690 nm light, respectively . Fit the units with 470 - 495 nm and 565 - 585 nm excitation filters, respectively, and with emission filters that transmit 510 - 550 nm and 600 - 690 nm light, respectively . The w / o emulsion centrifugation method is illustrated photographically and schematically in figure 1 . The schematic image in figure 1 suggests that the most important determinant of the success of this method is that the specific gravity of the inner aqueous solution must be larger than that of the outer aqueous solution, so that the gvs will precipitate during centrifugation . In addition, the formation of a lipid monolayer at the w / o interface requires that the system be chilled for 10 min after the emulsion is layered on the outer aqueous solution . Because the gvs form by transfer of emulsion droplets across the w / o interface, the osmotic pressures in the inner and outer aqueous layers must be the same . As a control experiment, we also prepared gvs containing no microspheres by means of the process shown in figure 1 and step 1.3, except that the inner aqueous solution was prepared without microspheres . Collection of the precipitated gvs after centrifugation is shown in figure 2 . In addition to the semitransparent phase at the very bottom of the microtube, we also observed a white, turbid intermediate phase in the outer aqueous solution (figure 2a). This intermediate phase was rich in aggregations of microspheres and oil, whereas the bottom phase contained the gvs . Therefore, after piercing the bottom of the microtube with a pushpin (figure 2b), we collected only the first drop (figure 2c), which contained massive amounts of gvs . It is important to make sure that no more than two drops are collected; any additional drops may contain aggregations of microspheres and lipids, which will result in a lower density of gvs . The obtained vesicular dispersion often contained encapsulated materials outside of the gvs because the gvs often rupture during centrifugation . To obtain only gvs, a sorting method such as dialysis, gel filtration, or fluorescence - activated cell sorting if necessary for the purpose for which the precipitated gvs are to be used, they can be diluted with the outer aqueous solution . In some cases, the intermediate phase extended to the bottom of the tube, suggesting that any vesicles that formed were held together by the oil . We obtained differential interference microscopy and fluorescence microscopy images of the gvs without microspheres (figure 3a, 3b) and with microspheres (figure 3c-3f). Lipids conjugated with texas red dhpe, which emits red fluorescence, were used so that vesicle formation could be directly confirmed by visualization of the thin membrane . Of the 160 gvs that we obtained, 55 encapsulated microspheres and 105 were empty, giving a ratio of encapsulation of 34% . We determined the volume fraction (, vol%) of microspheres in the gvs by means of the following method . Because each gv contains dozens to several hundred microspheres, counting all the microspheres under an optical microscope therefore, we mixed the nonfluorescent 1.0 m microspheres with a small amount of fluorescent microspheres, which were manually counted under the fluorescence microscope . The total number (n) of encapsulated microspheres was calculated by multiplying the number (n) of manually counted fluorescent microspheres by 20 (based on the original 95:5 [v / v] ratio of nonfluorescent to fluorescent microspheres). The value of was then estimated as nv100/v, where v is the volume of the microspheres and v is the volume of the individual gv . Note that estimation of n from n gives rise to counting errors, and these errors must be taken into account when calculating . The value of was estimated from n, which was directly calculated as 20n, and this in turn resulted in the probability that accurately represents the true value is <50% . In fact, n fluctuates to some extent around 20n, so we need to consider it as 20(n i), where i is the error in n. we estimated i in order that a probability of n i could be more than 50% obtained on the basis of a poisson distribution . We estimated i, which in turn allowed us to calculate 20(n i) and values of that included counting errors for gvs with diameters of 10 and 15 m (table 1). According to this procedure, the volume fraction of microspheres in the gv shown in figure 3c was estimated to be 11 3 vol% . Our results indicate that we successfully encapsulated 1 m microspheres in gvs at a high volume fraction . We were also able to encapsulate other materials into 100 mol% dopc gvs using the same outer aqueous solution and the same protocol (figure 4). Specifically, gvs containing 0.1 m microspheres were prepared from a tris - buffered solution containing 0.1 m tris - hcl (ph 7.5), 0.15 m sucrose, and 0.5 vol% fluorescent microspheres by means of the protocol described for gvs containing 1.0-m microspheres (figure 4a). Following the protocol described above, dopc gvs containing gfp (0.1 m tris - hcl [ph 7.5], 0.15 m sucrose, and 100 g / ml gfp; figure 4b) and gvs containing uranine (0.1 m tris - hcl [ph 7.5], 0.15 m sucrose, and 30 m uranine; figure 4c) were also prepared . Table 1: numbers and volume fractions (, vol%) of microspheres . Errors were determined as described in the text; n = number of manually counted microspheres; n = total number of encapsulated microspheres . Figure 1: flow chart and schematic depiction of w / o emulsion centrifugation method . (a) oil solution consisting of dopc and texas red dhpe (100:0.3 molar ratio) in liquid paraffin . (b) inner aqueous dispersion consisting of sucrose and microspheres in tris - hcl buffer . (d) mixture of 1 ml of oil solution and 300 l of inner aqueous dispersion . (g) layering of 300 l of the emulsion on 1 ml of the outer aqueous solution . (i) schematic depiction of the principle of the w / o emulsion centrifugation method . (a) precipitated gvs just after centrifugation (also depicted in figure 1h). The pellet containing the gvs was obtained by piercing the microtube near the bottom with a pushpin and collecting droplets from the hole . (c) droplet of the precipitated gvs (indicated by the yellow arrow) dispersion diluted with the outer aqueous solution . (d) fluorescence microscopy image of 1.0 m microspheres (yg carboxylate microspheres) inside a gv . Then we estimated total number of inner microspheres (n = 20 (n i)) was 120 40 . It was calculated that the gv contained 1.0 m microspheres at a volume fraction (= nv100/v) of approximately 11 3 vol%, where v is the volume of the microspheres and v is the volume of the gvs . (f) merged image of the images in panels d and e. please click here to view a larger version of this figure . Differential interference contrast microscopy (top) and fluorescence microscopy (bottom) images of gvs containing (a) 0.1 m microspheres, (b) gfp, and (c) uranine . The specific gravities of the inner aqueous dispersion medium and the outer aqueous solution must be chosen carefully . For the w / o emulsion to precipitate into the outer aqueous solution during centrifugation, the specific gravity of the inner aqueous dispersion medium must be larger than that of the outer aqueous solution . We tried to prepare gvs using inner and outer solutions without sugars, but we obtained no gvs under these conditions, because the inner aqueous solution did not have enough mass to cross the interference between the two phases . If there is a large osmotic pressure difference between the two solutions, gvs that precipitate into the outer aqueous solution may shrink or rupture . Therefore, the osmotic pressure inside and outside the gvs must be equal . To accomplish this, we used sucrose as a solute in the inner aqueous dispersion and glucose as a solute in the outer aqueous solution; both sugars were at the same concentration . Both salt22 and sugar233538 have been used for such purposes, but sugar is usually employed because it is less toxic and more soluble than salt . However, if too much sugar is added, the gvs may come into contact with the bottom of the cover glass and collapse . One strategy is to reduce the specific gravity difference between the inner and outer aqueous solutions so that the gvs precipitate under mild conditions; specifically, the supernatant of the precipitated gv dispersion can be exchanged with a solution that is identical to the inner aqueous solution to reduce the possibility of vesicular rupture by adhesion to the cover glass as a result of buoyancy . Because these materials vary in specific gravity, viscosity, and surface tension, different numbers of vesicles form even when the same centrifugation conditions are used33 . To obtain the vesicles with the target properties, it is essential to optimize the specific gravities and viscosities of the inner and outer aqueous solutions as well as the centrifugal acceleration.for preparation of the oil phase, incubation must occur at high temperature and in a dry environment such as an incubator or a dehydrator . In this study, we heated the liquid paraffin to 80 c to completely dissolve the lipid molecules.in addition, the emulsion should be prepared only as needed and should be immediately subjected to centrifugation because it is unstable just after it is prepared and the w / o droplets readily fuse to one another . The emulsion can be prepared in large quantities by sonication, vortexing, or tapping . However, using a homogenizer allows for rapid preparation of large amounts of emulsion and easier emulsification in oil with a high viscosity . It is also important that the emulsion be layered on the outer aqueous solution gently and rapidly and then chilled at 4 c . To shorten the time between emulsification and centrifugation, the oil - outer aqueous solution system can be prechilled before the emulsion is layered on it, and the whole system can then be centrifuged immediately.if the white turbidity appears faster or slower than usual, the mechanical homogenizer must be thoroughly rinsed to remove cleaning detergents . In addition, before emulsification, the oil solution, inner aqueous solution, and emulsifier must be returned to room temperature ., we were able to prepare gvs with a single interior material encapsulated at a high concentration . When the encapsulation of multiple materials is required, it is better to reduce the centrifugal acceleration . For example, an actin assembly system encapsulating seven compounds was achieved with centrifugation at less than 350 x g35 . In cases in which centrifugation is undesirable, gvs can be obtained by adjusting the sugar concentration or by precipitating the emulsion under the influence of its own mass384041 . One is that oil molecules (paraffin, in this case) can be solubilized in the gv membrane, as has been pointed out by the weitz group21 . When insertion of a membrane protein into the gv membrane is desired, the effects of co - existing oil molecules on the protein must be considered ., we estimated that the volume fractions of microspheres in the gvs ranged from 4 - 30 vol%; the volume fractions were not identical to the volume fraction of the inner aqueous solution used for gv preparation . Although we were able to encapsulate microspheres in the gvs at a volume fraction high enough for microscopy observation, this method is not suitable for the preparation of gvs with a uniform volume fraction distribution . The w / o emulsion centrifugation method is commonly used for the formation of gvs containing encapsulated materials . Recently, molecular robots containing an encapsulated dna device or a molecular device have been constructed4344 . Gvs with compartments are the first choice for these kinds of applications; therefore, techniques, such as ours, that could be used for encapsulating magnetic microspheres and microspheres with diverse surface functionalization can be expected to be useful44.
Right sided valvular involvement in infective endocarditis has been well - described, but lesions affecting eustachian valve are distinctly rare . In 1986, edwards et al . First described the entity of eustachian valve endocarditis (eve) in an autopsy study of a patient with overwhelming streptococcal sepsis . In the literature only few cases have been reported so far . Herein, we review the literature and describe 2 new cases in which the causative organisms were determined to be vancomycin resistant staphylococcus aureus (vrsa), which is reported for the first time, and staphylococcus hominis . A 33 year old woman with a history of intravenous drug use was admitted with a history of fever, chills and cough for the last 4 days . On presentation, she was noted to have a temperature of 102.4 f (reference range 96.8 - 100.4 f), an elevated pulse rate (110 bpm) (reference range 55 - 90 bpm), respiration rate of 26 breaths / min (reference range 12 - 20 breaths / min) and low blood pressure (90/50 mm hg) (reference range 100 - 139/55 - 84 mm hg). Blood investigation showed an elevated white blood cell count (22,600 cells/l) (reference range 4000 - 11000 cells/l). Suboptimal images by transthoracic echocardiography (tte) showed mobile vegetation on the tricuspid valve, along with severe tricuspid regurgitation . Transesophageal echocardiography (tee) revealed a 6-cm, echogenic mass attached to the eustachian valve, [figures 1 and 2] along with pulmonary valve and right ventricular wall . During the next 2 days, the patient's condition was complicated by hemoptysis, renal failure and hypoxic respiratory failure requiring mechanical ventilation . Transesophageal echocardiography image demonstrating a large vegetation (6 cm) attached to the eustachian valve (case 1) vege: vegetation, ivc: inferior vena cava . Transesophageal echocardiographic image of vegetation attached to the right ventricular wall (case 1) pulmonary ary: pulmonary artery . She was treated with intravenous daptomycin initially with 6 mg / kg every 24 hours, and was discharged after 4 weeks of antibiotics . A 86-year - old nursing home female with a history of dementia, severe aortic stenosis, congestive heart failure, chronic anemia secondary to gastrointestinal bleeding requiring implantable venous catheter insertion, presented with high grade temperature of 103f (reference range 96.8 - 100.4 f) rectally, pulse rate of 124bpm (reference range 55 - 90 bpm), respiration rate of 23 breaths / min (reference range 12 - 20 breaths / min) and blood pressure of 128/69 mm hg (reference range 100 - 139/55 - 84 mm hg). Laboratory data showed an elevated white blood count 30,000 cells/l (86% polymorphs) (reference range 4000 - 11000 cells/l), low hemoglobin of 7.1 g / dl (reference range 14.0 - 18.0 g / dl) and normal platelets (323,000/l) (reference range 150,000 - 450,000/l) physical examination revealed a thin, cachectic female with a late peaking systolic murmur at the left sternal border, a soft s2 and few scattered rhonchi all over the lungs . Tte revealed moderate concentric left ventricular hypertrophy with ejection fraction of 70%, a heavily calcified aortic valve with severe aortic stenosis and moderate pulmonary hypertension; however, no vegetations were identified . The patient received 4 weeks of vancomycin, 30 mg / kg in divided doses every 24 hours and became afebrile with second set of blood culture turning negative . A 33 year old woman with a history of intravenous drug use was admitted with a history of fever, chills and cough for the last 4 days . On presentation, she was noted to have a temperature of 102.4 f (reference range 96.8 - 100.4 f), an elevated pulse rate (110 bpm) (reference range 55 - 90 bpm), respiration rate of 26 breaths / min (reference range 12 - 20 breaths / min) and low blood pressure (90/50 mm hg) (reference range 100 - 139/55 - 84 mm hg). Blood investigation showed an elevated white blood cell count (22,600 cells/l) (reference range 4000 - 11000 cells/l). Suboptimal images by transthoracic echocardiography (tte) showed mobile vegetation on the tricuspid valve, along with severe tricuspid regurgitation . Transesophageal echocardiography (tee) revealed a 6-cm, echogenic mass attached to the eustachian valve, [figures 1 and 2] along with pulmonary valve and right ventricular wall . During the next 2 days, the patient's condition was complicated by hemoptysis, renal failure and hypoxic respiratory failure requiring mechanical ventilation . Transesophageal echocardiography image demonstrating a large vegetation (6 cm) attached to the eustachian valve (case 1) vege: vegetation, ivc: inferior vena cava . Transesophageal echocardiographic image of vegetation attached to the right ventricular wall (case 1) pulmonary ary: pulmonary artery . She was treated with intravenous daptomycin initially with 6 mg / kg every 24 hours, and was discharged after 4 weeks of antibiotics . A 86-year - old nursing home female with a history of dementia, severe aortic stenosis, congestive heart failure, chronic anemia secondary to gastrointestinal bleeding requiring implantable venous catheter insertion, presented with high grade temperature of 103f (reference range 96.8 - 100.4 f) rectally, pulse rate of 124bpm (reference range 55 - 90 bpm), respiration rate of 23 breaths / min (reference range 12 - 20 breaths / min) and blood pressure of 128/69 mm hg (reference range 100 - 139/55 - 84 mm hg). Laboratory data showed an elevated white blood count 30,000 cells/l (86% polymorphs) (reference range 4000 - 11000 cells/l), low hemoglobin of 7.1 g / dl (reference range 14.0 - 18.0 g / dl) and normal platelets (323,000/l) (reference range 150,000 - 450,000/l) physical examination revealed a thin, cachectic female with a late peaking systolic murmur at the left sternal border, a soft s2 and few scattered rhonchi all over the lungs . Tte revealed moderate concentric left ventricular hypertrophy with ejection fraction of 70%, a heavily calcified aortic valve with severe aortic stenosis and moderate pulmonary hypertension; however, no vegetations were identified . The patient received 4 weeks of vancomycin, 30 mg / kg in divided doses every 24 hours and became afebrile with second set of blood culture turning negative . Eustachian valve is an embryological remnant of the sinus venosus, directing oxygenated fetal blood from inferior vena cava across foramen ovale, and into the left atrium . In adults, it is non - functional and is considered a benign rudimentary structure . We present 2 new cases of eve with a review of literature [table 1]. In the previously reported cases, the age of patients ranged from 22 years to 76 years with a median age of 44.2 years, with a male to female ratio of 5:3 . There seems to be an increasing trend in elderly population . In the present study, the incidence of eve is not well documented; however, a retrospective review by san roman et al . Reported an incidence of 3.3% in patients with right sided endocarditis . Summary of reported cases of eustachian value endocarditis, their location, microbial agents involved, and prognosis a predisposing factor was present in all but three cases,[35] with intravenous drug use (40% of the cases) being the most common . Other predisposing factors were presence of indwelling catheters, insertion of pacemaker wires, a history of rheumatic heart disease, and immunologic compromise (chronic alcoholism, human immunodeficiency virus [hiv]) status . The increasing prevalence of indwelling catheters / devices may be the reason for increasing incidence of eve in the elderly population . In the present study, a history of intravenous drug use was obtained in one case, and insertion of implantable venous catheter for repeated blood transfusions in the other case . The blood culture revealed staphylococcus aureus to be the most common pathogenic organism in 53% of the cases, which is consistent with previous reviews sawhney et al . The association of staphylococcus aureus positivity on blood cultures with intravenous drug abuse (ivda) and indwelling catheters was found to be in 100% of the cases . Other organisms that have been reported so far include staphylococcus hominis, enterococcus cloacae, escherichia coli, proteus vulgaris, streptococcus viridans, klebsiella pneumonia and actinomyces israeli . In our present report, this is the first case of vrsa eve reported in the literature . In the second case, staphylococcus hominis, a harmless commensal on human skin was the causative organism, likely related to the implantable venous access catheter insertion for chemotherapy (which is reported for the first time also). Like many other coagulase - negative staphylococci, staphylococcus hominis may occasionally cause infection in patients with compromised immune system . Both cases in our series the finding was in concordance with previous studies in which the vegetations were seen more frequently on tee than tte . As the eustachian valve is situated posteriorly, the superiority of tee over tte is seen frequently . Only in reports by punzo et al . And in 2 other cases reported by georgeson et al ., tte was frankly misleading, suggesting a ruptured chordae tendinae in one patient, and chiari's network in the other . Tee allows not only better visualization of the eustachian valve and chiari network, but also easily differentiates pathological masses from these normal structures . Nevertheless, tte remains the first imaging investigation of choice; and, tee should be performed if clinical picture strongly suggests endocarditis and no lesions are identified on tte . Though eve was first described in a post - mortem autopsy case, eve seems to follow a benign clinical course presenting as right sided endocarditis, resolving with a 4 - 6 week course of culture sensitive antibiotics, as seen in 78% of patients described till date . Few patients had a transient worsening of symptoms requiring intubation, open heart surgery with removal of eustachian valve . It should be strongly considered when a patient has the clinical syndrome of right - sided endocarditis, but no vegetations are identified on tte . We found the incidence of eve to be highest in young intra - venous drug users, and staphylococcus aureus to be the most common microbial agent . However, over the past 6 years eve has been seen more frequently in the elderly population with culture positivity for diverse microbial agents . Although eve is rare, it may be unwise to rule out this diagnosis based solely on tte, especially in the setting of persistent bacteremia or pulmonary emboli.
X - ray micro computed tomography (mxct) has many applications in various fields including medicine, geology, materials science, dentistry, art and archaeology, among others . The methodology combines a non - destructive and noninvasive analysis with the ability to quantify the geometrical characteristics of irregular specimens such as bones, archaeological remains, teeth, etc . The technique is constantly being improved through hardware and software developments and the subsequent increase in resolution provides researchers with new information and approaches for the investigation of the material properties . In the dental field, mxct has been extensively used to quantify the geometrical changes in the root canal anatomy during endodontic therapy, comparing pre and post instrumentation analyses . Root canals receive a chemo - mechanical treatment with successively larger endodontic files (figure 1) in order to prepare the anatomy and surface of the root canal to support the dental posts . This is a very demanding task as endodontic files must cut the dentin and remove the dental debris, preserving the curvature of the root canals without fracture . Root fracture is the biggest complication during instrumentation, jeopardizing the outcome of endodontic therapy . Despite the evolution of endodontic files over the last four decades and the large number of available endodontic systems, no system is free of problems and drawbacks . B: depth marking facilitates determination of the exact position of the file on x - ray . C: silicon rubber for working length marking . Color coding indicated according to iso requirements (yellow: n 20, red: n 25, blue: n 30 . ). E: the number of engraved rings on the shaft determines the taper of the instrument . One ring represents taper .02, 2 rings for .04 and 3 rings for taper .06 . F: specially designed shaft to be fitted in the handle of the low torque motor . The scale on the left is in mm endodontic files are made from different grades of austenitic stainless steel or ni - ti alloys characterized by a variety of geometrical features such as taper, cross - section, helix and rake angle, and the distance between the successive cutting blades . These features are critical factors in the mechanical resistance of endodontic files to load forces (i.e., bending and torsion), their cutting capacity, and the clearance of dental chips . The introduction of the ni - ti alloy in file manufacturing was followed by the development of a variety of new cross - sectional designs with an increased taper compared to the 0.02 employed in k- and h - type files made of stainless steel as dictated by the international standard organization (iso) specification 3630 . Nevertheless, the determination of other important geometrical features such as the surface area and volume of the endodontic files remain unknown, limiting the assessment of other parameters derived from these basic features . Precise estimation of the basic geometrical features might provide an additional approach to explain the differences in the clinical performance among various file designs and establish a valuable tool for development of new and more efficient geometrical designs . Apart from the k - files, where the surface area and volume can be calculated based on the untwisted tapered blank values employing mathematical formulas, the calculation of these features was impossible before the introduction of mxct . This technique has been extensively used to determine the geometrical features, such as shape, surface area and the volume of the root canals before and after treatment with endodontic instruments but has never been utilized to determine the geometrical features of endodontic files . The aim of this study was to determine, for the first time, the surface area, volume and specific surface area of successive file sizes of a commercially available ni - ti system . Additionally, we tested the hypothesis that mxct is capable of discriminating the quantitative differences in the aforementioned geometrical properties between the successive sizes of endodontic files . These differences exist by definition due to the progressively increased size of the successive files used in root canal therapy . The hypothesis tested was that there are significant differences in the surface area, volume and specific surface area among the different sizes of endodontic files . Three sets of flex - master ni - ti files (vdw; munich, germany), 6 files each (iso sizes n 20/lot 0411310306, n 25/lot 0410310302 and n 30/lot 0406310290) all of 0.04 taper, were utilized in this study . To avoid any inclination from the vertical axis, the files were placed on the stage, employing a custom made attachment and then scanned by a mxct scanner (skyscan model 1072; aartselaar, belgium) operated under the following conditions: wo ka source (100 kv, 98 a), 2.36 m pixel size, 180 rotation, 0.9 rotation step, 1.9 sec exposure time averaging by two frames, and 1 mm al filter . The surface area and volume of all files were determined from the tip up to the 16 mm level, taking 6,782 horizontal slices . The files were successively scanned using the automated routine of oversize mode, for 16 h each . A fixed threshold was applied to discriminate the crosssection from the air, providing high contrast images of the horizontal cross - sections . The surface area (sa) and volume (v) of each file were determined by the embedded software (ctan, skyscan, aartselaar, belgium) employing the following formulas: with n = number of slices, s = slice thickness, pi = measured periphery in slice i and ai = measure area in slice i the specific surface area (the surface to volume ratio) was also calculated . The percentage differences between the successive file sizes for the aforementioned properties were calculated based on the formula: horizontal slices of all scanned files were also inspected for the presence of internal defects such as cracks or pores . All data were statistically analyzed using oneway anova and snk multiple comparison tests at a 95% significance level, employing the file size as the discriminating variable . Linearity of the surface area and volume data versus iso size was analyzed employing linear regression analysis . All data were statistically analyzed using oneway anova and snk multiple comparison tests at a 95% significance level, employing the file size as the discriminating variable . Linearity of the surface area and volume data versus iso size was analyzed employing linear regression analysis . Figure 2 demonstrates two representative horizontal sections (perpendicular to the longitudinal file axis) from the mxct . The left image has been taken from a region near the handle and the right from a region near the cutting tip of a ni - ti file, demonstrating the difference in the cross - sectional surface area . The cross - section was found to be free of internal defects such as pores or cracks . Left and right images show two horizontal cross sections of the same file . The right image has a smaller cross- sectional surface, as it is closer to the cutting tip the quantitative results for the surface area, volume and specific surface area of successive file sizes are presented in table 1 . The surface area of the n 30 files showed the highest value followed by n 25 and n 20 . The increase in total surface area was 8.9% between n 20/n 25 and 16.6% between n 25/n 30 files, demonstrating close to a 100% increase for the latter . Similar results were found for the volume of the ni - ti files tested . However, the increase in volume declined towards the larger file sizes . The percentage increase was estimated as 21.1% between n 20/n 25 and 17.2% between n 25/n 30). The file n 20 showed a significantly higher specific surface area followed by n 25 and n 30 . The specific surface area showed a 10.1% decrease between n 20/n 25, but only 0.4% between n 25/n 30 . Regression analysis revealed a strong linearity between the surface area (figure 3a) and volume (figure 3b) versus file sizes . The raw data, the fitted line, the 95% confidence intervals, the yielded analytical formula, and the regression coefficient (r) are all presented in figures 3a and 3b for the surface area and volume, respectively . Mean values and standard deviations for the surface area (sa), volume (v), and specific surface area (ssa) of flexmaster ni - ti files . The percentage differences (dif) between successive file sizes are also presented the same superscripts indicate mean values without statistical significant differences (p>0.05) raw data, fitted line with the 95% confidence intervals, mathematical equations and liner regression coefficients (r), for the surface area (a) and volume (b) of the flexmaster ni - ti system the results of the current study showed significant differences for the surface area and volume between the files tested, thus the original hypothesis is accepted . It is noteworthy that this analysis provided significant differences for the endodontic files with different iso sizes, demonstrating the ability of this analysis to discriminate the quantitative differences of the geometrical characteristics among the different endodontic file sizes . This discrimination has also been facilitated due to the increased resolution of 2.36 m obtained in this study . The transition to scanner technology has a beneficial effect on the resolution of mxct from 1000 m for conventional tomography, which was insufficient for endodontic applications, to roughly 30 m, providing the ability for more extensive research, especially in the root canal anatomy after chemo - mechanical treatments . However, beyond the technological advancement, the resolution of a specific analysis with a given mxct scanner is limited by the size of the object, as it is magnification dependent . This is a disadvantage in addition to the restriction that all horizontal projections produced during rotation must be fitted to the maximum horizontal width of the ccd camera . The mxct device used in this study has a maximum isotropic resolution of 1.8 m but the maximum achievable isotropic resolution for endodontic file scanning remained at 2.36 m, due to dimensional constraints . The scanning of an alloy with a homogeneous elemental atomic ratio and a uniform x - ray absorption through its bulk facilitates image contrast and thus the selection of the proper threshold level to discriminate the edges of the cross - sections . All tested files were found free of internal defects such as pores or cracks, a finding which is in agreement with previous cross - sectional and mxct analyses . Despite the increased isotropic resolution available through technological advancements, the accuracy of the quantitative analysis remains unknown, at least for endodontic applications dealing with the quantification of the geometrical features of the root canals and endodontic files . It is logical to assume that this accuracy is dependent on the isotropic resolution and might increase towards smaller isotropic resolutions . However, such an approach requires the development of specific standards made of the same material as the unknown sample, in order to preserve the same contrast . This could be a milestone for the application of mxct in the quantification of the geometrical features and could be an interesting subject for future research . The surface area and volume of the endodontic files, as presented for the first time by the present study, was found to increase towards higher file sizes with significant differences between the successive file sizes (table 1). Linear regression analysis showed a linear correlation of both the surface area and volume with the nominal file sizes . The surface area and volume are not physically dependent on the nominal iso sizes and the equations presented in figure 3 are simply an engineering relationship between two different physical magnitudes . Finally, the aforementioned equations are not universal and should be used exclusively for the tested ni - ti endodontic system . For the other ni - ti files, linear models with different coefficient values are anticipated . Although the geometrical configuration and design of the ni - ti files are important factors in controlling the clinical performance of these micro - instruments, the assessment of their clinical performance with experimental testing remains questionable . Some studies provide results with great differences, not only among the different brands but also within one brand and type . The main weakness of the currently available experimental protocols is that the clinical performance of the endodontic files has been biased as to the influence of various factors and has been determined separately . On the other hand, the results of the current study do not have any immediate clinical implications, as they must be combined with further experimental results of the clinical properties (such as cutting efficiency, loading of dental chips, etc .) In order to determine any possible correlation . For instance, it is logical to assume that a file with a greater surface area has the increased ability of loading dental chips but this requires experimental documentation . The surface area and volume between the successive files showed significant differences and thus there is no overlap between the successive file numbers, as occurs with the first diameter (d1) below the tip . As expected, both the surface area and volume show an increase towards the higher file sizes . The percentage difference between n 25/n 30 (16.6%) is almost double the value of n 20/n 25 (8.9%) files sizes, whereas the percentage increase in volume was similar (21.1% and 17.2% for n 20/n 25 and n 25/n 30, respectively) showing a completely different increasing pattern . It should be mentioned that the percentage differences in the surface area show an abrupt increase towards the larger file sizes, while volumetric changes exhibit a declining trend . This implies that the surface area and volume progress towards larger files with a completely different pattern, a finding reflected by the values of the specific surface area (figure 3). The latter is a property that defines the total surface area per unit of bulk volume and has significant importance in cases where the surface area has a significant effect on the system studied . The n 20 files have the highest specific surface area, indicating that more surface area is exposed per volume unit than in n 25 and n 30 sizes . This value is characteristic of the geometrical design and it is expected to vary significantly among different file designs . Files with a non - standard taper (i.e., protaper) are anticipated to demonstrate increased specific surface area due to the significant reduction in file volume . It is noteworthy that beyond the estimation of the surface area and volume of the scanned files, the 2d and 3d analysis of the scanned files provides tremendous opportunities . Firstly, all the geometrical features (i.e., cutting angle, depth of flutes, crosssectional diameter) measured in longitudinal and cross - section analyses, with optical and electron microscopy can be readily measured with mxct methodology . This analysis is advantageous over traditional techniques, as it is non - destructive and thus there is no need for specimen preparation (embedding, cutting, metallographic polishing, conductive coating). Computational analysis of 3d models can be used to quantify any selected geometrical feature for any region of interest . For instance, the real surface area of a file working in a root canal can be easily estimated, selecting the relative region of interest . Secondly, 3d modeling of scanned files can provide more accurate models for subsequent finite element analyses . On the other hand, the drawbacks of mxct methodology are the inferior resolution compared to optical and electron microscopy and prolonged scanning times for the model reconstruction in high isotropic resolution . Another limitation is that the image quality might be affected by the beam hardening phenomena . Normally, an x - ray beam contains photons with a vast range of energies . In physical metallurgy, the beam hardening phenomenon refers to the absorption of lower energy photons during the passing of a beam through a metal object and once this happens, " beam hardening " occurs as the mean energy of a beam increases . In this study, to minimize the beam hardening effect an al filter was utilized and a beam hardening correction routine was applied . The former was used to pre - harden the beam by cutting the lower energy photons, while the latter is a correction algorithm which was applied during the reconstruction process . The estimation of the surface area and volume of endodontic files might provide a new approach for the characterization of clinically - related properties such as cutting efficiency, loading of dentin debris etc . This study demonstrates that mxct is a powerful tool with interesting applications for endodontic research . Continuing technological advancements allowing development of more powerful mxct scanners should accelerate the applications of this methodology in the near future . The surface area and volume demonstrated an almost linear increase, while the specific surface area demonstrated an abrupt decrease towards the higher file sizes . For the first time, we have shown that mxct is capable of discriminating the quantitative differences in the geometrical properties of the successive sizes of endodontic files . This type of analysis should be used to investigate the unexplored correlations of the various clinical properties of the geometrical characteristics of the endodontic files, opening new avenues for research in the field of endodontics . The authors would like to thank the research group program for funding this research project . This study has been funded by a research grant (#rgp - vpp-206) from the research group program, deanship of scientific research, king saud university, riyadh, saudi arabia.
This study was approved by the institutional ethics committee review boards of chang gung memorial hospital linkou medical center and chang gung university . We recruited 123 patients, and all patients gave written informed consent to participate in the study . The screening glucose challenge test for gestational diabetes was performed as previously described (24). Genomic dna samples of participants were extracted and purified from anticoagulated blood with the dneasy blood & tissue kit (qiagen, venlo, netherlands). Genotyping of snps was performed using the taqman validated snp genotyping assays (applied biosystems, foster city, ca). Blood samples were collected from patients for hormone measurement 1 h after administration of the oral glucose tolerance test . Total gip, insulin, and c - peptide levels in human serum were measured using sandwich elisa kits (millipore, billerica, ma; mercodia, uppsala, sweden; and calbiotech, spring valley, ca). A 2.15-kb fragment of human gip promoter with the a allele at rs3895874, rs3809770, rs3848460, and rs937301 (2073 bp to + 77 bp) was chemically synthesized (genescript inc ., piscataway, nj) and subcloned into the pgl4.2 luciferase reporter vector (promega corp . Promoter fragments with ancestral haplotypes were obtained using the site - directed mutagenesis . In the promoter reporter study, each experiment was conducted at least three times with three or four replicates for each treatment . Patients glucose challenge responses and serum hormone profiles were compared with the test or the student t test with welch correction . Ratios of patients with glucose levels exceeding the threshold were analyzed with the test . All data were presented as mean sem, and the statistical significance cutoff value was 0.05 . This study was approved by the institutional ethics committee review boards of chang gung memorial hospital linkou medical center and chang gung university . We recruited 123 patients, and all patients gave written informed consent to participate in the study . The screening glucose challenge test for gestational diabetes was performed as previously described (24). Genomic dna samples of participants were extracted and purified from anticoagulated blood with the dneasy blood & tissue kit (qiagen, venlo, netherlands). Genotyping of snps was performed using the taqman validated snp genotyping assays (applied biosystems, foster city, ca). Blood samples were collected from patients for hormone measurement 1 h after administration of the oral glucose tolerance test . Total gip, insulin, and c - peptide levels in human serum were measured using sandwich elisa kits (millipore, billerica, ma; mercodia, uppsala, sweden; and calbiotech, spring valley, ca). A 2.15-kb fragment of human gip promoter with the a allele at rs3895874, rs3809770, rs3848460, and rs937301 (2073 bp to + 77 bp) was chemically synthesized (genescript inc ., piscataway, nj) and subcloned into the pgl4.2 luciferase reporter vector (promega corp ., madison, wi). Promoter fragments with ancestral haplotypes were obtained using the site - directed mutagenesis . In the promoter reporter study, each experiment was conducted at least three times with three or four replicates for each treatment . Patients glucose challenge responses and serum hormone profiles were compared with the test or the student t test with welch correction . Ratios of patients with glucose levels exceeding the threshold were analyzed with the test . All data were presented as mean sem, and the statistical significance cutoff value was 0.05 . To systematically identify putative metabolic modifiers, we curated and screened snps in 207 gene loci that have previously been implicated in the regulation of diabetes - related and/or obesity - related traits using fst (supplementary table 1). The empiric distribution of the fst statistic has been used to detect genomic regions that have rapidly increased in frequency as a result of local selective pressures (27). Of these 207 genes, 59 carried genic variants with fst values in the top 5% bracket in comparisons between the corresponding hapmap ii populations yri (yoruba from ibadan), ceu (u.s . Residents with northern and western european ancestry), and asn (pooled samples of chinese from beijing [chb] and japanese from tokyo [jpt]; supplementary table 1). The genic region in 29 of these 59 genes also contained another indication of local selection: long haplotypes in one of the hapmap populations . On the basis of the presence of highly divergent allele frequencies between eurasians and africans, the presence of ld and extended haplotypes in eurasians, and a> 30% minor allele frequency in the overall eurasian population, we identified seven snps in the 5 gene region of cdkal1, cyb5r4, gad2, gip, and pparg as potential common metabolic modifiers (table 1). In earlier gwa studies, select variants in cdkal1, cyb5r4, gad2, and pparg were associated with type 2 diabetes - related or obesity - related traits (2831). By contrast, there has been no report of linkage of gip variants in gwa studies . Because the three gip variants (rs3895874, rs3848460, and rs937301) are highly linked compared with those that appeared alone in other candidate genes (32), and because these gip variants are partially linked with a nonsynonymous gip snp (rs2291725) (22), these gip variants have a low likelihood of being false positive (table 1). Snps from the 5 gene region that exhibited signals of partial selection asn, pooled samples of chinese from beijing and japanese from tokyo; ceu, utah residents with northern and western european ancestry; gd, gestational diabetes; ld, linkage - disequilibrium; ob, obesity; snp, single nucleotide polymorphism; t2d, type 2 diabetes; yri, yoruba in ibadan, nigeria . * the allele frequency is significantly different among hapmap ii populations (p <0.01). Fine mapping of the gip locus showed that these variants are linked with more than three dozen neighboring snps (from rs9904761 to rs3895874 on chr17: 44,31144,402 kb), and these linked snps exhibited fst values in the top 210% bracket in comparisons between yri and asn (supplementary fig . A plot of a 250-kb region of genotypes around gip in the three hapmap ii populations showed that whereas genotypes surrounding gip in yri exhibited a high degree of homozygosity for ancestral alleles (fig . 1a, upper panel), in the same region, genotypes of asn and ceu exhibited a high degree of homozygosity for the derived alleles (fig . Analysis of genic snps at the gip locus between 11 populations from the hapmap iii project (34) showed that fst values were the highest for comparisons between east asian and african populations (fig . This result is consistent with our recent finding that a nonsynonymous variant in the exon iv of gip (rs2291725) and a 71-kb haplotype block surrounding this variant were positively selected in eurasians in the last 2,000 to 11,800 years (22). Differential distribution of polymorphic alleles at the gip locus in human populations . A: visual depiction of genotypes within a 250-kb region around gip in yri, ceu, and asn populations . Polymorphic sites are color coded according to their allelic state . Individuals with a homozygous genotype with ancestral allele (aa) and a homozygous genotype with derived allele (aa) the location of snps in the gip gene region is indicated by a green rectangle . The position of snps within the genomic region is indicated by blue vertical lines in the bottom panel . B: average fst for genic snps at the gip locus between 11 populations of the hapmap phase iii dataset . Population descriptors: asw, african ancestry in southwest u.s . ; ceu, utah residents with northern and western european ancestry from the centre de'etude du polymorphism humain (ceph) collection; chb, han - chinese in beijing, china; chd, chinese in metropolitan denver, co; gih, gujarati indians in houston, tx; jpt, japanese in tokyo, japan; lwk, luhya in webuye, kenya; mex, mexican ancestry in los angeles, ca; mkk, maasai in kinyawa, kenya; tsi, toscans in italy; yri, yoruba in ibadan, nigeria . The highest population differentiation was found between asian (han - chinese and japanese) and african (luhya, maasai, or yoruba) populations . (a high - quality color representation of this figure is available in the online issue .) Interestingly, analyses of ld and haplotype block diversity of the genomic region that encompassed the three gip variants at the 5 gene region showed that a 91-kb ld block was represented by five inferred haplotypes in ceu and four in and asn chromosomes, respectively (fig . 2; supplementary fig . In addition, these analyses showed that the high fst values and the major shift in allele frequencies of gip variants at the 5 gene region between eurasian and african populations could be attributed to the increase of a derived haplotype (haplotype 50 in fig . Because the three 5 gene region variants are completely linked with the positively selected rs2291725 in asn (22), we inferred that rs3895874, rs3848460, and rs937301 at the human gip promoter region were positively selected in east asian populations as well . Frequencies of the 58 inferred haplotypes found in the 91-kb ld region (from rs9904761 to rs3895874) surrounding gip in yri, ceu, and asn . Most of the ceu and asn chromosomes contained derived haplotypes (with aaaa residues at positions 7679), whereas yri chromosomes exhibited significant divergence in the haplotype composition . Population descriptors: asn, pooled samples of chinese from beijing and japanese from tokyo; ceu, utah residents with northern and western european ancestry from the centre de'etude du polymorphism humain (ceph) collection; yri, yoruba in ibadan, nigeria . (a high - quality color representation of this figure is available in the online issue .) Importantly, we found that the 5 gene region variants (i.e., rs3895874, rs3809770, rs3848460, and rs937301 at positions 1920, 1650, 1158, and 320 of gip, respectively) are located in a haplotype block that is separated from the one containing the nonsynonymous variant rs2291725 by a hotspot for recombination in ceu and yri (supplementary fig . A tetranucleotide polymorphism was represented by three inferred haplotypes in all three populations (referred to as derived gip, ancestral gip, and ancestral gip haplotypes in the following text; table 2). The derived gip haplotype, which was found in 18.3% of yri chromosomes, has become the dominant haplotype and has a frequency exceeding 50 and 75% in ceu and asn, respectively (table 2). By contrast, the dominant ancestral haplotype in yri chromosomes (gip, 50.8%) was only found in 1.1% of asn chromosomes . Therefore, these 5 gene region variants and the nonsynonymous variant rs2291725 could be selected differentially in the overall hapmap populations and represent causal mutations independent of the nonsynonymous variant rs2291725 . Frequency of inferred gip haplotypes and rs3895874 genotypes at the 5 gene region in hapmap ii populations asn, pooled samples of chinese from beijing and japanese from tokyo; ceu, utah residents with northern and western european ancestry from the centre de'etude du polymorphism humain (ceph) collection; yri, yoruba in ibadan, nigeria . * frequencies of gip haplotypes were significantly different among hapmap ii populations (p <0.0001). Because only functional investigations can convincingly demonstrate causal mutations, we sought to obtain direct evidence that these 5 gene region snps represent causal mutations for the population genetics observation . We constructed and tested gip promoter reporters with each of the three major haplotypes in transfected human embryonic kidney (hek) 293 t cells (fig . Measurement of promoter reporter activities showed that constructs with an ancestral haplotype (gip or gip) exhibited luciferase reporter activity 2545% higher than that of a derived haplotype (gip, p <0.01; fig . Because the gip promoter region contains elements that are important for regulation by transcriptional factors, including pax6 and gata4 (23), we also determined whether the gip promoter reporter activity was haplotype - dependent in the presence of these transcription factors . As expected, coexpression of pax6 or gata4 increased the basal reporter activities by 1.52.5-fold and 0.70.8-fold, respectively (fig . Importantly, we found that reporters with an ancestral haplotype consistently exhibited significantly higher activities than those containing the derived haplotype in the presence of pax6 or gata4 (p <0.01). Together, these results suggested that derived alleles at rs3895874, rs3848460, and rs937301but not rs3809770represent functional mutations . The gip promoter reporter activity is haplotype - dependent . A: schematic representation of luciferase reporters containing one of the three inferred haplotypes (derived: gip; ancestral: gip and gip) found in a 2.15-kb fragment of the gip promoter . The genomic fragment from position 2073 to + 77 bp of gip contains four snps (from rs3895874 to rs937301), and three of them are linked . Genomic fragments that contained each of the three haplotypes were subcloned in the pgl4.2 luciferase reporter . B: the luciferase reporter activity is shown in hek293 t cells transfected with combinations of reporter and expression vectors for pax6 and gata4 . The reporter activity is haplotype - dependent in the absence or presence of select transcription factors . To compare gip promoter reporter activities, hek293 t cells in 6-well culture dishes were transfected with different combinations of transcription factor expression vector and a select gip promoter reporter using lipofectamine 2000 (life technology inc .,, equal amounts of pcmv and pgl4.2 expression vectors and a one - tenth aliquot of a -galactosidase expression vector were transfected . At 48 h after transfection, cells were free - thawed once in lysis buffer, and luciferase activity in supernatant was assayed using the steady - glo luciferase assay system (promega corp .) And a lumimark microplate reader (bio - rad corp . The reporter activity has been expressed as the ratio of relative luciferase unit/-galactosidase activity in transfected cells . (a high - quality color representation of this figure is available in the online issue .) Given that earlier genome studies have not reported an association between gip variants and any trait, we speculated that the partial selection of gip variants in eurasian populations could be associated with adaptation at a life stage that is vulnerable to environmental changes and that has not been specifically studied . Because pregnancy represents a critical life stage that subjects individuals to excessive metabolic load, and because its success has a major impact on reproductive fitness, we hypothesized that studies of phenotypic variation during pregnancy may provide a sensitive model to investigate the role of gip haplotypes . To test for an allelic effect of gip variants, we studied east asian patients for proof - of - concept testing because selection pressures are most likely ongoing in populations that exhibit the most significant evidence . We genotyped a panel of 123 unrelated han - chinese women who underwent a screening glucose challenge test for gestational diabetes during the 23rd to the 29th weeks of pregnancy, and these patients were assigned to three genotype groups (gip, gip, or gip) based on alleles at rs3895874, rs3848460, and rs937301 . The frequency of rs3895874 in these patients was similar to that of the asn population and was in the hardy weinberg equilibrium; frequencies of gip, gip, and gip genotypes were 0.089, 0.480, and 0.431, respectively . In addition, alleles at rs3895874 in these patients were in absolute ld with those at rs3848460 and rs937301 . Measurements of serum gip and glucose levels showed that circulating gip and glucose at 1 h after the challenge test were 20.6219.9 pg / ml, and 72230 mg / dl, respectively . Consistent with in vitro promoter reporter assays, gip levels in patients carrying the ancestral gip haplotype (gip heterozygote and gip homozygote) were significantly higher than those with a homozygous gip genotype (fig . By contrast, serum levels of glucose, insulin, and c - peptide, as well as age and bmi, were not significantly different among patients (table 3). Gip haplotypes impart a difference in gip response and glucose metabolism after glucose challenge tests . A: measurements of serum gip and glucose levels in 123 patients during the 23rd to the 29th weeks of pregnancy at 1 h after the 50-g glucose challenge test . The gip level was significantly higher in patients carrying a gip haplotype compared with those homozygous for the gip haplotype . B: in 72 patients with the dominant gipr genotype, both serum gip and glucose levels were both significantly different between gip homozygotes and those carrying a gip haplotype . Association between gip haplotypes and gip response after glucose challenge tests in 123 pregnant han - chinese women gip, glucose - dependent insulinotropic polypeptide; or, odds ratio . Significantly different from patients with a gip haplotype (test, p <0.05). Because two linked gip receptor (gipr) variants rs10423928 and rs1800437 (referred to as the gipr mutation in table 3) have recently been shown to be associated with glucose and insulin levels after oral glucose challenge tests as well as the incretin effect in nondiabetic individuals in gwa studies (35,36), we also genotyped these variants and sought to isolate the potential confounding effect of gipr variants . We found no association between gipr snps and serum glucose or hormone levels, but levels of serum glucose, in addition to gip, were significantly different between gip homozygotes, and heterozygotes and the gip homozygotes combined within the pool of patients with the dominant gipr genotype (fig . Moreover, we noticed that after controlling for the variation at gipr, the derived gip genotype was associated with increased risk of having a glucose level that exceeded the 140 mg / dl threshold (odds ratio 3.53 [95% ci 1.259.92]; p = 0.015; table 3). Among patients with a gipr genotype, 48.3% of patients with gip homozygotes exhibited glucose levels that exceeded the threshold, whereas only 20.9% of the remaining patients did therefore, the homozygous gip genotype could be associated with a reduced gip response and reduced capability of maintaining glucose homeostasis . To systematically identify putative metabolic modifiers, we curated and screened snps in 207 gene loci that have previously been implicated in the regulation of diabetes - related and/or obesity - related traits using fst (supplementary table 1). The empiric distribution of the fst statistic has been used to detect genomic regions that have rapidly increased in frequency as a result of local selective pressures (27). Of these 207 genes, 59 carried genic variants with fst values in the top 5% bracket in comparisons between the corresponding hapmap ii populations yri (yoruba from ibadan), ceu (u.s . Residents with northern and western european ancestry), and asn (pooled samples of chinese from beijing [chb] and japanese from tokyo [jpt]; supplementary table 1). The genic region in 29 of these 59 genes also contained another indication of local selection: long haplotypes in one of the hapmap populations . On the basis of the presence of highly divergent allele frequencies between eurasians and africans, the presence of ld and extended haplotypes in eurasians, and a> 30% minor allele frequency in the overall eurasian population, we identified seven snps in the 5 gene region of cdkal1, cyb5r4, gad2, gip, and pparg as potential common metabolic modifiers (table 1). In earlier gwa studies, select variants in cdkal1, cyb5r4, gad2, and pparg were associated with type 2 diabetes - related or obesity - related traits (2831). By contrast, there has been no report of linkage of gip variants in gwa studies . Because the three gip variants (rs3895874, rs3848460, and rs937301) are highly linked compared with those that appeared alone in other candidate genes (32), and because these gip variants are partially linked with a nonsynonymous gip snp (rs2291725) (22), these gip variants have a low likelihood of being false positive (table 1). Snps from the 5 gene region that exhibited signals of partial selection asn, pooled samples of chinese from beijing and japanese from tokyo; ceu, utah residents with northern and western european ancestry; gd, gestational diabetes; ld, linkage - disequilibrium; ob, obesity; snp, single nucleotide polymorphism; t2d, type 2 diabetes; yri, yoruba in ibadan, nigeria . * the allele frequency is significantly different among hapmap ii populations (p <0.01). Fine mapping of the gip locus showed that these variants are linked with more than three dozen neighboring snps (from rs9904761 to rs3895874 on chr17: 44,31144,402 kb), and these linked snps exhibited fst values in the top 210% bracket in comparisons between yri and asn (supplementary fig . A plot of a 250-kb region of genotypes around gip in the three hapmap ii populations showed that whereas genotypes surrounding gip in yri exhibited a high degree of homozygosity for ancestral alleles (fig . 1a, upper panel), in the same region, genotypes of asn and ceu exhibited a high degree of homozygosity for the derived alleles (fig . Analysis of genic snps at the gip locus between 11 populations from the hapmap iii project (34) showed that fst values were the highest for comparisons between east asian and african populations (fig . This result is consistent with our recent finding that a nonsynonymous variant in the exon iv of gip (rs2291725) and a 71-kb haplotype block surrounding this variant were positively selected in eurasians in the last 2,000 to 11,800 years (22). Differential distribution of polymorphic alleles at the gip locus in human populations . A: visual depiction of genotypes within a 250-kb region around gip in yri, ceu, and asn populations . Polymorphic sites are color coded according to their allelic state . Individuals with a homozygous genotype with ancestral allele (aa) and a homozygous genotype with derived allele (aa) the location of snps in the gip gene region is indicated by a green rectangle . The position of snps within the genomic region is indicated by blue vertical lines in the bottom panel . B: average fst for genic snps at the gip locus between 11 populations of the hapmap phase iii dataset . Population descriptors: asw, african ancestry in southwest u.s . ; ceu, utah residents with northern and western european ancestry from the centre de'etude du polymorphism humain (ceph) collection; chb, han - chinese in beijing, china; chd, chinese in metropolitan denver, co; gih, gujarati indians in houston, tx; jpt, japanese in tokyo, japan; lwk, luhya in webuye, kenya; mex, mexican ancestry in los angeles, ca; mkk, maasai in kinyawa, kenya; tsi, toscans in italy; yri, yoruba in ibadan, nigeria . The highest population differentiation was found between asian (han - chinese and japanese) and african (luhya, maasai, or yoruba) populations . (a high - quality color representation of this figure is available in the online issue .) Interestingly, analyses of ld and haplotype block diversity of the genomic region that encompassed the three gip variants at the 5 gene region showed that a 91-kb ld block was represented by five inferred haplotypes in ceu and four in and asn chromosomes, respectively (fig . 2; supplementary fig . In addition, these analyses showed that the high fst values and the major shift in allele frequencies of gip variants at the 5 gene region between eurasian and african populations could be attributed to the increase of a derived haplotype (haplotype 50 in fig . Because the three 5 gene region variants are completely linked with the positively selected rs2291725 in asn (22), we inferred that rs3895874, rs3848460, and rs937301 at the human gip promoter region were positively selected in east asian populations as well . Frequencies of the 58 inferred haplotypes found in the 91-kb ld region (from rs9904761 to rs3895874) surrounding gip in yri, ceu, and asn . Most of the ceu and asn chromosomes contained derived haplotypes (with aaaa residues at positions 7679), whereas yri chromosomes exhibited significant divergence in the haplotype composition . Population descriptors: asn, pooled samples of chinese from beijing and japanese from tokyo; ceu, utah residents with northern and western european ancestry from the centre de'etude du polymorphism humain (ceph) collection; yri, yoruba in ibadan, nigeria . (a high - quality color representation of this figure is available in the online issue .) Importantly, we found that the 5 gene region variants (i.e., rs3895874, rs3809770, rs3848460, and rs937301 at positions 1920, 1650, 1158, and 320 of gip, respectively) are located in a haplotype block that is separated from the one containing the nonsynonymous variant rs2291725 by a hotspot for recombination in ceu and yri (supplementary fig . A tetranucleotide polymorphism was represented by three inferred haplotypes in all three populations (referred to as derived gip, ancestral gip, and ancestral gip haplotypes in the following text; table 2). The derived gip haplotype, which was found in 18.3% of yri chromosomes, has become the dominant haplotype and has a frequency exceeding 50 and 75% in ceu and asn, respectively (table 2). By contrast, the dominant ancestral haplotype in yri chromosomes (gip, 50.8%) was only found in 1.1% of asn chromosomes . Therefore, these 5 gene region variants and the nonsynonymous variant rs2291725 could be selected differentially in the overall hapmap populations and represent causal mutations independent of the nonsynonymous variant rs2291725 . Frequency of inferred gip haplotypes and rs3895874 genotypes at the 5 gene region in hapmap ii populations asn, pooled samples of chinese from beijing and japanese from tokyo; ceu, utah residents with northern and western european ancestry from the centre de'etude du polymorphism humain (ceph) collection; yri, yoruba in ibadan, nigeria . * frequencies of gip haplotypes were significantly different among hapmap ii populations (p <0.0001). Because only functional investigations can convincingly demonstrate causal mutations, we sought to obtain direct evidence that these 5 gene region snps represent causal mutations for the population genetics observation . We constructed and tested gip promoter reporters with each of the three major haplotypes in transfected human embryonic kidney (hek) 293 t cells (fig . Measurement of promoter reporter activities showed that constructs with an ancestral haplotype (gip or gip) exhibited luciferase reporter activity 2545% higher than that of a derived haplotype (gip, p <0.01; fig . Because the gip promoter region contains elements that are important for regulation by transcriptional factors, including pax6 and gata4 (23), we also determined whether the gip promoter reporter activity was haplotype - dependent in the presence of these transcription factors . As expected, coexpression of pax6 or gata4 increased the basal reporter activities by 1.52.5-fold and 0.70.8-fold, respectively (fig . Importantly, we found that reporters with an ancestral haplotype consistently exhibited significantly higher activities than those containing the derived haplotype in the presence of pax6 or gata4 (p <0.01). Together, these results suggested that derived alleles at rs3895874, rs3848460, and rs937301but not rs3809770represent functional mutations . . A: schematic representation of luciferase reporters containing one of the three inferred haplotypes (derived: gip; ancestral: gip and gip) found in a 2.15-kb fragment of the gip promoter . The genomic fragment from position 2073 to + 77 bp of gip contains four snps (from rs3895874 to rs937301), and three of them are linked . Genomic fragments that contained each of the three haplotypes were subcloned in the pgl4.2 luciferase reporter . B: the luciferase reporter activity is shown in hek293 t cells transfected with combinations of reporter and expression vectors for pax6 and gata4 . The reporter activity is haplotype - dependent in the absence or presence of select transcription factors . To compare gip promoter reporter activities, hek293 t cells in 6-well culture dishes were transfected with different combinations of transcription factor expression vector and a select gip promoter reporter using lipofectamine 2000 (life technology inc ., carlsbad, ca). In each well, equal amounts of pcmv and pgl4.2 expression vectors and a one - tenth aliquot of a -galactosidase expression vector were transfected . At 48 h after transfection, cells were free - thawed once in lysis buffer, and luciferase activity in supernatant was assayed using the steady - glo luciferase assay system (promega corp .) And a lumimark microplate reader (bio - rad corp ., hercules, ca). The reporter activity has been expressed as the ratio of relative luciferase unit/-galactosidase activity in transfected cells . (a high - quality color representation of this figure is available in the online issue .) Given that earlier genome studies have not reported an association between gip variants and any trait, we speculated that the partial selection of gip variants in eurasian populations could be associated with adaptation at a life stage that is vulnerable to environmental changes and that has not been specifically studied . Because pregnancy represents a critical life stage that subjects individuals to excessive metabolic load, and because its success has a major impact on reproductive fitness, we hypothesized that studies of phenotypic variation during pregnancy may provide a sensitive model to investigate the role of gip haplotypes . To test for an allelic effect of gip variants, we studied east asian patients for proof - of - concept testing because selection pressures are most likely ongoing in populations that exhibit the most significant evidence . We genotyped a panel of 123 unrelated han - chinese women who underwent a screening glucose challenge test for gestational diabetes during the 23rd to the 29th weeks of pregnancy, and these patients were assigned to three genotype groups (gip, gip, or gip) based on alleles at rs3895874, rs3848460, and rs937301 . The frequency of rs3895874 in these patients was similar to that of the asn population and was in the hardy weinberg equilibrium; frequencies of gip, gip, and gip genotypes were 0.089, 0.480, and 0.431, respectively . In addition, alleles at rs3895874 in these patients were in absolute ld with those at rs3848460 and rs937301 . Measurements of serum gip and glucose levels showed that circulating gip and glucose at 1 h after the challenge test were 20.6219.9 pg / ml, and 72230 mg / dl, respectively . Consistent with in vitro promoter reporter assays, gip levels in patients carrying the ancestral gip haplotype (gip heterozygote and gip homozygote) were significantly higher than those with a homozygous gip genotype (fig . By contrast, serum levels of glucose, insulin, and c - peptide, as well as age and bmi, were not significantly different among patients (table 3). Gip haplotypes impart a difference in gip response and glucose metabolism after glucose challenge tests . A: measurements of serum gip and glucose levels in 123 patients during the 23rd to the 29th weeks of pregnancy at 1 h after the 50-g glucose challenge test . The gip level was significantly higher in patients carrying a gip haplotype compared with those homozygous for the gip haplotype . B: in 72 patients with the dominant gipr genotype, both serum gip and glucose levels were both significantly different between gip homozygotes and those carrying a gip haplotype . Association between gip haplotypes and gip response after glucose challenge tests in 123 pregnant han - chinese women gip, glucose - dependent insulinotropic polypeptide; or, odds ratio . * significantly different from patients with a gip haplotype (test, p <0.05). Because two linked gip receptor (gipr) variants rs10423928 and rs1800437 (referred to as the gipr mutation in table 3) have recently been shown to be associated with glucose and insulin levels after oral glucose challenge tests as well as the incretin effect in nondiabetic individuals in gwa studies (35,36), we also genotyped these variants and sought to isolate the potential confounding effect of gipr variants . We found no association between gipr snps and serum glucose or hormone levels, but levels of serum glucose, in addition to gip, were significantly different between gip homozygotes, and heterozygotes and the gip homozygotes combined within the pool of patients with the dominant gipr genotype (fig . Moreover, we noticed that after controlling for the variation at gipr, the derived gip genotype was associated with increased risk of having a glucose level that exceeded the 140 mg / dl threshold (odds ratio 3.53 [95% ci 1.259.92]; p = 0.015; table 3). Among patients with a gipr genotype, 48.3% of patients with gip homozygotes exhibited glucose levels that exceeded the threshold, whereas only 20.9% of the remaining patients did . Therefore, the homozygous gip genotype could be associated with a reduced gip response and reduced capability of maintaining glucose homeostasis . On the basis of studies of signatures of selection, in vitro promoter assays, and glucose challenge tests in humans, we show that it is possible to identify causal variants related to energy - balance regulation by focusing on genic snps that were subject to environmental selection in a subset of candidate genes . Specifically, we demonstrated that gip variants at the 5 gene region represent metabolic modifiers that contribute to phenotypic variation in gip response and glucose metabolism . Further characterization of these causal variants would open a new venue for understanding the molecular mechanisms that underlie phenotypic variations in energy - balance regulation and improve our ability to stratify and interpret clinical outcomes associated with the gip signaling pathway . For decades, adaptive selection was assumed to be rare; however, recent studies have demonstrated that adaptive substitution is pervasive in human genomes (1,7,37). Despite this progress, it is obvious that population differentiation characteristics of human genomes have yet to be fully explored because physiologic consequences of almost all of these past gene environmental interactions remain to be verified experimentally (1,2). On the other hand, because many selection pressures could be heterogeneous or reversible in a short time, the signature of selection may have eroded in genes that were responsive to cultural selection pressures (12,38) compared with those shielded from heterogeneous selection (e.g., the adaptation to environmental oxygen levels and altitude) (5,39). We therefore reasoned that important metabolic modifiers could be hidden in the trove of snps that showed limited evidence of positive selection and that this limitation could be particularly pertinent to modifiers associated with adaptations in response to shifts of subsistence cultures . Consistent with this hypothesis, a survey of earlier studies of genome - wide or chromosome - wide positive selection using the so - called outlier approaches in which candidate loci are identified in the extreme tails of empiric distributions (40)showed that gip variants have not been reported as positively selected (1,7). The selection of gip variants was inferred after we focused the analysis on local genomic regions and assessed the significance of integrated haplotype score using coalescent simulations (22). Therefore, our investigation provided a proof - of - concept study for identifying causal mutations that underlie phenotypic variation of complex disease - related traits . This approach could open new venues for improving the translation of common variant association signals into biologic mechanisms that underlie physiologic variability or disease risk . Neel hypothesized that mismatches between prior adaptations and new environments, or a conflict of adaptations, could lead to changes in fitness or health risks (11). Because ancient variants could have been selected for the organism s reproductive success but not for its health or longevity, the ancient alleles could confer disease risks as selection pressures change . Therefore, studies of positively selected variants that are associated with adaptations in energy - balance regulation could point not only to novel genotype phenotype relationships but also to novel molecular mechanisms that mediate the potential phenotypic variation, thereby providing much - needed insight into how and which phenotypic variations in energy - balance regulation can be attributed to the selected variants . In support of the thrifty genotype hypothesis, human capn10 and house - mouse insulin genes have been shown to exhibit characteristics of adaptive evolution after the emergence of agricultural societies (41,42). Conceptually, the high gip response associated with the ancestral gip haplotype could have been a beneficial energy - conserving mechanism when the food supply was irregular . The ancestral haplotype could become deleterious in the last 10 millenniums as agricultural practice became widespread . One possible deleterious effect of the ancestral gip haplotype in an environment that supplies abundant high - starch food resources is the hypersecretion of insulin and insulin resistance (43,44). On the other hand, a reduced gip response associated with the derived gip haplotype could be protective by decreasing the extent of insulin secretion in the face of oversupply of energy inputs (45,46). In support of this speculation, it has been well documented that in the absence of modern medicine, diabetes - associated complications and, possibly, obesity posed detrimental effects on survival when human culture shifted (47), even though type 2 diabetes is generally considered a chronic disease in modern society . Alternatively, an elevated glucose level associated with the derived haplotype may have improved the survival of fetuses if the population faced serious famine an event frequently experienced by agricultural societies (48)despite the reality that an impaired glucose - tolerance response represents a risk to both the mother and fetus under normal circumstances . Moreover, the derived haplotype could have been beneficial by reducing the obesity - promoting effect of gip (16). In vitro and in vivo studies have shown that gip promotes fatty liver and other obesity - associated metabolic disorders, whereas gip antagonists suppress lipid accumulation induced by a high - fat diet (23). Therefore, the derived gip haplotype could be selected for its effects on the enteroadipocyte or the enteroinsular axis, or both . Although we speculated that the derived gip haplotype may have provided protective effects in famine - plagued agricultural societies, the observation that the derived haplotype has not been fixed in any population suggests that the selection of the derived gip haplotype(s) (e.g., cycles of famine) could be opposed (balance selection) as populations experienced temporal changes in selection pressure (e.g., resumption of population growth with stable food supply). Alternatively, the derived gip haplotype could simply be too young to become fixed, or the spread could be limited by the transgenerational effects associated with abnormal gestational glucose metabolism, which raise the risk of macrosomia and diabetes in the offspring (11). Although an association between gip variants and glucose - metabolism regulation has not been reported, gipr variants were associated with glucose and insulin levels after challenge tests as well as with bmi in gwa studies that evaluated> 29,000 individuals (35,36). The finding that patients with a homozygous gip genotype have significantly higher glucose levels compared with those carrying an ancestral gip haplotype within the pool of gipr homozygotes suggested that there is a confounding effect stemming from interactions of gip and gipr variants, and that gip and gipr variants represent novel markers for the stratification of the capability to maintain glucose homeostasis during pregnancy . We also speculate that the significant results observed in pregnant women could be related to the fact that the success of pregnancy has a significant impact on reproductive fitness and that a major fraction of gene environmental selections probably occurred before birth (49). Recent studies have corroborated this idea by showing that associations between many risk alleles and type 2 diabetes can be replicated with smaller sample sizes in patients with gestational diabetes mellitus (50,51). Furthermore, given the evolutionary signatures at the gip locus, the plausible molecular mechanism, and the significant results in east asian women, we speculate that the gip variant mediated phenotypic divergence could also exist in most human populations . It is also important to note that the selection of gip variants represents a unique example in which the selection process involves regulatory variants that alter the glucose - induced gip response as well as a nonsynonymous variant that affects peptide bioactivity (22). Thus, the gip signaling pathway could represent a hotspot for selection in recent human history and play an important role in the manifestation of phenotypic variation in energy - balance regulation among individuals . In addition to gip variants, our study identified several cdkal1, cyb5r4, gad2, and pparg variants as potential metabolic modifiers . Recent studies have shown that variants in cdkal1, pparg, and more than two dozen genes are associated with glycemic traits in diabetic patients (10). Surprisingly, none of the cdkal1, cyb5r4, gad2, and pparg variants identified here have been implicated in earlier gwa studies, which suggests that these variants could be related to novel energy - balance regulatory mechanisms that operate at certain life stages or under specific physiologic conditions that have not been specifically investigated . Future investigations of these variants could reveal additional metabolic modifiers that have arisen recently and their contributions to phenotypic variation in normal human physiology and metabolic syndrome related traits . In conclusion, our data demonstrated a strong association between regulatory gip variants, and gip response and glucose metabolism, reinforcing the indication of an important role of gip signaling in diabetes - related traits from earlier gwa studies of gipr . Importantly, our study also provided a novel approach to reveal metabolic modifiers by studying consequences of previous mismatches of physiologic capabilities and environments.
The conventional definitions of pediatric adiposity depend on a measured body mass index (bmi, kg / m) interpreted relative to a reference distribution (bmi normative growth charts) for sex and age [13]. Because it has body weight in its numerator, bmi reflects generalized (total - body) enlargement with a simplified correction (as height) for skeletal size . Pediatric adiposity has been defined alternatively by abdominal size, most commonly a waist circumference, because increased truncal adipose tissue is correlated better than generalized adiposity with cardiometabolic dysfunction [4, 5]. Since waist circumference is a regional measurement, it reflects specifically only abdominal or central enlargement . Thus, waist circumference also requires interpretation relative to its own reference distribution for sex and age . Comparisons of risk assessments in youth have generally found little difference between bmi and waist circumference in the ability of these indicators to identify cardiometabolic risk [6, 7]. The waist - to - height ratio (whtr) is an adiposity indicator with waist circumference in the numerator and a simplified correction (as height) for skeletal size . Whtr does not depend on sex- or age - specific reference criteria [810]. In a large sample of us sixth - graders, we examined the performance of bmi z - score (bmiz, referenced to cdc 2000 growth charts for the united states) and whtr for the purpose of cardiometabolic risk assessment . Participants came from the baseline enrollment (sixth - grade students in 2006) of the healthy study, a cluster - randomized, controlled, primary prevention trial designed to improve indicators of adiposity and glycemic dysregulation among us middle - school children [12, 13]. Seven research centers recruited 42 middle schools with at least 50% of students eligible to participate in the federally subsidized national school lunch program or belonging to an ancestral minority group at increased risk of type 2 diabetes (hispanic, non - hispanic black, or native american). A detailed protocol and background details about the healthy study are available for download at http://www.healthystudy.org/. We restricted a priori our analytic sample to students with integer ages of 11 or 12 years who were able to participate in physical education and did not have known diabetes . From 5950 eligible enrollees, we excluded 13 students due to missing or invalid data for the adiposity indicators (height, weight, and waist circumference). Additional 239 students were excluded for lack of outcome cardiometabolic risk variables, and 216 were excluded for lack of information on pubarche (an adjustment variable associated with adrenarche, growth pattern, and insulin resistance) [1416]. Participant ancestry (hispanic, non - hispanic black, non - hispanic white, other) and sex were self - reported . The study was approved by each research center's institutional review board, and informed consent from parents and assent from students were obtained prior to data collection . From measured height and weight, we calculated the sex- and age - specific bmiz based on the centers for disease control and prevention 2000 growth charts [11, 17]. Waist circumference was measured to the nearest 0.1 cm on bare skin just above the iliac crest following procedures of the national health and nutrition examination survey, and the whtr was calculated . Blood pressure was recorded three times using an omron automated blood pressure monitor (with appropriate - size cuff) after the participant sat quietly for 5 minutes . Pubarche was identified dichotomously from the participants' response to a standardized question on the appearance of underarm and pubic hair . Fasting blood samples were processed onsite and shipped to the healthy central blood laboratory (northwest lipid research laboratories, university of washington). Insulin was measured by an immunoenzymometric assay using a tosoh 1800 autoanalyzer; the interassay and intra - assay precision analysis consistently showed a coefficient of variation (cv) <10% . The assay had low cross - reactivity with human c - peptide (0%) and proinsulin (2%). The homeostasis model assessment of insulin resistance (homa - ir) was calculated from glucose (mg / dl) and insulin (u / ml) concentrations using the following formula: (1)homa - ir=(glucose0.05551)(insulin)22.5 . Measurements of total plasma cholesterol, cholesterol in the lipoprotein fractions, and triglycerides were performed enzymatically on the roche modular - p autoanalyzer using well - standardized methods . The interassay cvs were consistently <1.5% for total cholesterol and triglycerides and <2% for hdl cholesterol . We calculated the total - to - hdl cholesterol ratio (tc / hdlc), a variable that strongly predicts cardiovascular disease in adults and may be more strongly associated than ldl - cholesterol or hdl - cholesterol concentrations with pediatric adiposity [22, 23]. In addition to stratification by sex, we chose a priori to stratify our analyses by high fatness or lower fatness because the ability of adiposity indicators to identify adipose tissue mass, ectopic fat, and cardiometabolic risk variables may be stronger among children in a higher fatness category [2326]. As defined for this report, the high - fatness level included students who were above the sex - specific median value for both bmiz and whtr; any student below the median for either adiposity indicator was designated lower fatness . For each fatness level, we prepared sex - specific, linear - regression models adjusted for ancestry (4 categories) and pubarche (yes / no) to estimate the associations of continuous adiposity indicators with the continuous cardiometabolic risk factors (outcomes). Since blood pressure varies with height in children [27, 28] our models for blood pressure outcomes included an additional adjustment for height which was entered as a continuous variable . For all variables except bmiz, we calculated descriptive statistics without using reference - based corrections for sex or age . For indicators or outcomes that departed markedly from a normal distribution (whtr, homa - ir, tc / hdlc, hdl cholesterol, triglycerides, and (only for lower - fatness students) diastolic blood pressure), we transformed the variable by loge or inverse square root to approach normality prior to their use in regression models . Our adjusted models estimated standardized beta coefficients (change in the outcome variable (in standard deviations) associated with change of one standard deviation in the adiposity indicator) for each cardiometabolic risk factor . Cary, nc) was used to account for variability both within and between the school clusters . In these mixed models, the proportion of variation explained (r) by each adiposity indicator was calculated as the full model r minus r for a model omitting the adiposity indicator . To compare linear slopes among ancestral groups, mixed - regression models estimated nonstandardized, beta - regression coefficients; interactions were tested between each adiposity indicator and the three ancestries represented prominently in our sample (hispanic, black, and white). Characteristics of the analytic sample are presented by sex in table 1 . As expected for sixth - grade students, following further stratification by fatness level, the distributions of adiposity indicators and ancestry are summarized in table 2 . Compared to the high - fatness groups in our sample, the lower - fatness groups had bmi and whtr distributions that resembled more closely the general population of us youth in the same age range [31, 32]. Within the high - fatness subpopulations of either sex (table 3), adiposity indicators explained 19%28% of the variation in homa - ir, 4%9% of the variation in circulating lipids (tc / hdlc, hdl cholesterol, triglycerides), and 5%9% of the variation in diastolic blood pressure . Adiposity indicators explained <3% of the variations in systolic blood pressure and fasting glucose . For each outcome variable in these high - fatness subpopulations, the effect sizes (standardized beta coefficients) associated with bmiz were similar to those associated with whtr . Within the lower - fatness subpopulations of either sex (table 4), adiposity indicators explained 8%13% of the variation in homa - ir and 2%7% of the variation in circulating lipids . For tc / hdlc and triglycerides, the standardized beta coefficients tended to be weaker for bmiz (0.130.20) than for whtr (0.170.28). Adiposity indicators in these lower - fatness subpopulations explained <1% of the variations in systolic blood pressure, diastolic blood pressure, and fasting glucose . A comparison between the two levels of fatness (table 3 versus table 4) demonstrates that for either adiposity indicator the associations with homa - ir were stronger among the high - fatness students (beta coefficients 0.430.52) than among the lower - fatness students (0.300.37). Similarly, both adiposity indicators were associated with diastolic blood pressure more strongly among high - fatness students (0.230.32; p <0.001 for each of 4 beta coefficients) than among lower - fatness students (0.030.05; p> 0.05 for each of four beta coefficients). For identification of lipid outcomes, however, we found steeper beta coefficients only among high - fatness boys (compared to lower - fatness boys) whose adiposity was assessed by bmiz . For both sexes assessed by whtr, the associations between adiposity indicators and risk variables were not notably different between the hispanics, non - hispanic blacks, and non - hispanic whites except when related to blood pressure outcomes . Although adiposity explained 5%7% of variation in diastolic blood pressure in the complete sample of high - fatness girls (table 3), this relationship was extremely weak for high - fatness girls who were black, as indicated by slope point estimates close to zero (figure 1). However, for high - fatness girls who were hispanic or white, bmiz and whtr had significant associations (p <0.05) with diastolic pressure . Among high - fatness boys systolic blood pressure was not significantly associated with bmiz or whtr for high - fatness blacks of either sex, but the association was present for high - fatness students who were hispanic or white . An ancestral contrast (blacks compared to whites) related to systolic blood pressure was significant, however, only among the high - fatness girls assessed by bmiz (figure 1; p <0.01). In this large sample of middle - school students at increased risk of obesity and type 2 diabetes, we found that adiposity indicators bmiz (with reference to cdc 2000 growth charts) and whtr (without reference to sex and age) had similar utility for identifying adverse levels of cardiometabolic variables . Our findings are generally consistent with previous published reports, most of which were based on populations that had a wider age range or included less ancestral diversity . Earlier cross - sectional studies that compared continuous whtr against bmi either without a normative growth reference [3335] or with reference - based bmi z - scores / percentile ranks [23, 36] generally found that whtr provided stronger associations with lipid outcomes, but bmi was superior for blood pressure outcomes . A recent report on sixth - grade students from switzerland found that bmiz (referenced to cdc 2000 growth charts) and whtr provided associations with blood pressures that were weak but nearly identical . In studies of youth from the southern us, bmiz provided a slightly stronger association than whtr with homa - ir and fasting insulin, a relationship that was complicated by nonlinearity . Nationally representative, cross - sectional data from the us demonstrated that whtr at ages 417 years was more strongly associated than bmiz with resting heart rate . A longitudinal analysis from the same survey of adolescent and young - adult participants found that categorical whtr predicted all - cause mortality before age 55 better than categorical bmiz (baseline ages 1218 years) or bmi (ages 1939). From the united kingdom, a large study recently reported that whtr and bmiz obtained at ages 79 years had similar associations with cross - sectional and prospective cardiometabolic risk factors in adolescence . Given an approximately equal utility of bmiz and whtr for pediatric health assessments, we should consider how these adiposity indicators might perform in different settings or in the future . Bmiz values reported in the research literature depend on standardized protocols for measuring height and weight using calibrated, high - quality scales . In nonresearch settings, however, staff training and time pressures might not be so favorable to careful measurements . The dependence of bmiz on normative growth references can be problematic because bmi - for - age reference values can yield discrepant inferences between populations, time periods, and ethnicities within a single country . Worldwide bmi growth reference based on large datasets from six countries, but subsequent reviews found that this international growth reference provided no advantage over national bmi growth references for the definition of excessive fat mass in youth or prediction of subsequent cardiovascular risk in adulthood . The world health organization (who) more recently developed a bmi - based growth reference, the utilization of which has been described as a cumbersome task in need of simplification . Surveys from various clinical settings have found generally that the use of bmi - for - age reference values is suboptimal [4750]. Advocates of the whtr must address problems associated with the available protocols for measuring waist size . While tape measures are inexpensive and generally need little calibration, protocols for circumference measurement are still unfamiliar to many pediatric practitioners or clinic assistants . Our study carefully measured the waist circumference just above the iliac crest, an anatomic location endorsed by prominent researchers in the united states [18, 51] and canada . The who, however, recommends measuring waist circumference at the approximate midpoint between the lower margin of the last palpable rib and the top of the iliac crest . Minimal waist, and other sites [54, 55]. In an anthropometric study of diabetic youth, the iliac - crest protocol and who protocol demonstrated comparable reproducibility, but these alternative protocols yielded notable differences in the absolute value of a waist circumference obtained from the same participants . A study of overweight youth found that the who waist - circumference protocol had a stronger association than the iliac - crest protocol with cardiometabolic risk, and studies of adult waist circumference have likewise suggested an advantage for the who protocol [5860]. It follows that the whtr values calculated from the iliac - crest and who protocols should not be casually substituted for each other . It is possible that if our healthy study had adopted the who instead of the iliac - crest protocol for its baseline anthropometry, the re - calculated whtr indicator might have demonstrated stronger associations with cardiometabolic risk variables than those we report in this paper . Standardization of a single waist - circumference protocol would probably advance the widespread adoption of the whtr as a low - cost adiposity indicator [55, 61]. As an alternative to the circumference, some pediatric investigators have described waist size in selected participants by measuring the external diameter sagittally (back - to - front) in the supine position [6264]. Protocol might further enhance studies that are cross - sectional or involve short - term follow - up of central adiposity, but this anthropometric method needs to be tested in larger datasets that represent general youth populations . The physiological importance of tissues accumulated in the waist may help to explain why whtr was more closely associated than bmiz with variations in the levels of circulating lipid markers among our lower - fatness participants (table 4). An increase in waist size primarily marks expanding amounts of adipose tissue, including notably the visceral depot which is most strongly associated with an adverse metabolic phenotype [5, 65]. Variation in the waist circumference can explain more than 64% of the variance in the area or volume of visceral adipose tissue . An increase in bmi, by contrast, may substantially mark also the variations in gain of muscular weight or subcutaneous fat patterning that precede adulthood . Along with the changes in fat mass, these variations in lean mass or superficial adipose tissue contribute to the bmi calculation while contributing relatively little to metabolic risk . Although high - fatness hispanic and white girls in our study demonstrated the expected associations between adiposity and blood pressure, we found among the high - fatness black girls (but not black boys) that neither bmiz nor whtr had a significant association with blood pressure outcomes (figure 1). In comparison to young hispanics and whites, young blacks tend to have abdominal adipose tissue relatively less in the visceral depot and more in the abdominal subcutaneous regions . Another study has also reported that black girls' waist circumference around the same age was unrelated to their diastolic blood pressure . Since both the bmiz and whtr indicators demonstrated similar patterns of nonassociation with black girls' blood pressure, it may be that this absence of a correlation with blood pressure is due to factors operating primarily outside the abdominal region . Perhaps black girls benefit from an increased capacity to expand their lower - body (gluteofemoral), subcutaneous, adipose - tissue stores in a manner that would increase their total body weight yet protect them from cardiometabolic risk [7073]. If this protective characteristic of black girls extends into their later years, it could help explain why adult black women in the us experience no increased cardiometabolic risk or mortality until their bmi reaches approximately 33 kg / m . If a well - standardized waist measurement comes into widespread use for clinical assessments of pediatric adiposity, patients and their families may improve their intuitive understanding of how excess adiposity contributes to adverse health risk . Pediatric health care providers, too, may find it more useful to recognize risk associated with a waist increment (corrected for height) than with a weight increment (corrected for height squared). Adoption of the whtr could optimize both patient education and the tracking of risk . Compared to bmi, the whtr allows a simpler calculation without the necessity of squaring the child's height . Of interest to those concerned with child adiposity and cardiometabolic risk observed in different cultures or distinct time periods, the whtr will facilitate comparisons based directly on anthropometric observations without using normative reference tables that may not be suitable to all populations [7779].
The bucky shuttle being the combination of nanosize carbon structures fullerene and nanotube, has many possible applications: nanoscale storage cells, devices for directed medicine transfer and containers for effective and safe gas storage [7 - 13]. Nanosize containers and capsules of various shapes that allow reaching a higher safety level and mass content of gas stored have been investigated for a number of years [11 - 13]. The engineering of nanostructured carbon opens the ways for the production of nanocapsules of complex structural shapes [14 - 16]. In this work, the processes of methane molecule adsorption, storage and desorption by the nanocapsule are investigated with molecular - dynamic modeling method . The nanocapsule - specific structure defines its adsorption qualities: at the storage stage under normal conditions, the nanocapsule contains the amount of methane that was adsorbed at normal temperature and under 40 mpa . The nanocapsule desorption takes place at the temperature elevation up to 350 k. there is no need to apply electric field during storage and desorption . Methane adsorption, storage and desorption processes were modeled with the method of molecular dynamics . The values of hydrogen and carbon atom charges in methane molecule were obtained using the combination of hartree fock and becke exchange with lee yang the following atom charge values in methane molecule were obtained: carbon atom 0.628204 mulliken and hydrogen atom + 0.157051 mulliken . 1 . Nanocapsule for natural gas storage, consisting of storage chamber, junction and blocking chamber the nanocapsule consists of three parts: storage chamber, junction and blocking chamber . The junction consists of the nanotube (10,10) and nanotube (8,8), moreover, the nanotube (8,8) is connected with the storage chamber, and nanotube (10,10) with the blocking chamber . The blocking chamber is opened and closed by the transfer of the k@c60 endohedral complex under electrostatic field action . The charge of + 1|e| of the k@c60 endohedral complex is uniformly distributed over the c60 shell . The nanotube (8,8) in the junction prevents the k@c60 from entering the storage chamber . The nanotube (8,8) diameter is rather large for the penetration of methane molecules, but small for the transition of the k@c60 . Each hole in the blocking chamber is formed as a result of removing 24 carbon atoms . Dangling the holes obtained are large enough for free penetration of methane molecules into the nanotube internal space . The experiment on obtaining similar holes with the application of electron beams is described in . It is shown that the beams can be focused on the area 1 in diameter . The holes in the nanotube can exist at the temperatures up to 400 k; when the temperature elevates, the hole diameter in the nanotubes considerably decreases due to the motion and fusion of single vacancies [8 - 10]. During modeling, it is imitated that the nanocapsule is placed on the substrate, i.e., the nanotube base is fixed the nanocapsule left end the change in the nanotube diameter is also possible with the methods of nanostructural engineering . The charged endohedral complex k@c60 moves in the blocking chamber and junction under the action of external electric field . The electric field direction defines the nanocapsule state in the operation cycle: methane adsorption, its storage and desorption . The value of external electric field intensity, required for the k@c60 to move, equals 3.045 10 v / m . The motion of charged fullerene in the nanotube with the help of electric field is described in detail in . The nanocapsule operation can be split into several stages: methane adsorption, storage and desorption . At the adsorption stage (fig . 2), the k@c60 endohedral complex is retained at the end of the blocking chamber under the action of van der waals forces . The methane molecules from the environment freely penetrate through the three holes into the blocking chamber and adsorb into the external space of the storage chamber . Adsorption stage (t= 300 k, p = 40 mpa) the calculations are based on the following formula (1): where number of methane molecules, nc number of carbon atoms in the nanotube, mass of one methane molecule and mc mass of one carbon atom . Figure 3 demonstrates the nanocapsule filling dynamics with methane at 300 k and under 40 mpa . It is clearly seen that 4 ps is enough to complete the filling of the nanocapsule storage area . Thermodynamic conditions are p = 40 mpa and t = 300 k to block methane molecules in the storage chamber, it is necessary to move the k@c60 ion into the junction with the help of electric field as shown in fig . 4 . External thermodynamic conditions are t = 300 k and p = 40 mpa . Further motion of the k@c60 is blocked by the junction narrow part nanotube (8,8). Nanocapsule closing stage (t = 300 k, p = 40 mpa) figure 5 demonstrates the dependencies of the change in the k@c60 position and its kinetic energy under the electric field action in the blocking chamber upon time . A sharp increase in the k@c60 kinetic energy equaled to 0.254 ev is observed at 0.5 ps, at the same time the velocity reaches 327 m / s . = 1 ps, the k@c60 kinetic energy decreases significantly, reaching 0.000255 ev and further up to 15 ps its value does not considerably increase . This is explained by minor oscillations of the k@c60 near the right end of the blocking chamber . The k@c60 is retained due to van der waals forces . Under the constant action of electric field, the k@c60 kinetic energy increases again and reaches 0.61 ev at t = 16.5 ps, i.e., the k@c60 breaks off the blocking chamber and moves to the storage chamber to block its entrance . Results of molecular - dynamic modeling of the k@c60 motion in the blocking chamber under the electric field action at the adsorption stage . The k@c60 ion position with respect to the initial (time = 0 ps) ion position as a function of time . The change in the k@c60 ion kinetic energy as a function of time in the time period from t = 16.5 ps to t = 26.5 ps, the considerable attenuating oscillations of the kinetic energy conditioned by the k@c60 motion along the blocking chamber walls adjacent to the junction entrance are observed . In this time period, each peak of the k@c60 kinetic energy corresponds to the time moments after passing the pentagonal rings in the structure of the blocking chamber . Under the electric field action, the k@c60 penetrates into the right end of the junction nanotube (10,10)and blocks the outlet of methane molecules from the storage chamber . During the penetration, a considerable increase in the kinetic energy is observed, its maximum value reaches 0.63 ev at t = 32 ps . After the k@c60 passes the nanotube (10,10), the kinetic energy sharply decreases conditioned by the k@c60 deceleration in the portion of the nanotube (8,8). In the interval from t = 41.5 ps to t = 48.5 ps, the insignificant fluctuations of the k@c60 position connected with the compressed gas pressure from one side and electric field action from another the value of the k@c60 kinetic energy does not exceed 0.033 ev . In the process of methane molecules adsorption, the maximum velocity of the k@c60 motion is 515.5 m / s (t = 32 ps). When transferring to the storage stage, the electric field switches off, and external thermodynamic conditions are brought to normal . The k@c60, which is located in the junction, moves to the blocking chamber under the methane pressure . However, its transfer is insignificant (d~5 a) that is conditioned by the necessity to overcome the considerable energy barrier (e = 90 kcal / mol) to move to the blocking chamber . The calculations made show that there are no abnormal extensions of bonds between carbon atoms in the nanocapsule . Methane storage stage (t = 300 k, p = 0.1 mpa) at the desorption stage when the temperature elevates from 300 k up to 350 k and the external pressure is normal, the k@c60 endohedral complex in the junction is pushed into the blocking chamber under the expanding methane pressure, as shown in fig . Methane under pressure in the storage chamber freely desorbs into the external space through the holes in the blocking chamber . The availability of three holes in the blocking chamber and their configuration allow forcing out methane molecules and preserving the required rigidity of the construction . The holes are located in such a way that the k@c60, moving under the electric field action in the blocking chamber, is unable to block all its holes at once . The k@c60 in the blocking chamber does not prevent methane desorption as the gas molecules flowing out do not touch it, and it is retained near the wall of the blocking chamber adjacent to the junction inlet nanotube (10,10) due to the action of van der waals forces without the external electric field involved . Methane desorption stage (t = 350 k, p = 0.1 mpa) figure 8 demonstrates the dependencies of the k@c60 location stage and its kinetic energy upon time at the temperature elevation from t = 300 k up to t = 350 k at the stage of the k@c60 desorption into the blocking chamber . At 3 ps, the significant increase in the k@c60 kinetic energy equaled to 2.05 ev (the k@c60 velocity reaches 930 m / s) is observed . The k@c60 kinetic energy is consumed for overcoming the considerable energy barrier (e = 90 kcal / mol) formed under the action of capillary forces . When the k@c60 passes the energy barrier, the kinetic energy decreases considerably to 0.41 ev (t = 5 ps). After passing the junction at 7 ps the k@c60, kinetic energy increases again and when the k@c60 gets into the blocking chamber, the oscillations between its walls are observed . Each zero value of the k@c60 kinetic energy in the interval from 7 to 23 ps corresponds to the k@c60 impact against the blocking chamber wall . Then, the insignificant impacts of the k@c60 against the blocking chamber wall with further state stabilization near one of the pentagonal rings of the blocking chamber are observed (fig . 7) the maximum kinetic energy is 2.05 ev, which is considerably smaller than the known value (200 ev) required for carbon nanotube destruction . The availability of even insignificant number of methane molecules in the blocking chamber considerably decreases the velocity of the k@c60 motion, and, respectively, the kinetic energy of the k@c60 impact against the blocking chamber wall . Results of molecular - dynamic modeling of the k@c60 transfer at the temperature elevation up to 350 k. k@c60 ion position with respect to the initial (time = 0 ps .) The change in the k@c60 ion kinetic energy as a function of time the methane molecules desorption process is shown in fig . The desorption stops at 25.4 ps, there are 53 methane molecules in the storage chamber, which is 1.38 mass% we demonstrated the functioning of the nanocapsule of complex structural shape for methane storage using the method of molecular dynamics . An obvious advantage of the nanocapsule is its operation cycle: methane is adsorbed under the elevated pressure (40 mpa) and at normal temperature with further blocking of methane molecules by the k@c60 endohedral complex in the nanocapsule with the external electric field, the storage is performed in normal external conditions, and methane desorption is performed at temperature elevation up to 350 k, at which methane molecules push out the k@c60 and are desorbed from the nanocapsule . Methane content in the nanocapsule at the storage stage is ~11.09 mass% . At the storage and desorption stages, the electric field is not used, this significantly simplifies the use of nanocapsules in automobile applications . The multiple techniques of nanostructural engineering developed are the prerequisites for the creation of similar nanocapsules . Calculations are made in interdepartmental supercomputer center of the russian academy of science (moscow).
It is an unusual " atypical " antipsychotic, as the " atypical " profile of the new antipsychotics clozapine, olanzapine, quetiapine, and risperidone has been linked to combined antagonism of serotonin 2 (5-ht2) and dopamine 2 (d2) receptors, whereas amisulpride has negligible affinity for 5 ht2 receptors and is specific for dopamine d2 and d3 receptors in the limbic rather than striatal structures . There are reports of amisulpride being used for the management of bipolar disorders . However, there are very few reports of mania induced by amisulpride . Here we describe a young male who developed mania while on amisulpride, a newer antipsychotic drug introduced in india . A 18-year - old unmarried hindu male presented with a history suggestive of schizophrenia for the last 2 years . The illness had an acute onset with complaints of suspiciousness, hearing voices not heard by others, violent abusive behavior, disturbed biological functions, and decreased self care . He was started on risperidone 4 mg along with trihexyphenidyl 2 mg and lorazepam 6 mg per day . Gradually, over a period of 1 month, he showed improvement in the symptoms . Subsequently, trihexyphenidyl and lorazepam were tapered and he was maintained on risperidone 4 mg per day for the next 1 and a half year . However, he would still be lethargic, would prefer to remain alone and would be inattentive at class . He would not interact with others and not take active part in various household functions . He was prescribed amisulpride for the negative symptoms along with risperidone 4 mg that was continued . It was initiated at 50 mg per day and was increased to 100 mg per day after 4 days of initiation it . After 10 days of 100 mg dose, the patient developed a manic episode, characterized by decreased need for sleep, over talkativeness, hyperactivity, persistent elevated mood, disinhibited behavior, over - grooming, and distractibility . Amisulpride was stopped and he was prescribed lorazepam 4 mg on as and when required basis . The patient was followed up after 1 week and during this time there was substantial improvement in his manic symptoms with ymrs score of 17 . To the best of our knowledge of mania due to first amisulpride was reported by murphy in 2003 . However, in the case described by murphy, the patient was also on citalopram, an antidepressant, though its discontinuation did not led to improvement in manic symptoms . Also, the patient was initiated on olanzapine immediately which would also probably have antimanic effects . In our case, use of the naranjo adverse drug reaction probability scale and edward's criteria both indicate a probable relationship between the manic episode and short - term exposure to amisulpride therapy . The manic symptoms with amisulpride can be postulated to be due to the fact that amisulpride in low doses (<10 mg / kg), preferentially blocks presynaptic d2/d3 receptors, resulting in enhanced dopamine transmission . Increased dopamine metabolites and increased dopamine transmission this case report highlights the fact that close monitoring of patients on amisulpiride should be done for manic symptoms . This is also important because of the fact that atypical antipsychotic drugs (including amisulpride) are used for the treatment for bipolar disorder . Open label studies have shown that amisulpride may be useful for patients with bipolar disorder . Also, as low doses enhance dopamine transmission, and high doses reduce dopamine transmission, it might be prudent to start amisulpride at the recommended target dose at the initiation of therapy.
Aging leads to senile diseases, including alzheimer disease (ad), which has become a serious medical and socioeconomic problem . Therefore, progress in early diagnosis and effective treatment of ad is necessary, especially in the preliminary or early stages of the disease . Most elderly people experience physiological memory disorders; these disorders require a careful clinical assessment, as it is extremely difficult to delineate the line between physiology and pathology . Thus, when disorders of memory and other cognitive functions go beyond the standards of age and educational level, but have not yet reached the standards of dementia, we diagnose mild cognitive impairment (mci), which includes several states that either match the standard in its wide meaning, for example age - associated memory impairment (aami), age - related cognitive decline (arcd), or we diagnose pathology like mci, which, although clinically similar, has a different prognosis than aami and arcd [14]. Currently, base on criteria established by the mayo clinic group, mci is define as a transitional state between normal aging and alzheimer s disease, in which memory impairment is greater than expected for age, but general cognitive function and daily living activities are preserved . People suffering from mci, especially amnestic form (amci), are at risk for developing dementia, particularly alzheimer disease (ad) [35]. According to various reports, the percentage of conversion from amci into ad ranges from 1% to 25% per year, while the mean time of dementia progression from the mci diagnosis is 4.4 years . Obviously, the early identification of patients at risk for alzheimer disease from among those with mci would facilitate proper treatment help to delay the symptoms of dementia . Therefore, searching for methods that would help us detect a higher risk of dementia in those patients, as well as looking for objective methods of early diagnosis of patients with mci, seems reasonable . Many reports confirm a typical repeatable topographical location of neuropathological lesions at various stages of ad, as described by braak et al and pantel et al ., while emphasizing early involvement of the limbic system, including the hippocampus and entorhinal cortex . Earlier pathology in these strategic regions in patients with a higher risk of alzheimer - type dementia, as well as in certain patients with amnestic mci, seems likely . Atrophy of the medial temporal lobe in mci patients with a positive correlation of atrophy level and a risk of conversion to ad, inadequate for age and observed in imaging examinations (ct, mri), has been clearly demonstrated [813]. The level of atrophy is judged by descriptive, volumetric and planimetric methods, or indirectly with the use of linear measurements of particular fluid spaces, such as fissures or certain parts of the ventricular system . Despite many years of experience in structural diagnosis of the dementia diseases, the use of functional methods seems to be very helpful . In spect and pet examinations we observe the lowering of perfusion and metabolism of glucose and oxygen in temporal and parietal areas in patients with possible ad, as well as in those with mci . However, these methods have certain limitations such as relatively low linear resolution, which hinders precise determination of the topography of the measuring (this problem relates to the middle temporal structures and not to the hemispheres cortex). A wider clinical application of magnetic resonance spectroscopy (mrs), described by bootomley as a window for metabolism enabled an intravital assessment of regional metabolic disorders in certain structures of the brain . There have been several reports on such dysfunctions in the limbic system in patients with alzheimer disease . A relatively small number of spectroscopic examinations have been carried out on patients with mci . Some of these were presented by catani et al ., who located voxels in the white matter at the ventricular triangle level and kantarci et al . Who examined the posterior part of the cingulate gyrus in patients with mci and ad . However, these are the locations where anatomopathologic changes, typical for ad, appear later than in the medial temporal lobe (including hippocampal formation). Many authors give up on spectroscopic examinations of hippocampal structures due to their technical limitations, such as the size of examined structures and topographical relations of the surrounding area . The problems mentioned most often are: difficulties with field homogeneity, artifacts from cranial base area, a disqualifying weakening of the signal - to - noise ratio, and the need to reduce the volume of interest (voi). There have been reports on the technical capacities of such examinations in various brain diseases [1923]. According to available the available literature, in the majority of papers h1mrs in mci and ad metabolites were measured in the posterior cingulated gyrus, but parts of papers evaluated the concentration of metabolites in the bilateral hippocampi of mci patients . This study attempted to evaluate the regional metabolic disorders using h mrs within the frontal, external and medial temporal lobes in patients with mci, as a predictor of clinical deterioration to dementia based on clinical follow - up . This study attempted to evaluate the regional metabolic disorders using h mrs within the frontal, external and medial temporal lobes in patients with mci, as a predictor of clinical deterioration to dementia based on clinical follow - up . The examination was performed on a group of 31 randomly selected subjects (19 females and 12 males) with mci diagnosed under the care of the department of neurodegenerative disorders, medical research centre, polish academy of science . All subjects underwent neurological and psychiatric tests, routine laboratory investigations and standard neuropsychological examinations . Patients with serious cns injuries, alcoholic abuse, diabetes, and serious hepatic and renal dysfunctions were excluded . Mci diagnosis was established by a team of specialists after analyzing all available information and test results . Mri and h mrs examination was performed on a 1.5 t eclipse (marconi medical systems, usa) scanner . Morphological mri examination of the brain was carried out in transverse planes, parallel to the longitudinal axis of the temporal lobe in se, fse and flair sequences, in t1- and t2-weighted images, and in the frontal plane perpendicular to the longitudinal axis of the temporal lobe in flair sequence . We investigated the extent of cerebral atrophy, especially in medial and external temporal lobes and in frontal structures, as well as the presence of cortical - subcortical hyperintensive focuses (which equal angiogenic lesions) in t2-weighted images and flair sequence . Morphological examination enabled us to exclude other pathologies such as extensive ischemic lesions, tumors, paracerebral hematomas, and hydrocephalus, which might lead to cognitive disorders . Changes like leukoaraiosis and/or small single angiogenic focuses of gliosis were not exclusion criteria for the study . The voi (volume of interest) was located in the frontal, medial and external temporal lobe regions, separately on each side . In case of medial temporal lobe covering the hippocampal formation, it was divided into 2 areas the anterior (the topographical point of reference in the coronal plane / layer was the level of dens) and the posterior (the point of reference was the output of the middle cerebellar peduncles from the pons). Both areas were then added, and final average data sets were used in further analysis . In cases of reduced volume of the hippocampal formation, the adjacent fluid spaces (eg, the temporal horn of the lateral ventricle and the lateral part of the transverse fissure) were also included into the voi . Necessary corrections of voi location were applied to particular frontal cross - sections, as well as to the axial plane, and care was taken not to cover the osseous structures of the temporal bone pyramids . For every localization, the size of voi was 8 cm . Additionally, each subject had frontal measurement taken . H mrs examination was carried out with a single - voxel method using press sequence . Routine 3-impulse sequences of 90, 180, 180 degrees and double crusher impulse were used . The examination was performed with an automated standardization of the field in the entire encephalon / brain (total shimming) and in the examined sample (local shimming). For water suppression, spectra were recorded within the following parameters: te=35 ms, tr=1500 ms, thickness = 15 mm, signal averages = 192 . Assignment of resonance lines of particular metabolites was based on n - acetylaspartate signal with chemical shift set to 2.0 ppm . The spectra were analyzed using the manufacturer - supplied software package for the mrs (marconi). In some cases, it was necessary to correct the phase manually in order to obtain a maximum of symmetrical signal of residual water and to maintain a proper baseline . Relative concentration ratios of particular metabolites n - acetylaspartate (naa), choline (cho), myoinositol (mi), glutamine and glutamate (glx) were analyzed in reference to the signal of unsuppressed water signal, and also to the signal of creatine, considering its level as an inner standard . Results analysis of clinical and biochemical data age, mini - mental score (mm - score), folic acid, vitamin b12 and homocysteine level was performed including initial data of all subjects enrolled into the study . Evaluation of relative concentration ratios of metabolites from all vois, localized within frontal, medial and external temporal lobes, symmetrical on both sides, were performed in each case . A comparison of some metabolic ratios of mrs in patients with mci, who on follow - up has stable disease (sd), disease progression (dp) and conversion to ad, was performed . The statistical analysis was carried out using the statistica for windows 7.0 (statsoft, ok, usa) software package . The examination was performed on a group of 31 randomly selected subjects (19 females and 12 males) with mci diagnosed under the care of the department of neurodegenerative disorders, medical research centre, polish academy of science . All subjects underwent neurological and psychiatric tests, routine laboratory investigations and standard neuropsychological examinations . Patients with serious cns injuries, alcoholic abuse, diabetes, and serious hepatic and renal dysfunctions were excluded . Mci diagnosis was established by a team of specialists after analyzing all available information and test results . Mri and h mrs examination was performed on a 1.5 t eclipse (marconi medical systems, usa) scanner . Morphological mri examination of the brain was carried out in transverse planes, parallel to the longitudinal axis of the temporal lobe in se, fse and flair sequences, in t1- and t2-weighted images, and in the frontal plane perpendicular to the longitudinal axis of the temporal lobe in flair sequence . We investigated the extent of cerebral atrophy, especially in medial and external temporal lobes and in frontal structures, as well as the presence of cortical - subcortical hyperintensive focuses (which equal angiogenic lesions) in t2-weighted images and flair sequence . Morphological examination enabled us to exclude other pathologies such as extensive ischemic lesions, tumors, paracerebral hematomas, and hydrocephalus, which might lead to cognitive disorders . Changes like leukoaraiosis and/or small single angiogenic focuses of gliosis were not exclusion criteria for the study . The voi (volume of interest) was located in the frontal, medial and external temporal lobe regions, separately on each side . In case of medial temporal lobe covering the hippocampal formation, it was divided into 2 areas the anterior (the topographical point of reference in the coronal plane / layer was the level of dens) and the posterior (the point of reference was the output of the middle cerebellar peduncles from the pons). Both areas were then added, and final average data sets were used in further analysis . In cases of reduced volume of the hippocampal formation, the adjacent fluid spaces (eg, the temporal horn of the lateral ventricle and the lateral part of the transverse fissure) were also included into the voi . Necessary corrections of voi location were applied to particular frontal cross - sections, as well as to the axial plane, and care was taken not to cover the osseous structures of the temporal bone pyramids . For every localization, the size of voi was 8 cm . H mrs examination was carried out with a single - voxel method using press sequence . Routine 3-impulse sequences of 90, 180, 180 degrees and double crusher impulse were used . The examination was performed with an automated standardization of the field in the entire encephalon / brain (total shimming) and in the examined sample (local shimming). For water suppression, spectra were recorded within the following parameters: te=35 ms, tr=1500 ms, thickness = 15 mm, signal averages = 192 . Assignment of resonance lines of particular metabolites was based on n - acetylaspartate signal with chemical shift set to 2.0 ppm . The spectra were analyzed using the manufacturer - supplied software package for the mrs (marconi). In some cases, it was necessary to correct the phase manually in order to obtain a maximum of symmetrical signal of residual water and to maintain a proper baseline . Relative concentration ratios of particular metabolites n - acetylaspartate (naa), choline (cho), myoinositol (mi), glutamine and glutamate (glx) were analyzed in reference to the signal of unsuppressed water signal, and also to the signal of creatine, considering its level as an inner standard . Results analysis of clinical and biochemical data age, mini - mental score (mm - score), folic acid, vitamin b12 and homocysteine level was performed including initial data of all subjects enrolled into the study . Evaluation of relative concentration ratios of metabolites from all vois, localized within frontal, medial and external temporal lobes, symmetrical on both sides, were performed in each case . A comparison of some metabolic ratios of mrs in patients with mci, who on follow - up has stable disease (sd), disease progression (dp) and conversion to ad, was performed . The statistical analysis was carried out using the statistica for windows 7.0 (statsoft, ok, usa) software package . All patients had annual clinical follow - up at least twice . At the beginning of the study, subjects were divided into 2 groups 9 subjects who had amnestic mci, and the others who had multidomain mci . There were no statistical differences between groups of patients with multidomain mci and amnestic mci, including age, m - m score, level of vitamin b12, folic acid and homocysteine (p>0.05). Comparison of mean value in some selected parameters including both groups is presented in table 1 . During clinical follow - up (median 3 years) 8 subjects had stable disease (sd), 13 had progression of disease (dp) and 10 developed ad . There was no significant difference between age, m - m score, vitamin b12, folic acid and homocysteine level among these 3 groups of subjects (p>0.05). Statistical analyses of baseline metabolic ratios measurement using h mrs between the final 3 groups of patients, (sd, dp and ad) found significant difference in frontal lobes in mi / h20 ratio on left, between patients with stable disease (0.27) and those with progression (0.22) (p=0.03) (figure 1). In the groups of patients with dp and those with conversion to ad, there was a significant difference on the left side in ratio naa / cr (1.77 vs. 1.43), (p=0.02) (figure 2). Significant difference within temporal external lobes were found between patients with sd and dp in naa / h2o ratio on the left side (0.55 vs. 0.51), (p=0.04) (figure 3). Additionally, there were significant differences between patients with sd and ad in chol / cr ratio (0.99 vs. 0.88) on the right side (p=0.04) and in mi / cr (1.09 vs. 0.62) on the left side (p=0.03). A significant difference within the medial temporal lobe was found between patients with dp and ad in glx / h2o ratio (0.44 vs. 0.34) on the right side (m - w u - test, p=0.02). There were no other significant differences within h mrs metabolic ratios . An example of h mrs study in patient with initial diagnosis of mci and clinical deterioration during 2 years of follow - up with final diagnosis of ad is presented in (figure 4) (a initial h mrs, and after final diagnosis, control h mrs study b). Summary of initial h mrs ratios of some metabolites in frontal, external and medial temporal lobes both sides are presented in table 3 . Proton magnetic resonance spectroscopy h mrs enables an in vivo noninvasive assessment of the degree of biochemical disorders in a specified voi of the examined tissue, as well as monitoring the progress of those changes in the course of the disease and its treatment [5,1725]. The method we used, along with the parameters mentioned above, resulted in satisfactory quality of spectra in examined patients . Recent studies have demonstrated the value of h1mrs in many types of cognitive disorders, not only in degenerative diseases . In mrs diagnosis, normal tissues present a constant proton spectrum, while ratio changes of the metabolites can be considered as reflections of certain biochemical transformations . Several cytological and histochemical investigations have contributed to the study of the relationship between certain chemical substances and precisely defined intracellular structures or biochemical processes physiological as well as pathological . N - acetylaspartate is commonly considered as a neuronal marker due to its presence only in mature nerve cells . There are several reports of age - dependent lowering of naa level in certain parts of the encephalon, which is being interpreted not only as an effect of a progressive decrease in number of neurons, but also as their dysfunction . It also seems clear that there is a lowering of the naa concentration in atrophic structures of the limbic system in patients with ad, and a reverse correlation of the level of this metabolite with the level of dementia . However, the h mrs examinations of the posterior part of the cingulate gyrus (frontal lobe) in patients with mci, carried out by the rochester group, did not prove statistically significant differences of the naa ratios as compared to the control group . In our study, we found a significant difference between the ratio of naa / cr between patients with ds vs. dp in the left frontal lobe . We also found significant difference in naa / h2o between patients with ds and dp in the left external temporal lobe . We could not find any significant difference between naa / cr and naa / h2o within the medial temporal lobe on any sides . This could due to the frequent technical difficulties mentioned before, as measurement of the medial temporal lobe (hippocampus area) is often inconvenient . The neuronal integrity marker naa / cr or naa / h2o ratio (independent of creatine level) is currently declined in patients with progressive mci and those with conversion to ad compared to cognitively normal elderly subjects . Our findings generally agree with others reports that found lower levels of naa in patients with mci and deterioration of brain function and who convert to ad . Others reports indicated the left side more often has a drop in naa - rich neurons compare to the right side [2026]. Medial temporal lobes (hippocampus structures) are widely considered as the region in which the earliest ad pathologies occur . Therefore it seems that the lowering of naa concentration in this localization in patients with mci proves the theory of successive metabolic disorders in progression of dementia, according to which a lower concentration of myoinositol precedes the decline in naa concentration [2124]. In many reports, naa depletion seems to be good marker, as in metastasio et al . Single reports indicated that the significant reduction of naa has great predictive value within the occipital area in those based on roc with threshold level <1.61 of naa / cr ratio; other regions and others ratios were not significant in this study . Despite this inhomogeneous data, numerous studies have shown that naa plays an important role in neuronal integrity, with the left side more often affected in patients with progressive mci and in those with conversion to ad [1826]. Some studies have found an elevated level of mi / cr, with good correlation of disease progression and increase of neurofibrillary tangles in patients with conversion into ad . In our study we did not find any of these findings; on the contrary, we detected some depletion of mi / cr in patients with conversion to ad compared to those with stable disease, with a significant difference on the left external temporal lobe (1.09 vs. 0.62). We found the same tendency in mi / h2o ratio on the left frontal lobe between patients with disease stability and disease progression . Others reported differences between patients with mci and ad, with significantly higher signal ratio of mi / cr in ad . Others publications did not report any difference in this metabolite ratio in the group of patients with mci . The differences in results of various groups of researchers could be explained by selection of the study population . The same research group indicated different results, dependent on study group for instance, no difference was found in selected population of patients with amnestic mci compare to a heterogenous population with significant difference in mi signal . Some reports indicated that an elevated level of this metabolite in structures of the limbic system in patients with mci or dementia is connected with regional gliosis . This theory is supported by the presence of visibly higher mi concentrations in glia cells than in neurocytes . However, thus far the exact role of mi in mci and ad is unclear . There are many other disorders of the brain with mi disturbance, so specificity of this marker and ratio of mi / cr or mi / h2o seems to be low . Recent data suggests good discrimination using mi / cr ratio in different types of dementia using roc curve . Additional theory posits an extensive cellular capture of mi in patients at risk of dementia as the result of na / mi osmoregulator dysfunction . The study of adults with down syndrome, who constitute a clinically exceptional group of subjects with 100% risk of dementia similar to the alzheimer s disease, demonstrated a greater that 50% rise of the myoinositol level with age compared to the healthy control group . The authors associated this with an elevated activity of sodium - myoinositol transporter/ transmitter, which results from the existence of the additional 21 chromosome in down syndrome adults, which includes the gene - encoding protein of the transmitter . In our study, significant differences in mi / cr and mi / h2o were found in frontal and external temporal lobes, but not in the medial temporal lobe . Our h mrs study shows a significant difference between chol / cr ratio only in the external temporal lobe on the left side, with a significant drop in the chol / cr ratio between patients with stable disease and ad . This result agrees with metastasio et al ., who showed a decreased, but not significant, depletion of chol / cr in mci patients with disease progression compare to those with stable disease in both hemispheres . This could be related to cholinergic neuronal damage, which is indirectly confirmed by increased activity of choline acetyltransferase (chat), and which probably represents a compensatory (but insufficient) response in ad . Impairment of mitochondrial activity seen in elderly patients, and more obviously in patients with ad, could be related to increase of mitochondrial membrane damage and evaluated level of membrane phospholipid and decrease in phosphatidyl - choline and phosphatidylethanolamine described previously . In our study, significant difference in glutamine and glutamate (glx) ratio was noted only on the medial temporal lobe on the right side, which indicates disturbance of glx . This finding agrees with data presented by kantarci et al ., who found a trend toward decreased glu + gln / cr ratios from normal to mci to ad, but there were no statistically significant differences . Detailed analysis of glutamine and glutamate in mci and ad could be explored using the new 3 t system, which currently is commercially available . In the medial temporal lobe h mrs has several limitations that could influence our results and our interpretation . In view of the complicated spatial shape of the medial temporal - hippocampal formation (which is considered to be the region first changed by the progression of dementia pathology) and its relatively small size, our volume of interest also covered other tissue structures outside the target structure, which could have caused partial falsification of the results as to its volume effect on the other hand, these structures belong to the limbic system, and show pathological changes in the subsequent stages of the disease . According to reports in the literature, including the adjacent fluid spaces (temporal horn of the lateral ventricle, lateral part of the transverse fissure) into the voi should not affect the results . Some researchers claim that chemical shift imaging (csi), also known as single voxel spectroscopy (svs), which allows recording spectra from many neighboring voxels within the examined area, is better for assessment of metabolic disorders within the hippocampus because it enables a more precise measurement . This theory was not corroborated in comparative studies of both of the methods used on a group of patients with temporal lobe epilepsy . N - acetylaspartate is commonly considered as a neuronal marker due to its presence only in mature nerve cells . There are several reports of age - dependent lowering of naa level in certain parts of the encephalon, which is being interpreted not only as an effect of a progressive decrease in number of neurons, but also as their dysfunction . It also seems clear that there is a lowering of the naa concentration in atrophic structures of the limbic system in patients with ad, and a reverse correlation of the level of this metabolite with the level of dementia . However, the h mrs examinations of the posterior part of the cingulate gyrus (frontal lobe) in patients with mci, carried out by the rochester group, did not prove statistically significant differences of the naa ratios as compared to the control group . In our study, we found a significant difference between the ratio of naa / cr between patients with ds vs. dp in the left frontal lobe . We also found significant difference in naa / h2o between patients with ds and dp in the left external temporal lobe . We could not find any significant difference between naa / cr and naa / h2o within the medial temporal lobe on any sides . This could due to the frequent technical difficulties mentioned before, as measurement of the medial temporal lobe (hippocampus area) is often inconvenient . The neuronal integrity marker naa / cr or naa / h2o ratio (independent of creatine level) is currently declined in patients with progressive mci and those with conversion to ad compared to cognitively normal elderly subjects . Our findings generally agree with others reports that found lower levels of naa in patients with mci and deterioration of brain function and who convert to ad . Others reports indicated the left side more often has a drop in naa - rich neurons compare to the right side [2026]. Medial temporal lobes (hippocampus structures) are widely considered as the region in which the earliest ad pathologies occur . Therefore it seems that the lowering of naa concentration in this localization in patients with mci proves the theory of successive metabolic disorders in progression of dementia, according to which a lower concentration of myoinositol precedes the decline in naa concentration [2124]. In many reports, naa depletion seems to be good marker, as in metastasio et al . Single reports indicated that the significant reduction of naa has great predictive value within the occipital area in those based on roc with threshold level <1.61 of naa / cr ratio; other regions and others ratios were not significant in this study . Despite this inhomogeneous data, numerous studies have shown that naa plays an important role in neuronal integrity, with the left side more often affected in patients with progressive mci and in those with conversion to ad [1826]. Some studies have found an elevated level of mi / cr, with good correlation of disease progression and increase of neurofibrillary tangles in patients with conversion into ad . In our study we did not find any of these findings; on the contrary, we detected some depletion of mi / cr in patients with conversion to ad compared to those with stable disease, with a significant difference on the left external temporal lobe (1.09 vs. 0.62). We found the same tendency in mi / h2o ratio on the left frontal lobe between patients with disease stability and disease progression . Others reported differences between patients with mci and ad, with significantly higher signal ratio of mi / cr in ad . Others publications did not report any difference in this metabolite ratio in the group of patients with mci . The differences in results of various groups of researchers could be explained by selection of the study population . The same research group indicated different results, dependent on study group for instance, no difference was found in selected population of patients with amnestic mci compare to a heterogenous population with significant difference in mi signal . Some reports indicated that an elevated level of this metabolite in structures of the limbic system in patients with mci or dementia is connected with regional gliosis . This theory is supported by the presence of visibly higher mi concentrations in glia cells than in neurocytes . However, thus far the exact role of mi in mci and ad is unclear . There are many other disorders of the brain with mi disturbance, so specificity of this marker and ratio of mi / cr or mi / h2o seems to be low . Recent data suggests good discrimination using mi / cr ratio in different types of dementia using roc curve . Additional theory posits an extensive cellular capture of mi in patients at risk of dementia as the result of na / mi osmoregulator dysfunction . The study of adults with down syndrome, who constitute a clinically exceptional group of subjects with 100% risk of dementia similar to the alzheimer s disease, demonstrated a greater that 50% rise of the myoinositol level with age compared to the healthy control group . The authors associated this with an elevated activity of sodium - myoinositol transporter/ transmitter, which results from the existence of the additional 21 chromosome in down syndrome adults, which includes the gene - encoding protein of the transmitter . In our study, significant differences in mi / cr and mi / h2o were found in frontal and external temporal lobes, but not in the medial temporal lobe . Our h mrs study shows a significant difference between chol / cr ratio only in the external temporal lobe on the left side, with a significant drop in the chol / cr ratio between patients with stable disease and ad . This result agrees with metastasio et al ., who showed a decreased, but not significant, depletion of chol / cr in mci patients with disease progression compare to those with stable disease in both hemispheres . This could be related to cholinergic neuronal damage, which is indirectly confirmed by increased activity of choline acetyltransferase (chat), and which probably represents a compensatory (but insufficient) response in ad . Impairment of mitochondrial activity seen in elderly patients, and more obviously in patients with ad, could be related to increase of mitochondrial membrane damage and evaluated level of membrane phospholipid and decrease in phosphatidyl - choline and phosphatidylethanolamine described previously . In our study, significant difference in glutamine and glutamate (glx) ratio was noted only on the medial temporal lobe on the right side, which indicates disturbance of glx . This finding agrees with data presented by kantarci et al ., who found a trend toward decreased glu + gln / cr ratios from normal to mci to ad, but there were no statistically significant differences . Detailed analysis of glutamine and glutamate in mci and ad could be explored using the new 3 t system, which currently is commercially available . In the medial temporal lobe h mrs has several limitations that could influence our results and our interpretation . In view of the complicated spatial shape of the medial temporal - hippocampal formation (which is considered to be the region first changed by the progression of dementia pathology) and its relatively small size, our volume of interest also covered other tissue structures outside the target structure, which could have caused partial falsification of the results as to its volume effect on the other hand, these structures belong to the limbic system, and show pathological changes in the subsequent stages of the disease . According to reports in the literature, including the adjacent fluid spaces (temporal horn of the lateral ventricle, lateral part of the transverse fissure) into the voi should not affect the results . Some researchers claim that chemical shift imaging (csi), also known as single voxel spectroscopy (svs), which allows recording spectra from many neighboring voxels within the examined area, is better for assessment of metabolic disorders within the hippocampus because it enables a more precise measurement . This theory was not corroborated in comparative studies of both of the methods used on a group of patients with temporal lobe epilepsy . H mrs seems to be a very sensitive method that provides biochemical information using an in vivo approach in patients with initial mci, who in significant numbers developed disease progression and/or converted to ad . A potential advantage could be achieved by using 3 t systems, which can better discriminate quantization of glu + gln / cr and gln / cr ratios.
Intraocular pressure (iop) is one the most important modifiable risk factors for glaucoma progression.13 iop measurements in the ophthalmology clinic are often limited to office hours, which do not fully represent the nychthemeral iop peaks and fluctuations.4,5 previously, 24-hour iop monitoring studies have reported fluctuation as high as 8.21.4 mmhg, but many of these studies measured iop in the sitting position, overnight in a hospital environment, and over a few sampling periods, which does not truly reflect the physiological and normal setting of one s daily living, especially when the subjects are awakened at night for iop measurements.610 various studies have reported the significance of iop fluctuation on glaucoma progression.11,12 while there are studies that report otherwise,13,14 much of the existing literature has only documented inter - visit or daytime iop variability over a limited number of hours . This is at least partly due to limitations of how frequently repeated tonometric iop measurements can be taken . A contact lens - based sensor (cls) is nowadays available for the recording of ocular dimensional profiles for up to 24 hours.15 this device has been shown to be safe and tolerable in healthy subjects and glaucoma patients as well as to provide reproducible recording of 24-hour profiles.1618 the aim of this study was to analyze the 24-hour ocular dimensional profile in normal - tension glaucoma (ntg) patients on medical treatment . Informed patient consent and approval by the institutional review board of the hospital authority of hong kong were obtained prior to study commencement . This was a prospective cohort study from july 2012 to june 2013, conducted at a university hospital in hong kong . The study recruited consenting adults (age> 18 years old) with unilateral or bilateral ntg who were currently on topical antiglaucoma medications . Ntg was defined as open angle on gonioscopy; progressive thinning of the retinal nerve fiber layer (rnfl) on optical coherence tomography, with corresponding glaucomatous visual field changes on the humphrey visual field analyzer; and an iop 21 mmhg on all clinical visits based on previous medical records . Cases with previous glaucoma surgery or laser treatment, active or previous corneal disease, and subjects with only one functional eye were excluded . The sensimed triggerfish (sensimed ag, lausanne, switzerland) is a soft silicone cls that enables recording of the ocular dimensional profile over a 24-hour period with minimal disturbance to one s daily routines and sleep cycles . Such 24-hour profiles are related to the 24-hour iop profiles.18 dimensional changes are recorded in the corneoscleral area for 30 seconds every 5 minutes over 24 hours and each recording burst represents 300 data points, the medians of which are plotted as a single graph which makes up the 24-hour ocular dimensional profile measured in sensory output units of millivolt equivalents (mveq). The device was ce - marked and thus approved for clinical use in 2009 . In healthy volunteers and glaucoma patients, the cls was found to be tolerable in normal activities of daily living and during sleep . A contact lens with base curve 8.7 mm was also found to be well adapted in most eyes, although the device also exists in steeper (8.4 mm) and flatter (9.0 mm) base curves.1618 the cls was placed on the subject s eye by an ophthalmologist in the outpatient clinic after a slit - lamp examination of the anterior segment and goldmann applanation tonometry (gat) by a single investigator . For those with unilateral disease, the cls was placed on the eye with ntg . For those with bilateral disease, a random eye assignment by card shuffling was used to determine the eye for the cls placement . The subject then returned home with lubricating eyedrops and carried on his or her daily activities (both indoor and outdoor), apart from showering or swimming (as the device cannot be in contact with water). Subjects continued their same regimen of antiglaucoma eyedrops and slept in their habitual position at night . After 24 hours, the subject returned to the clinic to have the cls removed followed by a slit - lamp examination and gat . Cls profile parameters were extracted following smoothing of the profile using locally weighted polynomial regression . Cls variability from mean: this variable reflects variability around the mean value of all raw (not smoothed) cls measurements in the respective period (24-hour, diurnal, or nocturnal). Diurnal / nocturnal variability: same as above but only during the awake and asleep periods, respectively, where the sleep cycle is determined from recorded sleep times in each individual s logbook and verified by the eye - blinking frequency (present during waking) and the presence of rhythmic ocular pulsation waves (present during sleep). Sleep - to - wake and wake - to - sleep slopes: calculated with a generalized linear model on raw measurements in units of mveq / hour from 1 hour before sleep or wake time to 1 hour after sleep or wake time, respectively . Number of peaks: a peak is defined as a local maximum point in the smoothed curve . The calculation of the number of peaks occurs as follows: each trough is noted as the start of a peak . The pre- and post - cls gat iops were compared using the wilcoxon signed - rank test . Whitney u - test: nocturnal versus diurnal mean variability from mean;wake - to - sleep versus sleep - to - wake slopes;number of nocturnal versus diurnal peaks; and24-hour, diurnal, and nocturnal variability among prostaglandin users and nonusers . Nocturnal versus diurnal mean variability from mean; wake - to - sleep versus sleep - to - wake slopes; number of nocturnal versus diurnal peaks; and 24-hour, diurnal, and nocturnal variability among prostaglandin users and nonusers . Fisher s exact test was used to compare the differences in the number of nocturnal peaks between those using a prostaglandin antiglaucoma medication versus those using other, non - prostaglandin antiglaucoma medications . Cls variability from mean: this variable reflects variability around the mean value of all raw (not smoothed) cls measurements in the respective period (24-hour, diurnal, or nocturnal). Diurnal / nocturnal variability: same as above but only during the awake and asleep periods, respectively, where the sleep cycle is determined from recorded sleep times in each individual s logbook and verified by the eye - blinking frequency (present during waking) and the presence of rhythmic ocular pulsation waves (present during sleep). Sleep - to - wake and wake - to - sleep slopes: calculated with a generalized linear model on raw measurements in units of mveq / hour from 1 hour before sleep or wake time to 1 hour after sleep or wake time, respectively . Number of peaks: a peak is defined as a local maximum point in the smoothed curve . The calculation of the number of peaks occurs as follows: each trough is noted as the start of a peak . The pre- and post - cls gat iops were compared using the wilcoxon signed - rank test . Whitney u - test: nocturnal versus diurnal mean variability from mean;wake - to - sleep versus sleep - to - wake slopes;number of nocturnal versus diurnal peaks; and24-hour, diurnal, and nocturnal variability among prostaglandin users and nonusers . Nocturnal versus diurnal mean variability from mean; wake - to - sleep versus sleep - to - wake slopes; number of nocturnal versus diurnal peaks; and 24-hour, diurnal, and nocturnal variability among prostaglandin users and nonusers . Fisher s exact test was used to compare the differences in the number of nocturnal peaks between those using a prostaglandin antiglaucoma medication versus those using other, non - prostaglandin antiglaucoma medications . In the 18 subjects enrolled in the study, there were seven males and eleven females . Gat iops before and after the cls wear were 15.32.2 and 13.81.7 mmhg, respectively, while on the same antiglaucoma medications (p=0.05). The mean rnfl thickness was 72.99.8 m and the mean deviation and pattern standard deviation on humphrey visual field analysis were 6.34.5 decibels (db) and 6.14.1 db, respectively . In the 18 subjects, 38.9% (7/18) used a single prostaglandin eyedrop administered in the evening, 44.4% (8/18) used a twice - daily non - prostaglandin eyedrop, and 17.6% (3/17) used both a nocturnal prostaglandin eyedrop plus a twice - daily antiglaucoma eyedrop . The mean 24-hour variability from the mean cls signal was 75.921.5 (range: 35.7120.9; 95% confidence interval [ci]: 62.886.7) mveq . The mean nocturnal variability from the mean was 52.120.3 (range: 23.9105.1; 95% ci: 41.662.5) mveq, which was 48.9% less than the mean diurnal variability from the mean (77.620.6) (range: 43.9118.4; 95% ci: 66.988.2) mveq (p=0.002). There were no statistically significant differences in the mean diurnal, nocturnal, or 24-hour variability between those with and without prostaglandin analog treatment (all p>0.1) (table 1). The mean number of peaks during sleep and daytime was 6.42.3 and 9.32.4, respectively . The number of peaks was 54.7% less during the nocturnal period than the diurnal period (p=0.001). There was no significant difference between the frequencies of nocturnal peaks among those using a prostaglandin antiglaucoma medication versus those using other, non - prostaglandin antiglaucoma medications (table 2). The mean sleep time of subjects was from 8.53 pm 12.6 minutes to 7.06 am 3.6 minutes . The study population had a mean positive linear slope on their cls profile from wake - to - sleep with a mean of 53.242.9 mveq / hour, signifying an increase in the ocular dimensional profile when going to sleep . Similarly, the population had a mean negative linear slope from sleep - to - wake with a mean of 42.547.6 mveq / hour, signifying a decrease in the ocular dimensional profile upon waking . On comparing the two slopes, the rate of increase when going to sleep was significantly greater than the rate of decrease upon waking (p<0.001) (table 3). The ocular dimensional profiles of all 18 ntg subjects were unique, with individual peaks occurring at different time intervals throughout the day and night; no two tracings were identical . The mean ocular dimensional profile of the study population increased during sleep (positive wake - to - sleep slope) and decreased upon waking (negative sleep - to - wake slope), with the mean rate of increase during sleep being significantly greater than the rate of decrease upon waking (p<0.001). We are inclined to agree with previous postulations, wherein the increase in nocturnal iop was thought to be related to the gravitational pull of fluids to the eye and an increase in episcleral venous pressure during the supine sleep posture.19 through the use of the 24-hour cls, we affirm that the phenomenon of increased iop with supine posturing was consistent among ntg subjects under medical treatment . Other authors have also observed the persistence of posture - induced iop changes despite treatment of ntg patients with iop - lowering medication.20 similarly, a previous japanese study reported, in a population of ntg subjects, that the iop spikes recorded from the habitual positions (sitting up during the day and supine at night) were positively correlated to the spikes induced from a postural - change test and after a water - drinking test.21 in contrast, renard et al reported that, in 27 subjects with suspected ntg, 24-hour iop monitoring revealed that 54.5% exhibited a diurnal acrophase and 36.4% exhibited a nocturnal acrophase, while 9.1% had no nychthemeral rhythm in the absence of medical treatment.22 the existence of concomitant obstructive sleep apnea syndrome in 80% of assessed patients could have influenced the observed iop rhythm in their cohort.22 before the availability of continuous 24-hour ocular dimensional profile recording, it has been reported that, in many glaucoma patients, the iop peaks occurred outside of office hours23,24 and that two - thirds of iop peaks in untreated glaucoma patients occurred during the nocturnal period.25 in our ntg population, we noted that there were 55% less peaks occurring nocturnally than diurnally (p=0.001). The reduction in the number of peaks at night in our ntg population could be related to the use of prostaglandin antiglaucoma eyedrops, since 57% of our subjects were at least on prostaglandin antiglaucoma eyedrops nocturnally . However, it may also be simply due to the absence of physical activity, eye blinking, and saccadic movements at night, as these parameters are known to cause iop spikes and fluctuations.26 other authors have suggested that the nocturnal iop and iop spikes may be related to visual field progression in ntg subjects.21 study on the effect of medical treatment on iop fluctuations has shown that prostaglandin antiglaucoma eyedrops offer the best sustained 24-hour iop reduction, while brimonidine offers the least.27 in our study, the mean nocturnal variability was significantly lower than the mean diurnal variability by 49% (p=0.002). Our findings are in agreement with a previous study by pajic et al28 reporting higher coefficients of variation in cls data during the daytime than at nighttime in ntg patients . Pajic et al reported reduced variability in nocturnal cls data independent of whether or not patients were on antiglaucoma medication.28 we have not recorded cls profiles in our patients without medical treatment and therefore do not know whether the same is valid for this patient cohort; however, it seems plausible that the lower level of activity during sleep provides a natural reduction in variability, which iop - lowering medical treatment may further influence . Holl et al recorded cls profiles in primary open - angle glaucoma and ocular hypertension patients and found no difference in 24-hour, diurnal, or nocturnal standard deviation of cls values in the presence of prostaglandin analog treatment as compared to without treatment.29 the variability of diurnal versus nocturnal cls values was not evaluated . Thus, in this patient cohort, it seems that, while the overall ocular dimensional profile was higher at night, the number of peaks and variability from the mean were significantly reduced at night for ntg subjects on medical treatment . It was interesting to note that the gat iop after cls wear (13.81.7 mmhg) was lower (p=0.05) than the iop before the cls wear (15.32.2 mmhg), although the readings were measured exactly 24 hours apart . This seemingly lower iop after the cls use was short of statistical significance and can be explained by day - to - day variations in iop . There was no sample size calculation, and the relatively small sample size of the study did not allow for evaluation of differences in iop - related pattern nor stratification by the type of treatment . Furthermore, only one 24-hour measurement with the cls was performed, therefore we could not ascertain the reproducibility of the 24-hour iop profile . At present, the ocular dimensional profile is something that cannot be translated into iop and therefore has no validation for use in clinical practice . Additional clinical research needs to be done before we can state (based on evidence) that the cls can be useful in optimizing the timing of medical therapy for individual patients . Nevertheless, this is one of the few publications in the literature analyzing the 24-hour ocular dimensional profile on a continuous basis in ntg subjects receiving medical treatment . Continuous 24-hour ocular dimensional profiles recorded in ntg patients on medical treatment revealed that the profile increased during sleep and decreased upon waking . There was a 50% reduction in both the variability from the mean and number of peaks during sleep as compared to daytime.
Cyclodialysis cleft is a rare clinical finding, but one that can have significant ocular complications, including decreased vision, shallowing of the anterior chamber, corneal edema, hypotony, choroidal effusions, maculopathy, vascular tortuosity, and optic disc edema . While it can be caused by surgical manipulation of the eye, it is more frequently a consequence of trauma.1 traumatic injury to the eye results in separation of the ciliary body from the scleral spur, which creates an aberrant outflow pathway for aqueous humor through the suprachoroidal space and often leads to hypotony . Cyclodialysis cleft has been reported to occur in 3.4% of cases of ocular injury or globe rupture.2 additionally, one large review of 291 cases involving cyclodialysis suggested that hypotony occurs 9% of the time.3 medical treatment with atropine ophthalmic drops and laser therapy to promote reattachment of the ciliary body to the scleral spur are options for repair of this entity, but larger and more chronic cyclodialyses often require surgical repair.4,5 because of their rarity, reports on surgical repair techniques in the literature are limited . We share a novel, simple surgical approach to management of a case of chronic traumatic cyclodialysis cleft with a successful outcome . A 70-year - old caucasian male followed at the martinsburg veterans affair hospital ophthalmology clinic, martinsburg, west virginia, usa, since 2002 was found consistently to have intraocular pressure (iop) asymmetry, with the right eye iop ranging from 615 mmhg and usually having an iop 04 mmhg lower than the left eye . He was monitored for primary open - angle glaucoma and was on latanoprost eye drops in the left eye for field defects in that eye . In april 2008, the patient s history was significant for trauma to the right eye with a piece of wood over 30 years ago, which was thought to be the cause of the cleft . While the patient had hypotony, he maintained good visual acuity, ranging from 20/25 to 20/40, and was therefore observed for approximately 3 years until december 2011 . At this visit, his visual acuity dropped to 20/150 and he clinically developed descemet s folds with a shallow anterior chamber and an iop of 02 mmhg . On dilated fundus exam, he had a shallow choroidal hemorrhage and effusion in the far nasal periphery . The patient was initially treated medically with atropine and prednisolone acetate 1% ophthalmic drops for approximately 2 months, without improvement in iop and with persistence of choroidal hemorrhage and effusion . Postoperatively, the choroidal effusion resolved, but the patient s iop did not improve . On repeat gonioscopy therefore, the patient was taken for additional surgical repair of the persistent cleft by the same technique, this time with successful closure . On postoperative day 1 following the second surgery, the patient complained of severe eye pain and nausea, and was found to have an lop of 58 mmhg . The patient was treated with topical anti - glaucoma drops and oral acetazolamide, with reduction in the iop to the mid - teens and resolution of his pain . On exam, there was no distortion of the pupil by sutures and the anterior chamber appeared deep (figure 1). The patient was subsequently tapered off the oral acetazolamide and topical drops, with stabilization of the pressure in the mid - teens and maintenance of 20/70 visual acuity at 1 year postoperatively . Final visual acuity was limited by subsequent progression of ocular comorbidities in that eye, including cataract and proliferative diabetic retinopathy . A nasal conjunctival peritomy was performed, and dissection down to bare sclera was carried out and continued superotemporally to encompass the region of the cyclodialysis cleft . A 10 - 0 nylon suture on cs175 - 6 needle (ethicon), which is a 7.0 mm -circle needle, was selected for cyclopexy . Interrupted 10 - 0 nylon sutures were radially passed through the corneal side of the limbus, then through the iris root and ciliary body, and carried out through the sclera on the opposite side of the limbus (figure 3). To ensure that ciliary body was incorporated into each pass, the sutures were tugged on intraoperatively and the iris root was evaluated for movement with mechanical pull . Additionally, as more sutures were placed, the eye appeared to become more firm . We found the needle type to have a curvature and size that was very helpful for the angle and length of the pass required . A nasal conjunctival peritomy was performed, and dissection down to bare sclera was carried out and continued superotemporally to encompass the region of the cyclodialysis cleft . A 10 - 0 nylon suture on cs175 - 6 needle (ethicon), which is a 7.0 mm -circle needle, was selected for cyclopexy . Interrupted 10 - 0 nylon sutures were radially passed through the corneal side of the limbus, then through the iris root and ciliary body, and carried out through the sclera on the opposite side of the limbus (figure 3). To ensure that ciliary body was incorporated into each pass, the sutures were tugged on intraoperatively and the iris root was evaluated for movement with mechanical pull . Additionally, as more sutures were placed, the eye appeared to become more firm . We found the needle type to have a curvature and size that was very helpful for the angle and length of the pass required . Multiple approaches to cleft closure have been described in the literature, including medical management, laser photocoagulation, cryotherapy, trans - scleral diathermy, gas tamponade, and anterior scleral buckle, along with various surgical repair techniques.6 while different surgical approaches have been described, many are technically challenging, particularly in the hypotonous eye . In this case report, we discuss the repair of a chronic traumatic cyclodialysis with indirect surgical cyclopexy, which we found to be technically easier and less invasive than other reported techniques, but equally successful . Compared to the direct cyclopexy described in a review by ioannidis and barton,6 our indirect technique eliminated the need for direct visualization of the ciliary body, thereby reducing technical difficulty along with bleeding and wound dehiscence risk . Additionally, compared to cyclopexy described by mccannel,7 our approach eliminated the additional need for clear corneal stab incision with retrieval of suture, which can also be difficult in a soft, hypotonous eye and may prolong surgical time . While our technique was successful, it required two operations to achieve successful cleft closure with improvement in iop . Our first attempt failed, likely due to the spacing of our sutures in one particular quadrant, which we determined were too far apart . Additionally, we used a needle with less curvature and length initially . We found that spacing the sutures approximately 1 mm apart achieved good apposition of ciliary body to scleral spur and, ultimately, closure of the cleft with restoration of physiologic iop . The length and curvature of the cs175 - 6 (ethicon, cincinnati, ohio, usa) needle also assisted with passage of each suture through the targeted tissues . The patient s postoperative iop spike after the second surgery was suggestive of successful closure of the cleft.1 additionally, successful closure was later confirmed by gonioscopy . Another challenge to our case was the chronicity of the injury which was sustained 30 years prior to presentation as per the patient s self - reported history . There was concern that, even with successful anatomic closure, iop and visual function may not be restored due to chronic ischemic changes to the ciliary body . However, our repair achieved both anatomic and functional success, suggesting that even chronic cyclodialysis clefts can be effectively repaired . Delgado et al reported a similar finding in a case of hypotony maculopathy secondary to cyclodialysis that was resolved with cleft closure 7 years later.8 cyclodialysis is a vision - threatening ocular injury that can often be difficult to treat medically . Surgical repair is often necessary but can be technically difficult and challenging, particularly because of how rarely it is encountered in clinical practice . We present a simple, less - invasive approach to surgical cleft closure that was successful anatomically and functionally . Additionally, we demonstrate clinical success with cleft closure in an eye with chronic hypotony.
Acoh (3.00 mmol) was added to a solution of galactoside 20 or 13 (1.57 mmol) in acetone (3.5 ml) and meoh (4.7 ml) at 0 c . After 8 h, the reaction was quenched by the addition of nahco3 (5.95 mmol) and then filtered . After concentration of the filtrate under reduced pressure, the resulting oil was purified by flash column chromatography (etoac in hexane) to afford alcohol 21 (from 20) or 26 (from 13) as a colorless oil . Pph3 (1.86 mmol), diad (1.86 mmol), and dppa (1.86 mmol) were added sequentially to a cooled solution of alcohol 21 or 26 (0.90 mmol) in thf (20 ml). Concentration under reduced pressure followed by purification of the residue by flash column chromatography (etoac in hexane) afforded azide 22 (from 21) or 25 (from 26) as a colorless oil . Tfa (0.50 ml, 6.6 mmol) was added dropwise over 5 min to a solution of azide 22 (200 mg, 0.19 mmol) in ch2cl2 (5 ml) at rt . After 30 min, the reaction mixture was concentrated under reduced pressure to afford pentaol 9 as a colorless oil (115 mg, quant . ): []d + 12.4 (c 0.5, cdcl3:cd3od, 2:1); max(film) (cm) 3282s br (oh), 2114s (n3), 1696 m (c = o); h nmr (300 mhz, cdcl3:cd3od, 2:1) 0.85 (t, j = 6.0 hz, 3h), 1.181.39 (stack, 22h), 1.401.71 (stack, 4h), 1.44 (s, 9h), 3.26 (a of abx, jab = 12.6 hz, jax = 4.9 hz, 1h), 3.513.64 (stack, 3h), 3.653.98 (stack, 7h), 4.89 (d, j = 3.3 hz, 1h); c nmr (100 mhz, cdcl3:cd3od, 2:1) 14.3 (ch3), 23.2 (ch2), 26.4 (ch2), 28.6 (ch3), [29.9, 30.2, 32.4, 32.8 (ch2, resonance overlap)], 51.7 (ch), 51.8 (ch2), 68.3 (ch2), 69.3 (ch), 70.4 (ch), 70.6 (2 ch, resonance overlap), 72.5 (ch), 75.3 (ch), 80.1 (c), 156.8 (c); ms (tof es+) m / z 627.3 ([m + na], 100%); hrms (tof es+) calcd for c29h56n4o9na [m + na] 627.3945, found 627.3956 . Tfa (1.0 ml, 13.2 mmol) was added dropwise over 5 min to azide 22 (400 mg, 0.38 mmol) at rt . The resulting colorless oil was used in the next step without further purification (192 mg, quant . ). Tfa (0.50 ml, 6.6 mmol) was added dropwise over 5 min to azide 9 (114 mg, 0.19 mmol) at rt . The resulting colorless oil was used in the next step without further purification (96 mg, quant . ).
Ventriculoperitoneal and cystoperitoneal (cp) shunts are commonly used for the treatment of hydrocephalus and symptomatic intracranial cysts . Abdominal complications, including intestinal volvulus, pseudocyst formation and migration into the gastrointestinal tract have been reported, accounting for 25% of shunt - related complications . Bowel perforation by the shunt catheter is uncommon and accounts for 0.010.07% of all abdominal complications [13]. Breast - related complications represent a class of thoracic shunt complication and are characterized by breast cerebrospinal fluid (csf) pseudocyst formation, csf galactorrhoea and shunt obstruction . We report a rare case of acute mastitis caused by enteric organisms passing through a cp shunt catheter, which had penetrated the transverse colon, and was related to a previous failed attempt to remove the shunt resulting in a divided catheter . The patient is a 56-year - old woman who underwent a surgical treatment of a lateral ventricle meningioma at the age of 29 . The postoperative course was uneventful and she was well without shunt - related problems for 26 years . She developed a brain abscess related to the shunt catheter at the age of 55 . A surgical removal of the catheter was attempted, but was not technically possible, and only the segment from the clavicle to the breast was removed with ligation of the two remaining ends . A year later, she was taken to a local hospital with continuous right - breast pain . The diagnosis of acute mastitis was made and she was referred to our institution for further examination . On presentation, her temperature was 36.7c, and laboratory tests revealed a decreased platelet count of 103 000/l, elevated ast of 97 u / l, alt of 72 u / l and c - reactive protein level of 1.4 mg / dl . Cultures taken from the abscess showed enteric organisms including enterococcus avium, klebsiella oxytoca and bacillus . Abdominal ct showed that the shunt catheter was in the splenic flexure of the transverse colon with no other abnormalities (fig . 2). Colonoscopy was performed to survey the colon and the shunt catheter was found inside the lumen at the splenic flexure (fig . Acute mastitis caused by enteric organisms which had migrated through the shunt catheter after penetration into the transverse colon was the presumptive diagnosis, and the catheter removed under general anesthesia . The breast to the abdomen segment of the catheter was exteriorized through the right - anterior chest wall without laparotomy . The shunt catheter (white arrow) extended through the right - rectus sheath (a), crossed the midline to the left side of the abdomen (a, b) and was inside the splenic flexure of the colon (b, c). Figure 3:colonoscopy showed the distal catheter within the transverse colon, 40 cm proximal to the anal verge (a). An inflammatory polyp was present at the penetration site in the colon wall (b). The shunt catheter (white arrow) extended through the right - rectus sheath (a), crossed the midline to the left side of the abdomen (a, b) and was inside the splenic flexure of the colon (b, c). Colonoscopy showed the distal catheter within the transverse colon, 40 cm proximal to the anal verge (a). An inflammatory polyp was present at the penetration site in the colon wall (b). The penetration of shunt catheters into the intestine at the distal end is rare with a reported incidence between 0.01 and 0.07% . The mortality rate may be high, up to 15%, due to intracranial or intra - abdominal infections . Several factors have been found to be responsible for this rare complication, including chronic irritation of the gastrointestinal tract, prior abdominal surgery or silicone allergy [2, 3]. Csf leakage and retrograde flow from the peritoneal cavity to the breast may cause breast - related complications . This is the first report of case with acute mastitis caused by enteric organisms migrating through a cp shunt catheter that had penetrated the transverse colon . The diagnosis of bowel perforation by a shunt may not be easy to make, unless the shunt protrudes from the anus [5, 6]. Prolonged diarrhea of unknown etiology, as well as abdominal symptoms, serves as warning signs of possible bowel perforation . Ct can play a crucial role in the diagnosis of bowel perforation . In the present case, these findings suggested that the infection was due to the retrograde flow from the colon . The development of mastitis was facilitated by previous division of the catheter, leaving a ligated end . Presumably, the ligature became dislodged, leaving a direct connection from the breast tissue to the distal end of the catheter . Previous study reports that the shunt catheter can be directly removed percutaneously in 69% (31/45), whereas 17% (8/45) of patients require a laparotomy and repair of the bowel . If there is evidence of significant abdominal infection, such as an abscess or life - threatening peritonitis, the fistulous opening may not close spontaneously, warranting laparotomy . In the present case, previous insufficient surgical treatment such as a partial removal of the catheter contributed to this shunt - related complication . However, it is common surgical practice to permit the distal end of a shunt catheter to remain in situ in order to simplify the surgical procedure . Although this practice is most commonly uncomplicated, it is not unreasonable to suspect that the tube may irritate the serosal surface of the colon leading to chronic inflammation . It is speculated that local inflammation owing to repeated irritation of the bowel wall by the catheter tip might have contributed to the subsequent perforation . In conclusion, a patient who presents with acute mastitis and has previously undergone shunt placement should undergo assessment of the abdominal segment of the catheter.
We explore, in mice, the possibility of diagnosing an early - melanoma tumor and following its growth by analyzing the changes that occur throughout the pathological process in vocs excreted in urine and feces . We report here total of 29 potential biomarker candidates of melanoma; 25 of these are novel, and 4 have been previously reported by other research groups in relation to vocs detected from cultures of human melanoma cells . The chemical identity of only 24 of the 29 possible biomarker candidates was revealed with high confidence . This study will contribute to the development of a noninvasive and reliable diagnostic procedure to detect melanoma in the urine of patients . Melanoma accounts for less than 2% of all skin cancers, but for the vast majority of deaths from skin cancer . In the united states alone, it is estimated that 76,100 individuals will be diagnosed with melanoma during 2014 and that 9,710 patients will die from it . Early detection of malignant melanoma is the key factor in reducing mortality from this cancer . Although histopathological examination is the gold standard for diagnosis of melanoma, additional, noninvasive approaches should be developed . Here, we explore the possibility of exploiting volatile organic compounds (vocs) to develop such an approach; hundreds of vocs are emitted from the human body and usually reflect the metabolic condition of the individual . Therefore, pathological processes, such as cancer, are expected to influence the voc fingerprint of patients either by changing the ratio between different vocs or by producing new vocs . It has been reported that dog scan identifies, by using their olfaction sense, melanoma on the skin of patients or melanoma samples hidden on healthy subjects . Used gas sensor array (also known as an electronic nose) to differentiate between melanomas and nevus lesions . Those authors compared the lesion with the adjacent skin region to reduce the skin headspace variability . Collected biopsy samples and compared the vocs released from melanoma tissue to those released from nevus and normal tissue, using matching skin as a control . Those authors found 32 potential biomarker candidates; the concentration of 9 vocs increased in the presence of melanoma, and 23 vocs were detected only when melanoma cells existed and were not detected in normal cells . The authors used the nist 2.0 mass spectral database, with a 60% quality factor for chemical identification of the possible biomarker candidates; however, they did not report the quality factor obtained for the different compounds by mass spectrometry (ms). In a recent study, kwak et al . Compared human melanoma cells to normal melanocytes cultured in vitro . By using gas chromatography- (gc-) ms, those authors found increased levels of both isoamyl alcohol and isovaleric acid in the headspace over melanoma cells . The authors also found that the melanoma cells produced some unique compounds, such as dimethyldisulfide and dimethyltrisulfide . In the present study, we analyzed the vocs emitted from the urine and feces of mice before (healthy group) and after (cancer group) subcutaneous injection of b16 melanoma cells . The present work will serve as a basis to analyze possible vocs in human patients . We expect some voc to be shared between the species and new and different vocs to be detected . The sample classification used in the present study is summarized in table 1 . The analysis of the urine samples of healthy and tumor - bearing mice revealed some differences in the vocs composition . There was no significant difference between the first two samples (samples a and b), which were taken before the injection of the b16 melanoma cells, and the first sample taken after injection (sample c). In the second sample taken after the injection (sample d), a significant difference was found in the observed vocs, although tumors were not yet palpable . In the last two samples (samples e and f), tumors were palpable in all mice, and the chromatographic spectra were significantly different from those obtained in earlier samples . Therefore, the samples were classified into three groups: healthy, early - melanoma, and late melanoma . Typical urine chromatograms obtained from one mouse before (sample b) and after injection (sample e) are shown in figure 1 . Some peaks in the chromatograms were present only in the tumor - bearing mice, and the area under some peaks was markedly higher or lower in the tumor - bearing mice compared to the healthy mice . By using the nist'08 and wiley mass spectral libraries, total of 120 vocs were identified in urine and 139 vocs in feces were identified in all mice samples, with an 80% quality factor (qf). After subtracting the vocs that were found in the background samples, a statistical analysis reduced the numbers of these peaks to 16 vocs in urine and 13 vocs in feces, which could serve as possible biomarker candidates . In addition, three vocs in urine and two vocs in feces, with a qf in the range of 6079%, were also included as possible biomarker candidates . Of the 19 possible biomarker candidates in urine, three compounds were detected only in the tumor - bearing mice (table 2), three vocs were detected only in the healthy and early - melanoma - bearing mice (table 3), and 13 vocs were detected in markedly higher concentrations in the tumor - bearing mice as compared with the healthy group (table 4). Similarly, from the 15 possible biomarker candidates found in the headspace of feces, two vocs were detected only in the tumor - bearing mice (table 5) and 13 vocs were found with a markedly higher (12 vocs) or lower (1 voc) concentration in the tumor - bearing mice than in the healthy group (table 6). To examine the significance of the changes in the concentrations of compounds during the different melanoma stages (see tables 4 and 6), a two - tailed paired t - test was carried out . As can be seen in table s1 in supplementary material available online at http://dx.doi.org/10.1155/2015/841245, some of the vocs that were identified as possible biomarker candidates in the current study have already been reported previously by other research groups as being predictive for melanoma and other cancers . The four potential melanoma - related biomarkers that have already been reported are isopropyl palmitate (rt = 18.41, qf = 72%), 1-hexadecanol (rt = 14.54, qf = 93%), benzaldehyde (rt = 6.94, qf = 97%), and dimethyl sulfone (rt = 6.21, qf = 94%). 1-hexadecanol and isopropyl palmitate, a derivate of palmitic acid, were detected only in the urine of tumor - bearing mice . These findings are consistent with a previous study, which reported a 35-fold increase in the level of 1-hexadecanol in the case of melanoma (as compared with a matching skin sample) and that isopropyl palmitate was found only in the melanoma sample . The authors suggested that these compounds may reflect an increased de novo synthesis of fatty acids, which is a crucial metabolic alteration that cancer cells require for synthesis of a new plasma membrane . De novo synthesis of fatty acids could be caused by the hyperactivity of the oncogenic fatty acid synthase (fasn), a common phenotype in cancer pathogenesis . Benzaldehyde levels in feces were 132% higher in the tumor - bearing mice than in the healthy group (p = 0.004), but it is important to notice that the increases were from the early - melanoma stage to the late melanoma stage (p = 0.002), and not from the healthy group to the early - melanoma stage . In other words, benzaldehyde could be a useful possible biomarker candidate for predicting melanoma, but not in its early stage . The levels of dimethyl sulfone in urine showed a 199% increase from the healthy to the tumor - bearing mice groups (p = 0.026). As shown earlier, significantly higher amounts of this compound were found in metastatic melanoma cells, as compared with normal cells . This finding suggests that the metabolism of sulfur - containing amino acids by melanoma cells differs from that in normal cells . The gc - ms analysis of headspace in b16 melanoma cell cultures yields 12 vocs that were not detected in the headspace of the materials in the phosphate buffered saline (pbs) and fresh growth medium without cells (table 7). The compounds that were identified were isopropyl myristate (rt = 16.76, qf = 93%), decane (rt = 7.43, qf = 93%), 2,4-dimethyl-1-heptene (rt = 4.67, qf = 93%), and hexadecane (rt = 14.7, qf = 95%). As described above, the concentrations of isopropyl myristate were higher in both urine and feces of tumor - bearing mice . Decane and two chemically similar compounds, 1-hexadecene and 2,4-dimethyl - heptane, were previously reported to be present only in melanoma samples . The difference between 1-hexadecene and 2,4-dimethyl - heptane to hexadecane and 2,4-dimethyl-1-heptene (resp .) Is in the presence or absence of a single double bond . Hakim et al . Studied two hydrocarbons, decane and 2,4-dimethyl-1-heptene, that were reported as potential biomarkers of lung cancer and suggested that these compounds are probably the outcome of oxidative stress . As mentioned above, the tumor was palpable only in the last two samples (late melanoma). An average lesion volume of 1664 mm (n = 2) was measured three days after the last sample was taken (see figure s1). Among all possible biomarker candidates that were found in the urine and feces, three compounds in urine (figures 2(a)2(c)) and two compounds in feces (figures 2(d)-2(e)) three of these compounds were all ketones, that is, 5-methyl-2-heptanone (rt = 6.87, qf = 91%), 6-methyl-2-heptanone (rt = 6.71, qf = 94%), and 6-methyl-3-heptanone (rt = 6.67, qf = 97%). The quality factor of the two compounds found in the feces headspace was smaller than 80%; hence they are referred to only by their retention time: rt = 8.9 and rt = 18.41 . 6-methyl-2-heptanone has been found in the blood of patients with liver cancer and 6-methyl-3-heptanone was found in the urine of mice with lung cancer . In addition, other chemically similar ketones, such as 2-heptanone and 6-hydroxy-6-methyl-3-heptanone, were also detected in urine samples from mice with lung cancer tumors . Partial least square discriminate analysis (pls - da) models of urine and feces were built with the simca p+ software . Each model included three latent variables that were calculated by the software and are, in fact, weighted linear combinations of the 12 possible biomarker candidates that most contributed to the separation between the three groups (all the compounds in tables 26, except compound 2 in table 2, compound 3 in table 3, compounds 3 and 912 in table 4, compound 1 in table 5, and compounds 5 and 6 in table 6). The models are shown in figures 3 and 4 for the urine and feces models, respectively . The urine model exhibited good predictability of the mouse condition (healthy or sick) with a 92.3% sensitivity, 100% specificity, a 93.1% negative predictive value (npv), and a 100% positive predictive value (ppv). The model for feces gave less significant results, with an 80.8% sensitivity, a 96.3% specificity, an 83.9% npv, and a 95.5% ppv . It is important to note that eight out of nine mice were correctly predicted with an early - melanoma by using the urine model, whereas the feces model did not clearly discriminate between healthy and early - melanoma mice . The present study constitutes a novel proof - of - concept for the detection and monitoring of melanoma in urine and feces samples of mice at an early stage . Our urine statistical model correctly predicted eight out of the 9 mice bearing an early - melanoma, indicating that mice at that stage can be detected and distinguished from healthy mice and from mice bearing a late melanoma . While other research groups [6, 7] focused on comparing human melanoma to normal and nevus skin biopsies, we attempted to distinguish between mice with an early - melanoma and healthy mice . Our model was able to distinguish between melanoma bearing mice and healthy mice with sensitivity of 92% and specificity of 100%, as compared to studies of other groups on human samples (e.g., 70% sensitivity and 90% specificity reported by and 89% sensitivity and 90% specificity reported by). These differences might be related to the low variability in the vocs of mice all having similar genetics and environment, as compared to those of humans . The results of this study also indicate a marked difference between healthy mice and mice bearing a late melanoma, whereas the difference between healthy mice and mice bearing an early - melanoma is less clear . One possible explanation for this finding is that the concentration of the new compounds, which are products of the altered metabolism of the melanoma cells or of the normal cells that it affects, is below the detection threshold of our gc - ms system . In addition, the angiogenesis in mice bearing an early - melanoma is limited and, therefore, metabolites induced by melanoma cell do not disperse efficiently and are thus hard to detect . To overcome these concentration - dependent limitations, one should concentrate on detecting the compounds (potential biomarker candidates) that are responsible for the differences between healthy and late melanoma one should also develop methodologies to detect vocs directly from the regions of skin showing suspicious lesions; a step in this direction has been taken by detecting differences in human melanoma cell line signatures by ftir spectroscopy [15, 16]. Some of the potential biomarker candidates that were identified in the present study were previously reported to be predictive for melanoma and other malignancies (table s1). Those reports strengthen the validity of our findings and imply the existence of cancer type-specific biomarkers and of common cancer biomarkers . Some of the potential biomarker candidates are cross species compounds; namely, they are found in both mice and human melanoma cells; therefore, similar experiments with human melanoma cell lines as xenografts should be conducted to confirm these data . Two additional possible biomarker candidates that may be good candidates to identify melanoma are dehydroabietic acid (rt = 21.7) and 2-hexanone (rt = 3.78). It could be a pollutant from the sawdust, although it was not detected in the background samples . Another possibility could be wrong identification of this compound by the code used ms database search (qf = 81%). Importantly, isopropyl myristate, the concentration of which increased in the urine and feces of tumor - bearing mice, was also found in the vapor phase of the b16 melanoma cells culture . This finding suggests that isopropyl myristate is a valid direct product of melanoma cell metabolism for further study . Other compounds that were found in the headspace of the melanoma cell cultures were not detected in the urine or feces samples, and vice versa . This is attributed to the differences between the tumor cells microenvironment in a culture as compared to a tumor in the animal . We assume that there may be also contribution from the tumor microenvironment since tumor cells affect other cells in the tissue . At this point, the origin of the specific molecules we detected cannot be determined . The observed increase in the concentration of ketones as a function of tumor growth suggests that ketogenesis pathways, incorporating various ketone formations, may be involved in the model of melanoma cancer . Therefore, monitoring these ketones could help in tumor follow - up in melanoma patients . Finally, to substantiate the findings in this study, we plan to perform an extended study with larger number of mice focusing on the urine vocs . In addition, to correlate more precisely between tumor size and voc concentration one should collect samples more often (every 24 days) and correlate the biomarkers to tumor volume as measured with a caliper . A different way of measuring is by expressing gfp or luciferase in the b16 cells and following their volume with an imaging device such as mri . Despite the differences between mouse and human metabolism, possible biomarker candidates found in mice urine and feces if the possible biomarker candidates were formed in biochemical processes related to the activity of cancer cells, we can expect to find some overlap between biomarkers found in human and mice . Urine and feces samples from nine mice were collected, twice before (healthy group, n = 18) and four times after (cancer group, n = 35, one mouse died before the last sample was obtained) subcutaneous injection of b16 melanoma cells . Compounds from these samples were separated and identified by using headspace solid phase microextraction (hs - spme) and gc / ms . In addition, vocs above a culture of b16 melanoma cells were also collected and analyzed . Comparison between vocs content of the two first samples of each mouse, collected before b16 melanoma cell injection, showed high repetition of peaks in the chromatograms of each mouse . Comparison of peak repetition in the chromatograms of different mouse in the two preinjection samples shows a markedly reduced degree of repetition (see figure s2 in the supplementary material). These findings clearly indicate that the metabolism characteristics of each mouse have large influence on the observed chromatograms . Consequently, we did not use a control group but compared the chromatograms of each mouse after b16 melanoma cell injection to those obtained before injection . Female c57bl/6j inbred mice, 12 weeks old and weighing 1820 g, were obtained from harlan laboratories (jerusalem, israel). All mice were maintained at the animal resource center of ben - gurion university of the negev, in a controlled environment (illumination, temperature, and humidity) free of specific pathogens . All animal experiments described in this work were approved by the ben - gurion university committee for the ethical care and use of animals in experiments . Each individual mouse was kept in a separate cage (9 cages total) under the same housekeeping conditions . The first samples were taken after a week of acclimation (at the age of 13 weeks). B16f10 cells were cultured in an rpmi 1640 medium supplemented with 10% heat - inactivated fetal calf serum (fcs), 100 u / ml penicillin, 100 mg / ml streptomycin, and 2 mm l - glutamine (biological industries, israel). B16f10 cells (10 cells) were seeded in a 10 cm diameter tissue culture dish . After 48 h, the medium was collected and centrifuged to eliminate cells and cell debris, and the cells were harvested by 0.23% trypsin and washed once in medium and two more times in phosphate buffered saline (pbs). B16f10 cells were harvested by 0.23% trypsin and washed once in medium and two more times in pbs . One hundred microliters, containing a total of 2 10 b16f10 cells in pbs, was injected subcutaneously to the left flank of each of nine c57bl/6 mice . Mice with tumors that reached the size of 1.5 cm diameter were sacrificed by co2 . Urine and feces samples were collected into vials with a pipette from the new disposable plastic table cover . At the end of the sample collection we could not find in the literature a component in the urine or feces that allow the prediction of the hydration state of mouse (similar to creatinine in human urine). We found 8 vocs that showed up in all the chromatograms; however, their peak areas did not show any correlation to the total chromatogram area and they could not be used to monitor hydration state of the mice . Thus, it was assumed that there should not be significant variations in mice hydration state since they were kept in identical conditions (temperature and humidity) with unlimited access to food and water . Moreover, urine and feces samples were collected from all mice at the same time . It should be noted that the amount of urine and feces that were collected from the different mice varied, not enabling a direct comparison between amounts of different vocs of different mouse . Static headspace sample extraction was achieved by exposing a 65-m polydimethylsiloxane / divinylbenzene (pdms / dvb) spme fiber (supelco, bellefonte, pa, usa) to the headspace for 10 min at 60c . Following the extraction, the fiber assembly was transferred to the gc injection port for desorption at 250c for 5 min, with the split valve closed for 2 min . Gc - ms analyses were performed by using an agilent 6890 series gc system (agilent, usa) connected to an agilent 5973 network mass selective detector (agilent, usa). The bench top system was fitted with an spme injection sleeve 0.75 mm i d quartz liner (supelco, bellefonte, pa, usa). The analytical column was a zebron zb-5msi fused - silica capillary column, 30 m 0.25 mm i d 0.25 m film thickness (phenomenex, torrance, ca, usa). The carrier gas was 99.9995% pure helium (maxima, ashdod, israel) passed through a moisture trap (model mt-200 - 2s) and an agilent hydrocarbon / moisture trap (model hmt200 - 2) (agilent, china) at flow rate of 1.0 ml min . The gc was operated under the following temperature program: 50c for 3 min, ramp of 12c min to 240c, held at 240c for 5 min, ramp of 50c min to 260c, then held at 260c for 1 min, giving a total run of 25.23 min . For gc - ms, following electron ionization, ions were scanned as the total ion current (range: 10500 m / z at 2.97 scans s). At both the beginning and end of each gc / ms analysis session the headspace over a calibration mixture (containing equal amounts of chloroform, toluene, and dodecanethiol) the test is based on examination of retention time and peak shape of the solvents used in the calibration mixture . Compounds were assigned a chemical identification by means of spectral library matching, using the nist'08 and wiley libraries . The databases search was performed using the chemstation software (by agilent) that was used to control and operate the gc / ms system . The assignment of chemical identity by the software is accompanied by a quality factor (qf). The qf is also termed in some cases as matching factor . A library search procedure that identifies structural features of an unknown compound this procedure first retrieves library compounds whose spectra are most similar to the spectrum of the unknown compound . The algorithm then deduces structural features of the unknown compound from the chemical structures of the retrievals . The significance and reliability of each retrieved spectrum are weighted according to its similarity to the spectrum of the unknown compound . There are different procedures to estimate the reliability of the chemical identification of a gc peak (see, e.g., stein). The exact algorithm used to obtain the qf in the chemstation software is not described in the documentation (it is considered as a commercial secret); however, the manual states that qf larger than 80% is considered to be reliable . Below this value of qf the reliability of the assignment is too low and the peaks are designated by their retention time only . A gc - ms analysis produces a complex chromatogram, where each peak represents a different volatile compound and the area below the peak is proportional to the amount of the compound in the sample . This threshold was used to ensure that all volatiles with low concentration are detected but noise is eliminated . To obtain estimates of the concentration of each compound, the peak area this normalization is performed by the chemstation software (by agilent) used to operate the gc / ms . The total chromatogram area used in the normalization is available in the output file; hence, the actual peak area of any individual feature can be calculated . Examination of the variations in total chromatogram area shows that the standard deviation is 17% of the mean value, a quite narrow distribution . The data analysis described in the present study we repeated some of the analysis using the actual area of the peaks in the chromatograms and found almost identical results to those obtained by the normalized data . Some of the volatiles in the chromatogram were eluted at multiple rts and, therefore, we used only the rt with the best match . In addition, to overcome peak shifting across different chromatograms, we first grouped peaks in the same time window (0.3 s) and then grouped adjacent peaks in adjacent time windows that hit the same match . Each identified volatile was compared to all the background volatiles (room air, plastic table cover, vial, vial septum, spme fiber, sawdust, and mouse food) to ensure that differences were not due to a background alternation . A partial least squares discriminant analysis (pls - da) was conducted with the simca p+ code (version 12.0.1.0, by umetrics ab, ume, sweden) to test whether mice with melanoma could be diagnosed by using the potential urine or feces biomarkers . Each chromatogram vector was defined as a member in one of three classes, healthy, early - melanoma, and late melanoma in urine samples, and in one of two classes, healthy and melanoma in the feces samples . Two mice chosen arbitrarily were scanned three days after the last sample was taken to confirm the existence of the tumor and to estimate its volume . T1-weighted scanning images were acquired at 1 t by means of an aspect m2 high performance mri system (aspect imaging technologies ltd ., israel), by using a gadolinium - dtpa contrast agent (dotarem, 1 ml / kg body weight plus 0.05 ml for catheter).
Genome - wide association studies (gwass) have emerged as a powerful non - biased technique for identifying pathways related to human diseases with complex genetic architecture . Understanding such complex diseases requires a broad understanding of the relevant functional nodes regulating disease - relevant pathways . Genes do not function in isolation, and it is clear that both gene - gene and gene - environment interactions contribute to disease susceptibility (barreiro et al ., 2012; cadwell et al ., 2010; silver et al ., 2013). More than 140 genetic risk loci have been identified for crohn s disease, a chronic inflammatory condition affecting the gastrointestinal tract (franke et al ., 2010; these studies have highlighted the contribution of multiple immune and cellular pathways to crohn s disease pathogenesis, particularly those involved in microbial defense (jostins et al ., 2012; lassen et al ., 2014; murthy et al ., 2014; sadaghian sadabad et al ., 2014). Atg16l1 (autophagy - related protein 16-like 1) is a component of the core autophagy machinery, and the atg16l1 t300a polymorphism confers a modestly increased susceptibility to crohn s disease despite its relatively high prevalence in the population (franke et al ., 2010). Autophagy is a pro - survival intracellular degradation pathway that functions as a key mediator of a number of processes including central metabolism, cell signaling, cell death, and carcinogenesis, as well as both innate and adaptive immunity (deretic et al ., 2013; yang and klionsky, 2010). The atg16l1 t300a polymorphism has been associated with both impaired antibacterial autophagy and altered production of cytokines by peripheral blood mononuclear cells (pbmcs) in response to immune stimuli (lassen et al ., 2014; recent studies have demonstrated that the mechanism underlying these alterations is linked to increased susceptibility of atg16l1 t300a to caspase - mediated cleavage and thus lower levels of functional atg16l1 (lassen et al . The autophagy pathway is important for defense against a number of intracellular pathogens and pathobionts including salmonella enterica serovar typhimurium, shigella flexneri, listeria monocytogenes, enterococcus faecalis, and mycobacterium tuberculosis (benjamin et al ., 2013; castillo et al ., 2012; gutierrez et al ., 2004; huett et al ., 2012;, 2013; ogawa et al ., 2005; tattoli et al ., 2012;, cytoplasmic bacteria are first marked for degradation primarily by ubiquitination (deretic et al ., 2013). Recent studies have identified key roles for the e3 ligases lrsam1 and parkin in recognition and ubiquitination of cytoplasmic bacteria; however, there are likely additional cellular e3 ligases that provide specificity to this pathway (huett et al ., 2012; ubiquitinated bacteria are then recognized by the adaptor proteins p62, optineurin, and ndp52, leading to the recruitment of lc3 and the autophagy machinery (cemma et al ., 2011; thurston et al ., 2009; wild et al ., the autophagy pathway targets only a subpopulation of bacteria within a cell, and little is known about the molecules involved in the selective recognition and targeting of bacteria for autophagosomal degradation, despite the important pathological consequences of this process . In this study, we approached the question of the impact of the atg16l1 t300a risk variant by searching for associated responsiveness quantitative trait loci (reqtls), which are defined as the effects of genetic variation on transcriptional responses of cells (barreiro et al ., 2012). Given that functionally similar genes are often transcriptionally coregulated, using multiple immune stimuli in genetically defined cell populations along with reqtls has enabled the identification of differential effects on molecular circuits (gat - viks et al ., 2013). In the current study, we perform stimulus - specific perturbational profiling in pbmcs, quantitative mass - spectrometry - based (ms) proteomics, and genome - wide rna expression analysis to identify antibacterial genes that are functionally related to atg16l1 . Using these approaches, we demonstrate a role for clec12a in antibacterial autophagy and pinpoint a functionally relevant interaction node of clec12a with an e3 ligase complex that is important for this function . To identify molecules involved in the atg16l1-t300a - dependent antibacterial autophagy pathway, we used perturbational profiling to measure differential gene regulation in the setting of stimulation with pathogen - associated molecular patterns and bacterial challenge . Given that mounting evidence indicates an important role for the involvement of host - microbiota interactions and bacterial defense pathways in crohn s disease (knights et al ., 2013; we selected a panel of three stimuli to perturb pbmcs from healthy individuals homozygous for the ancestral atg16l1300 t allele or the 300a risk allele (rs2241880). The nod2 ligand muramyl dipeptide (mdp) was selected based on the previous association of this stimulus with crohns - disease - specific pathways (hugot et al ., 2001; mdp can also modulate signals mediated through tlr2 activation, a pathway that has been implicated in crohn s disease and experimental colitis (netea et al ., 2004; we therefore also used the tlr2 ligand pam3cys, as well as the bacterium borrelia burgdorferi, from which these lipopeptides were initially isolated, to elicit both nod2-dependent and -independent responses . Using microarrays to assess genome - wide rna expression profiles, we found that baseline gene expression was similar between individuals harboring the non - risk and risk alleles . Furthermore, upon exposure to innate immune ligands, we observed strong genotype - independent induction of proinflammatory cytokines and chemokines after hierarchical clustering (figures 1a and s1a). 2012), we next used factorial design analysis to examine whether transcriptional responses to pam3cys, borrelia, or mdp differed between groups stratified by the 300 t non - risk and 300a risk alleles . Using multiple immune stimuli in genetically defined pbmcs along with reqtls has enabled differential effects on molecular circuits to be determined (gat - viks et al ., 2013). Our analysis identified 20 atg16l1300a - dependent reqtls under at least one stimulation condition (figures 1b and s1b). Thus, perturbational profiling of human immune cells revealed genotype - specific responses to stimulation . We focused additional analysis on the autophagy pathway, the cellular degradation system that has been implicated in risk of crohn s disease by gwass, which identified predisposing alleles in atg16l1 and irgm (immunity - related gtpase family m) (rioux et al ., we and others have reported that the atg16l1 t300a polymorphism is associated with impaired antibacterial autophagy as well as altered production of cytokines by pbmcs in response to immune stimuli (lassen et al ., 2014; murthy et al ., 2014). Additionally, tlr simulation, particularly through tlr2, has been shown to induce antibacterial autophagy (anand et al ., 2011; 2010). To determine whether any of the identified genes might be associated with autophagy, we generated protein interaction networks anchored on core autophagy proteins as well as autophagy - associated components previously identified from a high - confidence interaction network derived from a systems - wide autophagy proteomics study (behrends et al ., 2010). Of the genes identified, rab24 was previously reported to have a direct effect on autophagy (behrends et al ., 2010; munaf and colombo, 2002), and three additional gene products (hck, fez1, and fyn) interacted with the autophagy network via known protein - protein interactions (figure s1c). These observations demonstrate that the atg16l1 t300a polymorphism is associated with transcriptional modulation reflecting known protein - protein interactions with the autophagy network . Given the previously described role for atg16l1 and irgm in antibacterial autophagy (singh et al ., 2006), we next used sirna to evaluate whether any of the identified atg16l1300a - dependent reqtls affected antibacterial autophagy . Of the 20 genes identified, 13 had detectable expression in hela cells and were suppressed by single sirnas (figure s1d). Antibacterial autophagy was assessed in sirna - treated cells using infection with s. typhimurium, a model pathogen that is degraded by autophagy (birmingham et al ., 2006). Knockdown of three of these genes (clec12a, rab24, and evi2b) resulted in significantly decreased salmonella - autophagosome colocalization (figures 1c, 1d, and s1e). We next tested whether rab24, evi2b, or clec12a play a role in classical autophagy using an lc3 flux assay, in which levels of lipidated lc3-ii are compared to lc3-i by western blot . In this assay, an increase in the ratio of lc3-ii to lc3-i corresponds to an increase in autophagic flux . Knockdown of rab24 and evi2 resulted in decreased lc3-ii accumulation when cells were treated with torin 1, an mtor inhibitor and inducer of bulk autophagy, suggesting that these genes are involved in classical autophagy; knockdown of atg16l1 served as a control in these experiments . Knockdown of clec12a did not impair lc3-ii accumulation under these conditions, suggesting that clec12a functions specifically in antibacterial autophagy (figure 1e) (thoreen et al ., 2009). Additionally, to confirm that the antibacterial autophagy phenotype seen with clec12a knockdown was not due to off - target effects, we employed a knockdown rescue approach (huett et al ., 2012) by generating two sirna - resistant constructs that express full - length clec12a during knockdown of endogenous gene expression (figure 1f). The autophagy defect caused by sirna against clec12a was rescued by overexpression of the appropriate clec12a construct (figures 1 g and 1h), demonstrating that the decrease in antibacterial autophagy was specific to a reduction in clec12a expression and not due to off - target effects of sirna . Additionally, sirna targeting clec12a did not alter bacterial entry, suggesting the observed effect was specific to the autophagy pathway (figure s1f). Given our findings that immune cells harboring the atg16l1300a allele exhibited reduced induction of clec12a under immune stimulation conditions and that clec12a is required for efficient lc3-salmonella colocalization (figure 1), we next investigated whether a genetic interaction exists between the atg16l1 t300a snp and clec12a with respect to antibacterial autophagy . To investigate this hypothesis, we generated an atg16l1 knockout (ko) hela cell line using the crispr - cas9 system (ran et al . Loss of atg16l1 expression was confirmed in single hela clones (figure s2a). As expected, atg16l1 ko cells were unable to convert lc3-i to lc3-ii under basal or stimulatory conditions (figure s2b) and had negligible lc3-bacteria colocalization (figure 2). To determine the effect of the t300a coding polymorphism, we stably transduced atg16l1 ko cells with 300 t (atg16l1 ko + atg16l1300 t) or 300a (atg16l1 ko + atg16l1300a) alleles, achieving equivalent expression levels of atg16l1 in these lines (figure s2a). As expected, we found that basal autophagy was restored in both atg16l1 ko + atg16l1300 t and atg16l1 ko + atg16l1300a cell lines, with modest impairment of antibacterial autophagy in the atg16l1 ko + atg16l1300a cells, consistent with published findings (figure 2) (conway et al ., 2013; lassen et al ., 2014; murthy et al ., 2014). Targeting clec12a with sirna resulted in impaired antibacterial autophagy in the atg16l1 ko + atg16l1300 t cell line similar to wt cells . We observed a more - pronounced impairment in atg16l1 ko + atg16l1300a cells, suggesting functional interaction of the t300a polymorphism and reduced clec12a expression . Clec12a is a c - type lectin receptor (clr) belonging to a family of transmembrane proteins that recognize pathogen - associated molecular patterns and engage downstream immune signal transduction pathways (dambuza and brown, 2015; osorio and reis e sousa, 2011). Clec12a is highly expressed in human myeloid cells (figure s3a), and targeting antigen to clec12a results in enhanced antigen presentation on dendritic cells in mice (lahoud et al ., 2009; recent studies have demonstrated that clec12a binds to uric acid crystals and helps to dampen inflammation through its itim motifs; however, it remains unclear whether this is the only ligand for clec12a (neumann et al . To determine whether clec12a plays a role in pathogen defense in vivo, we used clec12a mice . Bone - marrow - derived macrophages (bmdms) from wt or clec12a mice were infected with a strain of listeria (egde) known to be susceptible to autophagy in primary macrophages (anand et al ., 2011; birmingham et al ., 2007; huett et al ., consistent with the salmonella infection results in sirna - treated cells, clec12a bmdms displayed lower levels of bacterial colocalization with lc3 compared with wt bmdms (figures 3a and 3b). Additionally, clec12a bmdms did not show differences in torin-1-induced autophagy, suggesting that bulk autophagy is normal in these cells (figure s3b). Taken together, these data suggest that clec12a functions selectively in the antibacterial autophagy pathway for multiple pathogens in both mouse and human cells . We next investigated whether clec12a plays a role during infection with intracellular pathogens in vivo . Wt or clec12a mice were pre - treated with streptomycin and then infected with salmonella (conway et al . Four days post - infection, stool was collected from infected mice and colony - forming units (cfus) were measured . Clec12a mice had significantly higher cfu levels compared to wt mice (figure 3c). Clec12a mice also exhibited increased systemic bacterial dissemination as assessed by measuring cfus in spleens (figure 3d). This increase in cfu was associated with a more - severe clinical disease score as assessed by overall appearance, piloerection, mobility, and posture (figure 3e), as well as decreased survival (figure 3f). Taken together, these data suggest that clec12a plays a role in intracellular microbial defense both in vitro and in vivo . To further demonstrate the precise role for clec12a in antibacterial autophagy, we next tested whether knockdown of clec12a altered intracellular bacterial replication . Using knockdown of atg16l1 as a positive control, we found that knockdown of clec12a in hela cells resulted in significantly increased intracellular replication of salmonella (figure 4a), demonstrating that clec12a is required for restriction of intracellular bacterial replication . S4a) were predominantly membrane associated and could be found surrounding intracellular dsred - labeled salmonella at both early and late time points after infection . Association of clec12a with salmonella peaked at 30 min post - infection and declined gradually, whereas lc3-salmonella colocalization peaked 60 min after infection, consistent with previous data (figure 4b) (huett et al ., 2012). Live cell imaging confirmed that gfp - clec12a surrounds bacteria and then dissociates at approximately 1 hr post - infection (figure s4b), consistent with the time course of peak lc3 colocalization . Given the early association of clec12a with bacteria, we next determined whether clec12a was present at sites of bacterial entry into the host cell . We found that gfp - clec12a colocalized with bacteria and ruffled actin, an indicator of recent bacterial entry, suggesting that clec12a associates with bacteria concomitant with bacterial cellular entry (figure s4c) (lhocine et al . We confirmed that clec12a colocalizes with salmonella and rab5, a marker of early endosomes (figure s5a). However, clec12a recruitment was also readily detected around salmonella without colocalization of rab5, suggesting that clec12a is not exclusively associated with endosomes (figure s5a). Next, we evaluated the colocalization of clec12a with galectin 3 and galectin 8, which are both known to bind to sites of bacterial - induced intracellular membrane damage as well as sites of sterile membrane damage (thurston et al ., 2012). Clec12a colocalized with both galectin 3- and galectin 8-salmonella complexes (figure 5a). These data confirm that clec12a associates with bacteria early after infection concomitant with membrane damage . Clec12a also colocalized with the antibacterial autophagy adaptor ndp52 (figure 5b) as well as the autophagosome proteins gfp - lc3, the atg8 homolog gabarapl2, and atg16l1 (figures 5c and 5d). In all cases, these proteins surrounded intracellular bacteria in conjunction with either endogenous clec12a or gfp - clec12a (figures 5b5d). Of note, expression of gfp - clec12a gave a more - intense fluorescent signal and demonstrated increased levels of clec12a puncta within the cells, regardless of stimulation or bacterial infection . Physical interactions between clec12a and lc3, gabarapl2, and atg16l1 were also confirmed by co - immunoprecipitation (figure s5b). We first determined whether knockdown of clec12a altered recruitment of ubiquitin to bacteria . At 1 hr post - infection, sirna knockdown of clec12a significantly reduced salmonella - ubiquitin colocalization (figures 5e and 5f). Consistent with this observation, recruitment of ndp52 to salmonella was also decreased upon sirna knockdown of clec12a (figures 5 g and 5h). Colocalization of salmonella with galectin 3, galectin, 8, and p62 were unchanged in cells treated with clec12a sirna (figures s5c s5e). These data reveal clec12a as an early bacteria - associated factor that binds to the autophagy machinery and helps initiate antibacterial autophagy through the ubiquitin - ndp52 pathway . Recently, clec12a has been shown to be a receptor for dead cells (neumann et al ., 2014). We hypothesized that clec12a could also recognize sites of membrane damage triggered by vacuolar disruption after bacterial entry (tattoli et al . Galectin 3 served as a marker of damaged endosomes (thurston et al ., 2012). Gfp - clec12a colocalized with galectin 3 puncta after hypertonic shock and treatment with polyethylene glycol (peg) (figure 5i). These results demonstrate that clec12a is recruited to sites of membrane damage and could explain the high proportion of clec12a recruitment early after bacterial entry . To develop a more - integrated model of clec12a function in pathogen response, we utilized time course rna - seq data and targeted quantitative proteomics to pinpoint clec12a - dependent protein interactions that may be important for pathogen response . First, we employed 3 rna - seq to quantify the transcriptome of listeria - infected wt or clec12a bmdms at various times post - infection . Using this approach, we identified genes with statistically significant differences (fdr - adjusted q value 0.05) in fold - change response to listeria infection between wt and clec12a bmdms at any time point post - infection (figure 6a). Of note, expression of lamp1, a lysosomal membrane protein and marker of salmonella - containing vacuoles, was significantly downregulated in clec12a bmdms, suggesting endomembrane dynamics might be perturbed in these cells . We next performed clustering and pathway analysis using an expanded list of 674 nominally significant genes that were differentially regulated in clec12a bmdms at baseline as well as in response to listeria . Genes were grouped into ten clusters using short time - series expression miner (stem), where each cluster represents one of the predefined model profiles in stem that capture potential distinct patterns of infection response (figure 6b; table s1) (ernst and bar - joseph, 2006). Differences in these model profiles represent distinct regulation patterns of gene expression . Gene ontology enrichment analysis was applied to assess the functional significance of each cluster of genes . The top scoring pathway that was differentially regulated in clec12a bmdms was the negative regulation of the intracellular signal transduction pathway that includes key signaling components such as ndufs3, tmem161a, and mapkapk5, among others (cluster 2; table s1). Additionally, antifungal response genes (s100a9, myd88, and ptx3; cluster 6) were also differentially regulated in the clec12a bmdms . Selective upregulation of glucose transport (ppbp and sorbs1; cluster 7) but downregulation of lipid transport (scarb1, slmo1, and soat2; cluster 5) in clec12a cells suggested preferential regulation of metabolism by clec12a in response to listeria infection . These results highlight the central role of clec12a in pathogen - induced defense pathways and suggest how deficiencies in clec12a could result in impaired bacterial defense . Next, we sought to identify important transcriptional nodes that control these responses by integrating known transcription factor - dna interaction data with our temporal gene expression profiles of infected wt and clec12a bmdms into a unified model . To identify important regulation points in the clec12a pathway, we used dynamic regulatory events miner (drem), which searches for clec12a - dependent bifurcation events, defined by a transition in which a set of genes that were previously coregulated instead show divergent response / regulation profiles (figure s6a) (schulz et al ., 2012). Based on an extension of a hidden markov model, the analysis identified egr1, a transcription factor involved in transcriptional response to pathogens (de grado et al ., 2001; mcdermott et al ., 2011), as the earliest stage regulator that induces clec12a - dependent downregulation of specific genes (figure s6a). Interestingly, egr1 is also known to be induced by either amino acid deprivation or er stress, which are both stimuli known to trigger autophagy (shan et al ., 2014). These data suggest that reduced expression of egr1 target genes could contribute to the reduced pathogen response and autophagic targeting of bacteria in clec12a bmdms . Other notable transcriptional regulators identified in our analysis that are known to be important for pathogen response include rela, nfe2, hif1a, and arnt2 . Taken together, this analysis suggests that deletion of clec12a results in an alteration of the response to pathogens at the transcriptional level and identifies key regulators involved in this response . To further understand the role of clec12a in antibacterial autophagy, we next applied an integrated systems approach using quantitative ms - based proteomics and coupled these results with our transcriptomic profiling analysis to uncover functional clec12a interactions relevant to bacterial defense (figure 6c). Proteomic interactors were defined as those that demonstrated significantly increased binding to flag - clec12a relative to flag vector alone after immunoprecipitation (table s2). Interactome analysis identified highly connected nodes within the clec12a interactors (figure s6b). A specific interaction between clec12a and lc3 or atg16l1 was not identified by ms - based proteomics; however, this may reflect the fact that a meaningful interaction between these proteins occurs only under stimulation and represents a fraction of the total cellular pool of these proteins . To identify clec12a protein interactions that may lead to the measured transcriptomic changes in response to bacterial infection, we used a network optimization approach to identify high - probability sub - networks, composed of signaling and transcriptional factor interaction cascades (figure 6c) (basha et al ., 2013). We then used a hypergeometric test to rank order clec12a - interacting proteins with the most significantly enriched set of target genes within the network to identify relevant functional nodes (table s3). Some of the key transcriptional regulators identified in these sub - networks overlapped with those identified by drem analysis, including rela, tp53, hif1a, and egr1 . This analysis pinpointed the ubiquitin - like protein, nedd8 (neural precursor cell expressed, developmentally downregulated 8), as both a clec12a interactor and a regulator of egr1 . These results suggest that the interaction between clec12a and nedd8 is a functional interaction and contributes to an early clec12a - dependent transcriptional response . This integrated approach also linked an e3 ubiquitin ligase complex that includes cul3 (cullin 3) and the substrate adapters klhl9 (kelch - like family member 9) and klhl13 (kelch - like family member 13) to clec12a - dependent transcriptional responses controlled by the transcription factors cebpb and cebpd (table s3) (chen et al ., 2014). Importantly, proteomic interactome analysis demonstrated a physical interaction between nedd8, klhl13, cul3, and klhl9, indicating that this is a functional e3 ligase complex that interacts with clec12a (figure 6d). Nedd8 is a target of some cycle - inhibiting factors (cifs), which are virulence factors produced by bacterial pathogens that alter the host cell cycle (crow et al ., 2012; jubelin et al ., cif can associate directly with nedd8-modified cullin - ring complexes and inhibit their activity (crow et al . We therefore investigated whether cul3, nedd8, klhl9, and klhl13 had roles in antibacterial autophagy similar to clec12a (huett et al . 2013). Upon sirna knockdown in hela cells, klhl9, klhl13, and nedd8 had a dramatic effect on both lc3-salmonella colocalization and bacterial replication, consistent with a role for these proteins in antibacterial autophagy (figures 6e and 6f). Human genetics provides a powerful tool to identify and understand physiologically relevant host responses to pathogens given that host - pathogen interactions are known to have a role in many complex diseases . Gene - gene interactions and environment - gene interactions add to the complexity of identifying causal genes and variants from gwas data, as well as determining how these variants affect pathogenesis . Pathway - specific perturbational profiling and integrated systems approaches have previously been used in genetically defined organisms to identify genetic nodes of regulation underlying disease (gagneur et al ., 2013; gat - viks et al ., 2013; smith and kruglyak, 2008; zhang et al ., 2013). Using this strategy, we uncovered bacteria- and bacterial - ligand - specific programs affected in healthy individuals homozygous for the t300a polymorphism in the autophagy gene atg16l1 . Interestingly, 15% of the t300a - dependent response genes were found to play a role in autophagy pathways, highlighting important snp - pathway interactions . Our network analysis identified the clr family member clec12a as a gene that is less responsive upon tlr2 or bacterial stimulation in individuals carrying the atg16l1 300a snp . Pursuing the functional implication of this snp - environment interaction, we identified a role for clec12a in antibacterial autophagy and demonstrated that clec12a controls microbial replication in vitro and in vivo . Using cells engineered to express the crohn s disease non - risk or risk allele of atg16l1, we interrogated the snp - gene interaction with clec12a to demonstrate an exacerbated effect on antibacterial autophagy in the setting of the disease - associated snp . These findings are consistent with clec12a functioning at an early step in the antibacterial autophagy pathway at the level of pathogen recognition caused by membrane damage, with atg16l1 functioning downstream at the level of autophagosome formation . These data suggest a model in which individuals who carry the 300a risk allele have reduced clec12a responsiveness that serves to compound defects in antibacterial autophagy . These results highlight how non - redundant genes in the same pathway can be identified through ligand - specific transcriptional regulation . Clrs are a large family of pattern recognition receptors, many of which are important signaling mediators in antimicrobial defense (drummond and brown, 2013). Clec12a was recently shown to be a receptor for uric acid crystals and dead cells (neumann et al ., 2014), and we extend this finding to demonstrate that clec12a also recognizes sites of intracellular membrane damage triggered by bacterial entry (tattoli et al ., 2012; additionally, we show that clec12a likely serves as an adaptor to help recruit ubiquitin and ndp52 to sites of vacuolar damage caused by bacteria and thus induce antibacterial autophagy . These data suggest parallels between the functions of galectins and clrs as early sensors of damage in selective autophagy pathways . Additionally, a dendritic cell clr, dngr-1, regulates endocytic handling of necrotic cell antigens to modulate cross - priming, suggesting that clrs could function broadly in the selection of endocytic cargo (zelenay et al ., 2012). Recent data also indicate a role for another clr, clec16a, in mitophagy, indicating that these lectins can function broadly to control target selectivity in autophagy (soleimanpour et al ., 2014). Here, we integrated time course rna - seq data and quantitative proteomics to identify relevant clec12a - dependent protein interactions that are involved in antibacterial autophagy . We identified an e3 ligase complex including klhl9, nedd8, and klhl13 that interacts with clec12a and is required for antibacterial autophagy . Transcriptomic data suggested that the association of clec12a with this e3 ligase complex is important for the clec12a - dependent response to bacterial infection . Virulence factors produced by some bacteria are known to directly target neddylated cullin - associated ubiquitin ligase activity, suggesting that these proteins might be broadly involved in inhibiting bacterial pathogenesis (jubelin et al ., 2010). Additionally, klhl9 has been previously associated with early onset autosomal dominant distal myopathy, a disease in which alterations to the autophagy pathway are thought to contribute to pathophysiology (cirak et al ., 2010). Taken together, these data identify a role for the recently evolved substrate adapters klhl9 and klhl13 as well as nedd8 in the restriction of bacterial infection . Previous studies have suggested roles for the e3 ligases smurf1, lrsam1, and parkin in pathogen - specific autophagy (huett et al ., 2012; manzanillo et al ., 2013; orvedahl et al ., 2011). Recent studies have also highlighted roles for other e3 ubiquitin ligases in the control of bulk autophagy . These include a role for rnf5 in regulating the levels of atg4b (kuang et al ., 2012), a role for cullin-5 and cullin-4 in autophagy regulation through ambra1 (antonioli et al ., 2014), and a role for rnf216 in autophagy regulation through beclin1 (xu et al ., 2014) additionally, several members of the trim family of proteins can act as a platform for assembly of the autophagy machinery (mandell et al ., expression of rnf5 and rnf216 were also shown to increase pathogen susceptibility through autophagy (kuang et al ., 2012; xu et al ., 2014). Taken together with our data, these findings demonstrate that e3 ubiquitin ligases play an important role in regulating autophagy at different stages of the pathway . Specifically, e3 ubiquitin ligases create selectivity in autophagy regulation by recognizing and integrating specific signals from pathogens and cellular states . Utilizing e3 ligases to tightly control the response to pathogens is likely a highly conserved mechanism of innate defense (pollier et al ., 2013). Here, we use integrated genomics to demonstrate a role for clec12a in antibacterial autophagy and identify an e3 ligase complex that provides insight into the selectivity of pathogen degradation . Our in vivo results highlight a strong role for clec12a in the restriction of microbial replication . It is possible given this dramatic effect that clec12a functions not only in antibacterial autophagy but in other pathogen defense pathways as well . This study highlights how perturbational profiling can be used to study pathways underlying immunity and pathogen defense and illustrates the potential of combining whole - genome experimental data sets to understand functional gene interactions within a relevant pathway . For perturbational profiling, blood was collected after written informed consent (or waiver as approved by the institutional review board) from healthy volunteers at radboud university nijmegen medical centre (runmc). The study was approved by the institutional review boards and was performed in accordance with the declaration of helsinki . Separation and stimulation of pbmcs from healthy individuals was performed as described previously (netea et al ., 2004). Microarray hybridization and genotyping of volunteers was performed as previously described (smeekens et al ., 2013). Factorial design analysis was performed as described previously (cadwell et al ., 2010). S. typhimurium infections of hela cells and gentamicin protection assays were performed as previously described (huett et al ., 2012). For entry assays, cells were infected for 20 min, washed, fixed in 4% paraformaldehyde for 15 min at room temperature, and stained as described below . For antibacterial autophagy assays in sirna - treated cells, rnai knockdown for 48 hr was performed as described above on hela cells plated on glass coverslips and infected as above . Autophagy was induced in hela cells by treatment for 4 hr with 100 nm torin-1, 10 g ml of e64d - pepstatin a (sigma - aldrich), or mock treatment with dmso . Cells were treated with sirna for 48 hr as described above and then autophagy was induced followed by cell lysis (25 mm tris [ph 7.5], 0.5% np-40, 150 mm nacl, and protease inhibitors [roche]). Western blotting to demonstrate lc3 lipidation was performed after equalization of protein amounts and sds - page on an anykd polyacrylamide gel (bio - rad). Following transfer to immobilon - p membranes (millipore), detection was performed using rabbit anti - lc3 primary (sigma - aldrich), mouse anti - actin (sigma - aldrich), and appropriate fluorescent secondary antibodies (li - cor biosciences) as previously described . The second exon of atg16l1 was targeted in hela cells using the px330 plasmid crispr system as described (ran et al ., 2013). All animal studies were conducted under protocols approved by the subcommittee on research animal care (srac) at massachusetts general hospital . Clec12a mice were obtained from the laboratory of g.d.b . At the university of aberdeen . Clec12a mice were produced by conventional gene targeting of exons 14 on a c57bl/6 background (p. redelinghuys, a. augello, r.a . Protocols for bacterial growth and infection were performed as previously described, with slight modification (barthel et al ., 2003; conway et al ., 2013). Quantitative proteomics using itraq labeling of peptides was performed as described previously (lassen et al ., 2014; mertins et al ., 2014). Hela cells were reverse - transfected with plasmid expressing gfp - clec12a on glass coverslips in 12-well plates the night before the assay . Osmotic lysis of endosomes was accomplished by exposing cells to hypertonic medium (0.5 m sucrose in pbs with 10% peg100) for 10 min . Cells were washed twice with 1 pbs and then incubated in 60% pbs for 3 min as described previously (thurston et al ., 2012). Cells were returned to complete medium for 20 min and then fixed with ice - cold methanol.
Randomized controlled studies have shown that noninvasive ventilation (niv) reduces short - term mortality, risk of intubation and complication rate when given as an additional treatment to selected patients with an acute exacerbation in chronic obstructive pulmonary disease (copd) complicated by hypercapnic acute respiratory failure.1,2 plant et al2 showed a decrease of the in - hospital mortality rate from 20% to 10% when niv was given to patients with mild acidosis and in a stationary or intermediary ward in a multicenter setting . As with most other treatment modalities, there is likely to be a less noticeable effect when comparing real - life and clinical trial efficacy . This was documented in an audit performed in the uk,3 where the aim was to explore factors related to reported high mortality rates . Niv was implemented as an add - on modality in an acute medical ward and a respiratory ward at odense university hospital, odense, denmark, in 2004,4 based on local instructions and national recommendations,5 and the modality has since been used as a standard additional treatment primarily for patients with hypercapnic acute respiratory failure and verified or presumed copd . Specifically, patients with arterial measures of ph <7.35 and paco2> 6.0 kpa and mono - organic symptoms of dyspnea, respiratory rate> 25 and pao2 <7.0 kpa without oxygen therapy are eligible for niv . Exclusion criteria for niv treatment in the ward are untreated pneumothorax, unstable hemodynamics, and affected alertness, indicating need of intensified monitoring and intubation capability when required . There are few reports on long - term survival after receiving niv in a clinical setting,6 and the issue of whether there is an advantage by implementing niv in patients with severe prognosis and expected high mortality rates has not been addressed . The aim of this study was to analyze long - term all - cause mortality following the first years of implementing niv in a real - life acute medical ward at a university hospital in denmark, with the null hypothesis that niv has no impact on long - term survival . All niv treatments were registered prospectively at the acute medical and respiratory ward of the odense university hospital, with patients receiving niv for the first time in the period january 1, 2005 to december 31, 2007 included for this analysis . Baseline data registered were age, sex, when registered in the records, arterial blood gas analyses initiating the indication for niv (ph and pco2 are presented), diagnoses at discharge, and forced expiratory volume in 1 second (fev1). Patients were included at the time of their first niv episode, and were followed until death or january 31, 2012 using the danish central person register to ensure complete follow - up . Patients were admitted to the acute medical ward from either the general practitioner or the emergency ward at the hospital . When patients were suspected of having an acute exacerbation of copd based on clinical presentation, prior records, arterial blood gas analyses, and chest x - ray, patients were assessed after initial standard treatment with oxygen, inhaled bronchodilator treatment, administration of systemic steroids, and, if needed, antibiotics . Patients either continued standard medical treatment or were provided additional ventilatory support with niv in the medical acute ward . Criteria for niv were: (1) arterial blood ph <7.35; (2) pao2 <7.0 kpa; and (3) paco2> 6.0 kpa in patients with mono - organic symptoms of dyspnea and respiratory rate> 25 . Where possible, patients initiated on niv were referred to the respiratory ward the next day . Since niv was initiated in the acute medical ward, standard niv protocols were followed (initial inspiratory positive airway pressure 10 cm h20 and expiratory positive airway pressure 4 cm h20), with oxygen supplement depending on response (aim: peripheral oxygen saturation measure of 90%92%), and changes in pressure were performed depending on the clinical manifestation in accordance with the danish national guideline.5 the protocol on use of niv remained unchanged in the period of the study . Initiation was done by internal medical staff and a respiratory physician was available for consultation if required . Patients were monitored with repeated arterial analyses; if the patient s status deteriorated, this patient was discussed with the attending intensive care unit (icu) doctor, unless the patient did not want icu treatment or the attending acute medical physician or respiratory physician had issued a do - not - intubate order, based on the severity of the underlying illness(es). On a few occasions, niv was initiated for weaning in patients with prior longer intubation need due to respiratory failure; these patients are reported on separately . Patients were admitted to the acute medical ward from either the general practitioner or the emergency ward at the hospital . When patients were suspected of having an acute exacerbation of copd based on clinical presentation, prior records, arterial blood gas analyses, and chest x - ray, patients were assessed after initial standard treatment with oxygen, inhaled bronchodilator treatment, administration of systemic steroids, and, if needed, antibiotics . Patients either continued standard medical treatment or were provided additional ventilatory support with niv in the medical acute ward . Criteria for niv were: (1) arterial blood ph <7.35; (2) pao2 <7.0 kpa; and (3) paco2> 6.0 kpa in patients with mono - organic symptoms of dyspnea and respiratory rate> 25 . Where possible, patients initiated on niv were referred to the respiratory ward the next day . Since niv was initiated in the acute medical ward, standard niv protocols were followed (initial inspiratory positive airway pressure 10 cm h20 and expiratory positive airway pressure 4 cm h20), with oxygen supplement depending on response (aim: peripheral oxygen saturation measure of 90%92%), and changes in pressure were performed depending on the clinical manifestation in accordance with the danish national guideline.5 the protocol on use of niv remained unchanged in the period of the study . Initiation was done by internal medical staff and a respiratory physician was available for consultation if required . Patients were monitored with repeated arterial analyses; if the patient s status deteriorated, this patient was discussed with the attending intensive care unit (icu) doctor, unless the patient did not want icu treatment or the attending acute medical physician or respiratory physician had issued a do - not - intubate order, based on the severity of the underlying illness(es). On a few occasions, niv was initiated for weaning in patients with prior longer intubation need due to respiratory failure; these patients are reported on separately . In the study period 20052007, niv was initiated on 390 occasions: 107 times in 2005, 143 times in 2006, and 140 times in 2007 . Of the 302 patients registered, 253 patients received niv for the first time and were included in this study . Copd was listed as the primary diagnosis in 216 patients (85.4%); the diagnosis was confirmed by documented spirometry in 182 patients (8%) and was judged as highly probable in 34 patients (16%). Other diagnoses registered at discharge in patients presenting with acute hypercapnic respiratory failure were congestive heart failure, thoracic malignancy, and hypoventilation by other causes (see table 1). Arterial gas analyses resulting in initiation of niv was registered in 51.4% of cases; in these patients, the median ph was 7.24 (7.077.43), and median pco2 (kpa) was 10.1 (6.0, 20.3). After 5 years, 23.7% of the patients were still alive as shown in figure 1 . For patients with documented copd, the corresponding 30-day mortality was 24.3% and 5-year survival was 23.1% (see figure 2). There was no statistically significant difference in survival for men and women, although we did see a trend towards better long - term 5-year survival in females compared to males (25.7% vs 19.2%, p = 0.25 [logrank]). Presence of copd did not affect prognosis, but the trend of better long - term 5-year survival in females compared to males was maintained (27.2% vs 17.9%, p = 0.083 [logrank]). The only statistically significant differences found between the long - term survivors and patients who died in the observation time were age and issue of a not - to - intubate order . Survivors had a median age of 66 years compared to 74 years in nonsurvivors, and the not - to - intubate order was associated with 100% mortality . There was no difference in registered ph or pco2 between survivors and nonsurvivors at initiation of niv . Descriptive data of copd patients versus non - copd patients receiving niv for the first time are shown in table 2, and supplementary information in figure 1 . Data on long - term survival of patients receiving niv for the first time revealed an expected high 30-day mortality rate, considerably higher than that seen in pivotal trials of niv in copd,1,2 but in line with other observational audits and studies.3,6,7 however, the 5-year survival rate was higher than earlier anticipated, which could be due to more stringent selection criteria for initiation of niv, and the fact that the study was only conducted in one center, giving patients more homogenous treatment . One significant difference between survivors and nonsurvivors was age, survivors being, as a group, younger than the group of patients who died, but the oldest patient (91 years) registered in this study was alive at the end of 5 years of observation . We observed a trend of better long - term survival in females compared to males, in the whole niv group and especially in patients with copd, but further studies are needed to evaluate confounding variables . Unfortunately, the registration of comorbidities was not done routinely or stringently, but, in the last couple of years, more focus has been made on screening and registration of comorbidities in copd, a benefit for future surveys . Historically, males have had a higher exposure of cigarette smoke and occupational lung irritants8 and these factors could be contributing to the trend of worse long - term survival . It is well known that patients entered into clinical trials often differ significantly from patients in the usual clinical setting . In contrast to randomized controlled studies, this patient - based study included a much less selected group of patients having more comorbidities presenting with acute hypercapnic respiratory failure . Patients were not limited to patients with respiratory failure due to exacerbation in copd, and, a priori, one could assume that this would affect prognosis . Patients with other diagnoses included patients with clearly reversible disorders, such as overdoses of benzodiazepines, but several survivors were patients with other less morbid diagnoses than copd . Despite the disadvantages of retrospective and therefore less complete data retrieval from records (especially concerning arterial blood analyses), survivors compared to nonsurvivors were similar with regards to copd and, when registered, fev1, ph, and pco2 . In the non - copd patients especially severe diseases such as congestive heart failure, thoracic malignancy, and end - stage fibrosis, were present among nonsurvivors but not at all present in survivors . In several of these cases, niv was given as a last treatment option in patients with a not - to - intubate order . It seems apparent that patients labeled not - to - intubate have a particularly poor prognosis and, based, on our findings probably did not benefit from the treatment . The study included all patients initiated in an acute medical ward setting or a respiratory ward . Unlike two previous prospective studies by berkius et al,6 including 93 copd patients in a multicenter icu setting, and harris et al,7 reporting use of noninvasive ventilation (continuous positive airway pressure and bilevel positive airway pressure) in clinical practice over 5 years, we have not included patients receiving the modality of niv initiated only in the icu setting . Berkius et al6 reported survival data (5-year) for copd patients receiving niv in the icu (17%), which was lower for patients needing intubation (6%). A national british copd audit from 2008 on acidosis, niv, and mortality in hospitalized patients with copd exacerbations, including 232 hospital units and 9716 patients, showed that 20% of the patients had acidotic artery blood analyses at admission.3 niv treatment in clinical practice was given to severely ill patients, many with mixed metabolic acidosis . Further, patients fulfilling clinical criteria for niv treatment failed to receive niv, and others received it inappropriately . Niv was also seen used as a ceiling of treatment in which efficacy was uncertain . The primary focus of this present study has not been evaluation of the indication for niv treatment; since 2008, an annual national surveillance of patients with copd (dansk register for kol [drkol]) has been launched, registration practice (international classification of diseases [icd]-10) has been reviewed, and audits performed . In denmark, treatment with niv was provided to 9% of all copd patients admitted with an exacerbation in 2009 and 10% in 2010 and 2011.9 our study confirms that patients with hypercapnic respiratory failure are a high - risk group, often with a poor prognosis . It casts some doubt as to what is achievable from niv in a non - icu setting and suggests that regular audits are required to ensure that the right patients are offered the right treatment when admitted with mild hypercapnic respiratory failure . However, the 5-year survival rate was higher than earlier anticipated, justifying the broad approach to niv treatment in this setting . The high 30-day mortality rate for all niv - initiated patients was higher (29.3%) than for the group of patients with copd (24.3%), and this supports the notion that niv should be dedicated primarily to patients with copd in exacerbation . The 30-day mortality rate for copd patients receiving niv was similar in an audit from 2010, and patients with ph <7.25 had a worse outcome than patients presenting with higher ph at niv initiation (unpublished data). Monitoring of patient outcomes in a real - life setting is necessary to ensure optimal selection of patients for niv in a non - icu setting.
Takayasu arteritis (ta) is a chronic inflammatory arteritis affecting the aorta and its main branches . The disease has a world - wide distribution, but has a high prevalence in japan . Although there are no population based studies from india, reports have shown than the prevalence may be as high as in japan . Most of the patients diagnosed to have this condition are women in their second and third decades of life . The occurrence of the disease in young children and infants is extremely rare with only a few cases reported all over the world . The present case report is about a 2-year - old female patient who was brought to the hospital with a history of incidentally detected hypertension of 2 months duration . She was born out of a non - consanguineous marriage and had an uneventful antenatal and postnatal course with normal developmental milestones and she had received vaccinations according the national immunization program, which includes bacillus calmette - guerin (bcg). On examination, she was afebrile, active and well - nourished; her weight was 16 kg and height was 80 cm . Blood pressure was 140/90 mmhg, which was more than the 99 percentile for her height . Her renal functions were normal (blood urea: 8.4 mg / dl; serum creatinine: 0.39 mg / dl). Serum sodium was 133.5 mmol / l, s. potassium 3.3 mmol / l, s. calcium 9.9 mg / dl and s. phosphurus 3.94 mg / dl . Erythrocyte sedimentation rate (esr) was 20 mm/1 h and c - reactive protein was 6 mg / dl . The size of the right kidney was 7.1 cm 3.6 cm and that of the left kidney was 6.1 cm 2.9 cm . Computed tomography aortogram showed critical stenosis of the left renal artery, at a length of 8 mm from the origin, a short segment stenosis of the right renal artery at its origin, a tight focal stenosis at the origin of the celiac artery with post - stenotic dilatation, mild stenosis at the origin of the superior mesenteric artery and narrowing of the abdominal aorta at the level of renal arteries; there was no para - aortic lymphadenopathy [figure 1]. The diameter of aorta at the level of diaphragm, renal arteries and just above bifurcation into iliac arteries were 6.2 mm, 5.2 mm and 6.6 mm respectively, proving that there was a narrowing at the level of renal arteries followed by post - stenotic dilatation . With these angiographic findings, in this infant with hypertension, a diagnosis of ta was made according to the european league against rheumatism / pediatric rheumatology international trials organization / pediatric rheumatology european society (eular / printo / pres) criteria - 2008 . The child is being treated with nifedipine 5 g thrice daily and clonidine 50 mg thrice daily and her blood pressure is 90/55 mmhg . Computed tomography angiogram showing bilateral renal artery stenosis and narrowing of abdominal aorta (arrows: a: short segment stenosis of right renal artery, b: stenosis of left renal artery with small left kidney, c: narrowing of the abdominal aorta at the level of renal arteries) ta, also known as pulseless disease, occlusive thromboaortopathy and martorell syndrome, was first systematically described by a japanese ophthalmologist mikito takayasu . The disease remains an enigma as the exact cause of the disease is still not elucidated . A human leucocyte antigen (hla) association and viral etiology have also been postulated . The clinical presentation of ta includes three phases: the early phase or prepulseless phase characterized by nonspecific systemic features such as malaise, arthralgia, weakness, weight loss and low grade feverthe pulseless phase characterized by claudication, amaurosis or diplopia and renovascular hypertensionthe occlusive phase characterized by transient ischemic attack, stroke, aortic regurgitation, cardiac failure, renovascular hypertension and claudication . The early phase or prepulseless phase characterized by nonspecific systemic features such as malaise, arthralgia, weakness, weight loss and low grade fever the pulseless phase characterized by claudication, amaurosis or diplopia and renovascular hypertension the occlusive phase characterized by transient ischemic attack, stroke, aortic regurgitation, cardiac failure, renovascular hypertension and claudication . The diagnosis of ta in children is based on the eular / printo / pres criteria [table 1]. Diagnostic criteria for takayasu arteritis in children ta is certainly underdiagnosed and underreported from india, due to the fact that the disease may not present with classical features and the imaging modalities are available only in tertiary care centers . A study that compared the clinical manifestations of ta in india and japan reported that there was a significant variation in the manifestations of the disease in the two countries . In contrast to japanese patients in whom proximal aorta involvement (takayasu conference classification - type i and ii) was common, in indian patients descending and abdominal aorta involvement (type iv) was common . Moreover, hypertension was the most dominant sign in indians compared with pulse lessness in the japanese . It was also noted that the age at diagnosis of the disease was almost a decade earlier in indians compared to japanese (28 10 vs. 37 14 years, p <0.01). In an indian study, it was found that aortoarteritis was the most common cause of renovasular hypertension and accounted for 59.4% of all cases . However, the mean age of the subjects was 27 years and the youngest child was 5 years of age . To the best of our knowledge, there are no reports from india of a case of ta in an infant . Our patient had type iv disease, with the involvement of abdominal aorta, coeliac, superior mesenteric and both renal arteries . Although it is suggested that glucocorticoids are the mainstay of treatment in the early or prepulseless phase, other immunosuppressive agents like methotrexate, azathioprine and anti - tumor necrosis factor agents have also been used, especially in steroid resistant cases . However, no evidence is available for benefit of therapy in the pediatric age group . However percutaneous intervention is less likely to succeed when stenosis or occlusions affect lengthy portions of an artery or the artery is heavily scarred . An angioplasty to the left renal artery was attempted in this case, but was unsuccessful . Hence it was decided to continue medical management with anti - hypertensives as blood pressure could be controlled with medications and she was not given steroids as there were no clinical or laboratory indicators of an active inflammatory disease in this infant . Although the world - wide prevalence of ta is very low, it is more prevalent in asian countries like japan and india . The clinical manifestations of the disease in india are different from that seen in japan . Type iv disease involving abdominal aorta and renal arteries is more common in indians and hypertension is the most common sign . If the disease is active, steroids can be tried and the lesions amenable to angioplasty may be corrected by a percutaneous transluminal angioplasty.
Currently, liver transplantation is the only definitive treatment for the end stage liver diseases . However, its widely used was limited by the expensive costs, shortage of donor organs and invasive procedure (1). Hepatocyte transplantation has emerged as a feasible alternative to liver transplantation in some liver diseases (2), but it is limited by organ donors and the low cell quality of available liver tissues (3, 4). Although human embryonic stem cells (hescs) and umbilical cord blood stem cells (ucbsc) could be induced into hepatocyte - like cells in vitro (5), their widely used were limited by the low differentiation quality, ethics, and teratoma formation (6). Recently, the adult stem cells (ascs) derived from various tissues, including bone marrow derived mesenchymal stem cells (bmscs), adipose tissue derived mesenchymal stem cells (adscs), and peripheral blood mononuclear cells (pbmcs) have been developed as new cell sources contributing to liver regeneration for their high efficiency of hepatogenic differentiation using simple procedures and no ethnic issues (710). In the present study, we investigated whether ascs are the ideal seed cells for the liver regeneration from the followings: ascs biology, including isolation, culture, differentiation to hepatocytes, and the further role of ascs in cell therapy and tissue engineering in recent studies, samples of human bone marrow were obtained by lumbar puncture (lp), human adipose tissue were obtained from abdominal subcutaneous adipose tissue of gastric cancer patients or liposuction patients, human peripheral blood were obtained from patients with hbv or healthy adult blood donors, in accordance with the local ethics committee . Most laboratory data showed that bmscs could be prepared through the density degree of centrifuge, flow cytometry sorting, and sidewall sieve method (1114). Side - wall sieve method has become popular one for its simple operation, lower cost, less injury to cell (15). Adipose tissue was minced with scissors and scalpels into less than 3 mm pieces and isolation of adscs proceeded as previously described (16, 17). Generally, human peripheral blood monocytes isolated from donors were isolated by density gradient centrifugation and further purified by adherence separation . In order to obtain more pbscs in shortly time, g / kg / d, administered subcutaneously daily to mobilize pbmcs from bone marrow to peripheral blood (18, 19). Then pbmcs were collected by means of aphaeresis . Conget et al indicated that the bmscs express many surface agents including cd13, cd44, cd29, cd105, but did nt express cd1a, cd14, cd31, cd34, cd56, cd45 (20). Ascs derived from all three sources displayed no expression of hematopoietic markers (cd14, cd34, cd45), of the stem cell marker cd133, or the marker for endothelial cells cd144 . More than 90% of mscs derived from the three sources expressed the typical msc marker proteins cd44, cd73, cd29, and cd90 . However, the intensity of expression of cd90 of pbscs was significantly below that of the other tissues . More than 90% of the ascs derived from all three sources expressed hla i; however, none of the mscs expressed hla ii . Cd105 was expressed by a significantly lower percentage of pbscs compared with bm- or ad - scs, whereas, more pb- and bm - scs expressed cd106 than adscs . Besides the fact, that they are more heterogeneous (23), they reveal a surface antigen marker profile (22, 2426), and differentiation potential similar to bmscs (2732). Adscs are characterized as cd45, cd34 +, cd105 +, cd31-(33) (table 1). Some studies indicated that functional hepatocytes could be induced from ascs by some cytokines or through coculture with other cell types . However, the potential of the ascs transdifferentiation is generally low . Therefore, researchers are keen to explore new methods to induce ascs differentiate into functional hepatocytes in vitro currently . The hepatocyte - like cells from ascs were confirmed from the gene and protein expression . Gene expressions were identified by rt - pcr, using the common markers of hepatocytes, including alb, afp, ck18, ck19, and cyp3a4 (34). Protein expressions were usually identified by immunohistochemistry or mmunofluorescence, western blot, from the expression of albumin, ck18, cyp3a4, cyp1a1, cyp2c9 and nadph - p450 (3538). To compare the potential of hepatogenic differentiation of the different adult stem cells in vitro, researches indicated adscs have a similar differentiation potential towards the hepatic lineage, similar to bmscs . However, their longer culture period and proliferation capacity differ from the bmscs (3941). In recent studies, samples of human bone marrow were obtained by lumbar puncture (lp), human adipose tissue were obtained from abdominal subcutaneous adipose tissue of gastric cancer patients or liposuction patients, human peripheral blood were obtained from patients with hbv or healthy adult blood donors, in accordance with the local ethics committee . Most laboratory data showed that bmscs could be prepared through the density degree of centrifuge, flow cytometry sorting, and sidewall sieve method (1114). Side - wall sieve method has become popular one for its simple operation, lower cost, less injury to cell (15). Adipose tissue was minced with scissors and scalpels into less than 3 mm pieces and isolation of adscs proceeded as previously described (16, 17). Generally, human peripheral blood monocytes isolated from donors were isolated by density gradient centrifugation and further purified by adherence separation . In order to obtain more pbscs in shortly time, pbmcs were mobilized with recombinant g - csf at 510 g / kg / d, administered subcutaneously daily to mobilize pbmcs from bone marrow to peripheral blood (18, 19). Conget et al indicated that the bmscs express many surface agents including cd13, cd44, cd29, cd105, but did nt express cd1a, cd14, cd31, cd34, cd56, cd45 (20). Ascs derived from all three sources displayed no expression of hematopoietic markers (cd14, cd34, cd45), of the stem cell marker cd133, or the marker for endothelial cells cd144 . More than 90% of mscs derived from the three sources expressed the typical msc marker proteins cd44, cd73, cd29, and cd90 . However, the intensity of expression of cd90 of pbscs was significantly below that of the other tissues . More than 90% of the ascs derived from all three sources expressed hla i; however, none of the mscs expressed hla ii . Cd105 was expressed by a significantly lower percentage of pbscs compared with bm- or ad - scs, whereas, more pb- and bm - scs expressed cd106 than adscs . Besides the fact, that they are more heterogeneous (23), they reveal a surface antigen marker profile (22, 2426), and differentiation potential similar to bmscs (2732). Adscs are characterized as cd45, cd34 +, cd105 +, cd31-(33) (table 1). Some studies indicated that functional hepatocytes could be induced from ascs by some cytokines or through coculture with other cell types . However, the potential of the ascs transdifferentiation is generally low . Therefore, researchers are keen to explore new methods to induce ascs differentiate into functional hepatocytes in vitro currently . The hepatocyte - like cells from ascs were confirmed from the gene and protein expression . Gene expressions were identified by rt - pcr, using the common markers of hepatocytes, including alb, afp, ck18, ck19, and cyp3a4 (34). Protein expressions were usually identified by immunohistochemistry or mmunofluorescence, western blot, from the expression of albumin, ck18, cyp3a4, cyp1a1, cyp2c9 and nadph - p450 (3538). To compare the potential of hepatogenic differentiation of the different adult stem cells in vitro, researches indicated adscs have a similar differentiation potential towards the hepatic lineage, similar to bmscs . However, their longer culture period and proliferation capacity differ from the bmscs (3941). In the present study, we described different ascs could be induced into hepatocyte lineage cells in different culture systems in vitro . It is very safe and easy to acquire the enough ascs, and then induce them into functional hepatocytes in vitro . Based on this progress, ascs transplantation might be a novel therapy for the severe liver diseases, and also will be ideal seed cells for liver tissue engineering . However, which ascs are better still needs us to investigate from their preparation, molecular characterization, and functional assay . This paper firstly provides such a concise review focused on ascs biology and differentiates potential, indicating ascs might be an ideal seed cells in cell transplant therapy and tissue engineering . We also believe in the future, some studies will show us the most appropriate ascs for cell transplant or tissue engineering.
Waldenstrom's macroglobulinemia (wm) is the result of a clonal proliferation of lymphocytes that produce monoclonal immunoglobulin m (igm). It is now considered to correspond to lymphoplasmacytoid lymphoma as defined by the world health organization classification system (1, 2). Many central nervous system (cns) complications have been described in wm patients; the majority have been associated with blood hyperviscosity caused by igm . The hyperviscosity syndrome is characterized by headache, tinnitus, vertigo, blurred vision, and chronic bleeding from the nose and gums (3). However, cns infiltration by plasmacytoid lymphocytes (bing - neel syndrome) has only rarely been reported (4). A 51-yr - old woman was diagnosed with wm three years prior to this presentation . She received six courses of chlorambucil (0.3 mg / kg per day on day one to four orally) and prednisone (45 mg / m per day on day one to four). Next, she received fludarabine chemotherapy (25 mg / m per day on day one to five intravenously) with a limited response . High - dose cyclophosphamide and granulocyte colony - stimulating factor were administered to induce peripheral blood progenitor cell (pbpcs) mobilization for autologous stem - cell transplantation; however, the number of pbpcs collected was not sufficient . We then decided on a conservative treatment approach, because the patient did not have specific symptoms and the serum igm level was stable (3,000 - 3,500 mg / dl). The laboratory values on admission were as follows: white cell count 8,050/l with normal differential counts, hemoglobin 9.6 g / dl, platelets 296,000/l, erythrocyte sedimentation rate 144 mm / hr, total protein 9.44 g / dl, albumin 2.85 g / dl, igg 3144.4 mg / dl, iga 25.4 mg / dl, igm a brain computed tomography scan revealed multifocal extra - axial tumorous lesions along the dura matter . A brain magetic resonance imaging showed an extra - axial soft tissue tumor along the left cavernous sinus and tentorium, right frontal convexity and tentorium and falx; the brain parenchyma appeared to be unremarkable (fig . Cerebrospinal fluid analysis showed the following: white cell count 43/l with neutrophils 1%, lymphocytes 52% and monocytes 47%, total protein 1.81 g / dl, glucose 104 mg / dl, igm 64.5 mg / dl and a few plasmacytoid lymphocytes on cytology . Stereotactic biopsy of dural tissue at the falx showed a diffuse infiltration with atypical cells, which were identified immunophenotypically as plasmacytoid lymphocyte with expression of lca (+), cd3 (-), cd20 (+), and vs38a (+) (fig . 2). The patient was confirmed to have cns infiltration by atypical plasmacytoid lymphocyte infiltration (bing - neel syndrome). The paitent received a total dose of 1,980 cgy with irradiation therapy of the whole brain that was administered in 11 fractions, and then her headache subsided, but the igm level was elevated persistently to 3,379.8 mg / dl . Following radiation therapy, fludarabine chemotherapy was performed (25 mg / m per day on 1 to 5 intravenously, two courses). A follow - up brain mri after six months revealed a marked decrease in the size of the mass in the tentorium and falx (fig . The patient had no evidence of cns recurrence during the follow - up period of one year . However, the igm level has been increasing slowly, so further chemotherapy, including rituximab may be considered . In 1936 bing and neel reported the association of hyperglobulinemia, cns symptoms (paresthesias, headache, and paralysis), and brain infiltration composed of plasma cells and lymphocytes in two patients (5). In 1944, waldenstrom described the syndrome that bears their name (bing - neel syndrome) (6). The bing - neel syndrome, originally placed in a " toxic - infectious " category, appears to be the result of involvement of the cns by diffuse neoplasm infiltration . Although they are most often peripheral, they can involve the cns . In wm, the cns may be involved by a variety of mechanisms, including hyperviscosity and direct infiltration by neoplastic cells (7, 8). Patients with bing - neel syndrome have sometimes presented with a mass containing neoplastic cells, but the masses have been intraparenchymal rather than meningeal (8, 9). This syndrome can be subdivided into diffuse and tumoral forms . In the diffuse infiltrative form such as this case, malignant cells are localized mainly in leptomeningeal spaces, periventricular white - matter, pons, and medulla (7, 10 - 12). Radiological findings in this syndrome have been reported, but a typical pattern has not emerged (13 - 15). An imaging technique would be the preferable diagnostic test, although histological confirmation is necessary to establish the definitive diagnosis . Intraventricular chemotherapy for bing - neel syndrome was reported to be effective in 1984 (15). However, a review of the literature reveals that the outcome for most patients who underwent chemotherapy was poor, and the patients died within several months (10, 13, 14). Therefore, patients with bing - neel syndrome may benefit from cranial radiation therapy prior to chemotherapy (9, 12, 16). Recently, a great deal of interest has been noted by treatments with purine nucleoside analogs (fludarabine, cladribine, and pentostatin) because of their remarkable activity in lymphoproliferative disorders . It has been reported that a patient with bing - neel syndrome (in its diffuse form) was successfully treated with cladribine administration (17), or radiation therapy and combination of cladribine, cyclophosphamide, and prednisone (18). In the present case further treatment was not possible because of persistant bone marrow suppression . A follow - up brain mri after six months revealed a marked decrease in the size of the mass in the tentorium and falx; the patient had no evidence of cns recurrence during the follow - up period of one year, but the igm level has been increasing slowly . We think that the major effect of deceased mass size was due to the radiation therapy in the present case . Several retrospective and prospective studies have indicated that rituximab may induce an objective response in approximately 30 - 40% of previous treated patients with wm (19). However, the effect of rituximab treatment on the cerebrospinal fluid b - cell compartment is limited in comparison with the effect on the b cells in the periphery (20), and it has not been tried in bing - neel syndrome as yet . Therefore, the effect of rituximab on cns involovement of wm need to be validated by of future studies.
The increasing prevalence of childhood obesity, especially in preschool aged children [1, 2], has stimulated research targeting critical periods of growth . According to freinkel's hypothesis of fuel - mediated teratogenesis, the intrauterine environment can influence changes in gene expression and affect the development and maturation of fetal organs and tissues [3, 4]. The postnatal period up to 2 years of age is also a critical period of growth . Indeed, rapid infant weight gain is associated with an increased risk of obesity and metabolic consequences later in life [58]. These include metabolic parameters such as in utero glucose exposure [911], maternal prepregnancy body mass index (bmi) [1214], and maternal insulin sensitivity during pregnancy . In a cohort of low - income children, maternal obesity during pregnancy more than doubled the risk of obesity in children . Maternal diet and physical activity during pregnancy [1619], as well as smoking may impact offspring risk of obesity and metabolic risk [2023]. However, there is a paucity of literature examining these risk factors in very young children . In particular, breastfeeding has a protective role against the development of obesity [2427]. Harder et al . Reported a dose - dependent association between breastfeeding and risk of obesity, where each month of prolonged breastfeeding decreased obesity risk in the child . Beyond the first few months of life, breast - fed infants gained less weight than formula - fed infants . Another study showed weight gain from 6 to 12 months was less in infants exclusively breastfed for 5 months compared to 2 months . Earlier introduction to complementary foods may also contribute to increased risk of childhood overweight [14, 31], however the evidence is inconsistent . Additionally, reduced physical activity and increased screen time (television and video) are associated with obesity risk in older children, although limited data is available in infants [33, 34]. There is little known about the impact of maternal and infant lifestyle on weight gain and adiposity at 1 year of life . The effect of screen time in infants on weight gain and adiposity has not been included as a potential factor in prior statistical models . There is also little information on the effect of maternal physical activity on weight outcomes of offspring . The objective of our study was to determine how maternal physical activity, maternal insulin sensitivity (isogtt), prepregnancy bmi, infant feeding practices (breastfeeding duration, age of introduction of formula, and complementary foods), and screen time contribute to infant weight gain and adiposity at 1 year of age . The study protocol was approved by the research ethics board at mount sinai hospital and the hospital for sick children . Participants were recruited for this prospective cohort study at the time of antepartum gestational diabetes mellitus (gdm) screening and were consented to be followed into the postpartum . All consenting women then completed a 3-h oral glucose tolerance test (ogtt) in late 2nd or early 3rd trimester . Venous blood samples were drawn at baseline, 60, 120, and 180 min after ingestion of a standard 100 g glucose load . The pregnant women were then classified into 3 glucose tolerance groups: (1) gdm, as defined by the national diabetes data group (nddg) criteria (requires at least two of the following: fasting glucose 5.8 mmol / l, 1 h postload glucose 10.6 mmol / l, 2 h postload glucose 9.2 mmol / l, or 3 h postload glucose 8.1 mmol / l); (2) gestational impaired glucose tolerance (gigt), defined as meeting only one of the above criteria; (3) normal glucose tolerance (ngt), defined as not meeting any of the nddg criteria . Parental demographics, medical history and anthropometrics were collected during pregnancy at the time of the ogtt . Data collected included maternal age, maternal prepregnancy weight, maternal and paternal ethnicity, family history of diabetes, socioeconomic status, and maternal physical activity indices . Maternal isogtt was calculated from the ogtt using the matsuda index, which is well correlated with insulin sensitivity derived from the euglycemic - hyperglycemic clamp method . Physical activity was assessed using the baecke questionnaire, which has been validated in several populations including women of child - bearing age [37, 38]. The questionnaire was completed during the ogtt, with participants reporting on their physical activity in the year preceding the pregnancy . The baecke questionnaire measures three domains of physical activity: (i) occupation - associated activity (work index); (ii) sport - related physical activity (vigorous / sport index); (iii) leisure - time physical activity not including sports (leisure index). The work index quantifies the exertion related to occupational activities, including sitting, standing, lifting, and walking, as well as effects on the individual (e.g., fatigue and perspiration). The sport index characterizes vigorous / sport activity with respect to intensity (using the updated compendium of physical activities). These indices were calculated on a scale from 15, where 5 represented the highest level of physical activity for each category . For example, a score of 3 out of 5 for leisure index might indicate sometimes walking or cycling for 1530 min and seldom watching television . Mean parental education score and occupation score was calculated on a scale of 17 and 19, based on the hollingshead index, an established surrogate index of socioeconomic status . A maximum averaged parental score of 62 indicated the highest level of education and profession . Infant information collected at birth included length of gestation, gender (male or female), and birth weight . At the 1 year visit, infant weight and length were measured, and weight - for - length z - score was calculated according to the world health organization (who) 2006 child growth standards to provide a surrogate measure of adiposity . The infant lifestyle questionnaire was completed by the mothers when the infants were 3 and 12 months of age and provided information on exclusive breastfeeding duration, age of introduction to formula and cereal, and screen time based on predictors found to be important for the development of obesity (average daily exposure to tv or video viewing, meals eaten while tv is on, tv in bedroom) [34, 42]. Infants born <37 or> 42 weeks, twins, or those with medical illnesses that required prolonged hospitalization were excluded from the analysis . Bivariate analysis of continuous variables with infant weight gain and weight - for - length z - score were assessed by spearman's correlation analysis . Independent samples t - test or one - way analysis of variance (anova) and post hoc analysis (fisher's least significant difference) were used to test differences in the outcome variables with maternal glucose tolerance group (gdm, gigt, or ngt), gdm status (yes / no), family history of diabetes (yes / no), infant gender (male / female), ethnicity (caucasian or non - caucasian), age of introduction to formula (at birth, 15 months, 6 months or never), and average daily screen time divided into 3 categories (no screen time, <60 minutes, and 60 minutes). We converted age of introduction to formula into a categorical variable because although exclusive breastfeeding duration and age of introduction to formula are similar variables, they are not synonymous because some infants were never formula - fed (n = 80). Variables determined to be significant from bivariate analyses, concurrently with variables known to influence infant weight gain and adiposity, were entered into multiple linear regression models . Two separate models were created for weight gain from birth to 1 year and weight - for - length z - score at 1 year . Nonmodifiable risk factors (infant age, sex, ethnicity, birth weight, and family history of diabetes) were forced into the model and modifiable risk factors (maternal prepregnancy bmi, gdm status, maternal physical activity indices prior to pregnancy, socioeconomic status, maternal log isogtt, infant exclusive breastfeeding duration, age of introduction to formula, age of introduction to cereal, and daily screen time) were entered according to the forward stepwise method . Descriptive characteristics and lifestyle measures are presented in table 1 for mothers and infants at 1-year postpartum (n = 246). From the time of consent postnatally to the 1-year followup visit, 62 (20%) of the original 311 infants were lost to followup . There were no significant differences in gdm status, prepregnancy bmi, maternal education, or maternal physical activity between mothers retained in the study versus those lost to followup . No significant differences were found for infant weight gain and weight - for - length z - score based on the mother's gdm status (yes / no) or glucose tolerance group during pregnancy (gdm, gigt, or ngt). Independent samples t - tests also showed no significant differences in the infant outcomes for family history of diabetes (yes / no) and infant ethnicity (caucasian or non - caucasian). Males had greater weight gain than females (p <0.001), however no differences between males and females for weight - for - length z - score were found (p = 0.636). One - way anova showed significant differences in infant weight gain for age of formula introduction (p = 0.001) and screen time (p = 0.032) (figure 1). Similar trends for age of formula introduction were found for infant weight - for - length z - score at 1 year (p = 0.012). However no differences were found between 0, <60 min, or 60 minutes of daily screen time (p = 0.19). Spearman's correlation analysis (table 2) showed a negative association for infant weight gain with maternal pregravid vigorous / sport index (p = 0.031), exclusive breastfeeding duration (p <0.001), and an earlier age of introduction to cereal (p = 0.02). Weight - for - length z - score was positively associated with maternal prepregnancy bmi (p = 0.003) and birth weight (p <0.001), and negatively associated with maternal log isogtt during pregnancy (p = 0.031) and maternal pregravid vigorous / sport index (p = 0.006). Maternal pregravid vigorous / sport index was also positively correlated with isogtt during pregnancy (p <0.001), as expected from previous data . Each month of prolonged exclusive breastfeeding reduced weight gain by 116.4 g, after adjustment for infant age, sex, infant ethnicity, family history of diabetes, and maternal pregravid vigorous / sport index (p <0.001). After adjustment, each unit increase in maternal pregravid vigorous / sport index decreased weight gain by 218.6 g (p = 0.016). In total, 33% of the variance in the model for weight gain was explained by the sample . Infant birth weight, infant ethnicity, and family history of diabetes did not significantly predict infant weight gain at 1 year . Additionally, socioeconomic status, maternal prepregnancy bmi, maternal isogtt, gdm status, maternal pregravid work index, maternal pregravid leisure index, infant age of introduction to formula, and infant screen time did not emerge in the model when entered . For weight - for - length z - score, an increase in one unit of maternal prepregnancy bmi (kg / m) was associated with an increase in weight - for - length z - score of 0.03 (p = 0.016), or one standard deviation change on the who child growth standards, after adjustment . Thus, mothers with a greater prepregnancy bmi were more likely to have heavier infants normalized for length . In addition, each month of prolonged exclusive breastfeeding and unit increase in maternal pregravid vigorous / sport index decreased weight - for - length z - score by 0.08 (p = 0.010) and 0.20 (p = 0.031), respectively . Infant sex, infant ethnicity, and family history of diabetes were not significantly associated with infant weight - for - length z - score . Variables that did not emerge in the model included: socioeconomic status, maternal isogtt, gdm status, maternal pregravid work index, maternal pregravid leisure index, infant age of introduction to formula, and infant screen time . Approximately, 19% of the variance in the model for weight - for - length z - score was explained by the sample . These findings demonstrate that maternal pregravid physical activity, prepregnancy bmi, and infant feeding practices have a significant influence on infant weight gain and adiposity . Weight gain from birth to 1 year was negatively predicted by infant female sex, maternal pregravid vigorous / sport activity, and exclusive breastfeeding duration and positively predicted by infant age at time of 1 year visit . Weight - for - length z - score at 1 year was negatively predicted by maternal pregravid vigorous / sport activity and exclusive breastfeeding duration and positively predicted by birth weight, infant age at time of 1 year visit, and maternal prepregnancy bmi . Factors that have been previously shown to influence infant weight gain and weight - for - length z - score, such as socioeconomic status or gdm status, were not significant in our model . This may be due to the fact that women in this study tended to have excellent glycemic control, which was evidenced by normal birth weight in the gdm pregnancies . The effect of maternal prepregnancy bmi on infant adiposity is consistent with existing literature [1214, 31]. In mothers with ngt or gdm, maternal prepregnancy bmi was significantly associated with childhood overweight in both groups, even after adjustment for maternal glucose status and infant birth weight . Furthermore, knight and colleagues reported that the impact of maternal fasting plasma glucose in nondiabetic mothers on infant growth was transient, while maternal prepregnancy bmi and paternal bmi remained correlated with offspring bmi at 2 years of age . Thus, the authors suggested that parental obesity, shared environment, or genetic factors had a greater influence on childhood bmi than maternal fasting plasma glucose during pregnancy . After controlling for confounding factors, maternal pregravid vigorous / sport activity significantly predicted infant weight gain . The mean pregravid vigorous / sport index in our study was 2.4, which suggests that 1530 min of walking or cycling per day in mothers prior to pregnancy may be beneficial for decreasing obesity risk of offspring . Maternal log isogtt did not predict infant growth at 1 year, after adjusting for maternal physical activity indices . Prior analyses by our group showed pregravid vigorous / sport activity was an independent predictor of maternal isogtt and reduced glucose intolerance in pregnancy . Taken together, pregravid physical activity may affect infant weight gain through a mechanism that partly involves maternal isogtt, however, these results suggest that maternal lifestyle may have a greater impact on infant weight gain than maternal glucose tolerance group or isogtt . Although daily screen time was not a significant predictor of infant weight gain or adiposity in our multivariate analyses, it was unsettling to find that more than half of the infants in our study were already exposed to television at 1 year of age and 11% of infants watched more than 2 hours of television per day . Infants with 60 minutes of screen time each day were heavier at 1 year of age than infants with 0 or <60 minutes of daily screen time . One possible explanation may include decreased overall activity levels in infants exposed to television for longer periods of time . Preschool children, more than 2 hours of television per day was associated with a higher risk of overweight and at risk for overweight and greater adiposity . Despite the known effect of screen time on bmi in childhood [4547], there is currently limited information on the effect of screen time under 2 years of age . The mechanisms to explain the effects of breastfeeding compared to formula feeding may include different physiological and behavioural factors . Several studies [2427], however not all [32, 48, 49], suggest that breastfeeding has a protective role on later obesity risk . After adjusting for confounding variables, infants exclusively breast fed for a longer duration had reduced weight gain and adiposity at 1 year . This may be influenced by the unique metabolic factors in breast milk compared to formula, such as breast milk leptin [50, 51] and adiponectin that may induce earlier satiety . The higher protein content of formula may also contribute to increased adiposity in formula fed infants . Koletzko and colleagues demonstrated that infants given formula with high protein content compared to infants given formula with low protein content resulted in increased weight at 2 years of age with no effect on infant length . It is thought that the higher protein consumption results in higher insulin secretion and stimulates the expression of insulin - like growth factor i (igf - i), leading to more adipogenic activity and adipocyte differentiation [54, 55]. Additionally, behavioural differences between breast - fed and formula - fed infants may affect infant energy intake . Studies have shown that there is less maternal control and a greater response to the infant's hunger and satiety cues with breastfeeding compared to formula feeding [56, 57]. There is also a lower frequency of meals and a higher uniformity of feeding volumes in formula - fed infants compared to breast - fed infants . Although some studies have reported the timing of cereal introduction as a positive predictor of infant weight gain, it did not emerge in our multivariate analyses . In a recent study, huh and colleagues noted that the timing of the introduction of solid foods on the odds of obesity at 3 years of age varied by breastfeeding status . Infants that were introduced to solid foods before 4 months and were never breast fed or stopped breastfeeding before 4 months had a sixfold increase in the odds of obesity compared to infants breast fed for more than 4 months . Since our study population was introduced to cereal later than 4 months (5.5 1.1 months) altogether, our findings on infant feeding suggest that exclusive breastfeeding duration may be more predictive of infant weight gain and adiposity than age of formula or cereal introduction . This study should be viewed in context of certain strengths and limitations . Due to the assessment of glucose tolerance in the late 2nd or 3rd trimester of pregnancy, we cannot completely exclude the possibility that some individuals may have received treatments following ogtt that could affect in utero glucose exposure and isogtt on infant outcomes . Although data was available on the type of intervention (diet therapy or other), glycemic control during pregnancy could not be determined . Other limitations included the lack of data on maternal diet and maternal physical activity during pregnancy in our study . Proposed that maternal energy intake influenced energy intake in children more than intrauterine exposure to diabetes, which suggests maternal energy intake should be included in future studies . Additionally, our study population had a large proportion of caucasian infants and highly educated parents, and it is unclear whether results may be extended to other ethnic backgrounds or families with lower socioeconomic status . Loss to followup was 20%, and although there were no differences in maternal factors between those who left and remained in the study, feeding practices of the infants may have differed . We were also unable to report on infant physical activity due to challenges in capturing physical activity accurately and objectively in infants . Nevertheless, we examined maternal and infant lifestyle variables that have not been previously studied together, providing further insight into the effects of the maternal and infant environment on weight gain and adiposity while controlling for important confounding variables . In summary, increased maternal pregravid physical activity and longer exclusive breastfeeding duration may have a critical influence on reducing infant weight gain and adiposity as early as 1 year of age . Results from this study support the recommendation for exclusive breastfeeding in infancy, and suggest maternal physical activity may also influence postnatal outcomes . Future directions include examining the additive effects of maternal diet during and after pregnancy, infant physical activity, and sedentary time on infant weight gain and adiposity . The evaluation of paternal physical activity may also provide insight into the impact of family lifestyle on infant growth . Longitudinal followup of these children will examine the effects of maternal and infant factors on bmi and adiposity in early childhood beyond 1 year of age.
Phylogenetic networks represent the evolutionary relationships of taxa, including sequences, genes, chromosomes, genomes, or species . There are different types of phylogenetic networks, but here, we are interested in reticulate networks, which provide an explicit representation of evolutionary history, meaning that internal nodes represent ancestral species, and nodes with more than two parents correspond to reticulate events such as recombination, hybridization or lateral gene transfer (huson and bryant 2006). Reticulate networks have been extensively used in evolutionary studies, especially at the population level, where reticulate events are, in general, quite common (posada and crandall 2001). Very few studies have tried to assess the performance of the algorithms used to reconstruct phylogenetic networks (cassens et al . 2007), and only recently, a comprehensive computer simulation study has been completed (woolley et al . One of the problems that arose during these studies was the comparison of reticulate networks . Although several comparison metrics have been already introduced in the literature (baroni et al . 2008a, 2008b; cardona, rossell, and valiente 2008b, 2008c; cardona g, llabrs m, rossell f, valiente g, metrics for phylogenetic networks ii: nodal and triplets metrics, unpublished data; cardona g, llabrs m, rossell f, valiente g, recent advances in metrics for phylogenetic networks, unpublished date), all of them have specific requirements regarding the nature of the networks to be compared in order to be perfect, that is, to have the metric properties of nonnegativity, separation, symmetry, and triangle inequality . Before continuing a network contains nodes (vertices) and branches (edges) that connect them . In general, we will refer to rooted networks, with a direction from the past to the present (i.e., directed graphs) that allows for the identification of parent and child the root node is the oldest node and has no parents . Tree nodes when two nodes share the same parent they are siblings . Depending on the relationships among the nodes that occur in a network, these can be classified as tree sibling (cardona, llabrs, et al . 2008a; cardona, rossell, and valiente 2008a), where every hybrid node has at least one sibling that is a tree node; tree child 2008b; cardona, rossell, and valiente 2008a, 2008b, 2008c; cardona g, llabrs m, rossell f, valiente g, unpublished data), in which every internal node has at least one child that is a tree node; regular (baroni et al . 2004), where the set of descendant leaves (clusters) of the nodes are all distinct; galled trees (gusfield et al . 2004a, 2004b), where the paths from the most recent common ancestor (mrca) of the parents of a hybrid node down to the hybrid node form disjoint cycles; and (binary) trees, which only contain tree nodes . These network classes are nested in this order: tree sibling tree child galled trees trees, meaning a tree is also a galled tree, a tree child network, and a tree sibling network, and so on . Regular networks, however, are not related to tree sibling, tree child, or galled tree networks (cardona g, llabrs m, rossell f, valiente g, recent advances in metrics for phylogenetic networks, unpublished date). The point we want to make is that the networks resulting from reticulating evolutionary processes do not necessarily correspond with any of the idealized classes of networks described above and for which perfect metrics exist . Were this true, it would imply that many phylogenetic networks could not be properly compared with the existing metrics . Obviously, it is very important to characterize the size of this perceived gap between the algorithms and the biology, and this is precisely our goal . In order to provide a formal statistical description of this disagreement, independent of particular organisms or genomic regions, we will use coalescent theory (kingman 1982) to generate the type of reticulate networks that result from the evolutionary process . The coalescent describes the probabilities of the different genealogies for a sample of genes generally but not necessarily from the same population, and it was further extended by hudson (1983) to include recombination events . Specifically, we will quantify the different classes of networks (regular, tree sibling, tree child, and galled trees) produced by the coalescent as a function of the population recombination rate . The standard coalescent describes the possible histories of a sample of genes back in time to their mrca (kingman 1982). In the absence of evolutionary forces like selection, migration, or recombination, the only types of events that can occur are coalescent events, in which two lineages (branches) fuse into one . Therefore, for a sample of n genes, there will be n 1 coalescent events until the mrca is reached . If recombination is included, the recombination events will result actually in the opposite pattern going backward in time, as in this case one lineage (the recombinant) separates into two (the parents of the recombination event). Therefore, the genealogies produced by the coalescent with recombination (also known as arg, for ancestral recombination graph) will be explicit reticulate networks as internal nodes actually represent evolutionary events . In figure 1, we show a typical genealogy for a sample of 10 genes . A single realization of the coalescent with recombination . The genealogy goes from the present (bottom) to the past (up). Coalescent and recombinant nodes are represented in white and gray, respectively . In our simulations, the genealogies were simulated with the program recodon (arenas and posada 2007). Two sample sizes (n = 10 and 50) and seven population recombination rates (= 0, 1, 2, 4, 8, 16, and 32) were explored . We used a continuous - time approximation where the times of the events are exponentially distributed . For every combination of parameters, we simulated 1,000 replicates, producing and evaluating thus a total of 14,000 genealogies . We varied the recombination rate that much because the recombination events actually determine the different network classes produced (regular, tree sibling, tree child, galled trees, or binary trees). The number of raw recombination events r(n) in the network for a sample of n genes has the expectationand thus, 0, 2.72, 5.44, 10.87, 21.74, 43.49, and 86.97 recombination events are expected for n = 10, and 0, 4.46, 8.92, 17.83, 35.67, 71.34, and 142.68 for n = 50, for the recombination rates enumerated above, respectively . The simulated genealogies were classified into five different network classes: regular, tree sibling, tree child, galled trees, and binary trees . First, hybrid and tree nodes in the graphs were identified as the recombinant and coalescent nodes in the genealogies, respectively, while superfluous nodes were eliminated (fig . Superfluous nodes have just one parent and one child and result from concatenated recombination and coalescent events . Although they are real nodes (and therefore count for r(n)), they cannot be estimated from real data and, therefore, were removed from the networks before their classification . The corresponding graph for the arg shown in figure 1 . The standard coalescent describes the possible histories of a sample of genes back in time to their mrca (kingman 1982). In the absence of evolutionary forces like selection, migration, or recombination, the only types of events that can occur are coalescent events, in which two lineages (branches) fuse into one . Therefore, for a sample of n genes, there will be n 1 coalescent events until the mrca is reached . If recombination is included, the recombination events will result actually in the opposite pattern going backward in time, as in this case one lineage (the recombinant) separates into two (the parents of the recombination event). Therefore, the genealogies produced by the coalescent with recombination (also known as arg, for ancestral recombination graph) will be explicit reticulate networks as internal nodes actually represent evolutionary events . In figure 1, we show a typical genealogy for a sample of 10 genes . A single realization of the coalescent with recombination . The genealogy goes from the present (bottom) to the past (up). Coalescent and recombinant nodes are represented in white and gray, respectively . In our simulations, the genealogies were simulated with the program recodon (arenas and posada 2007). Two sample sizes (n = 10 and 50) and seven population recombination rates (= 0, 1, 2, 4, 8, 16, and 32) were explored . We used a continuous - time approximation where the times of the events are exponentially distributed . For every combination of parameters, we simulated 1,000 replicates, producing and evaluating thus a total of 14,000 genealogies . We varied the recombination rate that much because the recombination events actually determine the different network classes produced (regular, tree sibling, tree child, galled trees, or binary trees). The number of raw recombination events r(n) in the network for a sample of n genes has the expectationand thus, 0, 2.72, 5.44, 10.87, 21.74, 43.49, and 86.97 recombination events are expected for n = 10, and 0, 4.46, 8.92, 17.83, 35.67, 71.34, and 142.68 for n = 50, for the recombination rates enumerated above, respectively . The simulated genealogies were classified into five different network classes: regular, tree sibling, tree child, galled trees, and binary trees . First, hybrid and tree nodes in the graphs were identified as the recombinant and coalescent nodes in the genealogies, respectively, while superfluous nodes were eliminated (fig . Superfluous nodes have just one parent and one child and result from concatenated recombination and coalescent events . Although they are real nodes (and therefore count for r(n)), they cannot be estimated from real data and, therefore, were removed from the networks before their classification . The corresponding graph for the arg shown in figure 1 . In the absence of recombination, all the simulated genealogies were binary trees, as expected . With recombination, different classes of reticulate networks were produced whose complexity was a function of the population recombination rate (tables 1 and 2). For n = 10, at small recombination rates (= 1) many networks were tree sibling, but half were already non - tree child . With twice as much recombination, half the networks were more complex than tree sibling networks, and only a few were tree child networks or galled trees . With moderate recombination rates (= 4), only 15% of the networks were tree sibling, whereas with larger recombination rates . Almost no network, or even none at all, could be classified into any of the standard classes . Increasing the sample size to n = 50 just increased a little more the complexity of the networks but preserved the same trend regarding the effect of recombination . On the other hand, even at small recombination rates (= 1) rather few networks are regular because hybrid nodes in the genealogies simulated by the coalescent with recombination have two parents and a single child, and a network containing a hybrid node with a single child is not regular unless the child is also a hybrid node . Number of simulated networks falling in each class as a function of the recombination rate = 0, 1, 2, 4, 8, 16, and 32 for sample size n = 10 number of simulated networks falling in each class as a function of the recombination rate = 0, 1, 2, 4, 8, 16, and 32 for sample size n = 50 we will argue that the network topologies we do not consider branch lengths produced by the coalescent with recombination will be indistinguishable from those produced by other reticulating processes like gene conversion, hybridization, and lateral gene transfer . Note that the coalescent with recombination results, going backward in time, in nonreciprocal exchanges of genetic material as only one of the two recombinants inherits ancestral material and will be therefore represented in the network . Conveniently, these types of events are also typical of gene conversion, hybridization, and lateral gene transfer . In addition, the nodes in the arg produced by the coalescent do not have to belong to the same species; they just represent gene copies . Therefore, we believe that these results are likely to be very similar for models of lateral gene transfer and/or hybridization the assumptions underlying the standard classes of networks should eventually fail given sufficient reticulation . We can conclude that the reticulate networks produced by the evolutionary process, at least as modeled by the coalescent with recombination, are much more convoluted than regular, tree sibling, tree child, or galled tree networks . These network classes the only ones for which perfect metrics exist are clearly insufficient to describe reticulating evolutionary processes . Indeed, new network metrics need to be developed if we really want to compare reticulate phylogenetic networks estimated from real data.
We recently demonstrated that diabetes directly induced dental caries in rats and mice, although a direct association between the 2 was less evident and conflicting in humans [14]. We demonstrated that dental caries were produced using noncariogenic diets with a low concentration of sugar in diabetic rodent models [57], although many studies usually add large amounts of sugar to the diet to induce dental caries [8, 9]. In addition, early studies on the production of experimental dental caries have reported the effects of physical properties of cariogenic diets with high concentrations of sugar on dental caries . These studies mainly used finely ground cariogenic diet [1013] because it is more cariogenic compared to a coarsely ground diet in rodents . Moreover, hard and coarse foods have the ability to prevent caries [1417]. Thus, modifying the dietary formulation may possibly enhance or reduce caries development in diabetic animals . However, no reports have investigated the effects of the physical properties of non - cariogenic standard diets on dental caries in diabetic animals . Currently, 2 types of non - cariogenic standard diet formulations (i.e., powdered and pelletized diets) are widely used in experimental rodents . In the present study, we compared the effects of these diets on the development of dental caries in a diabetic rodent model focusing on the difference in hardness between the powdered and pelletized diets . Six - week - old female f344 rats were supplied by japan slc, inc . The animals were housed in stainless - steel cages at a temperature of 2026c and a relative humidity of 4070% under a 12/12 h light / dark cycle, that were ventilated with filtered fresh air . To prevent infection, the animals were allowed free access to tap water and fed with a widely used standard pelletized or powdered diet (charles river formula 1 (crf-1); oriental yeast co., ltd ., the animals were handled according to the principles for all experimental procedures outlined in the guide for the care and use of laboratory animals prepared by our institution (setsunan university) and the japanese association for laboratory animal science . The glucose levels in the fresh urine were measured semiquantitatively using urine test paper (wako pure chemical industries, osaka, japan) daily from day 1 to day 3 after dosing, once every week for 1 month after the first week, and once every month thereafter . The blood glucose levels in the tail vein samples were also measured semi - quantitatively using the glucose oxidase method (glutest e; sanwakagaku, aichi, japan) once every month from the fourth week after alloxan injection . Blood samples obtained from the tail vein and fresh urine were collected from 1:00 to 4:00 p.m. the severity of hyperglycemia was defined as follows: normal, <200 mg / dl; mild,> 200 mg / dl; moderate,> 300 mg / dl; or severe,> 400 mg / dl . The severity of glycosuria was defined as follows: normal, <100 mg / dl; mild,> 100 mg / dl; moderate,> 250 mg / dl; or severe,> 500 mg / dl . The experimental design is shown in figure 1 . Ten rats, aged 7 weeks, were given a single dose (35 mg / kg body weight) of alloxan (sigma - aldrich japan, tokyo, japan) via tail vein injection . The dose of alloxan was determined as the given dose at which a rat survives for a long period after the onset of diabetic symptoms . After the confirmation of hyperglycemia and glucosuria following the dosing of alloxan, five rats were given a pelletized crf-1 diet (diabetes - pelletized diet group) and the remaining 5 rats were given a powdered crf-1 diet (diabetes - powdered diet group). As a control, each of the 5 intact rats was fed a pelletized or powdered crf-1 diet (control - pelletized diet group and control - powdered diet group). The animals were euthanized by exsanguination under deep anesthesia at the end of the observation period . Subsequently, the mandible was removed and fixed in 10% neutral - buffered formalin (ph 7.4). After a 24 h fixation, the occlusal, buccolingual, and proximal surfaces of all of the molar teeth were intensively observed under a binocular stereoscope . Soft x - ray images of the mesiodistal plane were taken under conditions of 35 kv and 2 ma for 4 min . The molar teeth were classified into 5 groups according to caries characteristics by observing and analyzing the radiographs: no radiolucent change (grade 0), radiolucent area only on the occlusal surface of the crown (grade 1), radiolucent areas on occlusal surface and either of the mesiodistal surfaces of the crown (grade 2), radiolucent areas over the entire surface of the crown (grade 3), and radiolucent areas over most of the surface of the dental root (grade 4). The mean score of the caries was used as indicator for comparing the severity of the carious lesions between the groups . After soft x - ray examination, a histopathological examination was performed on the mandible in all of the rats . After fixation with 10% neutral - buffered formalin, the sample was decalcified in a 5% solution of ethylenediaminetetraacetic acid 4 na (edta 4 na) for 2 weeks at 4c . After decalcification, the specimens were trimmed, dehydrated in a sequential ethanol series using an automated processor, and embedded in paraffin wax . Serial 7 m thick sections on the mesiodistal plane were made through the centers of all of the molars and then stained with hematoxylin and eosin for examination using light microscopy . The severity of the caries lesion was graded as follows: slight, dentin caries localized in occlusal surface of dentin; mild, dentin caries extended into the dental pulp with pulpitis and/or pulp necrosis; moderate, dental crowns were partially decayed; and severe, dental crowns were completely decayed (only the molar roots remained). The wilcoxon rank - sum test was employed to compare the differences in the mean scores of the caries lesions using soft x - ray examination between the groups . The chi - square test was used to determine the caries incidence using soft x - ray examination and the incidence of histopathological lesions in each group of rats . Severe hyperglycemia (> 400 mg / dl) and glucosuria (> 500 mg / dl) continued from the day after alloxan injection to the last monitoring day in all of the rats in the alloxan - treated groups . In addition, the blood glucose levels ranged from 78 to 120 mg / dl (normoglycemia), and the urine glucose levels were less than 100 mg / dl in the control groups . Typical macroscopic appearances of carious molars in diabetic rats are shown in figures 3(a), 3(b), and 3(c). Macroscopically, the dental caries developed mainly in occlusal fissures and were identified as partial coronal defects of the molars in alloxan - treated diabetic rats (figure 3(b)). The carious lesions expanded horizontally, until the crown of the carious molar was completely invisible (figures 3(b) and 3(c)). In contrast, control nondiabetic rats showed no changes in any of the molars (figure 3(a)). Soft x - ray images of the carious lesion in diabetic rats are shown in figures 3(d), 3(e), and 3(f). In all of the alloxan - treated diabetic rats, radiographically, the dental caries progressed both horizontally and vertically . In diabetic rats fed with a pelletized diet, the carious lesion was mainly characterized as grade 2 (figure 3(e)) or 4 type (table 1). In addition, the diabetic rats fed a powdered diet demonstrated carious lesions that were nearly of grade 4 type (figure 3(f)). In the control non - diabetic rats, there was no change in the molar teeth (table 1, figure 3(d)). The histopathological characteristics of the carious lesion in diabetic rats are shown in figures 3(g), 3(h), and 3(i). Histopathological carious lesions were detected in the crown as eroded dentin with bacterial colonization in alloxan - treated diabetic rats . In diabetic rats fed with the pelletized diet, many of the molars were moderately affected and the dentin caries spread over a wide area of the dental crown (figure 3(h)). In the diabetic rats fed with the powdered diet, the dental caries were markedly worsened and the crowns were nearly completely decayed (figure 3(i)). The incidence of caries teeth on the basis of each scoring in the soft x - ray examination is shown in table 1 . The incidence of dental caries in the diabetic rats fed on both the pelletized and powdered diets was apparently higher (p <0.01) compared to the non - diabetic control rats (table 1). In the diabetic rats fed with the pelletized diet, 96.7% of their molar teeth were affected with dental caries, and the mean caries score was 2.7 . In addition, in the diabetic rats fed with the powdered diet, all of their molars (100%) were affected with caries, and the mean caries score was 3.7, which was significantly higher (p <0.01) than the diabetic rats fed with the pelletized diet (table 1, figure 4). No radiolucent lesions were observed in any of the molars in control non - diabetic rats . The incidence of histopathological carious lesions on the basis of each grade is summarized in table 2 . Histopathologically, the severity of the carious lesions in the diabetic rats fed with a powdered diet was significantly enhanced compared to the diabetic rats fed with the pelletized diet (table 2). In control non - diabetic rats, slight carious lesions, which were macroscopically and radiographically normal, were detected in a few animals; however, there were no differences observed between the non - diabetic rats on the pelletized and powdered diets (table 2). The physical properties of foods such as hardness, adhesiveness, and cohesiveness are closely related with the caries - producing potential [19, 20]. Moreover, the development of caries is known to be profoundly affected by food hardness, and hard and coarse foods can exert a detergent activity during mastication, which is effective in the prevention of caries [17, 19]. Furthermore, a lower degree of caries was reported in animals fed with the hardest food diet . In the present study, the severity of caries in diabetic rats was enhanced in the powdered diet group compared to the pelletized diet group . It was clear that food hardness affected the development of dental caries in diabetic rats fed on a non - cariogenic diet . Hard foods are known to help flush away or neutralize undesirable material within the dental plaque and exert a cleaning effect on smooth surfaces by direct mechanical friction . Therefore, cariogenicity will be higher in diabetic rats fed with a powdered diet than in those fed with a pelletized diet . In this study, a high incidence and severity of dental caries was confirmed in the alloxan - treated diabetic rats fed with 2 types of standard diets with a low concentration of sugar . Furthermore, the mean caries score of the diabetic rats fed on the pelletized diet at 52 weeks after alloxan dosing in this study was almost 2-fold compared to animals at 26 weeks after alloxan dosing described in a previous report, strongly suggesting that the duration of hyperglycemia may affect caries development in diabetic animals . In this study, dental caries developed and extended to all of the molars in diabetic rats fed on both the pelletized and powdered diets . Thus, the effect of food hardness on the different diets in caries development in diabetic rats may become clearer when the dental caries mildly develop during the more early stages . In conclusion, food hardness could have an effect on the development of dental caries in diabetic rats, and appropriate consideration of the food formulation should be made in experimental caries studies using diabetic rodent models.
Encapsulation of biological macromolecules within lipid vesicles is important for biophysical research and for a variety of applications such as pharmaceuticals, foods, and cosmetics . Although attractive interactions between solutes and the lipids used to encapsulate them can lead to high encapsulation efficiencies, such methods are only effective for certain solute / lipid combinations . In contrast, passive encapsulation (i.e., without attractive interactions) is more general but leads to internalization of solutes at or below their concentration in the vesicle formation solution . Solute size is a key determinant in the efficiency of passive encapsulation, with larger solutes excluded from the vesicle interior such that the internal solute concentration is lower than the external concentration during vesicle formation . Knowledge of solute concentrations in the vesicle interior is important for understanding processes as varied as enzymatic turnover, polymerization, crystallization, or phase separation occurring in this volume . It is also of interest for applications in which vesicles serve as carriers for solute delivery, such as in food formulations or therapeutics . Quantification of encapsulated solute is accomplished by different methods depending on the size of the vesicles . Encapsulation in large unilamellar vesicles (luvs) and other submicrometer vesicles (svs, which include both luvs and small unilamellar vesicles, suvs) is quantified in terms of the bulk encapsulation efficiency (bee). Bee is the percentage of solute trapped within a batch of submicrometer vesicles as compared to the total amount of solute added . It is typically determined by removing all of the unencapsulated solute (e.g., via centrifugation or dialysis) and then lysing the vesicles to quantify the remaining (encapsulated) solute . Giant vesicles (gvs, 1100 m),(12) on the other hand, are not generally studied via bulk methods due to their limited stability, but are large enough to be analyzed individually . For example, the concentration of a fluorescently tagged solute encapsulated within an individual giant vesicle can be quantified by comparing the internal solute fluorescence to a calibration curve. (13) the ability to determine encapsulation efficiency for individual gvs (eeind) also makes it possible to compare encapsulation between vesicles within a batch, which can vary widely . Recently, approaches to determination of eeind for submicrometer vesicles have been reported; these powerful new tools have not yet become routine . The most common gv formation techniques, electroformation(18) and gentle hydration,(19) passively encapsulate solutes, such that the expected concentration inside (cin) is equal to the external concentration during vesicle formation (cout). For solutes with rh <10 nm, mean cin does tend to be equal to cout; however, we and others have measured considerable variability in cin for individual gvs in the same batch . For example, mean cin was found to be much less than cout for dextran polymers with hydrodynamic radius, rh> 10 nm. (14) solute size is also an important determinant of entrapment in submicrometer vesicles . For example, adrian and huang compared the encapsulation of proteins of increasing molecular weight to that of a small marker protein (lysozyme, 14.1 kda) in ca . The 97 kda -amylase was encapsulated only 50% as well as the lysozyme. (7) the same authors reported that proteins up to 120 kda could be encapsulated in ca . 200 nm diameter vesicles with the same trapping efficiency as sucrose. (7) bee is often quite low for passive uptake because it is defined in terms of the total encapsulated volume (capture volume, cv), which can be <1% of the total volume, depending on the amount of lipid present and the morphology of the vesicles . Although cv can be increased up to ca . 50% by using more concentrated lipid,(20) this is not always possible for a given system . Indeed, most papers report bees much less than 50% . To increase bee beyond what is possible by passive encapsulation, for example, cationic lipids are routinely used to package nucleic acid drugs, despite concerns about their toxicity . Solute encapsulation based on electrostatic attractions can be essentially complete, with nearly 100% of all solute molecules added to the solution being associated with liposomes . Despite excellent loading, attractive interactions with encapsulating lipids can lead to more complex liposome morphologies, prevent activity of the encapsulated solute until released, and inhibit effective release of solutes upon vesicle rupture . While these factors are often considered acceptable in drug delivery applications, it is preferable to have free encapsulated solute of known concentration for biophysical studies, e.g., to evaluate the effects of confinement. (30) encapsulation of rh> 10 nm fluorescently labeled dextran polymers in gv has been reported to improve markedly in the presence of several weight percent additional polymeric solutes. (15) the additional polymers acted as volume excluders, resulting in condensation of the labeled solutes and allowing them to be more easily encapsulated during vesicle formation. (15) macromolecular crowding is an attractive means for improving macromolecule encapsulation because of its generality. (31) this approach for improving encapsulation has not previously been tested for biomacromolecules such as proteins, which in many cases already exist in globular conformations and hence may not undergo as large a rh change in response to volume excluders, nor has it been tested for encapsulation in submicrometer vesicles . Herein, we report the use of peg as a macromolecular crowding agent to increase the encapsulation efficiency of fluorescently labeled biomacromolecules within gvs and 200 nm diameter luvs . We find in general that the addition of peg increases the encapsulation efficiency of high molecular weight (mw) biomolecules compared to those encapsulated in di water alone . We conclude that volume exclusion in the presence of a crowding agent such as peg or dextran can be used as a general route to increase encapsulation efficiency of biomacromolecules in both giant and submicrometer lipid vesicles, up to levels expected for passive encapsulation of lower mw solutes (i.e., cin = cout). Volume exclusion induced condensation is expected to have the greatest impact on large, extended molecular conformations . Therefore, the macromolecules used in this work were chosen to give a range of molecular sizes and shapes . We first describe the effect of polymeric volume excluders on encapsulation in gvs formed by gentle hydration and then discuss encapsulation in luvs prepared by a freezethaw / extrusion protocol . We began by encapsulating fibrinogen, a 340 kda protein with a hydrodynamic radius (rh) of 11 nm, which is important in coagulation and thrombosis and is often administered to patients who have suffered severe blood loss or have lost the ability to clot blood on their own . Fibrinogen has been reported to condense to approximately one - half of its original length during polymerization . Fibrinogen labeled with alexa fluor 488 (af488) was added during gv formation at a concentration of 33 nm, either in di water or in a 3 wt% peg 8 kda solution . Gvs were imaged without removing them from the hydration solution, such that the external fibrinogen concentration remained 33 nm . Figure 1 shows representative confocal fluorescence images and histograms of encapsulation efficiency for individual gvs formed in the presence of fibrinogen alone and coencapsulated with 3 wt% peg . Here, encapsulation efficiency for the individual vesicles (eeind) is defined as the concentration ratio between the vesicle interior (ci) and the external solution (co) used during vesicle formation . The concentration ratio (ci / co) for each vesicle a vertical line is included at ci / co = 1 to facilitate comparison to the external fibrinogen - af488 concentration . In the absence of added peg, encapsulation efficiency is quite poor; the gv interiors appear dark, and fibrinogen - af488 concentration varied considerably from vesicle to vesicle, ranging from 1 to 54 nm (0.041.64 co) with a mean of 21 nm (0.64 co). In contrast, vesicles formed in the presence of 3 wt% peg contained fibrinogen - af488 concentrations similar to that of the external solution, with 65% of the gvs encapsulating internal concentrations between 28 and 38 nm and a mean of 34 nm . (left) confocal fluorescence images of vesicles prepared in the presence of af488-labeled fibrinogen without (top) and with (bottom) 3 wt% peg 8 kda . Membrane composition was 3:7 egg pc: dopg with 0.05 mol% dope - rhodamine . (right) histograms of the concentration ratio (cin / cout) for encapsulation of labeled fibrinogen in individual gvs without (top) and with (bottom) 3 wt% peg 8 kda (co = 33 nm). We repeated this experiment with two other proteins having relatively large rh to test the generality of the method of increasing eeind via macromolecular crowding . Thyroglobulin is a 660 kda protein with a pi of 4.6 that is important in the synthesis, storage, and secretion of thyroid hormones . The native structure has two slightly elongated subunits, with an rh of 10 nm. (39) in vivo, thyroglobulin structure is known to condense in order to increase the storage capacity of the thyroid. (40) encapsulation of thyroglobulin - af488 (18 nm) in gvs in the absence and presence of 3 wt% peg 8 kda produced results similar to those for fibrinogen - af488 (supporting information figure 1), which had similar rh and ability to compact . We then repeated the experiment with catalase - af488, a 250 kda enzyme with a pi of 5.4 and an rh of 10.4 nm . This protein catalyzes the decomposition of hydrogen peroxide to water and oxygen,(43) and has been encapsulated in submicrometer liposomes along with superoxide dismutase and injected to protect against oxygen toxicity in rats. (44) images and a histogram for cin are shown in supporting information figure 2 . Eeind for was significantly increased vs control by addition of peg 8 kda during encapsulation of all three of these relatively large proteins (student s t test, p <0.001). These results are consistent with the role of peg 8 kda as a volume excluder, driving the condensation of macromolecular structures . Proteins, nucleic acids, and enzymes are all known to adopt condensed structures in macromolecularly crowded solutions . Thus, we interpret the improved encapsulation of these high molecular weight proteins in 3 wt% peg 8 kda as the result of their condensation to give reduced hydrodynamic radii, which in turn caused them to be encapsulated as effectively as lower mw biomolecules . We next evaluated the effect of peg 8 kda on encapsulation of two smaller proteins and a dna oligomer, all of which had hydrodynamic radii less than 10 nm . -1-antitrypsin (aat) is a 52 kda protein with an rh of 3.8 nm and a pi between 4.9 and 5.1 . It is responsible for inhibiting elastase in vivo, which destroys elastin on connective tissues. (57) aat deficiency often leads to lung diseases, and clinical trials have been reported where patients are given aat infusions, which showed beneficial effects. (58) it has also been delivered to mice via encapsulation in submicrometer liposomes. (59) we began by encapsulating 1.9 m aat - af488 in gvs formed in with the presence and absence of 3 wt% peg 8 kda . Aat - af488 was encapsulated at essentially cin = cout with or without 3% peg (figure 2). (left) confocal fluorescence images of vesicles prepared in the presence of 1.9 m labeled -1-antitrypsin without (top) and with (bottom) 3 wt% peg 8 kda . Membrane composition was 3:7 egg pc: dopg with 0.05 mol% dope - rhodamine . (right) histograms of the concentration ratio (cin / cout) for encapsulation of labeled -1-antitrypsin in individual gvs without (top) and with (bottom) 3 wt% peg 8 kda (co = 1.9 m). Similar results were observed for encapsulation of labeled human serum albumin (hsa) in peg solution as compared to di water (supporting information figure 3). Hsa has similar characteristics as aat (i.e., hsa has a mw of 67 kda, pi of 4.95.1, and rh of 3.51). We also studied the encapsulation of a single - stranded 173 base pair oligomer (53 kda) labeled with fluorescein (fam). Nucleic acids are often encapsulated in submicrometer vesicles for gene delivery and in gvs to study biochemical reactions . Dna is known to undergo condensation in the presence of divalent cations, polycations, or even neutral polymers such as peg . This oligonucleotide was sufficiently small to be effectively encapsulated in the gv even without addition of a crowding agent (supporting information figure 4). Table 1 compares encapsulation for each of the biomacromolecular solutes with and without added peg . In addition to the increase in cin for the larger proteins when encapsulated in the presence of 3 wt% peg, decreased heterogeneity in cin across a population of vesicles in a batch is suggested by the standard deviations in cin (table 1) and the histograms for individual solutes (figures 1 and 2 and supporting information figures 14). An f - test(61) was performed to evaluate whether differences in the variance between the control and + peg populations were statistically significant . We found statistically significant changes in variance for the fibrinogen (p <0.001), catalase (p <0.001), and aat (p <0.05), but not for the other solutes . The increase in encapsulation homogeneity when fibrinogen and catalase were coencapsulated with a crowding agent arises largely from the shift to higher encapsulated concentrations . Decreased variance for aat may also be due in part to condensation, which has been reported for aat and other small polymers, but is more likely due to peg increasing the viscosity and osmotic pressure of the solutions, as has been discussed previously . For example, increased viscosity could improve encapsulation heterogeneity by facilitating pore formation in the membrane, allowing more time for solutes to equilibrate between internal and external solutions. (65) we note that the proteins were not found to be associated with the lipid membrane of the gvs, but rather to be uniformly dispersed in the exterior and/or interior of the vesicles (see, for example, figures 1 and 2, left panels). Polymerization or aggregation on microscopically visible length scales preparation of the vesicles in 3% peg did not inhibit their formation or change their size or morphology in any obvious way as compared to preparation in peg - free solution, consistent with our previous findings of decreased average vesicle diameter at 10 and 20 wt% peg but no noticeable difference between 0 and 3 wt% peg in terms of gv formation, size, or morphology. (15) the improvements in eeind observed in the presence of peg should be applicable to other crowding agents. (15) we therefore coencapsulated fluorescently labeled fibrinogen and 1-antitrypsin with 3 wt% dextran 500 kda for comparison . The 3 wt% dextran 500 kda had the same effect on encapsulation as peg 8 kda: the higher mw protein, fibrinogen, showed an increase in eeind magnitude and homogeneity with the introduction of either peg or dextran; and the lower mw protein, aat, showed essentially no change in mean eeind, but a decreased variance (f - test, p <0.05) when dextran was added (table 1). Theoretical eeind defined as the solute concentration in the external solution during vesicle preparation, which is given in parentheses for each solute in the first column . Fluorescein labeled; hydrodynamic radius of 7.5 nm for 280 nt ssdna was reported in ref (66) under conditions where excluded volume effects can be neglected; extrapolation of length vs rh data in ref (66) suggests 5 nm hydrodynamic radius for our 173 nt sequence . Internal solute concentrations in sv cannot be determined via simple confocal imaging as for the gv described above . Therefore, we estimated cin and the effectiveness of solute encapsulation by comparing the percentage of total solute that has been encapsulated within a batch of vesicles (bulk encapsulation efficiency, bee) to the capture volume . Capture volume was estimated based on the moles of lipid present and the size of the vesicles, assuming unilamellarity . Bee was determined by removing the unencapsulated solute from a batch of vesicles, then lysing the vesicles and quantifying the remaining (encapsulated) solute . For effective passive encapsulation, one can expect to achieve the same concentration inside the vesicles as is present outside (cin = cout). However, for high mw solutes, bee is often less than the capture volume (i.e., interior concentrations <exterior concentrations). Table 2 shows the average bee for three encapsulated solutes (carboxyfluorescein (cf), 500 kda dextran - fitc, and thyroglobulin - af488) with and without added peg in 200 nm diameter vesicles . The theoretical bee for passive encapsulation in this system is 0.38%, calculated by estimating the number of vesicles formed based on the amount of lipid added to the system (500 m) and then calculating the volume encapsulated by those vesicles as compared to the initial volume . We estimated that there were 3.4 10 lipid molecules per 200 nm diameter vesicle, for 4.5 10 vesicles that collectively encapsulated 19 l, or 0.38% of the total solution volume (5 ml), based on calculations for similar systems . Dynamic light scattering verified that vesicle diameter remained constant whether in dilute or crowded solution, and the addition of a fluorescent lipid in the membrane verified that a negligible amount of lipid was lost to the filter during extrusion . Errors represent the standard deviation of bee measurements taken for three separate batches of vesicles on three different days . Encapsulation of the small fluorescent molecule, carboxyfluorescein (cf), was performed as a control . It was expected that the effect of the coencapsulation of peg would be negligible, since the addition of peg did not significantly impact the encapsulation efficiency of cf in gvs. (15) the change in experimental cf bee observed between the solutions with and without peg was not statistically significant based on a student s t test (p = 0.63) (table 2). Encapsulation of fitc - dextran 500 kda and thyroglobulin - af488 did show improvement for luvs prepared in solutions containing peg 8 kda as compared to solutions without peg (student s t test, p <0.05). Experimentally determined bee for fitc - dextran 500 kda and thyroglobulin - af488 in water were 31% and 50% of the theoretically predicted value, respectively these low bees are most likely due to the large size of dextran 500 kda (rh 15 nm) and thyroglobulin (rh 10 nm). Addition of 3 wt% peg 8 kda significantly increased the bee of fitc - dextran and thyroglobulin - af488 in these vesicles, consistent with condensation of the dextran and thyroglobulin structures via macromolecular crowding. (15) although the error is large, it appears that with peg 3%, the luvs are essentially encapsulating even these very large solutes at cin = cout . Bee was increased without chemically modifying the vesicle or solute to utilize specific attractive interactions . In contrast to the gv encapsulation data, improvements in standard deviation were not observed in the luv experiments . This underscores the difference in the two measurements: the error in gv cin measurements indicates vesicle - to - vesicle variability within a batch, while variability in luv bee experiments reports on differences between entire batches prepared separately and as such may reflect variability in capture volume . We interpret this as the result of some cf loss from the vesicle interior during centrifugation and/or other handling, which is commonly reported in submicrometer vesicles. (69) these data are exciting, because while the majority of reports published on bee utilize specific interactions between liposome / solute, this method is quite general and should apply to a variety of solutes that can be condensed under conditions of macromolecular crowding . Although the absolute bee in these experiments was low, we have demonstrated that addition of 3 wt% peg provides a means of improving encapsulation for large solutes such that cin = cout for luvs prepared by freezethaw / extrusion . Increasing the amount of lipid used in a batch has been shown by others to increase cv from <1% to as high as 50%; which would lead to an increase in bee, as previously reported. (20) our results indicate that the addition of the polymeric coencapsulants peg 8 kda and dextran 500 kda as macromolecular crowding agents during passive encapsulation of biomacromolecular solutes can substantially increase mean encapsulated concentration and in some cases homogeneity for otherwise poorly encapsulated high mw proteins in giant vesicles . The addition of a crowding agent also reduced vesicle - to - vesicle encapsulation variability for the lower mw aat, which was already encapsulated efficiently (i.e., with cin = cout) in dilute solution . The mechanism for increased encapsulation is general, such that crowding agents need not be varied with the identity of the solute . This work is important to those using gvs as bioreactors, where knowledge of encapsulated concentration is critical to quantifying the progression of products formed during a reaction . Measurements of bulk encapsulation efficiency (bee) in luvs in the presence of peg suggest that this approach works similarly in these smaller vesicles as for gvs, bringing the internal solute concentration closer to the external concentration such that the bee is determined by capture volume . The approach used here should be effective for a wide range of membrane / macromolecular solute combinations . L--phosphatidylcholine (egg pc), 1,2-dioleoyl - sn - glycero-3-[phospho - rac-(1-glycerol)](sodium salt) (dopg), 1,2-dipalmitoyl - sn - glycero-3-phosphocholine (dppc), cholesterol, and 1,2-dioleolyl - sn - glycero-3(phosphoethanolamine - n - lissamine rhodamine b sulfonyl) (ammonium salt) (rhodamine - dope) were purchased from avanti polar lipids, inc . Carboxyfluorescein, fluorescein isothiocyanate (fitc)-labeled and unlabeled dextrans and poly(ethylene glycol) (peg) were obtained from sigma . Alexa fluor 488 and fitc labeling kits along with fibrinogen - alexa fluor 488 were purchased from molecular probes, inc . A fluorescein nucleic acid labeling kit was purchased from mirus bio (madison, wi). A 173 nucleotide single - stranded oligomer with the sequence for influenza b was purchased from integrated dna technologies, inc . Water used in these experiments was deionized to a resistance of 18 m with a nanopure diamond water system from barnstead int . Silanized borosilicate glass culture tubes, 12 75 mm, were used to prevent biomolecules from sticking to the glass surface during formation (kimble chase, vineland, nj). We first prepared a chloroform solution of lipids containing a 3:7 molar ratio of egg pc: dopg at a concentration of 0.26 mg / ml with 0.05 mol% rhodamine - dope . Lipid solutions were dried under ar (g) to form a thin, uniform lipid film, and then, the vials were vacuum - desiccated for 2 h to remove any residual organic solvent . Then, an aqueous solution containing a fluorescent biomolecule with or without 3 wt% unlabeled peg or dextran heated to 37 c was added along the wall of the tube, and the lipids were hydrated 48 h at this temperature . We chose 3 wt% peg 8 kda based on prior work with dextran 500 kda condensation, in which we observed increased encapsulation efficiency in gvs up to 10 wt% peg, with the bulk of the increase achieved by 3% and decreased average gv diameter for 10 wt% peg. (15) following incubation, the solutions were allowed to cool to room temperature . The contents of the vials, which remained undiluted, were removed with a micropipet and transferred to a microscope slide silanized with n-(triethoxysilylpropyl)-o - polyethylene oxide urethane (gelest, inc ., morrisville, pa) for analysis . Coverslips were also coated with n-(triethoxysilylpropyl)-o - polyethylene oxide urethane to prevent the adhesion of fluorescently labeled biomolecules to the glass surface . The concentrations of crowding agents are referred to in wt%, since this is the common notation used for crowding agents in the macromolecular crowding literature; the 3% peg 8 kda used here corresponds to 3.75 mm . Concentrations for fluorescently labeled solutes, which are considerably lower than for the crowding agents, are given as molarities . A fluorescence line scan was taken across each vesicle to determine the fluorescence intensity of the alexa fluor 488, fitc, or fluorescein inside the vesicle (ii) and in the undiluted bulk solution (io, outside the vesicle), as reported previously . The concentration of biomolecule inside (ci) and outside (co) the gv was determined directly from the intensities (ii, io) by a calibration curve of the labeled biomolecule free in solution . From the calibration curves, it was determined that the bulk concentration (co) was equal to the initial concentration used to hydrate the vesicles . Imaging was performed using an lsm-5 pascal laser scanning confocal microscope from carl zeiss, inc . (oberkochen, germany) with a plan - apochromat 63 oil immersion objective (1.4 na), and pascal software as previously reported . Only vesicles that were greater than 3 m in diameter and appeared to be uni- or oligolamellar were analyzed . Dppc / cholesterol vesicles (80:20 mol ratio) were prepared using a modified technique provided by the distributor to yield large unilamellar vesicles by extrusion (luvet) as previously reported . Briefly, dppc and cholesterol were combined with chloroform in a round - bottom flask and evaporated for 4 h. following this, 5 ml of the solute to be encapsulated was added in either water or 3 wt% peg 8 kda to yield a final lipid concentration of 0.34 mg / ml . The lipid mixture was allowed to incubate in this solution at room temperature for 30 min . Then, the flask was subjected to five freeze / thaw cycles to promote entrapment of water - soluble compounds into the vesicles. (71) the mixture was then extruded through a 0.2 m polycarbonate membrane for a total of 20 passes (mini extruder kit, avanti polar lipids, inc ., excess solute was removed from the vesicle suspension by washing with a 10 000 mw dialysis cassette in di water for 48 h (slide - a - lyzer, thermo scientific, rockford, il) and then centrifuging at 16 100 g, removing the supernatant, and replacing it with a solution free of fluorescent molecules . Vesicle diameter was confirmed using dynamic light scattering (zetasizer nano s, malvern instruments, worcestershire, u.k . ). After centrifugation, the vesicles were lysed in 0.5% triton - x 100, and the encapsulated concentration was determined via fluorescence measurements on a jobin yvon horiba fl3 - 21 fluorimeter.
We collected all possible literature from the year 1972 (when kfd was first described) to the present day conducting a medical search on kikuchi fujimoto disease (kfd) in english language . We included publications in authorized medical journals including original and review articles / theses, editorials, case reports and brief communications . Kfd is an extremely uncommon disease but cosmopolitan with higher japanese and asiatic prevalence.1,2 however, sporadic cases have also been reported from europe . In asian woman kikuchi s disease is rare and benign cause of cervical lymphadenopathy.3 the disease, most often, happens to occur in young adults below 40 and seldom in children.4 at first, little female predominance was considered, but the recent literature regards it as male to female ratio 1:1.1,5 a current study on the patients with kfd conducted in taiwan reports the average age of 21.5 cardiac, hepatic and pulmonary involvement raises the morbidity . However, role of viruses (epstein - barr virus and others) in the pathogenesis of kikuchi s disease is controversial and unremarked.1 on the other hand, unger and coworkers are in favor of viral etiology as kfd manifests certain viral features ie, atypical lymphocytosis, certain histologic features, flulike respiratory prodrome and no response to antibiotic therapy.7 also, kikuchi s disease has been reported in patients with aids.8 like systemic lupus erythematosus (sle), lymphocytes and histiocytes in the patients with kikuchi s disease show tubular reticular structures in their cytoplasm on electron microscopy.9 it has been opinioned that in genetically susceptible individuals, kfd may belong to exuberant t - cell mediated immune response provoked by variety of stimuli.1 even though course of cell death in kfd needs to be studied and emphasized, ohshima and his associates remarked apoptotic cell death might be involved in the pathogenesis of kfd.10 regarding to this study, proliferating cd8 t - cells may kill or be killed in the apoptotic process of this disease using fas and perforine pathways . Kikuchi s disease begins as an acute or sub - acute condition, developing over two to three week period . Tender cervical lymphadenopathy is the characteristic feature (56%98%) of kfd, predominantly involving the posterior cervical triangle . Size of the enlarged lymph nodes ranges from 0.5 cm to 4 cm (occasionally 6 cm). 59% patients represent painful lymphadenopathy and 1%22% patients undergo generalized lymphadenopathy.4,7,9,11 kfd, more or less, rarely involves mediastinal, peritoneal or retroperitoneal regions of the body.2 fever (30%50%) associated with upper respiratory symptoms, sore throat, night sweats, weight loss, headache, rash, nausea, vomiting, and leukopenia (about 50%) are the other manifestations of the disease . 12,13 atypical lymphocytes have been reported in the peripheral blood film of patients with kfd . Extranodal involvement is rare; however, skin, eye and bone marrow affection has been reported.1 nevertheless, kfd is linked to sle and autoimmune conditions as lymphocytes and histiocytes in the patients with kikuchi s disease show tubular reticular structures in their cytoplasm on electron microscopy.1,14 additionally, extranodal involvement in kfd is associated with frequent systemic symptoms . Anecdotal reports bring to light the unusual features of kfd like haemophagocytic syndrome and carcinoma15 along with fatal multicentric disease . Nervous system involvement (septic meningitis, acute cerebellar ataxia, and encephalitis) rarely happens to occur.16 regarding joint involvement, a case of 14 year old boy with kfd is in the record.17 in patients with kikuchi fujimoto disease, an excisional biopsy of the involved lymph nodes is the investigation of choice . Coagulative necrosis with ample karyorrhetic debris in paracortical areas of the involved lymph nodes is the characteristic histologic feature of kfd . Other baseline investigations are reported unaffected . Nevertheless, laboratory results of some kfd cases have reported anemia, little rise in esr and even leukopenia . One third individuals with kfd have shown atypical lymphocytes in their peripheral blood films.5 predominantly, t - cells (cd8 + t - cells) are found in kfd . However, neutrophils are found absent and scarce plasma cells may or may not be present . According to kuo, histopathologic features can be classified in three stages: proliferative, necrotizing, and xanthomatous.18 proliferative stage expresses various histiocytes, plasmacytoid monocytes and lymphoid cells containing karyorrhetic nuclear fragments, and eosinophilic apoptotic debris . Necrotizing stage shows a degree of coagulative necrosis while xanthomatous stage is predominantly stuffed with foamy histiocytes . It must be born in mind that in the individuals with kfd, atypical reactive immunoblastic component is common and can be mistaken for lymphoma.4 histiocyte - associated antigens (lysozyme, myeloperoxidase and cd68) are also expressed by histiocytes in kfd . Kfd is an extremely rare disease and the differential diagnosis can be established on the basis of enlarged lymph nodes which are associated with many other disorders . It is necessary to born in mind the differential diagnosis of kfd as its treatment dramatically differs from other disorders . Lymphoma (non - hodgkin s lymphoma), tuberculosis, sle, plasmacytoid t - cell leukemia, kawasaki s disease, and myeloid tumor are included in the differential diagnosis of kfd.1 sometimes, because of similar clinical and histological features, it becomes problematic to differentiate kikuchi fujimoto disease from lymphadenitis associated with systemic lupus erythematosus (sle). However, it has been reported that kfd is associated with sle . In order to exclude sle, all the necessary investigations of sle (c3, c4, anf, anti - sm, and le cells) are required . Early recognition of kikuchi fujimoto disease is of prime importance to save the patient from undergoing extensive investigations related to malignant lymphoma and other related disorders.8 histopathologic features like presence of abundant reactive histiocytes and absence of reed - sternberg cells favor kfd . Sometimes, kfd may express histiocytes resembling with signet - ring cells and can be confused with signet - ring carcinoma . However, metastaic adenocarcinoma contains cells with atypical nuclei and mucin debris instead of cellular debris . Kikuchi fujimoto disease (histiocytic necrotizing lymhadenitis) is a self - limiting condition that resolves spontaneously within 1 to 4 months of period . However, studies reveal recurrence of the disease in 3%4% of the patients.9 additionally, sle may happen to occur some years later . No hereditary risk has been documented in kfd.8 most of the time symptomatic relief is offered for the local and systemic complains of the disease . Lymph node tenderness and fever is treated with analgesics, antipyretics, and nsaids . Sometimes, but rarely, steroids can be used temporarily, especially in severe extranodal involvement or generalized clinical course.19 in order to run an excisional biopsy of the enlarged lymph nodes, surgical consultation may be prerequisite . Individuals with kikuchi fujimoto disease should be examined systemically and they must be under regular follow - up in order to monitor the manifestations of sle . The course of cervical lymphadenopathy is benign and resolves spontaneously . Very few cases have been reported as fatal . However, no standard or specific treatment of kfd has been recommended . Kikuchi fujimoto disease is an idiopathic, extremely rare, more or less worldwide, and often under - diagnosed condition; predominantly involving the posterior cervical lymph nodes . Early recognition of kikuchi s disease is of prime importance to avoid extensive and expensive investigations related to malignant lymphoma other related disorders . In order to avoid misdiagnosis, awareness of this disease
Does it have any bearing on outcome in the icu or during the post - icu period? Although not evidence based in any prospective, controlled, randomized clinical trials, it is unlikely that anyone would dispute that under - feeding eventually leads to death . This parallels the lack of controlled studies on the use of parachutes when jumping out of aeroplanes at high altitude . Nevertheless, a short period of starvation appears to be a part of clinical treatment in many icus . This is highlighted by a report from colleagues in the netherlands presented in this issue of critical care . Intensive care medicine is a comparatively young speciality, and within our arsenal of treatments the amount of evidence - based knowledge is often embarrassingly low . An illustration of this is seen in the guidelines for the surviving sepsis campaign, in which the evidence for different treatment modalities was evaluated in a formalized way . When we come to icu nutrition, there is little evidence at hand in terms of prospective, randomized, controlled clinical trials; this was highlighted in recently published canadian guidelines . . Some authors even call it' poisonous nutrition' and ban it from use in the icu . Most investigators and authorities in the field would advocate enteral nutrition before parenteral, merely on the grounds that it is the natural way to feed and is cheaper . The evidence in favour of enteral over parenteral nutrition, or the other way around, is weak; furthermore, it is obsolete because it was generated more than 10 years ago, with obscure indications for parenteral nutrition and with no blood sugar control . In studies comparing enteral and parenteral nutrition in patients whose attending physician is unsure regarding which modality will be optimal, the results demonstrate a very low feeding success rate with enteral nutrition and that complications are related to the duration of nutritional treatment, regardless of the mode of administration . In general terms it has repeatedly been shown that when patients are given only enteral nutrition, the success of feeding is below 70% . Successful feeding may be defined in terms of the percentage of prescribed calories, number of days with at least 80% of prescribed calories delivered, or any other measure . The study from the netherlands presented in this issue adds further evidence to a number of publications that demonstrate that clinical practice is equivalent to delivering as little as 50% of the prescribed kilocalories . Does this make any difference? Probably, a very large study population would be required to demonstrate that patients do worse when they are administered only 50% of the prescribed dose of antibiotics . The safety margin for bacterial kill when administrating antibiotics is such that reducing doses to half would require 500010,000 patients to show a difference in a prospective study . Still no - one would advocate such a regimen . However, the side effects of antibiotics create renal insufficiency, liver insufficiency and drug fever, and predispose to development of multi - resistant bacteria . Nevertheless, no - one would deliberately give only 50% of the prescribed dose, stating that it does not matter whether 50% or 100% of the dose is administered . When it comes to nutrition, however, many of us do this . In the study presented in this issue, the post hoc analysis shows that any action that reflects an interest in nutrition, such as placing the tube in any other position than the stomach, using some type of enhanced formula, or having a percutaneous feeding device, increases success rates with nutrition . These specially treated patient groups were small, and findings in these groups should perhaps not be used as a basis for clinical recommendations, but it is clear that an enhanced interest in nutrition and delivery of nutrition will increase success rates . So, the main reason for the systematic under - feeding that is practiced in icus is probably a lack of interest by the attending physician . Binnekade and coworkers do not give any information on success rates of feeding in relation to outcome . This is a difficult area, and studies that try to link nutritional practice to outcome must be designed carefully . There are examples in the literature of investigators jumping to conclusions based on insufficient information . Nevertheless, in any patient in whom a huge energy deficit is built up, resulting in malnutrition, increased risk for complications can be predicted . In addition, evaluation of nutritional protocols in terms of success rate, nutrition related complications and outcome must be encouraged . Systematic under - feeding of icu patients may be used as a marker of suboptimal care . Wherever it is considered a human right not be hungry, the burden of producing proper evidence should be imposed on anyone who suggests that half the feed is good enough.
Recently, apparent expression of foxp3 in the majority of thymic epithelial cells was observed in experiments using flow cytometry while a subset of thymic cortical epithelial cells was found positive for foxp3 by immunofluorescence (16). Because epithelial cells are notorious for a high degree of nonspecific antibody binding in flow cytometric assays and are tightly associated with thymocytes in situ, potentially leading to false positive results in immunofluorescence assays, we sought to reexamine foxp3 expression in thymic epithelial cells and thymocytes by flow cytometric analysis of genetically marked foxp3-expressing cells using knock - in mice harboring a foxp3 reporter allele . Previously, through examination of thymic tissue sections using immunofluorescence, we found foxp3 protein predominantly expressed in the medullary region in the thymus with rare foxp3 cells in the cortex (15). The cortical expression of gfp was previously ascribed to expression by the few cd4cd8 double positive (dp) thymocytes that are gfp by flow cytometry (15). To determine if this expression was due instead to epithelial cell expression of the foxp3 allele, we performed flow cytometric analysis of purified cd45 thymic stroma from foxp3 mice and found no expression of gfp (fig . Consistent with our previous studies, no expression of foxp3 was observed in thymocytes isolated from rag2 foxp3 mice (not depicted). This finding allowed us to examine foxp3 expression in thymic stromal cells using immunofluorescence in the absence of contaminating foxp3-expressing thymocytes by examining gfp expression using anti - gfp antibody (not depicted) and polyclonal affinity - purified rabbit antibody specific for foxp3 (fig . We found no sign of foxp3 expression in rag - deficient stroma above background fluorescence observed for foxp3 mice, whereas foxp3 expression was readily detectable in control rag - sufficient mice (fig . These data demonstrate that the thymic epithelium did not express detectable levels of foxp3 protein within the sensitivity limit of these assays . No expression of foxp3 in the thymic epithelium . (a) expression of gfp in cd45 thymic stroma from wild - type (shaded) and foxp3 mice (line). (b) immunohistochemical analysis of foxp3 expression in the thymus of foxp3, foxp3rag2, and foxp3rag mice . Although the aforementioned studies failed to detect foxp3 protein in thymic epithelial cells, it can be argued that our detection of foxp3 protein is not sufficiently sensitive . Thus, the possibility remained that low level of foxp3 expression in thymic epithelial cells at a certain stage of t cell differentiation is required for prevention of autoimmunity . We addressed this possibility by ablation of a conditional foxp3 allele using cre recombinase expressed exclusively in thymic epithelial cells . Because the foxn1 gene is the highly specialized regulator of thymic epithelial cell differentiation and is not expressed in bm - derived cells, we bred foxp3 mice with mice harboring cre recombinase knocked into the 3 untranslated region of the foxn1 locus (foxn1; unpublished data). The resulting foxp3 foxn1 mice were examined for signs of lymphoproliferative autoimmune disease and compared with foxp3 cd4-cre mice . The interpretation of these experiments, however, was critically dependent on the specificity of cd4-cre and foxn1-mediated deletion . In this regard, it was proposed that the autoimmunity previously reported in foxp3 cd4-cre mice (15) is due to cd4-cre mediated deletion of the foxp3 allele in a subset of cd4-expressing thymic epithelial cells . To directly address this issue, we first examined cd4 expression on cd45 thymic stromal cells using flow cytometry and failed to find cd4 thymic epithelial cells (fig . 2 a). Next, we tested the cell type specificity of recombination mediated by cd4-cre and foxn1 using the rosa26-stop - yfp recombination reporter allele as a genetic fate - mapping tool . We found that cd4-cre induced recombination in the majority of thymocytes, but no recombination was detectable in the cd45 thymic stroma (fig . Foxn1-induced recombination occurred in the majority of cd45g8.8 thymic epithelial cells, but not cd45g8.8 stromal cells or thymocytes (fig . 2 b). A comparable extent of foxp3 deletion in purified cd45g8.8 thymic epithelial cells from foxp3 foxn1 was confirmed by genomic pcr (not depicted). When the cd45g8.8 population was subdivided according to the expression of uea-1 or mhc class ii, both subsets showed similar levels of cre - mediated recombination (not depicted). Foxn1 was therefore active in the vast majority of thymic epithelial cells, but not fibroblasts or thymocytes . Foxn1 mice remained as healthy as foxp3 foxn1 littermates and showed no signs of t cell activation (not depicted), tissue pathology, or wasting disease (fig . In contrast, foxp3 cd4-cre mice developed lethal autoimmune lesions indistinguishable from those in foxp3 mice in full agreement with our previously reported observations (15). Thus, foxp3 gene ablation in thymic epithelium does not result in autoimmunity . Disruption of foxp3 in the t cell lineage is necessary and sufficient to cause autoimmune syndrome . (a) no expression of cd4 in the cd45 thymic stroma . Left: expression of cd4 in wild - type cd45 thymic stroma . Thymic stromal cells were analyzed after incubation with anti - cd4 antibodies (solid line) or no antibody control (shaded). Right: expression of yfp in cd45 thymic stroma and cd45 thymocytes from wild - type (shaded) and rosa - stopyfp cd4-cre (solid line) mice . (b) expression of yfp from wild - type (shaded) and rosa - stopyfp foxn1 (line) mice in cd45g8.8 epithelium, cd45g8.8 stroma, and thymocytes . (c) analysis of gross clinical signs and lung and skin histopathology in foxp3 foxn1 (n = 7; no histological infiltrates at 4 or 9 wk of age, no visible disease at> 16 wk of age), foxp3 cd4-cre (n = 6; average life span 4 wk), foxp3 (n = 7; average life span 4 wk), and wild - type or foxp3 mice (n = 9; no histological infiltrates or visible disease at> 16 wk of age). Lung and ear skin were taken from 4-wk - old male foxp3, foxp3 cd4-cre, and foxp3 foxn1 mice . (d) disease onset in neonatal rag1 mice reconstituted with foxp3 scurfy nude bm (; n = 4) or foxp3 wild - type nude bm (; n = 4), and neonatal rag1 foxp3 scurfy mice reconstituted with foxp3 scurfy nude bm (; n = 5) or foxp3 wild - type nude bm (; n = 6). These results were further supported by our experiments using transfers of t cell depleted foxp3 and foxp3 bm, either separately or mixed at a 1:1 ratio into sublethally irradiated rag2 recipients . All recipients of foxp3 bm died by 67 wk of age from severe autoimmune disease, whereas recipients of foxp3 bm and mixed bm chimeras remained healthy (not depicted). Although donor bm was depleted of cd4 and cd8 t cells using magnetic bead sorting, it is impossible to formally exclude the possibility of a few pathogenic t cells remaining in the preparations of foxp3 bm . In addition, our experiments also differed from those previously reported by chang et al . In using mice harboring a foxp3 allele generated through targeted mutagenesis and spontaneous foxp3 mutation, respectively . To definitively exclude these possible explanations for the contradictory results from the two sets of bm transfer studies, we crossed the foxp3 allele to the foxn1-deficient nude mice, which are characterized by an early block in thymic epithelium differentiation and thus lack mature t cells . As previously reported, foxp3 nude mice were not affected by the autoimmunity (2). Thus, we were able to transfer bm isolated from these disease - free mice into rag1 recipients without the risk of contamination with mature pathogenic t cells . In these experiments, foxp3 nude bm reconstitution of neonatal rag1 mice and foxp3rag1 mice (serving as a positive control) resulted in identical lethal lymphoproliferative disease (fig . In contrast, control foxp3 nude bm transfers into either neonatal rag1 or foxp3rag1 did not result in disease (fig . The findings above demonstrate that genetic ablation of foxp3 in the thymic epithelium is neither necessary nor sufficient for the development of autoimmune disease . Lack of autoimmunity in foxp3 nude foxp3 rag1 bm chimeras and in foxp3 foxn1 mice did not exclude the previously proposed role for expression of foxp3 in the thymic epithelium in normal thymopoiesis (16). Major thymic aberrations reported for foxp3 mutant mice include a decrease in thymic cellularity and in the proportion of cd4cd8 dp thymocytes (16). To reexamine this possibility, we analyzed thymopoiesis in foxp3, foxp3 cd4-cre, and foxp3 foxn1 mice and found that both foxp3 and the foxp3 cd4-cre mice showed reduced total thymic cellularity and a decrease in the percentage of cd4cd8 dp thymocytes, whereas foxp3 foxn1 mice were identical to their wild - type littermates (fig . These results demonstrate that deletion of the foxp3 gene in thymic epithelial cells does not result in detectable changes in thymic t cell maturation, and that an apparent decrease in dp thymocyte subset size and in total thymocyte numbers is due to loss of foxp3 in thymocytes rather than in the thymic epithelium and is most likely secondary to the severe autoimmunity and cytokine storm common to the foxp3, foxp3, and foxp3 cd4-cre mice . Thymopoiesis was assessed by examining total thymus cellularity and by flow cytometric analysis of thymocyte subsets . (a) representative cd4 and cd8 thymocyte profiles for wild - type, foxp3-deficient, foxp3 cd4-cre, and foxp3 foxn1 mice . (b) percentages of thymocytes in cd4cd8 dn, cd4cd8 dp, cd4 single positive, and cd8 single positive subsets . (c) representative flow cytometric profiles of dn thymocyte subsets and (d) percentages of dn1, dn2, dn3, and dn4 subsets in wild - type, foxp3-deficient, foxp3 cd4-cre, and foxp3 foxn1 mice . In addition to the aforementioned changes in thymocyte subsets, an expansion of dn1 (cd44cd25) cells was reported for both foxp3 and foxp3 rag mice (16). To examine this phenomenon, we first analyzed the composition of dn thymocyte subsets in foxp3, foxp3 cd4-cre, and foxp3 foxn1 mice . The relative size of the dn1 - 4 thymocyte subsets was not altered in foxp3 foxn1 as compared with control mice; however, we found relative increases in the dn1 subset in foxp3 and foxp3 cd4-cre mice (fig . 3, c and d). To determine whether this is a cell - intrinsic defect in developing thymocytes, we analyzed dn thymocyte subsets in disease - free foxp3rag2 and control foxp3rag2 littermates . No differences in the relative sizes of dn1, dn2, and dn3 subsets were detected in these mice (fig . 4, a and b). To exclude the possibility that very few thymic epithelial cells escaping cre - mediated deletion in foxp3 foxn1 mice are capable of supporting normal thymocyte development, we generated an additional set of bm chimeras by transferring wild - type bm into foxp3rag2 and foxp3rag2 recipients . The maturation of wild - type thymocytes was not different in the two sets of chimeric mice (fig . Together with the absence of expression of foxp3 in dn thymocytes, these experiments show that the changes in dn thymocyte maturation observed in foxp3 mutant mice are secondary effects of massive peripheral t cell activation . Foxp3 deficiency does not affect early thymopoiesis in disease - free rag - deficient mice . (a) representative flow cytometric analysis of dn1, dn2, dn3, and dn4 thymocyte subsets and (b) their percentages in rag2 and foxp3-deficient rag2 mice . Collectively, our data demonstrates that the thymic epithelium does not express detectable amounts of foxp3 protein, and that there are no measurable adverse effects on immunological tolerance attributable to foxp3 deficiency in thymic stromal cells or in other radiation - resistant nonhematopoietic cells . This conclusion is strongly supported by the lack of autoimmune manifestations and changes in thymocyte maturation upon foxn1-cre mediated ablation of a conditional foxp3 allele in the thymic epithelium . In contrast, in control experiments, foxp3 ablation in the t cell lineage resulted in lethal autoimmune pathology typical of germline foxp3 mutation, as previously reported . In full agreement with these data are the results of the bm transfer experiments, which showed that foxp3 deficiency in hematopoietic cells is solely responsible for autoimmunity, and that perturbed thymocyte subsets in foxp3-deficient mice are an indirect consequence of pathology . Thus, in mice the only known role for foxp3 remains promotion of t reg cell differentiation within the t cell lineage . Recently, apparent expression of foxp3 in the majority of thymic epithelial cells was observed in experiments using flow cytometry while a subset of thymic cortical epithelial cells was found positive for foxp3 by immunofluorescence (16). Because epithelial cells are notorious for a high degree of nonspecific antibody binding in flow cytometric assays and are tightly associated with thymocytes in situ, potentially leading to false positive results in immunofluorescence assays, we sought to reexamine foxp3 expression in thymic epithelial cells and thymocytes by flow cytometric analysis of genetically marked foxp3-expressing cells using knock - in mice harboring a foxp3 reporter allele . Previously, through examination of thymic tissue sections using immunofluorescence, we found foxp3 protein predominantly expressed in the medullary region in the thymus with rare foxp3 cells in the cortex (15). The cortical expression of gfp was previously ascribed to expression by the few cd4cd8 double positive (dp) thymocytes that are gfp by flow cytometry (15). To determine if this expression was due instead to epithelial cell expression of the foxp3 allele, we performed flow cytometric analysis of purified cd45 thymic stroma from foxp3 mice and found no expression of gfp (fig . Consistent with our previous studies, no expression of foxp3 was observed in thymocytes isolated from rag2 foxp3 mice (not depicted). This finding allowed us to examine foxp3 expression in thymic stromal cells using immunofluorescence in the absence of contaminating foxp3-expressing thymocytes by examining gfp expression using anti - gfp antibody (not depicted) and polyclonal affinity - purified rabbit antibody specific for foxp3 (fig . We found no sign of foxp3 expression in rag - deficient stroma above background fluorescence observed for foxp3 mice, whereas foxp3 expression was readily detectable in control rag - sufficient mice (fig . These data demonstrate that the thymic epithelium did not express detectable levels of foxp3 protein within the sensitivity limit of these assays . No expression of foxp3 in the thymic epithelium . (a) expression of gfp in cd45 thymic stroma from wild - type (shaded) and foxp3 mice (line). (b) immunohistochemical analysis of foxp3 expression in the thymus of foxp3, foxp3rag2, and foxp3rag mice . Although the aforementioned studies failed to detect foxp3 protein in thymic epithelial cells, it can be argued that our detection of foxp3 protein is not sufficiently sensitive . Thus, the possibility remained that low level of foxp3 expression in thymic epithelial cells at a certain stage of t cell differentiation is required for prevention of autoimmunity . We addressed this possibility by ablation of a conditional foxp3 allele using cre recombinase expressed exclusively in thymic epithelial cells . Because the foxn1 gene is the highly specialized regulator of thymic epithelial cell differentiation and is not expressed in bm - derived cells, we bred foxp3 mice with mice harboring cre recombinase knocked into the 3 untranslated region of the foxn1 locus (foxn1; unpublished data). The resulting foxp3 foxn1 mice were examined for signs of lymphoproliferative autoimmune disease and compared with foxp3 cd4-cre mice . The interpretation of these experiments, however, was critically dependent on the specificity of cd4-cre and foxn1-mediated deletion . In this regard, it was proposed that the autoimmunity previously reported in foxp3 cd4-cre mice (15) is due to cd4-cre mediated deletion of the foxp3 allele in a subset of cd4-expressing thymic epithelial cells . To directly address this issue, we first examined cd4 expression on cd45 thymic stromal cells using flow cytometry and failed to find cd4 thymic epithelial cells (fig . 2 a). Next, we tested the cell type specificity of recombination mediated by cd4-cre and foxn1 using the rosa26-stop - yfp recombination reporter allele as a genetic fate - mapping tool . We found that cd4-cre induced recombination in the majority of thymocytes, but no recombination was detectable in the cd45 thymic stroma (fig . Foxn1-induced recombination occurred in the majority of cd45g8.8 thymic epithelial cells, but not cd45g8.8 stromal cells or thymocytes (fig . 2 b). A comparable extent of foxp3 deletion in purified cd45g8.8 thymic epithelial cells from foxp3 foxn1 when the cd45g8.8 population was subdivided according to the expression of uea-1 or mhc class ii, both subsets showed similar levels of cre - mediated recombination (not depicted). Foxn1 was therefore active in the vast majority of thymic epithelial cells, but not fibroblasts or thymocytes . Foxn1 mice remained as healthy as foxp3 foxn1 littermates and showed no signs of t cell activation (not depicted), tissue pathology, or wasting disease (fig . In contrast, foxp3 cd4-cre mice developed lethal autoimmune lesions indistinguishable from those in foxp3 mice in full agreement with our previously reported observations (15). Disruption of foxp3 in the t cell lineage is necessary and sufficient to cause autoimmune syndrome . (a) no expression of cd4 in the cd45 thymic stroma . Left: expression of cd4 in wild - type cd45 thymic stroma . Thymic stromal cells were analyzed after incubation with anti - cd4 antibodies (solid line) or no antibody control (shaded). Right: expression of yfp in cd45 thymic stroma and cd45 thymocytes from wild - type (shaded) and rosa - stopyfp cd4-cre (solid line) mice . (b) expression of yfp from wild - type (shaded) and rosa - stopyfp foxn1 (line) mice in cd45g8.8 epithelium, cd45g8.8 stroma, and thymocytes . (c) analysis of gross clinical signs and lung and skin histopathology in foxp3 foxn1 (n = 7; no histological infiltrates at 4 or 9 wk of age, no visible disease at> 16 wk of age), foxp3 cd4-cre (n = 6; average life span 4 wk), foxp3 (n = 7; average life span 4 wk), and wild - type or foxp3 mice (n = 9; no histological infiltrates or visible disease at> 16 wk of age). Lung and ear skin were taken from 4-wk - old male foxp3, foxp3 cd4-cre, and foxp3 foxn1 mice . (d) disease onset in neonatal rag1 mice reconstituted with foxp3 scurfy nude bm (; n = 4) or foxp3 wild - type nude bm (; n = 4), and neonatal rag1 foxp3 scurfy mice reconstituted with foxp3 scurfy nude bm (; n = 5) or foxp3 wild - type nude bm (; n = 6). These results were further supported by our experiments using transfers of t cell depleted foxp3 and foxp3 bm, either separately or mixed at a 1:1 ratio into sublethally irradiated rag2 recipients . All recipients of foxp3 bm died by 67 wk of age from severe autoimmune disease, whereas recipients of foxp3 bm and mixed bm chimeras remained healthy (not depicted). Although donor bm was depleted of cd4 and cd8 t cells using magnetic bead sorting, it is impossible to formally exclude the possibility of a few pathogenic t cells remaining in the preparations of foxp3 bm . In addition, our experiments also differed from those previously reported by chang et al . In using mice harboring a foxp3 allele generated through targeted mutagenesis and spontaneous foxp3 mutation, respectively . To definitively exclude these possible explanations for the contradictory results from the two sets of bm transfer studies, we crossed the foxp3 allele to the foxn1-deficient nude mice, which are characterized by an early block in thymic epithelium differentiation and thus lack mature t cells . As previously reported, foxp3 nude mice were not affected by the autoimmunity (2). Thus, we were able to transfer bm isolated from these disease - free mice into rag1 recipients without the risk of contamination with mature pathogenic t cells . In these experiments, foxp3 nude bm reconstitution of neonatal rag1 mice and foxp3rag1 mice (serving as a positive control) resulted in identical lethal lymphoproliferative disease (fig . In contrast, control foxp3 nude bm transfers into either neonatal rag1 or foxp3rag1 did not result in disease (fig . The findings above demonstrate that genetic ablation of foxp3 in the thymic epithelium is neither necessary nor sufficient for the development of autoimmune disease . Lack of autoimmunity in foxp3 nude foxp3 rag1 bm chimeras and in foxp3 foxn1 mice did not exclude the previously proposed role for expression of foxp3 in the thymic epithelium in normal thymopoiesis (16). Major thymic aberrations reported for foxp3 mutant mice include a decrease in thymic cellularity and in the proportion of cd4cd8 dp thymocytes (16). To reexamine this possibility, we analyzed thymopoiesis in foxp3, foxp3 cd4-cre, and foxp3 foxn1 mice and found that both foxp3 and the foxp3 cd4-cre mice showed reduced total thymic cellularity and a decrease in the percentage of cd4cd8 dp thymocytes, whereas foxp3 foxn1 mice were identical to their wild - type littermates (fig . These results demonstrate that deletion of the foxp3 gene in thymic epithelial cells does not result in detectable changes in thymic t cell maturation, and that an apparent decrease in dp thymocyte subset size and in total thymocyte numbers is due to loss of foxp3 in thymocytes rather than in the thymic epithelium and is most likely secondary to the severe autoimmunity and cytokine storm common to the foxp3, foxp3, and foxp3 cd4-cre mice . Thymopoiesis was assessed by examining total thymus cellularity and by flow cytometric analysis of thymocyte subsets . (a) representative cd4 and cd8 thymocyte profiles for wild - type, foxp3-deficient, foxp3 cd4-cre, and foxp3 foxn1 mice . (b) percentages of thymocytes in cd4cd8 dn, cd4cd8 dp, cd4 single positive, and cd8 single positive subsets . (c) representative flow cytometric profiles of dn thymocyte subsets and (d) percentages of dn1, dn2, dn3, and dn4 subsets in wild - type, foxp3-deficient, foxp3 cd4-cre, and foxp3 foxn1 mice . In addition to the aforementioned changes in thymocyte subsets, an expansion of dn1 (cd44cd25) cells was reported for both foxp3 and foxp3 rag mice (16). To examine this phenomenon, we first analyzed the composition of dn thymocyte subsets in foxp3, foxp3 cd4-cre, and foxp3 foxn1 mice . The relative size of the dn1 - 4 thymocyte subsets was not altered in foxp3 foxn1 as compared with control mice; however, we found relative increases in the dn1 subset in foxp3 and foxp3 cd4-cre mice (fig . 3, c and d). To determine whether this is a cell - intrinsic defect in developing thymocytes, we analyzed dn thymocyte subsets in disease - free foxp3rag2 and control foxp3rag2 littermates . No differences in the relative sizes of dn1, dn2, and dn3 subsets were detected in these mice (fig . 4, a and b). To exclude the possibility that very few thymic epithelial cells escaping cre - mediated deletion in foxp3 foxn1 mice are capable of supporting normal thymocyte development, we generated an additional set of bm chimeras by transferring wild - type bm into foxp3rag2 and foxp3rag2 recipients . The maturation of wild - type thymocytes was not different in the two sets of chimeric mice (fig . Together with the absence of expression of foxp3 in dn thymocytes, these experiments show that the changes in dn thymocyte maturation observed in foxp3 mutant mice are secondary effects of massive peripheral t cell activation . Foxp3 deficiency does not affect early thymopoiesis in disease - free rag - deficient mice . (a) representative flow cytometric analysis of dn1, dn2, dn3, and dn4 thymocyte subsets and (b) their percentages in rag2 and foxp3-deficient rag2 mice . Collectively, our data demonstrates that the thymic epithelium does not express detectable amounts of foxp3 protein, and that there are no measurable adverse effects on immunological tolerance attributable to foxp3 deficiency in thymic stromal cells or in other radiation - resistant nonhematopoietic cells . This conclusion is strongly supported by the lack of autoimmune manifestations and changes in thymocyte maturation upon foxn1-cre mediated ablation of a conditional foxp3 allele in the thymic epithelium . In contrast, in control experiments, foxp3 ablation in the t cell lineage resulted in lethal autoimmune pathology typical of germline foxp3 mutation, as previously reported . In full agreement with these data are the results of the bm transfer experiments, which showed that foxp3 deficiency in hematopoietic cells is solely responsible for autoimmunity, and that perturbed thymocyte subsets in foxp3-deficient mice are an indirect consequence of pathology . Thus, in mice the only known role for foxp3 remains promotion of t reg cell differentiation within the t cell lineage . Foxp3 (14), foxp3 (14), foxp3 (15), cd4-cre (18), foxn1 (unpublished data; cre was inserted along with an internal ribosome entry site into the 3 untranslated region of the foxn1 gene), rosa - stop - yfp (19), foxp3, nude, rag1, and rag2 mice have all been backcrossed to the b6 background . B6 foxp3 mice were backcrossed either to the b6 nude or b6 rag1 backgrounds two generations to produce foxp3 nude and foxp3 rag1 strains . Bm chimeras were constructed using 7 10 bm cells / recipient harvested from athymic nude male mice with or without the foxp3 mutation and injected i.p . Into neonatal (23 d) rag1 with or without the foxp3 . Experimental mice were age and sex matched and housed in specific pathogen - free conditions . Disease incidence was monitored by frequent visual observation, and postmortem histological analysis of the tissues was performed using hematoxylin and eosin staining (histology consultation services). All mice were used in accordance with guidelines from the institutional animal care committee of the university of washington . 510-wk - old mice were analyzed using the following antibodies: cd45-apc, i - a pe, cd4-pe - cy7, cd44-pe, cd8-percp, cd25-apc, cd8-fitc, cd4-percp, and uea-1 biotin, followed by sav - percp (all from bd biosciences) and g8.8 supernatant conjugated to alexa 647 . Thymic stroma preparations were enriched from three to six pooled thymi from 510-wk - old mice as described previously (20). After enzymatic enrichment, cd45 thymic stromal cells were purified using cd45 microbeads (miltenyi biotec) and the automacs system (miltenyi biotec) as per the manufacturer's recommendations before flow cytometric analysis (21). Thymic sections were prepared and stained as described previously (22) using rabbit polyclonal igg anti - foxp3 antibodies (14), followed by alexa 546conjugated goat anti s1 shows early thymopoiesis for wild - type bm - derived thymocytes developing in foxp3-sufficient and foxp3-deficient hosts assessed by cd44/cd25 flow cytometric profiles of cd4cd8 thymocytes 4 wk after bm transfer . Foxp3 (14), foxp3 (14), foxp3 (15), cd4-cre (18), foxn1 (unpublished data; cre was inserted along with an internal ribosome entry site into the 3 untranslated region of the foxn1 gene), rosa - stop - yfp (19), foxp3, nude, rag1, and rag2 mice have all been backcrossed to the b6 background . B6 foxp3 mice were backcrossed either to the b6 nude or b6 rag1 backgrounds two generations to produce foxp3 nude and foxp3 rag1 strains . Bm chimeras were constructed using 7 10 bm cells / recipient harvested from athymic nude male mice with or without the foxp3 mutation and injected i.p . Into neonatal (23 d) rag1 with or without the foxp3 . Experimental mice were age and sex matched and housed in specific pathogen - free conditions . Disease incidence was monitored by frequent visual observation, and postmortem histological analysis of the tissues was performed using hematoxylin and eosin staining (histology consultation services). All mice were used in accordance with guidelines from the institutional animal care committee of the university of washington . 510-wk - old mice were analyzed using the following antibodies: cd45-apc, i - a pe, cd4-pe - cy7, cd44-pe, cd8-percp, cd25-apc, cd8-fitc, cd4-percp, and uea-1 biotin, followed by sav - percp (all from bd biosciences) and g8.8 supernatant conjugated to alexa 647 . Thymic stroma preparations were enriched from three to six pooled thymi from 510-wk - old mice as described previously (20). After enzymatic enrichment, cd45 thymic stromal cells were purified using cd45 microbeads (miltenyi biotec) and the automacs system (miltenyi biotec) as per the manufacturer's recommendations before flow cytometric analysis (21). Thymic sections were prepared and stained as described previously (22) using rabbit polyclonal igg anti - foxp3 antibodies (14), followed by alexa 546conjugated goat anti s1 shows early thymopoiesis for wild - type bm - derived thymocytes developing in foxp3-sufficient and foxp3-deficient hosts assessed by cd44/cd25 flow cytometric profiles of cd4cd8 thymocytes 4 wk after bm transfer.
Human parvovirus (hpv) b19, being first discovered and introduced in 1975, is a non - enveloped single - stranded dna virus from the parvoviridae family . The virus is transmitted by respiratory droplets and the prevalence is estimated to be high since most of the individuals are infected by the age of 15 . The clinical syndrome associated with hpv b19 strongly depends on the host; for instance those suffering from hemolytic disorders, including sickle cell disease, hereditary spherocytosis (hs), autoimmune hemolysis, thalassemias, and paroxysmal nocturnal hemoglobinuria (pnh) are susceptible to aplastic crisis . The virus has a predilection for infecting the erythroid progenitor cells of the bone marrow resulting in their lysis and aplastic anemia . Thus, the bone marrow in these patients appears without erythroid precursors but with normal myeloid series . The hpv b19 induced aplastic crisis can unmask several hereditary hematological disorders that have been normally compensated . Among these conditions, when hpv b19 infects the bone marrow erythroid cells of these patients, decompensation occurs and thus the patient presents with signs and symptoms of abrupt onset severe anemia . Several similar sporadic cases have been reported by now, but familial hpv b19 induced aplastic crisis leading to the diagnosis of hs in all family members is a very rare condition being only reported three times in the literature . We herein, report hpv b19 induced aplastic crisis in an asymptomatic and undiagnosed family of three with hs demonstrating pancytopenia on peripheral blood . A 3.5-year - old girl, the youngest child of a 4-member family, was presented with severe pallor and high fever without localizing sign with 5 days duration . On physical examination, she had jaundice in the sclera and the spleen was palpable about 3 cm below the costal margin . The following day, her 14-year - old brother presented with high fever of unknown origin and severe pallor . On physical examination, he was febrile (39 c) and had a mild prominence of frontal and maxillary bones and jaundiced sclera . Physical examination revealed an enlarged spleen with the tip of spleen palpated about 3 cm below the costal margins . The hematological indices of the three patients admitted to our department with severe pallor and fever of unknown origin according to the family history and positive findings on physical examination (jaundice and splenomegaly), a work - up for hemolytic anemias, including hb electrophoresis, osmotic fragility, and autohemolysis test was performed for each patient . The results were consistent with the diagnosis of hs . Knowing hpv b19 as the most common causative agent in the development of aplastic crisis in hemolytic anemias; specifically hereditary spherocytosis polymerase chain reaction (pcr) for hpv b19, dna was performed which was positive in all three patients (figures 1 and 2). Bone marrow aspiration of the girl revealed normal marrow cellularity with mild erythroid hyperplasia and clusters of erythroid nests heralding the recovery of the erythroid series already affected by parvovirus b 19 infection . In contrary, cellularity was severely decreased in all three lineages in the boy implicating suppression of all hematopoietic lineages . Both siblings received intravenous immunoglobulin (ivig) in a dosage of 1 gr / kg along with blood transfusion, twice for each . The girl recovered after 3 days with reticulocytosis of 16%, while the boy recovered 8 days later with reticulocytosis of 8% . Their mother also had to receive blood transfusion because of having hb of 3.6 gr / dl . Pcr for parvovirus b19 . From left to right; the siblings, their positive and negative control, and the ladder . These family members were typical examples of the occurrence of aplastic crisis due to hpv b 19 complicating hs simultaneously in a family . Only three previous reports have shown that hpv b19 can induce aplastic crisis and unmask the hs in a family . Previously, green et al . In 1984 reported an adult sibling pair with hs who developed aplastic crisis after a febrile illness, which was further diagnosed to be hpv b19 infection . The diagnosis of hpv b19 was developed based on specific igm antibody in their sera, as pcr was not available . They also found that the children of one of the patients also developed hpv b19 induced aplastic crisis, which was resolved with supportive care . These two adult patients were treated by blood transfusion and supportive care and were discharged after 6 - 8 days of hospital care . In a similar report, mclellan and rutter in 1987 reported hpv b19 induced aplastic crisis in two teenage sisters leading to the diagnosis of hs . They also had a history of splenectomy in their mother at the age of 11 years . They both were diagnosed to have hpv b19 and underwent splenectomy and supportive care until recovery . In 1962, chanarin et al . Reported aplastic crisis in 3 members of a family (2 sisters and the father). The 10-year - old girl presented with 7 days history of fever of unknown origin, jaundice, and dark urine . The same illness was reported in 2-year - old sister and 32-year - old father who both had hs . The 10-year - old girl was treated with repeated transfusions, splenectomy, and supportive care for 92 days . Based on laboratory investigations, the authors first assumed that the megaloblastic hematopoiesis accompanied by urinary excretion of large amounts of urocanic acid following oral dose of histidine hydrochloride was responsible for aplastic crisis in these patients with hs . However, the authors reached the conclusion that hpv b19 was responsible for the aplastic crisis in this family with hs . As hpv b19 was first discovered in 1975 and this family was reported in 1962, thus the etiology was misdiagnosed . In the present study, we described a family with hs that all three members developed aplastic crisis secondary to hpv b19 infection leading to the detection of asymptomatic hs . Those patients with hs, who remain undiagnosed, usually have mild hemolysis and the disease remains undiagnosed until the compensation is interrupted because of some environmental stressors such as infections . The distinguished feature of our report is the occurrence of some degrees of leukopenia, neutropenia and thrombocytopenia in two of our patients (the mother and his son). There are few reports of mild transient pancytopenia due to hpv b19 infection and recent report on persistent severe aplastic anemia in a previously healthy adult . However, none of them occurred in members of a single family and one of them was persistent in a healthy subject . One of the theories behind the etiology of transient pancytopenia in hpv b19 infections is that the virus could be responsible for the temporary arrest of hematopoiesis that leads to aplastic crisis in persons with chronic hemolytic anemia . The other hypothesis is the occurrence of hpv - associated hemophagocytosis leading to pancytopenia . Among our three patients, two showed transient pancytopenia with more severity in the 14-year - old boy; nevertheless, they did nt show any evidence of hemophagocytosis in bone marrow aspirate . According to available reports in the literature indicating probable efficacy of ivig in the treatment of patients with hpv b19 infections and its effect on replication on virus however, we cannot draw any conclusion on whether the fast recovery of the patients was a positive impact of ivig or spontaneous recovery of hpv b 19 that is expected in hs patients, albeit happened very soon in our patients . Hpv b19 induced aplastic crisis in a family leading to the diagnosis of hereditary hs is a very rare reported event in the literature . The distinguished feature of this report is that all affected members of a family developed some degrees of transient pancytopenia, not only anemia, all simultaneously in the course of their disease . However, it was transient and the recovery happened very soon in all of them within 10 days, which was attributed to the usage of ivig.
Primary mitochondrial disorders due to impaired oxidative phosphorylation (oxphos) are a well - established cause of severe disability and precocious death in both children and adults (koopman et al ., 2012). No effective therapies are currently available for these conditions, but encouraging results have recently been obtained by stimulating mitochondrial biogenesis acting on either the ppar system (wenz et al ., 2008) or the amp - kinase (ampk)/pgc1 axis (viscomi et al ., 2011). Importantly, these approaches can in principle be extended to several mitochondrial diseases with different genetic causes, as they do not point to the correction of a specific defect but are based on a more general strategy aimed at increasing the overall residual activity of the respiratory chain . Additional targets able to activate the mitochondriogenic program and boost mitochondrial function are sirtuins 17 (houtkooper et al ., 2012), the mammalian orthologs of the yeast silent information regulator (sir) 2 gene (imai et al ., 2000; sirtuins have different subcellular localization, sirt1 and sirt6 being mainly found in the nucleus, sirt2 in the cytosol, sirt3sirt5 in mitochondria, and sirt7 in the nucleolus . Sirtuins are important regulators of several proteins, including key metabolic players, acting as either deacetylases or adp - ribosylases (houtkooper et al ., 2012). The most - investigated member of the family is sirtuin1 (sirt1), a nad - dependent type iii nuclear deacetylase that utilizes nad as a cosubstrate to remove acetyl groups from lysine residues of a target protein . Known targets of sirt1 are the tumor suppressor p53, the myocyte - specific enhancer factor 2 (mef2), the forkhead box o (foxo), and pgc1, all of which regulate transcriptional programs related to increased mitochondrial function (andreux et al ., 2013). Sirt1 activity is directly regulated by nad availability, by substrate - dependent activation, raising the hypothesis that nad acts as a metabolic sensor . For instance, both nad levels and sirt1 activity increase in mammalian tissues in response to energy / nutrient stresses such as exercise (cant and auwerx, 2009, 2010) and fasting (cant and auwerx, 2010; chen et al . Recent studies have shown that sirt1 activation can prevent diet - induced obesity in mice . This effect was achieved by increasing the content of nad in cells and tissues essentially through (1) dietary supplementation of suitable nad precursors, such as nicotinamide riboside, nr (cant et al ., 2012), or (2) inhibition of nad - consuming enzymes, such as the poly(adp - ribose) polymerase 1, parp1 (bai et al ., 2011). Here, we have tested the therapeutic efficacy of these strategies on a genetic mitochondrial disease model, the sco2 knockout / knockin (sco2) mouse (yang et al ., 2010). Sco2 encodes a metallochaperone involved in the formation of the copper redox centers into nascent complex iv (cytochrome c oxidase, cox) (leary et al ., 2009). Mutations in this gene lead to infantile fatal encephalocardiomyopathy (papadopoulou et al ., 1999). Most of the patients carry at least one allele encoding the common mutation p.e140k, corresponding to the p.e129k mutation in the knockin murine sco2 allele . The second knockout allele in this animal model is functionally null (yang et al ., 2010). While homozygous knockout individuals are embryonic lethal, the sco2 mice show a predominantly myopathic phenotype characterized by exercise intolerance and associated with ubiquitous cox deficiency . To test the effects of persistent increase of the nad pool on the sco2 mouse, we first crossed it with a constitutive parp1 mouse (de murcia et al ., 1997), which shows increased levels of nad in skeletal muscle (bai et al ., 2011). The sco2-parp1 double mutants showed reduced fasting blood glucose levels, body weight and epididymal white adipose tissue (wat) compared to sco2 littermates, whereas no differences were observed between wt and parp1 littermates (see figure s1 available online). The endurance motor performance of sco2-parp1 double mutants, sco2, parp1, and wt littermates (four animals per group) was monitored weekly by a standard treadmill test for 4 weeks starting at 2 months of age . While sco2 mice showed markedly reduced motor performance compared to wt littermates throughout the observation time, the double mutant individuals performed as well as the wt and parp1 littermates (figure 1a). Biochemically, significant reduction of complex iv activity and, to a lesser extent, complex iii as well (yang et al ., 2010), was measured in skeletal muscle of sco2 mice . In the muscle homogenate of sco2-parp1 double mutants, these activities were comparable to that of parp1 and wt littermates, whereas complex i and ii activities were even higher (figure 1b; table s1). Accordingly, the intensity of the histochemical staining specific to cox was increased in skeletal muscle of the double mutants, compared to the sco2 mutants (figure 1c). The activities of complex iii and iv (figure 1d; table s2) were also increased in the brains of double mutants relative to sco2 animals, but remained significantly lower than those measured in parp1 and wt littermates; the histochemical reaction to cox was concordant with the biochemical data (figure 1e). To test the effects of pharmacological intervention, we first administered nr to sco2 mice and wt littermates (n = 4/group), as a food admix (400 mg / kg) (cant et al ., 2012) for four weeks . Metabolic parameters in the treated groups, including reduced blood glucose, plasma fatty acids, and epididymal wat, mirrored those of parp1 mice (figure s2), confirming that nr, or its derivative nmn, was pharmacologically active in vivo . Nr - treated sco2 mice significantly improved their motor performance compared to the vehicle - treated sco2 group, rapidly achieving the levels of motor endurance displayed by treated and untreated wt mice (figure 2a), which showed no difference to each other . These results suggest that nr treatment increases mitochondrial function in the sco2 mice through nad activation of sirt1 (cant et al ., 2012). Accordingly, the nad / nadh ratio was significantly increased (figure 2b), and the ratio between acetylated and total foxo1, a direct target of sirt1, was clearly reduced (figure 2c) in skeletal muscle of nr - treated versus vehicle - treated sco2 and wt animals . We did not observe differences in mtdna content (data not shown) and citrate synthase (cs) activity (figure 2f), but mrna levels of several genes related to either fatty acids oxidation (fao), including acox and cd36, or oxidative phosphorylation (coxi, coxii, coxiv, coxva) were significantly increased in nr - treated versus vehicle - treated sco2 but not in wt animals (figure 2d). Tfam, a key factor of mtdna transcription, was also increased, and ucp3 and pdk4, which were downregulated in sco2 mice, returned to control levels upon nr treatment . As expected, we found no change in transcripts specific to pgc1, which is activated posttranscriptionally by sirt1, and to two pgc1 partners, nrf1 and nrf2 . Accordingly, western blot immunovisualization demonstrated increased levels of several nuclear- and mitochondrial - dna - encoded oxphos - related proteins in nr - treated versus vehicle - treated skeletal muscle samples (figure 2e). In the same specimens, mitochondrial respiratory chain activities were significantly increased (figure 2f; table s3) in nr - treated versus vehicle - treated sco2 mice, but not in wt animals . The histochemical staining for cox reflected the biochemical results (figure 2 g). In both c. elegans and mammalian cells, nr - dependent sirt1 activation can induce the mitochondrial unfolded protein response (mtupr), a stress - response protective mechanism which can improve mitochondrial function (durieux et al . We found that the mtupr - specific transcripts clpp, hsp60, and sod2 were significantly increased in muscle samples of nr - treated sco2 mice, whereas sod3, which is unrelated to mtupr, was unchanged (figure 2h). No effect of the nr treatment was observed on the mitochondrial respiratory chain activities in the brain of our animals (table s4). Next, we administered a pan - parp inhibitor (mrlb-45696, ic50 for parp <1 nm; pirinen et al ., 2014, in this issue of cell metabolism) at 50 mg / kg as a food admix for 4 weeks . In mrlb-45696-treated sco2 mice, we observed metabolic effects similar to those of nr treatment (figure s3). Weekly treadmill tests showed progressive increase, up to normal, of the motor endurance in mrlb-45696-treated sco2, whereas no change was seen in wt mice (figure 3a). The nad / nadh ratio was significantly increased in treated versus untreated wt, but not in the sco2, animals (figure 3b), whereas the acetylated / total foxo1 ratio was reduced in both treated groups (figure 3c), indicating activation of sirt1 by mrlb-45696 . Similar to nr, mrlb-45696 increased the mrna expression levels of oxphos- and fao - related genes in both sco2 and wt mice, whereas mtdna content (data not shown) and cs activity (figure 3f) remained unchanged . In treated sco2 but not in wt animals, western blot analysis showed increased content of mitochondrial respiratory chain subunits (figures 3d and 3e), which was paralleled by significantly increased mitochondrial respiratory chain activities (figure 3f; table s3). Histochemistry for cox showed increased staining in treated versus vehicle - treated sco2 mice (figure 3 g). Again, we found that expression of the mtupr genes hsp60, clpp, and sod2 was significantly increased, unlike the mtupr - unrelated gene sod3 (figures 3h and 3i). In contrast to the nr treatment, the mrlb-45696 treatment determined significant increase of cox transcripts (figure 4a), and respiratory chain activities in the brain (figure 4b; table s4). The intensity of cox staining was increased as well (figure 4c). Similar results were obtained in both skeletal muscle and brain by using pj34, a commercially available pan - parp inhibitor (figures s3 and s4; table s4). The nad pool is set by the balance between de novo and salvage biosynthetic pathways and utilization by nad - consuming enzymes . Nad is synthesized de novo from tryptophan, but the main source of nad is from salvage pathways (houtkooper et al ., 2010). These require the uptake of other nad precursors from the diet, including nr . Upon its entry in the cell, nr is phosphorylated by nr kinases into nicotinamide mononucleoside (nmn), which is then converted to nad by nmn adenylyltransferase (bieganowski and brenner, 2004). Nad biosynthesis and cellular levels are also controlled by a circadian clock related to the feeding / fasting cycle . For example, in the mitochondrial compartment nad levels regulate sirtuin 3, a deacetylase targeting respiratory chain subunits (peek et al ., 2013), while in the nucleus nad is a substrate of both parp1 and sirt . Parp1, the highest consumer of nad in mammalian tissues, is activated upon binding to damaged or abnormal dna (durkacz et al ., 1980) and catalyzes the formation of poly(adp - ribose) polymers (par) using nad as a substrate, onto different acceptor proteins, including parp1 itself (adamietz, 1987). Ablation of the parp1 gene, supplementation of nr or administration of parp inhibitors (parpi) can expand the nad pool and activate sirtuins, particularly sirt1, a master regulator of mitochondrial homeostasis . These effects can protect mice from high - fat (hf)-induced metabolic disease (cant et al ., we have shown here that these treatments can correct the biochemical and clinical phenotype of the sco2 mouse, a model of genetically determined mitochondrial disease . Increased transcription of genes related to both oxphos and mtupr was associated with activation of oxidative metabolism, increase of mitochondrial respiratory chain activities, and normalization of the endurance motor deficit, displayed by naive sco2 animals . Notably, these effects were hardly seen in wt littermates, suggesting that mitochondrial dysfunction sensitizes muscle and possibly other tissues to activators of mitochondriogenic programs . Increased mitochondrial function can be achieved in wt animals only by much longer - term treatments (> 6 months) (pirinen et al ., 2014). In contrast with previous results, we found no change in mtdna copy number and cs activity in nr- or parpi - treated versus untreated animals, possibly because of the shorter timeframe of our experimental protocol (4 weeks) compared to that of other studies (12 weeks). This observation suggests time - dependent activation of different mitochondriogenic programs, with induction of oxphos- and fao - related genes occurring much earlier than stimulation of mitochondrial proliferation and increase in mtdna content . Likewise, prolonged nr supplementation up to 6 months induced mitochondrial biogenesis in the brain and improvement of cognitive dysfunction of an alzheimer disease mouse model (gong et al ., 2013). While we observed hardly any effect of nr in our 4 week trial, two pan - parp inhibitors did correct the respiratory chain defect in the brains of our sco2 mice . This observation is particularly relevant, as the brain is an exquisite target of mitochondrial dysfunction, and progressive encephalopathy is the most frequent clinical presentation of mitochondrial disease in infancy and childhood . Our work supports the idea that the increase of nad levels in critical tissues is an effective therapeutic option for mitochondrial disease . Nr is a natural vitamin with no known adverse effects, which could be administered as a dietary supplement, particularly in case of isolated mitochondrial myopathy . Our results are concordant with very recent works reporting beneficial effects of nad precursors in mouse models characterized by reduced nad / nadh ratio, such as aging (gomes et al ., 2013) or complex i deficiency (karamanlidis et al ., 2013) initially shown to boost oxidative metabolism in diet - induced models of obesity, parp1 ablation or inhibition has recently been reported to remarkably rescue pharmacological models of liver cirrhosis, partly by correcting the associated mitochondrial impairment (mukhopadhyay et al ., 2013). Several parp inhibitors are currently under clinical trial as anticancer molecules, and seem to be associated with relatively mild side effects (bundred et al ., 2013; tutt et al ., however, more work is needed to evaluate their use in chronic conditions such as primary mitochondrial disorders in view of their potential genotoxic effects . Mouse tissues were homogenized in 15 volumes of 10 mm potassium phosphate buffer (ph 7.5). Mitochondrial - enriched fractions were collected after centrifugation at 800 g for 10 min in the presence of protease inhibitors, and frozen and thawed three times in liquid nitrogen . Aliquots, 70 g each, were run through a 12% sds - page and electroblotted onto a nitrocellulose membrane, which was then matched with different antibodies . Carlo besta neurological institute, in accordance with guidelines of the italian ministry of health . Mice were maintained in a temperature- and humidity - controlled animal - care facility, with a 12 hr light / dark cycle and free access to water and food . A standard treadmill apparatus (columbus instruments, columbus, oh) was used to measure motor exercise endurance, as described in viscomi et al . Series of 8 m thick sections were stained for cox and sdh, as described (sciacco and bonilla, 1996). Muscle quadriceps samples stored in liquid nitrogen were homogenized in 10 mm phosphate buffer (ph 7.4), and the spectrophotometric activity of ci, cii, ciii, and civ, as well as cs, was measured as described (bugiani et al ., 2004). Note that in all panels the activity of cii has been multiplied by 10 for visualization clarity . Nad was extracted using acidic and alkaline extraction methods, respectively (yang and sauve, 2006). Tissue nad was analyzed with mass spectrometry as previously described (yang and sauve, 2006). Mtdna content and transcripts analysis was carried out by sybr green real - time pcr, as described (viscomi et al ., 2011).
Irinotecan is commonly used in combination with oxaliplatin as a component of folfirinox chemotherapy for several gastrointestinal malignancies . The purpose of this case report is to describe a patient who developed acute paralysis and aphasia while receiving her initial infusion of irinotecan . A 67-year - old woman with newly diagnosed metastatic pancreatic adenocarcinoma presented for her first cycle of folfirinox chemotherapy . During her infusion of irinotecan, she developed acute onset of generalized weakness, paralysis of all extremities, and nonfluent aphasia with complete inability to communicate . This episode was self - limited and resolved within 2 h. prior to subsequent infusions she received intravenous repletion of potassium and had no recurrence of symptoms . In selected cases, coadministration of irinotecan and oxaliplatin may result in severe generalized weakness and aphasia, which may be triggered by underlying electrolyte disturbances . Irinotecan is a topoisomerase i inhibitor derived from camptothecin, an alkaloid compound extracted from deciduous trees indigenous to eastern asia . Its antineoplastic activity is mediated by its inhibition of double - stranded dna replication through stabilizing the cleavage complexes of topoisomerase i. its most common use is in the treatment of colorectal cancer . However, since 2010, it has been combined with 5-fluorouracil, leucovorin, and oxaliplatin in the regimen known as folfirinox, which has been utilized as an effective therapy in patients with metastatic pancreatic cancer as well as other cancers . The most commonly cited adverse effects of irinotecan include late - onset diarrhea and bone marrow suppression, with clinically significant neutropenia and thrombocytopenia . A less frequent, acute cholinergic syndrome with resultant symptoms of diaphoresis, hypotension, anxiety, and abdominal cramping with diarrhea may result in severe discomfort and dehydration that can be life - threatening . Atropine is commonly administered with the chemotherapy infusion both for the prevention and treatment of this syndrome . Oxaliplatin is a third - generation platinum derivative that has shown to be an effective therapy in several malignancies, most commonly gastrointestinal cancers . Side effects of oxaliplatin include a dose - limiting severe peripheral sensory neuropathy that is chronic in onset . Less commonly, acute sensory disturbances that may be modulated by cold temperatures may occur . These effects are thought to be mediated by an interaction with voltage - gated sodium channels in peripheral nerves . Here we report the case of a patient with a rare complication of combination therapy with irinotecan and oxaliplatin, i.e. Severe generalized weakness, paralysis, and aphasia, and provide a synopsis of the current literature as well as a proposed therapeutic approach . A 67-year old asian woman with a history of poorly controlled diabetes presented with newly diagnosed metastatic pancreatic adenocarcinoma . In november 2013, she received her first cycle of palliative chemotherapy using folfirinox (oxaliplatin 85 mg / m, irinotecan180 mg / m, leucovorin 400 mg / m iv, and 5-fu 2,400 mg / m iv by continuous infusion over 48 h without a bolus, with dexamethasone 10 mg and ondansetron 12 mg iv as premedication). Prior to beginning therapy with folfirinox, her electrolyte levels were checked, which revealed mild hypokalemia (3.5 meq / l, normal values 3.55.0) with normal serum sodium and calcium (na 137 mmol / l, ca 8.7 mg / dl). Halfway through the irinotecan infusion, she developed acute onset of generalized weakness, paralysis of all extremities, and nonfluent aphasia with complete inability to communicate . Throughout this, she was awake, alert, and aware of her surroundings, with stable vital signs . At this time, the infusion was stopped and she was given a second dose of atropine 1 mg as well as an iv bolus of 1 l normal saline . She was monitored carefully and observed to return close to her baseline status within 12 h. neither the infusion of irinotecan nor the 5-fu infusion was restarted, and she was discharged to her home with appropriate follow - up . She returned 2 weeks later for cycle 2 of her folfirinox therapy and felt completely well . Prior to initiating the infusion, her electrolyte levels were checked, which showed a low - normal potassium level of 3.7 she received 20 meq iv kcl supplementation leading to an improvement in the potassium level to 4.4 meq / l immediately preceding the infusion . She was then given her second cycle of folfirinox with identical doses of the drugs as in the first cycle and was able to complete all of the therapy without recurrence of the symptoms previously experienced at her initial infusion . She was able to continue on therapy without event for a total of 3 cycles before she transferred her care to an institution closer to her home and was lost to follow - up . To date, there have been 9 reported cases of significant central nervous system toxicity during or following the administration of irinotecan, both with and without concurrent oxaliplatin administration . All of these cases involved the development of dysarthria, with 2 of them leading to a complete motor aphasia and 1 case with associated ataxia [1, 2, 3, 4, 5]. In each case, these symptoms developed with the initial infusion of irinotecan and completely resolved with time . The duration of symptoms ranged from as little as 15 min to as long as 8 h. the duration of symptoms appeared to be related to the dose of irinotecan, with doses <200 mg / m having a quicker return to baseline (1545 min) in comparison to larger doses of> 200 mg / m (28 h). Irinotecan and its primary active metabolite, sn-38, bind strongly to plasma proteins and tissues resulting in high plasma distribution . In animal models, irinotecan and its metabolites have been found to cross the blood - brain barrier into the central nervous system . In 2 patients in whom neurologic symptoms developed during irinotecan administration, hamberg et al . Examined the pharmacokinetics of irinotecan and sn-38 and found both of these values to be within the normal range . The acute onset of symptoms shortly after beginning irinotecan infusion also suggests that the manifestation of these symptoms is not dose or duration dependent . Therefore, it is unlikely that altered systemic clearance of irinotecan mediates the presence or absence of neurologic symptoms in these patients . The degree of severe generalized weakness seen in our patient following administration of irinotecan has not previously been reported in the literature . Though no imaging of the brain was performed in our patient, ct and mri performed in prior similar cases have failed to show any evidence of stroke or other acute cns abnormalities to explain the clinical presentation . Our patient was found to have mild hypokalemia (3.5 meq / l) prior to chemotherapy (which may have been even lower following hydration and drug administration), which may have contributed to her profound weakness and inability to move and speak while maintaining a normal sensorium . One case of acquired fanconi syndrome (characterized by proximal tubular dysfunction resulting in electrolyte wasting of potassium, calcium, phosphate, and uric acid) has been reported following combination therapy with capecitabine, irinotecan, and bevacizumab, but a single offending agent was not identified . Correcting our patient's electrolytes prior to the subsequent infusions and ensuring continued stability of these values throughout the infusion was the only change in the treatment plan and resulted in no recurrence of symptoms . We postulate that close monitoring and repletion of potassium was the factor that prevented further neurologic symptoms . As irinotecan alone has not previously been implicated in electrolyte - based neurologic complications, we also consider that the findings in our patient were not caused by irinotecan alone, but rather by combination therapy with oxaliplatin as administered in folfirinox . Two prior case reports have noted the acute onset of severe neurologic deficits (including generalized weakness, limb weakness, dysarthria, ophthalmoparesis, and coma) during and shortly after the administration of oxaliplatin, which our patient received prior to initiation of irinotecan [8, 9]. In both reported cases, mmol / l) and much more severe in the case reported by basso et al . (k 1.7 meq / l), which appears to correlate with the severity of symptoms . In these cases, symptoms developed during the oxaliplatin infusion or within 15 min of completion . Our patient tolerated her oxaliplatin therapy without complications during the infusion, but it is possible that the coadministration of oxaliplatin and irinotecan may have increased the risk of developing these reversible neurologic effects . If this is the case, those patients receiving combination folfirinox therapy may be at significantly higher risk of developing neurologic side effects than those receiving folfox therapy alone . From our experience in this patient, and from our review of the literature, we conclude that in selected cases, the coadministration of irinotecan and oxaliplatin (as is used in folfirinox) may result in severe generalized weakness and aphasia . We believe that a careful correction of these abnormalities into the upper ranges of normal as needed, both prior to beginning and during the infusion of oxaliplatin / irinotecan, may prevent this reaction . While the symptoms may be transient and self - limited, they may equally be severe . Without knowledge of their etiology and the appropriate therapy, patients may be denied further treatment or may be reexposed to a serious adverse reaction.
Alcohol dependence is the most prevalent substance use disorder that can lead individuals with the disorder to serious health - related and social problems . According to a report by nutt and colleagues (2007), the level of potential harm and risk of alcohol use and misuse was among the top five with heroin and cocaine . The 12-month prevalence of alcohol dependence is reported to be approximately 2% to 6% in the general populations . In part reflecting the high potential harm and high prevalence of alcohol dependence, there have been a number of studies on how chronic alcohol use or alcohol dependence interacts with the structure of the brain of animals and humans . Overall brain atrophy, including the lesser volumes of gray matter and white matter with increased cerebrospinal fluid, in patients with alcohol use disorders, has consistently been reported . Deficits in the prefrontal cortex, temporal cortex, cerebellum, striatum, hippocampus and amygdala have also been reported in patients with alcohol dependence . Neuropathological studies have shown that the alcohol - related neuronal and glial loss would preferentially involve the prefrontal cortex among cortical regions . Functional neuroimaging studies demonstrated altered metabolism or activation of the frontal cortex in association with the deteriorated neuropsychological functioning . Cortical thickness analysis, a reliable and valid method, can capture important information on cortical structures . Durazzo and colleagues exhibited that alcohol - dependent adults had thinner cortical regions in the left anterior cingulate cortex, bilateral frontal cortex, and bilateral insula than healthy controls . Other researchers found that alcohol - dependent adults had reduced cortical thickness in the widespread brain regions of the superior frontal, precentral, postcentral, middle frontal, middle and superior temporal, middle temporal, and the lateral occipital cortex than healthy comparison participants . In the report by momenan and colleagues, participants with alcohol dependence exhibited thinner cortical regions that encompass the medial superior frontal cortex, insula, precentral and the precuneus of the right hemisphere as well as the superior frontal gyrus of the left hemisphere, in comparison with the healthy controls . Previous studies have reported widespread cortical deficits without covarying out the effects associated with the global atrophy of the brain . Among these widespread regions that show alcohol - related atrophy, we wanted to localize the cortical regions that may be particularly vulnerable to alcohol consumption . We therefore undertook the cortical thickness analysis adjusting for the hemispheric average cortical thickness, in 21 detoxified alcohol - dependent patients and matched 22 healthy comparison subjects . The objective of this study was to identify brain regions with cortical thickness alterations that exceed the level of global alterations in alcohol dependence . We used the whole brain - wise cortical thickness analysis, which is validated histologically and with manual outlining method . We also investigated whether the magnitude of deficits are correlated with the alcohol use - related variable . Given the studies that suggest the preferential involvement of prefrontal cortex among brain structural and functional alterations in alcohol dependence, we hypothesized that patients with alcohol dependence would have thinner prefrontal cortex in comparison with healthy comparison subjects, after correcting for the global cortical thinning associated with alcohol dependence . Patients with alcohol dependence were enrolled from the inpatient unit of the department of neuropsychiatry in a university - affiliated hospital, seoul, south korea . Age - matched healthy comparison subjects were recruited from the community via the local advertisement during the same study period . Inclusion criteria for alcohol dependence group were (1) age between 20 and 70, and (2) diagnosis of alcohol dependence according to the diagnostic and statistical manual of mental disorders - iv by 2 board - certified psychiatrists . Exclusion criteria for both alcohol dependence and control groups were (1) any symptoms or signs of confusion, major medical disorders including kidney disease and chronic liver disease, and/or malnutrition, (2) presence or history of neurological disorders, (3) presence or history of any mental disorders other than alcohol dependence or comorbid depressive disorders, including alcohol - induced persistent dementia, alcohol - induced amnestic disorder, or alcohol withdrawal delirium (3) history of head injury, and (4) any contraindications to magnetic resonance imaging (mri) such as pace makers, claustrophobia, or metal implants . Additional exclusion criteria for control group were (1) presence or history of mental disorders including alcohol abuse and (2) current alcohol consumption greater than 14 equivalent standard drinks for men, 7 for women, per time . After being detoxified for 2 weeks, all patients underwent physical examination by a physician and the routine laboratory tests to screen out any major medical disorders . T1 and t2 weighted mr images were obtained using 1.5 tesla siemens whole body scanner . Repetition time [tr]=2,050 ms, echo time [te]=4.39 ms, inversion time [ti]=1,100 ms, number of excitation [nex]=2, flip angle [fa]=15, slice thickness=1.3 mm, field of view [fov]=180180 mm, acquisition matrix=256180 . T1 weighted images of 7 subjects were obtained with slightly different image acquisition protocol (tr=1,960 ms, te=4.38 ms, ti=1,100 ms, nex=2, flip angle [fa]=15, slice thickness=1.5 mm, fov=250 x 250, acquisition matrix=256 x 180). T2 weighted images were acquired in order to screen for gross brain abnormality (tr=9,710 ms, te=120 ms, nex=2, flip angle [fa]=170, slice thickness=3 mm). Smoothing processes were conducted using an iterative nearest - neighbor averaging procedure with the full - width half maximum (fwhm) 15 mm 2-d gaussian kernel . For calculating statistical difference maps of cortical thickness between alcohol dependence and healthy comparison groups, general linear model (glm) with cortical thickness at each vertex as the dependent variable has been used . Non - cortical areas of medial wall and corpus callosum were excluded from the model building . Hemispheric average cortical thickness was included in the model as a covariate since there was a significant difference in hemispheric average cortical thickness between groups and our aim was to identify the particularly vulnerable cortical regions beyond the global brain atrophy associated with alcohol dependence . 5,000 permutation simulations have been performed with random group - label shuffling, with a threshold for a significant vertex of p<0.05 . Clusters with the size that would pass the family - wise error rate correction were considered significant . Thickness values of the surface point with highest z values (local maxima) within the cluster, where significant group differences of cortical thickness were found, were extracted for post hoc analyses . Pair - wise correlations were used to test whether there were associations between the magnitude of cortical thickness deficits in patients with alcohol dependence and the duration of alcohol use . Considering the relatively modest sample size, sensitivity analyses to rule out the possibility that the current results may be modulated by other confounding factors such as comorbid depression, anxiety symptoms and scan parameter difference were performed . Local maxima thickness values within the cluster extracted as described above were subjected to linear regression models that included the scan parameter difference, the presence of comorbid depression as defined by 19 or more scores on the 17-item hamilton depression rating scale (hdrs), or the presence of anxiety as defined by 40 or more scores on the state - trait anxiety inventory (stai - t) as additional covariates . Computations were performed using stata version 11 (stata corp ., college station, tx, usa). Patients with alcohol dependence were enrolled from the inpatient unit of the department of neuropsychiatry in a university - affiliated hospital, seoul, south korea . Age - matched healthy comparison subjects were recruited from the community via the local advertisement during the same study period . Inclusion criteria for alcohol dependence group were (1) age between 20 and 70, and (2) diagnosis of alcohol dependence according to the diagnostic and statistical manual of mental disorders - iv by 2 board - certified psychiatrists . Exclusion criteria for both alcohol dependence and control groups were (1) any symptoms or signs of confusion, major medical disorders including kidney disease and chronic liver disease, and/or malnutrition, (2) presence or history of neurological disorders, (3) presence or history of any mental disorders other than alcohol dependence or comorbid depressive disorders, including alcohol - induced persistent dementia, alcohol - induced amnestic disorder, or alcohol withdrawal delirium (3) history of head injury, and (4) any contraindications to magnetic resonance imaging (mri) such as pace makers, claustrophobia, or metal implants . Additional exclusion criteria for control group were (1) presence or history of mental disorders including alcohol abuse and (2) current alcohol consumption greater than 14 equivalent standard drinks for men, 7 for women, per time . After being detoxified for 2 weeks, all patients underwent physical examination by a physician and the routine laboratory tests to screen out any major medical disorders . T1 and t2 weighted mr images were obtained using 1.5 tesla siemens whole body scanner . Repetition time [tr]=2,050 ms, echo time [te]=4.39 ms, inversion time [ti]=1,100 ms, number of excitation [nex]=2, flip angle [fa]=15, slice thickness=1.3 mm, field of view [fov]=180180 mm, acquisition matrix=256180 . T1 weighted images of 7 subjects were obtained with slightly different image acquisition protocol (tr=1,960 ms, te=4.38 ms, ti=1,100 ms, nex=2, flip angle [fa]=15, slice thickness=1.5 mm, fov=250 x 250, acquisition matrix=256 x 180). T2 weighted images were acquired in order to screen for gross brain abnormality (tr=9,710 ms, te=120 ms, nex=2, flip angle [fa]=170, slice thickness=3 mm). Smoothing processes were conducted using an iterative nearest - neighbor averaging procedure with the full - width half maximum (fwhm) 15 mm 2-d gaussian kernel . For calculating statistical difference maps of cortical thickness between alcohol dependence and healthy comparison groups, general linear model (glm) with cortical thickness at each vertex as the dependent variable has been used . Non - cortical areas of medial wall and corpus callosum were excluded from the model building . Hemispheric average cortical thickness was included in the model as a covariate since there was a significant difference in hemispheric average cortical thickness between groups and our aim was to identify the particularly vulnerable cortical regions beyond the global brain atrophy associated with alcohol dependence . 5,000 permutation simulations have been performed with random group - label shuffling, with a threshold for a significant vertex of p<0.05 . Clusters with the size that would pass the family - wise error rate correction were considered significant . Thickness values of the surface point with highest z values (local maxima) within the cluster, where significant group differences of cortical thickness were found, were extracted for post hoc analyses . Pair - wise correlations were used to test whether there were associations between the magnitude of cortical thickness deficits in patients with alcohol dependence and the duration of alcohol use . Considering the relatively modest sample size, sensitivity analyses to rule out the possibility that the current results may be modulated by other confounding factors such as comorbid depression, anxiety symptoms and scan parameter difference were performed . Local maxima thickness values within the cluster extracted as described above were subjected to linear regression models that included the scan parameter difference, the presence of comorbid depression as defined by 19 or more scores on the 17-item hamilton depression rating scale (hdrs), or the presence of anxiety as defined by 40 or more scores on the state - trait anxiety inventory (stai - t) as additional covariates . Computations were performed using stata version 11 (stata corp ., college station, tx, usa). There were no significant differences in age and sex between diagnostic groups (table 1). Patients with alcohol dependence drank alcohol more frequently and more heavily than healthy comparison subjects (table 1). Patients with alcohol dependence had general cortical thinning (left hemispheric average cortical thickness (mm): 2.440.07 [healthy comparison subjects] vs 2.240.27 [patients with alcohol dependence], t=3.35, p=0.002) (right hemispheric average cortical thickness (mm): 2.450.07 [healthy comparison subjects] vs 2.250.23 [patients with alcohol dependence], t=3.77, p<0.001). In order to identify regionally specific cortical deficits in patients with alcohol dependence compared to healthy comparison subjects, hemispheric average cortical thickness was added as a covariate in the whole brain vertex - wise analysis . In the glm model that includes age and average cortical thickness as covariates, significant cortical thickness deficits in patients with alcohol dependence, compared to healthy comparison subjects, were noted in the left superior frontal cortex, after correcting for multiple comparisons with the permutation method (fig . 1) (cluster size=1489.5 mm; number of vertices in the cluster=2,035; talairach coordinates = x [-15.3], y [61.8], z [5.0]; cluster p value=0.024). Given that different scanning parameter may influence on the cortical thickness variations, analysis was re - run with scan parameter as a covariate . When analysis was repeated covarying for comorbid depression that may be associated with thinner prefronto - temporal cortex, the diagnostic group effect remained significant (p=0.001). When analysis was repeated covarying for comorbid anxiety that may also be associated with thinner prefronto - temporal cortex, the diagnostic group effect remained significant in the left superior frontal cluster (p=0.017). Post hoc correlation analysis between cortical thicknesses in the left superior frontal cluster of significant group difference and duration of alcohol use in alcohol dependence group demonstrated the significant association (r=-0.55; p=0.02) (fig . Cortical thicknesses in the left superior frontal cluster was also correlated with the clinical institute withdrawal assessment for alcohol scores (r=-0.548, p=0.028). Otherwise we found no significant results between cortical thicknesses in the left superior frontal cluster and audit scores (r=0.048, p=0.859); and calculated alcohol use (alcohol dose x frequency x duration) (r=-0.193, p=0.509). In the current study, we have identified the brain region with altered cortical thickness in patients with alcohol dependence . The region of cortical thickness deficits in patients with alcohol dependence encompassed primarily the superior frontal cortex, after adjusting for the effects on the global cortical atrophy induced by alcohol dependence (fig . This is consistent with prior reports indicating that chronic alcohol use may have the most detrimental effects on prefrontal cortical regions . The level of n - acetyl aspartate, the viability marker of neurons, was decreased in prefrontal brain regions in chronic alcohol abusers . Neuronal and glial loss has consistently been noted in the prefrontal cortical regions, particularly in the superior frontal cortex . Alcohol use has been associated with the decreased performances in executive and attention tasks that are important function of the prefrontal cortex . Pre - existing vulnerability in these regions may predispose individuals to alcohol dependence, since the function of these regions are to executively control over drug craving and seeking . These regions may be associated with the compulsive substance - related behaviors, which is also in line with our finding that shows the association between duration of alcohol use with the magnitude of the cortical deficits in this region . The current findings do not provide information regarding whether the pre - existing prefrontal cortical deficits have rendered individuals vulnerable to alcohol dependence, whether neurotoxicity of chronic alcohol use, including the oxidative stress, have damaged the cortex, or whether both processes have contributed to the observed findings . Supporting evidence for the neurotoxicity as the cause of prefrontal deficits may come from the reports that show patients with longer abstinence have lesser deficits . It has also been suggested that subjects with alcohol dependence may have prefrontal cortex that are less recuperative from toxic effects and may undergo vicious cycle after initial exposure to substances . Considering that alcohol dependence can be divided into two subtypes, type 1 more environmentally influenced, and type 2 more genetically induced, a comparison between type 1 and type 2 alcohol dependent patients in a study with larger sample with balanced composition of type 1 and type 2 alcohol dependence may provide an opportunity to approach this question . Longitudinal brain imaging study that follows up patients with alcohol dependence would also provide important insights . This study alone does not provide direct information as to cellular level mechanisms that may underlie the observed deficits of the cortical thickness . However, there is a vast literature describing the impact of chronic alcohol on the brain . Miguel - hidalgo and colleagues (2002) reported, in their study with the postmortem brain of alcohol - dependent patients without wernicke or korsakoff syndromes, that the glial pathology of reduced size and density was the most characteristic finding . Kril and colleagues (1997) have shown selective loss of non - gabaergic pyramidal neurons . Selective dendritic retraction, rather than cellular death, has been suggested as main pathology related to the volume loss of the gray matter . There is a study that examined the cortical thickness differences in subjects with fetal alcohol syndrome or prenatal alcohol exposure, compared to control subjects, which demonstrated deficits in prefronto - temporo - parietal regions . However, few studies have examined cortical thickness in alcohol - dependent adults . The cortical thickness analysis has been reported to provide information on an important aspect of the gray matter structure, complementary to the conventional volumetry or the vbm . For example, highly folded regions could have high gray matter density in vbm analysis since there would be more voxels of gray matter within a fixed radius, but thinner cortical thickness . This is the first study that used cortical thickness analysis in patients with alcohol dependence excluding comorbid substance use, which showed regionally specific cortical thickness deficits in alcohol dependence . Large age range, though covaried in the statistical model, can be another weakness of the study . With the current study of a cross - sectional design, information on whether the observed cortical deficits would be progressive and nicotine dependence, which is highly comorbid with alcohol dependence, has also been reported to be associated with cortical atrophy, particularly that in frontal cortex . Now that we neither were able to exclude participants with co - morbid nicotine dependence nor delineate the effects of alcohol dependence from those of nicotine dependence, the current results may have been confounded by the effects of chronic nicotine use . Intellectual ability has also been reported to be associated with the prefrontal cortical development . The fact that the intelligence quotient was not included in the statistical model for comparisons of cortical thickness measures, is also an important limitation of the current study . Future studies in larger samples with narrow age range and with neuropsychological assessments for the frontal lobe function, would provide valuable information . Although there could be challenges in following up patients with alcohol dependence, long - term prospective longitudinal study is also warranted.
Nutrient intakes, health behaviors and quality of life are interrelated and are of particular importance among rural residents . Rural areas exhibit a variety of dietary habits and food - intake patterns (lee et al ., 2002; ministry of health & welfare, 2002) with food intake and food selection being lower, consequently nutrient intakes being lower than urban areas . Dietary diversity is a fundamental concept of dietary guidance internationally (katanoda et al ., 2006; kennedy, 2004; who, 1996), since increasing the diversity of foods is thought to ensure an adequate intake of essential nutrients and to promote good health (ruel, 2003). A low dietary diversity is a particularly severe problem among vulnerable populations of the poor (ruel, 2003) and elderly (bernstein et al ., 2002; adequate nutrient intake is essential to health promotion . Hence increasing nutrient intakes as well as the dietary diversity of rural koreans is a potential way to improve their nutritional, and consequently, their health status and quality of life . (1987) reported that variety among and within major food groups was associated with diet quality assessed by the mean adequacy ratio (mar) of 11 nutrients . Evaluating the dietary diversity score (dds) and mar are, therefore, a good way to predict quality of diet and the entirety of dietary habits . In this study, we examined the dietary intakes and health behaviors of asan residents in order to improve health status and consequently the quality of life of asan residents, especially those who live in a rural area . Asan is a medium - sized city with the unique feature with three distinctive regions since there are some areas with various kinds of industrial factories such as semi - conductor factories or automobile, air - conditioner and refrigerator manufacturing factories . Additionally, other areas are mostly composed of rice farms or other kinds of rural farms in the boundaries of asan . Some areas with a largely populated urban area (on - yang si) are also within the district of asan . Therefore, asan can be easily differentiated into three distinctive regions of rural, factory and urban areas . The purpose of this study was to examine and compare nutrient intake, dds, mar and health behaviors of asan residents by the three distinctive regions . Volunteers were recruited from residents of asan during january 2003 and the purposes and content of the study were explained to all participants, who provided their written, informed consent . A total of 930 subjects (351 men and 579 women), aged 61.4 13.8 (mean sd; range 20 - 96) years correctly completed a 24-hour recall interview and were finally selected as participants . Information on individual characteristics such as demography and socioeconomic status and health related behaviors was obtained using pre - coded questionnaires . Dietary - intake data using a one - day 24-hour recall method were obtained by one - to - one interviews from the 5 to the 26 of january 2003 . Detailed descriptions of all foods and beverages consumed and estimated food portion sizes were recorded by trained interviewers using food models, standard household measures, and full - sized colored photographs as memory aids . Food records were converted to nutrient intakes using a computerized nutrient analysis program (can - pro, v2.0, the korean society of nutrition, seoul, korea). All nutrient intakes were adjusted for total energy intake in order to minimize extraneous errors in estimating dietary intake due to individual differences in total food intake . The energy - adjusted nutrient intake for each individual was computed by taking the residual from the regression model in which total caloric intake was the independent variable and the observed nutrient intake was the dependent variable, plus a constant equal to the expected intake of the nutrient for the mean caloric intake of the study population (willett, 1990). Dietary diversity score (dds) of each individual was calculated from quantidd, which is the proportion of 17 food groups (cereals or grains, potato and its products, simple carbohydrates or sugars, beans and its products, nuts or seeds, vegetables and their products, mushrooms, fruits and their products, meat or pork or poultry, eggs and the products, fish or shellfish and their products, seaweed and its products, milk and dairy products, fats or oils, beverages, seasonings and others) contributing to the total amount of food intake after all the food ingredients from mixed dishes were decomposed . Information on the 17 food groups to calculate dds from quantidd is available elsewhere (katanoda et al ., 2006). The mean adequate ratio (mar) is a mean nutrient adequate ratio (nar) of 12 nutrients (protein, vitamins a, c, e and b6, thiamin, riboflavin, niacin, folic acid, calcium, iron and zinc) and nar of each nutrient was calculated by dividing actual nutrient intakes by recommended intakes (ri) of kdri (dietary reference intakes for koreans, korean nutrition society, 2005). Nutrients without ri values defined in kdri, such as energy, fat, carbohydrate, sodium, fiber and cholesterol, were excluded in the nar calculation . Differences among regions were assessed by anova and tukey's post - hoc analysis for continuous variables and by the test for categorical variables . Since regions showed different social economic status (ses) such as income and education levels and age distributions were also different by regions, analysis of covariance (ancova) was conducted to detect true differences among regions after controlling age and income levels as covariates . Volunteers were recruited from residents of asan during january 2003 and the purposes and content of the study were explained to all participants, who provided their written, informed consent . A total of 930 subjects (351 men and 579 women), aged 61.4 13.8 (mean sd; range 20 - 96) years correctly completed a 24-hour recall interview and were finally selected as participants . Information on individual characteristics such as demography and socioeconomic status and health related behaviors was obtained using pre - coded questionnaires . Dietary - intake data using a one - day 24-hour recall method were obtained by one - to - one interviews from the 5 to the 26 of january 2003 . Detailed descriptions of all foods and beverages consumed and estimated food portion sizes were recorded by trained interviewers using food models, standard household measures, and full - sized colored photographs as memory aids . Food records were converted to nutrient intakes using a computerized nutrient analysis program (can - pro, v2.0, the korean society of nutrition, seoul, korea). All nutrient intakes were adjusted for total energy intake in order to minimize extraneous errors in estimating dietary intake due to individual differences in total food intake . The energy - adjusted nutrient intake for each individual was computed by taking the residual from the regression model in which total caloric intake was the independent variable and the observed nutrient intake was the dependent variable, plus a constant equal to the expected intake of the nutrient for the mean caloric intake of the study population (willett, 1990). Dietary diversity score (dds) of each individual was calculated from quantidd, which is the proportion of 17 food groups (cereals or grains, potato and its products, simple carbohydrates or sugars, beans and its products, nuts or seeds, vegetables and their products, mushrooms, fruits and their products, meat or pork or poultry, eggs and the products, fish or shellfish and their products, seaweed and its products, milk and dairy products, fats or oils, beverages, seasonings and others) contributing to the total amount of food intake after all the food ingredients from mixed dishes were decomposed . Information on the 17 food groups to calculate dds from quantidd is available elsewhere (katanoda et al ., 2006). The mean adequate ratio (mar) is a mean nutrient adequate ratio (nar) of 12 nutrients (protein, vitamins a, c, e and b6, thiamin, riboflavin, niacin, folic acid, calcium, iron and zinc) and nar of each nutrient was calculated by dividing actual nutrient intakes by recommended intakes (ri) of kdri (dietary reference intakes for koreans, korean nutrition society, 2005). Nutrients without ri values defined in kdri, such as energy, fat, carbohydrate, sodium, fiber and cholesterol, were excluded in the nar calculation . Differences among regions were assessed by anova and tukey's post - hoc analysis for continuous variables and by the test for categorical variables . Since regions showed different social economic status (ses) such as income and education levels and age distributions were also different by regions, analysis of covariance (ancova) was conducted to detect true differences among regions after controlling age and income levels as covariates . The fundamental characteristics of the participants and comparisons by regions are presented in table 1 . For the total participants, mean age was 61.4 13.8 years, with the men being older (64.8 11.7 years; p<0.001) than the women (59.3 14.6). For the men, factory area residents were significantly older than those living in other areas whilst for the women, urban residents were significantly younger than those living in other areas . The education levels were significantly different by regions (p<0.001), with more college graduates in the urban area . Forty - five percent of the participants earned less than 500,000 won per month, which is less than half the korean average wage . Current drinkers were significantly more in the urban area while never - drinkers were more in the rural or factory areas (p<0.001). However, proportions of current, past and never smokers were not significantly different by regions . Physical activity levels were significantly higher in rural or factory areas than in the urban area (p<0.001), whereas urban residents exercised more frequently than both rural and factory area residents (p<0.001). There were more people who consider themselves less healthy than others with similar age in the rural and factory areas (p<0.001). On the other hand, more urban residents felt more stress than the rural or factory area residents (p<0.001). Energy intakes of the participants were 1679 523 kcal for men and 1467 436 kcal for women (table 3). Energy intake of the total participants was higher in urban area than those in the rural or factory area, but after ses variables such as age and income levels were controlled as covariates in ancova model, regional differences were no longer significant . Meanwhile, energy intake of women in the rural area was significantly lower than that in the urban area residents and the results were not different after ses variables were controlled . The energy - adjusted intakes of protein, riboflavin and calcium were lower in the rural area than in factory or urban areas for the total participants and after adjustment of ses variables, the results showed same significant differences (p<0.05). Energy - adjusted intakes of fat, vitamin c, and thiamin were significantly higher in the urban area than in the other two areas (p<0.05) by anova, but ancova models did not show any significant differences . However, for vitamin e and cholesterol, both anova and ancova models showed same results of significantly higher intake in the urban area than in the other two areas (p<0.05). Vitamin a intakes were significantly different among all three regions, being lowest in the rural area, significantly higher in the factory area and highest in the urban area by both anova and ancova (p<0.05). Zinc intake of the factory area residents was significantly higher than that of the urban area by anova (p<0.05), but by ancova, the difference was no longer significant . Carbohydrate, niacin, folic acid, vitamin b6, iron, sodium and fiber intakes did not show any regional differences by both anova and ancova models . The result of sodium intake after adjustment of ses variables, however, showed highest intake in the factory area . Just for the male participants, differences of fat, vitamin c, vitamin e, thiamin, riboflavin, iron and cholesterol intakes were not significant among regions while protein, vitamin a and calcium intakes were higher in the urban area and lower in the rural area . After ses variables were controlled in ancova model for male participants, protein, vitamin a and calcium intakes remained lowest in the rural area . For the women, regional differences of energy - adjusted nutrient intakes were similar to those of the total participants except for protein and niacin by both anova and ancova . Energy - adjusted protein and niacin intakes of the women were higher in the factory area (p<0.05). Sodium intake also showed significantly higher intake in the factory area after adjustment with ses as the case of the total participants . 1 presents dds of the participants by regions and by sex before and after adjustment with age, income and energy intake levels . Dds were higher in the urban area for total participants and women (p<0.05), but for men, dds was not different by regions before ses variables and energy were adjusted . Only male showed different dds (higher in the factory area) while total and female participants did not show significant differences . 2 shows mar of the participants by regions and by sex before and after adjustment with age, income and energy intake levels . However, mars of rural participants were lowest for total, men and women after adjustment with age, income and energy intakes (p<0.05). Previous studies showed that selected health outcomes are dependent on adequate nutrient intakes, which rely highly on dietary quality (foote et al ., 2004; haines et al ., 1999; kim et al ., 2003), dietary diversity (guthrie & scheer, 1981; hatloy et al ., 1998; kant et al ., 1991, 1993; krebs - smith et al ., 1987) or both parameters (bernstein et al ., 2002; drewnowski et al diet quality varies widely depending on the target population, since dietary habits are complex in nature and influenced by many factors . The korean rural population exhibits a distinct pattern of food choices (ministry of health and welfare, 2002) and korea shows a unique pattern in dietary intake in terms of a lower proportion of energy from fat compared to both developed and developing countries (lee et al ., 2002). In this study, we described the nutrient intakes, dietary diversity (dds), dietary quality (mar) and health related behaviors of asan residents . This population is unique since asan has regionally unique features so that the results of the current study may not be applicable to others residing in urban communities or geographical locations . Our results showed that social economic status (ses) of asan residents was significantly different by different regions . As korea becomes industrialized, urbanization is more prompt and the tendency of urbanization is not different in asan . The younger urban resident showed higher education and income levels . About 50% of the participants of the present study were older than 65 years, and their education and income levels were lower than the korean averages . Sixty - four percent of the total participants were educated up to the elementary school level only, with this increasing to 88% among those who are older than 65 years (data not shown). Therefore, the general ses of asan residents is lower than the korean average, with urban residents being the youngest and highest in education and income levels compared to rural or factory areas . Rural and factory area residents did not show much difference in education and income levels although there were more elderly residents in the factory area . The energy intake and quantitative dietary diversity for the one - day diets was not high in this population even though all foods from mixed dishes were included after decomposition . Only urban women showed the similar energy intake level compared to older women (aged from 50 to 64 y) living in big cities (chung et al ., 2005). However, diet quality (mar) of urban residents went up to 1.00 while other area residents showed mar being 0.86 for rural and 0.95 for factory residents . The difference of mar became significant for all participants regardless of sex after the ses factors were controlled . Therefore, the true regional differences in quality of diet exist in the population of asan, and public health strategies to improve diet quality of rural residents should be considered . The proportion of carbohydrate contributing to energy intake was very high (69%, data not shown) and that of fat was very low (15% vs. 19% korean national average; ministry of health and welfare, 2002). This high proportion of energy intake from carbohydrate may have limited the selection of foods from other groups in our population . The 1998 korean national health and nutrition survey found that the 30 most - consumed foods were similar in all areas except for rural areas, where three different kinds of kimchi were included in the top-10 most - consumed foods (ministry of health and welfare, 2002). Many participants in the present study, especially older women from the rural area, reported that they consumed rice and kimchi almost exclusively, with few animal products and fresh fruits (data not shown). The limited food choices resulting in a low dietary diversity may be related to the insufficient intake of essential nutrients in the korean rural population including the rural and factory area participants of this study . Especially, after the ses factors were controlled, significantly low dds of rural men reflect the poor quality of diet among this population . The current major concerns in korea as in many other countries are over nutrition and excess intakes of certain nutrients and foods rather than under nutrition (ministry of health and welfare, 2002). However, our results demonstrated that insufficient intakes of essential nutrients such as protein, vitamin a and e, riboflavin and calcium are still a problem in the rural area of asan even after ses was controlled . Therefore, korean nutrition concerns should focus on dietary quality including both the concepts of nutrient deficiency and over nutrition . Especially, significantly low dietary diversity of rural men and low quality measured with mar of rural men and women are of particular concern other health behaviors such as drinking, physical activity and perceived stress levels were much better among rural or factory residents compared to the urban residents, although exercise habits and perceived health were better in urban residents . (2005) with korean national data also reported that self - rated usual activity showed higher in the rural area while higher exercise rate in the urban areas . Therefore, the urban area residents of asan showed better nutrient intakes, dietary quality and exercise habits, which may result in the better perceived health compared to the rural or factory area residents of asan . The rural or factory area residents of asan showed much less perceived stress, however, even though nutrient intakes and dietary quality were not as good as urban residents . Urban residents reported higher perceived stress even if they exercised more, ate better diets and showed better perceived health . In conclusion, ses and quality of life measured by diet intakes and perceived health were lower in the rural area residents of asan . Therefore, in order to achieve better quality of life and health status of the rural residents of asan, improving diet quality is essential . For the urban resident, however, despite of higher ses and diet quality, their perceived stress was higher . Therefore, health promotion education to reduce the stress levels for urban residents of asan should be recommended.
The treatment of chronic hepatitis c (chc) has evolved in the last 15 years from monotherapy with interferon alpha (ifnalpha) to the combination treatment with pegylated ifn (peg - ifn) plus ribavirin for 24 - 48 weeks . Up to now, several viral, host and drug - related reactions in response to ifnalpha - based therapy have been identified . Recent studies suggest that liver inflammation in chc is controlled by several mechanisms, including host regulatory immune responses and viral polypeptides interacting with cells involved in innate and adaptive immunity . It is well known that cutaneous side effects of treatment with ifnalpha alone or ifnalpha plus ribavirin in patients with chc have been widely reported, beyond the fact that the virus itself can cause skin lesions . However, the cutaneous side effects during therapy of chc are of inflammatory type with local erythema, edema and, much less frequently, necrosis at the injection skin sites . By contrast, skin side effects of such drugs have few data available in the literature, although the number of reports has been increasing in the last years, including cosmetic filler site injections . Roughly one half of these patients had cutaneous findings, either alone or with systemic involvement . More recently there have been reported dermatological diseases in patients receiving the combination of ifn / ribavirin or ifn / ribavirin / amantadine for the treatment of chc . A 44-year - old man with chc genotype 1a and a viral load of hcv> 800,000 iu / ml, a2-f1 on liver biopsy according to metavir criteria, was treated for the hepatic disease . Peg - ifnalpha-2b 1.5 g / kg weekly and 1,000 mg of ribavirin daily was introduced . In the 40th week the patient reported sudden intense pain, pruritus, erythema and skin hypertrophy in the left deltoid area over the seahorse tattoo and in a scar on his face (fig . 1). A skin biopsy on the scar and tattoo showed granulomatous dermatitis (fig . Chest x - ray was normal and the level of angiotensin enzyme converter was 50 iu / ml (range 18 - 55 iu / ml). We intend to call attention especially to dermatologists to the possibility of a granulomatous tattoo reaction as a side effect during chc treatment with peg - ifnalpha-2b plus ribavirin . Until now, eight cases of sarcoidosis as a complication of ifn therapy in chc have been reported in the english language literature . The most relevant topic in this case is the occurrence of disease on a tattoo area . Six months later retreatment using peg - ifnalpha-2a 180 g once a week plus ribavirin 1,000 mg daily was tried . In the 6th week, cutaneous symptoms relapsed in an unbearable way . The patient did not accept to continue therapy, since hydrocortisone cream was prescribed again but no satisfactory pruritus and pain improvement was noticed . A prompt regression of skin reaction occurred after stopping therapy . Sarcoidosis is a granulomatous disorder of unknown etiology and whose epidemiology suggest a genetic tendency face to infectious agents being supposed to result of immune system deregulation leading to non - caseating granulomas as an immune reaction to an unknown persistent antigenic stimulus . Ifn has been linked to pulmonary macrophage activation, a characteristic feature of sarcoidosis which has been assumed an exaggerated t helper 1 (th-1) immune response to a variety of exogenous antigens . It seems very likely that a potent immunoregulatory protein for th-1 response such as ifn may induce the disease . In january 2003 the eighth case of ifn - related sarcoidosis was reported with a review of the literature . Chest x - ray revealed hilar lymphadenopathy in three patients, with reticulonodular shadows in another three, while the patient with only cutaneous involvement had a normal chest x - ray . The case we report presented with cutaneous sarcoidosis during chc therapy and spontaneous regression of the lesions was noted with treatment discontinuation . We intend to emphasize, especially to dermatologists, the risks of a granulomatous tattoo and other cutaneous sites during chc treatment with peg - ifnalpha-2b plus ribavirin . Thalidomide has been also shown to have specific activity to the inflammatory mediators of sarcoidosis and to be an alternative beneficial therapy.
Pleomorphic carcinoma is an aggressive tumour initially described in the lung by nash and stout . In the 4th edition of the world health organization (who) classification of tumours of the lung, pleomorphic carcinoma is defined as a poorly differentiated (squamous cell carcinoma or adenocarcinoma) or undifferentiated carcinoma in which at least 10% spindle and/or giant cells are identified, or as a carcinoma constituted purely of spindle and giant cells . Primary sites of occurrence of extrapulmonary pleomorphic carcinomas have been described in other organs such as the stomach, thyroid, gallbladder, pancreas, kidney, liver, bladder, and colon . To the best of our knowledge, only one report described a case of giant cell carcinoma of the colon resembling that observed in the lung . Based on the recommendations of the nomenclature committee on cell death, mitotic catastrophe is defined as a tumour - suppressive mechanism occurring during or after aberrant mitosis leading to cell death or cell senescence . Histological patterns of micro- and multinucleation have been used as morphological markers for the detection of mitotic catastrophe [5, 6]. A high frequency of multinucleated giant cells is characteristically found in pleomorphic carcinomas . In this report, we present an additional case of primary pleomorphic carcinoma of the colon, and we underline similarities to and differences from pulmonary pleomorphic carcinoma . The possibility of the pleomorphic component as morphological expression of mitotic catastrophe is finally discussed . A 65-year - old caucasian woman with a medical history of hypercholesterolaemia, chronic obstructive pulmonary disease, and paroxysmal tachycardia was admitted to the surgery unit of the university hospital g. martino (messina, italy) in 2013 for abdominal obstructive symptoms (colicky pain to the right iliac fossa as well as borborygmi), change in bowel habits (diarrhoea), asthenia, and severe weight loss since 6 months . There was no nausea or vomiting . On physical examination, a globular and tympanic abdomen, painless at superficial and deep palpation, was evident . She reported a history of adequate food intake with regular bowel habits, alcohol consumption (<20/30 g daily), and smoking . There was no family history of gastrointestinal malignancy, although familiality for bladder carcinoma was reported . Abdominal ultrasonography highlighted an exophytic / stenosing mass at the level of the ascending colon . Afterwards, colonoscopy also revealed an exophytic / stenosing malignant neoplastic mass in the caecum, subsequently confirmed through histological evaluation of biopsy . Carcinoembryonic antigen (value for smokers <10.0 ng / ml) and carbohydrate antigen 19 - 9 (value <35 iu / ml) were within normal limits . A contrast - enhanced computed tomography scan showed no evidence of liver or distant metastases . Routine haematoxylin - eosin sections were made from formalin - fixed, paraffin - embedded tissue . Sections were also stained with periodic acid - schiff and alcian blue at ph 2.5 . Additional sections collected on silanized, coated slides were used for the immunohistochemical stains, using the dako envisiontm flex, high ph detection system together with autostainer instruments . The commercial source, clone, and dilution of the primary antibodies are detailed in table 1 . Macroscopic examination of the resected colon revealed an endophytic / ulcerative lesion measuring 7 cm in its greatest dimension, invading the caecum nearly to the ileocaecal valve . Microscopically, the tumour was a poorly differentiated adenocarcinoma with a grade 4 pleomorphic component that occupied up to 10% of the whole tumour section . The pleomorphic component showed trabeculae and nests of neoplastic cells possessing eosinophilic cytoplasm, as well as irregularly shaped vesicular nuclei with a single large eosinophilic nucleolus . Giant cells containing multiple nuclei, micronuclei, and prominent eosinophil nucleoli were also found (fig . The micronuclei appeared as round chromatin fragments with a diameter less than one third of the diameter of the nucleus . 1b) and large geographical necrotic areas with sharp boundaries with respect to the viable tumour tissue (fig . Only 1 out of the 44 harvested perivisceral lymph nodes presented carcinomatous metastasis (pt3, pn1, clinical stage in accordance to the 2009 ptnm system). The histochemical stains were negative for periodic acid - schiff and alcian blue in all of the pleomorphic neoplastic cells . On the immunohistochemical stains, these cells were diffusely and strongly positive for ceap, ckae1/ae3, ck7, and vimentin, but they were negative for ck20, smooth muscle actin, desmin, synaptophysin, and -human chorionic gonadotropin . 2b), whereas p53 labelling was shown in more than 90% of the tumoural nuclei (fig . We described a rare case of pleomorphic carcinoma of the right colon showing opposing clinicopathological features . Although it was classified as a grade 4 tumour, it was characterized by a pushing growth pattern and presented only one lymph node with metastasis . These data confirm that classic grading of colorectal carcinoma is insufficient to predict a prognosis, and that further parameters such as growth patterns are needed . Accordingly, several recent studies have shown that colorectal carcinomas with pushing margins are associated with superior disease - free survival rates when compared with tumours with infiltrative margins . The present tumour had some of the morphological features described in giant cell carcinoma of the lung, such as pleomorphic tumour cells, malignant giant cells, atypical mitoses, and coagulative necrosis . However, pleomorphic carcinoma of the lung has been reported to have a poor prognosis, whereas in our case, the patient has been well without evidence of recurrence or metastases 2 years after the operation . Many studies suggested that pleomorphic tumours are a heterogeneous group of neoplasms arising in different anatomical sites (e.g. Lung, uterus, breast, central nervous system) characterized by variable morphological features and prognoses [8, 9, 10, 11]. In particular, a certain percentage of patients affected by them were found to be long - term survivors despite the anaplastic morphology of their primary neoplasms [8, 10, 11]. The differential diagnosis of pleomorphic carcinoma includes adenocarcinoma with a choriocarcinomatous component as well as mixed adenoneuroendocrine carcinoma [7, 12, 13]. A choriocarcinomatous component usually is characterized by immunoreactivity to -human chorionic gonadotropin, which was not found in our case, while the latter was excluded by the lack of expression of neuroendocrine markers such as synaptophysin and chromogranin [12, 13]. In our case, multinucleated tumour cells contained not only abnormally large giant nuclei but also those that are abnormally small, in the form of micronuclei . The presence of micronuclei is usually overlooked in the reports of pleomorphic carcinoma in the current literature . Micronuclei derive from chromosomes and/or chromosome fragments that have been irregularly distributed between daughter nuclei after abnormal mitosis . Besides micronucleation and multinucleation, we interpret these findings as a morphological expression of mitotic catastrophe, a particular type of cell death occurring in tumour cells after aberrant mitosis [5, 6, 14]. After mitotic catastrophe, tumour cells may continue to divide and thus develop polyploidy and/or aneuploidy . Ki-67 is an antigen of cell proliferation frequently used in routine histopathological diagnostics as a prognostic factor in more malignancies . Specifically, it is an epitope of a nuclear and nucleolar protein of 360 kda only expressed in nuclei of cells in active proliferation, i.e. During cell cycle phases g1, s, g2, and m, but not in the quiescent phase, i.e. In cell cycle phase g0 [17, 18]. Normally, p53 acts as a guardian of the genome, protecting cells against cancer via two main ways: by determining cell cycle arrest at g1 and g2/m and by inducing cellular apoptosis [19, 20]. Nuclear p53 immunohistochemical positivity in tumour cells suggests mutation in the p53 gene [21, 22]. Thus, immunohistochemical overexpression of p53 and ki-67 constitutes further evidence of mitotic catastrophe in the pleomorphic component of our case of colonic neoplasm . Ionizing radiation and different classes of cytotoxic agents induce cell death through mitotic catastrophe [15, 18]. Histological recognition of mitotic catastrophe could be useful to predict an eventual pharmacological modulation (induction or inhibition) of tumour cell death . Therefore, mitotic catastrophe has recently gained attention as a potential therapeutic target in neoplasms [23, 24, 25]. In summary, we reported a case of colorectal carcinoma with clinicopathological features partially similar to pleomorphic cell carcinoma of the lung, a neoplasm associated with a bad prognosis . In particular, this tumour presented only one lymph node with metastasis, and the patient is still well 2 years after the operation . This case presented morphological and immunohistochemical features compatible with mitotic catastrophe, a form of non - apoptotic cell death due to aberrant mitosis . The inclusion of mitotic catastrophe as part of a microscopic evaluation may be useful for understanding the pathogenesis of this rare entity and for new cancer treatment modalities . No further ethical approval was necessary to perform histology and immunohistochemistry in the case included in this report.
Management of suspected scaphoid fractures with normal x - rays at emergency department (ed) presentation is a common clinical challenge . There has long been concern that failure to identify and immobilise a scaphoid fracture might result in avascular necrosis or non - union with significant functional impact for the patient and potential medico - legal risk for the practitioner . Traditional management would see the patient immobilised in a plaster cast for 714 days followed by clinical examination and re - x - ray to identify fractures not visible on the initial films . That approach can been challenged on two fronts: whether cast immobilisation while awaiting clinical review is justified and the role of alternative imaging modalities at or near the time of initial presentation . The aim of this project was to characterise current management of adult patients with possible occult scaphoid fracture in australasia . This was an internet - based survey of directors of emergency medicine training (demt) throughout australasia as identified from the australasian college for emergency medicine web - site (www.acem.org.au). Demts are the designated supervisors of specialist training at hospitals accredited for training, both metropolitan and rural (one / hospital). As such, they are easily identifiable, experienced specialists with a good understanding of clinical practice within the ed in which they work . Participants were sent an invitation to participate in the confidential on - line survey by e - mail (where one could be found) or by post . Data were collected using internet - based survey software (www.surveymonkey.com) and included the most common management strategy used for patients with possible occult scaphoid fracture (from a range of options, see table 1) and whether there was a written ed guideline regarding management of such cases . The outcome of interest was the most common management strategy for possible occult scaphoid fractures . Table 1management options and reported frequencymanagement strategyfrequency (n,%) backslab (half - cast) with assessment and re - x - ray at 714 days23, 38%plaster cast (full) with assessment and re - x - ray at 714 days19, 32%backslab with early ct (within 7 days)6, 10%backslab with early bone scan (within 7 days)5, 8%backslab with early mri (within 7 days)2, 3%support bandage with early mri (within 7 days)1, 1.7%support bandage with early ct (within 7 days)1, 1.7%plaster cast (full) with early ct (within 7 days)1, 1.7%plaster cast (full) with early bone scan (within 7 days)1, 1.7%support bandage with re - assessment at 1 week, with further tests only if symptoms or signs persist1, 1.7%support bandage with assessment and re - x - ray at 714 days0plaster cast (full) with early mri (within 7 days)0support bandage with early bone scan (within 7 days)0othersame / next day ct1, 1.7% management options and reported frequency this project was approved by western health under the nhrmc quality assurance guidelines . The most common management reported was immobilisation in a backslab (23, 38%) or full cast (19, 32%) with clinical assessment and re - x - ray in 710 days . Ct scan within 7 days was used by 9 (15%), bone scan within 7 days by 6 (10%) and mri within 7 days by 3 (5%). Eighty - three percent of sites reported not having a written guideline / protocol for this condition . The rate of occult scaphoid fractures in cohorts of patients with clinical evidence suggestive of scaphoid fracture but normal initial x - rays is reported to be 016% [24], weighted average 3.7% (95% ci 2.55.6%). In the subgroup who prove to have a fracture, the rate of delayed / non - union is low (1020%). Traditional treatment for suspected occult scaphoid fracture is cast immobilisation with clinical re - assessment and re - x - ray at 710 days . That approach, however, has been suggested to be over - treatment, with a very low rate of significant fractures at the cost of significant time lost from work or school [57]. It has been suggested that symptomatic treatment with follow - up within 2 weeks for these cases is sufficient [6, 8, 9]. We found that most australasian eds continue to use plaster immobilisation for this patient group (backslab or full cast, 70%) and that uptake of alternative imaging modalities is only moderate (30%). The high use of immobilisation is at odds with reported uk practice, where only 46% of eds reported routinely using plaster immobilisation for x - ray - negative suspected scaphoid fracture . Ct, mri and bone scan have all been shown to be effective in the diagnosis of occult scaphoid fractures, but to date no studies have shown additional benefit from early advanced imaging for hard clinical outcomes . At present, the logical role for advanced imaging is for patients with persistent symptoms and normal follow - up x - rays . There is a clear need for further research comparing combinations of the various immobilisation and imaging strategies and reporting clinical outcomes (including time off work and time immobilised) and cost - effectiveness outcomes . There is no evidence that lack of access to advanced imaging impacts adversely on clinical outcome . The weight of evidence would suggest that this is over - treatment and that a simple bandage is sufficient . As this was a survey, the management strategy reported may not be that actually used . The traditional approach to management of possible occult scaphoid fracture of immobilisation with re - x - ray at 710 days remains the most commonly used in australasia, despite evidence that this is probably over - treatment with significant consequences for patients.
Women's reproductive health is a major area of concern, especially in developing countries . Maternal complications and poor perinatal outcome are highly associated with nonutilization of antenatal and delivery care services and poor socioeconomic conditions of the patient . More than half a million women die annually worldwide because of pregnancy - related complications . Migration is the most observable and impressive fact in the growth of cities, and it is also considered as an essence of urbanization in the globe . In india, major cities have noticed an increase of around 75% population due to migration . Migrants face numerous constraints, including lack of political representation; inadequate housing and lack of formal residency rights; low - paid, insecure, or hazardous work; limited access to state - provided services such as health and education; and discrimination based on ethnicity, religion, class, or gender . Migrants face denial of basic entitlements including access to subsidized food, housing, drinking water, sanitation and public health facilities, and education and banking services and often work in poor conditions devoid of social security and legal protection . Internal migrants in india constitute a large population: 307 million internal migrants or 30% of the population and by more recent estimates 326 million or 28.5% of the population . Out of the total internal migrants, 70.7% are women . Marriage is given as the prominent reason for female migration in both the rural and urban areas migration of women has been acknowledged as a demographic factor which affects the reproductive health of women . The migrant women, who move to the urban areas, face many challenges in relation to access to health care . A study showed that female migrants are vulnerable to environmental, social, and institutions forces that may affect their health - seeking behavior . Women of socially disadvantaged groups, migrant, and/or from ethnic minority groups have been recognized to be less likely to receive early prenatal care and the necessary care during pregnancy, childbirth, and postnatal period . Empirical evidence has pointed out that migrant groups face several barriers in accessing national maternal health services . Maternity care is classed as essential care and so cannot be refused due to inability to pay . There is no scope for special care for such vulnerable population in india, at present . Women suffer more because though antenatal care (anc) services are available, they could not reach them . Hence, assessment of present situation of migrant women with reference to anc services utilization and institutional deliveries becomes essential . Thus, this study was conducted with following objectives among interstate female migrants . To study socioeconomic and demographic profile of migrant womento estimate proportion of women utilizing full anc package and reasons for nonutilization of full anc servicesto estimate the proportion of institutional deliveries and reasons for home deliveries among the migrant women . To study socioeconomic and demographic profile of migrant women to estimate proportion of women utilizing full anc package and reasons for nonutilization of full anc services to estimate the proportion of institutional deliveries and reasons for home deliveries among the migrant women . To study socioeconomic and demographic profile of migrant womento estimate proportion of women utilizing full anc package and reasons for nonutilization of full anc servicesto estimate the proportion of institutional deliveries and reasons for home deliveries among the migrant women . To study socioeconomic and demographic profile of migrant women to estimate proportion of women utilizing full anc package and reasons for nonutilization of full anc services to estimate the proportion of institutional deliveries and reasons for home deliveries among the migrant women . A cross - sectional community - based survey was conducted among migrant women in reproductive age group in an urban slum of population (30,000), which is the field practice area of a medical college . Sample size was calculated using formula, where p is prevalence of the event, q is probability of nonoccurrence of event, and l is allowable error, the prevalence of anc services utilization according to the national family health survey-3 is 77%, and considering 10% allowable error, sample size comes approximately 120 . If there are no women fulfilling inclusion criteria in a randomly selected household, then next household was selected . If there is more than one woman in a household fulfilling inclusion criteria, then only one woman was selected by lottery method from that household . The national sample survey organization 2008 defined migrant as a household member whose last usual place of residence (upr) any time in the past was different from the present place of enumeration was considered as a migrant member in a household . In this survey, upr of a person was defined as a place (village / town) where the person had stayed continuously for a period of 6 months or more . Full anc received by women: it is defined as having 3 components (a) at least 3 antenatal visits to health center, (b) at least 1 tetanus toxoid (tt) vaccine taken before delivery, and (c) consumption of 100 or more iron and folic acid (ifa) tablets . Migrants (as per the above definition) from outside maharashtra (interstate migrants)married women in the age group of 1545 years who had delivered within last 2 yearsthose who consent was included in the study . Migrants (as per the above definition) from outside maharashtra (interstate migrants) married women in the age group of 1545 years who had delivered within last 2 years those who consent was included in the study . Interviews were conducted at the randomly selected households after getting informed written consent of participants . Pretested semi - structured questionnaire for face - to - face interview was prepared . Initial visits to the above - said areas were done to build rapport with the population as they are hesitant to get interviewed . Their household was visited with the female social workers, and meetings conducted by social workers were attended . While interacting with the participants, one representative from the social workers was always present . Data were coded, entered, and analyzed using open epi software (open source epidemiologic statistics for public health)version 3.01 . Chi - square test was used for evaluating association between anc utilization and categorical variables . The national sample survey organization 2008 defined migrant as a household member whose last usual place of residence (upr) any time in the past was different from the present place of enumeration was considered as a migrant member in a household . In this survey, upr of a person was defined as a place (village / town) where the person had stayed continuously for a period of 6 months or more . Full anc received by women: it is defined as having 3 components (a) at least 3 antenatal visits to health center, (b) at least 1 tetanus toxoid (tt) vaccine taken before delivery, and (c) consumption of 100 or more iron and folic acid (ifa) tablets . Migrants (as per the above definition) from outside maharashtra (interstate migrants)married women in the age group of 1545 years who had delivered within last 2 yearsthose who consent was included in the study . Migrants (as per the above definition) from outside maharashtra (interstate migrants) married women in the age group of 1545 years who had delivered within last 2 years those who consent interviews were conducted at the randomly selected households after getting informed written consent of participants . Pretested semi - structured questionnaire for face - to - face interview was prepared . Initial visits to the above - said areas were done to build rapport with the population as they are hesitant to get interviewed . Their household was visited with the female social workers, and meetings conducted by social workers were attended . While interacting with the participants, one representative from the social workers was always present . Data were coded, entered, and analyzed using open epi software (open source epidemiologic statistics for public health)version 3.01 . Chi - square test was used for evaluating association between anc utilization and categorical variables . Table 1 shows that 77% (93/120) of migrants were under the age of 29 years . Sixty - two percent (74/120) of migrants were married before the age of 18 years though marriage before the age of 18 years is punishable by law . Sixty - four percent (77/120) of migrants were belonged to lower socioeconomic class . Sociodemographic profile of migrant women with their association with full antenatal care package utilization table 2 shows that almost three - fourth of migrants were hailing from uttar pradesh followed by bihar, i.e. 11.7% (14/120). Thirty - three percent (40/120) of migrants visited their native place at least once in 6 months . Migration details of female migrants table 3 depicts that even after availability of reproductive and child health (rch) services in slum area, still 10% (12/120) of mothers did not register for anc services . Registration percentage in the first trimester is less, i.e., 21% (25/120). These women could not be educated about various health topics such as nutrition, immunization, and family planning . Nearly 63.4% (76/120) of mothers visited at least three times to health - care facility . Thirty - seven percent (44/120) of mothers were not able to visit health - care facility at least three times . Fourteen percent (17/120) of mothers did not consume a single tablet of ifa . Ten percent (12/120) of mothers did not receive a single injection of tt . Antenatal care services utilization by migrant women table 4 shows that 12% (15/120) of deliveries occurred in home . Even after implementation of rch program with janani suraksha yojana which emphasizes on institutional delivery delivery practices of migrant women table 5 shows that most of the participants, i.e., 30% (36/120) mentioned that too far location of government health facility was the most common reason for full nonutilization of anc services . They did not want to bear expenses toward traveling to health center, and visit to health center leads to loss of their daily wages . Nearly 25.8% (31/120) migrant women did not think it is necessary to utilize full range of anc services . Elder members in family did not allow 20.8% (25/120) anc mothers to go for regular anc visits as they did think it is necessary . They expect that their children should follow the same practice as they practiced at their time . Poor quality service at health center 17.5% (21/120) was one of the important reasons mentioned by migrants . Staff working at health center was not cooperative, spoke arrogantly, investigations and necessary medicines were not available are the reasons included in poor quality services . 15.8% of migrant women said they have not utilised anc services fully as they were not having any information (lack of knowledge) about this services . A study conducted in urban slums of delhi showed that majority of migrants were hindus (61%), aged 2429 years (44%), with a literacy rate of 38% . Majority of migrants were muslims (73%), aged 1823 years (39%). Twenty - seven percent were illiterates, and anc care utilization was significantly associated with religion and type of family . A cross - sectional study conducted in tribal blocks of maharashtra showed that anc registration in the first trimester is 63.8%, 82% received tt injections, 68.5% consumed ifa tablets, and 72% paid at least three visits to health centers . As compared to this study, in the present study, the percentage of anc registration in the first trimester is very low, i.e., 21% . Most of the anc migrants registered in the second trimester . Almost 91% of migrant women received at least one tt injections . Ifa tablets are consumed by all, but 100 tablets were consumed by only 28% of migrants . Therefore, in the present study, ifa consumption and no of anc visits to health center are very less . These figures clearly point out toward the inadequate utilization of anc services by migrants women . A cross - sectional study was carried out among recently delivered women residing in tea gardens of darjeeling district of west bengal . It mentioned that the major barrier toward utilization of these services was ignorance followed by distance to the health - care center . According to the district level household and facility survey 2007/2008, the percentage of institutional delivery and home delivery in urban area is 87.5% and 12.5%, respectively . Delivery at home conducted by skilled health personnel was 2.8% . In the present study, a community - based cross - sectional study conducted in urban area in nainital district mentioned that high proportion of home deliveries even in urban area despite proximity to hospitals is a result of many factors including weak demand, minimal outreach services, weak community - provider linkages, and timings that often do not suit the daily - wage - earning urban poor . In the present study, out of 15 home deliveries, 11 deliveries reason mentioned was lack of transport facility to hospital . Maternity care is an essential care which has to be made acceptable, accessible, and available at a cost affordable to women, but in case of migrant women, it is available but not acceptable and accessible due to above - mentioned reasons . The present study revealed low utilization of pregnancy - related health - care utilization among the study population . Health - care workers and influential people from muslim community should be made aware and trained in explaining necessity of maternal and child health (mch) care . For this purpose, during health awareness session, elder members of the family specially mother - in - laws have to be involved on a priority basis and educated about importance of full anc care utilization and institutional delivery . If necessary, one - to - one counseling should be provided to convince them about correct practices . In the present study, the percentage of anc registration in the first trimester is very low, i.e., 21% . Moreover, migrant woman feels comfortable to conduct delivery by dai if she is available . It means that the message of importance of institutional delivery is not reached or convinced to beneficiaries . Auxiliary nurse midwife, accredited social health activist, and anganwadi workers are not reached to them . Then, it becomes necessary to train presently working and close to population dais also so that they will conduct deliveries following proper aseptic precautions, i.e., to follow all 7 cs - clean hand, clean blade, clean cut, clean cord, clean tie, clean towel, and clean bed . Poor quality service by health workers is one of the reasons for nonutilization of anc services . Health - care workers should give sufficient time to counsel patients, or one counselor should be posted for a primary health center (phc) area (six subcenters) so that he / she should visit each subcenter under the phc area at least for a day in a week and educate groups or counsel patients on various health topics with proper feedback mechanism . Frequency of outreach activities should also be increased for migrant women staying at a far distance from health center in slums which does not come under municipal corporation . This study can provide new insight for policy makers to devote resources for achieving the best possible quality of mch services.
Phytoestrogens, naturally occurring hormone - like compounds with a unique diphenolic structure found in several plants, have received much attention as dietary components as they are known to promote better health . Phytoestrogens have been also associated with reduced incidence of various cancers, cardiovascular disease, and osteoporosis and lower cholesterol level [25]. Some studies suggest that the dietary intake of phytoestrogens decreases the risk of breast cancer in humans [6, 7]. The most extensively studied phytoestrogen in vitro and in vivo is genistein which is found richly in soybeans . However, biological activities of many other naturally occurring isoflavones have not been studied in detail till now . The phytoestrogen daidzein is an isoflavone present as a glucoside in many plants used in human diets . Daidzein is especially concentrated in soy and soy - based products used for human consumption [8, 9]. A higher incidence of breast cancer in western population is seen as compared to asians who consume diet containing relatively high levels of low - fat, high - fibre, high - soya content . Asian women show protection against breast cancer in comparison to women living in usa or britain [11, 12] which is believed to be lost upon immigration and exposure to western lifestyles within a few generations . These studies suggest that exposure to phytoestrogens at an early stage is extremely important, in order to gain their cancer - preventive effects . The female mammary gland undergoes cell division during puberty, and throughout adult life there is cyclical proliferation and involution during the estrous cycle . During early development, rising endogenous estrogen promotes mammary duct branching which ends in highly proliferative structures, terminal end buds (tebs). At postnatal day (pnd) 21, the number of tebs is maximal, and at puberty the onset of estrous cycles results in changing progesterone and estrogen levels that promote differentiation of tebs to the less proliferative alveolar buds or lobules [1517]. Highest number of tumours per animal was observed when carcinogen exposure occurred in rats at postnatal day 4050, a time when mammary gland exhibits a high density of the highly proliferative tebs . The incidence of carcinomas is positively correlated with the number of tebs in mammary gland of the young virgin rat at the time of carcinogen exposure [16, 17]. Administration of the phytoestrogen genistein to neonatal and prepubertal rats reduced tebs by promoting teb differentiation [18, 19]. A study on sprague dawley rats (mammary tumor model) shows that daidzein has been an effective inhibitor of dmba - induced mammary tumor . Chemoprevention study from our lab has also shown a decrease in tumor burden and incidence by prepubertal daidzein administration . Although daidzein also has the ability to bind to the ers, the precise mechanism of action by which it shows a chemoprevention against breast cancer has not been clearly elucidated . Considering the above literature, it could be hypothesized that daidzein could also affect the differentiation and signaling pathways as a mechanism of chemoprevention . Hence, to explore the mechanism of actions of daidzein, its effect on cell proliferation, mammary gland differentiation, and the expression of ers in a prepubertal mammary tumour model was carried out . Daidzein, estradiol benzoate (eb), and hoechst 33258 were bought from sigma aldrich co. (st . Louis, mo, usa), while dimethyl sulphoxide (dmso) and carmine were bought from qualigens (india)., santa cruz, calif, usa, and secondary antibodies, diaminobenzidine (dab), avidin - biotin complex, and normal goat serum (ngs) were purchased from bangalore genei (india). Female sprague dawley rats, kept in animal facility in a 12 hr day: 12 hr night cycle, and maintained in the animal house of the university were used for the present study . The studies were conducted according to the ethical guidelines of committee for control and supervision of experiments on animals, government of india, on the use of animals for scientific research . Experiment 1a total of thirty - six animals (female sprague dawley offsprings) of the same age were divided into 3 groups of 12 each . On postnatal days 16, 18, and 20, while group ii and iii were injected subcutaneously with 500 g / g body weight daidzein and 500 ng / g body weight of estradiol benzoate (eb), respectively [19, 23], an equal volume of vehicle (dmso) was injected to the animals of group i (control, dmso). On the 21st day, 18 hours after the last injection, 6 animals from each group were sacrificed and the rest of the 6 were maintained till the 50th day and sacrificed thereafter . The mammary glands obtained at both times (pnd21 and pnd50) were preserved for differentiation study . A total of thirty - six animals (female sprague dawley offsprings) of the same age were divided into 3 groups of 12 each . On postnatal days 16, 18, and 20, while group ii and iii were injected subcutaneously with 500 g / g body weight daidzein and 500 ng / g body weight of estradiol benzoate (eb), respectively [19, 23], an equal volume of vehicle (dmso) was injected to the animals of group i (control, dmso). On the 21st day, 18 hours after the last injection, 6 animals from each group were sacrificed and the rest of the 6 were maintained till the 50th day and sacrificed thereafter . The mammary glands obtained at both times (pnd21 and pnd50) were preserved for differentiation study . However, this time the mammary glands obtained at pnd21 and pnd50 were stored for immuno - histochemical experiments . However, this time the mammary glands obtained at pnd21 and pnd50 were stored for immuno - histochemical experiments . All mounts of fourth pair of the mammary gland of the animals were prepared . Mammary glands were dissected at the time of sacrifice, spread on the microscope slide, and then placed in neutral buffered formalin for 8 h (22-day - old animals) and overnight (50-day - old animals). Glands were defatted in acetone for 4 h or overnight, placed in 70% alcohol for 30 min, hydrated in water (15 min), and stained in alum carmine for overnight . After staining, glands were run through a series of graded alcohols (30100% ethanol) and placed in xylene to clear the tissue . Glands were then compressed between two glass slides for 24 h, released and allowed to expand for at least 8 h, and finally mounted using a glass coverslip and dpx . All mounts were then evaluated via light microscopy using the criteria established by russo and russo [16, 17] and murrill et al . . All mounts were evaluated for the number of terminal end buds, terminal ducts, and lobules type i by the help of the software imagepro . The mammary glands dissected were fixed in 10% neutral buffered saline, and sectioning was done by cryostat at 20 microns . Sections were treated with 10% normal goat serum (ngs) for 2 h for blocking and then incubated in the primary antibody for 3 days at 4c . The antibody was diluted in 0.1 m pbs containing 5% ngs and 0.5% triton - x-100 . After being washed in pbs, the sections were incubated in biotinylated goat antimouse igg at 1: 200 for 18 h at 4c . Following this secondary antibody step, the sections were washed and placed in preformed avidin - biotin peroxidase complex (abc) at 1: 400 dilutions for two hours at room temperature . For visualizations of the reaction sites, the sections were treated with the chromogen diaminobenzidine (dab) and hydrogen peroxide for 2 - 3 min . The sections were rinsed with distilled water dehydrate in ethanol and coverslipped with distyrene plasticizer xylene (dpx) mounting medium . The nuclei were stained with hoechst 33258 (sigma); 10 m sections were mounted on gelatin - coated slides and washed in pbs for 10 min (figure 6). They were incubated with hoechst 33258 (1 g / ml) for 30 min in dark at room temperature . After washing twice with pbs (5 min each) and once with distilled water (5 min), the slides were coverslipped with 10% glycerol and stored in dark . The slides were viewed in a fluorescent microscope under the blue filter (excitation wavelength = 343 nm, emission wavelength = 483 nm). Since hoechst is membrane permeant, the procedure does not require membrane permeablization . Immunostaining was evaluated by examination of slides under a bright field microscope (carl zeiss axioscop mot 2) at magnification 400x, and images were captured through a digital camera for measurement of intensity and counting of cells . Intensities of immunostained cells were estimated by densitometry using morphometric software scion image . In order to count the number of er, bcl2, bax, caspase-3 positive cells and hoechst stained apoptotic nuclei, magnified views (400x) of sections were captured . The total cells (unstained) and immunostained cells were counted with the help of the software imagetool (uthscsa). Values were compared using one - way anova (sigma stat, jandel scientific). Differentiation of mammary gland was studied by observing the branching of mammary gland and the terminal end buds and ducts and lobular count at two different stages (i.e., pnd21 and pnd50) after a prepubertal exposure of daidzein to the animals . An increase in the count of tebs, tds, and lobules has been seen in the daidzein - treated rat mammary glands at pnd21, whereas there is a decrease in the teb and td count and further increase of lobule i count at pnd50 as compared to the control, as shown in figure 1 . A similar significant increase of tebs, tds, and lobules has also been seen in the eb - treated animals at pnd21, and a decrease is seen in tebs and tds and an increase in mammary gland lobules at pnd50 . Immunohistochemistry results at pnd21 in daidzein - and eb - treated mammary glands showed that the percentage er+ cell count decreased significantly, that is, 41.92 1.0%, p <0.001 and 39.21 0.8%, p <0.05, as compared to the control (45.7 0.5%), whereas intensity of daidzein - and eb - treated epithelial cells decreased up to 80.9%, p <0.001, and 82.8%, p <0.001, respectively, as compared to the control (100%). At pnd50, daidzein - and eb - treated mammary gland epithelial cells in both the count and intensity were shown to be increased significantly . The percentage count of er+ cells increased to 39.2 0.7%, p <0.001, and 41.54 0.7%, p <0.001, in daidzein - and eb - treated epithelial cells respectively, from control (33.65 0.57%), and intensity increased to 121.5%, p <0.001, and 125.4%, p <0.01, in daidzein - and eb - treated epithelial cells, respectively from control (100%) significantly . In 21-days - old mammary glands, the bcl2 + cell count and intensity were found to be increased significantly in daidzein - treated animals (40.26 0.38%, p <0.001; 111%, p <0.01) as well as in the eb - treated animals (44.16 1.02%, p <0.001; 122.4%, p <0.001) from control (35.9 0.6%, 100%), whereas the cell count and intensity of bax+ cells were decreased significantly in daidzein - treated animals (19.37 0.22%, p <0.05; 82.0%, p <0.001) as well as in eb - treated animals (19.7 0.68%, p <0.05; 83.6%, p <0.05) from control (23.61 0.91%, 100%). In 50-days - old mammary glands, bcl2 + cell count and intensity were decreased significantly in daidzein - treated animals (31.3 0.64%, p <0.001; 82.3%, p <0.01) as well as in the eb - treated animals (29.11 0.65%, p <0.001; 79.5%, p <0.01) from control (40.4 0.65%, 100%). Simultaneously, the cell count and intensity of bax+ cells were increased significantly in daidzein - treated animals (40.65 0.67%, p <0.001; 114%, p <0.05) and in the eb - treated cells (39.0 0.84%, p <0.001; 116.3%, p <0.01) from control (28.05 0.37%, 100%). Bcl2/bax ratio was found to be enhanced in mammary gland at pnd21 but not at pnd50 . Caspase-3 + cell count percentage was shown to be increased significantly at 50 days in mammary glands treated with daidzein (20.57 1.07%, p <0.05) and eb (23.39 1.21%, p <also the percentage apoptotic nuclei count increased in daidzein (17.94 0.46%, p <0.001) and eb (18.82 0.71%, p <0.001), compared to the control (13.28 0.42%), at 50 days, significantly (figures 25). Our data clearly demonstrates, the prepubertal exposure to daidzein by the female sprague dawley rats produces an enhancement in the differentiation of the mammary gland as well as influences apoptosis and the er expression . The highest susceptibility of a rat mammary gland to a carcinogen occurs in the postpubertal virgin females around the age of 50 days, which correlates well with the higher number of tebs and the high cell proliferation, and a low incidence of mammary carcinoma is related to the loss of tebs and the low cell proliferation activity . There was an increase in the count of tebs and tds and lobules by the prepubertal administration of daidzein in pnd21, which shows an increased proliferation in the cells, which is probably necessary for the developing of mammary gland at a prepubertal stage . Lobules are more stable structures than the tebs and tds, hence, by the increase in the count of lobules, it could be interpreted that the undifferentiated tebs and tds are progressing gradually towards the formation of more differentiated lobules, which could be due to the influence of daidzein . In a similar kind of study with genistein, it was observed that prepubertal genistein exposure increases the count of tebs and lobules at pnd21 [19, 23]. At pnd50, the decrease in the count of tebs and tds indicated a decreased proliferation, and coupling this with an increase in count of lobules at the same time suggests further enhancement in the differentiation of mammary glands at pubertal stage, in daidzein - treated mammary glands . Earlier genistein had shown a similar potential to increase the mammary gland differentiation, along with reduction of teb count and increase in the lobules, at pnd50 [19, 23]. Some of the xenoestrogens such as diethylstilbestrol (des), o, p-ddt, aroclor 1221, aroclor 1254, and 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd) also showed an enhancement in the mammary gland differentiation when administered prepubertally . Since the development of mammary gland is controlled by female reproductive hormones like estrogen, it is likely that exogenously the administration of the estrogen agonist estradiol benzoate (eb) will show an enhancement in the mammary gland development, which has also been reported earlier . Here, the eb - treated mammary glands also showed an increase in the tebs and tds at pnd21 and a decrease in the tebs and tds count along with the increase in lobules at the old mammary gland pnd50 . A similarity in the results of both eb - and daidzein - treated mammary gland differentiation data suggests that daidzein might have a similar mode and magnitude of action as that of eb, when administered to rats during the prepubertal stage . Thus, the overall results of the mammary differentiation data reveals that shortly after exposure to daidzein, there was a rapid development of the mammary gland, yielding more differentiated structures (lobules) and fewer undifferentiated structures (terminal end buds). Tumorigenesis experiments done earlier in our laboratory had also shown a decrease in tumour incidence and burden by treatment of daidzein to sd rats in the prepubertal stage . Hence this chemopreventive effect of daidzein can be correlated to the increased differentiation rate of mammary gland caused by the prepubertal exposure of compound . Immunohistochemical data of er- indicated that there is a decreased expression of er- in response to daidzein, seen in the mammary epithelial cells at pnd21 . Normally, the percentage of er--positive nuclei varies according to the developmental state of the mammary gland . Decreased expression of er- may also reflect proliferation, as proliferating epithelial cells of the mammary glands of young virgin rats do not express the receptor [27, 28], while its increase after 50 days suggests that er- expression might not be somewhat necessary for proliferation but may be required for the differentiation of mammary glands . This is consistent with our previous results which indicated that prepubertal daidzein treatment resulted in a proliferative mammary gland at pnd21, which led to a more differentiated structure evident at pnd50 . A similar result in the expression of er- in response to daidzein and eb may suggest a common molecular mechanism of action . There has been a link established between the proliferating epithelial cells and the expression of er- in developing rodent mammary gland . The increase in the count and intensity of bcl2 at pnd21 further supported the result that there might be an increase in proliferation of cells which might have resulted in the increased count of the unstable proliferating structure, tebs, accordingly . Later at pnd50, there is a decrease in the bcl2 expression which indicates decreased proliferation . This can be related to the enhanced differentiation of the mammary glands in the daidzein - treated rats, where there was an increase in the lobule count along with a decrease in the count of teb at pnd50 . And since the differentiation of the cells has increased and proliferation has slowed down, the count of bcl2 has also decreased in 50-day - old daidzein - treated rats, significantly, as compared to control . Furthermore, a decrease in the level of antiapoptotic protein bax at pnd21 and its increase in pnd50 show that apoptosis is not seen in pnd21 rather it increased in pnd50 as evaluated by the simultaneous expression levels of bcl2 and bax . The process of apoptosis is integral to normal mammary gland development, and the morphogenesis of ducts in the development of mammary gland is dependent on the selective death of epithelial cells to form mammary acini [29, 30]. Nuclear condensation and fragmentation because of degradation of dna into oligonucleosome fragments, which is a characterized feature of apoptosis, was seen to be increased in pnd50, whereas no significant change in the apoptotic level was observed at pnd21 . This was further confirmed when the apoptotic marker protein, caspase-3, which is also known to be one of the principal intracellular effectors of the apoptotic cascade, simultaneously increased in the daidzein - and eb - treated cells along with the increase in apoptotic nuclei, at pnd50 . Since daidzein and eb decrease the expression of er- in prepubertal epithelial cells along with the increase in the proliferation and differentiation of cells at the same time, it can be said that the estrogen receptor expression and the mechanism for the proliferation of cells may not be directly correlated, and both proteins might have been influenced by the test compound by separate pathways . Both processes may be independent of each other, but both might be required for the enhancement of differentiation of the gland . The phytoestrogen daidzein has a potential to regulate the differentiation of mammary gland by maintaining a balance between proliferation and apoptotic death of the cells which is critical for its normal development . Perturbations in this balance can contribute to the development of various disorders in mammary gland including cancer . Conditions that upregulate cell proliferation or downregulate apoptosis can allow the accumulation of mutations that contribute to the subsequent development of breast cancer . Daidzein enhances the differentiation of mammary gland in a controlled manner at all the developmental stages . Although the influence of daidzein on some key proliferative and apoptotic proteins has been discussed here, investigations on other cellular pathways integral to the differentiation process can be explored to have a better understanding of the mechanism of actions of daidzein . Thus, it can be concluded that daidzein, in a similar mechanism of action as that of eb, influences the differentiation of mammary gland by affecting cell proliferation proteins and the er- expression . Since the more differentiated the mammary gland is, the less susceptible it is to cancer incidence, dietary intake of daidzein from an early developmental stages may be beneficial to women folk in particular, which can be further confirmed through clinical trials.
Acute appendicitis, one of the commonest surgical emergencies, affects nearly 7% of the world's population and accounts for about 1% of all surgical operations . Faecoliths formed by mineral deposits layered with faecal debris and lodged in the appendix are called appendicoliths . The prevalence of faecoliths in the general population is 3%, and appendicoliths are seen in 10% cases of acute appendicitis . A 25-year - old male presented to us with pain in the right flank for 1 day . Urinalysis was normal, and abdominal ultrasound raised a suspicion of small calculi in the right kidney . Non - contrast computed tomography (ncct) abdomen revealed a few subcentimetric calculi in both kidneys without hydronephrosis or hydroureter . [figure 1c and d] (mineral core), composed mainly of calcium and struvite on spectral analysis [figure 1a and b]. He underwent laparoscopic appendectomy using a 10-mm supra - umbilical camera port and two 5 mm ports at the supra - pubic region and the left iliac fossa, respectively . A pre - ileal appendix was found hidden in flimsy adhesions posterior to the terminal ileum . An incidental meckel's diverticulum was also found [figure 1f], which was not pathological and was left alone . The mesoappendix was cut using harmonic scalpel (johnson and johnson make) and the appendix was cut at the base between ligatures [figure 1e]. It was removed using a glove bag after enlarging the supra - umbilical incision because of the large stone size 2.5 cm 3.0 cm [figure 1 g and h]. Ncct abdomen (a and b) the ct spectral analysis of the appendicolith shows the highest peak of the histogram corresponding to struvite - calcium (c) multiplanar reconstruction (mpr) coronal image showing appendicolith 2.50 cm size (longitudinal) (d) axial image showing appendicolith 2.10 cm size (transverse) (e - h) laparoscopic appendectomy, procedure, specimen and appendicolith (e) multiple ligations of base of appendix (f) meckel's diverticulum (g) size of appendicolith 3 cm on longest axis (h) size of appendicolith 2.5 cm on the perpendicular axis acute appendicitis was first reported by fitz in 1886, and wangensteen and bowers proposed the theory of an obstructive component as a causative factor in 1937 . Other proposed aetiologies include lymphoid hyperplasia, constipation, trauma, diet, genetic predilection, hypersensitivity and mucosal ulceration . Appendicolith on plain abdominal x - ray is a reliable sign of appendicitis (70%). However, computed tomography (ct) is more sensitive, detecting even non - calcified faecoliths . On ct, appendicoliths appear as laminated bodies with gas in centre or homogenous opacity . When symptomatic, they carry 90% probability of acute appendicitis and 50% higher risk of perforation and abscess formation . Some authors have found good correlation (65 - 100%) between faecoliths on ct and appendicitis, while others have not . In a retrospective review by lowe et al ., an appendicolith detected on ct had a sensitivity of 65%, specificity of 86%, and positive predictive value of 74% for the diagnosis of appendicitis . Despite appendicoliths being common, a giant appendicolith (> 2 cm) is extremely rare and only sporadically reported . Others include a 2.1 cm appendicolith reported by garg and a 2.2 cm stone by kaluarachchi . Our case is probably the largest documented stone (3 2.5 cm) and the first whose chemical composition has been determined preoperatively by spectral analysis . The authors have not received any resources from a third party, directly or indirectly, to complete this work . The authors have not received any resources from a third party, directly or indirectly, to complete this work.
It is commonly treated with conservative surgery; prognosis is rapidly improved by performing concomitant chemotherapy after the initial surgery.1,2 gliomatosis peritonei is the metastatic implantation of mature glial tissue within the peritoneal cavity of patients with ovarian teratomas.3 as second - look or secondary debulking surgery is not generally performed for immature teratoma, as gliomatosis peritonei is not usually discovered in a patient who has completed chemotherapy and shows no evidence of disease.4 this is a rare case of a patient with ovarian teratoma recurrence in the contralateral ovary . The first and later occurrences were treated with conservative surgery, using local resections or cystectomies . Gravia 0, para 0was referred to us because of a lower abdominal mass; magnetic resonance (mr) imaging revealed a tumor 20 cm in size . Tumor marker tests revealed cancer antigen 125 = 279 u / ml, ca19 - 9 = 130.6 u / ml, squamous cell carcinoma = 3.9 ng / ml, and alpha - fet protein = 50.6 ng / ml . After providing informed consent, she selected conservative surgery . We performed a right salpingo - oophorectomy, partial omentectomy and peritoneal biopsy, and found lint - like scattered mass lesions 2 mm in size at the vesi - couterine pouch and the douglas pouch . The tumor is a mass with cystic regions of many sizes, with solid parts and adipocyte - laden parts (fig . The diagnosis was stage ii c(a) immature teratoma grade2 of the right ovary with gliomatosis peritonei . Pathologically, the mass contained squamous epithelium, adipose tissue, bone and cartilage tissue, and immature neuroectodermal tissue, and was therefore classified as a grade 2 immature teratoma (fig . Peritoneal lesions, which were composed of mature glial cells, were diagnosed as gliomatosis peritonei using hematoxylin and eosin (h&e) stain (fig . Immunohistochemically, the glial cells were positive for glial fibrillary acidic protein (gfap), which is expressed by numerous cell types of the central nervous system, including astrocytes, ependymal cells and glial cells (fig . Sixteen months after the first operation, the patient underwent cystectomy of a left ovarian tumor and a douglas pouch biopsy . Pathological diagnosis was mature cystic teratoma of left ovary and gliomatosis peritonei (fig . Sixty months after the first operation, mr imaging revealed a left cystic ovarian tumor with solid parts 7 cm in size . Pathologically, the mass contained immature neuroectodermal tissue, and so was classified as a grade 1 immature teratoma and gliomatosis peritonei (fig . 2f and g). 71 months after the first operation, cystectomy of a left ovarian tumor5 cm in size and biopsies of the douglas pouch and left external iliac lymph node8 mm in size were carried out . The pathological diagnosis was endometrial cyst of left ovary, gliomatosis peritonei and glial implant in lymph node (fig . Although this patient has never conceived a child, she has maintained a regular menstrual cycle, despite multiple surgeries for ovarian teratoma and chemotherapy . Immature teratoma of grades 1 and 2 are considered ovarian germ cell borderline tumors, according to the world health organization s classification . As they occur predominantly in women in their teens and 20 s, conservative surgery is performed as a standard; concomitant chemotherapy after the initial surgery has led to rapid improvements in prognosis.1,2 jefferys et al produced a retrospective study of 47 patients with malignant ovarian germ - cell tumors who were treated by conservative surgery and adjuvant chemotherapy . During chemotherapy, 61.7% (29/47) of patients developed amenorrhea but 91.5% of these women resumed normal menstrual function upon completion of chemotherapy . Twenty patients (42.6%) attempted conception after chemotherapy, 19 of whom (95%) were successful; 14 healthy live births were recorded, with no documented birth defects.5 in patients with ovarian germ - cell tumors, a recurrence in the contralateral ovary still could be treated by a local resection or cystectomy followed by chemotherapy if fertility was desired, thereby preserving some normal ovarian tissue, if present.5 however, there is little information about recurrence in the contralateral ovary in patients with immature teratomas . In the present case, we re - performed conservative surgery for contralateral recurrence of an ovarian immature teratoma . As such cases are too uncommon to offer evidence for or against repeated fertility - conserving surgery, such surgery should be performed only after obtaining informed consent . Histological grading of peritoneal implants, from grade 0 to grade 3, is essential for therapeutic and prognostic considerations . Grade 0 is defined by tumor consisting of only mature tissue with no mitotic activity . Gliomatosis peritonei is the metastatic implantation of the mature glial tissue in the peritoneal cavity of patients with ovarian teratomas.3 the prognosis for gliomatosis peritonei should be very good and no further therapy should be necessary . Peritoneal implants consisting of embryonic tissue and metastatic immature teratomas imply a poor prognosis.6 if no other teratomatous elements or malignant glial tissue can be found in the implants, the mature glial implants can be ignored and the methods of therapy should be judged only by the stage and grade of the primary ovarian teratoma.7 progression of the peritoneal implants may be as follows: (1) transforming fibroblastic and eventual disappearance; (2) transformation to malignant tissue (glial or teratomatous); and (3) persistence without morphological changes.8 in the present case, gliomatosis peritonei was initially classified as grade 0 . Because the peritoneal implants were not malignant and shrank over the 8 years, we thought them to be of the first stage (1) described above . Although the gliomatosis peritonei shrank, a lymph node glioma was detected in the fourth surgery . Presence of glial tissue in lymph nodes is rare, with very few reported cases . Patients with intraperitoneal and lymph node metastases of mature glial tissue do not need therapy for such metastases . The prognosis for these patients is excellent, but they require long - term follow - up.
Cesarean delivery rates have been increasing in a fast manner throughout the world within past few decades (1). Although reasonable cesarean rates have been proposed as 510% by who, cesarean delivery rates across the world varies between 0.4% and 41% (2). While cesarean birth rates had reached 28% in usa, 21% in canada, it is around 37% in brazil, 39% in mexico, 40% in china (2, 3). Cesarean birth rates are also increasing in turkey in parallel to the developments in the world . While 6.0% of all births were realized by cesarean section in 1998, this rate has risen to 48.1% in 2013 (4, 5). The birth and postpartum processes can imply significant risks for both mother and infant health . One of the most important conditions, which have effect on these risks during the birth process is the way of delivery . These complications may include staying at intensive care unit, postpartum depression, infection, thrombosis, hysterectomy, bleeding, blood transfusion and internal artery ligation related to maternal health, and iatrogenic prematurity, pulmonary hypertension, inability to breastfeeding, fetal respiratory syndrome in relation to newborn (68). Cesarean delivery rates are influenced by many non - medical factors such as cultural factors, personal characteristics of the woman and socioeconomic features (9). The purpose of this study was to determine cesarean birth rates and to find out social factors affecting the cesarean birth in primiparous women . This study was conducted in burdur province, turkey between the dates of 1 jan 201231 dec 2012 . There are 78 family health units and four general hospitals including three public, and one private sector in the province of the study . Pregnancies and pregnancy outcomes (abortion, stillbirth and live birth) are reported to provincial public health directorate by the hospitals and family physicians . A total of 737 childbirths were realized between the dates of 1 jan31 mar 2012 . The universe of this cross - sectional type study was formed by 223 primiparous women . Ninety - six percent of the universe was reached (214/223). The most prominent reasons for inability to reach the women were absence at the address given (2 women), permanent migration out of the province (1 woman) and temporary visit to their parents residing in neighboring provinces (6 women). Data collection form was made up of the questionnaire containing women s sociodemographic, biodemographic, birth characteristics and babies gender and weight . The dependent variable of the study is cesarean delivery, and independent variables are the factors related to women s sociodemographic, socioeconomic, health features, health behavior and violence . The data was collected using face - to - face interview technique after getting verbal consent from the woman, by midwives working in community health center between the dates of 15 apr31 may 2012 after necessary permissions were obtained from public health directorate . The midwives who would collect data were provided 3-h training, which includes the aim of the study, what each of questions targeted and the circumstances required to be considered at the stage of data collection in order to ensure standardization before data collection . The data was analyzed in spss 20 (chicago, il, usa) packaged software . In these analyses, chi - square and backward lr logistic regression analyses were used, odds ratio and confidence interval was calculated . The independent variables (p<0.05) which resulted as statistically significant in chi - square analyses, have been taken into backward logistic regression analyses . The universe of this cross - sectional type study was formed by 223 primiparous women . The most prominent reasons for inability to reach the women were absence at the address given (2 women), permanent migration out of the province (1 woman) and temporary visit to their parents residing in neighboring provinces (6 women). Data collection form was made up of the questionnaire containing women s sociodemographic, biodemographic, birth characteristics and babies gender and weight . The dependent variable of the study is cesarean delivery, and independent variables are the factors related to women s sociodemographic, socioeconomic, health features, health behavior and violence . The data was collected using face - to - face interview technique after getting verbal consent from the woman, by midwives working in community health center between the dates of 15 apr31 may 2012 after necessary permissions were obtained from public health directorate . The midwives who would collect data were provided 3-h training, which includes the aim of the study, what each of questions targeted and the circumstances required to be considered at the stage of data collection in order to ensure standardization before data collection . The data was analyzed in spss 20 (chicago, il, usa) packaged software . In these analyses, chi - square and backward lr logistic regression analyses were used, odds ratio and confidence interval was calculated . The independent variables (p<0.05) which resulted as statistically significant in chi - square analyses, have been taken into backward logistic regression analyses . When the table is monitored, it is seen that there is statistically significant relationship between the delivery mode and the place of residence, women s age, women s family type and her husband s employment status and presence of health insurance . When it is examined in terms of birth and infants characteristics, a significant relationship was shown between the delivery mode with doctor s influence in taking decision and the place of birth (table 2). Sociodemographic features of women birth and infant features 3 data is missing in cesarean group the factors affecting caesarean deliveries are seen in table 3 . Accordingly, when public hospitals are taken as reference, caesarean deliveries were increased by 11.2 fold in the event of the delivery in private hospital; 6.1 fold in the event of the delivery in university hospital . Again with reference to the conditions of woman s husband work on her own account, working in private sector or public sector increases 2.2 fold the caesarean birth . Doctor s guidance increases the caesarean 4.0 times with reference to those who say doctor had no impact on the delivery mode . When the deliveries made between 17:0007:59 are taken as reference, caesarean deliveries are increased by 7.1 times between 08:0016:59 . Women s place of residence, age, presence of health insurance, family type, husband s job, the place of birth, the birth hour and doctor s intervention to delivery mode have been identified as factors affecting the caesarean section delivery in univariate analyses performed . Meanwhile in multivariate analyses, the place of delivery, time of the birth, doctor s effect, and husband s employment status have been identified as factors affecting the caesarean delivery among these factors . Caesarean deliveries realized 11.2 times more in private hospitals and 6.1 times more in university hospitals in primiparous with reference to public hospitals in the study conducted . It was demonstrated that caesarean deliveries were increased by 12.7 times in university and top level hospitals with reference to deliveries of primiparous women in second - line hospitals in a study conducted (3). Caesarean deliveries are particularly among the preferable methods in terms of avoiding the complications associated with the childbirth . Caesarean deliveries are preferred especially for pregnant women at risk due to possible complications in terms of mother and infant during delivery, cephalopelvic disproportion or high birth weight infants . In such cases, if pregnant women are followed at 3rd step health institutions or are guided for delivery by 2nd step institutions, then it may increase caesarean deliveries in these institutions . One of the surprising aspects of the study was the 11.2 fold increase in caesarean delivery rates at private hospitals in spite of its equivalent adequacy with 2nd step health institutions in terms of the equipment with reference to public hospitals . Caesarean delivery rates in private hospitals are significantly more than public hospitals in the studies performed (10, 11). This increment is rooted in social and economic factors as well as medical reasons . In our study, working female ratio is around 50% both in case and control groups . And a very small portion of the husbands are unemployed . The employed status of the husband regardless of private or public or his own account, means the woman is also under the insurance coverage . On the other hand, employed status of the husband caesarean deliveries are more in the women with any health insurance compared to those without insurance in all studies conducted (3, 12, 13). This situation should be considered in conjunction with the finding of caesarean deliveries in private hospitals are, more which is another finding of the study . Caesarean deliveries within working hours are 7.4 times more with reference to out of working hours (18:0008:00) in our study . Caesarean operations increased on fridays and between 06:00 a.m. and 06:00 p.m. with respect to primaparous (14). Meanwhile in another study, a relationship was shown between the time of caesarean section and insurance status . While the time of caesarean shows dispersed within a day in kaiser type insured women, there was an increase between 4 in the morning and 6 in the evening in other type insured women having caesarean . The caesarean section rate is the lowest between 10 at night and 6 in the morning in all insured groups (15). Caesarean deliveries are also the operations performed with the patient s consent in line with physician s clinical evaluations and conviction just like in all other medical procedures . Physicians can offer particular options about delivery mode even though a specific preference is expressed for the patient . If the caesarean delivery is planned, caesarean delivery will take place, however if the plan is vaginal delivery then the delivery may be realized through vaginal or caesarean section (16). Elective caesarean elective caesarean deliveries are estimated to be around 418% of all caesarean sections and 2% of all deliveries (17). 31.1% of the women who gave birth through caesarean section have decided caesarean delivery without doctor s influence in the study . On the other hand, caesarean delivery rates increase by 4.03 times with reference to those without doctor s effect for the determination of delivery mode . We believe that the increase with doctor s effect in caesarean deliveries occurs in two ways . Even if the woman herself decides the delivery mode, beforehand women are informed by physicians about benefits or risks of caesarean delivery (16) or physicians directly affect the patient s decision - making process in caesarean practices due to the knowledge asymmetry between the patient and the physician (14). Caesarean deliveries are preferred because of physicians habits, caesarean deliveries bring more income and vaginal births take more time and defensive medicine application due to the fear of malpractice and complication during birth or pregnancy (18). Although the results do not show all of the factors affecting the caesarean delivery in primiparous, they also reveal that medical reasons are not the only reason in this increase trend . Health policy makers and health professionals are required to identify the causes of this increase and to take measures . The strong side of the study is taking only the women who gave first birth in the study and reaching the complete universe of the study . On the other hand, indetermination and non - exclusion of caesarean sections with medical causes in study questions ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
Las fracturas por fragilidad asociadas a la osteoporosis suponen un gran coste econmico y personal para la sociedad . La ingesta de calcio farmacutico o diettico es necesaria para aumentar la densidad mineral y prevenir fracturas por fragilidad . Aunque los productos lcteos son una buena fuente de calcio, los pacientes que no pueden digerir la lactosa tienden a evitarlos y tienen un mayor riesgo de fractura que la poblacin general . Informes anecdticos indican que las personas que no digieren bien la lactosa, al consumir leche cruda, tienen una gran reduccin de sntomas en comparacin con la leche pasteurizada . El mecanismo de la reduccin notificada en los sntomas, de ser verdad, se desconoce . El propsito del estudio actual era hacer una encuesta a las personas que beben leche cruda para determinar sus motivaciones relacionadas con la salud para consumir leche cruda, sobre todo en relacin con la mala digestin de la lactosa . 153 de 1527 miembros de una comunidad que compra leche cruda complet una encuesta online en relacin a la leche cruda . El motivo principal que los encuestados citaron para beber leche cruda fue que crean que era ms sano; el 30% notific ciertas molestias gastrointestinales al beber leche pasteurizada, aunque casi todos (99%) notificaron consumir leche cruda sin molestias . A pesar de los informes de molestias gastrointestinales, un profesional mdico haba diagnosticado intolerancia a la lactosa en solo el 5% de los encuestados, y solamente al 1% se le haba diagnosticado intolerancia a la lactosa mediante el mtodo de referencia de prueba de hidrgeno en el aliento . El motivo principal para beber leche cruda es su valor saludable percibido, no su digestibilidad . Aunque la leche cruda parece ser digerida ms fcilmente que la pasteurizada en la muestra de nuestra encuesta, se desconoce el mecanismo de digestibilidad . The popular media occasionally present anecdotal stories regarding the benefits of consuming raw dairy products . Yet we found no reports in the literature supporting the anecdotal reports that lactose maldigesters are able to consume raw milk without discomfort . Also unreported or under debate in the literature is the mechanism that allows maldigesters of pasteurized milk to consume raw milk without discomfort . If the enzyme is present in raw milk, it is very heat labile and would be denatured during the milk pasteurization process . Naturally occurring lactobaccili and lactococci, which are killed during pasteurization, another proposed mechanism of lactose maldigestion is that milk from cows with the a1 -casein variant (commonly european breeds) contains a peptide called -casomorphin-7 that reportedly can cause an immune response, lactose intolerance symptoms, and other health - related issues . These claims are not well substantiated in the literature and are controversial . Further complicating the issue, raw milk is often produced and sold from small family farms that typically use jersey or guernsey cows and pasture their cows on grass . Jersey and guernsey cows typically have the a2 -casein variant, whereas holstein cows (primarily used in large industrial dairies) have the a1 variant . So what are perceived by some to be the benefits of raw milk may have as much to do with the type of cow (a1 vs a2) and husbandry (pastured and grass - fed vs confined and ration - fed) as with the manner in which the milk is pasteurized (or not). We intend to clinically evaluate the digestibility of raw milk vs pasteurized milk, but to guide the design of our study, we need more background information . Therefore, we surveyed consumers of raw milk to determine the health - related motivations for consuming raw milk, especially as they relate to lactose maldigestion . We developed an online survey of 16 questions, which was available from december 7, 2012, until january 31, 2013 . The director of a raw milk buying consortium in maryland sent an email to its 1527 members, inviting them to complete our online survey . Because trafficking in raw milk intended for human consumption is against the law in maryland, survey responses were anonymous . This study was approved by our institutional review board, and respondents were informed that completing the survey served as informed consent . Most of the 153 respondents (response rate of 10%) were females between 30 and 50 years of age (table). Of the 153 respondents, 74% reported drinking at least one glass of raw milk per day . Results of survey of raw milk drinkers although instructed to choose only one response, 11 respondents chose one of the letter selections, then added a comment under other (please specify). We sought to differentiate those who consumed raw milk because they considered it more healthful than pasteurized milk from those who consumed it because they found it easier to digest . The concept of easy to digest was based on the absence of bloating, gas, diarrhea, and cramping . We queried on the digestibility of drinking milk under three conditions: (1) the reaction to drinking pasteurized milk before switching to raw milk; (2) the reaction experienced currently when drinking raw milk; and (3) the reaction of drinking pasteurized milk after having switched to raw milk . We also asked if there was a transition period at the onset of drinking raw milk to identify if some colonic adaptation had occurred as a result of drinking raw milk . We sought to identify subjects who had been diagnosed by a medical professional as lactose intolerant and if the diagnosis had been confirmed by a hydrogen breath test (hbt). We asked about the digestibility of other dairy products, namely yogurt, cheese, and ice cream . It has long been known that in parts of the world where prevalence of lactose maldigestion is high, those populations nevertheless consume large quantities of yogurt . Fermented products such as cheese and dairy products with live cultures (yogurt) are more easily digested than other dairy because of the presence of microbial -galactosidase . In an attempt to learn more about the potential role the -casein variant (a1 vs a2) has on milk digestibility, we asked from what breed of cow the raw milk came and what type of diet the cows were fed, if the participants knew . Lastly, we sought to assess the importance of calcium in the motivation for consuming raw milk . Lactose intolerance is related to reduced milk consumption and therefore reduced calcium intake, which is associated with an increased risk for osteoporotic fractures . We analyzed differences in reported discomfort from drinking raw vs pasteurized milk and in drinking pasteurized milk before and after drinking raw milk for significance (p<.05) using mcnemar's test . Of the 16 questions on the survey, only four were answered by all respondents, but all were answered by at least 148 (96.7%) (table). Of the 153 respondents, most (86) cited that they consumed raw milk because they believed it to be more healthful and easier to digest . : 12 said raw milk tasted better than pasteurized milk; 8 cited social / environmental concerns such as supporting local farmers, it is better for the cows, etc; 6 cited that they had allergies to pasteurized milk; two claimed it cured unspecified ills; and six cited individual reasons such as i grew up on it or [i] don't eat processed food . 71 respondents reported no discomfort from drinking raw or pasteurized milk . Two reported discomfort from drinking raw and pasteurized milk, and one commented that he / she does not consume cow milk but instead drinks goat milk . Fifty - nine respondents claimed no discomfort after drinking raw milk but discomfort from drinking pasteurized milk . One reported no discomfort from drinking pasteurized milk but did report discomfort from drinking raw milk . Eighteen consumed raw milk without discomfort but reported they do no drink pasteurized milk . Considering the number of respondents who cited discomfort drinking milk, it was surprising that only 5 (3%) respondents were diagnosed as lactose intolerant and only 1 (0.7%) was confirmed lactose intolerant by means of an hbt . In terms of symptoms between before and after beginning to drink raw milk, responses included, (70); do not have discomfort drinking pasteurized milk (41); and still get discomfort drinking pasteurized milk (28). Twenty - six respondents reported no discomfort from drinking pasteurized milk, but nevertheless they do not drink pasteurized milk . Four reported no previous discomfort but did report discomfort since beginning to drink raw milk . Five respondents reported previously having trouble drinking pasteurized milk but no symptoms since drinking raw milk . Two respondents reported not drinking pasteurized milk but symptoms when they did drink pasteurized milk . There was no significant reduction in discomfort of the respondents between the before and after drinking raw milk periods . In the current study, survey results suggest that the motivation for raw milk consumption is complex . We hypothesized that one motivation for raw milk consumption was to avoid symptoms associated with lactose maldigestion . Yet almost half of the respondents indicated that they had no ill effects after drinking pasteurized milk . Despite the number of respondents indicating some gastrointestinal (gi) discomfort when having previously consumed pasteurized milk, only 5 (3%) respondents were diagnosed as lactose intolerant, and only 1 (0.7%) was confirmed lactose intolerant by means of an hbt . These findings suggest that the symptoms of lactose intolerance were mild enough to not warrant the respondents' seeking a medical diagnosis or that the respondents self - diagnosed and sought alternatives to pasteurized milk . Diagnosing lactose maldigestion and the severity of the maldigestion would seem straightforward using the hbt . It is intriguing that a sizable percentage of those exhibiting lactose maldigestion symptoms have not been diagnosed by a medical professional as being lactose intolerant . It would be interesting to determine the hbt diagnosis of those who report gi discomfort . Some indicate that what is self - diagnosed as lactose intolerance / maldigestion may be a misinterpretation of gi dysbiosis or irritable bowel syndrome . It may also be a self - fulfilling diagnosis because those who consider themselves to be lactose maldigesters tend to avoid dairy, which causes a change in the gut microbiota, making the bacteria less adept at decomposing lactose . Others have found that those diagnosed as lactose maldigesters could ingest modest amounts of milk per day without incident and that symptoms associated with lactose maldigestion were misattributed . The underlying mechanism by which lactose in raw milk may be more readily digested, if in fact that is the case, is more difficult to determine . The predominant bacteria in raw milk are lactococcus lactis (strains of which are used commercially as starter cultures in cheese making), but the bacteria are virtually eliminated when milk is pasteurized . It is likely that these native bacteria account for the alleged enhanced digestibility of raw milk over pasteurized milk, but we found no report in the literature of a direct clinical comparison . In one study, yogurt with active bacterial colonies fed to maldigesters was more readily digested than pasteurized yogurt or milk with active cultures . Therefore, yogurt maintains the stomach at a higher ph than milk, which protects the bacteria . In one study, heating yogurt and reintroducing live bacteria up to 10 bacteria / ml concentrations was not as effective as standard yogurt with 10 bacteria / ml in reducing h2 in lactose maldigesters . Furthermore, certain strains of active bacteria appear to be more efficient than others at digesting lactose . Exposing the intestinal microflora to lactose allows the lactose - fermenting non hydrogen - producing organisms to thrive . The resulting colonic adaptation results in lactose being metabolized to short - chain fatty acids and lactate instead of hydrogen, which is the main component in flatus . This colonic adaptation may confound the study results, which is why we included the question regarding discomfort from drinking pasteurized milk after the respondent had been consuming raw milk . Our results did not indicate any evidence of colonic adaptation, but our results may be skewed because most respondents, after drinking raw milk, reported never drinking pasteurized milk, so it is impossible to know how they would react to pasteurized milk consumption . Other investigators have suggested a placebo effect instead of colonic adaptation because clinical symptoms of maldigestion (eg, bloating, diarrhea) decreased in lactose - treated and control groups . Yet objective analysis of h2 excretion decreased significantly in the lactose - exposed group compared with controls, suggesting some adaptation . In our survey, 95% of the respondents reported eating yogurt with active cultures at least once a month . Our survey did not ask if the yogurt with active cultures consumption was similar before and after raw milk consumption, so it is unknown what role yogurt might have in colonic adaptation in our survey group . However, after the survey, we learned that some of the respondents made their own cheese and ice cream from raw milk . Therefore, it is unknown what percentage of responses was associated with pasteurized commercial cheese and ice cream compared with raw - milk cheese and ice cream . When asked about drinking raw milk, almost 99% of respondents indicated no ill effects . This result suggests that, in the 20% to 30% who initially reported gi discomfort drinking pasteurized milk, the symptoms abated when consuming raw milk . Although these findings might argue the case that raw milk is more easily digested, it is unlikely that the result would apply to all who experience gi discomfort when consuming pasteurized milk because of a selection bias in our data set . It is unlikely that those who would experience gi discomfort from drinking raw milk would be part of a raw dairy buying club . Thus, there is likely an overestimate of those lactose maldigesters who would benefit from raw milk . That 99% of the respondents could drink raw milk without incident is high but consistent with the published finding that 82% of patients diagnosed as lactose intolerant after ingesting pasteurized milk were capable of ingesting raw milk without incident . The patients in that survey were self - reporting their diagnosis by a healthcare professional, but the definition of healthcare professional was unclear . Nevertheless, the information contained in that report is the best currently available for comparison . The current finding suggests that, at least among the group of survey respondents, milk is an important source of calcium . One might surmise that for those who are not able to digest milk easily, milk as a source of calcium may be eliminated from their consideration . In terms of osteoporosis prevention, it should be noted that calcium absorption from milk was not affected by lactose maldigestion status . The reduction in calcium intake in patients with lactose maldigestion more than 75% of the respondents reported consuming at least one glass of milk per day . The size of the glass was not specified, so it is unknown what magnitude of nutrients would be available for ingestion on a daily basis . Finally, the role of a1/a2 -casein variant in cow genetics and the role of husbandry on digestibility remain elusive . Almost 90% of the respondents reported that their milk came from grass - fed cows . Although these results are consistent with expectations of the cows and husbandry that are associated with raw milk for human consumption, it is unknown how reliable the reporting of this information is . More than half of the respondents readily admitted not knowing from which breed of cow their milk came.
The ultrastructural localization of a molecule requires that a certain degree of electron - density, resulting in adequate electron scattering, be present in sufficient amount . Binding of heavy atoms can be accomplished easily with regards to proteins, nucleic acids and other cellular components, in some cases with a high degree of specificity . However, the sub - cellular localization of ions is a challenge, since in many cases ions are diffusible and not easily kept in place after the procedures of sample preparation for electron microscopy (em). Many ions can offer enough scattering in spite of not being heavy metals, such as manganese, while others necessitate of blocking or precipitating techniques to be visualized . In particular, calcium ions are easily diffusible inside the cell, and even when protein - bound are not easily detectable . The pioneering paper by tandler et al . Demonstrated the presence of calcium ions by em via pyroantimonate precipitation, with a good yield of the final product . The end product of the reaction, however, is probably overrated, since the technique is capable of stabilizing and precipitating calcium and other bivalent cations, such as magnesium, as proved by electron spectroscopic imaging (esi) analysis . Since their introduction by tsien and coworkers, calcium studies have used specific ca - sensitive fluorochromes, such as fura-2, indo-1 and fluo-4, coupled to wide - field digitized video fluorescence microfluorimetry and confocal microscopy to image acute elevations in intracellular ca concentration ([ca]i) with high spatio - temporal resolution . Cytosolic and nuclear ca signals regulate a multitude of vital cellular processes, such as gene transcription, cell cycle progression, cytoskeletal and chromatin remodelling, and migration . However, proper ca handling within the endoplasmic reticulum (er), the most abundant intracellular ca reservoir, is also crucial for cell - fate decisions . The steady - state er ca level ([ca]er) does not only control synthesis, folding, export and trafficking of proteins, but it also fuels mitochondrial bioenergetics thereby suppressing autophagy . Low affinity ca indicators, such as mag - fura 2, and genetically - encoded probes, such as the bioluminescent protein aequorin and the gfp - based fluorophores camgaroos, pericams, and cameleons, have been devised to assess er ca levels .. nevertheless, these sophisticated tools do not provide any reliable information on ca distribution within the heterogeneous structure of the er . We propose in this paper a tool for a rapid high - resolution detection of calcium ions which can be used in parallel with other techniques . Maranto and sandell and masland have proposed the possibility of photoconverting fluorochromes into an electrondense end product . The technique utilizes the photo - oxidation of diaminobenzidine (dab) in presence of the emission of an excited fluorochrome, and it has been shown to be efficient on different dyes and conditions . This method combines the specificity of available fluorophores to the high spatial resolution offered by transmission em to detect fluorescing molecules even when present in low amounts in membrane - bounded organelles . The present manuscript sought to exploit dab photo - oxidation of mag - fura 2 for visualizing er ca distribution in hela cells, which are among the most widespread model cell lines used for studying intracellular ca signaling . Hela cells have been cultured in iscove s modified dulbecco s medium (imdm, lonza, basel, switzerland) supplemented with 10% fetal bovine serum, 2% l - glutamine, 1% penicillin and streptomycin, at 37c air atmosphere with 5% co2 . After reaching 90% confluence, cells have been plated in 6 wells cell culture plate (1x10 cells per well), or in chamber slides for staining and microscopic examination (8x10 cells per well). The day after seeding, when cells reached about 90% confluence, the medium has been removed from the wells and replaced with three solutions, one for each experimental condition . The solutions, different in ca concentration, are the following: physiological salt solution (pss), with the following composition: 150 mm nacl, 6 mm kcl, 1.5 mm cacl2, 1 mm mgcl2, 10 mm glucose, and 10 mm hepes; ca - free solution (0 ca), where ca has been substituted by 2 mm nacl, and 0.5 mm egta was added, whereas the solution with ca more concentrated is similar to pss in composition except for 120 mm nacl and 20 mm cacl2 . All the solutions have been brought to ph 7.4 with an osmolality of 338 mmol / kg, measured with an osmometer (wescor 5500; wescor, inc ., logan, ut, usa). Intracellular ca deposits have been marked by fluorescent dye - based calcium indicator mag - fura-2, acetoxymethyl (am) ester uv light - excitable (life tchnologies, carslbad, ca, usa), added to the three calcium solutions to obtain a final concentration of 5 m . Cells have thus been incubated at 37c in the dark, for 1 h. cells cultured on chamber slides, and treated as hereto described, have been analyzed at fluorescence microscopy . An olympus bx51 microscope (olympus italia srl, segrate, italy) was used under the following conditions: 100-w hg lamp as the excitation source, 330- to 385-nm excitation filter (excf), 400-nm dichroic mirror (dm), and 420-nm barrier filter (bf); 100 olympus uplanfl oil - immersion objective lens (na 1.25). Images were recorded with an olympus magnifier digital camera system, and stored by the olympus cellf software . Instead, cells in plates have been fixed at room temperature for 20 minutes with a fixative solution (2% paraformaldehyde and 1% glutaraldehyde in pbs). Meanwhile, a solution with dab has been freshly prepared as follows: 20 mg of dab (sigma aldrich, st . Louis, mo, usa) were dissolved in 1 ml dmso, briefly vortexed and then brought to 30 ml with pbs . Thereafter, cells have been washed twice with pbs and incubated for 3 h under a germicidal uv lamp (sankyo denki, kanagawa, japan; g30t8, uv - c) with 2 ml dab solution which is replaced with fresh solution every half an hour . In parallel, some cells were incubated in the absence of mag - fura 2, treated with dab and processed as above . Moreover, to exclude a possible interference by aldehyde groups, some slides were fixed and then treated with 0.5 m nh4cl in pbs for 30 min at 4c, then incubated with dab and processed as above . Fixed and photoconverted cells have been washed twice with distilled water and postfixed with 2% osmium tetroxide in water for 1 h, at room temperature . Once the osmium was removed and the cells rinsed several times with distilled water, cells have been scraped, centrifuged discarding supernatant, dehydrated in a graded series of ethanol and embedded in lrwhite resin (sigma aldrich). Ninety nm ultrathin sections have been cut by a reichert ultramicrotome, transferred to grids without membrane and visualized by a zeiss em900 transmission electron microscope operating at 80kv . Hela cells have been cultured in iscove s modified dulbecco s medium (imdm, lonza, basel, switzerland) supplemented with 10% fetal bovine serum, 2% l - glutamine, 1% penicillin and streptomycin, at 37c air atmosphere with 5% co2 . After reaching 90% confluence, cells have been plated in 6 wells cell culture plate (1x10 cells per well), or in chamber slides for staining and microscopic examination (8x10 cells per well). The day after seeding, when cells reached about 90% confluence, the medium has been removed from the wells and replaced with three solutions, one for each experimental condition . The solutions, different in ca concentration, are the following: physiological salt solution (pss), with the following composition: 150 mm nacl, 6 mm kcl, 1.5 mm cacl2, 1 mm mgcl2, 10 mm glucose, and 10 mm hepes; ca - free solution (0 ca), where ca has been substituted by 2 mm nacl, and 0.5 mm egta was added, whereas the solution with ca more concentrated is similar to pss in composition except for 120 mm nacl and 20 mm cacl2 . All the solutions have been brought to ph 7.4 with an osmolality of 338 mmol / kg, measured with an osmometer (wescor 5500; wescor, inc ., logan, ut, usa). Intracellular ca deposits have been marked by fluorescent dye - based calcium indicator mag - fura-2, acetoxymethyl (am) ester uv light - excitable (life tchnologies, carslbad, ca, usa), added to the three calcium solutions to obtain a final concentration of 5 m . Cells have thus been incubated at 37c in the dark, for 1 h. cells cultured on chamber slides, and treated as hereto described, have been analyzed at fluorescence microscopy . An olympus bx51 microscope (olympus italia srl, segrate, italy) was used under the following conditions: 100-w hg lamp as the excitation source, 330- to 385-nm excitation filter (excf), 400-nm dichroic mirror (dm), and 420-nm barrier filter (bf); 100 olympus uplanfl oil - immersion objective lens (na 1.25). Images were recorded with an olympus magnifier digital camera system, and stored by the olympus cellf software . Instead, cells in plates have been fixed at room temperature for 20 minutes with a fixative solution (2% paraformaldehyde and 1% glutaraldehyde in pbs). Meanwhile, a solution with dab has been freshly prepared as follows: 20 mg of dab (sigma aldrich, st . Louis, mo, usa) were dissolved in 1 ml dmso, briefly vortexed and then brought to 30 ml with pbs . Thereafter, cells have been washed twice with pbs and incubated for 3 h under a germicidal uv lamp (sankyo denki, kanagawa, japan; g30t8, uv - c) with 2 ml dab solution which is replaced with fresh solution every half an hour . In parallel, some cells were incubated in the absence of mag - fura 2, treated with dab and processed as above . Moreover, to exclude a possible interference by aldehyde groups, some slides were fixed and then treated with 0.5 m nh4cl in pbs for 30 min at 4c, then incubated with dab and processed as above . Fixed and photoconverted cells have been washed twice with distilled water and postfixed with 2% osmium tetroxide in water for 1 h, at room temperature . Once the osmium was removed and the cells rinsed several times with distilled water, cells have been scraped, centrifuged discarding supernatant, dehydrated in a graded series of ethanol and embedded in lrwhite resin (sigma aldrich). Ninety nm ultrathin sections have been cut by a reichert ultramicrotome, transferred to grids without membrane and visualized by a zeiss em900 transmission electron microscope operating at 80kv . Calcium labeling with mag - fura 2 results in highly fluorescent staining mainly localized in the cytoplasm . After incubation of the cells with 20 mm ca for 1 h, the signal is present in large vesicles in the cytoplasm and around the cell nucleus, as well as in elongated structures probably related to mitochondria (figure 1a). The faint signal visible in the nucleus is very probably due to the superposition of the cytoplasmic layer surrounding it . When the cells are incubated in pss, the signal is lower (figure 1b) and mostly present in the perinuclear vesicles, while the cytoplasmic signal far from the nucleus somehow disappears . In the last condition, without calcium and in the presence of egta, some labeling is still visible, although to a much reduced level (figure 1c). This continuous presence of ca represents very probably the last ions the cell cannot allow to lose, a sort of surviving threshold concentrations . Supplementary figure 1 confirms that altering extracellular ca concentrations results in a consequent change in er ca homeostasis, which may have important consequences also on cytosolic ca dynamics . At em level, the controls did not show any electron dense precipitates, both in the absence of the fluorochrome or after aldehyde blockade (not shown); consequently, the end product obtained in the mag - fura 2 stained cells is due to the fluorochrome photoconversion . The dab photoconversion is an efficient way to stabilize the ions and to visualize them . It must be underlined here that we observe a thin section, 60 - 80 nm thick, corresponding, consequently, only to a fraction of the fluorescent signal . After pss incubation, the cells show a distinctive positivity (figure 2a). In some cases it is possible to see the presence of precipitates without the direct association with smooth or rough er (ser or rer, respectively) membranes, likely related to unbound ca ions (figure 2b), and electron dense material inside the vesicles is also positive (figure 2c). A possible suggestion of ca internalization or extrusion is shown in figure 2 d, e, where the deposits are present on the outer membrane . When the cells are incubated without calcium and in the presence of egta, the deposits are extremely reduced, although still present on the outer cell membrane, suggesting the presence of an extruding mechanism (figure 2f). On the contrary, the diffuse, low density end product is almost absent from the cytoplasm . At higher ca concentration in the medium (figure 3a), the dark precipitate is detectable on the inner membrane of cytoplasmic vesicles possibly pertaining to ser, and in discrete foci with no apparent association with vesicles or membranes . The deposits are present within electron dense vesicles (figure 3b) and electron lucent structure, in some cases associated, and suggesting the idea of passage of ions from one compartment to another . In other cases, dab - positive material is present on the membranes of complex systems such as multivesicular bodies (figure 3c) or on the outer membranes of cytosolic vesicles (figure 3d). Interestingly, calcium deposits are detectable on the outer cell membrane (figure 3e) in spots, localized and separated, suggesting the presence of calcium channels . In figure 3f, the end product of the dab photoconversion is a speckled, dense precipitate of varying size . However, another abundant end product is present as small sized dots, showing a markedly lower electrondensity (figure 3f, inset) and a widespread distribution . We show in this paper that mag - fura 2 photoconversion via dab oxidation is an efficient way for localizing ca ions at em level . Moreover, this could be considered also as a means of stabilizing their presence, thus limiting the loss of ions . As for the method, photoconversion is easily carried out and reproducible, can be obtained on a good amount of cells, since the exposition in our conditions is not limited to the direct irradiation of the sample via an objective but obtained with a germicide lamp . The end product is sufficiently electron dense to be detected clearly when present in sufficient amount within a membrane boundary . In these conditions, the blackness of the product stands out from the background . In our conditions, in fact, ca ions are immediately detectable within the vesicles and the tubules of the ser, while it is much more difficult to see their presence when in the cytosol, due to their low electrondensity . This is a clear advantage over the conventional imaging of mag - fura 2 fluorescence that must be removed by the cytosol in order to study truly er signals . This is achieved by permeabilizing the plasma membrane with brief applications of antibiotics or detergents, but this procedure may destroy intracellular signaling pathways, dilute cytosolic modulators of er ca release / sequestration, and disassemble the cytoskeletal elements that maintain the contact between cell membrane and er . Alternatively, the whole - cell configuration of the patch - clamp technique could be exploited to remove the dye, but this experimental approach is rather expensive and challenging, requires highly skilled electrophysiologists and has a quite low throughput . The final yield of photoconverted mag - fura 2 is in direct relation with the amount of ca present in the sample considered . In our condition, the ca - enriched medium gave a higher end product staining than the normal physiological conditions or than ca deprivation . It is interesting that in several cases, dense precipitates could be found in areas suggesting the local accumulation of ca nearby the mouth of plasmalemmal ca channels . Accordingly, such precipitates are evident when extracellular ca concentration is increased, which is consistent with the notion that constitutive ca inflow from the extracellular milieu is enhanced . This unexpected outcome of dab photoxidation is extremely relevant in light of the master role served by local ca microdomains generated by extracellular ca influx, which regulate cell functions as diverse as cycle progression, proliferation, migration, nitric oxide production, and adenylyl cyclase activity . One thing that should be underlined here is that we could not visualize the ser tubule filled with the end product . This could be due to three different causes: i) ca can be dispersed (lost) in the conditions used here; ii) local intraluminal ca concentration is less than expected (which is less probable as it is unlikely to be lower than 100 m); or iii) dab photoconversion is not efficient enough for mag - fura . By comparing fluorescence images with em micrographs, it is clear the difference in the signal coming from vesicles and the elongated filamentous structures, the latter being much less fluorescent . The relative low yield when comparing fluorescence images is definitely related to the extremely lower amount of end product which can be found within a 60 - 80 nm thin section in relation to the fluorescence originating from the whole cell . In addition, albeit [ca]er fluctuates between 100 and 500 m, ca accumulates in specific regions of the er that may be missed in our sections . Moreover, releasable ca is actually trapped by oligomers of the ca - binding proteins calnexin and calreticulin: these form a concealed ca source that is not in rapid equilibrium with the [ca]er, but is easily accessible to ca - releasing channels upon extracellular stimulation . Thus, the lack of ser tubules or cisternae filled with the end product of the photo - conversion, i.e., ca, is not surprising . Finally, the photoconversion process seems to be efficient, and gives an end product more reasonable than the precipitation technique utilized, for instance, by tandler et al . In the latter case, an important amount of precipitates were found in the cell and especially in the nucleus; our method gives a much finer end product, and this allows a superior resolution and localization . In conclusion, this method is a reliable and efficient technique for stabilizing and visualizing ca ions at em . It gives a high resolution end product thus allowing the fine structural ca localization . In principle, this approach could provide important qualitative information about the amount and sub - cellular distribution of calcium ions both in cultured cells and, more importantly, in ex vivo samples, which are far less amenable to high resolution ca imaging of er ca levels.
Nearly, 90% of metastatic tumors occur in jaw bones, especially premolar - molar region of the mandible, whereas metastases to soft tissues are extraordinarily rare and account for 0.1% of all oral malignancies . Most metastatic tumors to the orofacial region are seen in patients aged between 40 and 70 years . Metastasis to the soft tissues mostly involves gingiva and alveolar mucosal sites (54%) followed by tongue (30%). In some cases, oral metastatic tumors are found to be the first sign of metastatic spread and in some instances; they are an indication for unidentified primary tumor of the distant site . The primary site differs according to oral site colonization . In men, primary tumor of the lung followed by the prostate gland and kidney the breast is the most common primary tumor site affecting the jawbones and soft tissues (41% and 24.3%, respectively), followed by the adrenal and female genital organs . Clinically, these metastatic lesions appear nonaggressive, mimicking reactive or benign lesions or even simple odontogenic infections . The clinical features of these lesions include a bony swelling with tenderness, pain, ulcer, hemorrhage, paresthesia and pathological fracture . It is important to diagnose the origin of the tumor as the management will depend significantly on the histological type . Although infrequent, oral metastases are rarely encountered as the first sign of occult cancer . Hence, this article emphasizes on detailed dentoalveolar examination and early diagnosis for finding the primary focus of metastatic tumor . A 60-year - old male patient presented with a swelling in the right lower back teeth region of the jaw since 3 months [figure 1]. The patient complaints of pain for 10 days, radiating to the right temporal region . The patient was a known hypertensive since 4 years . A well - defined solitary swelling present on the right side of mandible on extraoral examination, a well - defined, solitary swelling measuring 4 cm 5 cm was noted on the right side of the mandible, which was hard in consistency and fixed to the underlying skin . No other pathologic findings were noticed during physical examination . On intraoral examination, firm, nontender swelling with ill - defined borders measuring 3 cm 3 cm was noted in the right mandibular premolar - molar region [figure 2]. There was no ulceration, paresthesia or pathological fracture . On intraoral examination, firm, nontender swelling with ill - defined borders measuring 3 cm 3 cm was noted patient was advised for oral pantamograph and computed tomography (ct) scan . Ct scan of the face with three - dimension reconstruction revealed a well - defined osteolytic lesion involving the ramus and body of the right half of the mandible, measuring 54 mm 45 mm 50 mm (anterioposterior transverse craniocaudal). It showed speculated periosteal lesion with multiple irregular calcifications and extended into the lingual and mandibular soft tissues [figure 3]. Based on the clinical presentation, a differential diagnosis of inflammatory swelling, odontogenic cyst, odontogenic tumor, soft tissue tumor or metastatic tumor to the jawbones was given . Computed tomography scan of the face with three - dimensional reconstruction revealed a well - defined osteolytic lesion with multiple irregular calcifications that extended into the lingual and mandibular soft tissues incisional biopsy was done for the histopathological diagnosis . Histopathological examination of the h and e stained tissue showed diffuse fibrous connective tissue stroma invaded by the tumor cells which were cuboidal to short columnar with eosinophilic cytoplasm arranged in alveolar / follicular pattern of varying sizes [figure 4]. Bony trabeculae were evident in some areas [figure 5]. Based on these features, the lesion was diagnosed as a metastatic malignant tumor, probably metastasizing from the lung . (h&e stain, 100) tumor islands along with few bony trabeculae were evident in some areas . (h&e stain, 40) x - ray chest posterior - anterior view revealed consolidation of the right lower zone [figure 6]. The ct scan of the chest with contrast revealed dense soft tissue mass lesion with speculated margins and focal pleural thickening noted at the right posterior basal segment . X - ray chest posterior - anterior view revealed consolidation in right lower zone of the lungs treatment for the patient was palliative external beam radiotherapy on linac given to a total dose of 3000 cgy in 10 fractions to jaw by rl / ll for 12 days which was well - tolerated by the patient . Chemotherapy included injection cisplatin (75 mg)-intravenous (iv); injection etoposide (150 mg)-iv; tablet vomiset (8 mg); tablet ultracet . The common primary sources of tumors metastatic to the oral region are the breast, lung and kidney . The actual incidence of these cancers is unknown since oral metastatic disease is usually a manifestation of advanced disease . The mean age of occurrence is 54 years with slight male predilection . In our case, also the patient was aged about the same age (60 years) as supported in the literature . Most of the patients are aware of primary tumors before the metastatic spread to the oral cavity . In our case, the most common primary sites for oral metastases were the lung, kidney, liver and prostate for men; breast, female genital organs, kidney, and colorectum for women . In our case too, lung was found to be the primary site . The clinical presentation of the metastatic lesions differed between the various oral sites . In the jawbones, most of the patients complain of rapidly progressing swelling, pain, paresthesia, difficulty in chewing, dysphagia, disfigurement and bleeding . Our patient presented with features such as firm, nontender swelling with ill - defined borders . There was no paresthesia, difficulty in chewing, dysphagia, bleeding and pathological fracture . Pathogenesis of oral metastasis is unclear but thought to be a multistage process in which cells detach themselves from the primary tumor and get transported by lymphatic or blood vessels . Recent studies state that cancer cells metastasizing to bone have shown to alter the physiologic balance between both bone resorption and bone formation . Treatment of oral metastasis depends upon its presentation and the stage during which it has been identified . Management includes chemotherapy, radiotherapy, surgical excision or a combination of the techniques under local anesthesia . An average survival time for lung cancer metastasis is 4 months to 1 year with a maximum survival rate of 5 years.
The study population was all the 6 to 9 year- old students from the districts of one and two in yazd, an old and big city located in the center of iran . For the study group, 56 students were selected from imam hussein counseling center (counseling center of educational organization of yazd province) who were referred by their school staff and had received adhd diagnosis by a child psychiatrist based on dsm - iv - tr criteria and had no comorbid disorders . After that, the entire study group and their parents (mother or father) were interviewed by a clinical psychologist . The child symptom inventory-4 (csi-4) was filed out by parents to be used for the diagnosis and differentiation between the adhd subtypes . Of the participants, 19 were diagnosed with adhd - h, 15 with adhd - i and 22 with adhd - c . In the adhd - c group, finally, 45 students (15 students in each adhd subtype groups) were remained as the study group . The control group consisted of 30 students who were selected from the above mentioned population by stratified random sampling method . In the control group, none had a history of psychiatric disorders or developmental delay based on their parents report . Exclusion criteria was wearing glasses, color blindness, physical or psychological disorder and using psychiatric medicines . Students who were diagnosed with adhd in the past and were under treatment with medicine were excluded from the study due to the medicines effect on attention . In the current study, all the students (from both sexes) with all adhd subtypes were participated as the study group . All cases in the study and the control group were matched based on age, sex and iq level . In the current study four tools of structured interview, wechsler intelligence scale for children - revised (wisc - r) and child symptom inventory-4 (csi-4) were used . Child symptom inventory-4 (csi-4) is a screening tool for the symptoms of behavioral and emotional disorders in children based on the diagnostic criteria of dsm - iv . The parent report checklist contains 97 items to screen 15 behavioral and emotional disorders including ad / hd, oppositional defiant disorder, conduct disorder, generalized anxiety disorder, social phobia, separation anxiety disorder, obsessive - compulsive disorder, specific phobia, major depressive disorder, dysthymic disorder, schizophrenia, pervasive developmental disorder, asperger s disorder and tics disorder . There are two methods to score csi-4: criterion - related and norm - based . In the criterion - related method the score of zero was given to items which were rated as never and seldom, and the score of one was given to the items which were rated as sometimes and often . The final score for each subscale was obtained by adding the scores of the items related to the given subscale . In the present study, this subscale consists of 18 items, in which items 1 - 9 are used for adhd - i and items 10 - 18 for adhd - h . The total adhd score can be obtained by adding the scores of 1 - 18 items . The cutoff point for diagnosing adhd based on the csi-4 is 6 for both the mainly attention deficit and the mainly hyperactive - impulsive types . The test - retest reliability of the parent checklist in an iranian sample was reported as 0.90 . Furthermore, in another study, cronbach s alpha of 0.92 and a sensitivity of 0.94 were reported for this inventory(11). Wechsler intelligence scale for children - revised (wisc - r) is a well - known scale for assessing the iq in children aged between 6 - 16 years . Wisc - r gives two different scores for verbal and performance iq and a total iq scores . Moderate internal consistency for total iq, verbal iq and performance iq were reported as 0.96, 0.95 and 0.91 by wechsler, respectively(34). In the present study we used total iq score to match the participants . Wisconsin card sorting test (wcst-64) is a neuropsychological test for assessing problem solving, sorting, abstract thinking, ability to maintain concepts and cognitive flexibility skills which are related to performances of the frontal lobe . In this test, a set of 64 cards including1 - 4shapes in forms of red triangle, green star, yellow cross and blue circle are given to the participants, and then they should place the cards based on their perception of the pattern used by the examiner . The pattern is a red triangle, green star, yellow cross and a blue circle . For example, if the principle is color, the true placement is that the red card regardless of the shape or number should be placed under the triangle and the examiner determines if the placement is correct or not . After that, the subject completes a round of ten placements correctly, and the examiner will then change the principle . The test will continue until the subject finishes the placement of ten cards for six times and place 64 cards in one category(35). Data were entered in spss-17 and analyzed by t - test and anova static tests to clarify the differences between adhd and normal group and between adhd subtypes . Scheffe s test was also used to identify which groups were different . The mean and standard divisions (sd) were used for descriptive analysis . The study population was all the 6 to 9 year- old students from the districts of one and two in yazd, an old and big city located in the center of iran . For the study group, 56 students were selected from imam hussein counseling center (counseling center of educational organization of yazd province) who were referred by their school staff and had received adhd diagnosis by a child psychiatrist based on dsm - iv - tr criteria and had no comorbid disorders . After that, the entire study group and their parents (mother or father) were interviewed by a clinical psychologist . The child symptom inventory-4 (csi-4) was filed out by parents to be used for the diagnosis and differentiation between the adhd subtypes . Of the participants, 19 were diagnosed with adhd - h, 15 with adhd - i and 22 with adhd - c . In the adhd - c group, finally, 45 students (15 students in each adhd subtype groups) were remained as the study group . The control group consisted of 30 students who were selected from the above mentioned population by stratified random sampling method . In the control group, none had a history of psychiatric disorders or developmental delay based on their parents report . Exclusion criteria was wearing glasses, color blindness, physical or psychological disorder and using psychiatric medicines . Students who were diagnosed with adhd in the past and were under treatment with medicine were excluded from the study due to the medicines effect on attention . In the current study, all the students (from both sexes) with all adhd subtypes were participated as the study group . All cases in the study and the control group were matched based on age, sex and iq level . In the current study four tools of structured interview, wechsler intelligence scale for children - revised (wisc - r) and child symptom inventory-4 (csi-4) were used . Child symptom inventory-4 (csi-4) is a screening tool for the symptoms of behavioral and emotional disorders in children based on the diagnostic criteria of dsm - iv . The parent report checklist contains 97 items to screen 15 behavioral and emotional disorders including ad / hd, oppositional defiant disorder, conduct disorder, generalized anxiety disorder, social phobia, separation anxiety disorder, obsessive - compulsive disorder, specific phobia, major depressive disorder, dysthymic disorder, schizophrenia, pervasive developmental disorder, asperger s disorder and tics disorder . There are two methods to score csi-4: criterion - related and norm - based . In the criterion - related method the score of zero was given to items which were rated as never and seldom, and the score of one was given to the items which were rated as sometimes and often . The final score for each subscale was obtained by adding the scores of the items related to the given subscale . In the present study, this subscale consists of 18 items, in which items 1 - 9 are used for adhd - i and items 10 - 18 for adhd - h . The total adhd score can be obtained by adding the scores of 1 - 18 items . The cutoff point for diagnosing adhd based on the csi-4 is 6 for both the mainly attention deficit and the mainly hyperactive - impulsive types . The test - retest reliability of the parent checklist in an iranian sample was reported as 0.90 . Furthermore, in another study, cronbach s alpha of 0.92 and a sensitivity of 0.94 were reported for this inventory(11). Wechsler intelligence scale for children - revised (wisc - r) is a well - known scale for assessing the iq in children aged between 6 - 16 years . Wisc - r gives two different scores for verbal and performance iq and a total iq scores . Moderate internal consistency for total iq, verbal iq and performance iq were reported as 0.96, 0.95 and 0.91 by wechsler, respectively(34). In the present study we used total iq score to match the participants . Wisconsin card sorting test (wcst-64) is a neuropsychological test for assessing problem solving, sorting, abstract thinking, ability to maintain concepts and cognitive flexibility skills which are related to performances of the frontal lobe . In this test, a set of 64 cards including1 - 4shapes in forms of red triangle, green star, yellow cross and blue circle are given to the participants, and then they should place the cards based on their perception of the pattern used by the examiner . The pattern is a red triangle, green star, yellow cross and a blue circle . For example, if the principle is color, the true placement is that the red card regardless of the shape or number should be placed under the triangle and the examiner determines if the placement is correct or not . After that, the subject completes a round of ten placements correctly, and the examiner will then change the principle . The test will continue until the subject finishes the placement of ten cards for six times and place 64 cards in one category(35). Data were entered in spss-17 and analyzed by t - test and anova static tests to clarify the differences between adhd and normal group and between adhd subtypes . Scheffe s test was also used to identify which groups were different . The mean and standard divisions (sd) were used for descriptive analysis . The study group consisted of 45 school aged children; of whom, 27 were male and 18 were female . In the control group, there were 30 school aged children, of whom 18were male and 12 were female . Other characteristics of the two groups (age, iq, adhd subtype frequency) are presented in table 1 . Data analysis showed that adhd and normal group were significantly different in terms of perseverative responses, perseverative errors and total errors on wsct (tables 2 and 3) as shown in table 4, adhd subtypes were significantly different in terms of perseverative responses (p 0/01) and perseverative errors (p0/001). Based on scheffe s test, adhd - h was not different from adhd - i and adhd - c but there were significant differences between adhd - i and adhd - c in terms of perseverative responses and perseverative errors . The aim of the present study was to investigate the differences between adhd subtypes in terms of executive function profile . Previous studies showed inconsistent findings in this regard . In an extended study, houghton et al . Investigated the executive function in 94 children with adhd (without any co - morbid disorder) in terms of subtype and gender using five tests of the wisconsin card sorting test, the stroop color - word test, the matching familiar figures test, the trail making test, and the tower of london . They found that children with both types of adhd (adhd - i and adhd - c) differed from normal children in terms of perseveration and response inhibition, but this difference was significant in adhd - c, only (27). The lack of any co - morbidity in children with adhd showed that the impairments in executive function were obviously found in adhd, particularly in the adhd - c, so providing support for barkley s theory of adhd (27). Consistent with this finding, in another study, klorman et al . Found that children with adhd - c revealed more non - perseverative errors in wcst and solved fewer puzzles and also violated more rules on the tower of hanoi (toh) than adhd - i, but they were not different based on perseverative errors in wcst(28). Also, lawrence et al . Their finding revealed that children with adhd were only different in set - shifting on wsct (perseverative responses and errors) (10). In this respect, we found that children with adhd significantly differed from normal children in terms of total errors, perseverative errors and perseverative responses (p 0.01). Also, we found that adhd subtypes operated differently in the executive function domain (p 0.01); children with adhd predominantly combined type showed more perseverative responses and perseverative errors than children with adhd predominantly inattentive type . Some researchers suggest that the two primary subtypes of adhd share similar neuropsychological weaknesses in inhibitory control, but there are subtype differences in response to success and failure that are contributed to a child s ultimate level of performance (36). Unlike the barkley s behavioral inhibition theory, song and hakoda found that both types of adhd (adhd - i and adhd - c) showed deficits in the inhabitation domain (24). Also, li et al . Found noticeable cognitive impairments such as poor response inhibition, impaired working memory, dysfunction of planning and set - shifting in children with adhd, but there were no significant differences between the two subtypes of adhd in their study (12). The first and most notable limitation of our study was that we only used one test to assess the executive function; and the second limitation was that we did not directly evaluate the control group for psychiatric disorder and only relied on the parental report . Our findings revealed that executive function patterns are different in children with adhd compared to normal children . Our study also confirmed that adhd subtypes are different in terms of perseveration and response inhibition domains; adhd - c type showed more deficits in perseveration and response inhibition . Our findings revealed that executive function patterns are different in children with adhd compared to normal children . Our study also confirmed that adhd subtypes are different in terms of perseveration and response inhibition domains; adhd - c type showed more deficits in perseveration and response inhibition.
The visual environment provides a vast assortment of information to the sighted individual during the acts of daily living . For the visually - impaired individual, a need exists to compensate for the lack of this information, which has motivated the introduction of a wide variety of devices that transfer at least some visual information to another sense . However, the primary assistive technologies widely used today by the visually - impaired to navigate through the environment are essentially unchanged from those of twenty years ago, namely, white canes and guide dogs . Although these two methods can facilitate the ability to travel safely in a variety of indoor and outdoor environments, neither provide the kind of assistance needed to straighten a picture frame on the wall or find a can of soup on a counter - top . Electronic navigation aids are finding some acceptance, for example, ultrasonic canes (ultracane from sound foresight technology, ltd .) That provide tactile cues to objects beyond the tip of the cane, as well as portable computers with global positioning systems (gps) and electronic braille or speech interfaces . However, replacing the more general capabilities of vision to provide detailed information about objects in the environment has proven more difficult . There exists a need for a device that allows active interrogation and sensing of the 3d visual environment surrounding the operator while moving through everyday environments . There also exists a need for a device that not only allows the user to sense the environment but also provides control of specific aspects of the environment that have been detected . These abilities to interrogate and control the environment should not be limited to a specific, predetermined environment, such as those that already contain infrared (ir) transmitters . Devices using a concept we call fingersight are intended to allow visually impaired users to remotely identify objects of interest in, and navigate through, natural environments, by acting as a sensory substitution system for the user's sense of sight . There are already a number of technologies that monitor hand, eye, and body motion from a fixed or mobile camera to interpret gestures, commands, gaze direction, e.g., . Some of these may be used to track the operator's interrogation of the environment, as with the commercially available eye - tracking glasses (e.g., tobii, tokyo), but more often they are used to interpret the user's motions as commands . Our original goal was, and largely remains, to serve the population who are visually impaired . Most devices designed with this goal make use of sensory substitution systems, which transmit stimuli normally interpreted by one sense through another sense . Sensory substitution systems generally consist of three components: a sensor that collects a signal, a coupling system that processes the signal, and finally an output transducer, which transmits the signal to a sense organ not normally used for that signal, . We specifically consider substitution for the visual system by the haptic system (i.e., one's sense of touch). Although hearing offers a potentially higher bandwidth than touch, it is crucial not to impede the existing use of hearing, which can be acutely well developed by those who lack normal vision, providing essential acoustic cues about the environment . As for touch, the hands offer the greatest versatility and sensitivity, but still we must not completely usurp their use, since they are essential for so many tasks in daily living . Some employ tactile pin arrays, which feature a grid of small pins with adjustable heights . Tactile pin arrays can be used for either passive stimulation of the fingers or during active exploration to simulate contact with surfaces and objects . Existing systems capture an image and then display that image on a tactile screen that can be worn on a belt, for example . The fingers can then be used to interrogate the image depicted on the tactile screen in an effort to visualize the image, . Some devices have been developed to directly convey a predetermined map from coordinates of physical space to a tactile spatial layout . An example is bach - y - rita's brainport device, which uses an array of electrodes placed on the tongue to relay camera information . Sensory substitution systems also exist that provide an audio output, such as text - to - speech devices that employ optical character recognition, canes that provide audio feedback to enhance the natural tactile forces detected at the tip itself, and the voice system, which maps image pixels into frequency and time . Vibrotactile sensitivity is found in mechanoreceptors lying within the subcutaneous tissue, which respond maximally to frequencies of 250300 hz, as well as kinesthetic receptors . The cybertouch glove (immersion corp ., san jose, ca) uses optical tracking of each finger to determine when vibratory stimulators on that finger should be activated . Some sensory aids, such as the optacon (telesensory corp ., defunct), aim to simulate tactile exploration of virtual objects and have been developed specifically for reading the printed page . Our proposed device uses a vibrotactile stimulator to provide visual information gathered from a color camera system . The information from the camera system can be processed into a single feature whose presence or absence is communicated through the stimulator . For example, the camera may provide a positive signal when an edge is detected in the field of view . Our system is similar in some ways to that of lenay, who attached a photocell to the tip of a finger and used it to activate a vibrator held in the other hand in an all - or - nothing manner . Another system, developed by burch and pawluk, is mounted on the same finger as the sensor, for interacting with graphical objects on a flat screen . This system senses a single rgb pixel at a short distance (i.e., to the screen that the subject is touching), and vibrates based upon the color sensed . Our system goes beyond this basic idea by detecting not just the general directional presence of light or contact with a single light source, but rather actual images (or a series of images over time) using a miniature camera . Like burch and pawluk we believe that this placement promotes an intuitive coupling between the scene pointed to by the camera mounted on the fingertip and the feedback felt by that finger . In general, it is imperative for designers of any sensory substitution system to consider not only what is technologically feasible, but also what is functional in the context of the sensory and cognitive limitations of the user . In a review of sensory substitution for the blind, loomis and klatzky pointed to the need to couple device design to the capabilities of the user for a given task . Low bandwidth, for example, need not be a negative feature of a device if a task can competently be performed on the basis of the information provided . High bandwidth communication to the user is not an advantage if the target sensory channel cannot process the information provided . Furthermore, it should not be assumed that information - processing capacities of blind and sighted are equivalent; for example, superior tactile sensory systems may be preserved in older braille readers relative to sighted populations of the same age, whereas tasks that draw on visual imagery may be impeded in a blind population without any experience of sight . We have developed a series of working prototypes, leading up to the one used in the experiments described in the present paper . As the progression is informative, we review them briefly here . Our initial system permitted active interrogation of the visual surroundings with a miniature red laser attached to the fingertip (see fig . 1). The laser was modulated at 10 khz, allowing its reflection by objects in the environment to be detected by a non - directional phototransistor in the midst of other sources of light . Thus, like the burch device, it sensed the light (in this case reflected) from a single point in space, but at a distance . Moreover, it differed from that device by actively interrogating across the detected point for an edge . This was accomplished by means of a solenoid constructed from tiny magnets and a coil . Regenerative feedback between the amplitude of the detected signal from the reflected laser and the solenoid caused the laser to vibrate vertically when the laser spot was located on any edge between light and dark objects . Thus the system created a haptic stimulus (vibration) whenever a properly oriented visual edge was encountered by the laser . The laser - based system was limited to simple edges and had the disadvantage that the active visible light source could be disturbing to others . More importantly, limiting fingersight to what amounts to a single scanning line makes it extremely difficult to integrate more than the most rudimentary features in the visual field . A full video image captured at each pose of the finger offers many advantages, including immediate extraction of more complex features, identification of entire objects, and even determination of camera motion directly from the changing image . The recent availability of very inexpensive and small cameras, brought about largely by their use in cell phones, has led us to adopt a camera - based approach, the first version of which is shown in fig . 2 . A small black - and white camera (supercircuits pc206xp 510492) was mounted on the subject's finger along with a cell - phone vibrator . Real - time analysis of the video signal from a miniature camera was used to control the cell - phone vibrator . The cell - phone vibrator has the advantages of low cost and size, but presents problems in that amplitude and frequency are inextricably linked together by the operating voltage . Also, the frequency is low enough to cause noticeable vibration in the camera image, and the time for the motor to come up to speed is relatively long . Two small speakers (gui, inc . #gc0251k - nd, 1w, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $8\omega$\end{document}) were converted into haptic vibratory stimulators, or tactors, by cementing a short wooden dowel onto the central cones of each speaker . The converted speakers were mounted on either side of the finger and held there, along with the camera, by a springed clip, leaving the palmar aspect of the fingertip bare to use for touching and grasping objects . We hoped, by including two such tactors, to be able to use the relative strength of the vibration from each tactor to convey a parameter such as location of an image feature along the horizontal axis . This model did not perform well for identifying the location of visual targets, primarily due to mechanical design issues . It proved problematic to mount the device securely on the distal phalanx of the finger . Furthermore, given the influence of flexion / extension at the distal inter - phalangeal joint on the camera orientation, it was difficult for users to judge where they were aiming the device . In addition, there was low sensitivity to vibration the speakers mounted on the lateral aspect of the finger, as compared to the speaker on the medial aspect . Collectively, these issues made any asymmetry in signal strength from the two tactors of little value to the user's perception . The current version of fingersight uses the same speaker - based tactor shown in fig . 3, but with only one tactor on the (more sensitive) medial aspect of the finger, along with a miniature color camera (supercircuits pc208, 510492). The camera extended approximately 8 mm from the tip of the finger, and the speaker was attached to the side of the splint . The splint weighed 18.8 g and caused minimal interference with movement of the finger as a whole, though it did restrict flexion between the phalanges, thereby reducing uncertainty in camera orientation . Covering the palmer aspect of the finger made it difficult to use the finger for other purposes, but we were willing to accept this for the present experiment . The camera and the speaker were connected to a computer system, which performed spatiotemporal edge detection (described below) and controlled vibrator output . The haptic feedback was provided by a low - frequency (20 hz) audio signal sent to the speaker, the amplitude of which was adjusted to produce detectable vibrations . Fig . 4.current fingersight device apparatus with camera and stimulator attached . For the purposes of experimental testing the area of the circle was divided across its center, one semicircle containing red and one containing green pixels (see fig . 5). The line across the center of the circle separating red from green pixels could be set to any desired orientation . The circular area was surrounded by white pixels and the images were projected on a screen, where the user could point the finger - mounted camera at it . 5.examples of edge stimuli, at 12 (a) and 4 (b) o'clock, respectively . Software was developed to analyze the video image from the finger - mounted camera in real time and to control the vibratory feedback to that finger . The goal was to generate vibrations whenever the user's finger was pointing at, or had just passed over, the boundary between the red and green areas, irrespective of the edge's orientation . Optical edge detection was performed with a novel spatiotemporal kernel, designed to detect edges both in the spatial domain (when the camera was resting on an edge) and the temporal domain (when the camera had moved completely past an edge between one video frame and the next). This design accommodated fast hand movements, which might cause the edge to never actually have been within the kernel in any given frame, as well as slower continual tracking along the edge . The spatiotemporal kernel accomplished both of these for edges of any orientation by comparing each pixel in one time frame with the corresponding pixel directly across the center of a circular kernel in the next time frame . If the two pixels differed, an edge was present or had just been crossed . It is important to note that unlike the general usage of the term kernel in image processing, especially for convolution, our spatiotemporal kernel was applied not at every pixel, but only at one location, the center of the image . Just as the fovea of the eye (the high resolution central region) is constantly moving for human vision to function, our kernel was physically moved by the user's finger along with the entire image, to interrogate the visual environment . The optimal size of the circular kernel varied depending on the scale of the edge features to be considered . For the particular experiment described here, the optimal radius of the kernel was determined experimentally to be 50 pixels . A detailed formulation of the algorithm follows: we define k as the set of pixels within the circular kernel at the center of the image . Based on the particular red - green - blue (rgb) video image coming from the camera in real time, a color label \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c(x, y)$\end{document} was created for each pixel in k, denoting whether the pixel at location \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(x, y)$\end{document} was predominantly red, green, or ambiguous.\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $$c\left(x, y\right)=\cases{+1/2,&$if~predominantly~red$\cr-1/2,&$if~predominantly~green$\cr 0,&$if~ambiguous$\cr}\eqno{\hbox{(1)}}$$\end{document} for our purposes, predominantly indicates that the red (r) or blue (b) color value for the pixel in question was above a specific threshold, while the other two color values in the rgb pixel were both below their corresponding thresholds . Appropriate thresholds for red, green, and blue were determined experimentally, so that red, green, and white pixels (which registered as ambiguous) responded appropriately . We also created a binary mask value \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $w(x, y)$\end{document} for each pixel that had the value of 1 wherever c was non - zero, so that boundaries including the white area surrounding the circle could be excluded from generating edges.\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $$w\left(x, y\right)=\cases{1&$if~c\left(x, y\right)\ne 0$\cr 0&$otherwise$\cr}\eqno{\hbox{(2)}}$$\end{document} for each pixel in k, we also considered another pixel in k directly across the origin (center of the kernel) at location \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(-x,- y)$\end{document}. Our measure of boundary strength was calculated by comparing the value \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{t}$\end{document} for the pixel at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(x, y)$\end{document} in the current image at time \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $t$\end{document} to value of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{t-1}$\end{document} for the pixel at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(-x,- y)$\end{document} in the previous image at time \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $t-1$\end{document}. The mask values \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $w_{t}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $w_{t-1}$\end{document} were used to ensure that no comparisons were made using ambiguous pixels . Thus a measure of edge strength \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $d$\end{document} was computed as \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $$d\!=\!\!\!\sum_{\left(x,\!y\right)\in k}\!\! {\left\vert c_{t}\left(x, y\right)\!-\!c_{t-1}\left(-x,\!-y\right)\right\vert w_{t}\left(x, y\right)w_{t-1}\!\left(-x,\!-y\right)}\eqno{\hbox{(3)}}$$\end{document} if the edge measure \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $d$\end{document} was above some threshold (determined experimentally), the software reported that an edge had been detected, and triggered the haptic feedback in the form of vibration at the fingertip . The algorithm has the advantage that it measures equally well the conditions of sitting on an edge (of any orientation) for two successive timeframes and having passed completely over the edge from one timeframe to the next . For example, in 3d one would simply compare pixels directly across the center of a spherical rather than a circular kernel . Twelve sighted subjects (10 males and 2 female) were recruited from the university population, with an average age of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $29.4+/-{9.8}~{\rm years}$\end{document}. All gave informed consent . Subjects took part in a series of trials, in which they identified the angle of an edge stimulus according to a closed set of alternatives . Each edge stimulus, as described above, was projected on a display screen and consisted of a circular area 115 cm in diameter on a white background bisected with one half colored red and the other green . The circle was surrounded by white, so that the perimeter of the circle would not itself be interpreted as an edge (as described above). Subjects were fitted with earplugs, blindfolded, and seated with the right arm resting on a foam support 79 cm above the floor . The circles were projected (epson powerlite 70c) on a 154115 cm screen positioned 168 cm in front of the subject's fingertip . The arm support was arranged so that the subject's arm and finger were initially pointing perpendicular to the center of the projected image . During each trial, the subject freely explored the display edge with the fingersight device as long as desired . Generally, subjects maintained their arm on the rest and moved their forearm and wrist . Angle set 1 consisted of six angles equally spaced over a 180 range in 30 steps (from positive vertical, 90, to just short of negative vertical, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${-}{60}^{\circ}$\end{document}), corresponding to clock - hours from 12 to 5 o'clock . Angle set 2 consisted of seven angles equally spaced over a 90 range in 15 steps (from positive vertical, 90, to horizontal, 0) corresponding to the hours and half hours between 12 to 3 o'clock . Subjects reported their responses using these clock face labels . Within each set, tables 1 and 2 show the confusion matrices for all subjects for angle sets 1 and 2, respectively, plotting reported angle vs. stimulus angle . A confusion matrix shows correct measurements along the diagonal, with increasing error as one moves off the diagonal . Overall, subjects had an accuracy rate (proportion correct) of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $0.77\pm 0.05$\end{document} on angle set 1 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $0.52\pm 0.09$\end{document} on angle set 2 (95% confidence intervals). These levels are well above chance in this six - alternative choice task \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm chance}=0.16)$\end{document}. Table iconfusion matrix for set 1reported angle (deg)90603003060stimulus angle (deg)9071131011060168252003008843100101081313000068196040003260confusion matrix for angle set 1 . Each entry is the number of occurrences of the associated stimulus / response pair . Table iiconfusion matrix for set 2reported angle (deg)0153045607590stimulus angle (deg)0642532200151949242101301205519100450836391210600115234692750011533389900011112558confusion matrix for angle set 2 . Each entry is the number of occurrences of the associated stimulus / response pair . The data were also analyzed by measuring information transfer \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document}, in order to determine the number of bits that can be transmitted by the device under the experimental conditions .\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $$i=\sum_{j=1}^{k}\sum_{i=1}^{k}{p\left(s_{i},r_{j}\right)\log_{2}\left({{p\left(s_{i}\vert r_{j}\right)}\over{p\left(s_{i}\right)}}\right)}.\eqno{\hbox{(4)}}$$\end{document} here, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $k$\end{document} is the number of possible stimuli, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{i}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{j}$\end{document} represent a specific stimulus - response pair . This statistic can be estimated from the confusion matrices according to equation 6.\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $$i_{est}=\sum_{j=1}^{k}\sum_{i=1}^{k}\left({{n_{ij}}\over{n}}\right)\log_{2}\left({{n_{ij}\times n}\over{n_{i}\times n_{j}}}\right)\!.\eqno{\hbox{(5)}}$$\end{document} here, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n_{ij}$\end{document} is the number of joint occurrences of stimulus \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document} and response \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j, n_{i}$\end{document} is the overall occurrence of stimulus \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n_{j}$\end{document} is the overall occurrence of stimulus \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n$\end{document} is the total number of trials . Relative to the 2.58 bits of information in the six - alternative choice task, angle set 1 (angles with 30 increments) had an information transfer of 1.62 bits, while angle set 2 (angles with 15 increments) had an information transfer of 1.12 bits . We have developed a new method of providing the finger with haptic feedback about visual targets in the general environment, by permitting the finger to scan the environment directly to locate those targets . We have developed this idea, which we call fingersight, through a series of prototypes, exploring the particular application of detecting edges . In the process, we have developed a new spatiotemporal \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n$\end{document}-dimensional edge detection algorithm of potentially general interest, which is simultaneously capable of detecting the presence of a stationary edge as well as having passed over an edge between successive timeframes . We have conducted proof - of - concept experiments showing that under active exploration the fingersight device is capable of transmitting visual spatial information through haptic channels . Sighted, blindfolded subjects were able to use the device to differentiate between angles separated by as little as 15. performance with the coarser angle set, where responses were separated by 30 showed that fingersight transmitted close to 2/3 of the available information in the stimulus, with most errors being near misses . The information transmission of the fingersight device is intrinsically constrained by basic sensorimotor abilities of motor control, kinesthetic sensing, and spatial cognitive processing . Was found that when blindfolded, sighted adults tried to report the orientation of a raised line that was easily tracked by touch on the plane of a tabletop, their responses pulled the true value towards the sagittal axis by about 25% (plus some constant error). Since motor control was minimized in the task in, errors can be entirely attributed to the processes of kinesthetic sensing and building a spatial representation . The observed level of distortion is by itself substantial enough to lead to confusion errors in the present task . These observations suggest that performance with fingersight could be improved by features that support motor control and augment kinesthetic feedback . The present experiments measure only the performance of blindfolded sighted subjects who are novices using the device; training would be expected to considerably improve performance . Siegle and warren have shown that distal attribution, i.e., the direct perception of objects in external space, can occur with similar finger - mounted sensory substitution systems after a period of training . However the device used in their experiments had the vibrotactile stimulator mounted on the subject's back . It is possible that training time may be decreased with a device such as fingersight, where the stimulus is more strongly tied to the subject's proprioceptive knowledge of the hand's location in space . It is interesting to compare the accuracy of angular measurements by fingersight in 3d space with other researchers who restricted interrogation to a fixed plane ., explored the ability to recognize 90- or 180-degree rotation on raised - outline drawings directly touched by the blind or sighted - blindfolded subjects, but did not explore finer angular resolution . Postma, et al ., demonstrated the role of visual experience in such haptic spatial tasks, including the description of angles between bars on a table, showing that blindfolded sighted subjects outperformed late blind subjects, who outperformed early blind subjects . They found that having experienced vision, even to a limited extent, helps in the interpretation of angle by touch alone . The worst performance in verbally judging the angle of the bars (demonstrated by the early blind) was 7.2 degrees, a good deal better than our errors, possibly because they were constrained to a tabletop . It would also be interesting to see if sighted individuals also have a similar advantage in learning to use fingersight over blind individuals, due to previous visual experience . Also relevant to the question of angle and touch, with haptic computer mice, which are modified to have tactile pin arrays on their upper surface . Significant lack of accuracy in the haptic position information, which is critical for individuals to haptically piece together a 2-d graphic . The inaccuracy is due to the fact that the tactile mouse (or any normal mouse) is a relative positioning device, dependent upon the speed of motion and orientation of the mouse to determine total displacement on the screen . In contrast, fingersight is inherently an absolute positioning device, given a stationary environment, and as such, fingersight may have an advantage . The system of burch and pawluk previously mentioned uses a fingertip photosensor and piezoelectric stimulator to scan specially created graphical displays, in which texture is added to enhance perception of edges and orientations . A single photosensor thus suffices for this purpose, only because preprocessing is performed to populate regions on either side of boundaries with differing textures . Multiple photosensors on different fingers were found to improve results with this system, because the operator's knowledge of the spatial relationship between the fingertips could be used to integrate the inputs . But still the approach relies on preprocessing the image to create textures, after which individual photosensors can be effective . With fingersight, we are exploring the unadulterated 3d environment, where depending on only a few photosensors is not sufficient . We benefit greatly by having a multi - pixel image at each timeframe . By further processing of the camera images, the fingersight device could be adapted to identify more complicated features than simple visual edges, perhaps even constituting an object recognition system for a blind operator . For example, it could be used to find a particular person in a crowd, or identify a door displaying a particular sign . The rapid advancement in computer vision algorithms, driven in part by the security and social networking industries, will provide ever more sophisticated capabilities . For example, determining camera motion and target depth from a image sequence could permit greater 3d integration of multiple perspectives and facilitate providing navigational cues to the blind operator, such as where the curbside is, whether the approaching stairwell goes up or down, or whether one is moving towards or away from the elevator . Such analyses are not feasible for a single photosensor, but rather, they require an entire image . A common problem in any real - world computer vision application is the variability of lighting, and there are established techniques for solving this problem using such constructs as the illumination cone . For example, a recently developed time - of - flight (tof) 3d camera, the swiss ranger sr4000 (mesa imaging, zuerich), can deliver a 176144 pixel image with each pixel reporting range up to 10 m with 1 cm accuracy . The present camera is roughly 7 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${\rm cm}^{3}$\end{document} and is being integrated by at least one research group into portable devices for the blind . For some of these more sophisticated systems, it may become problematic to rely solely on vibrotactile feedback to the finger . The bandwidth of audio, especially combined with language, makes it an appealing option, though as noted above, one does not want to impede the natural use of auditory cues that are especially crucial for the vision impaired . However, intermittent use of verbal output by fingersight, and for that matter, verbal commands by the operator to the device, could prove extremely useful, while not impeding auditory cues form the environment . As noted above, it is imperative to test whether features added to the technology ultimately add to the functional capability of the user, given intrinsic limitations on human information processing . That said, one promising avenue is the incorporation of control capabilities into the fingersight device . One of our previous systems included the capability to control graphical objects on a screen . In this implementation, the location of a small white square on a screen is controlled by motion of the finger . The algorithm detects the square in the field of view of the camera, moving it on the screen to keep it constantly in the center of the camera image, while providing haptic feedback about whether the tracking system has locked onto the target . A variation on this system constrains the square to move along a straight line, simulating the action of a slide pot under the operator's control . A further variation uses a small white triangle to simulate a knob, whose orientation is determined using standard computer vision techniques and subsequently controlled by rotation of the finger . Clearly, such systems are not limited to actively controlling graphical objects on a screen, but could also identify inanimate objects such as a light switch or door latch . In such cases, remote control could still be achieved by motion of the finger once the target has been identified, using a separate control channel to turn on the light or lock the door . Continued work on the control aspects of fingersight a final note is merited on the eventual miniaturization of a fingersight device such that it might be small enough to be worn like an artificial fingernail . The cameras themselves are almost small enough already, and the main considerations are power and communications . One can envision radio communication between a fingertip device and a pocket unit, much as wireless earphones and microphones communicate with cell phones now . Such devices might be fully integrated into the everyday activities of the vision - impaired.
It negatively influences the child's quality of life and is an important cause of absence from school and also a significant factor in health - related costs among children and adolescents . Its prevalence varies greatly from 5.9 to 82%, depending on the definition criteria and the age of the patients . The international headache society classifies headaches into primary and secondary type in classification of headache disorders 2 edition (ichd - ii). Primary headache is not attributed to any other disorder . In the majority of patients with primary headache, general and neurological examinations are normal and primary headaches include migraine, tension - type headache, cluster headache, autonomic cephalalgias and other primary headache disorders . Frequency of headache increases with age in this population . In the present study we aimed to determine epidemiologic characteristics and compare socioeconomic and some clinical factors related to primary headaches in children / adolescents (4 - 15 year olds) presented to neurology clinics of tabriz university of medical sciences . The institutional review board at tabriz university of medical sciences approved the study protocol . After obtaining a written informed consent from parents, children with 4 - 15 years of age and with the diagnosis of primary headache (migraine or tension - type headaches) who presented to the neurology clinics affiliated to tabriz university of medical sciences, tabriz, iran from march 2009 to october 2011 were included in this cross - sectional study . A total of 190 patients fulfilled the criteria for enrollment in the study and their demographics were collected . We noted the type of headache, history of atopy, asphyxia during labor (according to the history of admission in the neonatal intensive care unit after birth due to respiratory problems based on the parents report and review of the previous medical records) and breast feeding, family history of headache, presence of headache triggers and the socioeconomic status of the family . Diagnosis of migraine and tension - type headache was based on the international headache society diagnostic criteria for the primary headache disorders . Socioeconomic status was determined according to the total monthly family income (<7,000,000 rl vs = 7,000,000 rl) based on the index of statistical center of iran for grand cities in the years of study in addition to the highest level of education of the father (<or = high school vs.> or = college). Statistical analysis was conducted with spss, version 16.0 for window (spss, chicago, il). Data were expressed as meansd for quantitative variables and as numbers and percentages for categorical variables . Statistical analysis was performed using the chi - square test for categorical variables and the student's t test for numerical variables . Eighty eight patients (46.3%) had migraine and 102 patients (53.7%) had tension - type headache . The distributions of gender and age groups in patients with migraine or tension - type headache are shown in table 1 . The distributions of gender and age groups in patients with migraine or tension - type headache data are presented as numbers no significant differences were seen in the distribution of gender between the patients with migraine and tension - type headache . Migraine and tension - type headache had comparable frequency in different age groups of male patients (p=0.1 and 0.07, respectively). In female patients the frequencies of both migraine and tension - type headache were significantly higher in the age group of 10 - 15 years as compared to the age group of 4 - 9 years (p=0.03 and 0.04, respectively). There was no significant differences regarding the prevalence of migraine or tension type headache between different genders in the same age group . The most common clinical presentations of aura in patients with migraine are demonstrated in table 2 . The comprehensive data regarding the epidemiologic characteristics of patients with migraine or tension - type headache in our study group are shown in table 3 . The clinical presentations of aura in patients with migraine the characteristics compared between patients with migraine and tension - type headache as triggering factors for headache; or: odds ratio; ci: confidence interval history of asphyxia during labor was more prevalent among patients with migraine as compared to the tension - type headache (p=0.007, or = 3.24). History of headache in parents was also significantly higher in patients with migraine as compared to tension - type headache (p=0.001, or = 3.19). Moreover, the prevalence of atopy was significantly higher in patients with migraine (p=0.01, or = 5.70). Prevalence of feeding with formula during infancy did not differ between the patients with either migraine or tension - type headache (p=0.9). The low socioeconomic status was more prevalent in patients with migraine headache (p=0.003, or = 2.38). In our study primary headache was more common in older age group which is consistent with danold's findings which showed that frequency of headache increases with age . Tension type headache in patients was more frequent than migraine which is comparable with findings of kroner - herwig et al . The main finding in the present study was that gender cannot predict the type of primary headache in younger children, as no gender differences were seen between the patients with migraine or tension - type headache in the age group 4 - 9 years . This finding is in contrast to previous report by krner - herwig et al which showed that being female was a significant predictor for three main subtypes of primary headaches a few other studies showed that the prevalence of migraine was higher in the males . Our results also demonstrated that the frequencies of migraine and tension - type headache were comparable in different age groups of male patients, whereas female patients in the age group 10 - 15 years had higher frequency of both types of headache especially migraine as compared to the age group 4 - 9 years . This finding reveals that female adolescents had higher risk for developing primary headache specially migraine as compared to female children . These results agree with those reported by krner - herwig et al who showed that children with migraine were significantly older than children in the other groups . It could be due to hormonal effect as the trigger of migraine headache in the female adolescents . It was previously shown that primary headache in children is closely related to history of headache in their parents . Our results demonstrated that when a parent showed combined headache, the risk of developing migraine in his or her child is more conspicuous as compared to the tension - type headache . This finding is consistent with previous reports by fallahzadeh et al and krner - herwig et al which showed a stronger association between family history of headache and being afflicted by migraine as compared to tension - type headache in children . Our study also demonstrated that if the patients with history of peripartum asphyxia would develop primary headache it would more probably be of migraine type . These results partly agree with those reported by maneyapanda et al who found an association between chronic migraine headache and significant perinatal insult due to neuroplasticity and its induced hyperexcitability . However, it is recommended to design prospective studies to compare the frequency of primary headache (either migraine or tension - type headache) in patients with or without perinatal insults to elucidate the role of peripartum asphyxia as a risk factor for developing primary headaches . We also showed that atopy is more prevalent in patients with migraine as compared to tension - type headache . Also ozge et al found an association between atopy and both migraine and episodic tension - type headaches . It has been shown that alteration in several interleukins occurs in migraine which supports an association between migraine and atopic disorders . Although it was shown by pogliani et al that breast feeding has a protective role against primary headache disorders, our results showed that children and adolescents with history of formula feeding during infancy have comparable prevalence of developing either migraine or tension - type headache . Our results showed that socioeconomic status of the patients could significantly influence the frequency of migraine in comparison to tension - type headache . Ayzenberg et al in a study on 2725 adults in russia, showed that low socioeconomic status is associated with higher frequency of primary headache disorders . Moreover, katsarava et al in another study on 1145 adult patients in the republic of georgia showed that low socioeconomic status and female gender are risk factors for development of migraine, not tension - type headache . Moreover, the possible role of psychological factors and behavioral characteristics influencing primary headaches could have been considered . While some variables have been checked by the present report, further prospective studies with larger sample sizes are needed to provide more comprehensive data regarding associated factors in childhood primary headache.
A total of 30 mabs that were either developed or in - licensed by companies are currently undergoing evaluation in late - stage studies (tables 1 and 2). Five of these (brodalumab, mabp1, moxetumomab pasudotox, tildrakizumab, rilotumumab) transitioned into phase 3 studies during the period from late 2012 to april 2013 . Brodalumab (amg827, amgen; khk4827, kyowa hakko kirin), a human igg2 targeting the interleukin (il)-17 receptor, is undergoing evaluation in three phase 3 studies (amagine-1, -2, and -3) of patients with psoriasis . The amagine-1 study (nct01708590) is evaluating the efficacy, safety, and effect of withdrawal and retreatment with brodalumab in patients with moderate - to - severe plaque psoriasis . In this study, either of two doses (140 mg or 210 mg) or placebo is administered subcutaneously (sc) every two weeks until week 12, when patients are rerandomized to placebo or continued treatment . The estimated primary completion date for the study is march 2014 . In the amagine-2 (nct01708603) and amagine-3 (nct01708603) studies, the efficacy and safety of induction and four maintenance regimens of brodalumab compared with placebo and ustekinumab in patients with moderate - to - severe plaque psoriasis is being evaluated . These studies have estimated primary completion dates of august and september 2014, respectively . Note: table compiled from information available as of april 25, 2013 . Abbreviations: cd, cluster of differentiation; il, interleukin; pcsk9, proprotein convertase subtilisin / kexin type; sle, systemic lupus erythematosus . Note: table compiled from information available as of april 25, 2013 . * in - licensed; national cancer institute is sponsoring the phase 3 study in hairy cell leukemia patients . Abbreviations: all, acute lymphoblastic leukemia; cll, chronic lymphocytic leukemia; hgf / sf, hepatocyte growth factor/ scatter factor; nhl, non - hodgkin lymphoma; nscl, non - small cell lung; vegfr2, vascular endothelial growth factor receptor 2 . A first phase 3 study (nct01767857) of mabp1 (xilonix, xbiotech, inc . ), a human mab targeting il-1, was recruiting patients as of march 2013 . The study will evaluate overall survival of metastatic colorectal cancer patients with cachexia who are administered the mab as a monotherapy . The effects of mabp1 administered intravenously (iv) every two weeks, plus best supportive care will be compared with those of megestrol acetate administered daily plus best supportive care . The difference between the study arms in median overall survival from baseline to 18 mo will be compared . The recombinant immunotoxin moxetumomab pasudotox (cat-8015, astrazeneca) is undergoing evaluation in a phase 3 study (nct01829711) of patients with relapsed / refractory hairy cell leukemia . The study is sponsored by the national cancer institute (nci); the mab is currently licensed to astrazeneca . In 2004, nci licensed moxetumomab pasudotox to genencor, inc . The mab was then acquired in 2005 by cambridge antibody technology, which was itself acquired by astrazeneca in 2006 . Moxetumomab pasudotox comprises a mouse disulfide stabilized variable fragment with the variable heavy domain fused with a 7-mer linker and the pseudomonas aeruginosa exotoxin a pe38 fragment . In the phase 3 study, patients will receive 40 g / kg of the immunotoxin administered iv over 30 min on days 1, 3, 5 of each 28 d cycle until complete response, progressive disease, initiation of alternate therapy or unacceptable toxicity is observed . Initiated in march 2013, the study s estimated primary completion date is december 2014 . Two phase 3 studies of tildrakizumab (sch900222/mk-3222, merck), a humanized mab targeting the p19 subunit of il-23, are recruiting patients . Initiated in december 2012, nct01722331 is a 64-week study to evaluate the efficacy and safety / tolerability of sc administration of tildrakizumab in patients with moderate - to - severe chronic plaque psoriasis . Patients receive 100 mg or 200 mg tildrakizumab at week 0 and week 4, and then every 12 weeks until study end or participant discontinuation . Patients receive the same doses of tildrakizumab, but the study includes 50 mg etanercept as well as placebo as comparators . The two phase 3 studies have estimated primary completion dates of june and july 2015, respectively . Rilotumumab (amgen) is a human igg2 targeting human hepatocyte growth factor / scatter factor (hgf / sf) that blocks binding of hgf / sf to its receptor met, thereby inhibiting the met signaling pathways . The mab is undergoing evaluation in a phase 3 study (nct01697072) of chemotherapy (epirubicin, cisplatin and capecitabine) with rilotumumab or placebo for untreated advanced met - positive gastric or gastresophageal junction adenocarcinoma . Rilotumumab or placebo is administered iv at doses of 15 mg / kg every 21 d. the primary outcome measure is overall survival in a time - frame of three years . Initiated in october 2012, the estimated primary completion date for the study is december 2015 . Recently announced results for three late - stage studies of two mabs for cancer (farletuzumab, naptumomab estafenatox) and tabalumab, a mab treatment for autoimmune disorders, indicate that clinical endpoints were not met . Farletuzumab (morab-003, morphotek / eisai) is a humanized igg1 mab that targets human folate receptor, which is overexpressed in most epithelial ovarian cancers, as well as some forms of endometrial, breast, renal, lung and colorectal cancers . The primary endpoint of progression - free survival (pfs) was not met in the phase 3 far-131 study (nct00849667) of farletuzumab in combination with carboplatin and a taxane in patients with platinum - sensitive epithelial ovarian cancer in first relapse . Patients received placebo or farletuzumab at either 1.25 mg / kg or 2.5 mg / kg weekly for ~six cycles . Although the primary endpoint was not met, a trend toward improved pfs was observed in some patient subsets in a post - hoc analysis . The safety and efficacy of farletuzumab in combination with a platinum containing doublet in chemotherapy - nave subjects with stage iv adenocarcinoma of the lung are being evaluated in a phase 2 study (nct01218516). As announced in january 2013 by active biotech ab, initial results of a phase 2/3 study (nct00420888) of naptumomab estafenatox (abr-217620, anyara) in combination with interferon as a treatment for advanced renal cell carcinoma indicated that the study did not achieve its primary clinical endpoint of overall survival in the intention - to - treat cohort . A confounding factor was the presence of high levels of pre - formed anti - drug antibodies found in a majority of patients in this, but not previous, studies . A doubling of pfs and overall survival occurred in the 25% of patients who had low or normal levels of base - line il-6 and expected levels of anti - drug antibodies . Naptumomab estafenatox is composed of an antigen - binding fragment (fab) that targets metastasis - associated 5t4 fused to a mutated form of staphylococcal enterotoxin a (sea / e-120). Phase 3 studies of tabalumab (ly2127399, eli lilly and co.) as a treatment for ra have been discontinued due to lack of efficacy . Tabalumab, a human igg4 targeting b - lymphocyte stimulator, was being evaluated in five phase 3 studies of ra patients . Tabalumab in combination with bortezomib and dexamethasone is also being evaluated in a phase 2/3 study (nct01602224) of patients with previously treated multiple myeloma . Historically, ~50% of mabs in the commercial clinical pipeline have been studied as cancer agents; however, ~67% of the current cohort of mabs at phase 3 is in studies for non - cancer indications (table 1). These 20 mabs are human or humanized, with more than half (55%) targeting an interleukin or an interleukin receptor . The mabs are being developed as treatments for immunological disorders such as ra, sle, ms and psoriasis, but also for hypercholesterolemia, cachexia and alzheimer disease . Reflecting the overall greater challenge of demonstrating safety and efficacy in cancers, the molecular types of the 10 mabs in late - stage studies of cancer (table 2) are more diverse than those for non - cancer indications . Of particular note is the inclusion of a toxin in three molecules (naptumomab estafenatox, moxetumomab pasudotox, inotuzumab ozogamicin) and use of less than a full - length sequence for three molecules (naptumomab estafenatox, moxetumomab pasudotox, onartuzumab). The majority (70%) of the 10 product candidates are in studies of solid tumors, with the remainder undergoing evaluation as treatments for hematological cancers . The number of anti - cancer mabs at phase 3 is likely to increase in the next 35 y as more adcs move into and through the clinical pipeline . Mabs will continue to track the progress of antibody therapeutics in clinical study throughout 2013, and we look forward to reporting on results that may be released during the year in which are the antibodies to watch in 2014?
They may be seen in midline or para - axial location, from the brain to the sacral area . They display a particular tendency to locate in the sacrococcygeal and pre - sacral regions . Reported incidence of tumors at these sites the oropharyngeal cavity is exceedingly rare for teratomas, 2% of all teratomas, present as large masses protruding from the oropharyngeal area . Though oropharyngeal teratomas have a benign histopathology, they are potentially lethal as they may cause airway obstruction and respiratory compromise . So, principles of management in such patients comprise of the immediate postpartum establishment of a secure airway, if needed via tracheostomy and complete surgical resection of the mass . A 1980 g female infant born to 22-year - old mother after 38 weeks gestation presented with a growth in oral cavity associated with respiratory distress . The mother had undergone ultrasonography examination during pregnancy, but the report of the same was unavailable . On examination, cleft palate was present and a palatal tumor of size 4 cm 3 cm was found in the cleft area [figure 1]. It was hampering feeding . Computed tomography scan showed mass lesion in the palatal region (attached to the palate, more on the right side). No intracranial extension [figure 2]. Computed tomography scan image after due preparation, the patient was operated, and the mass was excised in toto [figure 3]. Histopathologic examination revealed a teratoma composed of mature glial tissue, choroid plexus, glands lined by respiratory type, columnar mucin secreting, and melanin pigment bearing epithelium . Pools of myxoid matrix bearing physaliferous cells are present (notochord like / chondroid areas) [figures 4 and 5]. Microscopic picture 1 microscopic picture 2 following excision, patient recovered faster and gained weight . Now, the patient is under routine follow - up, and palatoplasty has been done . Teratomas are the tumors which contain tissues derived from all three germ layers . These contain tissues foreign to the anatomical site of origin . Most of the teratomas in the pediatric age group are benign, but reports of malignant teratoma do exist . Basic histological classifications which are widely used (arnold's system) are: dermoid tumors: these are composed of ectoderm plus mesoderm . This is the most common form of teratomateratoids: these are poorly differentiated tumors and contain all three germ layersteratomas: these also contain tissue from all three germ layers . They are histologically more identifiableepignathus: these are tumors which contain fully developed organs and appendages . The large cervical and nasopharyngeal teratomas which obstruct fetal swallowing of amniotic fluid may contribute to polyhydramnios . This is the most common form of teratoma teratoids: these are poorly differentiated tumors and contain all three germ layers teratomas: these also contain tissue from all three germ layers . They are histologically more identifiable epignathus: these are tumors which contain fully developed organs and appendages . The large cervical and nasopharyngeal teratomas which obstruct fetal swallowing of amniotic fluid may contribute to polyhydramnios . Other imaging technique such as magnetic resonance imaging, is useful in finding out the anatomical relationship of these tumors . Clinical differential diagnoses of oropharyngeal teratoma are cystic hygroma, lymphangioma, duplications and neuroblastoma . Moreover, the histopathological differential diagnosis includes hamartoma, dermoid cyst, and a heterotopic gastrointestinal cyst . With growth, oral teratomas that is why, the respiratory distress may be less . The neonates with oral teratomas the basic principle of management of oropharyngeal teratomas is the establishment and maintenance of a secure airway . If an oropharyngeal teratoma is diagnosed antenatally, elective delivery or lower segment cesarean section is carried out . If orotracheal / nasotracheal intubation is failed / or difficult, tracheostomy must be done . Surgical goal is to remove the complete mass in toto, as a residual tumor may cause recurrence . Associated cleft palate can be repaired when the child grows up, that is, at the age of 1 years . During follow - up, afp should be monitored . In our case, all the afp levels were within normal range . Early diagnosis, the establishment of the good airway, complete excision of tumor and timely follow - up should increase the survival of newborns with oral teratomas.
The rationale underlying treatment recommendations based on esthetic impairment come from the social science researches, which indicate that unacceptable dental appearance may stigmatize, impede career advancement and peer group acceptance, encourage negative stereotyping, and have a negative effect on self - concept . Orthodontic problems are usually not associated with grave mortality or morbidity; hence, they tend to be overlooked by most health professionals as less important . However, studies reveal that malocclusions have a significant impact on the psychosocial health of the affected individual . For many years, epidemiologic studies of malocclusion suffered from considerable disagreement among investigators, especially regarding how much deviation from the ideal should be accepted within the bounds of normal . The orthodontic treatment need in the study group was assessed by esthetic component (ac) of the index of orthodontic treatment need (iotn). It is being widely used in dental epidemiology to prioritize orthodontic treatment and seeks to quantify the likely sociopsychological effects of each patient's malocclusion . The study was undertaken to assess the orthodontic treatment need in 2025-year - old patients reporting to the department of orthodontics and dentofacial orthopaedics, as assessed by orthodontists to plan future orthodontic services in the region as per priority in orthodontic triage, for worldwide comparisons, and as a powerful tool for patient counseling . The study was undertaken to assess the orthodontic treatment need in 2025-year - old patients reporting to the department of orthodontics and dentofacial orthopaedics, as assessed by orthodontists to plan future orthodontic services in the region as per priority in orthodontic triage, for worldwide comparisons, and as a powerful tool for patient counseling . The sample comprised 753 patients (360 females and 393 males - table 1) irrespective of gender, caste, creed, and socioeconomic status essentially fulfilling the following criteria: 2025 years old [table 2] no history of previous / current orthodontic treatmentpresence of all permanent teeth with / without third molarsno large restorationsinformed consent from patients for participation as part of the survey . 2025 years old [table 2] no history of previous / current orthodontic treatment presence of all permanent teeth with / without third molars no large restorations informed consent from patients for participation as part of the survey . The division of sample according to gender division of the subpopulation according to the age patients were examined clinically using mouth mirror and explorer . Ac was assessed by comparing and matching digitally clicked intraoral frontal view photograph in occlusion to the nearest resemblance on standardized photographs of iotn . Number 1 is the most, and 10, the least attractive arrangement of teeth . The anterior teeth were graded in their dental attractiveness as seen and no endeavor was made to predict the future appearance of the dentition . Esthetic component of the index of orthodontic treatment need scale (photographs 110) the ac of iotn has commonly been used to evaluate the treatment need on esthetic grounds by dentists (operator - rated) or patients (self - rated). Both patients and orthodontists can also assess the ac with the intent of removing the influence of parents and patients desires on the assessment of treatment need apart from considering individual variations in psychological maturity . Esthetic component grades all the data were analyzed using the statistical package for the social sciences 13.0 software program, ibm corporation, new york, usa . Results of the ac revealed that 78.1% exhibited no or slight need for treatment, whereas 13.2% demonstrated moderate to borderline need, and only 8.7% proved to have a definite need for orthodontic treatment . This states that the examiner, in general, expressed satisfaction with the esthetics of most of the screened patients, like the one shown in figure 2 unlike the one in figure 3 that without doubt required treatment . A patient categorized with slight need for orthodontic treatment a patient in severe / definite need for orthodontic treatment all the data were analyzed using the statistical package for the social sciences 13.0 software program, ibm corporation, new york, usa . Results of the ac revealed that 78.1% exhibited no or slight need for treatment, whereas 13.2% demonstrated moderate to borderline need, and only 8.7% proved to have a definite need for orthodontic treatment . This states that the examiner, in general, expressed satisfaction with the esthetics of most of the screened patients, like the one shown in figure 2 unlike the one in figure 3 that without doubt required treatment . A patient categorized with slight need for orthodontic treatment a patient in severe / definite need for orthodontic treatment malocclusions may range from the severe, rather uncommon conditions such as cleft lip and palate to the more common irregularities of teeth resulting from biological variations . Management of malocclusion is contained by a number of disciplines in dentistry, primarily orthodontics and attempts to prioritize treatment have used the measure of iotn, which relates to treatment need rather than its complexity . A sample of 753 patients from among those reporting to the department for a routine dental check - up was considered . The age group of 2025 years old was chosen because by then, the patients would be in a permanent dentition stage . At this age, there are less individual variations in dental age and occlusal development . The ac scores were recorded by the orthodontist unlike other studies where the patients self - assessed with the intent of removing the influence of patients desires on the assessment of treatment need apart from considering individual variations in psychological maturity . 78.1% exhibited no or slight need for treatment, whereas 13.2% demonstrated moderate to borderline need, and 8.7% proved to have a definite need for orthodontic treatment [figures 4 and 5]. Esthetic component scores inference of esthetic component grading in evaluating the ac in a sample population in shiraz, 91.3% of the population was in no need for treatment, 2.44% in moderate need, and 6.21% in great need for treatment . On the contrary, 22.8% of the malaysian children were found to have a definite need according to ac in a study conducted by abdullah and rock in 2001 . Analysis of registrations of the ac of the iotn should be interpreted with some caution . It has shortcomings, for example, the lack of photographs showing hypodontia, anterior spacing, and a class ii division 2 dentition . There is always some uncertainty in assessing the photographs of different types of malocclusion to identify one which corresponds to one's own dental appearance . Kok et al ., (2004) suggested that concern about a malocclusion is not closely related to the severity of the malocclusion in terms of esthetics as measured by the iotn - ac . 2002 suggested that the 10 photographs should be complemented with photographs of patients from other ethnic backgrounds . These studies not only provide a global perspective of high orthodontic treatment need, but also confirm a persistently high orthodontic treatment need over the past decade . In some european countries, general dentists and orthodontists have been using indices of treatment need to prioritize state - funded orthodontic treatment for children with major irregularities . In addition, the demand for orthodontic treatment has increased in contemporary setting due to increasing awareness and perceptions resulting in extensive waiting rolls . It is essential, therefore, that health authorities should carefully prioritize and plan the provision of orthodontic treatment . The introductions of easily comprehensible, reproducible, valid, and reliable indices of therapeutic need such as the ac of iotn have allowed improved focusing of services a baseline data were obtained for planning future orthodontic services in the region as per priority in orthodontic triage . The data collected can help for worldwide comparisons with other populationsthe ac - iotn is, hence, being used as a powerful tool for patient counseling and planning desired orthodontic mechanotherapy in the department . A baseline data were obtained for planning future orthodontic services in the region as per priority in orthodontic triage . The data collected can help for worldwide comparisons with other populations the ac - iotn is, hence, being used as a powerful tool for patient counseling and planning desired orthodontic mechanotherapy in the department.
In order to proliferate, cells must accurately transmit their chromosomes from one generation to the next . In eukaryotes, the chromosomes are confined to the nucleus, the perimeter of which is defined by the nuclear envelope . The nuclear envelope is made of a double membrane; the outer nuclear membrane is continuous with the endoplasmic reticulum (er) and contains many of the same proteins . The inner nuclear membrane contains a distinct set of proteins, some of which interact with chromatin . The outer and inner nuclear membranes are fused at sites of nuclear pore complexes (npcs), macromolecular structures that allow selective passage of proteins, rna and other molecules to and from the nucleus . In most eukaryotes, underlying the inner nuclear membrane is a network of proteins, called the nuclear lamina, made of lamins and lamin - associated proteins . This network provides rigidity to the nucleus and contributes to chromatin organization and other nuclear processes . Interestingly, neither plants nor fungi have a lamin - based nuclear lamina, although other structures may serve a similar purpose . Of note alterations in nuclear shape and size are characteristic of aging and certain disease states, such as various types of cancer . Thus, understanding how nuclear shape is regulated and identifying genes that contribute to nuclear morphology are of interest from both a medical and a basic biology standpoint . The nuclear envelope not only serves as a diffusion barrier but also as a physical barrier separating the chromosomes from cytoplasmic structures . In most animal cells these cytoplasmic structures include the centrosomes, which function as microtubule organizing centers that nucleate spindle microtubules necessary for chromosome segregation . However, just before mitosis, the nuclear envelope stands between these microtubules and the chromosomes . Different cell types have adopted different strategies to facilitate the access of chromosomes by microtubules: at one end of the spectrum are cells of most metazoans, in which nuclear envelope components, including the two nuclear membranes, the npcs and the nuclear lamina with their associated proteins, disperse during each and every mitosis (fig . This type of mitosis is called open mitosis, and it necessitates the reassembly of the nuclear envelope around a full complement of chromosomes in each of the daughter cells once chromosome segregation is completed . Parenthetically, the mechanism that ensures the formation of only a single nucleus at the end mitosis, as opposed to several nuclei each encompassing a subset of chromosomes, is not known . At the other end of the spectrum are certain fungi in which the centrosome equivalents, called spindle pole bodies, are either permanently embedded in the nuclear envelope (such as in budding yeast) or are embedded in the nuclear envelope prior to mitosis (such as in fission yeast). These cells undergo what is called closed mitosis, which occurs without nuclear envelope breakdown, as spindle microtubules that assemble within the nucleus can readily access the chromosomes . However, during closed mitosis, the nucleus must elongate in a manner that is coordinated with chromosome movement as chromosome segregation takes place (fig . The chromatin (blue) is contained within the nuclear envelope (light green). As cells enter mitosis, the nuclear envelope disassembles, allowing spindle microtubules (purple lines) nucleated by centrosomes (purple spheres) to align the chromosomes on the metaphase plate . (b) closed mitosis . Shown is mitosis as it occurs in s. cerevisiae . The spindle pole body (purple) is embedded in the nuclear envelope throughout the cell cycle . After spindle pole body duplication, an intra - nuclear spindle is formed (s. cerevisiae chromosomes do not condense enough to visualize individual chromosomes or a metaphase plate). During anaphase, the nucleus elongates and the nuclear envelope expands as the sister chromatids move away from each other . (c) functionally open, structurally closed mitosis . A term defined by sazer to indicate a breakdown in the diffusion barrier while maintaining an intact nuclear envelope . Shown is mitosis as it occurs in aspergillus nidulans . As in s. cerevisiae, during interphase the spindle pole body is embedded in the nuclear envelope . As cells enter mitosis the nuclear pores (dark green) partially disassemble, significantly reducing the diffusion barrier between the nucleus and cytoplasm . As in closed mitosis, the bulge in the center of the elongated nucleus during anaphase contains the nucleolus, which is left behind during chromosome segregation . Schizosaccharomyces japonicus cells form an intra - nuclear spindle as in cells undergoing closed or partially open mitosis . However, during anaphase, the nuclear envelope ruptures as the nucleus elongates without nuclear envelope expansion . The historic definition of open vs. closed mitosis was based on cytology: during open mitosis the nuclear envelope disappears, opening the nucleus and exposing its content to the cytoplasm, while in closed mitosis the nuclear envelope remains intact . From a functional standpoint, the presence or absence of a nuclear envelope affects at least two processes: the free diffusion of molecules between the cytoplasm and the nucleus (which occurs during open, but not closed, mitosis) and the presence of a physical barrier between the chromosomes and cytoplasmic structures (which exists in closed, but not open, mitosis). Over the years, mitotic divisions that fall somewhere in between open and closed have been described, warranting a brief discussion on how these forms of mitosis should be defined . In aspergillus nidulans, which was originally defined as undergoing closed mitosis, npcs partially disassemble as cells enter mitosis, disrupting the diffusion barrier between the nucleus and the cytoplasm, while maintaining a physical barrier between the chromosomes and cytoplasmic structures (fig . A breakdown in the diffusion barrier also occurs during a brief period in anaphase of meiosis ii of the fission yeast schisosaccharomyces pombe . Unlike the situation in a. nidulans, however, the change in permeability in s. pombe meiosis ii occurs at only a short window of nuclear division and is not accompanied by changes in either npc composition or nuclear membrane integrity . This led sazer to define this type of division as functionally open but structurally closed, a term that can also be applied to a. nidulans mitosis . Other types of mitosis involve a partial opening in the nuclear membrane itself . In schisosaccharomyces japonicas, the nuclear envelope does not expand during mitosis, nor does it disassemble . As a result, the nuclear envelope ruptures as the intra - nuclear spindle elongates (fig . Interestingly, rupturing is not a result of forces exerted by the spindle, but rather a programed cell cycle event, the regulation and mechanism of which remain to be discovered . In the early embryonic divisions of the nematode caenorhabditis elegans the nuclear envelope is breached in pro - metaphase, allowing diffusion of cytoplasmic proteins into the nuclear space . A similar phenomenon is seen during drosophila syncytial divisions, where the nuclear envelope displays a partial disassembly of nuclear pore complexes and fenestrations near the centrosomes, thereby allowing microtubules to access the chromosomes . Live cell imaging suggests that just as in closed mitosis, the nuclear envelope during drosophila syncytial divisions expands as the spindle elongates . In these three cases, however, mitosis is not structurally closed, as nuclear envelope integrity is breached and cytoplasmic structures, such as microtubules, can enter the nucleus . Consequently, the term functionally open but structurally closed may not fully apply when describing these types of mitosis, and several studies have previously referred to these mitoses as semi - open mitosis . We propose to use partially open mitosis as term that encompasses all forms of mitosis that are neither fully closed nor fully open, but that exhibit a change in the diffusion barrier at some point during mitosis that may or may not be accompanied by visible structural change to the nuclear envelope . Among unicellular eukaryotes there are many variations of nuclear envelope behavior during mitosis (for more examples see refs . 16 and 17), and undoubtedly additional forms of mitosis still remain to be discovered . It is likely that the various types of mitosis have evolved to adapt to a particular environment, although it is currently not known what kinds of selective pressure shaped the different modes of mitosis . A possible driving force is the position of the centrosome, namely in the cytoplasm vs. embedded in the nuclear envelope, which likely coevolved with nuclear envelope behavior . In addition, the evolution of mitosis could have been affected by the need to eliminate rate - limiting diffusion barriers between the nucleus and the cytoplasm as occurs during open and partially open mitosis, but is either not a problem or is somehow overcome in closed mitosis . It is conceivable that, during syncytial divisions, partially open mitosis evolved to overcome the diffusion barrier and microtubule accessibility problems, while protecting chromosomes from aberrant attachments to microtubules from neighboring nuclei . The evolution of different forms of mitosis remains an unresolved, yet fascinating, question . Closed mitosis appears at first glance to be an economical solution to the issue of microtubule - chromosome accessibility: nuclear envelope breakdown is circumvented, the chromosomes do not get entangled with cytoplasmic structures, and cells do not have to reassemble the nuclear envelope at the end of mitosis, risking leaving one or more chromosomes outside the nuclear perimeter . Chief among them is how the nuclear envelope expands . In particular, how is the timing of nuclear expansion determined? Is it a consequence of spindle elongation or is it an independent process regulated by the cell cycle machinery? And how are nuclear envelope components added? Finally, what happens to nuclear envelope expansion if cells are delayed in mitosis, for example due to checkpoint activation? An insight into these questions came from a study by witkin et al . On the shape of the budding yeast nucleus . During normal growth, the budding yeast nucleus is round, except during mitosis when it elongates through the bud neck to accommodate chromosome segregation (fig . Witkin et al . Screened for genes that when deleted lead to alterations in nuclear shape, aiming to identify genes that affect nuclear envelope dynamics . The authors used a collection of roughly 5000 budding yeast deletion mutants (each deleted for a single non - essential gene), into which they introduced a nuclear gfp marker and a cytoplasmic rfp marker . This strategy then allowed them to screen visually for mutants that displayed abnormal nuclear morphology . One class of nuclear abnormalities was of nuclei that exhibited extensions, referred to as flares . Further examination of these mutants revealed that this altered nuclear phenotype was not due to a direct involvement of the deleted genes in nuclear morphology, but rather due to the activation of a checkpoint pathway (e.g., the dna damage checkpoint or the spindle assembly checkpoint) that induced a mitotic delay . In other words, the mutations isolated in the screen likely increased the formation of intracellular damage, which, in turn, led to a mitotic delay through checkpoint activation . Indeed, other conditions that induced a mitotic delay (e.g., depolymerizing microtubules with nocodazole; inhibiting the anaphase promoting complex) also led to the formation of a nuclear flare . Interestingly, the nuclear flare formed due to a mitotic delay was confined to the nuclear envelope region adjacent to the nucleolus (fig . 2b, and see below), which normally forms a crescent - shaped structure at the nuclear periphery (fig . Are images taken 20 min apart of budding yeast cells expressing a gfp - tagged nucleoplasmic marker (pus1) and an rfp - tagged nucleolar marker (nsr1). Importantly, the change in nuclear morphology was specific to a cell cycle delay in mitosis; witkin et al . Found that nuclei of cells arrested in s phase or g2 were mostly round . Moreover, the formation of the nuclear flare in cells treated with nocodazole began at the same time as nuclear elongation in untreated cells and was dependent on phospholipid synthesis . However, phospholipid synthesis alone was not sufficient to induce flares, as g2 arrested cells accumulated just as much phospholipid as mitotic arrested cells . Taken together, these results suggest that nuclear expansion during closed mitosis of budding yeast is independent of spindle elongation, but rather occurs in response to a cell cycle cue that signals mitotic entry . First, what regulates nuclear envelope expansion? As noted above, the process is independent of spindle elongation, much like nuclear envelope rupture in s. japonicus . Thus, in these yeasts there are likely targets of the cell cycle machinery that affect nuclear envelope dynamics during mitosis the synthesis of phospholipids, the main components of the nuclear membrane, is required for nuclear envelope expansion, as shown previously for both budding and fission yeast . Moreover, at least one enzyme that negatively regulates membrane expansion, pah1, is regulated by cdk1 phosphorylation (ref . The observation that a nuclear flare forms when checkpoint pathways are activated suggests that phospholipid synthesis is not subjected to checkpoint regulation . However, phospholipid synthesis is unlikely to be the only cell cycle target required for nuclear expansion, because g2-arrested cells accumulate just as much phospholipid as mitotic - arrested cells, yet they don't form a flare (ref . 18; note, however, that it is currently not known whether nuclear envelope of g2 cells also expands, but without forming a flare). It is tempting to speculate that the cell cycle target may be a protein or a process that is responsible for allocating membrane addition specifically to the nuclear envelope, either by localized phospholipid synthesis or by drawing membrane from the er preferentially during mitosis . Spindle elongation may also play a role in nuclear envelope expansion: although the surface area of the nucleus increases during a mitotic arrest in the absence of a spindle (i.e., during an arrest induced by nocodazole), it is possible that spindle elongation contributes to the rate, and perhaps magnitude, of nuclear envelope expansion . Observed that nuclear envelope expansion during a mitotic arrest occurs in a curious fashion: rather than expanding isometrically, thereby generating a larger sphere, the flare occurs at the nuclear envelope that is adjacent to the nucleolus (fig . Whether this occurs in other organisms that undergo closed mitosis is currently not known, as cell cycle analyses typically use dna staining, rather than a nuclear envelope marker, to follow cell cycle progression . Nonetheless, the flare induced by a mitotic arrest is similar to the nuclear expansion observed when the pah1 pathway is misregulated . Pah1 converts phosphatidic acid to diacylglycerol . In the absence of pah1 (or in the absence of its activators, the nem1 and spo7 phosphatase complex) the overall levels of certain phospholipids increase, the er loses its tubular shape in favor of membrane sheets, and the nucleus forms a flare at the nuclear envelope adjacent to the nucleolus . Why, then, in both pah1 pathway mutants and in a mitotic arrest is the expansion of the nuclear envelope specific to the region adjacent to the nucleolus? Campbell et al . Showed that in a spo7 mutant, if the nucleolus is reduced to a tiny sphere the flare still forms, with the diminished nucleolus often at the base of the flare . Whether the nucleolus, or its remnant, affects the adjacent nuclear envelope remains unknown . Alternatively, there may be a structure that prevents nuclear envelope expansion around the entire nuclear envelope except in the region adjacent to the nucleolus . There are indeed budding yeast nuclear membrane proteins that are excluded from the nucleolus; none of the ones tested had properties consistent with an inhibitor of membrane expansion (our lab, unpublished), but other such proteins may still exist . Since the nuclear envelope is continuous with the er, it is quite possible that phospholipids are synthesized at the nuclear envelope itself . If this were the case, it is conceivable that the nuclear envelope adjacent to the nucleolus would have a higher capacity for phospholipid synthesis, or that membrane is added throughout the nuclear envelope, but, as mentioned above, there may be a mechanism that resists expansion everywhere except adjacent to the nucleolus . Alternatively, the membrane could come from the er, and if this were the case then the cell would have a mechanism for allocating membrane from the er to the nuclear envelope specifically during mitosis . It is currently not known whether the er expands during a mitotic arrest, and if so, at what rate . Thus, the mechanisms driving nuclear envelope dynamics, and in particular nuclear envelope expansion, remain to be uncovered . The study by witkin et al . Highlights the dynamic nature of the nuclear envelope during the cell cycle . The observations in this study support a model whereby the nuclear envelope adjacent to the nucleolus is the preferential site of expansion during a mitotic delay . It is interesting that phospholipid synthesis is not under checkpoint control; consequently, a cell delayed in mitosis needs to somehow deal with increased nuclear envelope surface area in the absence of chromosome segregation . We can envision at least three possibilities: first, sequestering the added nuclear envelope to the region adjacent to the nucleolus could preserve inter - chromosomal interactions that would otherwise be disrupted were the nucleus to expand isometrically . Second, yeast cells are known to maintain a constant nuclear to cell volume ratio by a yet unknown mechanism . It is possible that by confining the extra nuclear envelope to a flare, rather than distributing it throughout the entire nuclear surface, the cell is better able to regulate its nuclear volume . Finally, the nuclear envelope adjacent to the nucleolus may be the region of initial nuclear envelope expansion even under normal growth conditions, but in the absence of spindle elongation this expansion is not distributed throughout the entire nuclear surface . Regardless of the mechanism, the appearance of a nuclear flare suggests that the budding yeast nuclear envelope has domains of distinct properties . How these domains differ in their ability to expand is not known . Isolation of mutants that fail to produce a flare during a mitotic arrest will likely shed light on the mechanism that designates distinct nuclear envelope domains and on the function of flare formation . Finally, can observations in closed mitosis illuminate processes related to the nuclear envelope in cells that undergo open mitosis? As in closed mitosis, the nuclear envelope of metazoans must also expand, not during mitosis but during interphase, immediately following nuclear envelope reassembly . Much like in yeast, the source of membrane, and both the temporal and spatial regulation of this process, are unknown . Moreover, in certain cancer cells nuclei become larger and multi - lobed, and during aging the nuclear envelope appears if so, do changes in the nuclear envelope have consequences for cell function? Despite the different modes of mitosis in budding yeast and mammalian cells, cell cycle processes have often proved to be based on conserved proteins . Thus, studies on nuclear envelope dynamics in budding yeast will likely shed light on processes related to nuclear envelope formation, tumorigenesis and aging in higher eukaryotes.
Fibro - osseous lesions (fol) are a poorly defined group of lesions affecting the jaws and craniofacial bones . All are characterized by the replacement of bone by cellular fibrous tissue containing foci of mineralization that vary in amount and appearance . Recent world health organization classification (2005) for fibro - osseous lesions was considered while sub - dividing these into various groups [table 1]. So proper categorization requires good correlation of the history, clinical findings, radiographic characteristics, operative findings, and histologic appearance . The aim of this study was to analyze various clinico - pathological and radiological features in the benign fol reported and to compare the features between fibrous dysplasia (fd) and cemento - ossifying fibroma (cof). These patients were treated for fol, reported to the hospital between 1989 and 2009 . The clinical parameters included were age, sex, location, duration, family history, associated symptoms, and behavior of the lesion . The radiographic appearance, histologic features, treatment, and follow - up data were also recorded . Basic clinical parameters such as age, sex, duration of lesion, family history, history of trauma, associated symptoms, palpatory findings, status of associated / involved teeth, associated pigmentation, site of the lesion, treatment, and recurrence details were retrospectively analyzed . Regarding site distribution, the maxilla was divided into two anatomic regions as anterior (midline to distal surface of canine) and posterior (mesial surface of first premolar distally). The mandible was divided into four anatomic regions such as anterior (midline to distal surface of canine), posterior (mesial surface of first premolar distally), angle (from distal of third molar to the inferior portion of ramus), and ramus (upper portion of the ramus beyond the occlusal plane). Radiological features were assessed for radiolucency, radiopacity, margin of the lesion, cortical - plate expansion, involvement of antrum, displacement, and resorption of teeth . Histopathologically, parameters such as type of bone (mature / immature), cellularity, presence of cementum - like material, and nature of stroma were assessed . A total of 80 cases of benign fols were recorded over the 20 years . Among these, cof (all variants) was the most frequent tumor found in 60 patients with 63 lesions (73.2%) and fd was found in 20 patients (24.4%). In general for fol, the age ranged from 3 years to 65 years with a mean age of 23.3 years; the majority of cofs and fds were seen in the second decade (38.3% and 65% respectively). The male - female ratio for these 80 patients was 1:1 with slight female predilection (27 men and 33 women i.e., 1:1.2), whereas fd showed definite male predilection (13 men and 7 women, i.e., 1.8:1). However, there was no significant correlation between the lesions and the sex with p> 0.05 [figure 1]. The sex distribution of 80 patients with fibro - osseous lesions most of the time, fol patients complained of a slow - growing swelling of the jaws and facial asymmetry (75 patients = 93.7%) whereas in four patients (5%), it was an incidental finding; all these four cases were later diagnosed to be cof . In one case of fd, a biopsy was done because of a non - healing extraction socket . In case of cof, the associated signs and symptoms involved pus discharge, tenderness, egg shell crackling, tender lymph nodes, ulceration of the overlying mucosa, numbness of lip and proptosis . None of family history and past medical history data collected were contributory to our study except few which are listed below . There were four cof patients recorded with history of extraction (2 patients), surgery for osteosarcoma (1 patient), and history of trauma (1 patient) at the site of current presentation . When fol as a whole was taken, no specific jaw / side predilection was evident . The cof showed slight mandibular predilection (1.37:1) unlike that of fd which showed definitive maxillary predilection (2.3:1). Moreover, cof were often recorded in mandibular posterior region (51.2%), whereas at the time of presentation fd was recorded unilaterally in maxilla as a whole bone . There were three cases of cof noted at the midline either in maxilla (1 patient) or in mandible (2 patients) and three other cases of cof crossed midline with an extensive presentation in the mandible . The most posterior presentation of cof was noted in two of our cases in the ramus and angle of the mandible [table 1]. Extensive involvement of facial bones like ethmoidal and frontal bone was seen in fd (2 patients), in four cases of cof {juvenile ossifying fibroma (jof) variant}, and in two patients with aggressive form of ossifying fibroma (of) (which cannot be classified as jof). When the data was subjected for chi - square test, significant association was found between the fol and the site (maxilla and mandible) with p <0.05 [figure 2]. The site distribution of 80 patients with fibro - osseous lesions mobility of teeth was seen in 13 patients which included 11 cases of cof and two cases of fds . In one case of cof, the lesion was associated with displacement of teeth, whereas one cof showed impacted tooth . Radiographically, 23 (38.3%) cofs showed mixed opaque and lucent areas, 19 (31.6%) cases showed only radiolucent areas and 18 (30%) cases showed only radiopacity . Among these, 55 (91.6%) had a well - defined border whereas 5 (8.3%) cases were having diffuse outline . A total of eight cofs, showed involvement of antrum, displacement and resorption of the teeth . Among fds, most of them showed mixed opaque and lucent areas (75%), diffuse borders (60%) with only four cases (20%) showing expansion of cortical plates, and five cases showing expansion of antrum . Only one case showed resorption of the associated teeth . In case of cof, on 34 (56%) occasions it was provisionally diagnosed as cof and fd was considered in four cases . Among 20 fds, 15 (75%) times fd was considered as a provisional diagnosis and only in two occasions, it was thought in terms of cof . Other provisional diagnosis considered were adenomatoid odontogenic tumor, ameloblastoma, aneurysmal bone cyst, odontoma, calcifying epithelial odontogenic tumor, odontogenic myxoma, central giant cell granuloma, and odontogenic keratocyst for cof and osteoma for fd . The cof on the post - operative histologic findings was seen as a well - demarcated lesion that was separated from the overlying cortical bone by a thin zone of fibrous tissue . The stroma was fibro - cellular (42 cases) and fibrous (18 cases) with irregular thin trabeculae of woven bone (43 patients) or lamellar bone (11 patients) rimmed by osteoblasts . Basophilic, ovoid, cementum - like material was evident in 21 cofs: among these four were considered as jof psammamatoid type . Other features evident with regular histopathology were the presence of giant cells (5 cof), myxoid areas (1 jof), and endothelial proliferation (1 cof). Fd showed merging of lesional bone with the normal along with highly fibrous stroma (8 cases) consisting of immature trabeculae of woven bone (18 lesions) giving a comparison of histopathological features between cemento - ossifying fibroma and fibrous dysplasia the treatment procedures rendered in these cases has been summarized in the table 3 . Eight patients of cof showed recurrences within a period ranging from 2 months to 4 years . One case of jof showed three recurrences every year . Among three patients with fds, two patients had recurrences after 2 and 4 years respectively, with last one showing multiple (3 times) recurrences almost after 3 years each time . A total of 80 cases of benign fols were recorded over the 20 years . Among these, cof (all variants) was the most frequent tumor found in 60 patients with 63 lesions (73.2%) and fd was found in 20 patients (24.4%). In general for fol, the age ranged from 3 years to 65 years with a mean age of 23.3 years; the majority of cofs and fds were seen in the second decade (38.3% and 65% respectively). The male - female ratio for these 80 patients was 1:1 with slight female predilection (27 men and 33 women i.e., 1:1.2), whereas fd showed definite male predilection (13 men and 7 women, i.e., 1.8:1). However, there was no significant correlation between the lesions and the sex with p> 0.05 [figure 1]. The sex distribution of 80 patients with fibro - osseous lesions most of the time, fol patients complained of a slow - growing swelling of the jaws and facial asymmetry (75 patients = 93.7%) whereas in four patients (5%), it was an incidental finding; all these four cases were later diagnosed to be cof . In one case of fd, a biopsy was done because of a non - healing extraction socket . In case of cof, the associated signs and symptoms involved pus discharge, tenderness, egg shell crackling, tender lymph nodes, ulceration of the overlying mucosa, numbness of lip and proptosis . None of family history and past medical history data collected were contributory to our study except few which are listed below . There were four cof patients recorded with history of extraction (2 patients), surgery for osteosarcoma (1 patient), and history of trauma (1 patient) at the site of current presentation . When fol as a whole was taken, no specific jaw / side predilection was evident . The cof showed slight mandibular predilection (1.37:1) unlike that of fd which showed definitive maxillary predilection (2.3:1). Moreover, cof were often recorded in mandibular posterior region (51.2%), whereas at the time of presentation fd was recorded unilaterally in maxilla as a whole bone . There were three cases of cof noted at the midline either in maxilla (1 patient) or in mandible (2 patients) and three other cases of cof crossed midline with an extensive presentation in the mandible . The most posterior presentation of cof was noted in two of our cases in the ramus and angle of the mandible [table 1]. Extensive involvement of facial bones like ethmoidal and frontal bone was seen in fd (2 patients), in four cases of cof {juvenile ossifying fibroma (jof) variant}, and in two patients with aggressive form of ossifying fibroma (of) (which cannot be classified as jof). When the data was subjected for chi - square test, significant association was found between the fol and the site (maxilla and mandible) with p <0.05 [figure 2]. The site distribution of 80 patients with fibro - osseous lesions mobility of teeth was seen in 13 patients which included 11 cases of cof and two cases of fds . In one case of cof, the lesion was associated with displacement of teeth, whereas one cof showed impacted tooth . Radiographically, 23 (38.3%) cofs showed mixed opaque and lucent areas, 19 (31.6%) cases showed only radiolucent areas and 18 (30%) cases showed only radiopacity . Among these, 55 (91.6%) had a well - defined border whereas 5 (8.3%) cases were having diffuse outline . A total of eight cofs, showed involvement of antrum, displacement and resorption of the teeth . Among fds, most of them showed mixed opaque and lucent areas (75%), diffuse borders (60%) with only four cases (20%) showing expansion of cortical plates, and five cases showing expansion of antrum . In case of cof, on 34 (56%) occasions it was provisionally diagnosed as cof and fd was considered in four cases . Among 20 fds, 15 (75%) times fd was considered as a provisional diagnosis and only in two occasions, it was thought in terms of cof . Other provisional diagnosis considered were adenomatoid odontogenic tumor, ameloblastoma, aneurysmal bone cyst, odontoma, calcifying epithelial odontogenic tumor, odontogenic myxoma, central giant cell granuloma, and odontogenic keratocyst for cof and osteoma for fd . The cof on the post - operative histologic findings was seen as a well - demarcated lesion that was separated from the overlying cortical bone by a thin zone of fibrous tissue . The stroma was fibro - cellular (42 cases) and fibrous (18 cases) with irregular thin trabeculae of woven bone (43 patients) or lamellar bone (11 patients) rimmed by osteoblasts . Basophilic, ovoid, cementum - like material was evident in 21 cofs: among these four were considered as jof psammamatoid type . Other features evident with regular histopathology were the presence of giant cells (5 cof), myxoid areas (1 jof), and endothelial proliferation (1 cof). Fd showed merging of lesional bone with the normal along with highly fibrous stroma (8 cases) consisting of immature trabeculae of woven bone (18 lesions) giving a chinese letter eight patients of cof showed recurrences within a period ranging from 2 months to 4 years . One case of jof showed three recurrences every year . Among three patients with fds, two patients had recurrences after 2 and 4 years respectively, with last one showing multiple (3 times) recurrences almost after 3 years each time . The fol of the jaws comprise a diverse, interesting, and challenging group of conditions that pose difficulties in classification and treatment . Common to all is the replacement of normal bone by a tissue composed of collagen fibers and fibroblasts that contain varying amounts of mineralized substance, which may be bony or cementum - like in appearance . Langdon et al ., suggested that certain fols of the jaw may represent different stages in the evolution of a single disease process . Although the first case report of fibro - osseous lesion was reported 60 years ago, there are only few retrospective studies regarding their clinic - pathological correlation . Among them, the four important studies were carried out by alsharif et al ., on chinese population, ogunsalu et al ., on jamican population, langdon et al . Comparison of clinical parameters with previous studies however, although fol are one of the common lesions occurring in india, such a retrospective study is not reported in the english language literature . We also tried to compare the features between cofs and fds, which are the only two groups of entities reported in this region . Aggressive variants seen in young adults are called as jof (who 1992). According to recent who classification of fols, of is a well - demarcated lesion composed of fibrocellular tissue and mineralized material of varying appearances . Juvenile trabecular of and juvenile psammamatoid of are two histologic variants of of . Due to the presence of cementum - like material of have been called as cementifying fibroma (cf) or cof if they have both cementum and bone - like material . Previous studies considered cementoid lesions as separate groups which included cemento - osseous dysplasia, gigantiform cementoma, and cementoblastoma . However, alsharif et al ., has considered cof as cementoid lesions containing cementum - like material, since he has considered of as a separate entity . However, in 1992 the who grouped such lesions under the common denomination of cof on the grounds that they represented histologic variants of the same type of lesion . In this study, of and cof are combined and no cementoid lesions were reported till today to our hospital . In our data, 24 cases were diagnosed as of, 21 as cof, 11 as cf, and 4 as jof . However, we considered all 60 cases as a single entity (cof) in contrast to the study on chinese population where cof and of are assessed separately . None of these cases showed any familial history as we know there are two case reports of familial cof . The term fd was given by lichtenstein in 1938, which was earlier described as osteitis fibrosa disseminate . It is a genetically based sporadic disease of bone that may affect single or multiple bones (monostotic or polyostotic) or if it is occurring in multiple adjacent craniofacial bones, it is regarded as craniofacial fd . Fd may be part of jaffe - lichenstein's, macunae albright's, or mazabraud's syndrome . In over 80% of cases it is monostotic, whereas all 20 cases in our data showed a solitary lesion in the jaws, although few of maxillary lesions extending up to infra - orbital margin affect vision ., was 27 years and 34 years, contrasting to what we got as 21 years for the present study . Early lesions may be radiolucent, but they become increasingly radiopaque and typically show a diffuse radiopacity or ground glass appearance . In the present study, 75% of the lesions showed mixed opacity and lucency, whereas two cases were completely radiolucent and three cases with complete radiopaque picture . The key histologic features of fd are delicate trabeculae of immature bone with no osteoblastic rimming, enmeshed within a fibrous stroma giving a mature bone was seen in one of our case and osteoblastic rimming was evident in few areas of five cases and stroma was mostly fibrocellular, although few showed a completely fibrous or vascular background . Compared with previous studies,[468] both cof and fd were predominantly seen in younger population (25.5 years and 21 years respectively). However, in our data, there was a definite male predilection (1.8:1) for fd which was contrasting to the previous studies. [468] when compared with fd, many of cof presented with associated symptoms like pus discharge, egg shell crackling, tenderness, ulceration of the overlying mucosa, numbness of lip, and proptosis which is unusual for these groups of lesions (this involvement was seen in four patients diagnosed as jof). Other than jof, there are no previous reports of conventional cof showing highly aggressive behavior . Only few fds presented with aggressive symptoms . The involvement of other facial bones (frontal, ethmoidal, antrum) was a frequent finding in cof when compared with fd . Both cof and fd showed multiple recurrences . Since few of our cof cases showed history of trauma and association with osteosarcoma, a careful detailing of these in the history is emphasized although its correlation with the occurrence of the lesion cannot be established through this study . As aggressive behavior and recurrence was a frequent finding in few patients with cof, a long follow - up was advised . Juvenile ossifying fibroma was of predominantly psammamatoid type and finally, not a single cementoid lesion was reported for last 20 years.
Green tea, unfermented and made from the leaves of the camellia sinensis plant, is one of the most popular beverages consumed across the world [13]. The property and chemical components of green teas are influenced by many factors, such as tea species, harvest season, climate, geographical locations, and processing . In china, among various factors, the geographical origin is recognized as an important aspect of tea . Because of the similar tea species, cultivation and processing conditions in a specific tea - producing area, many teas are named after their geographical origins . Longjing tea is a green tea produced in xihu and its surrounding areas (hangzhou, china). As a famous green tea with protected designation of origin (pdo), longjing is recognized as one of the top green teas for its special appearance (flat and straight leaves), flavor, and taste . However, little information has been available on the feasibility of discriminating longjing from its three specific subproducing areas, namely, xihu, qiantang, and yuezhou . As the quality and prices of longjing tea from the above three producing areas are different, it is necessary to develop effective analysis methods for discrimination of longjing from different subproducing areas . Because of the similarity (processing, appearance, and taste) among different subproducing areas, the specific geographical origins of longjing are usually distinguished by sensory analysis . However, because it is very expensive and may take years to train a tea taster, it would be more efficient to use some nonhuman techniques . Recent years have witnessed increased applications of electronic tongue technology to analysis of wines, milk, tea, beer, juice, and so on [710]. In these applications, a very good time stability and sensitivity, a good correlation between human and electronic tongue judgment has been observed, which makes it a promising alternative to human sensory analysis of teas . This paper was focused on developing a rapid analysis method for discriminating specific subproducing areas of longjing tea by electronic tongue and chemometrics . Robust principal component analysis (robpca) [11, 12] was used to detect outliers in each class . Partial least squares discriminant analysis (plsda) was used to develop the classification model . 155 longjing samples were collected from the local tea plantations in xihu (32 samples, class a), qiantang (59 samples, class b), and yuezhou (64 samples, class c). All the samples were preserved in a cool (about 4c), dark, and dry place with integral packaging before preparation of tea extract . Six gram of each sample was added with 250 ml boiling deionized water and infused for 10 min . The infusion was then filtered into a beaker and cooled to the room temperature (25c) by water bath for electronic tongue analysis . The detection system consists of one reference electrode (ag / agcl) and 7 liquid cross selective sensors (zz, ba, bb, ca, ga, ha, and jb). The cross - sensitivity and selectivity of the sensor array are listed in table 1 . The sensors array analyzed the solutions of tea samples with sampling interval of 1 s. each sample was measured for 150 s, which can ensure a stable response . All the data analysis was performed on matlab 7.0.1 (mathworks, sherborn, ma, usa). The responses of the 7 sensors reported at 150 s were used for the subsequent data analysis . Outliers in the data would degrade the classification models and prediction performance, so robust principal component analysis (robpca) was used to detect outliers in each class of samples . Robpca can obtain robust projections of the original data points and avoid the masking effects caused by multiple outliers . With the computed robust score distance (sd) and orthogonal distance (od), robpca can classify an object into one of the four groups: regular points (with small sd and small od), good pca - leverage points (with large sd and small od), orthogonal outliers (with small sd and large od), and bad pca - leverage points (with large sd and large od). With outliers deleted, the duplex algorithm was used to divide the measured data into a training set and test set . Duplex algorithm can obtain a test set of samples distributed uniformly in the range of training samples . For multiclass classification, plsda can be performed by regressing each column of a dummy response matrix y on the measured data x by pls . For the ith (i = 1, 2, and 3) column in y, an element is set a value of 1 if the corresponding object is from class i; otherwise, it is assigned a value of 0 . For prediction, a new sample is classified into class i when the ith element of its predicted response vector is nearest to 1 . Monte carlo cross validation (mccv) was used to estimate the number of components in plsda by minimizing the mean percentage error of mccv (mpemccv): (1)mpemccv=i=1bnii=1bmi, where b is the numbers of mccv data splitting, mi is the number of prediction objects, and ni is the number of wrongly predicted for the ith mccv data splitting . Model sensitivity and specificity of prediction for each class were used to evaluate the performance of classification models: (2)sensitivity = tptp+fn, specificity = tntn+fp, where tp, fn, tn, and fp represent the numbers of true positives, false negatives, true negatives, and false positives, respectively . For classification, objects in each class were denoted as positives and the other two classes were denoted as negatives . The average electronic tongue features for each class of longjing tea are shown in figure 1 . Seen from figure 1, the features of the three classes have very similar response patterns . The features of class b and c are very similar and different from those of class a, especially in the responses of ga and ha . Robpca was used for outlier detection with a significance level of 0.05 . Because each class of tea has a different probability distribution, robpca models were performed separately on each class . Figure 2 demonstrates the robpca plots for the three classes . For each class, a robpca model with three principal components (pcs) three pcs explained 89.7, 91.5 and 92.1 percents of the total variances of each class, respectively . For outlier diagnosis, bad pca - leverage points, good pca - leverage points and orthogonal outliers were excluded to obtain a representative data set distributed in the entire range of measured samples . The numbers of objects with large sd and od were denoted . As a result, for class a, two orthogonal outliers (objects 1 and 26) and two good pca - leverage points (objects 15 and 31) were deleted; for class b, four orthogonal outliers (objects 1, 19, 24, and 43) were deleted; for class c, three orthogonal outliers (objects 12, 17, and 29) and one bad pca - leverage point (object 55) were deleted . The duplex algorithm was then performed to divide the remaining 143 tea samples into training and test objects . Finally, 95 samples (class a, 18; class b, 37; and class c, 40) were used for training and 48 samples (class a, 10; class b, 18; and class c, 20) for prediction . Plsda model was developed and mccv was used to select the number of latent variables (lvs). For mccv, the original 95 training samples were randomly split into training (50%) and test objects (50%) for 100 times . The training and prediction results of a three - component plsda are demonstrated in figure 3 . The sensitivity / specificity of plsda for classes a, b, and c was 1.000(10/10)/1.000(38/38), 1.000(18/18)/0.967(29/30), and 0.950(19/20)/1.000(28/28), respectively . The training accuracy was 1 and for prediction only one object from class c was wrongly assigned to class b, indicating the effectiveness of electronic tongue for classification of longjing tea samples . Rapid and effective discrimination of longjing green tea from different subproducing areas was performed using electronic tongue and chemometrics . The sensitivity / specificity of plsda for classes a, b, and c was 1.000/1.000, 1.000/0.967, and 0.950/1.000, respectively . Electronic tongue and chemometrics can provide a rapid and reliable tool for discriminating the specific producing areas of longjing . Compared with human sensory analysis, this method is easier to perform and the more attractive economically . In the future studies, the comparison of chemical methods, for example, lc / uv / ms, to the electronic tongue analysis will be performed to investigate the statistical correlation between the chemistry and the tastes of longjing tea.
Aging is associated with changes in various body systems including in the neuromuscular structures, which lead to a reduction in important components of physical fitness.1 the preservation of fitness - related components such as muscular strength, endurance, and flexibility are essential to the performance of daily activities, which thus helps to maintain autonomy and quality of life in the elderly population.25 of these fitness - related components, flexibility is often less appreciated with respect to its contribution to optimal health and functional status as well as independent living for the elderly.3,6 flexibility reductions may increase the risks of injury, falling, back pain, and physical dependence in older adults.7 several mechanisms have been proposed for reductions in flexibility, among them alterations in soft - tissue structures and physical inactivity.7 when a joint is relatively inactive due to sedentary behavior, the muscles that cross it shorten, thereby reducing its range of motion . Moreover, independent of activity levels, the aging process plays a role in flexibility decreases.8 joint structures such cartilage, ligaments, and tendons change mechanically and biochemically with aging, increasing muscular and tendon stiffness and thus impeding mobility.911 on the other hand, maintaining a physically active lifestyle may result in improvement of functional performance with advancing age, thus enabling the execution of activities of daily living with more vigor and less fatigue.12,13 while resistance training (rt) is recommended for older people for the development of muscular strength,13,14 some studies have indicated that regular participation in rt programs may also contribute to increased flexibility.11,1519 in fact, there is evidence that regular rt serves as an active form of flexibility training and can improve range of motion to a similar extent as typical static stretching protocols.20 regular performance of rt may improve flexibility by reducing passive tension and stiffness of the tissues surrounding a joint.11 thus, from a time - saving standpoint, rt is a good way to develop both strength and flexibility as well as achieve improvements in body composition within a single session of training . The fitness - related benefits associated with rt are dependent on the manipulation of variables such as intensity, volume, exercise order, and rest intervals.12 with respect to training volume, manipulation can involve varying the number of repetitions, sets, and/or frequency defined here as the number of sessions performed per week . The american college of sports medicine recommends that older adults engage in two to three rt sessions a week for improving neuromuscular fitness.12 however, there is a current paucity of research regarding the effects of different rt weekly frequencies on flexibility adaptive responses . Previous studies are limited to analyzing the impact of rt on flexibility without regard for manipulation of the variables that make up the training program . Considering the importance of flexibility in the health and wellness of the elderly therefore, the main purpose of this investigation was to analyze the effect of rt performed at different weekly frequencies on flexibility in untrained older women . We hypothesized that higher rt frequencies would result in greater flexibility increases than lower frequencies . The rational for our hypothesis response relationship between training volume and muscle strength and hypertrophy,21,22 whereby greater training volumes are associated with enhanced muscular adaptations . A secondary aim of the study was to assess rt frequency - related changes in skeletal muscle mass . In accordance with the aforementioned dose response relationship, it was hypothesized that muscle protein accretion would be greater with the higher frequency program . Recruitment of the participants was carried out through newspaper and radio advertisements and home delivery of flyers in londrina, paran, brazil . A total of 350 older women responded to the advertisements, and then completed detailed health history and physical activity questionnaires . The women were subsequently admitted to the study if they met the following inclusion criteria: non - hypertensive (systolic blood pressure <140 mmhg and diastolic blood pressure <90 mmhg), nondiabetic, free from cardiac or renal dysfunction, nonsmoking, not receiving hormonal replacement therapy, not performing any regular physical exercise more than once per week over the preceding 6 months, and participated in> 85% of the study training sessions . The remaining 64 older women (60 years old) were randomly assigned to one of two groups: a group that performed rt two times per week (n=32; group g2x) or a group that performed rt three times per week (n=32; group g3x). A total of 53 women (g2x=28; g3x=25) completed the study and therefore were included in the analysis . Participants passed a diagnostic, graded exercise stress test with twelve - lead electrocardiography reviewed by a cardiologist and were released with no restrictions for participation in this study . This investigation was conducted according to the declaration of helsinki, and was approved by the londrina state university ethics committee . The study was carried out over a period of 16 weeks, with 12 weeks dedicated to the rt program and 4 weeks used for testing . Anthropometric, body - composition, and flexibility measurements were performed at weeks 12 and 1516 for baseline and post - training analysis, respectively, while the supervised rt program was performed during weeks 314 . Subjects were instructed not to perform any other type of physical exercise during the entire study period . Body mass was measured to the nearest 0.1 kg using a calibrated electronic scale (balmak scale, model iii, so paulo, brazil), with the participants wearing light workout clothing and no shoes . Height was measured with a stadiometer attached on the scale to the nearest 0.1 cm with subjects standing without shoes . Body mass index was calculated as body mass in kilograms divided by the square root of height in meters . The skeletal muscle mass was estimated by the predictive equation proposed by kim et al.23 the appendicular fat - free mass used in the equation was determined by a dual energy x - ray absorptiometry scan (lunar prodigy nrl 41990, ge lunar, madison, wi, usa). Before scanning, participants were instructed to remove from their person all objects containing metal . Scans were performed with the subjects lying in the supine position along the table s longitudinal centerline axis . Feet were taped together at the toes to immobilize the legs, while the hands were maintained in a pronated position within the scanning region . The software generated standard lines that set apart the limbs from the trunk and head . These lines were adjusted by the same technician using specific anatomical points determined by the manufacturer . Analyses during the intervention were performed by the same technician who was blinded to intervention time point . Retest scans resulted in a standard error of measurement of 0.29 kg and intra - class correlation coefficient of 0.997 for skeletal muscle mass . To evaluate a subject s flexibility, five joint movements were adopted: cervical flexion (cf), cervical extension (ce), frontal hip flexion (fhf), left hip flexion, and right hip flexion . These movements were chosen because the flexibility of the hip and cervical spine are highly important for the elderly, especially for locomotion, eye orientation, and good timeline perception.24 all measurements were obtained by a fleximeter (code, american do brazil ltda, so paulo, brazil) with a degree scale . All the procedures were made according to procedures and recommendations described elsewhere.25 briefly, in both cf and ce subjects remained lying supine on a stretching table in order to neutralize any possible compensatory movements, and the fleximeter was positioned at the side of the head, in the sagittal plane, starting with cf, where they moved the head slowly, until the chin leaned on the sternum or noticed a rigidity in the final range of motion; for ce, the subjects moved their head back slowly . For fhf, the fleximeter was positioned next to the hip just above the iliac crest, in a standing position with shoulders vertically flexed, elbows extended, fingers intertwined, legs together, then the subjects flexed frontally the hip, with knees extended throughout the movement . For lateral hip flexion, the fleximeter was placed on the medial surface of the thoracic spine, the participant remained standing, with legs together, and knees extended, but with arms crossing the trunk and hands on the contrary shoulder, and then performed the lateral trunk flexion, as a special consideration to such movement, the heel should remain supported on the ground . For all moves, after fixing the velcro attached to the fleximeter and setting the zero point, the participants executed the movements as far as they could or until tightness or discomfort in the final range of motion was felt, and at the end range of motion the evaluator recorded the measure at this point the participants were instructed to remain in the final position until the reading was completed . The highest score obtained from the three measurements at each joint motion was adopted as a reference standard . The information obtained at baseline was not made available to the evaluator at the time of revaluation in an attempt to avoid their unduly influencing the results . It is worth emphasizing that the evaluator had over 2 years experience, and based on the test retest, the standard error of measurement and the intra - class correlation coefficient among the movements were 2.26 degrees and 0.950, respectively, and the maximal technical error among the movements analyzed was 1.19 degrees . During the intervention period, in each session, the instructors registered the load (kg) for each of the eight exercises for all the subjects . Afterwards, training load for each subject was weekly calculated, using the sum of the load employed in the exercises as a reference for each week . Supervised rt was carried out for 12 weeks during the morning hours, in the londrina state university facilities . The protocol was based on recommendations for rt in an older population to improve muscular endurance and strength.12,13 all participants were personally supervised by physical - education professionals with substantial rt experience to help ensure consistent and safe performance . G2x performed two rt sessions per week on tuesdays and thursdays, while g3x performed the same exercises in three sessions per week on mondays, wednesdays, and fridays . The rt program was a whole - body program with eight exercises comprising one exercise with free weights and seven with machines, performed exactly in the following order: chest press, horizontal leg press, seated row, knee extension, preacher curl (free weights), leg curl, triceps push - down, and seated calf raise . Participants were instructed to inhale during the eccentric phase and exhale during the concentric phase while maintaining a constant velocity of movement at a ratio of approximately 1:2 seconds (concentric and eccentric phases, respectively). Instructors adjusted the loads of each exercise according to the subject s ability and improvements in exercise capacity throughout the study in order to ensure that the subjects were exercising with as much resistance as possible while maintaining proper exercise technique . Progression was planned so that when 15 repetitions were completed for two consecutive training sessions, weight was increased 2%5% for the upper limb exercises and 5%10% for the lower limb exercises in the next session.12 it is important to note that the participants did not perform any type of warm - up or cool - down exercises at the beginning or end of the session, respectively . Two - way analysis of variance for repeated measures was used for within - group comparisons . In variables where sphericity was violated, as indicated by mauchly s test, the analyses were adjusted using a greenhouse geisser correction . When the f - ratio was significant, bonferroni s post - hoc test was employed to identify the mean differences . Baseline differences between groups were explored with an independent t - test . The effect size (es) was calculated to verify the magnitude of the differences by cohen s d, where an es of 0.200.40 was considered small, 0.500.79 as moderate, and 0.80 as large.26 for all statistical analyses, significance was accepted at p<0.05 . The data were stored and analyzed using statistica software (v 10.0; statsoft inc, tulsa, ok, usa). Recruitment of the participants was carried out through newspaper and radio advertisements and home delivery of flyers in londrina, paran, brazil . A total of 350 older women responded to the advertisements, and then completed detailed health history and physical activity questionnaires . The women were subsequently admitted to the study if they met the following inclusion criteria: non - hypertensive (systolic blood pressure <140 mmhg and diastolic blood pressure <90 mmhg), nondiabetic, free from cardiac or renal dysfunction, nonsmoking, not receiving hormonal replacement therapy, not performing any regular physical exercise more than once per week over the preceding 6 months, and participated in> 85% of the study training sessions . The remaining 64 older women (60 years old) were randomly assigned to one of two groups: a group that performed rt two times per week (n=32; group g2x) or a group that performed rt three times per week (n=32; group g3x). A total of 53 women (g2x=28; g3x=25) completed the study and therefore were included in the analysis . Participants passed a diagnostic, graded exercise stress test with twelve - lead electrocardiography reviewed by a cardiologist and were released with no restrictions for participation in this study . This investigation was conducted according to the declaration of helsinki, and was approved by the londrina state university ethics committee . The study was carried out over a period of 16 weeks, with 12 weeks dedicated to the rt program and 4 weeks used for testing . Anthropometric, body - composition, and flexibility measurements were performed at weeks 12 and 1516 for baseline and post - training analysis, respectively, while the supervised rt program was performed during weeks 314 . Subjects were instructed not to perform any other type of physical exercise during the entire study period . Body mass was measured to the nearest 0.1 kg using a calibrated electronic scale (balmak scale, model iii, so paulo, brazil), with the participants wearing light workout clothing and no shoes . Height was measured with a stadiometer attached on the scale to the nearest 0.1 cm with subjects standing without shoes . Body mass index was calculated as body mass in kilograms divided by the square root of height in meters . The skeletal muscle mass was estimated by the predictive equation proposed by kim et al.23 the appendicular fat - free mass used in the equation was determined by a dual energy x - ray absorptiometry scan (lunar prodigy nrl 41990, ge lunar, madison, wi, usa). Before scanning, participants were instructed to remove from their person all objects containing metal . Scans were performed with the subjects lying in the supine position along the table s longitudinal centerline axis . Feet were taped together at the toes to immobilize the legs, while the hands were maintained in a pronated position within the scanning region . The software generated standard lines that set apart the limbs from the trunk and head . These lines were adjusted by the same technician using specific anatomical points determined by the manufacturer . Analyses during the intervention were performed by the same technician who was blinded to intervention time point . Retest scans resulted in a standard error of measurement of 0.29 kg and intra - class correlation coefficient of 0.997 for skeletal muscle mass . To evaluate a subject s flexibility, five joint movements were adopted: cervical flexion (cf), cervical extension (ce), frontal hip flexion (fhf), left hip flexion, and right hip flexion . These movements were chosen because the flexibility of the hip and cervical spine are highly important for the elderly, especially for locomotion, eye orientation, and good timeline perception.24 all measurements were obtained by a fleximeter (code, american do brazil ltda, so paulo, brazil) with a degree scale . All the procedures were made according to procedures and recommendations described elsewhere.25 briefly, in both cf and ce subjects remained lying supine on a stretching table in order to neutralize any possible compensatory movements, and the fleximeter was positioned at the side of the head, in the sagittal plane, starting with cf, where they moved the head slowly, until the chin leaned on the sternum or noticed a rigidity in the final range of motion; for ce, the subjects moved their head back slowly . For fhf, the fleximeter was positioned next to the hip just above the iliac crest, in a standing position with shoulders vertically flexed, elbows extended, fingers intertwined, legs together, then the subjects flexed frontally the hip, with knees extended throughout the movement . For lateral hip flexion, the fleximeter was placed on the medial surface of the thoracic spine, the participant remained standing, with legs together, and knees extended, but with arms crossing the trunk and hands on the contrary shoulder, and then performed the lateral trunk flexion, as a special consideration to such movement, the heel should remain supported on the ground . For all moves, after fixing the velcro attached to the fleximeter and setting the zero point, the participants executed the movements as far as they could or until tightness or discomfort in the final range of motion was felt, and at the end range of motion the evaluator recorded the measure at this point the participants were instructed to remain in the final position until the reading was completed . The highest score obtained from the three measurements at each joint motion the information obtained at baseline was not made available to the evaluator at the time of revaluation in an attempt to avoid their unduly influencing the results . It is worth emphasizing that the evaluator had over 2 years experience, and based on the test retest, the standard error of measurement and the intra - class correlation coefficient among the movements were 2.26 degrees and 0.950, respectively, and the maximal technical error among the movements analyzed was 1.19 degrees . During the intervention period, in each session, the instructors registered the load (kg) for each of the eight exercises for all the subjects . Afterwards, training load for each subject was weekly calculated, using the sum of the load employed in the exercises as a reference for each week . Supervised rt was carried out for 12 weeks during the morning hours, in the londrina state university facilities . The protocol was based on recommendations for rt in an older population to improve muscular endurance and strength.12,13 all participants were personally supervised by physical - education professionals with substantial rt experience to help ensure consistent and safe performance . G2x performed two rt sessions per week on tuesdays and thursdays, while g3x performed the same exercises in three sessions per week on mondays, wednesdays, and fridays . The rt program was a whole - body program with eight exercises comprising one exercise with free weights and seven with machines, performed exactly in the following order: chest press, horizontal leg press, seated row, knee extension, preacher curl (free weights), leg curl, triceps push - down, and seated calf raise . Participants were instructed to inhale during the eccentric phase and exhale during the concentric phase while maintaining a constant velocity of movement at a ratio of approximately 1:2 seconds (concentric and eccentric phases, respectively). Instructors adjusted the loads of each exercise according to the subject s ability and improvements in exercise capacity throughout the study in order to ensure that the subjects were exercising with as much resistance as possible while maintaining proper exercise technique . Progression was planned so that when 15 repetitions were completed for two consecutive training sessions, weight was increased 2%5% for the upper limb exercises and 5%10% for the lower limb exercises in the next session.12 it is important to note that the participants did not perform any type of warm - up or cool - down exercises at the beginning or end of the session, respectively . Two - way analysis of variance for repeated measures was used for within - group comparisons . In variables where sphericity was violated, as indicated by mauchly s test, the analyses were adjusted using a greenhouse geisser correction . When the f - ratio was significant, bonferroni s post - hoc test was employed to identify the mean differences . Baseline differences between groups were explored with an independent t - test . The effect size (es) was calculated to verify the magnitude of the differences by cohen s d, where an es of 0.200.40 was considered small, 0.500.79 as moderate, and 0.80 as large.26 for all statistical analyses, significance was accepted at p<0.05 . The data were stored and analyzed using statistica software (v 10.0; statsoft inc, tulsa, ok, usa). A significant main effect for group - by - time interaction (f=2.53, p<0.05) was observed, in which g3x showed a higher increase than g2x (g2x=+87.8%, es=7.31; g3x=+92.2%, es=10.39). The information regarding flexibility indicators pre - and post - training according to group are presented in table 2 . A main effect of time (p<0.01) was observed for ce (g2x=+19.1%, g3x=+20.0%), right hip flexion (g2x=+14.6%, g3x=+15.9%), and left hip flexion (g2x=+25.7%, g3x=+19.2%). Significant group - by - time interaction (p<0.01) was observed only for fhf, in which g3x showed a higher increase than g2x (+ 12.8%, and + 3.0%, respectively). Figure 3 shows the absolute (a) and relative (b) variations from pre- to post - training on skeletal muscle mass indicators according to group . Only the main effect of time reached statistical significance (f=22.05, p<0.001), with both groups having a similar increase after the 12 weeks of the rt program . The ess for skeletal muscle mass changes were 0.21 and 0.43 for twice and thrice per week sessions, respectively . The main finding of the present study is that 12 weeks of rt was sufficient to increase or at least maintain flexibility in elderly women . The increases in flexibility after an rt program in older individuals have been previously reported,11,1619 and our findings are consistent with these studies . For example, fatouros et al18 recruited eight older men to perform 16 weeks of rt three times per week, and observed significant range - of - motion increases in knee flexion, elbow flexion, shoulder flexion, hip flexion, shoulder extension, and hip extension at study end . Gonalves et al19 investigated the effect of 8 weeks of rt three times per week on the flexibility of elderly men and women, and noted an increase in shoulder extension, hip flexion, and hip extension after the intervention . Barbosa et al16 investigated the effect of 10 weeks of rt three times per week in elderly women and observed an increase in flexibility as measured by the sit - and - reach test after 10 weeks . The exact mechanisms responsible for increased flexibility after an rt program have not yet been established in the literature and the outcomes drawn from our study do not provide mechanistic insight . Joint movement is related to morphological elements such as muscle, bone, and connective tissues . In particular, muscle and fascia are responsible for ~41% of a joint s resistance to movement,27 suggesting that an rt - mediated reduction in passive tension and stiffness of these tissues translates into a greater range of motion.11 this hypothesis requires further study . The novel and important feature of our study was the comparison of two versus three rt sessions per week with respect to flexibility outcomes . Results show that only fhf benefited from an increased rt frequency, while all other flexibility outcomes were similar regardless of the number of weekly sessions . The fact that hip - flexion range of motion showed greater improvement when training was undertaken three times per week rather than twice per week has implications for exercise prescription . Hip flexion measures the flexibility of muscles in both the lumbar region and on the posterior thigh . These structures are highly relevant to the mobility of the torso and lower back, which has particular implications for functional capacity in the elderly.28 moreover, hip flexibility is a predictor of low back pain, and is strongly associated with aging.29 the muscles of the low back and the hamstrings are considered to be particularly relevant to hip mobility.24 given that es analysis showed the group with higher volume had a greater positive effect on skeletal muscle mass compared with the lower volume group, it is conceivable that the associated increased strength of muscles surrounding the hip may have led to a greater improvements in flexibility . An analysis of the weekly training load, which refers to the load used to perform a given exercise, was adopted in this study as the muscular strength indicator . Analysis of the training load is an alternative and potentially more practical method for monitoring muscular strength changes compared with one repetition maximum test.30 our results indicate that a greater rt frequency is associated with higher increments of specific muscle strength in the sum of exercises used (88% and 92%, for g2x and g3x, respectively). To date, as far as we are aware, only a few studies have investigated the effects of different training frequencies in older people,3133 with conflicting results . For example, both difrancisco - donoghue et al32 and taafee et al33 showed similar increases in strength between programs with high (twice) and low (once) weekly training frequencies . Alternatively, farinatti et al31 investigated the effects of rt once, twice, and three times per week, and observed that higher frequencies promoted greater increases in strength for certain exercises (seated dumbbell curl and knee extension) but not for others (bench press and standing calf raise). No statistically significant differences in changes in skeletal muscle mass were noted between training two versus three times a week in the present study . However, thrice - weekly training showed greater absolute increases compared with the twice - weekly condition (7.4% vs 4.4%, respectively) and the ess were considerably larger when training three times a week as well (0.43 versus 0.21, respectively)., g3x performed three sets per muscle per week while the g2x group performed two sets per muscle per week . Thus, our findings suggest a potentially meaningful benefit to increasing the volume of training for a given muscle from two to three sets per week with respect to skeletal muscle mass . Considering the relatively short duration of our study, future research is recommended to determine the extent to which such differences in skeletal muscle mass would continue or perhaps narrow over time . The data found in our study are limited to the joint movements analyzed and time of training applied . It is possible that the range of motion of these joints might continue to increase if training were to exceed 12 weeks, and the results should not be extrapolated to populations other than older women . Moreover, the absence of monitoring the physical activity and dietary intake habits is a limitation as well . On the other hand, to our knowledge, the present study is the first to have investigated the effect of different rt frequencies on flexibility in older women . Our findings indicate that rt performed at a minimum of twice per week can result in positive effects on flexibility in the elderly, reversing or slowing the aging - induced losses . The results of our study suggest that 12 weeks of rt improves or at least preserves the flexibility of different joint movements in older women . In addition
Bovine eyes (from 3-year - old animals) were obtained from a local slaughterhouse within 3 hours of death . The eye globe was dissected from its anterior aspect, the cornea and iris were removed, and the front face of the ciliary processes was exposed . The lens, zonule, and ciliary body were released from the eye and transferred to a petri dish filled with ringer's solution . We divided the zonular fibers into two groups: the equatorial zonule (blue fibers in fig . Other investigators have subdivided these fibers into anterior, equatorial, and posterior groupings, but here they were all included in a single sample, the equatorial zonule . Using iridectomy scissors, fibers from the equatorial zonule were first transected near the ciliary body and then grasped with fine forceps and cut close to the lens . Because the equatorial fibers are anatomically isolated within the eye, it was possible to remove them precisely, with little or no contamination from other tissues . Once the equatorial fibers had been removed, the hyaloid zonule was exposed . The hyaloid zonule was defined as the set of fibers that were closely associated with the anterior face of the vitreous . They were also significantly longer than the equatorial fibers . Because they were intimately connected to the vitreous face, it was not possible to dissect the hyaloid fibers as precisely as the equatorial fibers, and the hyaloid sample inevitably contained some elements of the anterior vitreous humor . Samples were centrifuged for 10 minutes at maximum speed, supernatants were removed, and the zonular pellet was frozen immediately . A third sample, taken from the center of the vitreous humor, a single bovine eye yielded sufficient tissue for a proteomic analysis of the equatorial zonule, hyaloid zonule, and vitreous humor . Human eyes (from 10 donors 2366 years of age; table) were obtained from a local eye bank and dissected using a similar approach to that described for the bovine eye . Because the vitreous of the aged human eye was often partially liquefied, it was not possible to collect a human hyaloid zonule sample . Thus, the human zonular sample was equivalent to the bovine equatorial zonule sample . Description of human zonular samples to have sufficient material for analysis, human zonular samples were pooled (table). Thus, each pool contained combined material from four eyes of both sexes, with mean ages ranging from 38.5 (pool d) to 60 years (pool c). Human eyes were fixed for 1 week in 4% paraformaldehyde / pbs, dehydrated through graded ethanols and xylene, and embedded in paraffin wax . Sections (4 m thick) were cut in the midsagittal plane and processed for immunofluorescence . Deparaffinized sections were antigen retrieved using a 60c overnight incubation in sodium citrate buffer (10 mm sodium citrate, 0.05% tween-20; ph 6.0). Sections were blocked with 3% bsa for 2 hours and incubated overnight at 4c in a 1:501:100 dilution of primary antibody . The following antibodies were used: adamtsl-6/thsd4 (atlas antibodies, stockholm, sweden), emilin-1 (santa cruz biotechnology, santa cruz, ca, usa), fbn1 (millipore, temecula, ca, usa), fibulin-6/hemicentin-1 (millipore), ltbp2 (gift of tomoyuki nakamura, kansai medical university, osaka, japan), and mfap2 (santa cruz biotechnology). After washing in pbs (3 10 minutes), sections were incubated for 2 hours in 1:300 dilution of appropriate secondary antibody (alexa 488conjugated goat anti - mouse or anti - rabbit; invitrogen, carlsbad, ca, usa) containing methyl green (a nuclear counterstain). Sections were then washed, coverslipped (prolong gold; invitrogen), and viewed using an olympus fv1000 confocal microscope (center valley, pa, usa). Bovine and human zonules were suspended in 50 l buffer containing 4% sds, 0.2% deoxycholic acid (dca), and 100 mm ammonium bicarbonate (ph 8) and sonicated using a fisher scientific model 60 sonic dismembranator (thermo fischer scientific, waltham, ma, usa), using three treatments of 10 seconds each . Samples were then shaken for 10 minutes at 600 rpm in a thermo - mixer at 90c . Five microliters was removed for a pierce bicinchoninic acid (bca) assay (thermo fisher scientific) using bsa as a standard . Five microliters of 0.5 m tris (2-carboxyethyl)phosphine (tcep) was then added, and the samples were heated at 90c for an additional 10 minutes and centrifuged at 14,000 g for 10 minutes, the supernatant was mixed with 200 l exchange buffer containing 8 m urea, 0.2% dca, and 100 mm ammonium bicarbonate, and the mixture was transferred to tween-20 passivated ultra-0.5 centrifuge filter units (amicon ufc503008; emd millipore, billerica, ma, usa). The remaining sample preparation and digestion used the enhanced filter - aided sample preparation (efasp) method of erde et al . Briefly, the sds containing lysis buffer was replaced with exchange buffer, proteins were alkylated with iodoacetamide, and exchange buffer was replaced with digestion buffer containing 0.2% dca and 50 mm ammonium bicarbonate . A ratio of 1:50 of sequencing grade modified trypsin (promega, madison, wi, usa) to substrate was then added, and the filter units were shaken at approximately 100 rpm for 12 hours at 37c . Peptides were recovered by centrifugation and passage through the ultrafiltration membrane, and membranes were further washed with two 50-l portions of 50 mm ammonium bicarbonate . The dca in the combined filtrates was then extracted using ethyl acetate as previously described, and peptides in the aqueous phase were dried by vacuum centrifugation . Bovine vitreous humor samples (200 l) containing approximately 100 g protein were dried by vacuum centrifugation and dissolved in 50 l 8 m urea, 1.0 m tris (ph 8.5), 8 mm cacl2, and 0.2 m methylamine . Samples were reduced by addition of 4 l 0.2 m dithiothreitol and incubation at 50c for 15 minutes, followed by alkylation through addition of 4 l 0.5 m iodoacetamide and incubation at room temperature (rt) for 30 minutes in the dark . An additional 8 l 0.2 m dithiothreitol was then added, samples were incubated for an additional 15 minutes at rt, and 94 l water was added, followed by 40 l 0.1 g/l trypsin . Digestion proceeded overnight at 37c and then 10 l formic acid was added to stop the reaction . Peptides were solid phase extracted using sep - pak light c18 cartridges (waters, milford, ma, usa), and the final eluate was dried by vacuum concentration . Samples were dissolved in water containing 5% formic acid and transferred to autosampler vials, and 4 g of each zonule peptide digest (or 2 g of each vitreous humor digest) was analyzed . The samples were injected at a flow rate of 5 l / min onto an acclaim pepmap 100-m 2-cm nanoviper 5-m c18 trap (thermo fisher scientific) using mobile phase a containing water and 0.1% formic acid . After 5 minutes, the trap was switched in - line with a pepmap rslc c18, 2 m, 75-m 25-cm easyspray column fitted in an easyspray nano electrospray source (thermo fisher scientific) at 40c . Peptides were eluted with a 90-minute gradient of 7.5%30% mobile phase b containing acetonitrile and 0.1% formic acid at a flow rate of 0.3 l / min . Survey scans were performed in the orbitrap mass analyzer at a resolution of 120,000 with a scan range of 4001500, maximum inject time of 50 ms, and automatic gain control (acg) target of 2 10 . The quadrupole was used to isolate ions for mass spectroscopy (ms)/ms scans with a 1.6-m / z isolation window, and fragmentation was performed by higher - energy collisional dissociation (hcd) with normalized collision energy of 35% . Top speed data - dependent ms / ms spectra were collected in parallel using the ion trap, with a maximum 35-ms inject time, single scan, signal - to - noise ration (s / n) threshold = 2, minimum ion intensity threshold of 5000, and a maximum interval of 3 seconds between survey scans . Dynamic exclusion was performed with the monoisotopic precursor selection (mips) filter on, exclusion of + 1 ions, 60-second exclusion time, exclusion mass tolerance of 10 ppm, and count = 1 ., is provided as supplementary materials s1 . The open source proteowizard toolkit was used to convert thermo raw files into compressed text files using msconvert via command line . An in - house python program was used to convert information in the compressed text file into appropriately formatted ms2 files . Ms2 scans were extracted with a minimum ion count of 15 and minimum total absolute intensity of 100 . Databases were downloaded from ensembl (www.ensembl.org, in the public domain) for bovine samples or from uniprot (www.uniprot.org, in the public domain) for human samples and processed with utilities available from www.proteomicanalysisworkbench.com, in the public domain . Common contaminant sequences (179) were added before all sequences were reversed for peptide and protein error estimation using the target / decoy method . The ensembl bovine database (release 79, march 2015) had 22,118 protein sequences . The human database consisted of 20,207 uniprot reviewed canonical sequences (swiss - prot) downloaded july 2015 . Searches were performed using comet version 2015.02 rev . 1 (human samples) or 2016.01 rev . 2 (bovine samples). Monoisotopic mass parent ion and fragment ion tolerances of 1.25 and 1.0005 da were used, respectively . Other parameters were as follows: tryptic enzyme specificity, static modifications of + 57 da on cysteine residues, variable modifications of + 16 da on methionine residues (maximum of 2 modifications), and use of y- and b - ions in scoring . The paw analysis pipeline was used to control peptide sequencing errors, infer protein identities from observed peptides, and provide quantitative protein abundance estimates . Comet search scores were transformed into discriminant scores using functions similar to those used in peptideprophet . Target and decoy discriminant scores were displayed as histograms and overlaid for interactive setting of score thresholds to filter peptide - spectral matches at an overall false discovery rate (fdr) of 3% . Protein inference used basic parsimony logic where proteins having indistinguishable peptide sets were combined into protein groups and proteins having peptide sets that were subset of other protein's peptide sets were removed . Protein inference was performed experiment - wide with additional requirements of a minimum of two distinct peptides per protein per biological sample applied after protein inference . In a final round of processing, straightforward extensions of parsimony principles these results were used for quantitative analyses using ms2 fragment ion intensity weighted spectral counting . To more confidently determine the composition of the zonule, contaminating proteins from surrounding tissues have to be identified and excluded . It was assumed that the zonule would be composed predominantly of extracellular matrix (ecm) proteins . Comprehensive lists of ecm proteins for human and mouse have been compiled (http://matrisomeproject.mit.edu, in the public domain), and the lists of core and ecm - associated proteins for human were used to extract the corresponding protein sequence from uniprot . A fasta database file of all human ecm proteins was constructed . For both human and bovine samples, the lists of identified proteins were used to extract separate fasta database files for identified proteins . An in - house python program was used to run a local installation of blast (ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/latest/, in the public domain) to determine the reciprocal best matches between the identified proteins and the human ecm proteins . Analysis of alignment scores was used to categorize likely matches to matrisome proteins from poor alignments between matrisome proteins and contaminating proteins . Common contaminant proteins and proteins not matching to matrisome ecm proteins were excluded from quantitative analysis . Extracellular matrix proteins constituted 90% of the bovine zonule sample and 82% of the human zonule sample . The total abundances of putative zonule proteins (using ms2 intensity weighted spectral counts) were set to 100.00, and the relative abundance of the proteins within each sample was determined . Average protein abundances and their standard deviations were computed using standard excel functions . Unlike the human dataset, multiple proteins from the bovine dataset mapped to individual matrisome genes . This was because the bovine ensemble protein database (unlike the human swiss prot database) contained multiple entries for protein isoforms of nearly identical sequence . To facilitate comparison to the human samples, the ms2 intensity weighted spectral counts for all proteins mapping to the same matrisome gene symbol were summed together . Full, annotated protein reports (supplementary materials s2, s3) and associated detailed peptide evidence files (supplementary materials s4, s5) for each experiment are included . Bovine eyes (from 3-year - old animals) were obtained from a local slaughterhouse within 3 hours of death . The eye globe was dissected from its anterior aspect, the cornea and iris were removed, and the front face of the ciliary processes was exposed . The lens, zonule, and ciliary body were released from the eye and transferred to a petri dish filled with ringer's solution . We divided the zonular fibers into two groups: the equatorial zonule (blue fibers in fig . Other investigators have subdivided these fibers into anterior, equatorial, and posterior groupings, but here they were all included in a single sample, the equatorial zonule . Using iridectomy scissors, fibers from the equatorial zonule were first transected near the ciliary body and then grasped with fine forceps and cut close to the lens . Because the equatorial fibers are anatomically isolated within the eye, it was possible to remove them precisely, with little or no contamination from other tissues . Once the equatorial fibers had been removed, the hyaloid zonule was exposed . The hyaloid zonule was defined as the set of fibers that were closely associated with the anterior face of the vitreous . They were also significantly longer than the equatorial fibers . Because they were intimately connected to the vitreous face, it was not possible to dissect the hyaloid fibers as precisely as the equatorial fibers, and the hyaloid sample inevitably contained some elements of the anterior vitreous humor . Samples were centrifuged for 10 minutes at maximum speed, supernatants were removed, and the zonular pellet was frozen immediately . A third sample, taken from the center of the vitreous humor, a single bovine eye yielded sufficient tissue for a proteomic analysis of the equatorial zonule, hyaloid zonule, and vitreous humor . Human eyes (from 10 donors 2366 years of age; table) were obtained from a local eye bank and dissected using a similar approach to that described for the bovine eye . Because the vitreous of the aged human eye was often partially liquefied, it was not possible to collect a human hyaloid zonule sample . Thus, the human zonular sample was equivalent to the bovine equatorial zonule sample . Description of human zonular samples to have sufficient material for analysis, human zonular samples were pooled (table). Thus, each pool contained combined material from four eyes of both sexes, with mean ages ranging from 38.5 (pool d) to 60 years (pool c). Human eyes were fixed for 1 week in 4% paraformaldehyde / pbs, dehydrated through graded ethanols and xylene, and embedded in paraffin wax . Sections (4 m thick) were cut in the midsagittal plane and processed for immunofluorescence . Deparaffinized sections were antigen retrieved using a 60c overnight incubation in sodium citrate buffer (10 mm sodium citrate, 0.05% tween-20; ph 6.0). Sections were blocked with 3% bsa for 2 hours and incubated overnight at 4c in a 1:501:100 dilution of primary antibody . The following antibodies were used: adamtsl-6/thsd4 (atlas antibodies, stockholm, sweden), emilin-1 (santa cruz biotechnology, santa cruz, ca, usa), fbn1 (millipore, temecula, ca, usa), fibulin-6/hemicentin-1 (millipore), ltbp2 (gift of tomoyuki nakamura, kansai medical university, osaka, japan), and mfap2 (santa cruz biotechnology). After washing in pbs (3 10 minutes), sections were incubated for 2 hours in 1:300 dilution of appropriate secondary antibody (alexa 488conjugated goat anti - mouse or anti - rabbit; invitrogen, carlsbad, ca, usa) containing methyl green (a nuclear counterstain). Sections were then washed, coverslipped (prolong gold; invitrogen), and viewed using an olympus fv1000 confocal microscope (center valley, pa, usa). Bovine and human zonules were suspended in 50 l buffer containing 4% sds, 0.2% deoxycholic acid (dca), and 100 mm ammonium bicarbonate (ph 8) and sonicated using a fisher scientific model 60 sonic dismembranator (thermo fischer scientific, waltham, ma, usa), using three treatments of 10 seconds each . Samples were then shaken for 10 minutes at 600 rpm in a thermo - mixer at 90c . Five microliters was removed for a pierce bicinchoninic acid (bca) assay (thermo fisher scientific) using bsa as a standard . Five microliters of 0.5 m tris (2-carboxyethyl)phosphine (tcep) was then added, and the samples were heated at 90c for an additional 10 minutes and centrifuged at 14,000 g for 10 minutes, the supernatant was mixed with 200 l exchange buffer containing 8 m urea, 0.2% dca, and 100 mm ammonium bicarbonate, and the mixture was transferred to tween-20 passivated ultra-0.5 centrifuge filter units (amicon ufc503008; emd millipore, billerica, ma, usa). The remaining sample preparation and digestion used the enhanced filter - aided sample preparation (efasp) method of erde et al . Briefly, the sds containing lysis buffer was replaced with exchange buffer, proteins were alkylated with iodoacetamide, and exchange buffer was replaced with digestion buffer containing 0.2% dca and 50 mm ammonium bicarbonate . A ratio of 1:50 of sequencing grade modified trypsin (promega, madison, wi, usa) to substrate was then added, and the filter units were shaken at approximately 100 rpm for 12 hours at 37c . Peptides were recovered by centrifugation and passage through the ultrafiltration membrane, and membranes were further washed with two 50-l portions of 50 mm ammonium bicarbonate . The dca in the combined filtrates was then extracted using ethyl acetate as previously described, and peptides in the aqueous phase were dried by vacuum centrifugation . Bovine vitreous humor samples (200 l) containing approximately 100 g protein were dried by vacuum centrifugation and dissolved in 50 l 8 m urea, 1.0 m tris (ph 8.5), 8 mm cacl2, and 0.2 m methylamine . Samples were reduced by addition of 4 l 0.2 m dithiothreitol and incubation at 50c for 15 minutes, followed by alkylation through addition of 4 l 0.5 m iodoacetamide and incubation at room temperature (rt) for 30 minutes in the dark . An additional 8 l 0.2 m dithiothreitol was then added, samples were incubated for an additional 15 minutes at rt, and 94 l water was added, followed by 40 l 0.1 g/l trypsin . Digestion proceeded overnight at 37c and then 10 l formic acid was added to stop the reaction . Peptides were solid phase extracted using sep - pak light c18 cartridges (waters, milford, ma, usa), and the final eluate was dried by vacuum concentration . Samples were dissolved in water containing 5% formic acid and transferred to autosampler vials, and 4 g of each zonule peptide digest (or 2 g of each vitreous humor digest) was analyzed . The samples were injected at a flow rate of 5 l / min onto an acclaim pepmap 100-m 2-cm nanoviper 5-m c18 trap (thermo fisher scientific) using mobile phase a containing water and 0.1% formic acid . After 5 minutes, the trap was switched in - line with a pepmap rslc c18, 2 m, 75-m 25-cm easyspray column fitted in an easyspray nano electrospray source (thermo fisher scientific) at 40c . Peptides were eluted with a 90-minute gradient of 7.5%30% mobile phase b containing acetonitrile and 0.1% formic acid at a flow rate of 0.3 l / min . Survey scans were performed in the orbitrap mass analyzer at a resolution of 120,000 with a scan range of 4001500, maximum inject time of 50 ms, and automatic gain control (acg) target of 2 10 . The quadrupole was used to isolate ions for mass spectroscopy (ms)/ms scans with a 1.6-m / z isolation window, and fragmentation was performed by higher - energy collisional dissociation (hcd) with normalized collision energy of 35% . Top speed data - dependent ms / ms spectra were collected in parallel using the ion trap, with a maximum 35-ms inject time, single scan, signal - to - noise ration (s / n) threshold = 2, minimum ion intensity threshold of 5000, and a maximum interval of 3 seconds between survey scans . Dynamic exclusion was performed with the monoisotopic precursor selection (mips) filter on, exclusion of + 1 ions, 60-second exclusion time, exclusion mass tolerance of 10 ppm, and count = 1 . The open source proteowizard toolkit was used to convert thermo raw files into compressed text files using msconvert via command line . An in - house python program was used to convert information in the compressed text file into appropriately formatted ms2 files . Ms2 scans were extracted with a minimum ion count of 15 and minimum total absolute intensity of 100 . Databases were downloaded from ensembl (www.ensembl.org, in the public domain) for bovine samples or from uniprot (www.uniprot.org, in the public domain) for human samples and processed with utilities available from www.proteomicanalysisworkbench.com, in the public domain . Common contaminant sequences (179) were added before all sequences were reversed for peptide and protein error estimation using the target / decoy method . The ensembl bovine database (release 79, march 2015) had 22,118 protein sequences . The human database consisted of 20,207 uniprot reviewed canonical sequences (swiss - prot) downloaded july 2015 . Searches were performed using comet version 2015.02 rev . 1 (human samples) or 2016.01 rev . 2 (bovine samples). Monoisotopic mass parent ion and fragment ion tolerances of 1.25 and 1.0005 da were used, respectively . Other parameters were as follows: tryptic enzyme specificity, static modifications of + 57 da on cysteine residues, variable modifications of + 16 da on methionine residues (maximum of 2 modifications), and use of y- and b - ions in scoring . The paw analysis pipeline was used to control peptide sequencing errors, infer protein identities from observed peptides, and provide quantitative protein abundance estimates . Comet search scores were transformed into discriminant scores using functions similar to those used in peptideprophet . Target and decoy discriminant scores were displayed as histograms and overlaid for interactive setting of score thresholds to filter peptide - spectral matches at an overall false discovery rate (fdr) of 3% . Protein inference used basic parsimony logic where proteins having indistinguishable peptide sets were combined into protein groups and proteins having peptide sets that were subset of other protein's peptide sets were removed . Protein inference was performed experiment - wide with additional requirements of a minimum of two distinct peptides per protein per biological sample applied after protein inference . In a final round of processing, straightforward extensions of parsimony principles these results were used for quantitative analyses using ms2 fragment ion intensity weighted spectral counting . The open source proteowizard toolkit was used to convert thermo raw files into compressed text files using msconvert via command line . An in - house python program was used to convert information in the compressed text file into appropriately formatted ms2 files . Ms2 scans were extracted with a minimum ion count of 15 and minimum total absolute intensity of 100 . Databases were downloaded from ensembl (www.ensembl.org, in the public domain) for bovine samples or from uniprot (www.uniprot.org, in the public domain) for human samples and processed with utilities available from www.proteomicanalysisworkbench.com, in the public domain . Common contaminant sequences (179) were added before all sequences were reversed for peptide and protein error estimation using the target / decoy method . The ensembl bovine database (release 79, march 2015) had 22,118 protein sequences . The human database consisted of 20,207 uniprot reviewed canonical sequences (swiss - prot) downloaded july 2015 . Searches were performed using comet version 2015.02 rev . 1 (human samples) or 2016.01 rev . 2 (bovine samples). Monoisotopic mass parent ion and fragment ion tolerances of 1.25 and 1.0005 da were used, respectively . Other parameters were as follows: tryptic enzyme specificity, static modifications of + 57 da on cysteine residues, variable modifications of + 16 da on methionine residues (maximum of 2 modifications), and use of y- and b - ions in scoring . The paw analysis pipeline was used to control peptide sequencing errors, infer protein identities from observed peptides, and provide quantitative protein abundance estimates . Comet search scores were transformed into discriminant scores using functions similar to those used in peptideprophet . Target and decoy discriminant scores were displayed as histograms and overlaid for interactive setting of score thresholds to filter peptide - spectral matches at an overall false discovery rate (fdr) of 3% . Protein inference used basic parsimony logic where proteins having indistinguishable peptide sets were combined into protein groups and proteins having peptide sets that were subset of other protein's peptide sets were removed . Protein inference was performed experiment - wide with additional requirements of a minimum of two distinct peptides per protein per biological sample applied after protein inference . In a final round of processing, straightforward extensions of parsimony principles these results were used for quantitative analyses using ms2 fragment ion intensity weighted spectral counting . To more confidently determine the composition of the zonule, contaminating proteins from surrounding tissues have to be identified and excluded . It was assumed that the zonule would be composed predominantly of extracellular matrix (ecm) proteins . Comprehensive lists of ecm proteins for human and mouse have been compiled (http://matrisomeproject.mit.edu, in the public domain), and the lists of core and ecm - associated proteins for human were used to extract the corresponding protein sequence from uniprot . A fasta database file of all human ecm proteins was constructed . For both human and bovine samples, the lists of identified proteins were used to extract separate fasta database files for identified proteins . An in - house python program was used to run a local installation of blast (ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/latest/, in the public domain) to determine the reciprocal best matches between the identified proteins and the human ecm proteins . Analysis of alignment scores was used to categorize likely matches to matrisome proteins from poor alignments between matrisome proteins and contaminating proteins . Once matrisome proteins were identified common contaminant proteins and proteins not matching to matrisome ecm proteins were excluded from quantitative analysis . Extracellular matrix proteins constituted 90% of the bovine zonule sample and 82% of the human zonule sample . The total abundances of putative zonule proteins (using ms2 intensity weighted spectral counts) were set to 100.00, and the relative abundance of the proteins within each sample was determined . Average protein abundances and their standard deviations were computed using standard excel functions . Unlike the human dataset, multiple proteins from the bovine dataset mapped to individual matrisome genes . This was because the bovine ensemble protein database (unlike the human swiss prot database) contained multiple entries for protein isoforms of nearly identical sequence . To facilitate comparison to the human samples, the ms2 intensity weighted spectral counts for all proteins mapping to the same matrisome gene symbol were summed together . Relative abundances within each sample by gene were computed as described above . Full, annotated protein reports (supplementary materials s2, s3) and associated detailed peptide evidence files (supplementary materials s4, we began by comparing the protein composition of the human and bovine ciliary zonule (the zonulome). For this purpose, the human zonular sample was compared with the bovine equatorial zonule sample (see materials and methods). Our initial goal was to identify those proteins common to both, reasoning that protein conservation may imply important structural or signaling roles for the set of conserved proteins . Liquid chromatography ms analysis of tryptic digests identified> 1000 proteins, but, following removal of common contaminants and filtering against the matrisome database, this number was reduced to 268 proteins (176 proteins in the bovine zonulome and 144 in the human). 3). In terms of mass,> 95% of the human and bovine zonules consisted of the proteins that were common to both species . Two main classes of matrisomal proteins are defined: those constituting the core matrisome and those belonging to the group of matrisome - associated proteins . The core matrisome is further divided into three subcategories: ecm glycoproteins, collagens, and proteoglycans . The matrisome - associated protein category is also divided into three subcategories: ecm - affiliated proteins, ecm regulators, and secreted factors . Of the six classes of matrisomal proteins, the two best represented by the number of identifications in the zonulome were glycoproteins (28 proteins in the human zonule and 53 in the bovine zonule) and ecm regulators (23 in humans and 26 in cows; (figs . However, when the data were weighted according to protein abundance, based on ms2 intensity weighted spectral counts, it was clear that in both cases the zonulome was dominated by glycoproteins (figs . 4c, 4d). The nine most abundant glycoproteins in the human and bovine zonulome are ranked in figure 5 . The five most abundant proteins in either case were fibrillin-1 (fbn1), microfibrillar - associated protein 2 (mfap2), latent - transforming growth factor -binding protein-2 (ltbp2), emilin-1, and thrombospondin type-1 domain - containing protein 4 (thsd4, also known as adamtsl-6). Overview of zonule composition in bovine (a, c) and human (b, d) samples . In terms of the number of proteins present (a, b), all six categories of matrisomal proteins are well represented in the zonulome . However, in terms of relative protein abundance, both zonulomes are composed predominantly of glycoproteins (c, d). Shown here is a ranking of the nine most - abundant glycoproteins, which together account for 95% of the bovine zonule and 89% of the human zonule . We used an orthogonal technique, confocal immunofluorescence, to verify the distribution of the four most abundant glycoproteins detected in the lc - ms analysis (fbn1, ltbp2, mfap2, and emilin-1; fig ., the zonule appeared as a system of fibers projecting from the pars plana region of the nonpigmented ciliary epithelium, fanning out as they approached the lens . At their midpoint, the fibers had a relatively large diameter but near the lens surface, the large fibers divided to form smaller diameter fibers that inserted into the lens capsule (see insets in fig . The three most abundant glycoproteins in the zonulome (fbn1, ltbp2, and mfap2) labeled all zonular elements uniformly (figs . Fbn1, ltbp2, and mfap2 are distributed throughout the system of zonular fibers, including the small diameter fibers near the lens surface (inset a in b) and large diameter fibers at the midpoint of the zonular span (inset b in b). Emilin-1 was absent from zonular fibers near the lens surface (arrow in d). Fibrillins and ltbps comprise a superfamily of seven structurally related glycoproteins (fbn1 - 3 and ltbp1 - 4). All seven superfamily members were detected in the bovine zonule and only ltbp4 was absent from the human zonule (fig . The fbn / ltbp superfamily constituted 83.4% of the bovine zonule and 76.0% of the human zonule and represented the most abundant protein family in either zonulome . Fbn1 was the most abundant individual protein, accounting for 63.49% and 75.57% of the protein in the human and bovine ciliary zonule, respectively . All family members are present (with the exception of ltbp4 in the human zonule). The high representation of fbn / ltbp superfamily members in the zonule is consistent with the ocular phenotypes of syndromes resulting from mutations in those proteins . Mutations in fbn1 underlie marfan syndrome, a condition in which progressive lysis of the zonular fibers leads to ectopia lentis in most (71%) patients . Mutations in fbn1 and ltbp2 have also been shown to cause weill - marchesani syndrome (types 2 and 3, respectively), which is a disease characterized by microspherophakia and ectopia lentis, in addition to systemic symptoms . Together, these observations support the notion that fbn1 and ltbp2 play indispensable structural roles in the ciliary zonule . Ltbps, as their name implies, have the ability to bind and sequester latent forms of tgf in the ecm . Both the human and the bovine zonule contained relatively high levels of tgf-2 (lesser amounts of tgf-3 were also detected in the human sample). Curiously, ltbp2, by far the most abundant of the zonular ltbps, is the only family member incapable of binding tgf, so its role in the zonule and elsewhere is unresolved . Another class of proteins linked with inherited ectopia lentis (and the closely related condition ectopia lentis et pupillae, in which both the lens and the pupil are displaced) is the adamtsl family . Adamtsls share significant sequence similarity with the adamts family of metalloproteases but lack the protease domain found in the latter . Mutations in adamtsl-4 cause isolated ectopia lentis and ectopia lentis et pupillae . Adamtsl-4 was detected in both the bovine and human zonules (at somewhat higher levels in the latter), as were adamtsl-1,-2 and -5 . Unexpectedly, however, the most abundant member of the family was adamtsl-6 (also known as thsd4), which, in the human zonule, accounted for> 2% of the total protein (figs . 5, 8). We used immunofluorescence to verify the expression of adamtsl-6 in the human eye (fig . Adamtsl-6 was strongly expressed in the large diameter fibers in a similar fashion to emilin-1 (fig . In vitro studies suggest that adamtsl-6 can bind directly to fbn1, promoting the assembly of fibrillin - rich ecm . Immunofluorescence is largely restricted to the large diameter fibers in the center of the zonular span and absent from small fibers at the lens surface (see fig . A number of protease inhibitors were detected in the zonule, including several members of the serpin family, but the most abundant inhibitor, particularly in the human sample, was timp3 (fig . The only protease detected in both the human and bovine zonule was cathepsin d, a lysosomal aspartic endopeptidase that may also be secreted from cells . Work on model systems suggest that the material properties of microfibrillar networks are shaped by both nonreducible crosslinks and disulfide bonds . We examined human and bovine zonules for the presence of known crosslinking enzymes that might play a role in bundling of microfibrils . Several transglutaminases (tgm1 - 3) were detected, but the most abundant crosslinker detected was lysyl oxidase - like 1 (loxl1; fig . Transglutaminase - derived crosslinks have been identified previously in fibrillin microfibrils and may be important in the zonule . The presence of loxl1 is intriguing because variants in the loxl1 gene have been shown to predispose to exfoliation syndrome . Exfoliation syndrome is a condition in which disintegration of the zonular fibers and unscheduled production of matrix components results in formation of fibrillar aggregates that can clog the outflow pathways of the eye, leading to exfoliation glaucoma . Given its demonstrated role in elastin polymerization, it is curious that loxl1 is such a prominent component of the elastin - free ciliary zonule . One explanation may be that fibrillin or other zonule components serve as substrates for loxl1 . The availability of mice deficient in loxl1 should allow us to test whether loxl1 has a role in crosslinking microfibrils . Expression of crosslinking enzymes (transglutaminases and lysyloxidase - like 1) in the ciliary zonule . The expression of collagens, secreted factors, and proteoglycans was compared in the human and bovine zonular samples (supplementary tables s1, s2). Only trace amounts of collagen were detected, of which the most abundant were col2a1 and col9a2 . Col4 and col18, components of basement membranes, were also detected and may represent contamination from the lens capsule or the inner limiting membrane covering the basal surface of the nonpigmented ciliary epithelium . Megf6, shown to interact via its egf domains with mfap5, was one of the most abundant . Immune components, such as cxcl14 and egfl7, were identified in the human but not bovine zonule . This may reflect the fact that the human samples were largely from middle - aged individuals (table), whereas the bovine samples were from young animals . Similarly, the presence of il17d in human samples may indicate ongoing inflammatory reactions in the aged human eyes . Cxcl14 is a chemokine implicated in the recruitment of immune cells in all types of inflammatory conditions . Proteoglycans were not prominent zonule components in either species, although in the bovine zonule, opticin (opt) was detected at moderate levels . Unlike the bovine zonule (where members of a single glycoprotein family, the fbn / ltbp family, accounted for> 80% of the protein), the composition of the vitreous was not dominated by a restricted set of super abundant proteins (supplementary material s3). Among the more abundant vitreous proteins were broad spectrum protease inhibitors (a2ml1, a2 m, cpmd8, cst3, and serping1), collagens (col9a2, col18a1, and col2a1), fibulins (fbln1, fbln2, and fbnl3), the proteoglycans opt and hspg2, and wnt signaling components sfrp2 and sfrp3 . Fbn1, the most abundant single component in the equatorial zonule, accounted for only 2.5% of the protein in the vitreous sample . Recent proteomic analyses of human vitreous humor have identified many hundreds of protein components, of which a core set of 231 proteins were detected in all studies . In the present study, after filtering against the matrisome database, we identified 200 components of the bovine vitreous . Comparing the bovine vitreous proteome with that of the equatorial and hyaloid zonular samples, it was evident that the zonular samples were quite distinct from the vitreous sample (figs . Proteins such as mfap2 and fbn2, for example, were almost undetectable in the vitreous but relatively abundant in the zonular samples . Overlapping distribution of matrisome proteins in samples from the bovine equatorial zonule, hyaloid zonule, and vitreous humor . Protein composition of samples from the bovine vitreous humor (gray), equatorial zonule (light blue), and hyaloid zonule (dark blue). Some proteins are relatively abundant in all three samples; others, such as thsd4, are abundant in the zonular samples but barely detectable in the vitreous three classes of fibrillary collagen (type 2a, 11a, and 5a; circled in yellow) are significantly overrepresented in the hyaloid zonule sample compared with the equatorial zonule or vitreous . Note that opticin (opt) accounts for 30% of the hyaloid zonule but was barely detectable in the equatorial zonule . The hyaloid zonule is associated with the vitreous face, and it is possible that during dissection, the hyaloid sample might have been contaminated with proteins emanating from the vitreous . If we assume that the hyaloid zonule has a similar basic composition to the equatorial zonule, then vitreous contamination should lead to values for relative protein abundance that were intermediate between the vitreous and equatorial zonule values . Although such instances were certainly observed, there were also many examples where the abundance of a protein in the hyaloid zonule significantly exceeded (by orders of magnitude) that of the vitreous or the equatorial zonule . Such proteins are likely to be unique to, or significantly enriched in, the hyaloid zonule sample . The set of hyaloid - enriched proteins included opt, a3i3bp, cochlin, and the collagens col2a1, col11a1, col5a3, and col5a2 (fig . Histograms showing relative abundance of each class of matrisomal proteins in the bovine samples are included as supplementary figures s6s12 . We began by comparing the protein composition of the human and bovine ciliary zonule (the zonulome). For this purpose, the human zonular sample was compared with the bovine equatorial zonule sample (see materials and methods). Our initial goal was to identify those proteins common to both, reasoning that protein conservation may imply important structural or signaling roles for the set of conserved proteins . Liquid chromatography ms analysis of tryptic digests identified> 1000 proteins, but, following removal of common contaminants and filtering against the matrisome database, this number was reduced to 268 proteins (176 proteins in the bovine zonulome and 144 in the human). 3). In terms of mass,> 95% of the human and bovine zonules consisted of the proteins that were common to both species . Two main classes of matrisomal proteins are defined: those constituting the core matrisome and those belonging to the group of matrisome - associated proteins . The core matrisome is further divided into three subcategories: ecm glycoproteins, collagens, and proteoglycans . The matrisome - associated protein category is also divided into three subcategories: ecm - affiliated proteins, ecm regulators, and secreted factors . Of the six classes of matrisomal proteins, the two best represented by the number of identifications in the zonulome were glycoproteins (28 proteins in the human zonule and 53 in the bovine zonule) and ecm regulators (23 in humans and 26 in cows; (figs . However, when the data were weighted according to protein abundance, based on ms2 intensity weighted spectral counts, it was clear that in both cases the zonulome was dominated by glycoproteins (figs . 4c, 4d). The nine most abundant glycoproteins in the human and bovine zonulome are ranked in figure 5 . The five most abundant proteins in either case were fibrillin-1 (fbn1), microfibrillar - associated protein 2 (mfap2), latent - transforming growth factor -binding protein-2 (ltbp2), emilin-1, and thrombospondin type-1 domain - containing protein 4 (thsd4, also known as adamtsl-6). Overview of zonule composition in bovine (a, c) and human (b, d) samples . In terms of the number of proteins present (a, b), all six categories of matrisomal proteins are well represented in the zonulome . However, in terms of relative protein abundance, both zonulomes are composed predominantly of glycoproteins (c, d). Shown here is a ranking of the nine most - abundant glycoproteins, which together account for 95% of the bovine zonule and 89% of the human zonule . We used an orthogonal technique, confocal immunofluorescence, to verify the distribution of the four most abundant glycoproteins detected in the lc - ms analysis (fbn1, ltbp2, mfap2, and emilin-1; fig ., the zonule appeared as a system of fibers projecting from the pars plana region of the nonpigmented ciliary epithelium, fanning out as they approached the lens . At their midpoint, the fibers had a relatively large diameter but near the lens surface, the large fibers divided to form smaller diameter fibers that inserted into the lens capsule (see insets in fig . The three most abundant glycoproteins in the zonulome (fbn1, ltbp2, and mfap2) labeled all zonular elements uniformly (figs . Fbn1, ltbp2, and mfap2 are distributed throughout the system of zonular fibers, including the small diameter fibers near the lens surface (inset a in b) and large diameter fibers at the midpoint of the zonular span (inset b in b). Emilin-1 was absent from zonular fibers near the lens surface (arrow in d). Fibrillins and ltbps comprise a superfamily of seven structurally related glycoproteins (fbn1 - 3 and ltbp1 - 4). All seven superfamily members were detected in the bovine zonule and only ltbp4 was absent from the human zonule (fig . The fbn / ltbp superfamily constituted 83.4% of the bovine zonule and 76.0% of the human zonule and represented the most abundant protein family in either zonulome . Fbn1 was the most abundant individual protein, accounting for 63.49% and 75.57% of the protein in the human and bovine ciliary zonule, respectively . All family members are present (with the exception of ltbp4 in the human zonule). The high representation of fbn / ltbp superfamily members in the zonule is consistent with the ocular phenotypes of syndromes resulting from mutations in those proteins . Mutations in fbn1 underlie marfan syndrome, a condition in which progressive lysis of the zonular fibers leads to ectopia lentis in most (71%) patients . Mutations in fbn1 and ltbp2 have also been shown to cause weill - marchesani syndrome (types 2 and 3, respectively), which is a disease characterized by microspherophakia and ectopia lentis, in addition to systemic symptoms . Together, these observations support the notion that fbn1 and ltbp2 play indispensable structural roles in the ciliary zonule . Ltbps, as their name implies, have the ability to bind and sequester latent forms of tgf in the ecm . Both the human and the bovine zonule contained relatively high levels of tgf-2 (lesser amounts of tgf-3 were also detected in the human sample). Curiously, ltbp2, by far the most abundant of the zonular ltbps, is the only family member incapable of binding tgf, so its role in the zonule and elsewhere is unresolved . Another class of proteins linked with inherited ectopia lentis (and the closely related condition ectopia lentis et pupillae, in which both the lens and the pupil are displaced) is the adamtsl family . Adamtsls share significant sequence similarity with the adamts family of metalloproteases but lack the protease domain found in the latter . Mutations in adamtsl-4 cause isolated ectopia lentis and ectopia lentis et pupillae . Adamtsl-4 was detected in both the bovine and human zonules (at somewhat higher levels in the latter), as were adamtsl-1,-2 and -5 . Unexpectedly, however, the most abundant member of the family was adamtsl-6 (also known as thsd4), which, in the human zonule, accounted for> 2% of the total protein (figs . 5, 8). We used immunofluorescence to verify the expression of adamtsl-6 in the human eye (fig . Adamtsl-6 was strongly expressed in the large diameter fibers in a similar fashion to emilin-1 (fig . In vitro studies suggest that adamtsl-6 can bind directly to fbn1, promoting the assembly of fibrillin - rich ecm . Immunofluorescence is largely restricted to the large diameter fibers in the center of the zonular span and absent from small fibers at the lens surface (see fig . A number of protease inhibitors were detected in the zonule, including several members of the serpin family, but the most abundant inhibitor, particularly in the human sample, was timp3 (fig . The only protease detected in both the human and bovine zonule was cathepsin d, a lysosomal aspartic endopeptidase that may also be secreted from cells . Work on model systems suggest that the material properties of microfibrillar networks are shaped by both nonreducible crosslinks and disulfide bonds . We examined human and bovine zonules for the presence of known crosslinking enzymes that might play a role in bundling of microfibrils . Several transglutaminases (tgm1 - 3) were detected, but the most abundant crosslinker detected was lysyl oxidase - like 1 (loxl1; fig . Transglutaminase - derived crosslinks have been identified previously in fibrillin microfibrils and may be important in the zonule . The presence of loxl1 is intriguing because variants in the loxl1 gene have been shown to predispose to exfoliation syndrome . Exfoliation syndrome is a condition in which disintegration of the zonular fibers and unscheduled production of matrix components results in formation of fibrillar aggregates that can clog the outflow pathways of the eye, leading to exfoliation glaucoma . Given its demonstrated role in elastin polymerization, it is curious that loxl1 is such a prominent component of the elastin - free ciliary zonule . One explanation may be that fibrillin or other zonule components serve as substrates for loxl1 . The availability of mice deficient in loxl1 should allow us to test whether loxl1 has a role in crosslinking microfibrils . Expression of crosslinking enzymes (transglutaminases and lysyloxidase - like 1) in the ciliary zonule . The expression of collagens, secreted factors, and proteoglycans was compared in the human and bovine zonular samples (supplementary tables s1, s2). Only trace amounts of collagen were detected, of which the most abundant were col2a1 and col9a2 . Col4 and col18, components of basement membranes, were also detected and may represent contamination from the lens capsule or the inner limiting membrane covering the basal surface of the nonpigmented ciliary epithelium . Megf6, shown to interact via its egf domains with mfap5, was one of the most abundant . Immune components, such as cxcl14 and egfl7, were identified in the human but not bovine zonule . This may reflect the fact that the human samples were largely from middle - aged individuals (table), whereas the bovine samples were from young animals . Similarly, the presence of il17d in human samples may indicate ongoing inflammatory reactions in the aged human eyes . Cxcl14 is a chemokine implicated in the recruitment of immune cells in all types of inflammatory conditions . Proteoglycans were not prominent zonule components in either species, although in the bovine zonule, opticin (opt) was detected at moderate levels . Unlike the bovine zonule (where members of a single glycoprotein family, the fbn / ltbp family, accounted for> 80% of the protein), the composition of the vitreous was not dominated by a restricted set of super abundant proteins (supplementary material s3). Among the more abundant vitreous proteins were broad spectrum protease inhibitors (a2ml1, a2 m, cpmd8, cst3, and serping1), collagens (col9a2, col18a1, and col2a1), fibulins (fbln1, fbln2, and fbnl3), the proteoglycans opt and hspg2, and wnt signaling components sfrp2 and sfrp3 . Fbn1, the most abundant single component in the equatorial zonule, accounted for only 2.5% of the protein in the vitreous sample . Recent proteomic analyses of human vitreous humor have identified many hundreds of protein components, of which a core set of 231 proteins were detected in all studies . In the present study, after filtering against the matrisome database, we identified 200 components of the bovine vitreous . Comparing the bovine vitreous proteome with that of the equatorial and hyaloid zonular samples, it was evident that the zonular samples were quite distinct from the vitreous sample (figs . Proteins such as mfap2 and fbn2, for example, were almost undetectable in the vitreous but relatively abundant in the zonular samples . Overlapping distribution of matrisome proteins in samples from the bovine equatorial zonule, hyaloid zonule, and vitreous humor . Protein composition of samples from the bovine vitreous humor (gray), equatorial zonule (light blue), and hyaloid zonule (dark blue). Some proteins are relatively abundant in all three samples; others, such as thsd4, are abundant in the zonular samples but barely detectable in the vitreous . Three classes of fibrillary collagen (type 2a, 11a, and 5a; circled in yellow) are significantly overrepresented in the hyaloid zonule sample compared with the equatorial zonule or vitreous . Note that opticin (opt) accounts for 30% of the hyaloid zonule but was barely detectable in the equatorial zonule . The hyaloid zonule is associated with the vitreous face, and it is possible that during dissection, the hyaloid sample might have been contaminated with proteins emanating from the vitreous . If we assume that the hyaloid zonule has a similar basic composition to the equatorial zonule, then vitreous contamination should lead to values for relative protein abundance that were intermediate between the vitreous and equatorial zonule values . Although such instances were certainly observed, there were also many examples where the abundance of a protein in the hyaloid zonule significantly exceeded (by orders of magnitude) that of the vitreous or the equatorial zonule . Such proteins are likely to be unique to, or significantly enriched in, the hyaloid zonule sample . The set of hyaloid - enriched proteins included opt, a3i3bp, cochlin, and the collagens col2a1, col11a1, col5a3, and col5a2 (fig . Histograms showing relative abundance of each class of matrisomal proteins in the bovine samples are included as supplementary figures s6s12 . The ciliary zonule plays a key role in ocular function, centering the lens on the optical axis and transmitting the forces that mold its shape during accommodation . The zonule is adversely affected in several pathologic conditions, including exfoliation syndrome, homocystinuria, and marfan syndrome . To understand how and why the zonule is compromised in these diseases, a detailed analysis of its composition microfibrils (the main structural elements of the zonule) are ubiquitous components of the ecm but questions remain regarding their organization, synthesis, and role as signaling hubs . The ciliary zonule, a readily accessible, cell - free system composed of bundled microfibrils, represents a useful model system in which to gain insights into microfibril organization . The composition of the equatorial zonule was broadly similar in humans and cows, and the set of 52 proteins identified in both samples accounted for> 95% of the mass in either case . The fact that the human samples were from middle - aged individuals, whereas the bovine samples were from young animals, might in part explain why more proteins were identified in the bovine zonulome (176 vs. 144). The bovine samples were also obtained shortly after death, whereas the human samples were obtained 2448 hours postmortem . It is possible that labile proteins were lost from the human samples during the postmortem period . In both humans and cows, the zonule consisted of a microfibril backbone comprised primarily of fibrillin and a relatively restricted set of glycoproteins . Ltbp2, a fibrillin - like protein implicated in autosomal recessive weill - marchesani syndrome type 3 (wms3: mim#614819), was a surprisingly abundant component, comprising 10% of the total zonular protein . There are three fibrillin genes in humans and the presence of all three proteins was confirmed in the zonulome, consistent with earlier observations . Fbn2, the second most abundant fibrillin in the zonule, is synthesized early in development and is essential for normal zonule formation in mice . Immunolocalization studies have previously failed to detect fbn2 in the adult zonule, but its presence in the human and bovine zonulome suggests that fbn2 epitopes may become inaccessible to antibody staining during postnatal development, as reported in other systems . Several proteins implicated in tgf signaling were detected in the zonule . Despite its name, latent tgf binding protein 2 (ltbp2) is not a bona fide tgf-binding protein, but two other family members, ltbp1 and ltbp3, were detected in the zonulome . In other systems, ltbp1 and ltbp3 facilitate the sequestration (and release) of tgf in the ecm through interaction with fbn1 and other components . Of note another protein with a potential role in modulating tgf signaling was emilin-1, a prominent component of the human and bovine zonulome . Emilin-1 has been shown to inhibit tgf signaling by binding to pro - tgf precursor and preventing its furin - mediated maturation . Emilins were originally identified as elastic fiber components located at the interface between microfibrils and the underlying elastin core . More recent studies have suggested that they associate directly with microfibrils . Because zonular fibers insert into the lens capsule directly above the lens germinative zone (the region of the lens epithelium containing the mitotically active cell population), tgf or other growth factors sequestered in the zonule are well placed to influence the growth of the lens directly . It is also possible that the cyclical stretching of the zonule during accommodation might serve to release bound factors from the surface of zonular fibers . One of the novel (and abundant) proteins detected in our study was adamtsl-6 (thsd4). Adamts proteins and adamtsl proteins have well - documented roles in ocular biology and pathology . Adamtsl-6 has not been identified previously in the zonule but, in other systems, is known to bind to the n terminus of fbn1, where it may promote microfibril formation . Among the proteins that we expected to detect in the zonulome, but did not, was adamts10; adamts10 mutations underlie weill - marchesani syndrome type 1 (wms1). Ectopia lentis is commonly observed in wms1, implying a mechanical defect in the ciliary zonule . Clinically, wms1 is indistinguishable from wms2 and wms3, syndromes caused by mutations in fbn1 and ltbp2 respectively, genes encoding two of the most abundant zonular proteins . Immunoelectron microscopy studies have previously suggested that adamts10 is abundant in the human ciliary zonule so its absence from the proteome is perplexing . A striking feature of the zonulome in human and cows was the presence of a diverse set of protease inhibitors, the most abundant in humans being timp3 . The zonule is known to be exquisitely sensitive to proteolysis . Before the introduction of modern cataract surgery, ophthalmologists removed the cataractous lens in a single piece, a procedure facilitated by brief exposure to dilute solutions of -chymotrypsin, which served to lyse the zonule and release the lens from the eye . The presence of timp3 and other protease inhibitors may help explain the evident durability of the zonule, despite lifelong exposure to matrix metalloproteinases and other proteases present in the ocular humors . The hyaloid zonule is intimately associated with the anterior face of the vitreous . During ophthalmic surgery, the vitreous face behaves, physically, as if it were a distinct membrane (the hyaloid membrane). Ophthalmologists take great care not to damage the hyaloid membrane during surgical procedures, lest the contents of the vitreous leak . The current study may provide some clues as to the nature of the hyaloid membrane . First, it is apparent that the hyaloid membrane is reinforced by the presence of a meshwork of fibrillin - rich microfibrils, the hyaloid zonule . During dissection of the hyaloid zonule it is likely that proteins from the anterior - most region of the vitreous were coisolated . The hyaloid zonule sample was characterized by the presence of high concentrations of opticin, consistent with previous immunolocalization studies of opticin in human eyes . Our analysis also suggested that the hyaloid sample was enriched in fibrillar collagens (especially col2a1, col5a2, col5a3, and col11a1), which were detected elsewhere in the vitreous but at much lower concentrations . Interestingly, mutations in col2a1 and col11a1 result in stickler syndrome, a condition characterized by vitreous pathology . In stickler syndrome type 1 (caused by col2a1 mutations), a membranous vitreous is often observed; whereas in stickler syndrome type 2 (col11a1) a beaded vitreous is observed . In each case the anterior face of the vitreous appears to be compromised . Thus, the phenotypes in stickler syndrome are consistent with a model in which fibrillar collagens form part of a meshwork (along with fibrillin - rich microfibrils and opticin) that defines and supports the vitreous face . One question arising from the current study is why such an unassuming structure as the ciliary zonule should require a proteome with fifty or more components? In other settings, it is evident that microfibril scaffolds, decorated with latent growth factors, serve as both mechanosensors and signaling hubs . The pleitropic ocular effects of mutations in zonular genes (which include congenital glaucoma, cataract, ectopia lentis, and microspherophakia) are consistent with the notion that the role of the ciliary zonule is not solely to secure the lens in place.
Identification of specific subtypes of circulating tumor cells in the peripheral blood of cancer patients can provide important prognostic information, but to be effective, the method used must recognize all tumor cell types . The subtype of 19 well - characterized breast cancer cell lines was obtained by use of gene expression profiling, including normal - like, basal - like, her2-positive, and luminal a and b. cells from each line were mixed with blood from a healthy donor and subjected to the cellsearch circulating tumor cell assay . The cellsearch assay, which uses epithelial cell adhesion molecules on the cell surface, did not recognize normal - like breast cancer cells, although other subtypes were recognized . Normal - like breast cancer cells have especially aggressive features, and so assays that recognize this subtype would provide valuable prognostic information . New assays are needed that include antibodies that specifically recognize this breast cancer subtype but not other cell types, including those of hematopoietic origin . Identification of specific subtypes of circulating tumor cells in the peripheral blood of cancer patients can provide important prognostic information, but to be effective, the method used must recognize all tumor cell types . The subtype of 19 well - characterized breast cancer cell lines was obtained by use of gene expression profiling, including normal - like, basal - like, her2-positive, and luminal a and b. cells from each line were mixed with blood from a healthy donor and subjected to the cellsearch circulating tumor cell assay . The cellsearch assay, which uses epithelial cell adhesion molecules on the cell surface, did not recognize normal - like breast cancer cells, although other subtypes were recognized . Normal - like breast cancer cells have especially aggressive features, and so assays that recognize this subtype would provide valuable prognostic information . New assays are needed that include antibodies that specifically recognize this breast cancer subtype but not other cell types, including those of hematopoietic origin . This study was in part financially supported by the netherlands genomic initiative / netherlands organisation for scientific research.
Zoonotic cutaneous leishmaniasis (zcl) is polymorphic disease with various clinical manifestations (1, 2). Leishmaniasis, a group of parasitic infections, has a worldwide distribution (3); the world health organization estimates a prevalence of approximately 12 million cases, with an annual mortality rate of 60,000 and an at - risk population of approximately 350 million (4). Approximately 90% of cl cases occur in just seven countries, including iran (5). Several molecular targets for diagnostic pcr testing have been evaluated in leishmania, including minicircle kinetoplast dna (kdna) (5, 6), the mini - exon (spliced leader rna) gene (7), gp63 polymerase chain reaction analysis of restriction fragment length polymorphism (pcr - rflp) (8), and the internal transcribed spacer (its) (1, 3, 9, 10). Pcr is a new alternative to existing diagnostic procedures, such as direct smear of parasites from clinical specimens or by cultivation, with microscopic examination . In the present study, as described previously (1, 11, 12), we used the rflp analysis of amplified its1 in ribosomal operons to investigate the parasite that causes zcl, and the genetic variations among l. major isolates from chabahar, a port city in southeast iran (situated at the iran - pakistan border). In this region, the manifestation of zcl as a new focus of disease was in doubt, but our findings showed that the species is l. major with variable genes . The disease was correlated with the clinical manifestations of zcl in chabahar, so this is a new major public health problem . A variety of nucleic acid detection methods that target both dna and rna have been developed (1). The its1-rflp pcr assay is a multipurpose tool for the diagnosis of leishmania from clinical samples, and it enables determination of the infecting species (3). The study was approved by the institutional ethics committee, and all patients signed informed consent forms . We evaluated the pcr - rflp assay of the its1 genes for direct identification of leishmania species in 24 out of 33 suspected patients . These patients were referred for diagnosis to the central laboratory of chabahar (25 17 n.70 38e; 13,162 km) for evaluation of skin diseases . The clinical samples were taken from patients suspected to have cl in different endemic areas of chabahar, including negor and other districts and villages . Each diagnosis was confirmed by the demonstration of amastigotes on the slit smear and/or the presence of flagellated promastigotes in novy - macneal - nicolle (nnn) medium from skin samples of 24 patients with typical and atypical lesions . For the parasitological investigation, two were used for direct smears and were stained with giemsa, and the third was inoculated into sterile screw - tap tubes that contained blood agar slanted in nnn medium, then incubated at 25 1c . The isolated promastigotes were subcultured in rpmi-1640 medium supplemented with 15% fetal bovine serum (fbs), 100 g / ml streptomycin, and 100 u / ml penicillin . The diagnosis of leishmaniasis was confirmed by the presence of amastigotes in slit smears and/or the presence of flagellated promastigotes in nnn medium from typical and atypical lesions . For parasitological investigations, three skin samples were collected from the edges of the lesions using sterile surgical blades . Two of the samples were used for direct smears and were stained with giemsa, and the third was inoculated into sterile screw - top tubes containing blood agar slanted in nnn medium, then incubated at 25 1c . Parasites from a 15 ml mid - logarithmic phase of the bulk culture were harvested by centrifugation (700 g for 20 min at 4c) and washed three times in ice - cold sterile pbs (ph 7.2). For species identification, the dna isolated from amastigotes in ulcers and promastigotes in cultures was extracted using a commercial extraction kit (high pure template dna preparation kit, roche, germany), according to the manufacturer s instructions . The target its1-dna was amplified in a reaction mixture that consisted of 1 l of litsr: 5-cttg gatcattttccgatg-3 and 1 l of l5.8s 5-tga tac cac tta tcg cat t-3 (12). The reaction was carried out with the pcr - ready supreme mix in 47 l of total reaction, 15 l of deionized water, 5 l of target dna, and 25 l of master mix . Amplification products were separated in 1% agar gel and visualized under ultraviolet light after staining with ethidium bromide . Major (mhom / ir/15/er) and l. tropica (mhm / su/79/k27) (13) were used as positive controls the designed program for leishmania dna amplification was an initial denaturation cycle at 95c for 5 minutes; 30 cycles with cycle 1 at 95c for 20 seconds (denaturation), cycle 2 at 53c for 30 seconds (annealing), cycle 3 at 72c for 1 minute (extension), and a final extension at 72c for 7 minutes . The pcr products from its1-dna pcr were digested using the haeiii restriction endonuclease enzyme and the taq1 restriction enzyme, as recommended by the manufacture (new england biolabs, inc . ). The its1 sequence was amplified from all isolates, and reference stains were digested separately with restriction enzymes, according to the manufacturer s instructions . A variety of nucleic acid detection methods that target both dna and rna have been developed (1). The its1-rflp pcr assay is a multipurpose tool for the diagnosis of leishmania from clinical samples, and it enables determination of the infecting species (3). The study was approved by the institutional ethics committee, and all patients signed informed consent forms . We evaluated the pcr - rflp assay of the its1 genes for direct identification of leishmania species in 24 out of 33 suspected patients . These patients were referred for diagnosis to the central laboratory of chabahar (25 17 n.70 38e; 13,162 km) for evaluation of skin diseases . The clinical samples were taken from patients suspected to have cl in different endemic areas of chabahar, including negor and other districts and villages . Each diagnosis was confirmed by the demonstration of amastigotes on the slit smear and/or the presence of flagellated promastigotes in novy - macneal - nicolle (nnn) medium from skin samples of 24 patients with typical and atypical lesions . For the parasitological investigation, two were used for direct smears and were stained with giemsa, and the third was inoculated into sterile screw - tap tubes that contained blood agar slanted in nnn medium, then incubated at 25 1c . The isolated promastigotes were subcultured in rpmi-1640 medium supplemented with 15% fetal bovine serum (fbs), 100 g / ml streptomycin, and 100 u / ml penicillin . The diagnosis of leishmaniasis was confirmed by the presence of amastigotes in slit smears and/or the presence of flagellated promastigotes in nnn medium from typical and atypical lesions . For parasitological investigations, three skin samples were collected from the edges of the lesions using sterile surgical blades . Two of the samples were used for direct smears and were stained with giemsa, and the third was inoculated into sterile screw - top tubes containing blood agar slanted in nnn medium, then incubated at 25 1c . Parasites from a 15 ml mid - logarithmic phase of the bulk culture were harvested by centrifugation (700 g for 20 min at 4c) and washed three times in ice - cold sterile pbs (ph 7.2). For species identification, the dna isolated from amastigotes in ulcers and promastigotes in cultures was extracted using a commercial extraction kit (high pure template dna preparation kit, roche, germany), according to the manufacturer s instructions . The target its1-dna was amplified in a reaction mixture that consisted of 1 l of litsr: 5-cttg gatcattttccgatg-3 and 1 l of l5.8s 5-tga tac cac tta tcg cat t-3 (12). The reaction was carried out with the pcr - ready supreme mix in 47 l of total reaction, 15 l of deionized water, 5 l of target dna, and 25 l of master mix . Amplification products were separated in 1% agar gel and visualized under ultraviolet light after staining with ethidium bromide . Major (mhom / ir/15/er) and l. tropica (mhm / su/79/k27) (13) were used as positive controls . The designed program for leishmania dna amplification was an initial denaturation cycle at 95c for 5 minutes; 30 cycles with cycle 1 at 95c for 20 seconds (denaturation), cycle 2 at 53c for 30 seconds (annealing), cycle 3 at 72c for 1 minute (extension), and a final extension at 72c for 7 minutes . The pcr products from its1-dna pcr were digested using the haeiii restriction endonuclease enzyme and the taq1 restriction enzyme, as recommended by the manufacture (new england biolabs, inc . ). The its1 sequence was amplified from all isolates, and reference stains were digested separately with restriction enzymes, according to the manufacturer s instructions . We used the pcr - rflp assay of its1 genes for the direct identification of leishmania species in 24 out of 33 patients suspected to have cl . These 24 patients, who were positive on smears and cultures for l. donovani bodies demonstrated microscopically, were selected for the study . The patient characteristics are shown in table 1, including gender, age, number of lesions, ulcer duration, and distribution of ulcers on the body . With the use of litsr / l5.8s primer for pcr amplification, single products of the expected size of 350 bp of l. major were detected in 21 patients (figure 1). In three isolates, a nonspecific 450 bp band was seen . Rflp was performed on the its1 region in the ribosomal operons of 24 isolates of l. major . After using the restriction enzyme haeiii, banding patterns, including fragments of 140 bp and 210 bp bands, were observed in 19 cases (lma). In three cases with this enzyme, 300 bp and 150 bp bands (figure 2) m, molecular size marker (50 bp); lane 1, standard l. major (mrho / ir/75/er); lane 2, standard l. tropica (mhom / ir/99/yaz1); lane 3, pcr products (350 bp) as a standard; lane 4, pcr products (450 bp; different from standard); lanes 5 - 10, pcr products; lane 11, negative control . M, molecular marker (50 bp); lane 1, standard l. major; lane 2, standard l. tropica; lanes 3 - 9, pcr products; lane 10, the only sample different from the normal samples and standard patterns, probably flagellates; lane 11, negative control . Digestion of its1 from ribosomal dna with taq1 enzymes enabled us to identify two different patterns . Using the taq1 restriction enzyme, banding patterns including 150 bp and 200 bp were observed in 19 cases, same as the standard of l. major (genotype pattern lma). In three isolates, digestion with this enzyme showed 300 bp and 150 bp banding patterns, dissimilar to the l. major reference strain . In two cases, m, molecular marker (50 bp); lane 1, standard l. major; lane 2, l. tropica; lanes 3 - 9, pcr products; lane 10, the only sample different from the normal samples and standard patterns, probably flagellates; lane 11, negative control . M, molecular marker (50 bp); lane 1, standard l. major; lane 2, l. tropica; lane 3, pcr products; lane 4, pcr products; lane 5, pcr products; lane 6, the only sample different from the normal samples and standard patterns, probably flagellates; lane 7, pcr products; lanes 8 - 10, pcr products; lane 11, negative control . Leishmaniasis is a major societal health problem that mostly affects populations where essential health services are not easily accessible and the detection of cl is based on clinical characteristics (14). The present study shows that cl is caused by l. major in chabahar, iran . Parasitological methods are the gold standard for the diagnosis of cl, with a high dependence on the number of parasites in the samples and a requirement of technical skill for sampling . The sensitivity of these methods varies from 27% to 85% for the diagnosis of leishmaniasis, which is their main disadvantage (15). In addition, contamination of the cultured medium is an occasional problem; such material must be discarded . Molecular techniques have proved to be sensitive and powerful tools for detecting leishmania directly in clinical samples, as well as for parasite characterization using pcr (1). Some studies on viannia isolates from different hosts and geographic areas have found high levels of intra- and interspecific variation . Schonian et al . Established a diagnostic its1 pcr - rflp method using the restriction enzyme haeiii for leishmaniasis, combining high sensitivity for detecting leishmania directly in clinical materials and the ability to identify all medically relevant species groups (12). In our study, using the haeiii restriction enzyme, the restriction analysis of the amplified its1 ribosomal dna revealed two different schizodeme patterns (lma and lmb) in l. major . On the other hand, some researchers have found that haeiii was not sufficient to distinguish all species of viannia (16, 17). We found that haeiii, rsa, and hinf1 can produce two profile bandings; alu1 produces three; dde1 and scrf1 produce four; and taq1 produces five (1). In this study, (20), two profile bandings (220 bp and 140 bp) in haeiii digestion were detected, similar to the standard . Taq1 digestion showed two patterns with 150 bp and 200 bp bands . In contrary, in a study in yazd (20) on molecular identification using taq1 restriction enzymes, four patterns were produced . It should be emphasized that leishmaniasis in chabahar is new, and genetic variation is limited . The results of the present study showed that cl infections were more common in males (48.4%) than in females (24.2%) (table 2), probably because males spend more time outdoors than females do in this region . Some studies have shown that pcr methods achieved positive results in more than 90% of cl cases (13). The crithidias are able to endosymbiotically live within some parasites related to the trypanosomatidae family and sub - families of leishmania, and move to different hosts along with them . Some researchers believe that the only way to isolate crithidia from leishmania is through kdna and/or ribosomal rna genes . It has been suggested that by extracting kdna and/or rdna, then amplifying them with pcr using the pcr - rflp technique with the haeiii enzyme and isolation of bands at 350 bp for leishmania and at 450 bp for crithidia, these two parasites can be isolated from each other (21). However, its1-rflp pcr showed good sensitivity, and two its1 analyses showed the same results, as in a recent study by doudi et al . Thus, the results of the present study confirm that in the border area of sistan va baluchestan, on the peninsula of chabahar, l. major is the causative agent of cl, with genotypic variation in this area.
It is a multisystem disorder affecting the gastrointestinal, respiratory, hepatobiliary, and reproductive systems, as well as the sweat glands (1 - 6). Cf is caused by a mutation in the cystictransmembrane conductance regulator (cftr) gene, leading to defective ion transport of the cftr protein (7 - 10). Although numerous mutations in the cftr gene have been reported as a primary cause in the clinical manifestations and outcome of cf (9), recent research has focused on the role of other factors such as gender (11, 12), race (1), age (11), geographic area (2), infection with pseudomonas aeruginosa (11, 13), religion (8), culture (1, 14), and nutritional status (13 - 15). Recently, improvement and progress in outcomes have been observed through better understanding of the disease, finding the effective factors in the start and progression of the disease, and ultimately in better management of the disease (16). These factors have led to earlier diagnosis and more timely treatment, which could affect the clinical course and change the outcome for a patient . Therefore, the link among researchers and clinicians will be stronger due to extensive research on the disease and improved introduction of the disease (17, 18). In addition, the research results could have an effective role in changing of the culture and laws of a society . Retrospective research, in spite of some disadvantages, plays an important role in depicting the disease (16, 19). This research has been conducted after searching the electronic databases and performing a literature review, to ensure that no similar study had been undertaken in the region . This study aimed to assess the association between outcomes and demographic status in azeri turkish patients with cystic fibrosis . This was a cross sectional study conducted at the educational and treatment children s hospital of the university of medical sciences and the medical genetic laboratory, tabriz, iran, from march 2001 to september 2014 . The educational and treatment children s hospital is a governmental, specialized, and referral hospital with 150 beds and six wards in northwestern iran and dr . M. rafeey is the top, and the most professional, physician in this field and region . This study was performed on azeri turks, who are members of one of the largest ethnic groups in iran (20). All the medical records of the patients were reviewed using the census method, and further information was gathered from patients, or their parents, through telephone interviews . The diagnosis of cf was based on typical clinical features and confirmed by sweat chloride level> 60 meq / l, according to the method of gibson and cooke, or detection of mutations in the cftr gene known to cause cf (21). The medical records of 442 patients who met the inclusion criteria were separately reviewed by two authors . Patients with incomplete records and who were not diagnosed as having cf were excluded with the reviewer s agreement . The kappa agreement rate was higher than 85%, as inclusion criteria to the next phase . In the end, 331 cases were included in this study, which was conducted over a 13-year period from 2001 to 2014 . Data included patient outcome, gender, age, residence, ranking in birth order of the family s children, family history, consanguineous marriage, degree of consanguineous marriage, and weight at birth . Ranking in birth order of the family s children was divided into two groups, including one child as the first group, and two children or more as the second group . A positive family history for cf was considered as having had a first, second, or third - degree relative affected with cf (22). A consanguineous marriage was defined as a union between two persons who are related as first cousins (3rd degree), first cousins once removed or double second cousins (4 degree), and second cousins (5 degree). The first degree and the second degree, first cousins were classified as the first group and the others as the second group . Demographic data were analyzed using spss 18 for means and standard deviations for normally distributed continuous variables, and median and interquartile ranges were obtained for non - normally distributed continuous variables . The comparison between variables was analyzed with a chi - square or fisher s exact test, and independent samples t test . Logistic regression analyses were carried out to identify variables independently associated with gender . In all analyses, odds ratio (or) with a 95% confidence interval, and p <0.05 indicated statistical significance . Ethical aspects were considered and approval for the study was gained by the ethics committee of the university (no = 5/4/1775). Participants were assured of confidentiality, and consent was obtained from the patients or their parents . The diagnosis of cf was based on typical clinical features and confirmed by sweat chloride level> 60 meq / l, according to the method of gibson and cooke, or detection of mutations in the cftr gene known to cause cf (21). The medical records of 442 patients who met the inclusion criteria were separately reviewed by two authors . Patients with incomplete records and who were not diagnosed as having cf were excluded with the reviewer s agreement . The kappa agreement rate was higher than 85%, as inclusion criteria to the next phase . In the end, 331 cases were included in this study, which was conducted over a 13-year period from 2001 to 2014 . Data included patient outcome, gender, age, residence, ranking in birth order of the family s children, family history, consanguineous marriage, degree of consanguineous marriage, and weight at birth . Ranking in birth order of the family s children was divided into two groups, including one child as the first group, and two children or more as the second group . A positive family history for cf was considered as having had a first, second, or third - degree relative affected with cf (22). A consanguineous marriage was defined as a union between two persons who are related as first cousins (3rd degree), first cousins once removed or double second cousins (4 degree), and second cousins (5 degree). The first degree and the second degree, first cousins were classified as the first group and the others as the second group . Demographic data were analyzed using spss 18 for means and standard deviations for normally distributed continuous variables, and median and interquartile ranges were obtained for non - normally distributed continuous variables . The comparison between variables was analyzed with a chi - square or fisher s exact test, and independent samples t test . Logistic regression analyses were carried out to identify variables independently associated with gender . In all analyses, odds ratio (or) with a 95% confidence interval, and p <0.05 indicated statistical significance . Ethical aspects were considered and approval for the study was gained by the ethics committee of the university (no = 5/4/1775). Participants were assured of confidentiality, and consent was obtained from the patients or their parents . Demographic data of this study is shown in table 1.there was a significant difference between frequencies of deceased and living patients (p <0.001). In the application of the kolmogorov - smirnov test, age was assumed as non - normal distribution that uses the sample median and the iqr (minimum - maximum), consequently, median age for living patients was 0.4 years (7 days30 years) and median age at death was 4.8 years (3 months 43 years). Abbreviations: d, days; iqr, minimum - maximum; m, months; y, years . All data were mentioned as frequency (%). For deceased cf - patients, median age at death and living cf - patients, median age at time of the study have been considered, because of non - normal of age and weight at birth, median and iqr were applied . Eighty - five patients expired during the 13 years of the study with a mean of six deaths per year and at a ratio of 1:3 . During the time of the study, 77 (90.6%) of the 85 deceased cf patients had died under the age of four years . Among the 246 living cf patients, 131 (53.3%) were less than four years of age . (%). At first, we calculated the association between outcome and gender . At the time of the study, 51 (26.7%) of the deceased patients were males and 34(24.3%) were females . The test did not show any significant difference between outcome and gender (or = 1.13 [95% ci, 0.68 - 1.87], p = 0.6). In the next step, there was a significant difference between the outcome and the geographic location (or = 0.55 [95% ci, 0.32 - 0.95], p = 0.03). There was no significant difference between outcome and ranking among the family s children, while 38 (23.9%) were first - born children, and 47 (27.3%) were second or later born children (or = 0.83 [95% ci, 0.50 - 1.37], p = 0.4). In this study, we analyzed family history status among these patients, and the risk of mortality was approximately two times higher in patients with a positive family history than in those with a negative family history (or = 1.91 [95% ci, 1.09 - 3.36], p = 0.02). There was a statistically significant difference between the outcome and consanguineous marriage (or = 1.94 [95% ci, 1.14 - 3.29], p = 0.01), but no significant difference in degree of positive consanguineous marriage (or = 0.68 [95% ci, 0.34 - 1.37], p = 0.2). The risk of mortality was 1.94 times higher for patients in consanguineous marriages than for those in non - consanguineous marriages . Finally, weight at birth was computed and compared in cf patients, both deceased and living . There was no significant difference between the outcome and weight at birth (or = 1 [95% ci, 1 - 1.001], p = 0.7) (tables 1 and 3). There was no statistically significant difference when logistic regression analysis was considered with the or for all of the variables (p> 0.05). Associations between gender, ranking in birth order of the family s children, degree of consanguineous marriage, and weight at birth were not significant in terms of outcome, and therefore, omitted from the final model . When residential area, family history, and consanguineous marriage were entered into the model, the difference associated with outcome and or was somewhat reduced . Results of logistic regression analysis illustrated the adjusted or for the final model and are shown in table 3 . At first, we calculated the association between outcome and gender . At the time of the study, 51 (26.7%) of the deceased patients were males and 34(24.3%) were females . The test did not show any significant difference between outcome and gender (or = 1.13 [95% ci, 0.68 - 1.87], p = 0.6). In the next step, there was a significant difference between the outcome and the geographic location (or = 0.55 [95% ci, 0.32 - 0.95], p = 0.03). There was no significant difference between outcome and ranking among the family s children, while 38 (23.9%) were first - born children, and 47 (27.3%) were second or later born children (or = 0.83 [95% ci, 0.50 - 1.37], p = 0.4). In this study, we analyzed family history status among these patients, and the risk of mortality was approximately two times higher in patients with a positive family history than in those with a negative family history (or = 1.91 [95% ci, 1.09 - 3.36], p = 0.02). There was a statistically significant difference between the outcome and consanguineous marriage (or = 1.94 [95% ci, 1.14 - 3.29], p = 0.01), but no significant difference in degree of positive consanguineous marriage (or = 0.68 [95% ci, 0.34 - 1.37], p = 0.2). The risk of mortality was 1.94 times higher for patients in consanguineous marriages than for those in non - consanguineous marriages . Finally, weight at birth was computed and compared in cf patients, both deceased and living . There was no significant difference between the outcome and weight at birth (or = 1 [95% ci, 1 - 1.001], p = 0.7) (tables 1 and 3). There was no statistically significant difference when logistic regression analysis was considered with the or for all of the variables (p> 0.05). Associations between gender, ranking in birth order of the family s children, degree of consanguineous marriage, and weight at birth were not significant in terms of outcome, and therefore, omitted from the final model . When residential area, family history, and consanguineous marriage were entered into the model, the difference associated with outcome and or was somewhat reduced . Results of logistic regression analysis illustrated the adjusted or for the final model and are shown in table 3 . The association between non - genetic variables and mortality in individuals with cf has been established (2, 6). Despite improved management and increased awareness, outcome remains an important issue for cf patients, because non - genetic parameters, especially demographic factors, have been ignored by researchers and clinicians . The current study was performed to highlight the associations between demographic parameters and outcomes in cf patients . In this study, the ratio of deceased patients to living patients was 1:3, with a significant difference . Eighty - five patients expired during the period of 13 years, with a mean of six deaths per year . In a study performed by dodge et al . In the uk from 1996 to 2003, there were 1,066 deaths, with a mean of 133 deaths per year (15). Therefore, based on these findings the mortality rate is lower in our study than in the uk, perhaps because this study has been performed on an ethnic group in iran with a low incidence of cf . In addition, it is likely that a number of deaths were not recorded or were not reported by the family in our study . In a previous study in sweden, lannefors et al . Reported data from 1971 - 1999 showing that while the incidence of cf was 1/5600 live - births, the mean and median age of living cf patients were 18 12 and 16 years, respectively . In this study, regarding deceased patients, 45% were older than 18 years and 10% were older than 35 years . In deceased patients, the median age at death was 26 years (range 0 - 72) (2). In another study, also, this statistic had been observed in median age at death . Delayed diagnosis and inappropriate health care were risk factors for a younger median age at death in non - european countries (24). In our study, living cf patients had lower mean, median, and were of an older age than that reported in developed countries . Also, in deceased cf patients the mean and median age at death were lower than in developed countries . We hypothesize that this difference may be due to the lack of proper equipment, inadequate diagnostic processes, and absence of treatment by specialists and expert staff, as well as poor nutritional status in our region compared to developed countries (13, 24). In our study, there was no significant difference between outcome and gender; however, the mortality rate was somewhat higher in males than females . A number of studies have indicated that males have a better survival rate than females, while lannefors et al . In another study, accumulated data related to the mortality rate between genders reflects a higher mortality rate in cf females compared to males (6). Cultural issues and intrinsic ethnic differences (1), as well as religion (8, 25) and geographical elements, (9) for example, females are more susceptible to cf because of their body functions; consequently, they more often report problems than males . Expression of problems can be observed more in females than males in our region because of cultural issues (26). Reasons for this difference may be unclear, so it is necessary to perform additional investigations in a large population from neighboring countries to elucidate this issue . In the current study, there was a significant difference between outcome and location of residence . The mortality rate of cf was 50% higher in rural patients than urban patients, in spite of less air pollution (10), lower stress, sufficient exercise, and organic nutritional intake in rural areas (13, 27). The availability of appropriate facilities to diagnosis and treat the disease is an important factor in patient survival . Growth and lung health of children is influenced by proper treatment, and decreased pulmonary function is associated with morbidity and shortened survival for cf patients (28). Continuous care, suitable food, and daily physiotherapy are the main elements in survival of cf (27). The relationship between improved nutritional support and increased survival in cf has been established, and retention of balanced and stable nutritional status is the best method of treatment for cf (13, 27). Preventive treatments, such as adequate exercise, have been introduced at early ages for cf patients, and it appears to be an important factor in health maintenance in patients with cf (27). In addition, a healthy lifestyle (27), related to appropriate family functioning (29), elevated levels of social class, education, and higher income (19, 30) are determinates of survival for cf patients . Patients living in urban areas are usually more likely to benefit from these conditions . In this study, there was no significant difference between outcome and ranking in birth order of the family s children, although the mortality rate was slightly higher for the second or subsequent children than for the first - born . Management of patients with cf is one of the greatest challenges for families, and the family plays an important role in the treatment of cf (30). Cf patients need constant care such as physiotherapy, various medications, proper dietary intake, exercise, and adequate support (21, 31). On the other hand, high socioeconomic status with adequate income, suitable occupation, and employment status were identified as factors related to a good prognosis in affected individuals (30). In crowded families, patients with a positive family history, such as a diagnostic category (32, 33), had a higher mortality rate than those with a negative family history . There was a significant difference, with the risk of mortality approximately two times, or 91%, higher with a positive family history than a negative family history, in the current study . Ormond et al . Published findings of a study stating that individuals affected by cf are segregated into four categories based on severity of disease . Patients with a family history of cf showed a broader range of superficial severity with an unknown reason (34).understanding the reasons these patients have poorer prognoses than others will need additional research . Considering consanguineous marriage as a predicating factor of outcome, children born to related parents were 94% more at risk for death than children of non - consanguineous marriage, especially in consanguineous marriage of the first - cousin type (3rd - degree). Social conditions, religion, economic situations, and traditional beliefs are essential considerations in the preference for consanguineous marriage . In muslim populations, first - cousin unions (3rd - degree) between a man and his father s or mother s brother s daughter, and the opposite, were detected frequently . The incidence of consanguinity has been reported to be 56% in middle east with saudi arabia having the highest prevalence at 89% in families with cf (35). Most studies have shown that early mortality is higher in the progeny of consanguineous unions than in non - consanguineous marriage (36). Ultimately, weight at birth was reviewed in deceased patients and living patients and no significant difference between them was found . The mean of weight at birth in the living cf population was slightly higher than the deceased cf population . Cf is an autosomal recessive disorder affecting several organs, such as the digestive system, which is manifested in fat malabsorption, steatorrhea, and poor growth (2, 21). Patients who intake adequate dietary requirements and gain proper weight have better pulmonary function (1, 13). An increased rate of mortality was associated with malnutrition, growth retardation, and declining lung function (1, 13, 37). It is thought that in consanguineous marriage this was observed and that low weight at birth in cf patients causes shortened survival . The presence of ranking among the family s children, degree of consanguineous marriage, and weight at birth do not rule in the mortality of cf, although location of residence, family history, and consanguineous marriage are predictors of increased mortality in cf patients . The primary weakness of this study was that it was a retrospective study and may have limited accuracy, but it does lead the way to prospective research . Another weak point was the investigation was limited to a specialist group, which decreases the ability to generalize the study results . Data were limited to the children s hospital of the university of medical sciences and medical genetic laboratory in tabriz, and it was possible that some cf patients were not referred to these centers . The strength of this study was the adequate sample size in this population, and that it was conducted over a long period of time . Data that was approved by two reviewers were collected from educational, referral, and therapeutic centers, and were designed to evaluate the effects of non - genetic factors on outcomes . This study was conducted in a population with a unique religion, ethnic origin, and culture, which could be a basis for the performance of comparative studies . This study indicates an association between outcome and the number of demographic factors in cf patients and emphasized the role of these factors in outcomes . Clinicians need to be aware and educate patients and their families about treatments such as the correct use of medicines (oral nutritional supplements, antibiotics, and nebulizers), physiotherapy, and proper nutrition, which are essential for a positive prognosis, especially in patients living in rural areas . It should be required that the government and relevant organizations focus on informing the public of the dangers of consanguinity . Couples with consanguineous marriages, especially with a positive family history of the disease, require more frequent and thorough evaluations before pregnancy . Other studies were performed for evaluating the association, if any, between outcome and other demographic factors . In this study, the ratio of deceased patients to living patients was 1:3, with a significant difference . Eighty - five patients expired during the period of 13 years, with a mean of six deaths per year . In a study performed by dodge et al . In the uk from 1996 to 2003, there were 1,066 deaths, with a mean of 133 deaths per year (15). Therefore, based on these findings the mortality rate is lower in our study than in the uk, perhaps because this study has been performed on an ethnic group in iran with a low incidence of cf . In addition, it is likely that a number of deaths were not recorded or were not reported by the family in our study . In a previous study in sweden, lannefors et al . Reported data from 1971 - 1999 showing that while the incidence of cf was 1/5600 live - births, the mean and median age of living cf patients were 18 12 and 16 years, respectively . In this study, regarding deceased patients, 45% were older than 18 years and 10% were older than 35 years . In deceased patients, the median age at death was 26 years (range 0 - 72) (2). In another study, also, this statistic had been observed in median age at death . Delayed diagnosis and inappropriate health care european countries (24). In our study, living cf patients had lower mean, median, and were of an older age than that reported in developed countries . Also, in deceased cf patients the mean and median age at death were lower than in developed countries . We hypothesize that this difference may be due to the lack of proper equipment, inadequate diagnostic processes, and absence of treatment by specialists and expert staff, as well as poor nutritional status in our region compared to developed countries (13, 24). In our study, there was no significant difference between outcome and gender; however, the mortality rate was somewhat higher in males than females . A number of studies have indicated that males have a better survival rate than females, while lannefors et al . 15) showed 45% and 49% of males with cf expired, respectively . In another study, accumulated data related to the mortality rate between genders reflects a higher mortality rate in cf females compared to males (6). Cultural issues and intrinsic ethnic differences (1), as well as religion (8, 25) and geographical elements, (9) may be reasons for the differences . For example, females are more susceptible to cf because of their body functions; consequently, they more often report problems than males . Expression of problems can be observed more in females than males in our region because of cultural issues (26). Reasons for this difference may be unclear, so it is necessary to perform additional investigations in a large population from neighboring countries to elucidate this issue . In the current study the mortality rate of cf was 50% higher in rural patients than urban patients, in spite of less air pollution (10), lower stress, sufficient exercise, and organic nutritional intake in rural areas (13, 27). The availability of appropriate facilities to diagnosis and treat the disease is an important factor in patient survival . Growth and lung health of children is influenced by proper treatment, and decreased pulmonary function is associated with morbidity and shortened survival for cf patients (28). Continuous care, suitable food, and daily physiotherapy are the main elements in survival of cf (27). The relationship between improved nutritional support and increased survival in cf has been established, and retention of balanced and stable nutritional status is the best method of treatment for cf (13, 27). Preventive treatments, such as adequate exercise, have been introduced at early ages for cf patients, and it appears to be an important factor in health maintenance in patients with cf (27). In addition, a healthy lifestyle (27), related to appropriate family functioning (29), elevated levels of social class, education, and higher income (19, 30) are determinates of survival for cf patients . Patients living in urban areas are usually more likely to benefit from these conditions . In this study, there was no significant difference between outcome and ranking in birth order of the family s children, although the mortality rate was slightly higher for the second or subsequent children than for the first - born . Management of patients with cf is one of the greatest challenges for families, and the family plays an important role in the treatment of cf (30). Cf patients need constant care such as physiotherapy, various medications, proper dietary intake, exercise, and adequate support (21, 31). On the other hand, high socioeconomic status with adequate income, suitable occupation, and employment status were identified as factors related to a good prognosis in affected individuals (30). In crowded families, patients with a positive family history, such as a diagnostic category (32, 33), had a higher mortality rate than those with a negative family history . There was a significant difference, with the risk of mortality approximately two times, or 91%, higher with a positive family history than a negative family history, in the current study . Ormond et al . Published findings of a study stating that individuals affected by cf are segregated into four categories based on severity of disease . Patients with a family history of cf showed a broader range of superficial severity with an unknown reason (34).understanding the reasons these patients have poorer prognoses than others will need additional research . Considering consanguineous marriage as a predicating factor of outcome, children born to related parents were 94% more at risk for death than children of non - consanguineous marriage, especially in consanguineous marriage of the first - cousin type (3rd - degree). Social conditions, religion, economic situations, and traditional beliefs are essential considerations in the preference for consanguineous marriage . In muslim populations, first - cousin unions (3rd - degree) between a man and his father s or mother s brother s daughter, and the opposite, were detected frequently . The incidence of consanguinity has been reported to be 56% in middle east with saudi arabia having the highest prevalence at 89% in families with cf (35). Most studies have shown that early mortality is higher in the progeny of consanguineous unions than in non - consanguineous marriage (36). Ultimately, weight at birth was reviewed in deceased patients and living patients and no significant difference between them was found . The mean of weight at birth in the living cf population was slightly higher than the deceased cf population . Cf is an autosomal recessive disorder affecting several organs, such as the digestive system, which is manifested in fat malabsorption, steatorrhea, and poor growth (2, 21). Patients who intake adequate dietary requirements and gain proper weight have better pulmonary function (1, 13). An increased rate of mortality was associated with malnutrition, growth retardation, and declining lung function (1, 13, 37). It is thought that in consanguineous marriage this was observed and that low weight at birth in cf patients causes shortened survival . The presence of ranking among the family s children, degree of consanguineous marriage, and weight at birth do not rule in the mortality of cf, although location of residence, family history, and consanguineous marriage are predictors of increased mortality in cf patients . The primary weakness of this study was that it was a retrospective study and may have limited accuracy, but it does lead the way to prospective research . Another weak point was the investigation was limited to a specialist group, which decreases the ability to generalize the study results . Data were limited to the children s hospital of the university of medical sciences and medical genetic laboratory in tabriz, and it was possible that some cf patients were not referred to these centers . The strength of this study was the adequate sample size in this population, and that it was conducted over a long period of time . Data that was approved by two reviewers were collected from educational, referral, and therapeutic centers, and were designed to evaluate the effects of non - genetic factors on outcomes . This study was conducted in a population with a unique religion, ethnic origin, and culture, which could be a basis for the performance of comparative studies . This study indicates an association between outcome and the number of demographic factors in cf patients and emphasized the role of these factors in outcomes . Clinicians need to be aware and educate patients and their families about treatments such as the correct use of medicines (oral nutritional supplements, antibiotics, and nebulizers), physiotherapy, and proper nutrition, which are essential for a positive prognosis, especially in patients living in rural areas . It should be required that the government and relevant organizations focus on informing the public of the dangers of consanguinity . Couples with consanguineous marriages, especially with a positive family history of the disease, require more frequent and thorough evaluations before pregnancy . Other studies were performed for evaluating the association, if any, between outcome and other demographic factors.
The original technique of staining the anterior capsule with trypan blue (tb) in eyes with no red reflex involves the injection of the dye with a cannula after filling the anterior chamber with an air bubble.1 the stability of the anterior chamber can be compromised by air escaping when the cannula is introduced and the dye is injected . Moreover, the superficial tension of air bubble and capillary action between tb and the metal cannula can force the dye to build up within the aqueous meniscus surrounding the air bubble, making selective staining of the capsule difficult . Several techniques using viscoelastic substances as an alternative to air have been presented to increase the stability of the anterior chamber.25 however, staining under viscoelastic material can be time - consuming and expensive, as it requires the mechanical spreading of tb onto the anterior capsule and the replacement of the viscous solution when an excessive diffusion of dye affects its transparency . We present an under - air staining technique of the anterior capsule using one drop of tb injected with a 30 g needle through the peripheral cornea . Our procedure prevents the exit of air during the injection of the dye, resulting in increased stability of the anterior chamber . Moreover, it allows selective staining of the capsule using the needle and avoids an excessive buildup of tb in the anterior chamber . Connect a 30 g needle to a 2.25 ml luer lock syringe containing trypan blue 0.06% (visionblue; dutch ophthalmic research center international, zuidland, netherlands). Make a standard side - port incision with a 15 blade . Use a 25 g cannula connected to a 5 ml syringe to inject a big air bubble in the anterior chamber . Introduce the 30 g needle bevel - up in the anterior chamber through the peripheral cornea between the side - port incision and the site chosen for the corneal tunnel . Push the needle forward in the air bubble right between the anterior capsule and posterior corneal surface until the tip reaches the center of the pupil . Unlike what occurs using a cannula, the air cannot escape from the anterior chamber . Inject gently, allowing the tb volume to grow within the needle bevel (figure 1). Rotate the syringe 90, letting the drop fall on the anterior capsule (figure 2). The needle tip allows precise control on the injected dye, similarly to a dropper . If the staining is not sufficient, it is possible to inject one more drop of tb on the unstained area . Once the needle is removed, the perforation will close spontaneously in a few seconds, and if necessary an absorbent stick can be used to stop tiny leakages of air and/ or dye . Inject viscoelastic substance in the anterior chamber through the side - port incision, allowing the air and the leftover dye to exit the eye . Tb is the most used dye to perform capsulorhexis in eyes with no red reflex.6 the main staining techniques involve tb injection under air,1 under viscoelastic material,25 or directly under aqueous humor . An air bubble within the anterior chamber reduces the contact between the dye and the corneal endothelium and allows the delivery of undiluted tb onto the anterior capsule . However, the air bubble makes the anterior chamber unstable and prone to collapse when the cannula is introduced to inject the dye . In such an event, the anterior chamber has to be reinflated, thus increasing the duration of surgery . Moreover, sudden reductions in volume of the anterior chamber can cause narrowing of the pupil and damage to the corneal endothelium . To prevent the air bubble from escaping the anterior chamber, it has been proposed that a small amount of high - density viscoelastic material be placed near the side - port incision.7 in our technique, we inject the dye in the anterior chamber, introducing a 30 g needle through the peripheral cornea . In this way, the air cannot escape from the side - port incision, as often occurs when a cannula is used . Once the needle is pulled out, the corneal perforation spontaneously closes in a few seconds . When the dye is injected with a blunt cannula through the side - port incision, the superficial tension of the air bubble spreads the dye into the thin liquid layer between the air and the anterior capsule.8 in this phase, a meniscus of tb forms between the metal cannula and the anterior capsule due to the capillary action and adhesive forces . To obtain the right staining, the anterior capsule must be swept thoroughly with the cannula, allowing the meniscus of tb to contact the largest possible area . If too much dye is injected, it can migrate back between the cannula and the capsule, escaping from the paracentesis, or it could build up in the aqueous meniscus surrounding the air bubble . To avoid this, toprak et al8 modified a cannula by bending it to increase the surface contact between the dye and the capsule . In our procedure, we use a very sharp - tipped needle, which reduces the adhesive forces with tb and allows the drop of dye to fall easily over the anterior capsule . Many authors have described alternative staining techniques based on viscoelastic substances instead of air.25 these techniques have the advantage of making the anterior chamber more stable and of better dosing the amount of injected dye . However, when the anterior chamber is filled with viscoelastic substance, it is difficult to deliver the dye onto the capsule . The surgeon has to mechanically spread the dye on the largest possible surface of the capsule, and at times the dyed viscoelastic material or pockets of dye can affect the visibility of the capsule beneath . To avoid these problems, special cannulae have been proposed.2,4 rarely, an exchange of the viscoelastic material is needed to restore the transparency before the capsulorhexis . We injected tb with a 30 g needle in seven consecutive patients with white cataract and normal anterior chamber depth . In this small group of patients, we have not observed intra- or postoperative complications . After surgery, all patients showed marked improvement in their visual acuity . In six patients, we performed a regular capsulorhexis after injecting only one drop of dye . In a single patient, one more drop of tb had to be injected to build up the staining of the capsule . An additional corneal access and a sharp needle in the anterior chamber are the major disadvantages of our technique . In eyes with shallow anterior chamber or with excessive posterior pressure, the use of the 30 g needle technique could be dangerous and should be avoided . In conclusion, in a small series of seven patients, the staining of the anterior capsule using tb under air with a 30 g needle allowed for enhanced stability of the anterior chamber and the use of the smallest quantity of dye.
High resolution transmission electron microscopy and high angle annular dark - field scanning transmission electron microscopy were employed to investigate the microstructure and the epitaxial growth of the structures . Room temperature ferroelectric and ferrimagnetic domains of the heterostructures were imaged by piezoresponse force microscopy (pfm) and magnetic force microscopy (mfm), respectively . Pfm and mfm investigations proved that the hybrid epitaxial nanostructures show ferroelectric and magnetic order at room temperature . Dielectric effects occurring after repeated switching of the polarization in large planar capacitors, comprising ferrimagnetic nife2o4 dots embedded in ferroelectric pbzr0.52ti0.48o3 matrix, were studied . These hybrid multiferroic structures with clean and well defined epitaxial interfaces hold promise for reliable investigations of magnetoelectric coupling between the ferrimagnetic / magnetostrictive and ferroelectric / piezoelectric phases . There is no conflict of interest in the present study for any of the authors.
Malnutrition is a common and serious problem among geriatric patients, particularly for those who are diagnosed with lung cancer caused by declined functional reserve of visceral organs, decreased stability of the internal environment, and effects of acute or chronic diseases . Malnutrition can lead to increased risk of surgery, decreased quality of life, increased incidence of postoperative complications, increased fatality rate, and decreased survival rate among elderly lung cancer inpatients.1,2 nutrition support has also been reported to improve the perioperative nutritional status and reduce the severity of postoperative complications in lung cancer.3 in the people s republic of china, the number of elderly lung cancer inpatients is increasing at a rapid rate; thus, there is a great need to develop a tool that can accurately and effectively assess the nutritional status of these patients . The mini - nutritional assessment (mna) is a tool that is widely used in the usa and europe to evaluate patients nutritional status . This study examines the use of the mna and short - form mna (mna - sf) (with a revised scoring system to better suit the elderly chinese population5) in assessing the nutritional status of elderly chinese lung cancer inpatients prior to scheduled surgery . A total of 180 elderly chinese lung cancer inpatients (120 men and 60 women) aged 60 and older were randomly selected from the tianjin medical university cancer institute and hospital between june 2010 and july 2011 . The original mna and mna - sf scoring systems developed by guigoz4 were revised to account for differences in height, weight, and dietary behaviors between asian and western populations . For the present study, guigoz s cutoff point of <17 for malnutrition was changed to <19, thereby modifying the overall scoring system for assessing patients nutritional status (maximum score = 30), thus: a score 24 would indicate that a patient was well nourished, a score in the range 1923 would indicate that a patient was at risk of malnutrition, and a score <19 would indicate that a patient was malnourished.5 in addition, the body mass index (bmi) (kg / m2) ranges were adjusted to align with the following scores: <18.50 kg / m = 0 (vs <19.00 kg / m = 0), 18.5021.25 kg / m = 1 (vs 19.0021.00 kg / m = 1), 21.2524.00 kg / m = 2 (vs 21.0023.00 kg / m = 2),> 24.00 kg / m = 3 (vs> 23.00 kg / m = 3). Finally, in assessing dietary behaviors, cheese, which is infrequently consumed by the chinese population, was replaced with soy and peanut milk . The maximum score for the mna - sf is 14, where a score of 12 or more reflects a well - nourished nutritional status . Patients demographic data, including age, sex, and smoking history (eg, date started smoking, number of cigarettes smoked per day, date ceased smoking), were collected by clinically trained nurses . Anthropometric parameters and biochemical markers were determined based on previous research.5 biochemical markers were provided by clinical laboratories at the tianjin medical university cancer institute and hospital, and reference values of biochemical markers were modified to assess the nutritional status of hospitalized patients . All protocols used in this study were approved by the tianjin cancer institute and hospital . All nurses and patients participating in this study were informed about the objectives of the study and signed an informed consent document prior to participating . Spss (v 17.0; ibm, armonk, new york, ny, usa) software was used to conduct all statistical analyses . Means, standard deviations, cross tabulation, and frequency tables were used as descriptive statistics . Analysis of variance for normally distributed dates and nonparametric methods, such as the wilcoxon two - sample test and the kruskal - wallis test were used to make statistical comparisons . A total of 180 elderly chinese lung cancer inpatients (120 men and 60 women) aged 60 and older were randomly selected from the tianjin medical university cancer institute and hospital between june 2010 and july 2011 . The original mna and mna - sf scoring systems developed by guigoz4 were revised to account for differences in height, weight, and dietary behaviors between asian and western populations . For the present study, guigoz s cutoff point of <17 for malnutrition was changed to <19, thereby modifying the overall scoring system for assessing patients nutritional status (maximum score = 30), thus: a score 24 would indicate that a patient was well nourished, a score in the range 1923 would indicate that a patient was at risk of malnutrition, and a score <19 would indicate that a patient was malnourished.5 in addition, the body mass index (bmi) (kg / m2) ranges were adjusted to align with the following scores: <18.50 kg / m = 0 (vs <19.00 kg / m = 0), 18.5021.25 kg / m = 1 (vs 19.0021.00 kg / m = 1), 21.2524.00 kg / m = 2 (vs 21.0023.00 kg / m = 2),> 24.00 kg / m = 3 (vs> 23.00 kg / m = 3). Finally, in assessing dietary behaviors, cheese, which is infrequently consumed by the chinese population, was replaced with soy and peanut milk . The maximum score for the mna - sf is 14, where a score of 12 or more reflects a well - nourished nutritional status . Patients demographic data, including age, sex, and smoking history (eg, date started smoking, number of cigarettes smoked per day, date ceased smoking), were collected by clinically trained nurses . Anthropometric parameters and biochemical markers were determined based on previous research.5 biochemical markers were provided by clinical laboratories at the tianjin medical university cancer institute and hospital, and reference values of biochemical markers were modified to assess the nutritional status of hospitalized patients . All protocols used in this study were approved by the tianjin cancer institute and hospital . All nurses and patients participating in this study were informed about the objectives of the study and signed an informed consent document prior to participating . Spss (v 17.0; ibm, armonk, new york, ny, usa) software was used to conduct all statistical analyses . Means, standard deviations, cross tabulation, and frequency tables were used as descriptive statistics . Analysis of variance for normally distributed dates and nonparametric methods, such as the wilcoxon two - sample test and the kruskal - wallis test were used to make statistical comparisons . Average age of the 180 sample patients was 67.3 5.0 years, with a range of 60~85 years . Across all patients assessed 9% (n = 17) were malnourished (mna score <19), 33% (n = 59) were at risk of malnutrition (mna score 1923), and 58% (n = 104) were well nourished (mna score 24). Average mna - sf score was 11.5 2.3 with a range of 4 to 15 . Among all patients assessed 4% (n = 7) had a bmi of greater than 30 kg / m and 7% (n = 13) had a bmi of less than 20 kg / m . To measure the criterion - related validity of the mna, significant correlations were found between bmi and mna scores (p = 0.000); mna scores of well - nourished at risk of malnutrition, and malnourished patients (p <0.001); the bmi of well - nourished and malnourished patients (p <0.05); and the calf circumference (cc) of well - nourished and at risk of malnutrition patients with malnourished patients (p <0.05). Reliability was measured as homogeneity using cronbach s coefficient and item - to - total score correlations . Significant correlations between total mna score and mna questions were found for all questions with the exception of four related to neuropsychological problems, independence, skin problems, and number of meals eaten per day . For example, declined food intake was strongly correlated with weight loss during the last 3 months (r = 0.538), self - perceived nutritional status (r = 0.485), and self - perceived health status (r = 0.482). There was also a strong correlation between self - perceived nutritional status and self - perceived health status . In contrast, no significant correlations were linked to skin problems, number of meals eaten per day, and neuropsychological problems . Mna questions that had a high number of an assigned score of 0 provided key insights: 99% (n = 178) of patients could consume their food independently, 44% (80) suffered psychological stress, 26% (46) consumed low amounts of protein each day, 25% (45) had a cc <31 cm, 15% (27) drank fewer than three cups of water per day, and 13% (24) consumed fewer than three different types of fruits and vegetables per day . Patients who were well nourished, at risk of malnutrition, and malnourished differed significantly in their responses to anthropometrics, and global, diet, and subjective assessments (table 3). This suggests that all four aspects of the mna contribute to the total mna score and the nutritional status of the patients . Average age of the 180 sample patients was 67.3 5.0 years, with a range of 60~85 years . Across all patients assessed 9% (n = 17) were malnourished (mna score <19), 33% (n = 59) were at risk of malnutrition (mna score 1923), and 58% (n = 104) were well nourished (mna score 24). Average mna - sf score was 11.5 2.3 with a range of 4 to 15 . Among all patients assessed 4% (n = 7) had a bmi of greater than 30 kg / m and 7% (n = 13) had a bmi of less than 20 kg / m . To measure the criterion - related validity of the mna, significant correlations were found between bmi and mna scores (p = 0.000); mna scores of well - nourished at risk of malnutrition, and malnourished patients (p <0.001); the bmi of well - nourished and malnourished patients (p <0.05); and the calf circumference (cc) of well - nourished and at risk of malnutrition patients with malnourished patients (p <0.05). Reliability was measured as homogeneity using cronbach s coefficient and item - to - total score correlations . Significant correlations between total mna score and mna questions were found for all questions with the exception of four related to neuropsychological problems, independence, skin problems, and number of meals eaten per day . For example, declined food intake was strongly correlated with weight loss during the last 3 months (r = 0.538), self - perceived nutritional status (r = 0.485), and self - perceived health status (r = 0.482). There was also a strong correlation between self - perceived nutritional status and self - perceived health status . In contrast, no significant correlations were linked to skin problems, number of meals eaten per day, and neuropsychological problems . Mna questions that had a high number of an assigned score of 0 provided key insights: 99% (n = 178) of patients could consume their food independently, 44% (80) suffered psychological stress, 26% (46) consumed low amounts of protein each day, 25% (45) had a cc <31 cm, 15% (27) drank fewer than three cups of water per day, and 13% (24) consumed fewer than three different types of fruits and vegetables per day . Patients who were well nourished, at risk of malnutrition, and malnourished differed significantly in their responses to anthropometrics, and global, diet, and subjective assessments (table 3). This suggests that all four aspects of the mna contribute to the total mna score and the nutritional status of the patients . Published findings on the nutritional status of lung cancer inpatients vary greatly in the medical literature . Some studies conclude that there is a high incidence of malnutrition among lung cancer inpatients . For example, hollaus et al6 and chauhan et al7 found that 10%20% and 30% of patients suffered from malnutrition, respectively . In contrast, other studies have shown that malnutrition rates are overestimated in lung cancer patients . Jagoe et al reported that severe malnutrition was uncommon among lung cancer patients who were referred for surgery.8 however, in the present study, the incidence rate of malnutrition was found to be 42% among 180 lung cancer inpatients who were referred for surgery . The malnutrition or cachexia in these patients may have been caused by a slowdown in metabolism due to decreased organic functions, or absorption of the body s nutrients by malignant tumors before metastasis.9 this study also showed that there were significant correlations between mna score and bmi (p = 0.000); the mna scores of well - nourished, at risk of malnutrition, and malnourished patients (p <0.001); the bmi of well - nourished and malnourished patients (p <0.05); and the cc of well - nourished and at - risk of malnutrition patients with malnourished patients (p <0.05). Secondly, all but four mna questions (neuropsychological problems, independence, skin problems, and number of meals eaten per day) were significantly correlated to total mna score . This shows that the mna is a reliable instrument (cronbach s coefficient = 0.698) for nutritional assessment . In addition, well - nourished, at risk of malnutrition, and malnourished patients differed significantly in their responses to mna subgroup questions related to anthropometrics, and global, diet, and subjective assessments (table 3). All these findings are supported by existing studies, suggesting that the mna (with a revised scoring system to better suit the elderly chinese population) is a valid and reliable diagnostic tool with which to assess the nutritional status of elderly chinese lung cancer inpatients.5,10 no significant correlations were found between total mna score and mna questions related to neuropsychological problems and independence (table 2). Studies conducted by soini et al10 also found that independence was correlated with total mna score, as nurses or family members helped feed patients . However, neuropsychological problems were strongly correlated to total mna score in soini and murphy s studies.10,11 the differences between these findings and those of the present study may be due to the fact that, in our study, 99% (n = 178) of patients could consume their food independently . Additionally, in our study, preliminary evaluations were carried out before surgery, and some patients with neuropsychological problems may have been transferred to receive neuropsychological treatment instead of undergoing surgery . As such, the lack of cooperation from patients with neuropsychological problems may increase their risk of postoperative complications and death . The mna is a valid and reliable diagnostic tool that can be used to identify elderly lung cancer inpatients who are malnourished, as well as those who are at risk for malnutrition . The high incidence rates of preoperative malnutrition and risk of malnutrition among elderly chinese lung cancer inpatients highlights the need for further investigations to determine the relationship between nutritional status and prognosis of these patients.
Population aging can be considered as the most evident and dynamic aspect of modern demography, influencing the economy and public health in a significant way . The world has experienced a modest increase in the population above 60 years of age over the last six decades from 8% to 10% . However, there were 204 million elderly in the world . In 1998, this number more than doubled, totaling 579 million; in 2011, the figure reached was 893 million.1 over the next four decades, experts expect this age group to grow to 22% of the world population, which would correspond to 2.4 billion of elderly by the middle of this century.2 in this sense, many elders will likely face health problems inherent to aging, as well as challenges in maintaining their independence . However, the elderly can stay healthy and active in society in an independent and sustainable manner,3 and the work of professionals and researchers in the multidisciplinary health field that serve this group is fundamental in achieving this state . At the same time, it is essential that the government create and apply public policies that enable and sustain educational and awareness actions regarding people qualification and the fulfillment of the population basic needs . As for the health of the elderly, changes in body balance (postural instability) have received much attention, as it is one of the symptoms that most affect their lives . Body balance is the result of a harmonious interaction among different systems in the human body: vestibular (inner ear posterior labyrinth), visual, and somatic - sensorial (cutaneous, muscular, and articular receptors) systems . This interaction is accomplished through processes of the neural system, which organizes and executes a rapid response by means of the musculoskeletal system.4 the aging process is associated with a decrease in the ability to keep balance, especially in situations where responses of the balance keeping systems to unexpected disturbances during free moving and the avoidance of obstacles are necessary . Sensorial, motor, and adaptive balance components become vulnerable as degenerative, infectious, or damaging processes accumulate . Although small alterations in any of the systems that comprise balance keeping do not result in significant disturbances, the involvement of multiple components may lead to severe deficits in postural stability conservation.5 6 the aging process may alter the dynamic posture keeping system . This condition is a contributing factor to falls among the elderly, albeit not the main cause.7 impairment of the vestibular system is also believed to be a factor that leads the elderly to lose balance, through the aging process of this systes organs.8 alterations to postural stability are also followed by dizziness . This can be defined as any sensation of change in the body balance and can be rotational (vertigo) or non - rotational (unbalance, oscillation, vacillation, etc . ). Both types may or may not be caused by specific vestibular system disturbances.9 the presence of dizziness may cause falls, which are associated to the main cause of death in the elderly group . Some authors also associate dizziness to partial or full inability to perform social, professional, family activities, in addition to causing physical and psychological damage, such as loss of self - confidence, depression, deficit in concentration, and performance, thus negatively interfering in the quality of life.10 11 however, it is still difficult to know if psychological problems pre - exist or are a result of vestibular complications.11 balance disturbances and anxiety disorders share central neural circuits involving monoaminergic components, this being the reason why anxiety is often associated with balance alterations . These neural circuits concentrate in a parabrachial nucleus network (vestibular system and visceral information processing convergence point), also involving avoidance, anxiety, and fear symptoms.12 physical insecurity triggered by dizziness and unbalance lead to psychological insecurity, irritability, loss of self - confidence, anxiety, depression or panic, a sense of being out of reality and depersonalization.13 depression which may be caused or made worse by body imbalance is a common condition in seniors . Furthermore, it is associated to higher risk of morbidity and mortality, increase in health services usage, negligence in self - care, and higher risk of suicide.14 the main symptoms of depression are depressed mood and loss of interest or lack of pleasure in almost all activities, being characterized as a psychiatric syndrome . In the elderly, its manifestation occurs in a heterogeneous form regarding both the presentation aspects of its etiology and its treatment.15 studies relate the involvement in physical activities with a better general health condition and lesser occurrence of depression and falls in the elderly.16 17 physical activity is capable of improving mental and clinical conditions of depressed elderly . This is because physical activity stimulates cognitive, memory, and concentration functions, in addition to raising self - esteem, improving quality of life,18 and helping decrease scores indicative of anxiety and depression,19 favoring daily activities and promoting functional independence.20 furthermore, the physically active elderly show improvement of dizziness and vertigo symptoms,21 22 23 decreasing, as a result, the risk of falls and associated comorbidities . Thus, the objective of this work is to verify the correlation between physical exercise, dizziness, probability of falls, and symptoms of depression in a group of middle - aged and elderly group . This is a transversal and observational study with approval from the institutios ethical committee (record n 216292011). The sample comprised adult and elderly individuals of both sexes who took part in university extension projects . The inclusion factors for subjects were non - institutionalized elderly with no history of neurological or cognitive alterations, who voluntarily accepted to take part in the research and signed the informed consent form (icf). Assessment procedures included a medical history prepared for this study; the abridged version of the geriatric depression scale (gds); and anterior functional reach test . The medical history assessment included questions on individuals socio - demographic and health (age, gender, presence of diseases, treatment used), as well as questions about their practice of physical exercises (frequency, time of practice, type of physical exercise). As for assessing the results of the geriatric depression scale, each answer indicating depression scored one point . Scores below five points indicated lack of depressive symptoms; 6 to 10 points indicated mild / moderate depressive symptoms; and 11 to 15 points meant severe depressive symptoms.24 for the functional range test was initially placed a tape measure on the wall, parallel to the floor, at the height of the acromion of each individual . The following were instructed to position themselves parallel to the wall, without lean on to it, with the parallels and bare feet in a comfortable position . The upper limb was positioned with bent shoulders at 90, extended elbows, wrists in a neutral, flat hand position . As a result, it was requested that incline forward as much as possible, hold for three seconds without taking the heels off the floor . Taking as the third metacarpal of the individual parameter was recorded in centimeters anterior displacement on the tape . Displacements smaller than 15.2 cm indicate the risk of falls four times higher compared to those who reached more than 25.4 cm, or is highly likely to falls . Measures between 15.2 and 25.4 cm has an average probability of falls (twice as likely to fall than those who reach values greater than 25.4 cm). Values greater than 25.4 cm indicate low probability of falls.25 the authors analyzed the data using descriptive statistics through measures of central tendency (mean and median) and variability (standard deviation and inner quartile ranges), as well as absolute and relative distribution (n -%). The symmetric continuous distribution was evaluated by the kolmogorov - smirnov test . For the bivariate analysis between qualitative variables, the authors used the pearson qui - square test () and continuity correction, which compares between observed (real) and expected frequencies . In contingency tables in which at least 25% of cell (quads) values presented expected frequency below five, they used fishes exact test . For continuous variables, when comparing two independent groups, the applied test was students t - test or, its non - parametric equivalent, the mann whitney test . Multivariate analysis was accomplished through non - conditional binary logistic regression, by employing regressive procedures to test the hypotheses of association between cognitive decline and co - variables defined by the bivariate analysis (p 0.250), by obtaining the adjusted odds ratio (or). Data received statistical treatment via spss 17.0 software (statistical package for social sciences for windows), adopting a significance level () of 5% for the decision - making criteria . The sample comprised of 90 individuals, aged 69.3 (6.8) in average, with minimum age of 59 years and maximum age of 84 years . The majority of investigated individuals was in the age group between 65 and 74 years (38.9%). Results presented as n (%), with percentage obtained as based on total valid cases;: nr = 5 (2.5%). The majority of individuals interviewed (65.8%) did not show depressive symptoms . Regarding the anterior functional reach test, the majority of evaluated individuals indeed showed low probability of fall occurrence, with an average score of 28.2 cm (sd = 9.2) points, varying from 0 to 44.5 cm (table 2). Results presented as n (%), with percentage obtained as based on total valid cases,: nr = 11 (12.2%);: nr = 8 (8.8%). In the analyses done on dizziness complaints, the authors verified a significant association with age group (p <0.05), with the elderly aged 75 years or more presenting a higher probability of feeling dizziness, whereas the group aged between 65 and 74 years, this association was not verified (table 3). Percentages obtained as based on total of each dizziness category;: pearson chi - square test with continuity correction;: t - student test for independent groups;: pearson chi - square test;: fisher's exact test through monte carlo simulation; * statistically significant test at 5%; * * statistically significant test at 1% . Moreover, it has been observed statistically significant association between the occurrence of dizziness and the presence of light / moderate depressive symptoms (p <0.01), as well as between the occurrence of dizziness and the average probability of falls (p <0.001). In terms of the association between the occurrence of dizziness and the results of the anterior functional reach test, the average in centimeters for the anterior reach (25.3 5.4) of elderly with dizziness showed to be significantly less when compared with the average of the group without dizziness complaints (30.1 10.6) (p <0.01). When comparing the occurrence of dizziness with gender, age, practice of physical exercise, and time of practice, we identified an independent relation, evidencing that dizziness is unrelated to any of these factors in the studied group . In the group of individuals that did not practice physical exercise, there was an association between the occurrence of dizziness and light / moderate depressive symptoms (p <0.001). However, in the same analysis done with the group that practiced some physical activity, the association between dizziness and depressive symptoms was not statistically significant (p> 0.05) (table 4). Another evaluation confirms the importance of physical exercise . Keeping the remaining variation factors not considered in the analysis (gender, age) constant, the group that practices physical exercise was less prone to dizziness and depressive symptoms (table 4). We looked for and identified the variables that could respond in a more trustworthy form to the occurrence of dizziness . We performed the logistic regression analysis with an adjustment to minimize the number of explanatory variables employed and maximize model precision, through the backward model, to maximize the explanatory power of the study factor . Through a model defined as saturated, we listed all variables with minimum significance level below 0.25 through bivariate analysis (table 3) as possible preceding factors for the presence of dizziness . They are the following: gender, age, age group, physical activity, gds score, dislocation in the anterior functional reach test, and balance . In this model, the variables for gender and age pointed out an independent relation to the occurrence of dizziness . According to the adjusted logistic regression model, the following were significant predictive factors for the occurrence of dizziness: non - practice of physical exercise, classifications of light / moderate depressive symptoms, and dislocation in the anterior functional reach test . Results described in table 5 show that the elderly who do not practice physical exercise have 2.2 times higher risk of presenting dizziness than the group that practices some physical exercise . In relation to depressive symptoms, the significant risk of presenting dizziness occurred in the light / moderate degree, indicating that the elderly included in this classification had 4.5 times more chance of presenting dizziness than the group with absence of depressive symptoms . Model parameters: pseudo - r = 0.432; -2 log likelihood = 80.208; hosmer and lemeshow (p = 0.998); pearson's chi - square (= 9272; p = 0.099); nagelkerke (r: 0.460); correct classification: 74.4% (dizziness: no = 78.7%; yes = 67.7%). As the number of elderly with severe depressive symptoms was very low, the light / moderate and serious groups were merged, by classifying the answer for symptoms as presence or absence . Over this new variable, we once more calculated the risk of presence of depressive symptoms associated to dizziness, estimated at 2.1 times that of the group with absence of this symptom . The results verified that the group with medium probability of falls as the result for the anterior functional reach test had 4.0 times more chances of occurrence of dizziness than the group with low probability of falls . When age was kept constant, results indicated that the non - practice of physical exercise, the presence of depressive symptoms, and the result of the anterior functional reach test (indicating medium probability of falls) are factors associated to the occurrence of dizziness in the investigated sample . In the sample of this study, more than 60% of the individuals affirmed to not practice physical exercise, confirming other similar studies . The ministry of health of brazil26 made a survey, and verified that 53.7% of elderly men and 58.3% of elderly women were inactive . Similar results were found in other study concerning the level of physical activity and its relationship with the environment (specifically, safety) with 1,656 elderly from florianpolis.27 by using similar parameters, pucci, reis, rech and hallal28 classified the majority of the individuals of their study as insufficiently active in leisure or walking activities . In this study, current studies highlight the prevalence of dizziness reports among the elderly population.29 30 31 32 approximately one in every five seniors currently presents dizziness or imbalance.29 in our research, 40% of the elderly reported sensation of dizziness . This finding is very similar to other studies done in brazil, in which the authors verified that the prevalence of dizziness in the elderly is substantial, having observed dizziness complaints from 45% of 391 elderly over 65 years of age interviewed.33 another study interviewed 516 elderly people, and confirmed self - reported dizziness in 42% of them.31 thus, dizziness is a common problem for the elderly population,11 34 35 as these individuals show a decrease in visual acuity during aging, and loss of balance due to the reduction of ciliated cells and vestibular neurons . This results in loss of functions from two important components responsible for keeping balance.36 furthermore, with age, the central nervous system capabilities become impaired, affecting the processing of vestibular, visual, and proprioceptive signals responsible for maintenance of body balance . Age also reduces capacity of modifications of the adaptive reflexes, may be responsible for the occurrence of vertigo and/or dizziness in the geriatric population.35 the data from the studied sample evidenced that 33.7% of the elderly presented depressive symptoms . This prevalence is higher than that described by other authors,37 who report prevalence of 26.7% of depressive symptoms in a sample of elderly people residing in an urban zone . In turn, study reported depressive symptoms in 31% of the elderly evaluated, by also using the gds scale in active elderly who were part of a conviviality group, i.e., a similar sample to the one evaluated in this study . Additionally, the cited authors verified that 4% of the evaluated elderly presented severe depressive symptoms, which was also similar to the obtained data.38 regarding anterior functional reach results, the average obtained was 28.2 9.2 cm . Results were higher than those observed by previous studies,39 40 and lower than those obtained by another study.41 values found were similar to those observed in brazil,42 which also evaluated a sample of adult and elderly people . The sample of elderly people in the age group between 70 and 87 years of age presented functional reach values between 29.75 (men) and 27.13 (women). Variations in the results of these studies can be explained through different factors, such as fall history, freight, strength, and flexibility of upper and lower limbs.42 this research verified a stronger presence of dizziness in the age group above 75 years (41.7%), a significant association (p = 0.028) when compared with remaining age groups . Such a finding is similar to that of the research with 1,273 elderly between 60 and 96 years of age, which verified reports of dizziness in 23.6% of all elderly evaluated . In this study, 17.8% of them were under 80 and 31% were over 80 years old.30 another longitudinal research with 620 elderly people verified that dizziness was a factor that depended on age, with prevalence of 27% in the elderly under 70, and over 54% in the group with 90 years of age or more . Among the elderly that mentioned dizziness, 68.2% perceived this symptom daily or weekly.43 the bigger prevalence of dizziness in the age group above 75 years of age could be due to the generalized deterioration of health in older people44 or multifactor conditions, both medical and functional.43 it is worth mentioning that the presence of dizziness is directly related to the presence of falls in the elderly population;30 both conditions are considered geriatric syndromes that occur concomitantly to other harms to multiple systems of the body.5 this worsens with age . The elderly who suffer falls can have fractures as a consequence, which might require longer periods in bed . Such condition is responsible for 70% of deaths resulting from accidents in individuals over 75 years in age.45 further to this, there was no significant difference when comparing the presence of dizziness complaints among the elderly who practiced physical exercise whith those who did not . These data were different from the expectations of the authors and the findings of ruwer et al,35 because, according to these authors, the complaint of dizziness is less prevalent in the elderly that practice physical exercise . Nevertheless, with the adjusted logistic regression, it is possible to verify that the individuals who do not practice physical exercise are 2.2 times more likely of feeling dizzy than physically active individuals are . This result confirms studies that compared elderly people with and without dizziness and observed that those without complaints of dizziness were engaged in physical activity.46 these authors also verified that there was a relation between dizziness and depression, which attest to the data from our study . The research verified a significant association between light to moderate depressive symptoms and 4.5-fold increase in the risk of feeling dizziness . Regarding the anterior functional reach test, this research verified a significant association between the probability of falls and reports of dizziness . The elderly with medium probability of falling are four times more likely to feel dizziness than the elderly with low probability of falls, as described in another study.47 the studies indicate that active elderly people are less prone to depression than the sedentary elderly.19 48 49 physical exercises help to reduce depression, aside from helping in its prevention . Physical activity relates to less frequent mood disorders and may even help release some neurotransmitters, such as noradrenalin and serotonin.50 51 studies indicate that elderly people who practice regular physical activity mention less depressive symptoms than non - active or sedentary elderly people . Analysis of social skills, social support, life quality and depression of elderly people in an extension project, family contexts and asylums indicated that the depressive symptom was present in 0% of practicing elderly people compare to 30% of the elderly who did not participate in the project . In the asylum, in turn, this percentage increased 40%.52 in other study about the intensity and prevalence of depressive symptoms in elderly women participating in an extension project, it was verified an absence of depressive symptoms in 80.6% of the sample.53 another study evaluated the effect of a program of aerobic physical exercise in the intensity of the ventilator threshold over depression and anxiety and life quality of healthy elderly people divided into a control and a experimental group . The elderly in the experimental group had a reduction in the scores of depression and anxiety and an increase in life quality, while in the control group no changes were observed.51 in the research on the freight of falling and its relation with balance and mobility tests, there was a moderate correlation.40 authors state that balance and mobility enable the stability necessary to maintain a standing position, for instance . Therefore, maintaining adequate levels of such capabilities reduces the risk of falls, which are directly related to level of physical activity . The american college of sports medicine54 mentions that the level of physical activity is inversely related to the number of limitations in the elderly . Brazilian authors analyzed the relation between health conditions, incidence of falls, and level of physical activity in 256 elderly people . Results indicated an association between the level of physical activity and the incidence of falls and health conditions . In other words, the more frequent the practice of physical activity the less the occurrence of falls . Muscular weakness, reduction in articular mobility, degraded synergy, programming mechanisms, and motor control difficulties are the variables present in low levels of physical activity, predisposing to falls in the elderly.55 the results of this study indicated the existence of an association between the practice of physical exercise, dizziness, probability of falls, and depressive symptoms in a group of non - institutionalized middle aged adults and elderly people, evidencing that physical activity is a beneficial factor for the aging population.
We measured the differences in stiffness between extrafloral nectaries of v. faba and the tissue that surrounds them . We mounted 20 stipules from 20, 18-day - old plants on adhesive tape that was attached (sticky side up) to the surface of a piece of flat styrofoam . We did a penetrometer test to measure the initial modulus of rigidity of the spot being tested, using a texture analyzer (ta.xt2i, stable micro systems, surrey, uk) fitted with a 10 stainless steel cone moving at 0.5 mm / s . In each stipule, one measurement was done in the center of the extrafloral nectary and 3 measurements were done in random locations on the stipule . For each stipule, an average stipule stiffness was calculated from these 3 measurements and this value was compared with the measured stiffness of the extrafloral nectary on that stipule.
Health systems based on primary health care (phc) distribute health care more equitably, are more cost effective and have better overall health outcomes and impact than health systems based on specialist care (1). This is the foundation of the health for all concept of alma - ata, adopted by the world health organization (who) in 1978 (2) and reiterated in the world health report 2008 (3). Worldwide, authorities have recognized that the health and well - being of a population is highly dependent on a quality phc system that is equitable, easily accessible and affordable for all members of the community (4) and that emphasizes universal coverage (5). The concept of the postgraduate - trained family physician qualified to deliver equitable, high - quality phc closer to the community is now accepted in many countries around the world . However, in sub - saharan africa, family medicine is still a relatively new concept . In this article, we analyse the development of family medicine in anglophone sub - saharan africa in the recent years based on the experiences of the primafamed (primary health care and family medicine education) project (6). Lower - resource countries in sub - saharan africa face enormous health challenges and pervasive poverty . Despite the work of governments and nongovernmental organizations (ngos), the majority of people still do not have easy access to affordable quality health care . The inverse care law (7), noting that the fewest health - care professionals are found where they are needed the most and vice versa, is still very much applicable in most african countries . The poor are not only more prone to illnesses but are also unable to cope with diseases because health care is hard to access . With continuous population growth and a rather slow economic development, the number of people living in poverty in sub - saharan africa has also increased, with 20.6% living on less than us$1.25 a day in 2008 (8). It is the first level of contact of a continuing health - care process bringing health care as close as possible to where people live and work (9). Phc responds to the immense challenges that african countries are facing in their health systems by providing accessible, high - quality services that offer comprehensive and continuous care (preventive, curative, rehabilitative and palliative) at the local level, through interdisciplinary teams integrating vertical disease - oriented programmes . Family physicians together with phc nurses (and in some countries, mid - level care workers) act as the clinical practitioners of the phc team . In 2009, the 62nd world health assembly urged its member states to train and retain adequate numbers of health workers, including family physicians, and to encourage the implementation of vertical programmes in the context of integrated phc (10). In 1968, the university of pretoria was the first university in south africa to start training specialized phc physicians, now referred to as african family physicians (11). This was followed by the other seven health science faculties in south africa . In 1997, these eight departments of family medicine formed a network for communication and consultation, famec (family medicine educational consortium), to share and exchange expertise, form a core curriculum and standardize examinations and develop appropriate assessment systems (12). In august 2007, the concept of the african family physician in other anglophone african countries is even more recent . Only in the 21st century did universities in anglophone countries in sub - saharan africa start family medicine training programmes, and the recently graduated african family physicians are beginning to find their place in the health systems of their respective countries . Family medicine departments are struggling for recognition as health systems are still dominated by centralized specialist services and vertical disease - oriented approaches . Several countries, such as namibia and botswana, did not have medical schools until very recently (14). Furthermore, many countries, such as the democratic republic of congo (dr congo), are emerging from conflict and need to rebuild both state and infrastructure . At the wonca (world organisation of family doctors) africa conference in 2009, this consensus statement defined the contribution of family medicine to equity, quality and phc within an african context, as well as the role and training requirements of the african family physician (15). Due to the low number of trained doctors per capita and the high burden of disease, african family physicians work in their specific context, mainly in district hospitals with outreach to health centres, in phc teams that address the problems of the community in a comprehensive, holistic and patient - centred way whereby specific skills like surgery and district management often are essential due to the lack of other specialists . The consensus illustrates the ownership of the development of family medicine by african universities, one of the key points from the paris declaration (2005) and the accra agenda for action (2008) (16). Lower - resource countries in sub - saharan africa face enormous health challenges and pervasive poverty . Despite the work of governments and nongovernmental organizations (ngos), the majority of people still do not have easy access to affordable quality health care . The inverse care law (7), noting that the fewest health - care professionals are found where they are needed the most and vice versa, is still very much applicable in most african countries . The poor are not only more prone to illnesses but are also unable to cope with diseases because health care is hard to access . With continuous population growth and a rather slow economic development, the number of people living in poverty in sub - saharan africa has also increased, with 20.6% living on less than us$1.25 a day in 2008 (8). It is the first level of contact of a continuing health - care process bringing health care as close as possible to where people live and work (9). Phc responds to the immense challenges that african countries are facing in their health systems by providing accessible, high - quality services that offer comprehensive and continuous care (preventive, curative, rehabilitative and palliative) at the local level, through interdisciplinary teams integrating vertical disease - oriented programmes . Family physicians together with phc nurses (and in some countries, mid - level care workers) act as the clinical practitioners of the phc team . In 2009, the 62nd world health assembly urged its member states to train and retain adequate numbers of health workers, including family physicians, and to encourage the implementation of vertical programmes in the context of integrated phc (10). In 1968, the university of pretoria was the first university in south africa to start training specialized phc physicians, now referred to as african family physicians (11). This was followed by the other seven health science faculties in south africa . In 1997, these eight departments of family medicine formed a network for communication and consultation, famec (family medicine educational consortium), to share and exchange expertise, form a core curriculum and standardize examinations and develop appropriate assessment systems (12). In august 2007, the concept of the african family physician in other anglophone african countries is even more recent . Only in the 21st century did universities in anglophone countries in sub - saharan africa start family medicine training programmes, and the recently graduated african family physicians are beginning to find their place in the health systems of their respective countries . Family medicine departments are struggling for recognition as health systems are still dominated by centralized specialist services and vertical disease - oriented approaches . Several countries, such as namibia and botswana, did not have medical schools until very recently (14). Furthermore, many countries, such as the democratic republic of congo (dr congo), are emerging from conflict and need to rebuild both state and infrastructure . At the wonca (world organisation of family doctors) africa conference in 2009, this consensus statement defined the contribution of family medicine to equity, quality and phc within an african context, as well as the role and training requirements of the african family physician (15). Due to the low number of trained doctors per capita and the high burden of disease, african family physicians work in their specific context, mainly in district hospitals with outreach to health centres, in phc teams that address the problems of the community in a comprehensive, holistic and patient - centred way whereby specific skills like surgery and district management often are essential due to the lack of other specialists . The consensus illustrates the ownership of the development of family medicine by african universities, one of the key points from the paris declaration (2005) and the accra agenda for action (2008) (16). The aim of this article is to explore the extent to which the primafamed south south cooperative project contributed to the development of family medicine in sub - saharan africa . The specific objectives are the following: the implementation of the primafamed project; the outcomes of the primafamed project; the development of family medicine training in sub - saharan africa from the viewpoint of the primafamed partners . A process analysis of the primafamed project between 2008 and 2011 is presented to discuss the implementation of the programme and the development of the network of 10 universities and associated partners in anglophone sub - saharan africa . Finally, a swot analysis is detailed to explore the positive and negative dynamics that partners faced during the project . In 2007, a call for proposals under the name edulink was launched by the secretariat of the african, caribbean and pacific (acp) group of states (17). Together with 10 universities in eight countries in sub - saharan africa (sudan, ghana, nigeria, dr congo, rwanda, uganda, kenya and tanzania), figure 1, the department of family medicine and phc at ghent university in belgium developed the primafamed project proposal with a focus on developing family medicine training in sub - saharan africa . The aim of the primafamed project was to establish an institutional network between new and established departments of family medicine in universities in sub - saharan africa, within a framework of south south cooperation (18). The who world health report 2006, working together for health, emphasized the need for phc training in the local community in order to deal with the brain drain from acp states (19). Training medical doctors in the field of family medicine, thus providing phc at the district level, responds to this call . The objectives of the primafamed project were formulated as follows: 1 . To contribute to the health of communities through accessible, responsive and quality health systems in sub - saharan countries by educating and training family physicians who provide interdisciplinary phc services, oriented towards the needs of individuals, their families and the communities in which they live develop and strengthen academic departments or units of family medicine that offer family medicine training at the undergraduate and postgraduate levels . The specific objectives were as follows: 1 . To develop a comprehensive vision and strategy, within the specific context of sub - saharan countries, that delineates the integral contribution of family medicine and the phc team to an equitable and quality phc system; 2 . To establish a specific institutional network between departments and units of family medicine . The expected results of the primafamed project were the following: 1 . An improved institutional and administrative functioning in terms of policy, management, planning and administrative capacity building of the participating departments and units of family medicine . 2 . Improved relevance of family medicine in undergraduate and postgraduate training in the regional context . The partnering universities in the primafamed project were university of goma (dr congo), moi university (kenya), national university of rwanda, aga khan university (tanzania), university of lagos (nigeria), makerere university (uganda), mbarara university (uganda), ahfad university for women (sudan), gezira university (sudan) and university of ghana . The south south network connecting these 10 universities worked together with the eight departments of family medicine in south africa and accordingly formed a forum to share knowledge, experiences and resources . Each of the 10 partner universities hired a local coordinator to oversee the implementation of the project, coordinate the activities and actively communicate with all partners . Partners worked independently, integrating the primafamed objectives and the output for the project into the already existing structures and work plan at their universities . Because african family physicians work mainly in district hospitals with outreach to the health centres, the primafamed project consequently stimulated all partners to develop training complexes (mainly district hospitals, several of which are located in rural areas) for family medicine residents and to support the supply of these training complexes with the needed equipment . To further strengthen family medicine residents education, training sessions by professors from south african universities and other associated primafamed partners were held . A yearly conference for partners, associates and stakeholders was organized with the goal of offering trainings, sharing ideas and experiences, and strengthening the network . At the 2008 conference in kampala, the african journal of primary health care and family medicine (20) this new open - access online journal has since published various articles related to the development of family medicine on the african continent, and researchers in the field of phc have written numerous articles on operational research and community - oriented primary care (copc) projects (21). To monitor and evaluate our project, this four - level scale shows the progress that took place during the 2.5-year period in which primafamed supported the partners . The first level corresponds to the institution being at a preparatory stage in the development of a postgraduate family medicine training programme . The fourth level reflects that the institution has started a postgraduate family medicine training programme with an existing curriculum by an organized department at well - organized training complexes and, most importantly, that family medicine has been accepted by the ministry of health as a specialization and that graduated family physicians are integrated into the existing health system . Undeniably, the fourth level is not the end stage because, in our opinion, the ultimate objective would be to have an equitable and high - quality phc system with a central role for family physicians . Department / unit of family medicine exists or is part of other departments (community medicine) training complexes are under development family medicine is part of undergraduate training postgraduate training has started department / unit of family medicine exists training complexes are in place postgraduate training has started the ministry of health has accepted family medicine as a specialization and graduated family physicians are part of the health - care system adopted from the primafamed edulink acp eu project . All 10 primafamed partners made progress during the 2.5 years that the project provided funding and support (table 1). At the start of the project, all of them had a unit or department of family medicine under development or in place, yet only three had officially started postgraduate family medicine training . At the end of the project, eight had started postgraduate training, with family medicine residents located in properly equipped training hospitals . Progress scale for development of the primafamed partners adopted from the primafamed edulink acp eu project . The integration of family medicine into the local health systems has been a slower process . In many countries, policymakers have adopted a somewhat conservative attitude, with health systems mainly based on hospital / specialist care and on vertical programmes, which are often stimulated by donor programmes . A critical mass of well - trained family physicians is needed to demonstrate the effectiveness of family medicine training programmes . Because all but one partner universities train only a limited number of family medicine residents simultaneously due to limited capacity, reaching that critical mass takes time . However, as the example of gezira university (sudan) has shown, it is possible to create a large pool of well - trained family physicians who can make a difference, in a short time . In this particular situation, because there was a vital need, policymakers and local authorities worked closely together with gezira university in development of the training (example 1). In 2012, african family physicians came together at the wonca africa conference and the primafamed network workshop in victoria falls, zimbabwe, and reaffirmed the importance of reaching that critical mass and therefore scaling up of family medicine, particularly in the african context, in which poverty is very prevalent, where rural urban gaps remain, and where many of the millennium development goals (mdgs) will not be reached, including those related to child survival, maternal death and accessibility to antiretroviral drugs (22). In 2010, all primafamed local coordinators contributed to a swot (strengths, weaknesses, opportunities and threats) analysis on the development of family medicine training programmes and of family medicine as a new discipline within the health systems of their countries (box 3). The main findings are presented and categorized into the following levels: local / university level, national level, regional / african level and international level . Strong partnerships and collaboration with universities and professional bodies abroad is present the south african departments of family medicine have substantial experience in the family medicine training programmes: they can assist in training via south south cooperation and these cooperative steps can be seen as exemplary models and good practices the primafamed project and edulink acp - eu funding strengthens the development of family medicine training and is seen as the motor for the family medicine training development individuals working in the family medicine departments are very motivated, proactive and willing to advocate for the cause family physicians working as faculty are highly experienced and well qualified the chosen district hospitals and health centres are ready for the training programmes in several of the countries (sudan, kenya and ghana), a high commitment from the ministry of health, the national council and leaders is existing family medicine is responsive to the needs of the communities, especially in the rural areas where the majority of africans live family medicine is not yet part of undergraduate medical training, therefore medical students are not exposed to the concept of family medicine and its principles poor quality of intake and recruitment of family medicine residents for the family medicine training the lack of family physicians and local teachers . Many of the departments of family medicine depend on family physicians coming from non - african countries (mainly, western europe and united states) due to work overload, family medicine residents are continuously working in the hospital setting and have insufficient time to focus on the training in other aspects of family medicine, such as disease prevention and health promotion, community medicine, outpatient / continuity of care and research the existing health systems are still weak in several countries; plagued by poor support, weak referral systems, poor communication, poor funding and poor coordination between health centres, district hospitals and referral hospitals dropping out of family medicine residents during the training sometimes happens in countries like dr congo because family medicine residents lose faith in their career opportunities there is a lack of didactic materials capacity is still too limited there is a lack of awareness and knowledge of family medicine by medical graduates, specialists and the community there is lack of adequate infrastructure in some countries, such as dr congo and ghana there is poor communication with policymakers and little support from the government in countries like tanzania and rwanda standardization of training and examinations between faculties and countries is presently not existing, although there is a strong need for accreditation and quality assurance there is insufficient financial support for the family medicine residents in postgraduate training the position of family physicians in the different health systems is unclear (what is the career perspective of graduated family physicians?) There is international support for the concept of family medicine: in the world health report 2008 primary health care: now more than ever, the who advocated for the importance of moving health care out of tertiary hospitals into the community and from vertical to horizontal care, in order to respond to the needs of the community family medicine training is growing in the whole african continent, and there is support in the surrounding countries . The primafamed project has been linking these different countries, in order to fight for the cause together existing health systems in several countries are weak (poor coordination, poor referral systems, poor communication and little funding). Family medicine can be used as a technique to strengthen these health systems internet connection is present in several of the training centres (and this is rapidly expanding); e - learning is a very useful didactic tool for the family medicine residents a yearly conference is organized by the primafamed network to strengthen the network and to share ideas and exchange experiences wonca africa is organizing three yearly conferences and has been expanding in terms of number of members in the recent years there are many existing links with organizations and universities in the north for financial and didactic support iucea and wacp can assist in accreditation and quality assurance several very useful books on african family medicine have been published recently and can be used as training material the new african journal of primary health care and family medicine gives more opportunities for registrars to publish research health - care workers and policymakers are becoming increasingly aware of the importance of the basic principles of phc and family medicine such as patient - centred care, non - communicable diseases (ncds), interdisciplinary care, and continuity of care many african ministries of health are working on health - system reforms research in the field of family medicine is done by the registrars during the training the primafamed network has been looking into expanding to francophone africa: mali and benin will participate in a vlir uos funded project starting 2012, and the african journal of primary health care and family medicine will be published in english and french from 2012 onwards other specialities see family medicine as a threat family medicine is a new concept and not yet part of the health system in most of the partnering countries overload of work for doctors leads to little time for training lack of career opportunities for family medicine physicians in countries where family medicine is not supported by the government there is little or no funding for family medicine within the existing systems substantial decrease in funding for further development of the family medicine training after ending of the primafamed project funding from edulink acp - eu migration of graduates to private practice, ngos, management positions or public health (internal brain drain) or migration of graduates to other countries (external brain drain) war and political instability (e.g. Dr congo, sudan and nigeria); in some countries, there is a high turnover of government and with this, there often is a change of policies increasing commercialization and privatization of health - care provision worldwide economic crisis, which is decreasing the funding for health care and is putting health systems under pressure fragmentation of care through vertical disease - oriented programmes, not only for infectious diseases, but increasingly for ncds (23). I. when the swot analysis was done in 2010, the rwandan ministry of health was supportive of the new discipline and family medicine was accepted by the government as one of the specialist mmed trainings from the national university of rwanda . However, at the time of writing this article, the ministry of health in rwanda has changed its vision and family medicine is not seen as a priority . Recently west african college of physicians v. especially in sudan, this is a problem as a large percentage of medical graduates move to saudi arabia for more job opportunities, better salaries or family reasons adopted from the primafamed edulink acp eu project at the local / university level, the availability of resources plays an important role . From a human resources perspective, family physicians (in most cases from abroad) are needed to form the faculty, train family medicine residents and develop teaching materials . Other local professors and specialists willing to train family medicine residents in the different disciplines are important to the strengthening of both the training and the interdisciplinary network; however, several partners noted a low level of support from other specialists because family medicine is often not well understood and is often seen as a threat . Adequate motivation of faculty and family medicine residents is important and is influenced by many other factors such as financial backing, career opportunities and support at the local, national and international levels . The availability of training sites, especially at district hospitals and health centres, is crucial, including having access to physicians to train and mentor the family medicine residents and stimulating teamwork with other health - care workers such as the local nurses . Well - written curricula (often developed based on sample curricula from family medicine training programmes in other african universities) and training materials are essential to create a high - quality training atmosphere . Access to the internet and to didactic materials and equipment (such an ultrasound machines or health education materials) are important to strengthen the actual training . Lack of diagnostic or therapeutic equipments or insufficient availability of essential drugs in the training hospitals influences the way the doctors learn and hinders implementation of evidence - based medicine . Ensuring that there is a place for family medicine training in undergraduate curricula plays a crucial role in raising awareness and recruiting newly trained medical doctors . At the national level, policymakers play a pivotal role . In several countries, decision - makers accept family medicine as an official specialization that is starting to take its place in the health - care system, with kenya, sudan and ghana as examples (see examples 1, 2 and 3). Several other countries have had more difficulties with the ministry of health accepting family medicine, including tanzania and rwanda . Research on the positive outcomes of family medicine on health - care provision plays a significant role in advocating and strengthening awareness . A negative factor at the national level is political instability and war, as seen in eastern congo . At the regional / african level, the importance of strong partnerships and collaboration with universities and professional bodies abroad is noted . South african universities have excellent curricula and knowledgeable professors with extensive experience that can be leveraged via south south cooperation . Moreover, conferences organized by primafamed and wonca africa support the development of african family medicine . The establishment of the african journal of primary health care and family medicine is a great opportunity for young researchers to learn from others work and to publish their own articles . At the international level, secondly, global recognition of the importance of training health - care workers in phc (world health report 2006 and 2008) is vital to the development of african family medicine . In 2007, a call for proposals under the name edulink was launched by the secretariat of the african, caribbean and pacific (acp) group of states (17). Together with 10 universities in eight countries in sub - saharan africa (sudan, ghana, nigeria, dr congo, rwanda, uganda, kenya and tanzania), figure 1, the department of family medicine and phc at ghent university in belgium developed the primafamed project proposal with a focus on developing family medicine training in sub - saharan africa . The aim of the primafamed project was to establish an institutional network between new and established departments of family medicine in universities in sub - saharan africa, within a framework of south south cooperation (18). The who world health report 2006, working together for health, emphasized the need for phc training in the local community in order to deal with the brain drain from acp states (19). Training medical doctors in the field of family medicine, thus providing phc at the district level, responds to this call . The objectives of the primafamed project were formulated as follows: 1 . To contribute to the health of communities through accessible, responsive and quality health systems in sub - saharan countries by educating and training family physicians who provide interdisciplinary phc services, oriented towards the needs of individuals, their families and the communities in which they live . Develop and strengthen academic departments or units of family medicine that offer family medicine training at the undergraduate and postgraduate levels . The specific objectives were as follows: 1 . To develop a comprehensive vision and strategy, within the specific context of sub - saharan countries, that delineates the integral contribution of family medicine and the phc team to an equitable and quality phc system; 2 . To establish a specific institutional network between departments and units of family medicine . An improved institutional and administrative functioning in terms of policy, management, planning and administrative capacity building of the participating departments and units of family medicine . 2 . Improved relevance of family medicine in undergraduate and postgraduate training in the regional context . The partnering universities in the primafamed project were university of goma (dr congo), moi university (kenya), national university of rwanda, aga khan university (tanzania), university of lagos (nigeria), makerere university (uganda), mbarara university (uganda), ahfad university for women (sudan), gezira university (sudan) and university of ghana . The south south network connecting these 10 universities worked together with the eight departments of family medicine in south africa and accordingly formed a forum to share knowledge, experiences and resources . Each of the 10 partner universities hired a local coordinator to oversee the implementation of the project, coordinate the activities and actively communicate with all partners . Partners worked independently, integrating the primafamed objectives and the output for the project into the already existing structures and work plan at their universities . Because african family physicians work mainly in district hospitals with outreach to the health centres, the primafamed project consequently stimulated all partners to develop training complexes (mainly district hospitals, several of which are located in rural areas) for family medicine residents and to support the supply of these training complexes with the needed equipment . To further strengthen family medicine residents education, training sessions by professors from south african universities and other associated primafamed partners were held . A yearly conference for partners, associates and stakeholders was organized with the goal of offering trainings, sharing ideas and experiences, and strengthening the network . At the 2008 conference in kampala, the african journal of primary health care and family medicine (20) this new open - access online journal has since published various articles related to the development of family medicine on the african continent, and researchers in the field of phc have written numerous articles on operational research and community - oriented primary care (copc) projects (21). To monitor and evaluate our project, this four - level scale shows the progress that took place during the 2.5-year period in which primafamed supported the partners . The first level corresponds to the institution being at a preparatory stage in the development of a postgraduate family medicine training programme . The fourth level reflects that the institution has started a postgraduate family medicine training programme with an existing curriculum by an organized department at well - organized training complexes and, most importantly, that family medicine has been accepted by the ministry of health as a specialization and that graduated family physicians are integrated into the existing health system . Undeniably, the fourth level is not the end stage because, in our opinion, the ultimate objective would be to have an equitable and high - quality phc system with a central role for family physicians . Department / unit of family medicine exists or is part of other departments (community medicine) training complexes are under development family medicine is part of undergraduate training department / unit of family medicine exists training complexes are in place postgraduate training has started department / unit of family medicine exists training complexes are in place postgraduate training has started the ministry of health has accepted family medicine as a specialization and graduated family physicians are part of the health - care system adopted from the primafamed edulink acp eu project . All 10 primafamed partners made progress during the 2.5 years that the project provided funding and support (table 1). At the start of the project, all of them had a unit or department of family medicine under development or in place, yet only three had officially started postgraduate family medicine training . At the end of the project, eight had started postgraduate training, with family medicine residents located in properly equipped training hospitals . Progress scale for development of the primafamed partners adopted from the primafamed edulink acp eu project . The integration of family medicine into the local health systems has been a slower process . In many countries, policymakers have adopted a somewhat conservative attitude, with health systems mainly based on hospital / specialist care and on vertical programmes, which are often stimulated by donor programmes . A critical mass of well - trained family physicians is needed to demonstrate the effectiveness of family medicine training programmes . Because all but one partner universities train only a limited number of family medicine residents simultaneously due to limited capacity, reaching that critical mass takes time . However, as the example of gezira university (sudan) has shown, it is possible to create a large pool of well - trained family physicians who can make a difference, in a short time . In this particular situation, because there was a vital need, policymakers and local authorities worked closely together with gezira university in development of the training (example 1). In 2012, african family physicians came together at the wonca africa conference and the primafamed network workshop in victoria falls, zimbabwe, and reaffirmed the importance of reaching that critical mass and therefore scaling up of family medicine, particularly in the african context, in which poverty is very prevalent, where rural urban gaps remain, and where many of the millennium development goals (mdgs) will not be reached, including those related to child survival, maternal death and accessibility to antiretroviral drugs (22). In 2010, all primafamed local coordinators contributed to a swot (strengths, weaknesses, opportunities and threats) analysis on the development of family medicine training programmes and of family medicine as a new discipline within the health systems of their countries (box 3). The main findings are presented and categorized into the following levels: local / university level, national level, regional / african level and international level . Strong partnerships and collaboration with universities and professional bodies abroad is present the south african departments of family medicine have substantial experience in the family medicine training programmes: they can assist in training via south south cooperation and these cooperative steps can be seen as exemplary models and good practices the primafamed project and edulink acp - eu funding strengthens the development of family medicine training and is seen as the motor for the family medicine training development individuals working in the family medicine departments are very motivated, proactive and willing to advocate for the cause family physicians working as faculty are highly experienced and well qualified the chosen district hospitals and health centres are ready for the training programmes in several of the countries (sudan, kenya and ghana), a high commitment from the ministry of health, the national council and leaders is existing family medicine is responsive to the needs of the communities, especially in the rural areas where the majority of africans live family medicine is not yet part of undergraduate medical training, therefore medical students are not exposed to the concept of family medicine and its principles poor quality of intake and recruitment of family medicine residents for the family medicine training the lack of family physicians and local teachers . Many of the departments of family medicine depend on family physicians coming from non - african countries (mainly, western europe and united states) due to work overload, family medicine residents are continuously working in the hospital setting and have insufficient time to focus on the training in other aspects of family medicine, such as disease prevention and health promotion, community medicine, outpatient / continuity of care and research the existing health systems are still weak in several countries; plagued by poor support, weak referral systems, poor communication, poor funding and poor coordination between health centres, district hospitals and referral hospitals dropping out of family medicine residents during the training sometimes happens in countries like dr congo because family medicine residents lose faith in their career opportunities there is poor guidance for the present faculty there is a lack of awareness and knowledge of family medicine by medical graduates, specialists and the community there is lack of adequate infrastructure in some countries, such as dr congo and ghana there is poor communication with policymakers and little support from the government in countries like tanzania and rwanda standardization of training and examinations between faculties and countries is presently not existing, although there is a strong need for accreditation and quality assurance there is insufficient financial support for the family medicine residents in postgraduate training the position of family physicians in the different health systems is unclear (what is the career perspective of graduated family physicians?) There is international support for the concept of family medicine: in the world health report 2008 primary health care: now more than ever, the who advocated for the importance of moving health care out of tertiary hospitals into the community and from vertical to horizontal care, in order to respond to the needs of the community family medicine training is growing in the whole african continent, and there is support in the surrounding countries . The primafamed project has been linking these different countries, in order to fight for the cause together existing health systems in several countries are weak (poor coordination, poor referral systems, poor communication and little funding). Family medicine can be used as a technique to strengthen these health systems internet connection is present in several of the training centres (and this is rapidly expanding); e - learning is a very useful didactic tool for the family medicine residents a yearly conference is organized by the primafamed network to strengthen the network and to share ideas and exchange experiences wonca africa is organizing three yearly conferences and has been expanding in terms of number of members in the recent years there are many existing links with organizations and universities in the north for financial and didactic support iucea and wacp can assist in accreditation and quality assurance several very useful books on african family medicine have been published recently and can be used as training material the new african journal of primary health care and family medicine gives more opportunities for registrars to publish research health - care workers and policymakers are becoming increasingly aware of the importance of the basic principles of phc and family medicine such as patient - centred care, non - communicable diseases (ncds), interdisciplinary care, and continuity of care many african ministries of health are working on health - system reforms research in the field of family medicine is done by the registrars during the training the primafamed network has been looking into expanding to francophone africa: mali and benin will participate in a vlir uos funded project starting 2012, and the african journal of primary health care and family medicine will be published in english and french from 2012 onwards other specialities see family medicine as a threat family medicine is a new concept and not yet part of the health system in most of the partnering countries overload of work for doctors leads to little time for training lack of career opportunities for family medicine physicians in countries where family medicine is not supported by the government there is little or no funding for family medicine within the existing systems substantial decrease in funding for further development of the family medicine training after ending of the primafamed project funding from edulink acp - eu migration of graduates to private practice, ngos, management positions or public health (internal brain drain) or migration of graduates to other countries (external brain drain) war and political instability (e.g. Dr congo, sudan and nigeria); in some countries, there is a high turnover of government and with this, there often is a change of policies increasing commercialization and privatization of health - care provision worldwide economic crisis, which is decreasing the funding for health care and is putting health systems under pressure fragmentation of care through vertical disease - oriented programmes, not only for infectious diseases, but increasingly for ncds (23). I. when the swot analysis was done in 2010, the rwandan ministry of health was supportive of the new discipline and family medicine was accepted by the government as one of the specialist mmed trainings from the national university of rwanda . However, at the time of writing this article, the ministry of health in rwanda has changed its vision and family medicine is not seen as a priority . West african college of physicians v. especially in sudan, this is a problem as a large percentage of medical graduates move to saudi arabia for more job opportunities, better salaries or family reasons adopted from the primafamed edulink acp eu project at the local / university level, the availability of resources plays an important role . From a human resources perspective, family physicians (in most cases from abroad) are needed to form the faculty, train family medicine residents and develop teaching materials . Other local professors and specialists willing to train family medicine residents in the different disciplines are important to the strengthening of both the training and the interdisciplinary network; however, several partners noted a low level of support from other specialists because family medicine is often not well understood and is often seen as a threat . Adequate motivation of faculty and family medicine residents is important and is influenced by many other factors such as financial backing, career opportunities and support at the local, national and international levels . The availability of training sites, especially at district hospitals and health centres, is crucial, including having access to physicians to train and mentor the family medicine residents and stimulating teamwork with other health - care workers such as the local nurses . Well - written curricula (often developed based on sample curricula from family medicine training programmes in other african universities) and training materials are essential to create a high - quality training atmosphere . Access to the internet and to didactic materials and equipment (such an ultrasound machines or health education materials) are important to strengthen the actual training . Lack of diagnostic or therapeutic equipments or insufficient availability of essential drugs in the training hospitals influences the way the doctors learn and hinders implementation of evidence - based medicine . Ensuring that there is a place for family medicine training in undergraduate curricula plays a crucial role in raising awareness and recruiting newly trained medical doctors . At the national level decision - makers accept family medicine as an official specialization that is starting to take its place in the health - care system, with kenya, sudan and ghana as examples (see examples 1, 2 and 3). Several other countries have had more difficulties with the ministry of health accepting family medicine, including tanzania and rwanda . Research on the positive outcomes of family medicine on health - care provision plays a significant role in advocating and strengthening awareness . A negative factor at the national level is political instability and war, as seen in eastern congo . At the regional / african level, the importance of strong partnerships and collaboration with universities and professional bodies abroad is noted . South african universities have excellent curricula and knowledgeable professors with extensive experience that can be leveraged via south south cooperation . Moreover, conferences organized by primafamed and wonca africa support the development of african family medicine . The establishment of the african journal of primary health care and family medicine is a great opportunity for young researchers to learn from others work and to publish their own articles . At the international level, secondly, global recognition of the importance of training health - care workers in phc (world health report 2006 and 2008) is vital to the development of african family medicine . Inverse care law through achieving universal coverage and by providing equitable and high - quality health care through well - trained health - care workers to every individual . Training doctors who work closer to communities, where they are most needed, is an important step towards improving the health outcomes of the african population . However, developing a new discipline that has not yet been defined in the national health systems is a challenging task . The primafamed project showed that developing sustainable family medicine training programmes is a feasible but slow process with many obstacles . The south south cooperation between the primafamed partners and the south african family medicine departments strengthened confidence in the project and reinforced the principal need for well - trained african family physicians . Local ownership is of utmost importance, although, with no local family physicians as role models, this can be a difficult task . Support from key figures at the level of policymakers and academicians is necessary to create this new discipline and give it a place in health systems . Without the integration of family medicine into national health policy, it is very difficult to recruit new doctors for the training programmes because the uncertainty in career prospects negatively influences a potential candidate s decision to join these programmes . Continuous advocacy for the discipline and for strengthening the role of the african family physician are crucial . Exposure to family medicine and community health in the undergraduate medical curriculum is required to create awareness among new medical doctors . Action research, such as copc (24), in the african setting is needed to demonstrate significant outcomes and the positive influence of the discipline at the individual, community and national levels . Recruitment, training and retention of doctors in family medicine need to be adopted in the health system of each of the african countries . This requires increased investment of resources in phc, both from governments and from donor organizations . The primafamed network that was created during the 200810 project continues to endeavour to make these action points a reality . In november 2012, during the wonca africa conference, representatives from many african family medicine departments came together and discussed steps forward in creating a strong family medicine and phc - oriented health - care system in various african countries . This led to the statement of the primafamed network: scaling up family medicine and primary health care in africa. Concrete action for scaling up is needed, including convincing ministries and leadership of medical schools to integrate family medicine and phc into the undergraduate curriculum and to train a significant proportion of medical school graduates (between 40% and 60%) in family medicine and phc . Essential conditions include having accredited under- and postgraduate curricula; well - equipped training centres for transformative learning with well - trained trainers; national and international support networks; a sufficient number of funded posts for family medicine residents / registrars with appropriate remuneration; and continuous advocacy at the population and government levels (25). Continuous interaction with key players at the policymaking level and support from the government are necessary to scale up family medicine and to develop it into an essential part of the health - care systems, in order to provide equitable, high - quality health care for communities and, ultimately, to improve overall health in sub - saharan africa . Gezira university is a public university based in central sudan, in the city of wad madani . In many health centres, community physicians and medical officers were in charge of patient care . Together with policymakers, district health officers and representatives from the ministry of health identified the need for further training for medical doctors in primary health care . Gezira university decided to develop a 1-year diploma and a 2-year in - service master of science (msc) in family medicine . Both are accepted by the sudan national medical specialisation board . With the help of the primafamed project, a coordinator for this development was financed, a curriculum was developed and training sites were identified and equipped with the needed material . In 200910, the first 10 medical doctors were trained in the 1-year course . In 2010, 120 candidates were selected for the 2-year in - service msc in family medicine . In the fall of 2012, these 120 sudanese family physicians graduated with comprehensive knowledge in district primary health care . In 2013, 200 new candidates were selected . The university of gezira can be seen as a perfect example of how working together with policymakers is essential for the development of family medicine . In 2005, moi university started the first family medicine training programme in anglophone eastern africa, outside south africa, nigeria and ghana, leading to the degree of master of medicine in family health . The development of this residency programme was a triangular effort from moi university, infa - med (institute of family medicine, a faith - based ngo, aiming to introduce family medicine in kenya) and the kenyan ministry of health (moh). Infa - med contributed financial support, expatriate family medicine faculty and well - established training hospitals; and the moh provided political support to the new specialty as well as scholarships to medical doctors entering the residency programme (26). A national policy (the kenyan family medicine policy) was developed (27) and in august 2009, this was adopted by the kenyan government . In 2008, the first registrars finalized the family medicine programme at moi university . Most of these registrars are now working in connection with the department to further develop the curriculum and the training sites . A study in 2011 on the challenges of family physicians after placement showed that the ministry s posting policy needs to be improved to ensure that family physicians have a chance to perform their intended roles (28). In 2011, one of the first - graduated kenyan family physicians, dr patrick chege, became the head of department . The department of family medicine has strongly been focussing on the development of research . In 2009, a review of the present family medicine curriculum was started to improve the curriculum with a focus on the needs of the hospitals where the family physicians will be based . Many external experts from primafamed partners and associates were consulted in this process . In january 2012, the revised curriculum was approved by the moi university senate . The west african college of physicians (wacp) accepted family medicine in 1985 (29) and it extended to the subregion outside nigeria in 1991 (29). In ghana, postgraduate training began in march 1999 with three family medicine residents under the auspices of the faculty of family medicine (then general medical practice) of the wacp . This was a hospital - based training programme with the initial group of trainers being private general practitioners who were elected into fellowship by the college in the early 1990s . It started as a 4-year programme leading to membership after the initial 2 years and fellowship after a further training for 2 years . That same year, the ghana college of physicians and surgeons also started another programme in family medicine to run alongside the one conducted by wacp . The ministry of health provides sponsorship for the programmes and accords graduates of family medicine equal status and remuneration as graduates from other specialties . In january 2008, the undergraduate programme began in the university of ghana medical school with the first two fellowship graduates appointed as lecturers . These local efforts at promoting the specialty in ghana received a major boost with two significant collaborations: first with the primafamed edulink acp - eu project in 2007, a north south south cooperation, and second, with the department of family medicine, university of michigan health systems in 2008, a north south cooperation . These collaborations focussed on curriculum development, faculty development, teaching of students and family medicine residents, development of training complexes and research . Currently, there are two well - established postgraduate training complexes in accra (korle - bu teaching hospital) and kumasi (komfo - anokye teaching hospital) with 35 family medicine residents at various levels of membership and fellowship training (30). Funding: the primafamed project was funded by the edulink acp eu (european commission funded programmes in the africa, caribbean and pacific group of states). The vlir uos (flemish interuniversity council) supported the funding for the yearly primafamed conferences2008 in kampala, uganda; 2009 in rustenburg, south africa; 2010 in swaziland and 2011 in cape town, south africa.
Of those deaths, an estimated 7.3 million were due to coronary heart disease and 6.2 million due to stroke . A disproportionate amount of those deaths, over 80%, take place in low- and middle - income countries and occur at similar rates among men and women . Not surprisingly, elevated blood pressure levels are a major cause of these diseases and are found at higher rates among low- and middle - income countries . The relationship between blood pressure levels and risk of developing cardiovascular disease is strong and well supported . In 2008, approximately one billion adults worldwide had uncontrolled hypertension (defined as systolic blood pressure 140 mm hg systolic and/or diastolic blood pressure 90 mm hg). Given the increasing prevalence of hypertension worldwide and the associated risk for developing cardiovascular disease, public health interventions aimed at reducing blood pressure are crucial . Many national and international agencies have acknowledged the role of lifestyle and diet, in particular sodium intake, on blood pressure levels . Diets high in salt are now recognized as one of the leading risks to cardiovascular health in the world as they increase blood pressure in both children and adults . Furthermore, a recent meta - analysis of randomized trials has demonstrated that modest reductions in dietary sodium intake are associated with significant reductions in blood pressure in both normotensives and hypertensives and a 20% reduction in cardiovascular events [4, 5]. A reduction in salt intake of 6 g / day lowered blood pressure by 7/4 mm hg diastolic in hypertensives and 4/2 mm hg in normotensives . This relationship has been empirically supported and is sufficiently strong to warrant recommendations for public health interventions aimed at substantially reducing dietary sodium intake . Furthermore, sodium reduction is noted as one of the most cost effective and most easily implemented strategies to improve population health [513]. Reducing dietary salt is recommended by the world health organization and many national governmental and nongovernmental health organizations . Some agencies, however, do not promote a reduction in dietary sodium, namely, nongovernmental or commercial organizations such as the salt institute, as they are sponsored by either the food or salt industries [9, 11, 1417]. Regardless, it is apparent that the risks associated with an increase in salt consumption, chiefly those related to an increase in blood pressure, are linear [3, 18]. Most health economic models input relatively small changes in blood pressure that occur in those with normal and high blood pressure as estimated by short - term modest reductions in dietary sodium [7, 8, 19]. Some models also include the gastric cancers that are positively associated with, and probably caused by, high - salt intake . Typically, the health economic models do not include the potential impact of longer term irreversible increases in blood pressure, age - related increases in blood pressure, the epigenetic phenomena, whereby exposure to excess salt in utero may increase blood pressure in offspring, or that sodium may increase vascular and cardiac disease in the absence of changes in blood pressure [7, 8, 12, 1921]. The burden of disease studies also do not account for diseases that have a pathophysiological basis and close association with high sodium diets (i.e., increased severity and frequency of asthma attacks, increased calcium containing kidney stones, osteoporosis, or obesity related to the consumption of calorie containing beverages caused by sodium - induced thirst). Hence the burden of disease associated with excess dietary salt is not only high, but may also be underestimated . The objective of this commentary is to review current sodium consumption worldwide, discuss cost - effective strategies to reduce dietary sodium, as well as briefly review the role of behavioural and policy - based environmental interventions in reducing dietary sodium on a population - based scale . Humans evolved on diets consisting of natural plant and animal foods containing small amounts of sodium, typically less than 2 g / day [25, 26]. Today, nearly all populations consume far greater quantities of salt than those provided in natural, unprocessed food diets . The world health organization currently recommends a daily consumption of less than 5 grams of salt, although some agencies recommend that no more than 1500 mg of sodium should be consumed per day [2729], calculated as 2/3 tsp of table salt . In most populations, sodium intake is 5.7 g or more / day after age 5, with many populations consuming and average of over 10 g / day [3032]. Furthermore, within high sodium consumption countries, only a small proportion of individuals consume the recommended levels of salt . For example, in canada, a country with average salt consumption of 8.5 gm / day, 85% of men and 60% of women aged 9 to 70 consume over the upper recommended limit for salt and the vast majority (> 90%) are above the level recommended for individuals to consume [33, 34]. For example, one study found that in a population of overweight adults, a daily intake of sodium greater than 2300 mg / day was associated with a 61% increase in coronary heart disease mortality, an 89% increase in stroke mortality, and a 39% increase in all - cause mortality over a 19-year period . Along with the other sodium - related illnesses discussed above (i.e., gastric cancers, kidney stones, etc . ), it is clear that the economic costs associated with such illnesses can be substantial . In countries with developed economies, salt added during the processing of foods accounts for the vast majority of dietary salt (7580%). An additional 10% of dietary salt is accounted for by salt that is naturally occurring in foods, while the rest is accounted for by salt added at the table or during cooking . In low- to - middle income countries where populations may have limited access to processed foods, salt added at home, in cooking, or at the table, accounts for the majority of dietary salt . Reducing dietary salt is estimated to save substantial health care costs [7, 10, 16, 30, 3741]. For example, reducing dietary salt by 3 g / day in the united states is estimated to save 194,000 to 392,000 quality adjusted life years and reduce health care costs $10 to $24 billion us dollars a year . In canada, reducing salt consumption to recommended levels is estimated to reduce the prevalence of hypertension by 30% and to save up to $430 million dollars per year just in direct hypertension management costs alone . In lower - income countries, programs aimed at reducing consumption of dietary salt through an intervention largely based on education are estimated to cost little (less than $0.40 usd per person per year), reduce premature deaths by close to 14 million in 10 years, and to be slightly more cost effective than strategies to reduce tobacco use (both highly advocated interventions) [8, 40]. Although there is a general lack of awareness of salt as a health issue in many countries, some countries with established salt reduction programs show increasing awareness . For example, in canada, 80% of people diagnosed with hypertension are attempting to reduce dietary sodium . In addition, many food companies have developed low - salt options to their product lines for people to choose, with some companies reducing salt additives in their full product line . In developed economies, there are substantial barriers to free choice in those who chose to eat less salt [16, 44]. In most countries, it is often the case that nutritional information is available only on the company's website, by asking for and reviewing a binder on site, or only readily available after purchase . Even in the united states and canada, countries with mandatory labelling of packaged foods, the labels are often difficult to interpret . Also serving sizes may be variable and not comparable between products . In an unpublished study, we found that in a sample of over 100 people with diabetes who had received training on how to read a food label, not one could accurately answer how much of a processed food they could eat in a day when presented with the food label . In other countries, food labelling on packaged foods may not be mandatory and labelled foods may not be available . In remote regions and areas where populations vulnerable to the development of elevated blood pressure reside, low - salt alternative choices are typically not available . Furthermore, these populations may not have the health literacy with which to make informed choices . Food processors and manufacturers often use pervasive marketing techniques to create consumer demand for high - salt foods, which undermine efforts of public health and individual education interventions that attempt to reduce sodium intake . Moreover, these marketing techniques are often directed towards children by making consumption of such foods seem fun . Perhaps the greatest barrier to choosing and maintaining a low - sodium diet is that high - salt foods are ubiquitous and hence difficult for those who choose low - salt diets [16, 46]. In canada, high - salt diets are by and large perceived as unhealthy by the general population . However, it is often the case that the same people who recognize that canadians in general consume too much salt, believe that their personal consumption of dietary sodium is within the recommended amount . This suggests that even a relatively affluent, well - educated population may have difficulty identifying and avoiding high - salt foods even if they perceive it is a health issue and have chosen to follow a low - salt diet . Some of the challenges of individual choice in selecting low salt diets is perhaps best illustrated by clinical trials where highly motivated patients are carefully and repeatedly trained how to select low - salt foods but generally can only sustain small reductions in salt intake long term [44, 48]. Population - based approaches to reducing dietary salt may be effective in developed economies and have shown promising results for reducing blood pressure . In the late 1950s, the japanese government implemented a campaign to reduce salt intake given the high stroke mortality rates . Ten years later, salt intake was reduced from an average of 13.5 to 12.1 g / day overall, and from 18 to 14 g / day in the northern regions . The reduction resulted in a decrease in average blood pressure and an 80% reduction in stroke mortality . In the 1970s, finland's government began a public education campaign and enforced regulations on food processing companies through a warning label on high - salt foods in order to reduce salt consumption across the country [50, 51]. More than 30 years later, the overall sodium intake in finland has decreased more than 40%, with a subsequent decrease in mean diastolic blood pressure of greater than 10 mm hg and an 80% decline in the mortality rate from heart disease and stroke . Similar results were also seen on smaller scales in the dash (dietary approached to stop hypertension) trial conducted in the usa [3, 53]. This trial assessed three levels of dietary sodium intake on two diets (american diet versus dash diet) and demonstrated that reducing sodium in either diet resulted in lower blood pressure [3, 12, 53]. More recently in the united kingdom, reductions in the amount of salt added to foods, in conjunction with a social marketing campaign, have been associated with reduction in population salt intake . In developing economies widespread replacement of salt with a partial salt replacement (sodium, potassium magnesium combination) holds great promise [54, 55]. For example, a recent double - blind randomized controlled trial conducted in rural northern china found that replacing household salt with a reduced - sodium, high - potassium salt substitute for 1 year reduced systolic blood pressure by 5.4 mm hg . This low cost change in diet has shown promising outcomes for blood pressure reduction with little to no burden on the consumer . Clearly both a mix of population approaches and behavioural approaches targeting individuals are required to reduce sodium intake to within recommended levels [10, 11, 15, 16, 33, 56]. Similar methods have been successfully employed in reducing tobacco use . With respect to individually targeted efforts, for example, a variety of behavioural interventions, including brief physician smoking cessation counselling, was found to meaningfully increase smoking quit rates . However, it has become increasingly clear that education targeted towards individuals may be necessary, but not sufficient, to motivate long - term health behaviour change [59, 60]. For example, motivational interviewing, a directive patient - centred counselling approach focused on exploring and resolving ambivalence, which emerged as an effective therapeutic approach within the addictions field, has recently shown promise for other complex behaviour change problems such as weight loss in overweight and obese patients and adherence to antihypertensive medication . In contrast with recommendations for behaviour change delivered through education and advice giving, motivational interviewing differs in that motivation for change is elicited from individuals, rather than imparted by a healthcare provider . The mix of behavioural interventions and population interventions depends on the specific circumstances of both the individual and the population . In countries with developed economies, population - based approaches, and a reduction of salt additives to food, supplemented by public education campaigns, need to be the primary means of intervention to ensure that the healthy option that is low in salt is the easiest option a basic caveat of public health interventions . A universal reduction in salt additives during the manufacturing process has a strong potential to reduce health disparities in vulnerable populations while improving overall population health . Behavioural interventions may be most important to ensure the population and especially policy makers understand and are supportive of the need to reduce dietary salt . However, for specific individuals with strong motivation or at a greater personal risk from consuming a diet high in sodium, intensive behavioural interventions may be efficacious . Notably sole reliance on the individual behavioural approach is likely to have a smaller impact on a population basis, to be expensive, and to increase health disparity . In developing economies, where the majority of sodium intake comes from salt added at the table and in cooking, behavioural interventions are more likely to be effective in reducing overall intake than population - based means [8, 32]. In this case, the individual needs to understand the consequences of excess sodium intake and change their behaviors (i.e., eating habits) to reduce sodium intake . Nevertheless, even in this partial replacement of table salt (sodium chloride) with various mineral salts (mixtures of sodium, potassium, and/or magnesium and calcium) has been shown to be highly effective to reduce overall sodium consumption and also reduce blood pressure [55, 65]. Efforts to reduce dietary salt are also likely to reduce dietary iodine, therefore monitoring dietary iodine adequacy and revising the iodine content of salt is essential to maintain population health in most settings, including developed countries . Population interventions that ensure widespread replacement of salt with a partial salt substitute that contains iodine may be the dominant strategy to reduce sodium intake on a large - scale basis in combination with behaviour change interventions . Given the promising outcomes observed in recent randomized controlled trials and population - based interventions, reducing dietary sodium intake to modest levels (approximately 5 g / day) worldwide would result in a major improvement in overall health and reduce the costs associated with diseases connected to excess sodium intake . However, it is apparent that relying solely on interventions that target individual behaviour is not the ideal approach for reducing sodium consumption . While it may contribute to behaviour change among highly motivated individuals and increase the acceptability of population - based interventions, the latter approach seems better suited for this particular health behaviour.
The associated edema which may develop within an hour is the leading cause of potential life - threatening airway compromise . The disease may show variation in terms of its presentation and clinical course, which needs to be addressed carefully before making any airway management plan . Literature is convincing both for the active as well as conservative approach of airway management depending upon the patient's clinical condition . The purpose of reporting this case is to highlight these issues in the management of adult patient with acute supraglottitis . A 52-year - old man presented in the emergency department with the complaints of sore throat for 1 day . The past medical history was unremarkable except the history of ischemic heart disease for which he was taking regular clopidogrel, losartan, and sublingual trinitrates as required . He was febrile with the temperature of 37.6c, respiratory rate was 22 per minute, while the oxygen saturation on room air was 95% . There were no signs of airway obstruction including stridor, change of voice, and dyspnea related to change in position or lying down . The initial management was started with humidified oxygen, intravenous dexamethasone, and adrenaline nebulization . The fiberoptic nasolaryngoscopy showed the significant edema and inflammation of supraglottic region more on the right side as compared to the left . He was quiet comfortable with the breathing and maintaining the oxygen saturation on hudson mask . The rest of the physical and systemic examination was normal . On the basis of initial assessment however, consideration was given to nasolaryngoscopy findings and the fact that we did not have overnight otorhinolaryngology cover in our district hospital . It was also decided that conservative airway management of patient, either in our hospital or during shifting to the specialized unit, would be very high risk . The three anesthetists, out of whom two had consultant grades, were present for the case . Patient's was kept on spontaneous ventilation with the help of nasopharyngeal airway connected to the main circuit via 15 mm outer diameter connector . A surgical tracheostomy was done after infiltration of local anesthesia while the patient was kept anesthetized on inhalational anesthetic on spontaneous breathing pattern . The patient remained stable throughout the procedure and shifted to the intensive care unit on completion of the procedure . The unanticipated rapidly progressive course of the disease was confirmed by the computerized tomography scan of the neck done after 24 h, which showed the marked swelling of oropharynx reducing the size of airway to not more than a pin hole [figure 1]. Patient was shifted to specialized center on the first postoperative day where he was treated medically . Rest of the course in the hospital was uneventful and then he was discharged home . The reported incidence in this population group is 12.9/100,000 annually and is higher than that in the pediatric population . Signs and symptoms at the time of presentation show variation among the patient group involved . Sore throat, dysphagia, and change in voice are the common findings in the adults while the children usually present with the cardinal signs of airway obstruction as stridor, drooling, and dyspnea . The current literature supports the conservative approach for the patients in which no airway compromise is suspected . Patients having a rapid progressive course, diabetes, or symptoms of impending airway obstruction like stridor or muffled voice are likely to be managed with the active airway intervention . We recommend that before taking any decision on the approach to a patient, it is very important to consider the type of health care setup and facilities available . The disease process may show marked variation in terms of symptoms and progression as it was happened in our patient . Our patient presented with sore throat and he did not have any sign or symptoms of respiratory distress but still had rapid onset of massive airway edema . A retrospective review of nine healthy adults found that the signs of upper airway obstruction are characteristically absent in early phase of potentially fatal supraglottitis . . It also aids in tracking the disease progress and the response to medical treatment . Severe swelling of the epiglottis and its extension to the arytenoids are the two factors strongly associated with the airway intervention . The management of our patient was based on the nasolaryngoscopy finding at the time of presentation which showed the clinically significant edema of oropharynx . Air way manipulation in such high risk patients should be done in the operation theatre with a surgeon ready for emergency tracheostomy . The anesthetic options, inhalational induction using sevoflurane or awake trachesotomy, should be individualized according to the patient condition and clinical expertise available . In adult patients having acute supraglottitis, clinical parameters are not the reliable indicators of the airway condition, which may deteriorate rapidly . A multidisciplinary approach involving the otorhinolaryngologist and anesthesiologist is of prime importance for the management of airway . Either the prophylactic or conservative approach may be used depending upon the patient condition and the health care facilities available . It is also very important to anticipate the difficulty and all the preparations for an emergency tracheostomy should be there for securing of airway.
A 15-year - old boy had complained of motility limitation in the right eye since a young age . His visual acuity was 20/20 in each eye, although an ocular motility examination revealed markedly limited abduction and mildly limited adduction in his right eye (fig . 1). On attempted adduction of the right eye, globe retraction (fig . 2) with narrowing of the palpebral fissure was observed, and there mild upshoot and downshoot were also observed (fig . An alternate prism cover test revealed a 16 prism diopters (pd) right esotropia (et) in the primary position, 25 pd et in right gaze, 10 pd et in left gaze at distance fixation, and 4 pd et at near fixation . He assumed a compensatory face turn to the right and did not complain of diplopia . Duane's retraction syndrome was inferred as the diagnosis until we noted that the patient's right eye had slight enophthalmos . Hertel's exophthalmometry revealed a 1.5 mm difference between both eyes and the margin reflex distance 1 was 0.5 mm in the right eye . Computed tomography of the orbits was performed and demonstrated an old medial orbital wall fracture with entrapment of the medial rectus muscle and surrounding tissues (fig . However, there was no history of trauma or forceps delivery according to the patient or his parents . The patient's ocular motor impairment was concluded to have arose from a long - term medial orbital wall fracture and was diagnosed as' pseudo - duane's retraction syndrome' . Because open reduction surgery for an old orbital wall fracture would be very difficult, and fruitless for this patient, we decided only to perform surgery on the eye muscle . The 5 mm recession of the right medial rectus muscle was successfully performed in order to correct the patient's head turn and esotropia . Postoperatively, the patient had orthotropia in the primary position, and the anomalous head posture disappeared, though there were still some limitations in both abduction and adduction in the right eye one year after the surgery . Duane's retraction syndrome is a well - known congenital ocular motility disorder caused by anomalous innervation and mechanics of the lateral rectus muscle, with secondary muscle changes sometimes superimposed . In 1976, thomas duane reported five cases of pseudo - duane's retraction syndrome showing similar, yet different, symptoms and sign as duane's retraction syndrome.1 other authors preferred the names of' inverse duane, reverse duane, or mirror - image duane retraction syndrome' owing to the presentation of opposing clinical features compared with those of classic duane's retraction syndrome . The etiology is, also, completely different from that of classic duane's retraction syndrome . The primary lesion in pseudo - duane's retraction syndrome is suspected to be the medial rectus muscle . Most cases have been reported to result from the entrapment of the medial rectus muscle within the medial orbital wall due to trauma.1,3 congenital cases,4 recurrent pterygium,5 and myocysticercosis involving the medial rectus muscle6 have also been reported to be related with inverse duane's retraction syndrome . In korea, jo et al.7 reported on inverse duane's retraction syndrome with exotropia, and lew et al.8 reported a case of congenital inverse duane's retraction syndrome with a tight medial rectus muscle . Recently, a case of innervational etiology, such as bilateral inverse duane's retraction syndrome, due to simultaneous co - contraction of both horizontal rectus muscles has been reported by khan.9 to the best of our knowledge, there is no report presenting very similar clinical features as those of classic duane's retraction syndrome arising from the entrapment of the medial rectus muscle in a medial orbital wall fracture . This case would most appropriately be categorized as pseudo - duane's retraction syndrome instead of inverse or reverse duane's retraction syndrome . There might be some possibility that the patient acquired duane's retraction syndrome prenatally, and that the medial orbital wall then fractured after birth . However, several pictures of this patient around one year of age revealed that there was no conspicuous head turn, and his family recalled that the limited eye movement was not noted until 2 - 3 years of age . The limitation of his eye movements, therefore, could be concluded as acquired due to unnoticed orbital trauma after one year of age . We report a case of pseudo - duane's retraction syndrome caused by entrapment of the medial rectus muscle in an old medial orbital wall fracture presenting very similar clinical features as those of classic duane's retraction syndrome . The importance of several tests such as the forced duction test and an imaging study should be emphasized in making the diagnosis for limited eye movement.
Lumbar spine instability has been reported to be the leading cause of chronic back pain1 . An a abnormal vertebral joint creates mechanical lesions and pains in the lumbar spine, decreasing stability and increasing the range of motion, resulting in functional degeneration2 . These negative patterns have a variety of forms such as aging, medical history, and exercise deficiency and present serious problems in the age group of 2040, due to developments of modern society and recent changes in various working forms of work3, 4 . Herniated nucleus pulposus (hnp) is a representative disease of the functional vertebral unit that occurs when the pulposus nucleus is exposed by rupture of the annulus fibrosus and it is a disease that causes chronic back pains5, 6 . Chronic back pain patients not only have weak deep muscles of the lumbar region and muscle imbalance compared to normal subjects, but also show reduction in the re - positioning ability which leads to problem with the stability of the spine, due to the reduction in proprioceptive sense, which causes lumbar pain and recurrence7, 8 . They include exercises for increasing muscle strength, improving functions, and maintaining posture as well as preventing excessive movements of the lumbar spine9 . Exercise rehabilitation approaches for strength and stability are important even after surgical treatments, due to degeneration and restricted activities10, 11 and conservative methods of treatment by exercise have been recommended for the purpose of preventing recurrence of pain and improving functions12,13,14,15,16 . Thus, exercise therapies based on the stabilization exercises are considered to be necessary for preventing chronic pain and reductions in functional capabilities by the reduction of functional instability in various of type and the improvement of motor functional capabilities of the lumbar joints . Therefore, this study aims to help adult women with lumbar disc herniation recover muscle strength and stability through 8-week lumber extension strength exercise programs, and to provide data for constructing an integrated exercise program . In this study, an 8-week exercise program for lumbar muscle extension strength and stabilization was performed by 26 females older than 20 with lumbar disc herniation . This study was approved by the hankuk university of foreign studies and the institution where it was performed, and it complied with the ethical principles of the declaration of helsinki . The purposes and process of the study were fully explained to the subjects and their consent was obtained before participation . The subjects mean sd was 27.2 4.4 years old their mean sd height was 162.3 5.1 cm and their mean sd weight was 55.4 7.1 kg . The programs was conducted for a total of 8 weeks, 60 minutes a session, twice a week, to improve strength and stabilize lumbar extension . The exercise program was divided into warm - up exercises, main exercises and cool - down exercises . The warm - up exercises and cool - down exercises were conducted focusing on the range of joint motion (rom) without pain, utilizing cycles and steppers for 10 minutes, alternately . For the purpose of improving the lumbar stability and resistance muscles, the main exercises were designed to be individually conducted in the form of a circuit training in which the number of repetitions increased gradually, utilizing sling and weight exercise equipment . A lumbar extension strength machine (medx, medx inc ., ocala, fl, usa) was utilized for the evaluation of lumbar extensor strength . The maximum static muscular strength of lumbar extension was measured at 7 different angles of lumbar flexion: 0, 12, 24, 36, 48, 60, and 72 degrees . Passive tests were conducted to determine whether to limit the range of motion before measurement . The tests were conducted 12 times at 45 lbs in accordance with the medx exercise measurement guidelines . The measurement was performed after fixing the pelvis and thigh of the subjects on the support . Then, the motion of the lumbar spine was limited during measurement by adjusting the footrest . The subjects were asked to increasingly extend the lumbar spine by sufficiently considering the limited angular range of motion of the joints . The measurements were performed in the same manner at every angle by maintaining maximum muscle contraction for about 2 seconds . For the physical stability measurements, the total weight distribution index (wdi) was calculated by assessing the degree of interaction and coordination of the lower body through body away while maintaining a standing posture . For data processing, the statistical program spss (spss inc ., the mean and standard deviation of the measurements was calculated for all metrics . To compare the difference between the pre - exercise and post - exercise state of the 8-week exercise program, the paired t - test was used and statistical significance was accepted for values of p <0.05 . Significant differences were observed in lumbar extension strength (les) between pre - exercise and post - exercise at every angle of lumbar flexion, but no significant difference was found in wdi (%) (table 1table 1.changes of the les and wdivariableanglepre - exercisepost - exerciseles (ft - lbs)061.8 33.880.1 31.6**1278.7 33.898.8 33.6**2487.6 36.5116.5 32.7***3698.6 35.9129.7 32.3***48104.7 35.0137.6 30.2***60113.1 36.9146.5 30.5***72122.3 40.1158.7 34.7***wdi (%) 5.9 3.35.0 2.8values are mean sd, les: lumbar extension strength, wdi: weight distribution index . The post - exercise les were found to be very significantly (p<0.01) higher than pre - exercise at 0 degree and 12 degree, and extremity significantly (p<0.001) higher than pre - exercise at 24, 36, 48, and 72 degrees of lumbar flexion . Values are mean sd, les: lumbar extension strength, wdi: weight distribution index . This study attempted to identify the positive impacts that were exerted on extension muscle strength and stability by an 8-week extension strength exercise program which was performed by 26 females with lumbar disc herniation . Hnp is caused by the annulus fibrosus that is squeezed into the spinal canal when the pulposus nucleus is torn due to a degenerative intervertebral disc . It has been reported that approximately 29% of the projected and escaped intervertebral discs are associated with the pulposus nucleus17 . Chronic back pains resulting from hnp aggravate the instability of the lumbar spine, causing degenerative changes, atrophy of muscle strength, and reduce flexibility and joint range of motion due to trunk damage and instability18, 19 . Lumbar herniated nucleus pulposus does not occur due to lumbar pain or disability, but more frequently occurs due to deterioration of the related muscles or functions interacting with them adjunctively8 . In addition, it is said that the joint range of motion is limited due to the loss of muscle strength and flexibility caused by occupational factors, mode of action, specific changes in posture, or degenerative disease18 . These musculoskeletal diseases can be generally improved by utilizing conservative treatments such as exercise9, 18 . Rehabilitation exercise therapies for muscular strength and stability are important even after surgery10, 16 . Various types of composite exercises and core exercises in addition to exercises for muscular strength and stability are currently being utilized8, 12 . These exercise therapies help to stabilize the lumbar spine through lumbar and trunk dynamic stabilization and exercise modulation, and increase of muscle strength20 . Similar to the present study, a study analyzing the impacts of an 8-week functional exercise program for lumbar muscle strength, that was performed by 26 females with degenerative disc findings, found that there were significant differences between pre - exercise and post - exercise15 in lumbar muscle extension strength at all 7 angles of lumbar flexion, proving that exercise participation develops stability of the muscles around the lumbar spine . In addition, a study analyzing the effects of decompression therapy by 4-week joint mobilization that was performed for patients with lumbar herniated nucleus pulposus, reported improvements in joint range of motion in flexion and extension21, proving its effectiveness . Similarly, a study of13 lumbar traction for patients with lumbar herniated nucleus pulposus, and a study11 of lumbar discectomy and stabilization exercises for patients with lumbar herniated nucleus pulposus, both reported improvements in flexion and extension . The improvements in functions pursuant to improved muscle strength and stability were statistically significant, as were the results of the studies cited above . Therefore, prevention of excessive movement of the lumbar spine and trunk, in the patients with chronic back pains or lumbar herniated nucleus pulposus can be helpful in their daily life because they secure the joint range of motion, thereby improving strength and stability9 . Thus, the development of muscular strength for stabilization and integrated exercise for pain reduction and rehabilitation help to maintain the range of joint motion, muscle strength, and balance21,22,23 . For the improvement and rehabilitation of inpaired capacity in daily life due to back pain - associated injuries experienced by about 80% of the population a higher occurrence rate8, 10 when recurrence is included muscle weakness, and loss15 of balance the development of an integrated exercise program is required . The above results indicate that improving muscle extension strength to enhance and improve the functions the patients with chronic back pain or lumbar herniated nucleus pulposus can help improve muscle functions and increase the range of joint motion thereby exerting a positive impact on physical stability.
This article presents statistics on health care utilization, prices, expenses, employment, and work hours, as well as on national economic activity . Some of these statistics are based on sample surveys conducted monthly or quarterly by government agencies or private organizations, and are available 1 to 3 months after the completion of the period . They provide the first glimpse at changes occurring within the general economy and the health care sector . The accompanying tables report selected quarterly statistics for 1990 through the first quarter of 1993, and the calendar year aggregation of quarterly information in the past 3 years ., this calculation permits analysis of quarterly data to focus on the direction and magnitude of changes, without interference introduced by seasonal fluctuations . In the national health accounts, indicators such as these play an important role in the estimation of the latest historical year of health care expenditures . Information that is more comprehensive tends to lag behind the close of a calendar year by 9 to 12 months or more . Therefore, we rely extensively on indicators such as these to anticipate and predict changes in health care sector expenditures for the most recent year . Other indicators help to identify specific reasons (e.g., increases in price inflation or declines in utilization) for expenditure change . In the following sections, we will identify important indicators of health care and national economic activity and their sources . We then describe what these indicators tell us about general economic and health sector activity during the most recent quarter . Since 1963, the american hospital association (aha), in cooperation with member hospitals, has been collecting data on the operation of community hospitals through its national hospital panel survey . Community hospitals, which comprised more than 80 percent of all hospital facilities in the united states in 1991, include all non - federal, short - term general, and other special hospitals open to the public . They exclude hospital units of institutions; psychiatric facilities; tuberculosis, other respiratory, and chronic disease hospitals; institutions for the mentally retarded; and alcoholism and chemical dependency hospitals . The sample is designed to produce estimates of community hospital indicators by bed size and region (american hospital association, 1963 - 93). In tables 1 and 2, statistics covering expenses, utilization, beds, and personnel depict trends in the operation of community hospitals annually from 1990 to 1992 and quarterly for selected quarters from 1990 through 1993 . Figure 1 shows changes from the same quarter 1 year earlier in various measures of hospital utilization for 1984 through the first quarter of 1993 . For purposes of national health expenditures (nhe), survey statistics on revenues (not shown on table 1) are analyzed in estimating the growth in the largest component of health care costs community hospital expenditures . This one segment of nhe accounted for 33 percent of all health spending in 1991 (letsch et al ., 1992). The survey also identifies important factors influencing expenditure growth patterns, such as changes in the number of beds in operation, number of admissions, length of stay, use of outpatient facilities, and number of surgeries . The u.s . Bureau of labor statistics (bls) collects monthly information on employment for all workers, and earnings and work hours for non - supervisory workers in a sample of 370,000 establishments . Data are collected through cooperative agreements with state agencies that also use this information to create state and local area statistics . The survey is designed to collect industry - specific information on wage and salary jobs in non - agricultural industries . It excludes statistics on self - employed persons and on those employed in the military (u.s . Department of labor, 1993a). Approximately 5 percent of the population hold more than one job at any point in time . (other surveys that are household - based, such as the current population survey [cps], also record employment . In the cps, however, each person's employment status is counted only once, either as employed, unemployed, or not in the labor force .) Once each year, monthly establishment - based employment statistics are adjusted to benchmarks created from annual establishment census information, resulting in revisions to previously published employment estimates . Tables 3 and 4 and figure 2 present statistics on employment, average hourly earnings, and average weekly hours in private (non - government) health service establishments . Similar statistics for the private non - agricultural sector, included on these tables, provide a basis for comparing the economy as a whole with the health sector in employment, earnings, and work hours . Table 5 summarizes business activity in the health sector and the overall economy by measuring change in the implied non - supervisory work hours and payroll . Implied work hours are the product of the number of non - supervisory employees and average weekly hours . Implied non - supervisory payrolls figure 3 shows changes from the same quarter 1 year earlier in non - supervisory payroll for 1984 through the first quarter of 1993 . For purposes of nhe, changes in work hours by industry combined with changes in prices (discussed in a later section) can be used to gauge the direction and magnitude of expenditure change in specific industries . We use these composite indicators in the estimation of growth in physician and dental expenditures for the most recent period . We study the historical relationship of changes in this indicator to changes in expenditures, and estimate this relationship for the most recent period . Bls publishes monthly information on changes in prices paid by consumers for a fixed market basket of goods and services . Tables 6 and 7 and figure 4 present information on the consumer price index (cpi) for all urban consumers that measures changes in prices faced by 80 percent of the non - institutionalized population in the united states . (the more restrictive wage earner cpi gauges prices faced by wage earners and clerical workers . These workers account for 32 percent of the non - institutionalized population [u.s . The index reflects changes in prices charged for the same quality and quantity of goods or services purchased in the base period . For most items, the base period of 1982 - 84 is used to define the share of consumer expenditures purchasing specific services and products . Those shares or weights remain constant in all years, even though consumption patterns of the household may change over time . Cpis for health care goods and services depict price changes for out - of - pocket expenditures made directly by consumers . The composite cpi for medical care weights together product - specific or service - specific cpis in proportion to household out - of - pocket expenditures for these items . For example, the composite medical care cpi measures inflation for the 3 percent of hospital expenditures that are made out - of - pocket by consumers; the remaining 97 percent of the costs of hospital care paid by private health insurers, medicare, medicaid, and other payers are not weighted into the cpi for medical care . In addition, some medical care sector indexes measure changes in list or charged prices, rather than in the prices actually received by providers after discounts are deducted . In several health care areas, received or transaction prices are difficult to capture, although bls is making advances in this area . In the nhe, a combination of cpis for selected medical care items, input price indexes for nursing homes, and the cpi for hospital and related services, adjusted by the health care financing administration (hcfa) to provide transaction price changes, are used as measures of inflation for the health industry . The indexes are used to develop a fixed - weight price index for personal health care to depict price changes affecting the entire health care industry more accurately than does the overall cpi medical care index (letsch, 1993). In 1979, hcfa developed the medicare hospital input price index (hospital market basket), which was designed to measure the pure price changes associated with expenditure changes for hospital services . In the early 1980s, the skilled nursing facility (snf) and home health agency (hha) input price indexes, often referred to as market baskets, were developed to price a consistent set of goods and services over time . Also, in the early 1980s, the original medicare hospital input price index was revised for use in updating payment rates for the prospective payment system (pps). All of these indexes have played an important role in helping to set medicare payment percent increases, and in understanding the contribution of input price increases to growing health expenditures . The input price indexes, or market baskets, are laspeyres or fixed - weight indexes that are constructed in two steps . For example, for the pps hospital input price index, the base period is 1987 . Cost categories, such as food, fuel, and labor, are identified and their 1987 expenditure amounts determined . The proportion or share of total expenditures included in specific spending categories second, a price proxy is selected to match each expenditure category: its purpose is to measure the rate of price increase of the goods or services in that category . The price proxy index for each spending category is multiplied by the expenditure weight for that category . The sum of these products (weights multiplied by the price index) over all cost categories yields the composite input price index for any given time period, usually a fiscal year or a calendar year . The percent change in the input price index is an estimate of price change over time for a fixed quantity of goods and services purchased by a provider . The input price indexes are estimated on a historical basis and forecasted over several years . The hcfa - chosen price proxies are forecasted under contract with data resources, inc./mcgraw - hill (dri). Following every calendar year quarter, in march, june, september, and december, dri updates its macroeconomic forecasts of wages and prices based on updated historical information and revised forecast assumptions . Some of the data in tables 8 through 13 are forecasted, and are expected to change as more recent historical data become available and subsequent quarterly forecasts are received . The methodology and price proxy definitions used in the input price indexes are described in the federal register notices that accompany the revisions of the pps, hha, and snf cost limits . A description of the current structure of the pps input price index was published in the september 4, 1990 federal register . The most recent pps update for payment rates was published in the september 1, 1992 federal register . The latest hha regulatory input price index was published in the july 1, 1992 federal register, and the latest snf input price index was published in the october 7, 1992 federal register . Periodically, the input price indexes are revised to a new base year so that cost weights will reflect changes in the mix of goods and services that are purchased . Each revision allows for new base weights, a new base year, and changes to certain price variables used for price proxies . Each input price index is presented in two tables: the first is a percent - change table, and the second provides the actual index numbers from which the percentages were computed . Figure 5 shows a comparison in the growth of the pps input price index with the cpi all items . Bls publishes monthly information on changes in prices paid by consumers for a fixed market basket of goods and services . Tables 6 and 7 and figure 4 present information on the consumer price index (cpi) for all urban consumers that measures changes in prices faced by 80 percent of the non - institutionalized population in the united states . (the more restrictive wage earner cpi gauges prices faced by wage earners and clerical workers . These workers account for 32 percent of the non - institutionalized population [u.s . The index reflects changes in prices charged for the same quality and quantity of goods or services purchased in the base period . For most items, the base period of 1982 - 84 is used to define the share of consumer expenditures purchasing specific services and products . Those shares or weights remain constant in all years, even though consumption patterns of the household may change over time . Cpis for health care goods and services depict price changes for out - of - pocket expenditures made directly by consumers . The composite cpi for medical care weights together product - specific or service - specific cpis in proportion to household out - of - pocket expenditures for these items . For example, the composite medical care cpi measures inflation for the 3 percent of hospital expenditures that are made out - of - pocket by consumers; the remaining 97 percent of the costs of hospital care paid by private health insurers, medicare, medicaid, and other payers are not weighted into the cpi for medical care . In addition, some medical care sector indexes measure changes in list or charged prices, rather than in the prices actually received by providers after discounts are deducted . In several health care areas, received or transaction prices are difficult to capture, although bls is making advances in this area . In the nhe, a combination of cpis for selected medical care items, input price indexes for nursing homes, and the cpi for hospital and related services, adjusted by the health care financing administration (hcfa) to provide transaction price changes, are used as measures of inflation for the health industry . The indexes are used to develop a fixed - weight price index for personal health care to depict price changes affecting the entire health care industry more accurately than does the overall cpi medical care index (letsch, 1993). In 1979, hcfa developed the medicare hospital input price index (hospital market basket), which was designed to measure the pure price changes associated with expenditure changes for hospital services . In the early 1980s, the skilled nursing facility (snf) and home health agency (hha) input price indexes, often referred to as market baskets, were developed to price a consistent set of goods and services over time . Also, in the early 1980s, the original medicare hospital input price index was revised for use in updating payment rates for the prospective payment system (pps). All of these indexes have played an important role in helping to set medicare payment percent increases, and in understanding the contribution of input price increases to growing health expenditures . The input price indexes, or market baskets, are laspeyres or fixed - weight indexes that are constructed in two steps . For example, for the pps hospital input price index, the base period is 1987 . Cost categories, such as food, fuel, and labor, are identified and their 1987 expenditure amounts determined . Second, a price proxy is selected to match each expenditure category: its purpose is to measure the rate of price increase of the goods or services in that category . The price proxy index for each spending category the sum of these products (weights multiplied by the price index) over all cost categories yields the composite input price index for any given time period, usually a fiscal year or a calendar year . The percent change in the input price index is an estimate of price change over time for a fixed quantity of goods and services purchased by a provider . The input price indexes are estimated on a historical basis and forecasted over several years . The hcfa - chosen price proxies are forecasted under contract with data resources, inc./mcgraw - hill (dri). Following every calendar year quarter, in march, june, september, and december, dri updates its macroeconomic forecasts of wages and prices based on updated historical information and revised forecast assumptions . Some of the data in tables 8 through 13 are forecasted, and are expected to change as more recent historical data become available and subsequent quarterly forecasts are received . The methodology and price proxy definitions used in the input price indexes are described in the federal register notices that accompany the revisions of the pps, hha, and snf cost limits . A description of the current structure of the pps input price index was published in the september 4, 1990 federal register . The most recent pps update for payment rates was published in the september 1, 1992 federal register . The latest hha regulatory input price index was published in the july 1, 1992 federal register, and the latest snf input price index was published in the october 7, 1992 federal register . Periodically, the input price indexes are revised to a new base year so that cost weights will reflect changes in the mix of goods and services that are purchased . Each revision allows for new base weights, a new base year, and changes to certain price variables used for price proxies . Each input price index is presented in two tables: the first is a percent - change table, and the second provides the actual index numbers from which the percentages were computed . Figure 5 shows a comparison in the growth of the pps input price index with the cpi all items . National economic indicators provide a context for understanding health - specific indicators and how change in the health sector relates to change in the economy as a whole . Tables 14 and 15 and figure 6 present national indicators of output, employment, and inflation . Economy as the value of output produced within the geographic boundaries of the united states by u.s . Or foreign citizens or companies . Real gdp removes the effects of prices from the valuation of goods and services produced, so that the growth of real gdp reflects changes in the physical output of the economy (u.s . Department of commerce, 1993). Growth in operating expenses for community hospitals slowed considerably in the first quarter of 1993, increasing 7.5 percent . The deceleration continued steadily throughout 1992, but appears to have leveled off in the first quarter of 1993 . All measures of utilization admissions, inpatient days, surgical operations, and outpatient visits grew more slowly or decelerated faster than they had during the first quarter of 1992 at the height of the flu epidemic . Total employment in the health service sector continued to grow at nearly the same rate as in 1992 . In the first quarter of 1993, there were 360,900 more health services jobs than in the first quarter of 1992, an increase of 4.3 percent . For non - supervisory workers, the health service sector, maintaining steady employment growth during 1991, appeared immune to the recent recession marked by sagging total private sector employment growth . In the past three quarters, growth in health services employment also appears to be unaffected by the recent upsurge in employment growth for all private, non - agricultural establishments, as health sector employment growth remains steady (figure 2). Implied work hours (the product of the number of non - supervisory employees and average weekly hours) in private health service establishments grew at a rate lower than in any quarter since 1987, 3.7 percent . Slow growth was caused by the decline in average hours worked per week, rather than a slowing in employment growth . This may signal an impending slowdown in employment for the health service sector, as employers initially cut work hours rather than lay off workers when faced with falling demand for services . Growth for implied payroll (work hours times average hourly earnings) in private health service establishments was also at its lowest since 1987 . Growth in implied payroll for private hospitals has followed this trend as well, and may be one reason for the deceleration in operating - expense growth seen in the aha panel survey (as previously noted). Medical prices, as measured by the cpi for medical care, continued to increase more rapidly than prices for all other items . In the first quarter of 1993, prices for medical care increased 6.3 percent from the first quarter of 1992, more than two times the 2.9-percent growth for all other items . However, the gap between price increases for medical care and all other items has gotten smaller than what it was throughout 1992 (figure 4). Although growth for nearly all components of the medical care cpi has decelerated, the most dramatic slowdown in growth occurred with the prices of prescription drugs . In calendar year 1991, the cpi for prescription drugs increased 9.9 percent . In 1992 first, there has been a price war among retail establishments selling prescription drugs . As the number of non - traditional types of retail outlets has grown, competition against the traditional retail pharmaceutical outlets increased . Mass - merchandisers, such as walmart, are competing for the business of prescription drug customers . Secondly, recent proposals on health care reform have pharmaceutical manufacturers concerned about the free - market privileges from which they have historically benefitted . Conceivably, manufacturers and wholesalers have been voluntarily holding pricing down in an effort to avoid being faced with less desirable, mandatory price controls . Evidence of the behavior of drug manufacturers can be found in the producer price index (ppi) for pharmaceuticals, which measures average changes in prices received by domestic producers of commodities in all stages of processing . Growth in the ppi for pharmaceuticals decelerated at nearly the same rate as the cpi for prescription drugs . In calendar year 1991, the ppi for pharmaceuticals increased 8.4 percent . By the first quarter of 1993, growth in this ppi slowed to 4.6 percent . In the first quarter of 1993, overall economic conditions continued to improve modestly, as shown by the eighth straight quarter of positive growth in real gdp . The unemployment rate (7.0 percent) was lower than it had been since the fourth quarter of 1991 . Total employment in private non - agricultural establishments increased 1.3 percent, which is the largest increase experienced in nearly 3 years . Growth in operating expenses for community hospitals slowed considerably in the first quarter of 1993, increasing 7.5 percent . The deceleration continued steadily throughout 1992, but appears to have leveled off in the first quarter of 1993 . All measures of utilization admissions, inpatient days, surgical operations, and outpatient visits grew more slowly or decelerated faster than they had during the first quarter of 1992 at the height of the flu epidemic . Total employment in the health service sector continued to grow at nearly the same rate as in 1992 . In the first quarter of 1993, there were 360,900 more health services jobs than in the first quarter of 1992, an increase of 4.3 percent . For non - supervisory workers, the health service sector, maintaining steady employment growth during 1991, appeared immune to the recent recession marked by sagging total private sector employment growth . In the past three quarters, growth in health services employment also appears to be unaffected by the recent upsurge in employment growth for all private, non - agricultural establishments, as health sector employment growth remains steady (figure 2). Implied work hours (the product of the number of non - supervisory employees and average weekly hours) in private health service establishments grew at a rate lower than in any quarter since 1987, 3.7 percent . Slow growth was caused by the decline in average hours worked per week, rather than a slowing in employment growth . This may signal an impending slowdown in employment for the health service sector, as employers initially cut work hours rather than lay off workers when faced with falling demand for services . Growth for implied payroll (work hours times average hourly earnings) in private health service establishments was also at its lowest since 1987 . Growth in implied payroll for private hospitals has followed this trend as well, and may be one reason for the deceleration in operating - expense growth seen in the aha panel survey (as previously noted). Medical prices, as measured by the cpi for medical care, continued to increase more rapidly than prices for all other items . In the first quarter of 1993, prices for medical care increased 6.3 percent from the first quarter of 1992, more than two times the 2.9-percent growth for all other items . However, the gap between price increases for medical care and all other items has gotten smaller than what it was throughout 1992 (figure 4). Although growth for nearly all components of the medical care cpi has decelerated, the most dramatic slowdown in growth occurred with the prices of prescription drugs . In calendar year 1991, the cpi for prescription drugs increased 9.9 percent . In 1992 this growth decelerated to 7.6 percent . By the first quarter of 1993, it slowed further to only 5.0 percent . As the number of non - traditional types of retail outlets has grown, competition against the traditional retail pharmaceutical outlets increased . Mass - merchandisers, such as walmart, are competing for the business of prescription drug customers . Secondly, recent proposals on health care reform have pharmaceutical manufacturers concerned about the free - market privileges from which they have historically benefitted . Conceivably, manufacturers and wholesalers have been voluntarily holding pricing down in an effort to avoid being faced with less desirable, mandatory price controls . Evidence of the behavior of drug manufacturers can be found in the producer price index (ppi) for pharmaceuticals, which measures average changes in prices received by domestic producers of commodities in all stages of processing . Growth in the ppi for pharmaceuticals decelerated at nearly the same rate as the cpi for prescription drugs . In calendar year 1991, the ppi for pharmaceuticals increased 8.4 percent . By the first quarter of 1993,, overall economic conditions continued to improve modestly, as shown by the eighth straight quarter of positive growth in real gdp . The unemployment rate (7.0 percent) was lower than it had been since the fourth quarter of 1991 . Total employment in private non - agricultural establishments increased 1.3 percent, which is the largest increase experienced in nearly 3 years.
Urinary retention and voiding dysfunction (vd) symptoms (hesitancy, straining to void, difficulty in starting micturition, diminished stream, and sensations of incomplete emptying of the bladder) are common and problematic features occurring after surgery for stress urinary incontinence (sui), especially following a mid - urethral sling placement (retropubic or trans - obturator procedure). They can lead to urinary infections, and can also require self - catheterization or sling section . The prevalence of urinary retention varies from 2.216% after surgery for sui. [13] preexisting voiding dysfunction is known to be a predictive factor for post - surgery urinary retention . In 2003 hong et al ., showed that the best predictive factor for obstructive complications was the maximum flow rate, with which it was shown to be directly correlated . It is thus important to screen women suffering from sui for emptying symptoms before such surgery . The purpose of this study was to determine whether the completion of a vd questionnaire could have a good predictive value for uroflowmetry findings, in a population of sui women showing no obvious etiologies of obstruction . We analyzed 415 sui women from the urodynamic database, who had undergone a filling cystometry in the department, and whose uroflowmetry indicated a total urine volume greater than 200 ml . Women with neurological disorders, pelvic organ prolapse, urge or mixed urinary incontinence, detrusor overactivity or previous sui surgery were excluded . With these exclusion criteria, these 93 women were divided into two groups: those who complained of vd symptoms (vds group) according to the bristol female lower urinary tract symptoms (bfluts) questionnaire, and those without vd symptoms (non - vds group). We investigated the parity, age, menopausal status, and concomitant anorectal disorders of each woman . The women were interviewed on the presence of emptying symptoms, and completed the bfluts questionnaire [table 1], which is systematic in our department . We screened for five items related to voiding difficulties: hesitancy, slow or intermittent stream, straining, or sensations of incomplete emptying . For the purposes of data analysis, those women who answered never to all five items were classed in the non - vds group . Those women for whom one or more of the answers was positive (i.e. : occasionally, sometimes, most of the time or all the time), were classified in the vds group . Bristol questionnarire bfluts (urinary symptoms questionnaire): the five items concerning voiding dysfunction the clinical examination included a physical examination, urodynamic testing and a free flow uroflowmetry and filling cystometry at a rate of 50 ml per minute (duet, medtronic). The filling cystometry parameters studied were: compliance, detrusor overactivity (do), detrusor sensation . None of the patients presented with abnormal compliance, do, or abnormal detrusor sensation . Both a quantitative and a qualitative analysis of bladder outlet obstruction (boo) was made by uroflowmetry . Quantitatively, a patient was considered to have boo when a maximum flow rate of less than 15 ml / sec was observed for a urine volume greater than 200 ml, and/or the post - void residual was greater than 50 ml, as measured with a bladder scan or by catheterization . The urine flow was also analyzed in terms of average flow rate, urine volume, voiding time and acceleration (defined as the maximum flow rate divided by the time taken to reach maximum flow rate). The qualitative analysis dealt with the flow patterns: a standard bell - shaped three pathologic patterns were considered: intermittent or continuous polyphasic curves, and flat curves [figures 1a c]. We determined the sensitivity and specificity as well as the positive and negative predictive value of the vds questionnaire using the uroflowmetry data . (a) intermittent polyphasic curve (b) continuous polyphasic curve (c) flat curve a comparison of the clinical characteristics and uroflowmetry of the two groups was made using a wilcoxon test for continuous data and a fischer test for categorical data . As the bfluts questionnaire and urodynamics were identical to those systematically used for the routine evaluation of sui women in our department, the study did not require specific ethics committee approbation . We analyzed 415 sui women from the urodynamic database, who had undergone a filling cystometry in the department, and whose uroflowmetry indicated a total urine volume greater than 200 ml . Women with neurological disorders, pelvic organ prolapse, urge or mixed urinary incontinence, detrusor overactivity or previous sui surgery were excluded . With these exclusion criteria, these 93 women were divided into two groups: those who complained of vd symptoms (vds group) according to the bristol female lower urinary tract symptoms (bfluts) questionnaire, and those without vd symptoms (non - vds group). We investigated the parity, age, menopausal status, and concomitant anorectal disorders of each woman . The women were interviewed on the presence of emptying symptoms, and completed the bfluts questionnaire [table 1], which is systematic in our department . We screened for five items related to voiding difficulties: hesitancy, slow or intermittent stream, straining, or sensations of incomplete emptying . For the purposes of data analysis, those women who answered never to all five items were classed in the non - vds group . Those women for whom one or more of the answers was positive (i.e. : occasionally, sometimes, most of the time or all the time), were classified in the vds group . The clinical examination included a physical examination, urodynamic testing and a free flow uroflowmetry and filling cystometry at a rate of 50 ml per minute (duet, medtronic). The filling cystometry parameters studied were: compliance, detrusor overactivity (do), detrusor sensation . None of the patients presented with abnormal compliance, do, or abnormal detrusor sensation . Both a quantitative and a qualitative analysis of bladder outlet obstruction (boo) was made by uroflowmetry . Quantitatively, a patient was considered to have boo when a maximum flow rate of less than 15 ml / sec was observed for a urine volume greater than 200 ml, and/or the post - void residual was greater than 50 ml, as measured with a bladder scan or by catheterization . The urine flow was also analyzed in terms of average flow rate, urine volume, voiding time and acceleration (defined as the maximum flow rate divided by the time taken to reach maximum flow rate). The qualitative analysis dealt with the flow patterns: a standard bell - shaped three pathologic patterns were considered: intermittent or continuous polyphasic curves, and flat curves [figures 1a c]. We determined the sensitivity and specificity as well as the positive and negative predictive value of the vds questionnaire using the uroflowmetry data . (a) intermittent polyphasic curve (b) continuous polyphasic curve (c) flat curve a comparison of the clinical characteristics and uroflowmetry of the two groups was made using a wilcoxon test for continuous data and a fischer test for categorical data . As the bfluts questionnaire and urodynamics were identical to those systematically used for the routine evaluation of sui women in our department, the study did not require specific ethics committee approbation . Among the 93 women eligible for the study, 61% (57/93) complained of vd symptoms on the bfluts questionnaire (vds group) and 39% (36/93) had no vd symptoms (non - vds group). Patients characteristics are detailed in table 2 . No difference was observed between the two groups concerning age, parity, menopausal status, concomitant anorectal disorders and uroflowmetry parameters . In the vds group, 75% (27/36) of the women in the non - vds group had normal uroflowmetry, and 25% (9/36) an abnormal one without symptoms . The positive predictive value of the vds questionnaire was 32% and the negative predictive value was 75% [table 3]. There was no statistical correlation between symptoms and the defined criteria of boo on uroflowmetry (fischer test: p=0.64). Among the 42 women who complained of a sensation of incomplete emptying, only one had a real post - void residual greater than 50 ml . In this sui population without severe pelvic organ prolapse (baden and walker staging system 1), previous sui surgery, or neurological disorders (the most frequent etiologies of voiding dysfunction in women) we found a 29% (29/93) rate of abnormal uroflowmetry . Characteristics of women with and without voiding difficulties symptoms in terms of age, menopausal status, parity, anorectal disorders and uroflowmetry parameters sensitivity, specificity, positive and negative predictive value of voiding dysfunction symptoms on bfluts multivariate analysis (using multiple logistic regression method) demonstrated no correlation between symptoms and quantitative uroflowmetry parameters (maximum and average flow rate, acceleration, urine volume, time to maximum flow and voiding time), and no correlation was found between vds and age, menopausal status, parity or concomitant anorectal disorders [table 4]. Logistic regression method for multivariate analysis of urodynamic parameters (maximal and average flow rate, time to void and acceleration), age, menopausal status, parity, concomitant anorectal disorders with respect to voiding difficulties symptoms univariate analysis of multiple factors with respect to voiding difficulties symptoms our results show that 25% of sui women without obstructive symptoms, i.e. Without an obvious cause for bladder outlet obstruction (no severe genital prolapse (> grade 1)), having had no previous surgery for sui, and with no neurological disorders, have an abnormal uroflowmetry, and thus a higher risk of post - surgery obstructive disorders . Our study clearly demonstrates the poor predictive value of the vds questionnaire, when compared with urodynamic data . The prevalence of voiding dysfunction symptoms among women is not easy to determine, in contrast to storage symptoms, which are more often related and analyzed . Stress urinary incontinence and bladder outlet obstruction (boo) can coexist in women; bradley found 19 cases of boo out of 104 (18%), defined on the basis of pressure flow studies among women presenting with sui . In our study, we found a high prevalence of vds (61%), probably because in the vds group we included women with any level of positive response, even those who gave one occasionally response to the vd items (bfluts questionnaire). Urodynamic evaluation of the voiding phase in sui women before surgery is useful in order to predict the risk of vd and urinary retention, and to inform women about these potential complications . Surgical treatments of sui using mid - urethral sling procedures are known to affect the voiding phase: the spontaneous flow curve changes to a more obstructive pattern in 40% of cases, and the maximum and mean flow rates decrease significantly after one year . The incidence of urinary retention after such procedures ranges from 2.216%. [13] postoperative vd induces a decrease in global satisfaction after surgery, and leads to an impairment of the quality of life . Factors which correlate highly with a postoperative voiding dysfunction include a preoperative peak flow rate <15 ml / s (several studies), and an abnormal uroflow pattern or detrusor pressure <12 cm h2o. [31114] therefore, screening for such factors among sui women is critical . One of the main limitations of the current study is the lack of a standard definition for boo in urodynamics for women . Since voiding cystometry had not been performed, boo cannot be defined urodynamically in the current study . Farrar et al ., defined obstruction as qmax <15 ml / s with a voided volume of 200 ml . We added the flow curve pattern criteria, because a pathological pattern with a normal maximal flow rate can reflect voiding difficulties . Moreover, in pressure flow studies in women, the transurethral catheter has a significant impact on the urine flow. [1418] however, free flow uroflowmetry is a composite interaction between the detrusor pressure and the resistance produced by the urethra . Bladder outlet obstruction as well as impaired detrusor contractility can perturb uroflowmetry . In our population, we needed to detect voiding difficulties, whatever their origin, because among sui women both these causes of voiding disorders can promote obstructive complications after surgery . Chassagne et al ., prospectively studied 35 clinically obstructed women and 124 control patients . They determined cutoff values for the pressure flow studies as: qmax<15 ml / s and pdet . Qmax> 20 cm h2o, with a sensitivity of 74.3% and a specificity of 91.1% . No information was provided regarding the clinical criteria used to select the clinically obstructed patients . Qmax> 20 cm h2o) during detrusor pressure uroflow studies . Among the 38 women considered as obstructed within this definition, they concluded that micturition symptoms relevant to bladder outlet obstruction are non - specific, and that a complete urodynamic evaluation is essential . The correlation between obstructive symptoms and objective urodynamic findings is known to be poor, but has never been studied in this specific population of sui women, for which all cases with a pop - q> stage 1, previous surgery for sui, or neurological disorders, were excluded . Indeed, we excluded the most common etiologies of urodynamic assessment of bladder outlet obstruction . Groutz et al ., reported 26% of prior anti - incontinence surgery and 24% of severe genital prolapse in a population of 38 women presenting with urodynamically assessed obstructive criteria . Wyndaele et al ., recently confirmed the poor correlation between symptoms and urodynamic data, and a high prevalence of vds in women, whether it be considered to have a pathological origin or not . The absence of voiding symptoms is not a guarantee of normal micturition, since we found that almost one - third of the women not complaining of any voiding difficulty were actually shown to have an abnormal uroflowmetry . Previous studies[1421] have clearly demonstrated the lack of correlation between symptoms and urodynamic diagnoses, especially for obstructive symptoms . We found the same results, but in a particular population of sui women, with no obvious reasons for obstruction . Even in this selected population, in which voiding dysfunctions should be less frequent than in the general population, we found that almost 30% of the patients had an abnormal uroflowmetry . No correlation was found between obstructive symptoms and boo as defined on uroflowmetry, in a specific population of sui women.
Scurvy is a disease that played an important role in history and used to be the number one killer of sailors . It is still diagnosed in third - world countries because of malnutrition and in epidemic form in refugee camps . A 35-year - old patient was seen at the emergency department of a level 1 trauma centre with spontaneous bruisings on the lower extremity . Initially, the patient was seen by an orthopaedic surgeon at an outpatient clinic with a painful knee without any preceding trauma . The procedure was postponed twice . At first, the arthroscopy was cancelled because the patient had the flu . The second time the orthopaedic surgeon postponed the operation because of extensive bruising on the right leg (fig . 1) moreover, doctors of the internal medicine and dermatology department were consulted to explore the origin of the haematomas . 2) and a biopsy was performed . At the time of the current presentation at the emergency department, because of the progression of the haematomas to the patients left leg, the surgeon was consulted to rule out an active bleeding focus . Figure 1:small bruises on the upper legs . The patient was an electrician, currently unemployed because of knee problems . Since 10 weeks the haematomas on his right leg occurred after an episode of flu a month ago (fig . Ever since, he had been exhausted, and he had spent the majority of his time in bed . His dentist proposed to remove the decaying teeth . According to the patient, the bad teeth apparently, the patients eating regimen only consisted of bread, sometimes with spread, but mostly without any additions . For this eating habit on physical examination, we encountered a pale patient with haematomas on his upper legs, generally green / blue or yellow coloured . Laboratory tests revealed anaemia with a haemoglobin drop of 2.5 points in 2 weeks (from 8.6 to 5.7 mmol / l). No surgical cause for the haematomas was found . Instead, the diagnosis of a severe vitamin c deficiency (scurvy) by malnutrition due to his eating disorder was considered . After laboratory blood tests were drawn to confirm the diagnosis, vitamin c supplements were started . It is regrettable that the united east india company (voc) lost more sailors on scurvy than on the battlefield during the seventeenth century . Scurvy was one of the limiting factors for travelling long distances on ships because of the absence of fresh food, fruit and vitamins . Scurvy was first described by hippocrates . Later in 1753, a surgeon of the royal navy described how citrus fruits enhanced the symptoms of scurvy . In 1930, it was discovered that depletion of vitamin c level was the cause . Vitamin c is needed for the synthesis of collagen, which is essential for firmness of the blood vessels . In patients with scurvy, the presentation of scurvy is often malaise, fatigue, stiff joints and bruising, mostly on the upper thighs and legs . The next stage consists of open wounds, jaundice, fever, loss of teeth and finally death . Scurvy does not occur in most animals as they can synthesize their own vitamin c in contrast with the human, for example guinea pigs and certain monkey species . Treatment is relatively simple with a versatile diet with citrus fruits, sweet peppers and tomatoes . The recommended daily quantity of vitamin c is 75 mg for women and 90 mg for man (http://www.who.int/en/), but up to 40% more can be necessary in smokers and during infection . Nowadays, scurvy occurs predominantly in developed countries because of malnutrition, and frequently epidemics are reported from the lesser civilized areas . This present case report emphasizes that scurvy may still occur in developed countries and that patients with scurvy could be encountered by physicians of multiple medical disciplines . Scurvy should be considered in risk groups, e.g. Singles, patients with eating disorder, students, elderly, alcohol abusers and patients after gastric surgery [5, 6]. Recently, in wales (uk) in 2011, a young patient died of scurvy (http://www.bbc.com/news/uk-wales-31039895). However, even in these modern timeframe, groups with a high risk of vitamin deficiencies can be discerned . In our patient, the biopsy could have been avoided, and supplements could have been initiated more quickly in case of higher awareness of the signs and symptoms of vitamin c deficiency.
Human movement can be classified into walking and running, the latter of which easily fatigues the lower limb muscles1,2,3,4 . During running, the lower limbs must cope with the repeated transient impact of vertical ground reaction force (grf), which is an abrupt collision force equal to about 1.5- to 3-fold the body weight5 . Such repeated impacts are considered to cause lower limb muscle fatigue via chronic irritation . The incidence of running injury is affected by the running velocity and distance ran . Investigated 17,000 patients6 and found a significantly higher incidence of osteoarthritis in men who were involved in running> 20 miles per week . Koplan et al . Found that the risk of injury increased with increasing weekly distance3 . On the other hand, imai et al.7 found that the number of marathon athletes who stopped running within four hours was significantly high . Running faster generally produces greater ground reaction force (grf) and imposes greater stress on various parts of the body8, 9 . Running injuries occur most frequently in the knee, foot / ankle, and lower leg according to taunton, et al.10, who found that the most common overuse injuries included patellofemoral pain syndrome, iliotibial band friction syndrome, and plantar fasciitis . Running velocity is affected by various conditions including individual running ability . We postulated that the load imposed on the lower limbs would change at different running velocities . Furthermore, because portion failure differs among individuals, the load applied to each muscle is probably not uniform . Therefore, we analyzed muscle activity under free walking, jogging (8.7 km / h), and running (8.8 km / h) conditions on a treadmill . Ten male students without leg injuries (age, 23.2 6.5 y; height, 170.4 5.7 cm; weight, 67.6 11.1 kg; bmi, 23.3 3.2) provided written informed consent to participate after receiving an oral and written explanation of the study and its purpose . The ethics review board at heisei college of health sciences approved this study (no . The participants did not routinely run but participated in recreational sports once or twice each week . Muscle activity was measured by surface electromyography using a telemyo g2 and myoresearch xp (noraxon usa inc ., scottsdale, az, usa) with disposable m-00-s blue sensor polymer electrodes (ambu a / s, ballerup, denmark) attached to the belly of the muscle while the participants moved on a gait trainer system 2 treadmill (biodex medical systems inc . Muscle output was recorded at 30 frames / sec using a video camera to synchronize the movements with the electromyographic data . Activity was assessed at the left vastus medialis, vastus lateralis, hip adductors, tibialis anterior, lateral head of gastrocnemius, medial head gastrocnemius, and soleus . Maximum voluntary isometric contraction (mvc) was determined as manual resistance against a maximally contracted muscle . The participants walked, jogged, and ran for 10 minutes in random order, and the myogenic potentials were measured for 30 seconds 10 minutes later . Analog signals of myogenic potential were processed using a band - pass filter (10500 hz) at a sampling frequency of 1,000 hz . The greater trochanter, lower limb joint space, and lateral malleolus of the left hip, knee, and ankle were marked with tape to measure the range of motion . One 30-second cycle of walking, jogging, and running recorded with the video camera was selected, and then initial contact, mid stance, toe off, and the range of motion of hip flexion, knee flexion, and ankle dorsiflexion were measured on printouts . In addition, using the time required for one cycle, stride was calculated . Electromyographic data were analyzed using the average value of each muscle output and central frequency . The average activity was calculated from 30-second cycles of walking, jogging, and running, including both the swing and stance phases . These output values were divided by the mvc to determine the% mvc of each muscle . In addition, lower limb joint angles on printouts were measured using a protractor . The data were analyzed using a one - way analysis of variance, and statistical significance was accepted at p <0.05 . The average walking, jogging, and running speeds were 3.6 0.4, 6.7 0.6, and 10.4 1.3 km / h, respectively . The average electromyographic activities of the vastus medial, tibialis anterior, medial head of the gastrocnemius, and lateral head of the gastrocnemius were significantly higher during jogging and running compared with walking . The hip adductors and vastus lateralis did not significantly differ (table 1table 1.average% mvc of muscles (n=10)walkingjoggingrunningvastus medialis12.52.735.85.3 * 38.84.6*vastus lateralis17.16.136.38.137.76.8hip adductors31.26.741.07.250.17.1tibialis anterior14.31.329.33.8 * 37.63.0*lateral head of the gastrocnemius16.03.042.68.5 * 40.86.2*medial head of the gastrocnemius30.83.758.17.6 * 63.35.3*soleus18.45.039.67.844.86.2*values are meansse . * p<0.05, vs. walking . ). The maximal electromyographic activities of the vastus medialis during jogging and running and medial head of the gastrocnemius during running were significantly higher than during walking (table 2table 2.maximum% mvc of muscles (n=10)walkingjoggingrunningvastus medialis54.87.6105.915.2 * 135.711.5*vastus lateralis68.129.0103.117.0134.423.6hip adductors147.231.598.620.2137.320.0tibialis anterior54.16.385.820.787.87.9lateral head of the gastrocnemius69.014.4125.527.7136.515.1medial head of the gastrocnemius129.921.6190.427.8224.226.0*soleus103.351.8113.625.9179.028.6values are meansse . The central frequency did not significantly differ (table 3table 3.average central frequency of muscles (n=10)walkingjoggingrunningvastus medialis23.16.437.95.932.46.4vastus lateralis29.75.840.35.641.86.9hip adductors15.24.120.44.123.33.4tibialis anterior59.86.066.06.566.17.4lateral head of the gastrocnemius34.37.142.77.255.76.0medial head of the gastrocnemius50.07.362.59.963.19.2soleus61.27.645.18.259.711.8values are meansse). The angle of the knee at initial contact, mid stance, and toe off significantly differed, with the knee being more flexed during jogging and running than walking the knee being more flexed during running than jogging at mid stance and toe off (table 4table 4.average left lower limb joint angles (n=10)walkingjoggingrunninghip joint flexionic20.52.424.52.228.02.9ms10.51.623.51.5 * 28.51.7*to6.02.23.02.6 * 5.51.9*knee joint flexionic4.22.114.82.2 * 17.22.0*ms15.02.141.51.5 * 48.01.5*,**to57.11.338.92.4 * 25.42.4*,**ankle joint dorsiflexionic2.23.64.02.06.21.1ms6.51.320.01.7 * 22.01.3*to14.82.214.82.720.13.5values are meansse . * p<0.05, vs. walking . * * p<0.05, vs. jogging . Ic: initial contact, ms: mid stance, to: toe off). Ic: initial contact, ms: mid stance, to: toe off the average lengths of the running stride were significantly longer than those of jogging and walking . Also, that of jogging was significantly longer than that of walking (table 5table 5.average length of stride (n=10)walkingjoggingrunningstride (m)1.240.041.460.06 * 2.140.08*,**values are meansse . Hreljac identified training, anatomy, and biomechanical factors as risk factors associated with running, since fast running generates considerable grf and training to run stresses the joints, muscles, and ligaments12 . The present study investigated differences in the amount of muscle activity during walking, jogging, and running . All participants walked freely at their own pace and then jogged at 8.7 km / h and ran at 8.8 km / h . The central frequency of each muscle seemed to remain essentially unchanged between running and jogging compared with walking, and fatigue did not arise . The vastus lateralis and vastus medialis of the quadriceps not only act on the lower limb during running or walking but also suppress damage to the knee during weight - bearing in the stance phase . Therefore, we speculated that the amount of muscle activity would increase as the grf increases . The averaged values of the vastus medialis were significantly higher during running and jogging compared with walking . Brownstein et al.13 found that a knee position that is more flexed than extension is due to the amount of activity of the vastus medialis . The present study found that the knees were flexed significantly more during running and jogging compared with walking at initial contact and during mid stance . These findings support the notion that the vastus medialis works easily during jogging and running . In addition, kim et al.14 showed that the amount of activity in the vastus medialis rose in response to an elevated walking speed . Furthermore, in a previous study15, we compared the muscle activity during jogging and walking at the same velocity . In this study, the activity of the vastus medialis during jogging was significantly higher, and the knee joints exhibited significant flexion during jogging . Load was especially applied in the direction of internal rotation in the stance phase . A study by ono et al.17 showed that the output of the vastus medialis was increased in the lower leg during internal rotation . On the other hand, the output at 90 of flexion between knee extension from the vicinity of the vastus lateralis muscle did not significantly change13 . In addition, the activity of the vastus lateralis muscle during walking was significantly higher, which could account for the small difference between walking and running . The average values of the adductor muscles did not significantly differ among walking, jogging, and running . Along with the outer muscles of the hip joint such as the gluteus medius, the adductor muscles maintain the inner - outer intermediate position of the lower limb during running . The types of hip movement involved in running are primarily flexion and extension, with minimal adduction and abduction . In addition, because the treadmill floor is horizontal, the trunk is also likely to become upset . Therefore, we considered that the adductor muscles do not play significant roles in walking, jogging and running . The averages values for the tibialis anterior muscle were significantly higher during running and jogging compared with walking . The tibialis anterior muscle contracts either centrifugally or isometrically before and after initial contact to control the foot to prevent falling18, 19 . This muscle was significantly more contracted during running and jogging, perhaps because movement was faster . The average values of the lateral and medial heads of the gastrocnemius were significantly higher during running and jogging compared with walking . The gastrocnemius works from the loading response to the terminal stance between the stance phase18 . The knee joint extends in the late stance phase of the running stride via plantar flexion of the ankle joint . The force exerted on the achilles tendon during running exceeds 12-fold the weight of the runner20 . A large output by the gastrocnemius is required to advance the body during running . The average value of the soleus muscle was significantly higher during running than during walking . The soleus is a single joint muscle that runs from the proximal portion of the tibia and fibula to the achilles tendon . Thus, the amount of muscle activity is not affected by the angle of the knee joint . Because the knee flexes deeply in mid stance during running, more extension is required at toe off, and thus a large force is required for the triceps surae muscle . Under such conditions, the soleus muscle works more easily than the gastrocnemius, which is a biarticular muscle . According to mann et al.21, the angle of the lower limbs and the amount of muscle activity increases during running at higher velocities compared with walking . The stance phase is longer than the swing phase during walking but is shorter during running . According to kluitenberg et al.22, grf on a treadmill and on the ground increases in the same way when aramptzis et al.23 reported that the mechanical power of the knee joint and ankle joint increases with increasing running velocity, and the present study found that, the stride was extended in accordance with the increase in velocity . We considered that exercise load is greater during running compared with walking due to these factors . The present study found that the amount of activity in the soleus muscle was significantly higher during running and jogging compared with the amounts of activity in the vastus medialis, tibialis anterior, and gastrocnemius muscle, which are involved in walking . Therefore, it was suggested that an increase in velocity causes these muscles to carry a heavier load.
The online version of this article (doi:10.1007/s13300 - 015 - 0133-z) contains supplementary material, which is available to authorized users . Chronic kidney disease (ckd) is a common condition in patients with type 2 diabetes (t2 dm). An estimated 2035% of patients with t2 dm have moderate to severe renal impairment [1, 2]. However, many antihyperglycemic medications are contraindicated or need to be used with caution in patients with ckd, complicating t2 dm treatment choices and management . Patients with t2 dm and ckd are particularly susceptible to safety and tolerability issues related to many classes of oral antihyperglycemic agents (oaha). Dipeptidyl peptidase-4 inhibitors (dpp-4i) such as sitagliptin are well tolerated in a broad range of t2 dm patient types, including those with renal disease, and may therefore be preferentially used in patients with ckd . Prior studies have demonstrated the preferential use of sitagliptin in several populations [47]. In general, patients initiating treatment with sitagliptin were older and had more complications of diabetes and comorbidities than patients initiating other antihyperglycemic therapies [47]. If not recognized and appropriately considered in the analysis, this preferential selection of patients with specific demographic and disease characteristics for treatment with sitagliptin (channeling bias) could lead to inaccurate treatment effect estimates in comparative analyses that include sitagliptin . The objective of this study was to describe the baseline characteristics of patients with t2 dm and ckd initiating treatment with sitagliptin or non - dpp-4i oahas to ascertain whether channeling exists in this patient population . The truven health marketscan databases (marketscan, truven health analytics, ann arbor, mi, usa) contain medical claims records for more than 150 million unique patients dating from 1996 . The records are derived from outpatient and inpatient insurance claims for employees of over 100 employers participating in more than 12 health plans, and their beneficiaries in the united states . Records consist of commercial claims and healthcare encounters, including information on demographics, health plan membership, international classification of diseases, ninth revision, clinical modification (icd-9-cm) codes, and current procedure terminology (cpt) codes . The records of retirees with supplemental insurance are included in the database thus providing data on the elderly with continuity of care across those <65 and 65 years of age . Patients 25 years of age with t2 dm and ckd, with claims in the united states (us) between january 2006 and june 2012, were identified in marketscan . Of these patients, those initiating sitagliptin or a non - dpp-4i oaha were categorized by complexity of antihyperglycemic treatment . Patients were identified as having t2 dm if marketscan records for the patient indicated at least one inpatient or outpatient diagnosis of diabetes and at least one prescription for oaha medication . Patients with ckd were identified by icd-9-cm diagnostic codes (585, 585.3, 585.4, 585.5, 585.6, 585.9, 403, 403.0, 403.00, 403.01, 403.1, 403.10, 403.11, 403.9, 403.90, 403.91, 250.4, 404, 404.0, 404.00, 404.01, 404.02, 404.03, 404.1, 404.10, 404.11, 404.12, 404.13, 404.9, 404.90, 404.91, 404.92, 404.93, 582, 582.0, 582.1, 582.2, 582.4, 582.8, 582.81, 582.89, 582.9). Antihyperglycemic treatment was defined as: (1) initiating monotherapy (1 new outpatient prescription record on or after the t2 dm diagnosis); (2) escalating to dual combination therapy (1 new prescription for a 2nd class 90 days after the 1st class, with prescription for 1st class overlapping the index date of 2nd class); (3) escalating to triple combination therapy (1 new prescription for a 3rd class 90 days after the 2nd class, with prescriptions for 1st and 2nd classes overlapping the index date of 3rd class). Patients were required to have at least 1 year of continuous enrollment in the database prior to initiation / escalation of antihyperglycemic treatment . Patients were excluded from the analysis if they had a diagnosis of type 1 diabetes, ketoacidosis, malnutrition - associated diabetes, drug - induced diabetes or gestational diabetes without a subsequent t2 dm diagnosis code . Patients with icd-9-cm codes explicit for mild renal disease (stage 1 and 2) and patients on insulin or other injectable therapy were also excluded from the analysis . Demographics, and clinical conditions and health care resource utilization recorded up to 5 years before therapy initiation were assessed as baseline characteristics . Over 70 clinical conditions and comorbidities may have been recorded in the database, including diabetes complications, cancers, and cardiovascular (cv), metabolic, gastrointestinal, hepatic, infectious, psychiatric, pulmonary, and neurological events . Types of health care resource utilization recorded in the database included physician and emergency department visits, hospitalizations, days hospitalized, and number of medications received . Differences between sitagliptin and non - dpp-4i oaha treatment groups were compared using absolute standardized differences (asd). Asd is the difference of two means or proportions divided by the pooled estimate of the standard deviation . Unlike the traditional p value, asd is a measure of difference that is not influenced by large sample sizes and has been demonstrated to be a better measure of covariate balance [10, 12]. An asd of at least 10% was used to indicate a meaningful difference between treatment groups . This article does not contain any new studies with human or animal subjects performed by any of the authors . A total of 35,922 patients with t2 dm and ckd were identified as meeting the inclusion criteria . Over 45% of patients (46.7%; n = 16,742) initiated sitagliptin (n = 1234) or a non - dpp-4i oaha monotherapy (n = 15,508), 40.5% (n = 14,540) initiated an escalation to dual combination therapy (sitagliptin, n = 2683; oaha, n = 11,857), and 12.9% (n = 4640) initiated an escalation to triple combination therapy (sitagliptin, n = 1385; oaha, n = 3255). Roughly, 15% of patients with t2 dm and ckd (14.8%; n = 5302) initiated treatment with sitagliptin . In comparison, in the patients excluded from this analysis due to a lack of recorded ckd, the percentage of patients initiating sitagliptin was 7.4% . The greatest differences between treatment groups were observed in patients initiating monotherapy or an escalation to dual combination therapy . Compared to patients initiating monotherapy with non - dpp-4i oahas, patients initiating monotherapy with sitagliptin were older (mean [standard deviation (sd)]: sitagliptin 68.8 [12.5] years, non - dpp-4i 66.6 [12.8] years; asd 17%), were more likely to have a history of heart failure (fig . 1a; sitagliptin 23.0%, non - dpp-4i 18.6%; asd 11%) or arrhythmia (fig . 1a; sitagliptin 37.7%, non - dpp-4i 31.7%; asd 13%), were more likely to use loop diuretics (fig . 1a; sitagliptin 44.2%, non - dpp-4i 38.0%; asd 13%) or beta - blockers (fig . 1a; sitagliptin 66.3%, non - dpp-4i 61.3%; asd 11%), and had more physician visits (fig . 1b; mean [sd]: sitagliptin 73.2 [57.6] physician visits, non - dpp-4i 66.3 [55.4] physician visits; asd 12%). The differences between treatment groups (non - dpp-4i oaha users versus sitagliptin users) observed in patients initiating an escalation to dual therapy were similar to those observed in patients initiating monotherapy, with the exception that the between - group age difference was not as great (mean [sd]: sitagliptin 71.1 [11.1] years, non - dpp-4i 70.0 [11.0] years; asd 10%) and the differences for history of arrhythmia and use of beta - blockers were not meaningful (fig . 1c, d).fig . 1baseline characteristics of patients with type 2 diabetes and chronic renal disease up to 5 years before initiating treatment with sitagliptin or non - dpp-4i oral antihyperglycemic agent as monotherapy or as part of dual or triple therapy . A, c, e clinical conditions and comorbidities . Asd of 10% indicates a meaningful difference between treatment groups . For any between - group difference of asd of at least 10% asd absolute standardized difference, chf congestive heart failure, dpp-4i dipeptidyl peptidase-4 inhibitor, hosp hospital, htn hypertension, meds medications, mi myocardial infarction, phys physician, tia transient ischemic attack baseline characteristics of patients with type 2 diabetes and chronic renal disease up to 5 years before initiating treatment with sitagliptin or non - dpp-4i oral antihyperglycemic agent as monotherapy or as part of dual or triple therapy . A, c, e clinical conditions and comorbidities . Asd of 10% indicates a meaningful difference between treatment groups . For any between - group difference of asd of at least 10%, asd absolute standardized difference, chf congestive heart failure, dpp-4i dipeptidyl peptidase-4 inhibitor, hosp hospital, htn hypertension, meds medications, mi myocardial infarction, phys physician, tia transient ischemic attack in patients initiating an escalation to triple combination therapy, the differences between treatment groups (non - dpp-4i oaha users versus sitagliptin users) were not as pronounced as those seen in patients initiating monotherapy or escalation to dual therapy, including the between - group age difference (mean [sd]: sitagliptin 68.9 [10.9] years, non - dpp-4i 68.4 [10.5] years; asd 5%; fig . In this study of patients with t2 dm from an employee - based insurance database, sitagliptin was initiated in a higher percentage of patients with t2 dm and ckd (14.8%) compared to patients with t2 dm but no record of ckd (7.4%). Unlike many other oahas, sitagliptin is approved for patients with any stage of renal disease . In light of this and its favorable renal safety profile [1215], the higher use of sitagliptin in patients with ckd observed in the current analysis is not surprising . In general, patients with t2 dm and ckd who initiated treatment with sitagliptin tended to be older and were more likely to have a pre - treatment history of heart failure, arrhythmia, or use of loop diuretics or beta - blockers than patients initiating other classes of oaha . In this context, it is worth noting the results of a large, recently completed clinical trial examining the effects of adding sitagliptin to usual care in patients with t2 dm and cv disease . In the overall study population, no difference in cv event rates compared with placebo was observed (hazard ratio [hr] for the primary composite cv outcome was 0.98; 95% confidence interval (ci): 0.88, 1.09; p <0.001 for noninferiority). Additionally, in patient subgroups evaluated by renal function, no difference in cv risk was noted for patients with ckd [estimated glomerular filtration rate (egfr) <60 ml / min/1.73 m; hr = 0.92; 95% ci: 0.78, 1.10) or those without ckd (egfr 60 ml / min/1.73 m; hr = 1.00; 95% ci: 0.89, 1.13). The most pronounced differences in baseline characteristics between the treatment groups were observed between patients initiating monotherapy . As treatment complexity increased, the differences in baseline characteristics between treatment groups persisted but were attenuated, presumably due to diminishing treatment options with increasing treatment complexity . These observations of channeling in patients receiving treatment with sitagliptin are similar to those previously reported in a general t2 dm population [47]. While the marketscan database includes insurance claims data on a large, diverse population from the us, these results may not be generalizable to the overall us population or to ex - us populations . In addition, the primary uses of these data are for administrative purposes, not research . Consequently, the database has missing or limited data on a number of important disease characteristics and comorbidities . Importantly for this study, patients with end - stage renal disease are likely underrepresented since these patients are medicare eligible . Chronic renal disease was defined solely through icd-9-cm codes as laboratory data are not available in our dataset . This study further documents the presence of channeling in patients initiating treatment with sitagliptin . In this study, patients with ckd initiating treatment with sitagliptin were generally older and were more likely to have a pre - treatment history of heart failure, arrhythmia, or use of loop diuretics or beta - blockers than patients initiating other classes of oral therapies . If not recognized and analyzed appropriately, this channeling could lead to biased treatment effect estimates in comparative analyses, including those involving users of sitagliptin . K. g. brodovicz was an employee of merck sharp & dohme corp ., a subsidiary of merck & co., inc ., kenilworth, nj, at the time this analysis was carried out and may own stock and/or hold stock options in the company . Kenilworth, nj, at the time this analysis was carried out and may own stock and/or hold stock options in the company ., a subsidiary of merck & co., inc ., kenilworth, nj and may own stock and/or hold stock options in the company . This article does not contain any new studies with human or animal subjects performed by any of the authors . This article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made.
The use of the kuntscher nail has been the most important advancement in trauma surgery . He had an acetabulum fracture and a femoral shaft fracture treated 30 years ago with a reamed kuntscher femoral nail . Lateral hip approach was performed and after attempting to remove the nail with the specific tools being unsuccessful we decided to be more aggressive . Firstly, we performed a simple unicortical osteotomy on the lateral side from the proximal part to below the callus in order to decompress the femoral canal without success . Secondly, a trench in the greater trochanter around the proximal hole was performed to hit the nail from below which was still insufficient and furthermore, the hole broke when hitting the nail so we needed to drill a new hole distally . Several cerclages closed the osteotomy and a bone graft was used to close the trench . With this case report, we present a new salvage technique to remove an incarcerated kuntscher nail when all the described methods have failed . The use of the kuntscher nailing system for the treatment of long bone fractures has been the most important advancement in trauma surgery in recent history . Since its first implementation in a german hospital in the late 30 s, removal of a kuntscher nail is considered a routine procedure but could be really challenging . Bone ingrowth or overgrowth, damage to the proximal threads of the nail, and broken nails or locking screws may complicate the removal of intramedullary nails . The biggest challenge appears when all the described methods result in failure of removal of the nail . This article presents a case of an incarcerated femoral nail and describes a salvage procedure for nail extraction after all previously described methods have failed . The patient was involved in a plane accident 30 years before sustaining a femoral shaft fracture treated with a reamed kuntscher nail and a posterior wall acetabulum fracture treated with open reduction and internal fixation with lag screws (fig.1). The patient came to our outpatient clinic complaining about inguinal pain and chronic leg pain with limitation of activities of daily living, although he was able to walk for more than one hour . On physical examination, the ipsilateral knee had full range of motion and the patient did not need any crutches to walk without limping . The postelmerldaubign scale was 14 points (4 for pain, 5 for walking and 5 for range of motion). As a part of the initial evaluation, a blood test with infection parameters was performed and was negative for infection . Pre - operative radiographs showed a healed femoral fracture in all 4 cortices with an intramedullary kuntscher nail without locking screws and cortical thickening at the fracture site (fig . Pre - operative x - ray of the pelvic ring: intramedullary kuntscher nail in the left femur and osteosynthesis with three screws in the posterior wall of the acetabulum . Pre - operative x - ray of the distal part of the femur: fracture site healed and distal tip of the nail . The patient was informed about the incipient arthritis of the hip and the possibility to perform a one - stage or two - stage surgery . The surgical risks were discussed with the patient, including pain after hardware removal and failure to remove the nail, specially this last point because other surgeons had tried to do the same procedure few years before and had failed after many hours of surgery . Firstly, remove the nail at all costs and depending on the outcome of this first surgery he would assess the hip replacement surgery . The patient was put in a lateral position and a lateral hip approach was done . The first step was to find the proximal tip of the nail which was found seated deep in the great trochanter . The initial device used to remove the nail was the conical extraction tool that was unsuccessful after several attempts . After the overgrowth bone was removed of the proximal part of the nail a hook extraction system was engaged with difficulty . However, the nail did not move after multiple hits with a 1 kg hammer and finally the hook broke itself . At this point, we decided to use the saw to perform a simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal (fig . 3). After this decompression osteotomy we tried to hit the nail from below with an impactor engaged in the proximal hole of the nail . However, the implant remained in the same position . Clinicalintra operative image: simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal . After trying all these different ways to remove the nail being unsuccessful, we decided to continue the longitudinal osteotomy from proximal to distal in the lateral side of the femur . The nail was found in place with on growth and overgrowth in almost entire length of the nail . A new attempt to hammer the nail from below was performed and the nail started to move gradually until the proximal hole of the nail broke (fig . 4). After so many attempts, we did not give up and proceeded to drill a new hole distally with a diamond drill (fig . 5) to finish the nail removal . Clinical intra - operative image: detail of the moment when the nail started to move gradually until the proximal hole of the nail break . Clinical image . Subsequently, several cerclages and a bone allograft was used to close the longitudinal osteotomy (fig . Clinical intraoperative image: several cerclages closing the osteotomy with allograft bone used to close the longitudinal osteotomy . The patient was admitted to the hospital for pain and bleeding control . On the second day of hospitalization, the patient underwent a blood transfusion as his hemoglobin was reported to be 7.1 g / dl . The patient was discharged on day 4 after antibiotic prophylaxis, deep vein thrombosis prophylaxis with low - weight - molecular heparin and ambulation with crutches without weight bearing . At 8 weeks of follow - up the patient was satisfied at 1 year of follow - up with no complications and the x - ray showed complete healing of the longitudinal osteotomy (fig ., the patient is free from pain in the leg with only sporadic hip pain, so there is no indication of hip replacement surgery for the time being various reasons have been described in the literature for nail incarceration, including excessive callus formation closing the intramedullary canal, ingrowth of bone into the nail, bone ingrowth through the locking holes and bent or broken nails . There are different techniques to remove retained intramedullary nails, most of these techniques are designed for broken nails, but others are for incarcerated nails . There is only one case similar to our case report by lindeque et al which describes removal of tibial nail using a large longitudinal osteotomy . We decided to perform a two - stage procedure especially due to the incipient arthritis of the hip . If our patient would have had advanced stage of arthritis, we could have considered a single - staged procedure with nail removal and hip replacement or a hip replacement without removing the nail . Goosen et al treated a similar case in which they cut the proximal end of the nail to the length needed in order to implant a hip arthroplasty at the top of the nail . Mont et al used this technique on fifteen patients with femoral implants or extraarticular deformities . However, despite the aggressiveness of the procedure, the patient had a good result, and the osteotomy healed normally with no complications . This is the first case published in the literature using this longitudinal osteotomy to remove a femoral nail . It is recommended to remove it as soon as it possible to minimize later complications.
The anticancer agent 5-fluoro-2-deoxyuridine (floxuridine) has been shown to be clinically effective in the treatment of colon carcinoma and colorectal cancer that has metastasized to the liver . However, the adverse effects associated with chemotherapeutics are still unresolved, and many efforts have been made to minimize side - effects and maximize therapeutic efficacy . Prodrug strategies have been increasingly utilized over the past two decades in order to overcome undesirable physicochemical properties of drugs, to improve oral bioavailability and to minimize toxic side - effects . A majority of the efforts have focused on antiviral and anticancer drugs and reflect the need for improved targeting, more selective action and further development of orally available alternatives . Amino acid ester prodrugs of poorly permeant anticancer and antiviral drugs have been designed for targeted delivery via specific transporters in order to improve their oral bioavailability and metabolic disposition . Amino acid ester prodrugs have been shown to be substrates for pept1, pept2, and atb transporters, and their improved oral bioavailability has been attributed to enhanced transport via carrier - mediated mechanisms . Alkyl ester prodrugs and amino acid ester prodrugs of floxuridine, for example, have been synthesized and tested for potential improvement of oral drug delivery . Amino acid ester prodrugs of floxuridine and an antiviral agent, acyclovir, have been shown to be substrates of the pept1 transporter . Pept1 is stereoselective and exhibits greater affinity for l - enantiomers of amino acids than d - enantiomers. (16) pept1 is predominantly expressed in the small intestine, has broad substrate specificity and can transport dipeptides, tripeptides, and -lactam antibiotics . The valyl ester prodrug of acyclovir significantly enhances oral bioavailability of acyclovir, and several reports suggest that oligopeptide transporters are responsible for absorption enhancement . Amino acid ester prodrugs may also facilitate enhanced delivery to pancreatic ductal cancer cells such as aspc-1 and capan-2, since these cells express oligopeptide transporters at relatively high levels. (25) the activation of prodrug to the parent drug following transport is an essential step and cannot be ignored . It has been shown that a specific enzyme, valacyclovirase, is primarily responsible for the conversion of valacyclovir to acyclovir . It has also been suggested that this enzyme might be involved in the activation of other amino acid prodrugs. (26) kim and colleagues reported that the substrate specificity of valacyclovirase is largely determined by the amino acid acyl - linked promoiety of the prodrug. (27) the metabolic conversion of floxuridine to 5-fluorouracil following systemic delivery has been shown to be detrimental to therapeutic efficacy of floxuridine . The mechanism of action of 5-fluorouracil (5-fu) and floxuridine (fudr) is well understood. (30) 5-fu toxicity is predominantly caused by 5-fu incorporation into rna . However, unlike 5-fu, fudr is specifically incorporated into dna and not into rna, which leads to the minimization of adverse effects . Several groups have reported that floxuridine is more potent than 5-fu and that the inhibition of cell proliferation is 10- to 100-fold higher than that of 5-fu . However, floxuridine is rapidly converted to 5-fu in many tissues, including the liver, by the enzyme thymidine phosphorylase. (34) as a consequence, higher doses of floxuridine are required for maintenance of clinical efficacy, leading to greater toxicity . Therefore, protection of the glycosidic bond of floxuridine is expected to maintain the high potency of the drug and facilitate administration of low doses that can selectively kill only proliferating cells by robust inhibition of dna synthesis . Improving the chemical stability of floxuridine to thymidine phosphorylase may enhance its therapeutic efficacy at low doses and obviate toxicity concerns . Although amino acid monoester prodrugs of floxuridine have been shown to provide enhanced pept1-mediated transport as well as enzymatic activation in intestinal and liver surrogate cell systems, dipeptide analogues may exhibit even higher affinity and transport via the oligopeptide transporter . Therefore, dipeptide prodrugs may be delivered more to a target site by carrier mediated transporters, and extra amino acid attached prodrugs could be more suitable for specific enzymatic activation at a target site than mono amino acid ester prodrugs . Several studies on amino acid modifications to increase specific transporter affinity have been conducted . However, direct comparisons of mono amino acid and dipeptide prodrugs in terms of transporter affinity, prodrug stability and activation have not been reported . In this report, we describe the synthesis, characterization, and stability of dipeptide monoester prodrugs of floxuridine . Various dipeptides and peptidomimetics have been tested to characterize the hpept1 transporter and improve its affinity, and mono amino acid ester prodrugs have been evaluated as hpept1 substrates . Based on those reports, six amino acids were chosen to be n - terminal amino acids of the dipeptide . The smallest amino acid, glycine, and bulky amino acids like phenylalanine and tyrosine were paired with those six amino acids to form dipeptides to test the hypothesis that molecular sizes may structurally affect its ester bond stability . The six dipeptide promoieties, l - phenylalanalyl - l - glycine, l - leucyl - l - glycine, l - glycyl - l - leucine, l - isoleucyl - l - glycine, l - valyl - l - phenylalanine, and l - phenylalanyl - l - tyrosine, were designed for targeted delivery to an oligopeptide transporter and tested . Since 5-ester prodrugs were found to exhibit higher affinity for transporters than 3-ester prodrugs,(14) only 5-dipeptide monoester floxuridine prodrugs were examined in this study . Uptake inhibition and permeability studies were conducted with caco-2 cells as well as with aspc-1 and capan-2 cells . The chemical stability at physiological ph and the enzymatic activation of the prodrugs in caco-2, aspc-1, and capan-2 cell homogenates were also evaluated to determine the effects of the amino acid / dipeptide promoiety structure on enzyme - mediated activation . The feasibility of selective antiproliferative action of amino acid / dipeptide floxuridine prodrugs was also explored using cancer cells that overexpress pept1 . Finally, the stability and transport characteristics of the dipeptide monoester prodrugs of floxuridine were compared with those of the corresponding amino acid monoester prodrugs . The tert - butyloxycarbonyl (boc) protected amino acids boc - l - isoleucine, boc - l - glycine, boc - l - valine, boc - l - phenylalanine, boc - l - leucine, boc - l - glycyl - l - leucine, boc - l - phenylalanalyl - l - glycine, boc - l - leucyl - l - glycine, boc - l - isoleucyl - l - glycine, boc - l - valyl - l - phenylalanine, and boc - l - phenylalanyl - l - tyrosine were obtained from chem - impex (wood dale, il). High - performance liquid chromatography (hplc) grade acetonitrile was obtained from fisher scientific (st . Louis, mo). N, n - dicyclohexylcarbodiimide (dcc), n, n - dimethylaminopyridine (dmap), trifluoroacetic acid (tfa), and all other reagents and solvents were purchased from aldrich chemical co. (milwaukee, wi). Cell culture reagents were obtained from invitrogen (carlsbad, ca), and cell culture supplies were obtained from corning (corning, ny) and falcon (lincoln park, nj). The synthesis and characterization of 5-mono amino acid ester prodrugs of floxuridine have been reported previously . Briefly, boc - protected dipeptides boc - l - glycyl - l - leucine, boc - l - phenylalanalyl - l - glycine, boc - l - leucyl - l - glycine, boc - l - isoleucyl - l - glycine, boc - l - valyl - l - phenylalanine, and boc - l - phenylalanyl - l - tyrosine, (1.1 mmol), dcc (1.1 mmol), and dmap (0.1 mmol) were allowed to react with floxuridine (1 mmol) in 7 ml of dry dmf for 24 h. the reaction progress was monitored by tlc (ethyl acetate). The residue was extracted with ethyl acetate (30 ml) and washed with water (2 20 ml), and saturated nacl (20 ml). The three spots observed on tlc were separated and purified using column chromatography (dichloromethane (dcm)/methanol, 20:1). The boc group was cleaved by treating the residues with 5 ml tfa: dcm (1:1). After 4 h the tfa salts of amino acid prodrugs of floxuridine were obtained as white fluffy solids . The combined yield, consisting of 3-monoester, 5-monoester, and 3,5-diesters, of each floxuridine prodrug was 60% . The prodrugs were determined to be 90%99% pure by reverse - phase hplc, and were easily separated from their parent compounds by reverse - phase hplc . The observed molecular weights of all prodrugs, determined by electrospray ionization mass spectra (esi - ms) obtained on a micromass lct esi - ms, were found to be consistent with those predicted by their structures . The structural identities of the prodrugs were then confirmed using proton nuclear magnetic resonance spectra (h nmr), obtained on a 300 mhz bruker dpx-300 nmr spectrometer . 5-l - leucyl - l - glycyl - floxuridine: yield, 15%; percent purity, 93%; h nmr (dmso - d6), 0.840.92 (6h, m, (ch3)2), 1.501.77 (3h, m, ch2), 2.122.28 (2h, m, c2), 3.784.35 (7h, m, ch of leu and ch2 of gly, c3, c4, c5), 6.16 (1h, t, c1, j = 6.0 hz), 7.94 (1h, d, chf, j = 6.9 hz); esi - ms, 417.1 (m + h). 5-l - glycyl - l - leucyl - floxuridine: yield, 15%; percent purity, 96%; h nmr (dmso - d6), 0.85 (3h, d, ch3, j = 6.5 hz), 0.90 (3h, d, ch3, j = 6.5 hz), 1.511.68 (3h, m, ch2), 2.122.26 (2h, m, c2), 3.544.40 (7h, m, ch of leu and ch2 of gly, c3, c4, c5), 6.16 (1h, t, c1, j = 6.0 hz), 7.90 (1h, d, chf, j = 6.8 hz); esi - ms, 417.1 (m + h). 5-l - valyl - l - phenylalanyl - floxuridine: yield, 30%; percent purity, 95%; h nmr (dmso - d6), 0.90 (3h, d, ch3, j = 6.9 hz), 0.95 (3h, d, ch3, j = 6.9 hz), 2.082.20 (3h, m, c2, ch of val), 3.02 (2h, m, ch2 of phe), 3.624.60 (6h, m, ch of val and phe, c3, c4, c5), 6.14 (1h, t, c1, j = 6.1 hz), 7.227.31 (5h, m, aromatic protons), 7.91 (1h, d, chf, j = 6.9 hz); esi - ms, 494.1 (m + h). 5-l - isoleucyl - l - glycyl - floxuridine: yield, 15%; percent purity, 93%; h nmr (dmso - d6), 0.87 (3h, t, ch3, j=7.3 hz), 0.94 (3h, d, ch3, j = 6.8 hz), 1.17 (1h, m, ch2), 1.52 (1h, m, ch2), 1.81 (1h, m, ch), 2.112.28 (2h, m, c2), 3.904.31 (7h, m, ch of ile and ch2 of gly, c3, c4, c5), 6.15 (1h, t, c1, j = 6.5 hz), 7.94 (1h, d, chf, j = 6.9 hz); esi - ms, 416.9 (m + h). 5-l - phenylalanyl - l - glycyl - floxuridine: yield, 16%; percent purity, 98%; h nmr (dmso - d6), 2.122.28 (2h, m, c2), 2.923.16 (2h, m, ch2 of phe), 3.904.34 (7h, m, ch of phe and ch2 of gly, c3, c4, c5), 6.15 (1h, t, c1, j = 6.5 hz), 7.277.36 (5h, m, aromatic protons), 7.94 (1h, d, chf, j = 6.5 hz); esi - ms, 451.1 (m + h). 5-l - phenylalanyl - l - tyrosyl - floxuridine: yield, 3.2%; percent purity, 99%; h nmr (dmso - d6), 2.102.32 (2h, m, c2), 2.722.92 (4h, m, ch2 of phe and tyr), 3.904.29 (6h, m, ch of phe and tyr, c3, c4, c5), 6.15 (1h, m, c1), 6.657.32 (9h, m, aromatic protons), 7.93 (1h, m, chf); esi - ms, 557.2 (m + h). Capan-2 cells (passages 5054), and aspc-1 cells (passages 6365) from american type culture collection (rockville, md) were routinely maintained in rpmi-1640 containing 10% fetal bovine serum . Caco-2 cells (passages 3035) from american type culture collection (rockville, md) were routinely maintained in dmem containing 10% fetal bovine serum, 1% nonessential amino acids, 1 mmol / l sodium pyruvate, and 1% l - glutamine at 5% co2 and 90% relative humidity at 37 c . Cells were grown in antibiotic - free media to avoid the possible transport interference by antibiotics . The cells were washed with 5 ml of ph 7.4 phosphate buffer (10 mmol / l), lysed by ultrasonication (micro ultrasonic cell disrupter model kt40, kontes, vineland, nj), and pelleted by centrifugation for 5 min at 1000 g . Protein amount was quantified with bio - rad (hercules, ca) dc protein assay using bovine serum albumin as a standard . The protein amount was adjusted to 500 g / ml, and the hydrolysis reactions were carried out in 96-well plates (corning). Caco-2, aspc-1, and capan-2 cell suspensions (250 l) were placed in triplicate wells, the reactions started with the addition of substrate, and cells were incubated at 37 c for 120 min . At the desired time point, sample aliquots (35 l) were removed and added to 150 l of acetonitrile (acn) containing 0.1% tfa . The mixtures were filtered with a 0.45 m filter at 1000 g for 10 min at 4 c . Undiluted plasma (250 l) was added to each well in triplicate, and substrate was added to initiate the reactions that were conducted at 37 c for 2 h. at various time points, aliquots (35 l) were removed and added to 150 l of acn containing 0.1% tfa . The mixtures were filtered with a 0.45 m filter at 1000 g for 10 min at 4 c . The nonenzymatic hydrolysis of the prodrugs was determined as described above, except that each well contained ph 7.4 phosphate buffer (10 mmol / l) instead of cell homogenate or human plasma . The stability of floxuridine and its prodrugs in the presence of thymidine phosphorylase (tp) was assessed by incubating the desired substrates (200 m) with tp (2.0 ng/l) in phosphate buffer (ph 7.0) at 37 c . Aliquots of the incubation mixture were sampled at 0, 1, 3, 5, 10, 30, 60, and 120 min, and quenched with cold acetonitrile (acn) with 0.1% tfa, filtered through a 0.45 m membrane, and analyzed for the concentrations of prodrug, floxuridine, and 5-fu by hplc . Caco-2 cells at nine days postseeding, and aspc-1 and capan-2 cells, both at four days postseeding, were incubated with 10 mol / l gly - sar (9.98 mol / l gly - sar and 0.02 mol / l [h]gly - sar) along with various prodrug concentrations (50.05 mmol / l) for 30 min . The cells were washed three times with ice - cold pbs and solubilized with 10 ml of scintillation cocktail (scintiverse, fisher scientific, st.louis, mo), and the amount of cell - associated radioactivity was determined by scintillation counting (beckman ls-9000, beckman instruments, fullerton, ca). Caco-2 cell monolayers were grown on collagen - coated polytetrafluoroethylene membranes for 21 to 24 days, and capan-2 cell monolayers were grown on the same type of membrane for 14 days . Transepithelial electrical resistance (teer) was monitored, and values of 240280 /cm in caco-2 and 380420 /cm in capan-2 (total area for both cells was 4.67 cm) were used in the study . Apical side and basolateral sides of transwell inserts were washed with mes (ph 6.0) and hepes (ph 7.4), respectively . Fresh mes and hepes buffers were reapplied to transwell inserts and incubated at 37 c for 15 min . Freshly prepared 0.1 mm drug solution in mes buffer (total 1.5 ml) was placed in the donor chamber, and the receiver chamber was filled with hepes buffer (total 2.5 ml) sampling from the receiver chamber (200 l) was conducted up to a period of 2 h at time intervals of 15, 30, 45, 60, 75, 90, and 120 min, at 37 c and replaced with an equal volume of fresh hepes buffer to maintain sink conditions in the receiver chamber . All samples were immediately acidified with 0.1% tfa and analyzed by reverse - phase hplc . The initial rates of hydrolysis were used to obtain the apparent first - order rate constants and to calculate the half - lives . The apparent first - order degradation rate constants of various floxuridine prodrugs at 37 c were determined by plotting the logarithm of prodrug remaining as a function of time . The slopes of these plots are related to the rate constant k and given by the degradation half - lives were then calculated by the equation statistical significance was evaluated with graphpad prism v. 3.0 by performing one - way analysis of variance with posthoc tukey s test to compare means . The apparent permeability (papp) for the prodrugs was calculated using the following equations: where jss is the steady state flux, m is the cumulative amount of prodrug, and regenerated mono amino acid prodrug, drug and 5-fu in the receiver compartment . The apparent permeability was calculated from steady state flux as follows: where a is the surface area of monolayer exposed to the permeant and c0 is the concentration of the prodrug in the donor solution . The concentrations of floxuridine and its prodrugs in the receiver and donor compartments were analyzed using hplc . The concentrations of prodrugs and their metabolites were determined on a waters hplc system (waters, inc ., the hplc system consisted of two waters pumps (model 515), a waters autosampler (wisp model 712), and a waters uv detector (996 photodiode array detector) controlled by waters millennium 32 software (version 3.0.1). Samples were resolved in a waters xterra c18 reverse - phase column (5 m, 4.6 250 mm) equipped with a guard column . The mobile phase consisted of 1% hfba / water (solvent a) and 1% hfba / acetonitrile (solvent b) with the solvent b gradient changing from 056% at a rate of 2%/min during a 28 min run . Standard curves generated for each prodrug, and their parent drugs were utilized for quantitation of integrated area under peaks . The detection wavelength was 254 nm, and spectra were acquired in the 220380 nm range . The cells were seeded onto 96-well plates at 125,000 cells per well and allowed to attach / grow for 24 h before drug solutions were added . The culture medium (rpmi-1640 + 10% fetal bovine serum) was removed, and the cells were gently washed once with sterile ph 6.0 uptake buffer . Floxuridine and floxuridine prodrugs were 2-fold serially diluted in ph 6.0 uptake buffer from 4 to 0.25 mmol / l . The wash buffer was removed, and 25 l of drug solution per well was added and incubated at 37 c for 2 h with aspc-1 cells and 4 h with capan-2 cells in the cell incubator . After this time period, the drug solutions were removed and the cells were gently washed twice with sterile uptake buffer . Fresh culture medium was then added to each well after washing, and the cells were allowed to recover for 24 h before evaluating cell viability via 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2h - tetrazolium-5-carboxanilide inner salt (xtt) assays . A mixture (30 l) containing xtt (1 mg / ml) in sterile rpmi-1640 without phenol red and phenazine methosulfate (n - methyl dibenzopyrazine methyl sulfate in sterile pbs, 0.383 mg / ml) reagents was added to the cells and incubated at 37 c for 1 h, after which the absorbance at 450 nm was read . The total prodrug yield for each dipeptide was> 15%, and the purity for all prodrugs was> 90% as determined by hplc, where the impurity was the parent drug, floxuridine . The experiments concerning prodrug stability were performed at 37 c in ph 7.4 phosphate buffer . The estimated half - lives (t1/2) obtained from linear regression of pseudo - first - order plots of prodrug concentration vs time for floxuridine prodrugs in ph 7.4 phosphate buffers alone and in caco-2, aspc-1, and capan-2 cell homogenates are listed in table 2 . Prodrug metabolites such as floxuridine and 5-fu were monitored along with prodrug disappearance in this experiment . However, mass balance was not achieved because 5-fu was metabolized even further and those metabolites beyond 5-fu were not quantified (figure 1). Dipeptide prodrugs with at least one aromatic amino acid moiety were next - best with regard to stability in enzyme - containing solutions such as plasma and cell homogenates, and those with two aromatic amino acids also exhibited chemical stability that was similar to that of 5-l - isoleucyl - floxuridine . All prodrugs exhibited 3- to 30-fold shorter half - lives in cell homogenates than in ph 7.4 phosphate buffer suggesting enzyme - catalyzed hydrolysis . With a few exceptions, the half - lives of all monoester and dipeptide prodrugs tested exhibited similar trends in the three cell homogenates and showed good linear correlations (r = 0.870.93). The composition of the amino acids in the dipeptide moiety exerted a profound effect on the stability of the ester bond regardless of the mode of attachment . Thus, glycyl - containing dipeptide prodrugs were less stable in buffer alone compared to dipeptide prodrugs containing one or two aromatic amino acids . Glycyl - containing dipeptide prodrugs were also less stable than the 5-l - glycyl ester prodrug . A comparison of the stability of 5-l - isoleucyl - floxuridine in various media with 5-l - isoleucyl - l - glycyl - floxuridine dramatically illustrates this effect (table 2). The metabolic stability of floxuridine and its amino ester prodrugs was assessed using thymidine phosphorylase . The results shown in table 3 indicate that floxuridine was rapidly degraded to the less active metabolite, 5-fluorouracil, by thymidine phosphorylase . The amino acid ester prodrugs of floxuridine were found to be quite resistant to degradation by thymidine phosphorylase . Prodrugs containing the glycyl moiety, 5-l - glycyl, 5-l - leucyl - l - glycyl, 5-l - glycyl - l - leucyl, 5-l - phenylalanyl - l - glycyl, and 5-l - isoleucyl - l - glycyl floxuridine were 20- to 40-fold more stable than floxuridine to degradation by thymidine phosphorylase . The half - lives of 5-l - phenylalanyl - floxuridine, 5-l - isoleucyl - floxuridine, 5-l - valyl - l - phenylalanyl - floxuridine, and 5-l - phenylalanyl - l - tyrosyl - floxuridine were in excess of 500 min reflecting their superior resistance to metabolic degradation by thymidine phosphorylase . Ic50 values of the amino acid / dipeptide monoester prodrugs of floxuridine for pept1 determined using inhibition of gly - sar uptake in caco-2, aspc-1, and capan-2 cells are summarized in table 4 . Floxuridine showed minimal inhibition of gly - sar uptake, and ic50 values were 8.43 2.66 mm, 6.63 1.52 mm, and 16.06 6.71 mm in caco-2, aspc-1, and capan-2 cells, respectively . 5-l - isoleucyl - l - glycyl - floxuridine displayed the highest affinity for oligopeptide transporters in caco-2 cells (ic50 = 0.39 0.01 mm) and in aspc-1 cells (ic50 = 0.29 0.00 mm) and was second - best in capan-2 cells (ic50 = 0.44 0.02 mm). With the exception of 5-l - leucyl and 5-l - glycyl dipeptide analogs with caco-2 cells, all dipeptide prodrugs of floxuridine exhibited 2- to 14-fold higher affinity for oligopeptide transporters than the corresponding 5-l - monoester prodrug . In particular, dipeptide prodrugs with at least one aromatic amino acid component consistently exhibited 3- to 5-fold higher affinity for the oligopeptide transporters than the corresponding monoester prodrug in all three cell lines tested . The apical - to - basolateral permeability of mono amino acid / dipeptide monoester prodrugs of floxuridine and parent floxuridine were determined at 37 c in caco-2 and capan-2 cell monolayers . All ester prodrugs of floxuridine exhibited 4- to 20-fold higher permeability than floxuridine in caco-2 cells . With the exception of 5-l - valyl - l - phenylalanyl - floxuridine, the permeability of all other dipeptide prodrugs of floxuridine across caco-2 monolayers was 2- to 4-fold higher than the corresponding 5-l - mono amino acid ester floxuridine prodrug . The permeability trends in caco-2 monolayers are consistent with the affinity data observed in uptake inhibition studies; however, no simple correlations between permeability and affinity were evident . Floxuridine was impermeant with capan-2 cell monolayers; neither floxuridine nor its metabolite 5-fu could be detected suggesting the possibility of upregulation of metabolic enzymes such as tp and dihydropyrimidine dehydrogenase (dpd) in capan-2 cells . Dpd is the rate - limiting enzyme involved in the catabolism of pyrimidines and is also the main enzyme involved in the degradation of structurally related compounds like 5-fu (figure 1). Floxuridine permeability was indeed observed in the presence of dpd inhibitors, dipyridamole and cisplatin; however, it was 1,000- or 10,000-fold lower than that obtained with caco-2 cells (data not shown). The permeability of 5-l - valyl - l - phenylalanyl - floxuridine across caco-2 monolayers was quite low . 5-l - phenylalanyl - l - tyrosyl - floxuridine, however, exhibited dramatically lower permeability in capan-2 cells compared to its permeability in caco-2 cells . With the exception of 5-l - phenylalanyl - l - tyrosyl - floxuridine, the permeability of the floxuridine ester prodrugs in caco-2 cells was about 2-fold higher than the corresponding value in capan-2 cells (r = 0.83). Unlike caco-2 monolayers, general permeability enhancement effects with dipeptide prodrugs compared to the corresponding 5-l - mono amino ester prodrug were not apparent with capan-2 cell monolayers . Gi50 values for floxuridine and its 5-mono amino acid / dipeptide monoester prodrugs determined in cell proliferation studies with the pancreatic cancer cell lines, aspc-1 and capan-2, are shown in table 6 . All prodrugs exhibit 4- to 8-fold enhanced antiproliferative activity in the two cell lines compared to parent floxuridine . Thus, the gi50 values of all floxuridine prodrugs were in the range of 1.653.36 mm in aspc-1 and capan-2 cells as opposed to gi50 values of 22.85 mm and 17.63 mm for floxuridine in aspc-1 and capan-2 cells, respectively . These results are consistent with trends observed in gly - sar uptake inhibition studies . Gly - sar and gly - pro did not inhibit the growth rate of capan-2 cells . Additionally, 5-d - valyl - floxuridine exhibited antiproliferative activity similar to that of floxuridine and gly - sar, despite an affinity for pept1 that was similar to that of other mono amino acid / dipeptide monoester prodrugs of floxuridine . Amino acid ester prodrugs have been widely employed to improve intestinal absorption of poorly permeant drugs . The antivirals valacyclovir and valganciclovir (8,38) are early examples of the clinical and commercial success of amino acid ester prodrug strategies . The enhanced oral bioavailability of these prodrugs (24,39) has been attributed to their enhanced transport by intestinal oligopeptide transporters, and to their efficient bioconversion to the parent drug by valacyclovirase . A variety of dipeptide and tripeptide compounds and prodrugs have also been investigated for their suitability as substrates for the pept1 transporter . We had previously reported the synthesis and evaluation of mono amino acid ester prodrugs of antiviral and anticancer drugs such as floxuridine, gemcitabine,(2) acyclovir,(15) and 2-bromo-5,6-dichloro-1-(-d - ribofuranosyl)benzimidazole (bdcrb). These studies revealed that mono amino acid ester prodrugs in general provide enhanced pept1-mediated transport, a range of bioactivation rates, and enhanced glycosidic bond resistance to metabolic enzymes such as thymidine phosphorylase and cytidine deaminase . In this report, we describe the synthesis of dipeptide monoester prodrugs of floxuridine and their chemical stability, bioactivation and transport in caco-2 cells, a surrogate for intestinal transport, and in two pancreatic duct cell lines, aspc-1 and capan-2, that overexpress the pept1 transporter . The dipeptide prodrugs appeared to be less stable in ph 7.4 buffers than the corresponding mono amino acid ester prodrugs . Since no mono amino ester prodrug degradation products were detected, it is quite likely that the dipeptide monoester prodrugs degrade via parallel pathways similar to those suggested for gly - phe dipeptide alkyl ester prodrugs by larsen and colleagues. (45) thus, in addition to hydrolysis of the ester bond producing the dipeptide, a diketopiperazine cyclization product is also possible due to intramolecular condensation of the ester group with the free amino group of the dipeptide monoester prodrug . It has been reported that the rate of intramolecular aminolysis is comparable to that of ester hydrolysis and that cyclization is negligible at ph values below 6 . Indeed, the formation of diketopiperizine was observed in a chemical stability study at ph 10 but not at lower ph values (data not shown). The stability of the prodrugs in buffer was clearly influenced by the prodrug moiety of amino acids; dipeptide prodrugs containing glycyl and leucyl moieties were less stable than those containing phenylalanyl dipeptide prodrugs . Dipeptide prodrugs with two aromatic residues were the most stable in buffer as well as in cell homogenates . The enzymatic stabilities of 5-l - phenylalanyl - l - tyrosyl - floxuridine and 5-l - valyl - l - phenylalanyl - floxuridine were significantly enhanced compared to the other prodrugs, suggesting that bulky amino acids such as tyrosine and phenylalanine protect against enzyme - catalyzed hydrolysis of the ester linkage . The stability profiles of 5-l - phenylalanyl - l - tyrosyl - floxuridine and 5-l - valyl - l - phenylalanyl - floxuridine in cell homogenates, particularly caco-2, suggest that activation to the parent drug following transport would be much slower than monoester prodrugs such as 5-l - valyl - floxuridine and reference prodrugs such as valacyclovir . The improved stability in biological surrogate media would facilitate prolonged systemic circulation of intact prodrugs for enhanced therapeutic action . The results of the affinity studies of the mono amino acid ester prodrugs for the oligopeptide transporter in caco-2 cells were generally consistent with previous findings in our laboratory,(14) as well as with amino acid prodrugs of acyclovir reported by beuchamp and colleagues. (48) no significant trends were noticeable regarding the affinity of the mono amino acid ester prodrugs in aspc-1 and capan-2 cells . With the exception of leucyl floxuridine, the affinities of the mono amino ester prodrugs were lower in aspc-1 and capan-2 compared to those observed with caco-2 cells . Dipeptide monoester prodrugs exhibited enhanced affinity in all cell lines depending on the nature of the n - terminal amino acid moiety . Thus, attachment of isoleucyl, phenylalanyl, or leucyl groups to glycyl floxuridine yielded 3- to 9-fold enhancement in affinity for the transporter . However, attachment of a glycyl promoiety to the n - terminus of leucyl floxuridine did not result in affinity enhancement . These findings are consistent with previous observations on the importance of the amino acid composition at the n - terminus in improving affinity for the pept1 oligopeptide transporter. (22) the results of apparent permeability of the floxuridine prodrugs across caco-2 monolayers are consistent with the affinity trends observed in gly - sar uptake inhibition studies . In light of previous studies with mono amino acid prodrugs of floxuridine that revealed excellent linear correlations between caco-2 permeability and pept1-mediated transport in hela / pept1 cells,(13) the enhanced permeability of the dipeptide monoester prodrugs across caco-2 monolayers may indicate enhanced pept1-mediated transport of the dipeptide prodrugs . The extremely low permeability of 5-l - valyl - l - phenylalanyl - floxuridine in caco-2 and capan-2 cells and that of 5-l - phenylalanyl - l - tyrosyl - floxuridine in capan-2 cells are not consistent with permeability profiles of 5-l - valyl - floxuridine in caco-2 cells reported earlier(13) or of 5-l - phenylalanyl - floxuridine in this study . The low permeability of these prodrugs is similar to the low permeability across caco-2 monolayers observed for monoester prodrugs containing l - valyl - l - tyrosyl dipeptide promoieties. (17) the estimated clogp values (table 1) of these two were indicative of their being the most lipophilic prodrugs examined, and the contribution of mdr and mrp efflux transporters in permeability studies, therefore, was tested . However, the permeability of 5-l - phenylalanyl - l - tyrosyl - floxuridine in capan-2 cells was not affected by 1 mm verapamil, a known efflux pump inhibitor (data not shown). The permeabilities of the floxuridine prodrugs were consistently lower in capan-2 cells compared to their corresponding values in caco-2 monolayers . Dipeptide monoester prodrugs did not exhibit any significant enhancement in permeability compared to the mono amino acid ester prodrugs in capan-2 cells . Although the permeability across capan-2 cells for all prodrugs was significantly higher than that of floxuridine alone, meaningful trends based on structureactivity correlations between transporter affinity and membrane permeability are not evident with the limited set of promoieties examined in this study . The detection of only 5-fu in the basolateral receiver compartment following transport of floxuridine across caco-2 monolayers suggests the instability of the glycosidic bond of floxuridine . The extent of conversion of prodrugs to 5-fu following transport was substantially lower in caco-2 and capan-2 cells . The average percent 5-fu observed in the basolateral compartment in caco-2 monolayer studies (43%; range 092%) was higher than the corresponding average with capan-2 monolayers (15%; range 035%). In general, conversion of dipeptide prodrugs to 5-fu following transport across the monolayers was about 2-fold lower than that observed with mono amino ester prodrugs . The results are consistent with stability profiles of floxuridine and its prodrugs in the presence of thymidine phosphorylase, an enzyme involved in the in vivo for phosphorytic cleavage of floxuridine. (49) floxuridine was rapidly cleaved by thymidine phosphorylase, while all amino acid ester prodrugs examined in this study were at least 20-fold more stable to glycosidic bond cleavage by thymidine phosphorylase (table 3). The role of esterification of the hydroxyl groups in protecting glycosidic bond cleavage by thymidine phosphorylase, the rate - determining step in deprotection and in metabolic conversion of floxuridine to 5-fu, has been discussed in a previous study. (13) the cell proliferation studies in the pancreatic duct cancer cell lines confirmed the enhanced potency of the amino acid ester prodrugs compared to parent floxuridine . In many cases, dipeptide prodrugs exhibited better gi50 values even though the gi50 values for dipeptide monoester prodrugs in the two cell lines were not significantly different from those obtained with mono amino acid ester prodrugs . The gi50 values of prodrugs did not exhibit any discernible correlations with their permeability and/or bioactivation profiles in these cells . The lack of potency enhancement of 5-d - valyl - floxuridine in capan-2 cells compared to floxuridine suggests that activation of the prodrugs to the parent is essential for cytotoxic action and is enzyme - specific . The different amino acid promoieties of prodrugs may contribute to the different rates of prodrug activation inside cancer cells by particular activation enzymes . Therefore, it would be difficult to discern a meaningful correlation between gi50 values and prodrug permeabilities with a limited experimental time course . This characteristic could lead to enzyme targeted activation of prodrugs at target sites after their membrane permeation . Intracellular anabolism of floxuridine prodrugs may illustrate that transported drugs are converted to floxuridine and 5-fu via a sequential enzymatic pathway with higher concentrations of tp present in tumor tissue (figure 2). Taken together, our results indicate that the dipeptide monoester prodrugs exhibit significantly higher affinity for the pept1 oligopeptide transporter and 2- to 4-fold higher permeability in caco-2 and capan-2 cells than the corresponding mono amino acid ester prodrugs, suggesting their potential for improved oral absorption and uptake in cancer cells . Therefore, dipeptide prodrugs might possess an advantage over amino acid monoester prodrugs for cancer target delivery . Three dipeptide prodrugs of floxuridine, 5-l - phenylalanyl - l - tyrosyl - floxuridine, 5-l - phenylalanyl - l - glycyl - floxuridine and 5-l - isoleucyl - l - glycyl - floxuridine, displayed significantly higher affinity for the pept1 oligopeptide transporter and caco-2 permeability . The delayed enzymatic activation, enhanced metabolic resistance and superior affinity to oligopeptide transporters of dipeptide prodrugs may facilitate their prolonged systemic circulation and enhanced therapeutic action . With its display of respectable stability in biological surrogate media and its approximately 2- to 3-fold shorter half - life in cancer cell homogenates than ones in human plasma and caco-2 cell homogenates, 5-l - phenylalanyl - l - tyrosyl - floxuridine could be an optimal candidate for cancer cell targeting with enzyme - specific activation.
The mammalian order primate that includes humans, apes, and monkeys in addition to several other organisms can be traced to the late cretaceous period . The rhesus macaque is in many ways an ideal model organism, being closely related to humans (sharing a common ancestor about 25 million years ago) and also sharing similar physiology, neurobiology, and susceptibility to infectious and metabolic diseases . Since both the m. mulatta and h. sapiens genomes have been sequenced, it is known that the evolutionary distance between them is small, with local fluctuations and low divergence, particularly in chromosome x. on average, orthologs have about 97% identity between the genomes both at the nucleotide and amino acid sequence levels . Approximately 50% of the rhesus macaque genome consists of various repetitive sequences, similar to the human genome . The phenomenon of retrotransposition that occurs in eukaryotic genomes of diverse taxonomic groups is implicated in various human genetic diseases . Insertion sites of many non - long - terminal repeat (ltr) retrotransposons play an important role in genome evolution and are distributed throughout the genome . The phenomenon behind the selection of the insertion sites of these elements has been shown to be correlated with patterns found at pre - insertion loci . It is well known that mobile elements insertions are capable of altering gene expression, generating genomic deletions, and they can even create new genes and gene families . Existing repetitive elements can also cause ectopic recombinations . Despite the overall similarity in retrotransposon mobilization activity in the old world monkeys and hominid lineages, the retroelements that are presumed to have had the most dramatic impact in shaping primate genomes are the l1 family of line elements and the alu elements, their partner sines . Besides contributing large amounts of dna to many genomes (including at least 40% of the human genome) they have also provided new genes, exons and other motifs involved in the physical and sequence structure of chromosomes . There are instances in which a previous element is now a part of the machinery that regulates gene expression . Repetitive elements account for about 50% of the genome among all of the presently sequenced primate species (table 1). In m. mulatta, two classes of mobile elements are present, class i dna transposons and class ii retrotransposons . The transposons can also be categorized into different families and subfamilies, based on the relationships between their sequences . The rhesus family consists of about 320,000 copies of many families of dna transposons and about half a million copies of endogenous retroviruses . The l1s and alu elements account for most of the lineage specific insertions and these have been playing an important role in shaping the complete genome . Elan was developed earlier as a suite of tools for genome - wide retrotransposon element analysis . The application of modules of this bioinformatics pipeline is described as follows: (1) elefinder performs a whole genome distribution analysis of the mges through a blastn search by making the use of perl / bioperl scripts by which the output files are parsed . It also extracts sequence 100 bp up and downstream at each mge site identified as a preinsertion locus . (2) dnascanner scans dna sequences such as preinsertion loci and analyses insertion hotspots of elements in detail so as to provide a set of signals or characteristics that are potentially recognized by an element for its insertion . The m. mulatta genome has a total of 22 chromosomes including x and y (although the sequencing project did not sequence y). The only y chromosome that has been completely sequenced is of humans, and sequencing of the chimpanzee and mouse y chromosomes is in progress . The sequencing of the mammalian y chromosomes, of the organisms like rhesus macaque (macaca mulatta), the white - tufted - ear marmoset (callithrix jacchus), the rat (rattus novergicus), the bull (bos taurus) and the opossum (monodelphis domestica), is proposed and still under process . We present here a study of the primate macaca mulatta genome to identify and characterize insertion sites of the two representative retroelements present, and further, comparison with similar features of the human genome (excluding the y chromosome). The structural and thermodynamic features as well as protein interaction measures are computed in preinsertion loci using the tool dna scanner . In the human genome, a full - length l1 element is around 6 kb long, and is reported to be the most successful tes in human genome by mass while alu elements, typically ~300 bp long are most successful in terms of copy number . Currently, there are three macaque consensus sequences for alu: alumacya3, alumacyb2, and alumacyb4 and five of that for l1: l1p4a, l1p4b, l1p4c, l1p4d, l1p4e in repbase (version 13.5). We first compute the nucleotide sequence divergence of l1 (human) with respect to the corresponding l1 (macaca genome) (table 2(a)). As can be seen, pairwise alignment shows a low percentage identity, with the major areas of dissimilarity in the 3 region . The macaca lineages show higher percentage similarity with each other; with regard to the human genome, the l1 nearest to its human analog is l1p4d, while that which has diverged the most is l1p4e . Macaca lineages show high similarity with each other and human alu seems to be most closely related to the macaca specific alumcaya3 (table 2(b)). Tables 3 and 4 give details of the numbers of alu and l1 elements in each chromosome . The four groups constructed for the pre insertion loci were: intact on both ends, intact on 5, intact on 3 and intact on neither end . About 1077410 copies of alus were found uniformly distributed on each chromosome . Of these approximately 13.49% (145428) are truncated on the 5 end, 456752 copies (42.39%) are truncated at both the ends, 30.29% are the truncated at 3 end (326447). A negligible fraction (1.6%) of l1 elements was intact on both sides: of the 94616 elements identified 22% (21044) were truncated at the 5 end and 1.38% (1314) were truncated at the 3 end and about 75% at both ends . As in the human genome, there are few functional alu copies in m. mulatta, and their distribution on the various chromosomes follows similar patterns (fig . The x chromosome is known to have an exceptionally high number of the l1 elements (fig . 1b), which also contained the largest number of truncated elements (at both the ends). The y - axis represents the frequency of elements found on the different chromosomes (marked along the x - axis). The y - axis represents the frequency of elements found on the different chromosomes (marked along the x - axis). The pre - insertion loci were extracted and evaluated for various physicochemical properties as described in our earlier paper . The positions of the extrema were similar to those seen in other cases in the physicochemical profiles generated by dnascanner . Similar tables were calculated for each m. mulatta chromosome and for all the 14 characteristics extrema were seen in the range of -9 to -11 bp for alu element and that for the l1 element was between -2 to -19 for the majority of the cases . For l1 elements, results are similar and table 5 gives the complete information about the values and the extrema for each of the properties . Figures 2 and 3 show the graphs obtained for 4 physicochemical properties for alu and l1 elements insertion sites in macaca genome . Control sequences were generated by scrambling the positive data set of pre - insertion sequences; all these above properties gave a featureless distribution (namely no extrema). Another independent set of control sequences that were obtained by randomly selecting genomic sequences of 100 bp also gave similar featureless results . Various signals upstream of the insertion sites of alu in chromosome 1, for (a) stacking energy, (b) at content, (c) propeller twist and (d) protein induced deformability . The y axis represents value of the property and the x - axis gives the relative position with respect to the insertion site (taken to be 0). Various signals upstream of the insertion sites of l1 in chromosome 1, for (a) a rule, (b) nucleosomal bending, (c) nucleosomal positioning,(d) protein induced deformability . The y axis represents value of the property and the x - axis gives the relative position with respect to the insertion site (taken to be 0). Our rationale for the choice of the various parameters 1) regions with alternating purines / pyrimidines steps and at rich regions melt more readily . We found regions of low gc and high at content, indicating that a relatively less energy is required to melt dna near insertion sites, which in turn favors retrotransposition (figs . (2) propeller twist is a property, involved in the distortion of the hydrogen bonds that hold two bases together . Regions with specific dinucleotides with large propeller twist, followed by a lower propeller twist were obtained (fig . 2c), which shows that latter regions may be easily distorted and are suitable for insertion . (3) nucleosomes are involved in dna compacting and providing transcription factors access to the respective regulatory regions . Two different nucleosomal related features, the bending energy / persistence length and the position profiles of the nucleosomes, were studied . Regions with comparatively low energies were obtained, within the upstream areas of the insertion sites . (4) stacking energy profiles showed a maximum near -10, indicating that this region is unstable, leading to easy de - stacking of dna sequence, which would thereby enable an easy insertion of alu . (5) duplex stability is a measure of the relative stability of the dna - duplex structure, which is directly dependent on sequence . We obtained the region around the -10 position for alu and at -19 for l1, with a peak, representing a region which would de - stack or melt easily . (6) dna deformability is an important property, dependent on the sequence and required for interaction with proteins . The dna deformability was calculated and a region (at -10 for alu and -18 for l1) of low deformability was seen; this facilitates retrotransposon insertion . The results of elefinder as well as the information curated in the inside database were used to find the distribution of truncation sites in the whole m. mulatta genome . The x - axis represents the length of element divided in bins of 25, i.e.,125, 2550, and so on . The criteria used for the plotting was the occurrence of 5truncated and 3 intact ends and 3 truncated and 5 intact ends in the macaca genome . The basic aim was to identify the positions in the element sequence, where most of the times truncation occurs for the macaca genome as a whole . The graph plotted for the 3 truncated ends, the maximum number of hits were obtained in the last bin, i.e., the 276300 bin has the maximum number of truncations in the macaca genome (fig . Similarly, for the 5 truncated category, the maximum number of truncations was found to be in the first bin, i.e., the 125 bin (fig . (a) the truncation distribution of alu element in macaca mulatta for bin size 25 and the graph is plotted for 3 end of alu truncated and its 5 end being intact . (b) the truncation distribution of alu element in macaca mulatta for bin size 25 and the graph is plotted for 5 end of alu truncated and its 3 end being intact . Previously, we analyzed several genomes for distribution of mges as well as their insertion sites along with the signals facilitating their insertion . In the present study of alus (sine) and l1s (line) in the macaca genome we found that the insertion sites had physicochemical characteristics that were similar to those observed in other organisms, suggesting that these are generally important . The present study confirmed that the region 100 bp upstream from alu and l1 insertion sites show statistically significant distinctive properties both in the physical and structural characteristics, as well as in the energetics . These properties seem to play an important role in the insertion of mge . During insertion, a mge causes the target site to distort in a number of ways and requires the co - operative action of a number of proteins to break bonds, unwind the dna, and to nick the target site strand . It is due to this series of requirements, that the insertion sites for all the chromosomes, show a characteristic set of physicochemical properties, signified by the extremum peaks in each case . Each of the peaks for the several properties carry biological significance and may be used further for the identification of potential new insertion sites . In each case, that the nature of the extremum that has a role in defining the trend of each property was identical for both alu and l1 (table 5), explaining that the signals that are needed for the insertion of the element is same, and are probably necessary for the insertion to actually occur, although also probably are not sufficient . Detection of the most probable truncation sites for alu elements within the complete macaca genome revealed that during insertion the truncation distribution of alu peaks toward the starting positions in the case of the trailing edge truncation and is reversed for leading edge truncations . We have found that lines are present in large number in all the primate genomes which includes the recently studied gorilla genome as well as callithrix jaqqus, pan troglodytes, orangutan (fig . There could be an evolutionary link in primate genomes through the spread of lines and sines; alternately, there may have been a master l1 or retrotransposon copy in the genome of last common ancestor of all primates . The present work adds insight into primate genome architecture, showing the common structural features that promote mge insertion and genome expansion . In future work, we aim to compare the insertion sites across species- a task that will be facilitated as the diversity of sequenced genomes increases further . The genome sequence of macaca mulatta was retrieved from the ncbi (ftp server: ftp://ftp.ncbi.nih.gov/genomes/). The element sequence (for alu and l1) were obtained from repbase and pairwise alignment was performed for the l1 for the human and macaca specific l1s and its lineages using standard procedures . Elefinder was used to find the insertion site of alu and l1 in the macaca genome . This tool finds the nature, distribution, genomic location, and the site of truncation for each of the insertion sites and performs comparative genome analysis and also generates several set of sequences . Since we have previously shown that intact copies show the presence of signal as compared with the truncated groups, the analysis of the full - length elements, i.e., of those capable of transposition was also performed . The tool dna scanner analyses the dna for many physico - chemical properties by using various thermodynamic, protein interactions and sequence - based features, which are beyond the t density and at density . In accordance to the choice of input parameters, the program evaluates a number of properties, using windows that move along the length of the query dna sequence . Since downstream sequences tend to show signals that are not sufficiently statistically significant only upstream sequences were investigated for both alu and l1 elements . The controls were selected by scrambling sequences, randomly picking sequences from genome as well as gene sequences.
The prevalence of ulcerative colitis (uc) has increased each year for the past several decades . A large - scale population - based cohort study shows that the flare - up rate in women is 1.2 times higher than that in men . Accordingly, female gender appears to be a risk factor for frequent uc flare - up . Female patients often suffer from uc symptoms during pregnancy as uc symptoms generally start to appear then, and a definitive diagnosis of uc has been confirmed in younger individuals in their teens to thirties . It has been estimated that approximately 25% of female uc patients conceive after uc diagnosis . In addition, the risk of flare - up and the development of associated inflammation during pregnancy is known to be increased in both the remission and the active stages of inflammatory bowel diseases (ibd), including uc and crohn's disease . The first trimester is considered to be a particularly high - risk time for flare - up of uc . In contrast, two european cohort studies of 634 pregnancies in 303 women showed that pregnancy improves the disease course, with a reduction in flare - ups in subsequent years [2, 4]. Therapeutic options are limited when flare - ups occur during pregnancy due to the concerns for the safety of fetus . According to previous reports and statements by the united states food and drug administration (fda) (http://www.fda.gov/drugs/developmentapprovalprocess/developmentresources/labeling/ucm093307.htm), 5-aminosalicylic acid (5-asa), corticosteroids and granulocyte and monocyte adsorptive apheresis (gma; adacolumn) however, we have often observed uc that is refractory to individual treatment with these drugs or with this modality, or to intensive therapeutic approaches that combine these drugs with this modality . Intensive gma involving two gma sessions per week has recently been shown to be more efficacious than conventional weekly gma . Furthermore, intensive gma also safely induced rapid remission in patients with moderately active uc inflammation . Very recently, the drug tacrolimus was approved in japan for the treatment of patients with moderate or severe uc, regardless of whether the uc is dependent on or refractory to corticosteroids . Tacrolimus is reportedly useful for the treatment of refractory uc due to its potent immunosuppressive properties, which induce inhibition of the transcription of the early activation genes encoding interleukin-2, tumor necrosis factor- (tnf-) and interferon- that are responsible for the development of inflammation . We report herein the case of a patient with severe uc that had developed during the first trimester of pregnancy and was refractory to combination therapy with high - dose corticosteroids and intensive gma, but was successfully treated with tacrolimus following cesarean section early in the third trimester . In july 2009, a 36-year - old pregnant woman was referred to our hospital for treatment of refractory uc . She had been diagnosed with uc (total colitis) at the age of 17 . Oral 5-asa (2,250 mg / day) had maintained her in remission up to the age of 31 . Subsequently, repeated flare - ups had occurred and she had been treated with corticosteroids or with the routine weekly gma . Azathioprine (aza) administration was also tried, but had to be stopped due to aza - induced pancytopenia . Then, oral 5-asa (2,250 mg / day) plus 3 mg betamethasone enema had induced and maintained remission up to 2008 . In april 2009, at the age of 36 years, she became intentionally pregnant for the first time, while her uc was in remission with oral 5-asa at a dose of 2,250 mg daily . However, during pregnancy, the flare - up of her total colitis required daily intravenous administration of up to 80 mg / day prednisolone, oral 5-asa 2,250 mg / day and weekly gma for 10 weeks, followed by weekly lymphocytapheresis for 3 weeks under the management of a total parenteral nutrition program at the previous hospital . She underwent a blood transfusion due to the development of bloody bowel movements, which was followed by severe anemia with less than 8 g / dl of hemoglobin . Antigenemia (c7-hrp) positivity against cytomegalovirus was transiently detected and subsequently spontaneously converted into a negative response . After referral to our hospital, the patient was orally administered 20 mg prednisolone and 2,250 mg mesalamine on a daily basis . Physical examination revealed lower abdominal tenderness with repeated bloody stools (810 times a day). Laboratory investigations revealed a white blood cell count of 9,900/l, hemoglobin 10.1 g / dl, c - reactive protein 2.41 mg / dl, serum albumin 2.9 g / dl and an erythrocyte sedimentation rate of 50 mm / h (table 1). A first sigmoidoscopy showed several deep longitudinal ulcerations with erythematous and edematous changes in the mucosa from the rectum to the sigmoid colon (fig . Immunohistochemical findings and a polymerase chain reaction analysis of cytomegalovirus in colon biopsy specimens were also negative . Upon discussion of the remaining therapeutic options, she was first maintained on 20 mg prednisolone and 2,250 mg 5-asa daily; these doses were increased to 40 mg predonisolone and 4,000 mg 5-asa daily in addition to 500 mg vancomycin daily for 1 week because of little improvement and stool culture positivity of clostridium difficile (though cultures were negative for c. difficile toxin). The patient also underwent intensive gma therapy (two sessions weekly), which was partially successful, resulting in almost complete disappearance of abdominal pain and a decrease in bowel movements to 35 times daily . However, her anemia was little improved and there was a gradual development of hypoalbuminemia to such an extent that transfusion of albumin was necessary every other day in order to maintain the serum level at 3.0 mg / dl, the recommended level for healthy development and safe delivery of a child . She was consequently unable to attain a further prolonged gestation and feared risks of blood - borne infections like hepatitis b, hepatitis c or aids viruses by repeated frequent blood transfusions . Her first baby was prematurely delivered by cesarean section at 28 weeks and 1 day on september 9 (birth weight 1,008 g, length 35 cm) without any congenital malformations or neurological abnormalities . After cesarean section, the patient was started on oral tacrolimus (prograf), aiming for serum trough levels of 1015 ng / ml for 2 weeks, followed by tapered serum trough levels of 510 ng / ml . Her condition quickly improved in the following weeks and complete remission was achieved by tapering the prednisolone dose . Total colonoscopy showed scattered regenerating areas with faintly erythematous changes in the mucosa of the transverse colon and the rectum and the appearance of mucosal healing at other sites 3 months after oral tacrolimus administration was started (fig . Tacrolimus is not currently approved in japan for maintenance therapy, and therefore tacrolimus administration was stopped . In clinical settings, therapeutic treatment for uc flare - up during pregnancy is limited because of concerns for the safety of the unborn child . We report herein the case of a patient with flared refractory uc during pregnancy who underwent a bridging therapy consisting of high - dose corticosteroids combined with intensive gma until it was impossible to prolong gestation any further . At that point, the incidence rates of flare - up and the development of uc during pregnancy reach approximately 30% during both the remission and the active stages . However, it has been reported that there is no evidence to suggest that pregnancy increases the relapse risk for patients with uc [2, 4]. There is also some evidence to show that pregnancy has a favorable effect on uc over time . A retrospective study of 111 ibd patients showed that increased parity is associated with a reduction in surgical resections . Thus, while relapses do occur in pregnant patients, such episodes are apparently not more frequent than those in non - pregnant individuals . The key point regarding whether uc will re - emerge during pregnancy or not is the degree of activity of uc at the time of conception . Therefore, although the present case was in remission at the time of conception, this remission may not have involved complete mucosal healing . Currently used medications, such as corticosteroids, purine analogues, cyclosporine, tacrolimus and anti - tnf blockers, are all associated with an increased risk of opportunistic infection . Multivariate analysis of a recent case - control study performed in ibd patients showed that the use of corticosteroids increased the likelihood of opportunistic infection with a calculated odds ratio of approximately 4 compared with the use of mesalamine . Numerous studies have described an association between opportunistic enteric infections and exacerbation or relapse of uc . Pathogens involved as potential triggers of uc flare - ups include c. difficile, campylobacter spp ., escherichia coli, and cytomegalovirus . In particular, the risk of c. difficile - associated diarrhea is increased, not only by antibiotic exposure, but also by immune - compromising conditions in ibd patients, and there is therefore a strong focus on this risk during uc flare - ups . C. difficile - associated colitis in patients with ibd has a higher mortality than that in patients with c. difficile without a background of ibd . Although neither toxin a nor b was detected in the present case, we eradicated c. difficle as a precautionary measure this treatment resulted in a partial response with 23 times fewer daily bowel movements than prior to eradication, suggesting that c. difficile infection might indeed be involved in the exacerbation of uc disease activity . Repeated stool cultures and toxin analyses of c. difficile after eradication gave a negative result as did analysis of c7-hrp . Pharmacologic management of uc currently relies on 5-asa, corticosteroids, immunomodulators (aza and 6-mercaptopurine (6-mp)), calcineurin inhibitors (cyclosporine and tacrolimus), and tnf blockade . Regarding medication during pregnancy, the most important point is to maintain remission and inactivation of disease, since the greatest risk to pregnancy is active disease . Another key principle to disease management during uc flare - up is to remember that therapeutic treatment is limited due to concerns regarding potential fetal complications . 5-asa remains the first - line therapy for induction and maintenance of remission for patients with mild to moderately active uc, based on an extensive history of efficacy and safety . Prospective controlled trials and a population - based cohort study of pregnant patients who had been exposed to mesalamine did not suggest that 5-asa posed an increased risk to the fetus, despite the fact that mesalamine and its metabolite, acetyl 5-asa, are found in cord plasma . Corticosteroid therapy is a well - established and effective treatment for patients with active uc . A large case - control study and a meta - analysis of the use of corticosteroids during the first trimester of pregnancy reported an increased risk of oral clefts in the newborns with an odds ratio of 3.35 (95% confidence interval 1.975.69) and a low overall risk of major malformations with an odds ratio of 1.45 (95% confidence interval 0.82.60). Intensive leukocytapheresis (adacolumn, jimro and cellsorba; asahi medical company, tokyo, japan) is a relatively safe procedure that is widely used in japan for the treatment of active uc . A case report of a patient with uc at one center reported that gma was effective for severe uc by inducing remission with no fetal complications . Immunosuppressive therapy using aza or 6-mp is sometimes useful for maintenance of remission in uc . Pregnant patients treated with aza or 6-mp for ibd showed no incidence of pregnancy complications or congenital malformations . A cohort study that investigated the pregnancy outcome in female patients with crohn's disease showed a higher rate of congenital anomalies following antenatal exposure to aza compared with non - treated patients . Thus, the safety of aza and 6-mp in the treatment of pregnant patients with ibd remains controversial . One report that investigated 100 pregnancies among transplant recipients showed a 68% live birth rate, 12% spontaneous abortion, 3% stillbirth, and 59% premature delivery . In contrast, a case report of a patient with uc described a successful pregnancy and delivery of a healthy baby with rapid remission and long - term maintenance . A meta - analysis of 15 studies of pregnancy outcomes after cyclosporine therapy reported no statistical difference in the rate of fetal malformations compared to that among the general population . A rapid clinical response to a tnf- inhibitor (infliximab) is obtained when this inhibitor is used for the treatment of uc . Infliximab does not cross the placenta in the first trimester, but feasibly is likely to do so in the second and third trimesters, thus protecting the infant from infliximab exposure during the crucial period of organogenesis . This result suggests that infliximab treatment does not pose a significant risk of complications during pregnancy . The use of aza/6-mp, tacrolimus or cyclosporine during pregnancy has never been permitted in japan . Furthermore, until june 2010, infliximab treatment was not approved for treatment of active uc . Based on all of the above, we ultimately selected the following treatment regime: bridging therapy using 5-asa, corticosteroids, and intensive gma until it was impossible to further prolong gestation followed by a rescue therapy using tacrolimus after cesarean section . This therapy ultimately resulted in clinical remission . In conclusion, for pregnant uc patients, combined therapy consisting of high - dose corticosteroids and intensive gma is recommended until it is impossible to prolong gestation any further . When clinical remission cannot be obtained, rescue therapy using tacrolimus after cesarean section may be useful . The authors declare that no financial or other conflict of interests exists in relation to the content of this paper.
Only a few cases of pulmonary vascular tumors diagnosed using endobronchial ultrasound - guided transbronchial needle aspiration (ebus - tbna) have been reported in the literature . They frequently present as filling defects in the pulmonary vasculature on computed tomography (ct) making it challenging to distinguish between vascular tumor and thrombotic emboli . Although fluorodeoxyglucose - positive emission tomography (pet) scan may reportedly help differentiate malignant growth from benign emboli, pet scans are not routinely performed for this purpose . Increased uptake on the pet scan increases the malignant suspicion of vascular tumors but in most cases ebus - tbna of mediastinal and hilar lymph nodes has proven value in diagnosis and staging for lung cancer . In addition, ebus - tbna may provide an opportunity to identify and sample endovascular abnormalities in the mediastinal and hilar area . A 43-year - old white male was diagnosed with leiomyosarcoma of proximal left thigh involving femoral vessels 2 years back . He was found to have pulmonary embolism involving right pulmonary artery for which he was started on anticoagulation and an inferior vena cava filter was placed prior to surgery . Despite being on anticoagulation postoperatively, serial surveillance imaging continued to show persistent thrombus . Eventually, an interval increase in size of the filling defect in right main pulmonary artery extending to the right lower lobe pulmonary artery was noted on contrast - enhanced chest ct [figure 1]. At this point, intravascular metastatic tumor was suspected and the patient was referred to our interventional pulmonary service for diagnostic evaluation . The patient did not have any other imaging studies such as pet scan or magnetic resonance imaging of the chest . Ebus (bf - uc160f - ol8; olympus, tokyo, japan) procedure was performed under general anesthesia . With the ultrasound and color flow doppler, an endovascular hyper - echoic lesion was identified in right pulmonary artery [figure 2]. Only one endovascular lesion was identified, which extended to the right lower lobe branch of the pulmonary artery . Because of the nature of the lesion's extension in the pulmonary artery, it was not possible to accurately size it but it was estimated to be around 20 mm in the largest diameter . Ebus - tbna of this lesion using the 22 gauge ebus needle (olympus, na-201sx-4022) was performed under general anesthesia with laryngeal mask airway using propofol intravenous drip and fentanyl intravenous intermittent injections . A core biopsy was obtained using the 22 gauge ebus needle and a total of five passes were performed during this procedure . Rapid - on - site evaluation of fixed slides was bloody, and no malignant cells were identified . The procedure was performed without any complications and cytopathological and immunohistochemical evaluation confirmed the diagnosis of metastatic leiomyosarcoma [figure 3]. The patient was started on gemcitabine plus docetaxel combination chemotherapy . (a) chest computed tomography (ct) image showing right pulmonary artery filling defect (arrow) diagnosed as pulmonary thrombotic emboli 2 years ago . (b) chest ct 2 years later showing enlarged right pulmonary artery filling extending to the right lower arterial branch consistent with vascular tumor (arrow) (a) endobronchial ultrasound (ebus) image of the right hilar area showing an vascular tumor of the right lower lobe pulmonary artery (arrow). (d) ebus - guided transbronchial needle aspiration (arrow) of the right pulmonary artery tumor . The color doppler was used to ensure sampling the tumor area with the least blood flow (a) this is the tissue core biopsy of the right pulmonary mass lesion showing cells with abundant eosinophilic cytoplasm and spindled nuclei (h and e, 200 original magnification). (b) these cells cytologically shows fine granular chromatin without prominent nucleoli (papanicolaou stain, 600 original magnification). (c) immunohistochemical stains for smooth muscle actin shows strong immunoreactivity in these cells (sma, 400 original magnification). (d) immunohistochemical stains for desmin also shows strong positivity in these malignant cells (desmin, 200 original magnification) historically, most cases of pulmonary artery tumors were diagnosed with surgery or during postmortem examination . Successful diagnosis of primary pulmonary artery leiomyosarcoma with catheterization and biopsy has also been reported . In the last few years, several cases of primary and metastatic pulmonary artery tumors diagnosed by ebus - tbna have been reported without any procedure - related complications . Although pulmonary artery hematoma has been described from ebus - tbna, the pulmonary artery was inadvertently punctured in that case during a routine biopsy of mediastinal lymph node . In addition, there have been reports of using ebus - guided trans - pulmonary vascular lymph - node sampling without any complications . Here, we present the first case of metastatic leiomyosarcoma of pulmonary artery diagnosed with ebus - tbna . The case reported is a clear example of the challenges in diagnosis of pulmonary artery tumors due to their endovascular location and the potential risk of bleeding . The use of color flow doppler during ebus - tbna of pulmonary vascular tumor is essential to avoid area of higher blood flow and to perform the biopsy in the tumoral area of least blood flow . Given the potential higher risk of bleeding, anticoagulation or clopidogrel therapy should probably be discontinued prior to this procedure . Clinically, the importance of high index of suspicion is also demonstrated as the patient was initially diagnosed with pulmonary embolism . Misdiagnosing patients with pulmonary artery tumor emboli as thrombotic emboli can result in delaying effective tumor therapy with chemotherapy or surgery . The diagnosis of pulmonary embolism in patients with malignant diseases can be challenging especially in ill patients where the wells score is already high . Our patient was asymptomatic, and the chest imaging was performed as part of surveillance and staging of his sarcoma . Intravascular metastasis was suspected as an alternate diagnosis after the presumed failure of anticoagulation therapy and increased of the pulmonary artery lesion size . Ebus - tbna is a safe procedure and serious complications are extremely rare . Until now, ebus - tbna of the pulmonary vascular lesions did not report any serious complications . Ebus - tbna seems to be a safe, feasible, and minimally invasive tool for the diagnosis of vascular tumors such as metastatic pulmonary artery leiomyosarcoma.
Transitional cell carcinoma (tcc) of the urinary bladder can present as a non - muscle invasive or as a muscle - invasive lesion . The majority of patients (approximately 75%) present with non - muscle invasive tumors, which are limited to the mucosa (ta) or the lamina propria (t1) (1). . However, cis tends to behave more aggressively and is often found in association with high - grade non - muscle invasive tumors . Prognostic factors in patients with non - muscle invasive bladder cancer have been the subject of numerous publications for many years (2 - 18). Depending on a patient's characteristics, the probability of recurrence after transurethral resection (tur) at one year ranges from about 15% to 70% (2), and the probability of progression at five years ranges from about 7% to 40% (6). Non - muscle invasive tumors may be managed with tur with or without intravesical therapy . However, not all non - muscle invasive bladder cancer patients have the same risk for disease recurrence and progression, and the absence of risk stratification between aggressive and indolent tumors contributes to potentially excessive frequent surveillance or unnecessary intravesical therapy . Several studies have suggested risk tables for the recurrence and progression of non - muscle invasive bladder cancer (5, 7, 9, 10), but they cannot calculate the probability of a certain event, such as the probability of recurrence within five years . The purpose of this study was to develop and validate prognostic nomograms for disease recurrence in patients with ta, t1 transitional cell carcinomas of the bladder . These nonograms will facilitate patient counseling, choosing the most appropriate adjuvant treatment after tur, and determining the frequency of follow - up in individual patients . Thirty - eight training hospitals participated in this retrospective multicenter study . Between january 1998 and december 2002, 3,060 patients with newly diagnosed they were treated with transurethral resection (tur) and diagnosed with ta or t1 tcc of the bladder based on the 2002 american joint committee on cancer (ajcc) tnm staging system (19). Patients with prior histories of bladder cancer, non - tcc histology, primary cis, or a follow - up duration of less than 12 months were excluded . This cohort study was also limited to tumors whose grades were determined using the 1973 world health organization system . The median age was 63 yr (21 - 98), and the median follow - up duration was 44 months (12 - 97). The clinical and pathological data (local), including sex, age, tumor size (<3 cm or 3 cm), multiplicity (single or multiple), t category (ta or t1), tumor grade, presence of concomitant cis or squamous differentiation, and intravesical therapy were obtained from each hospital and merged . One - thousand and eighty - two patients were treated with intravesical therapy after tur, and drugs used for intravesical therapy were as follows: bcg in 827 patients, mitomycin - c in 108 patients, epirubicin in 135 patients, and other drugs in 12 patients . Follow - up data were also obtained, including pathologically proven recurrence and time to first recurrence, which was defined as the time period between the date of initial diagnosis and the date of recurrence . Patients who were still alive or who had died before a recurrence were censored at the date of the last available follow - up cystoscopy . We assessed the impact of various clinical and pathological features on time to first recurrence . The predictive accuracy of each univariate and multivariate logistic regression model was tested using the area under the receiver operating characteristics (roc) curve . All univariate and multivariate models were internally validated with 500 bootstrap re - samples as a means of calculating the most unbiased predictive accuracy . Statistical significance in this study all statistical tests were performed using r software (r, version 2.4.1, the r project for statistical computing, http://www.r-project.org). Three - year and five - year recurrence - free rates were 64.3% and 55.3%, respectively (fig . 1). On univariate cox proportional hazard analysis, age, tumor size, multiplicity, tumor grade, concomitant cis, and intravesical therapy had a significant influence on recurrence - free survival (p<0.05) (table 2). Multivariate analysis revealed that age (hazard ratio [hr]=1.437, p<0.001), tumor size (hr=1.328, p=0.001), multiplicity (hr=1.505, p<0.001), tumor grade (hr=1.347, p=0.007), concomitant cis (hr=1.611, p=0.007), and intravesical therapy (hr=0.681, p<0.001) were independent predictors for disease - recurrence (table 3). Based on this analysis, nomograms for the prediction of recurrence probabilities at three and five years were constructed (fig . The scales of the nomograms reflected the coefficients from the cox model rescaled to a user - friendly (100 point) range . The bootstrapping estimate of the predictive accuracy of the nomograms suggested that the area under the roc curve was approximately 0.599 at three years and 0.604 at five years . The results of bootstrap re - samples were 0.723 for the three - year estimation of the nomogram and 0.738 for the five - year estimation . The prognostic importance of various factors is not always consistent among various studies, and analyses of prognostic factors of the bladder tcc related to recurrence are sometimes difficult to compare (8). This difficulty may be due to differences in the choice of the variables analyzed, their coding, and, in multivariate analyses, the correlation among the factors (10). Another important source of variability stems from differences in tumor status, especially between primary or recurrent tumors . This study showed that patient age, tumor size, multiplicity, tumor grade, cis, and intravesical therapy are significant predictors for recurrence in patients with ta, t1 tcc of the bladder . There was no difference in the time to the first recurrence between grade ii and grade iii tumors in the univariate analysis, so a dichotomized tumor grade (grade i vs. grade ii / iii) was used for the multivariate analysis (table 2). In addition, differences among intravesical instillation agents had no influence on time to first recurrence, and intravesical therapy was also simply dichotomized (not performed vs. performed) (table 2). Of these, multiplicity and intravesical therapy following tur were the most influential determinants for prediction of recurrence in nomograms (fig . Tumor grade, tumor size, and patient age were less strong predictors than the ones mentioned previously . Concomitant cis was a relatively weak variable, especially in nomograms for five years (fig . 2). In addition, in this study, the study cohort was limited to tumors that were newly diagnosed between 1998 and 2002 . Nevertheless, tumor grade, t stage, concomitant cis, tumor size, intravesical therapy, tumor status (primary vs. recurrent), and recurrence rate among other factors were generally identified as independent prognostic factors for disease recurrence (2 - 18). In some studies, age, tumor location, and sex have also been regarded as independent risk factors (15, 17, 18). Notably, our nomograms showed that age is a strong determinant for prediction of recurrence . Younger patients appear to have a more favorable prognosis because they present more frequently with non - muscle invasive, low - grade tumors . However, studies have shown that the risk for disease progression is the same, grade - for - grade, in younger patients as in older ones (20, 21). In contrast, our results suggest that age has a prognostic impact independent from other factors . These observations are consistent with the work by shariat et al . We cannot explain why the age factor plays an important role in disease recurrence . Differences in genetic and molecular aberrations in bladder tumors and accumulation of these aberrations in older patients may relate to age . 2 may be useful for patient counseling because they predict the probability that the patient will encounter recurrent bladder cancer within the next three to five years . They are also effective tools for selecting patients for experimental adjuvant therapy because they are likely to be more prognostically accurate than the typical risk stratification approaches that form patient groups by placing cutoffs on variables . In the context of a randomized clinical trial this procedure could be accomplished by computing predicted probabilities for each patient, which would simultaneously consider all prognostic variables, and by comparing the predictions across treatment arms . In our study, we suggested two nomograms that were very similar, but there were some differences in the weight of risk score . The nomogram for three years would be more suitable for short - term studies, and the five - year nomogram may be helpful for long - term studies . Additionally, nomograms may aid in determining the scheduling of follow - up visits, as patients at lower risk for relapse or a second primary tumor may require less stringent follow - up evaluations (23). The prediction for the area under the roc curve was approximately 0.599 for the three - year nomogram and was 0.604 for the five - year nomogram . Despite being imperfect another limitation is that the nomogram predicts disease recurrence only within a maximum period of five years . The nomogram is additionally limited because it relies on postoperative variables, making it an inadequate preoperative patient counseling tool . It is important to remember that adjuvant therapy performed in this data set was a mixture of various intravesical therapies, and the decision as to which instillation drug should be chosen was left to the physicians . Finally, experiencing a beneficial effect on intravesical therapy in this study does not mean that adjuvant intravescial therapy has to be performed in all cases of non - muscle invasive bladder tumors . The nomograms for non - muscle invasive bladder cancer in which a point system was used are very rare . (22) have reported that nomograms for non - muscle invasive bladder cancer can predict recurrence and progression, which included nuclear matrix protein 22 and cytology, as well as conventional predictors . We tested only conventional variables without ancillary markers, i.e., nuclear matrix protein 22 . For this reason, the nomograms in our study may be more feasible in common clinical settings . In conclusion, current nomograms can be used to predict the probability of disease recurrence in patients with newly diagnosed ta, t1 transitional cell carcinoma of the bladder . They may be useful for patient counseling, clinical trial design, and patient follow - up planning.
Endobronchial tuberculosis (ebtb) is a form of tuberculous infection that involves mainly the trachea and/or bronchi . The disease is often mistaken for more common lung diseases like pneumonia, asthma, lung cancer and other lung diseases . Endobronchial stenosis is a common complication of ebtb despite the use of anti - tuberculous chemotherapy . We are presenting a case of ebtb that manifested with two endobronchial masses, which almost totally occluded the bronchial lumen and resulted in repeated episodes of post - obstructive pneumonia for more than a year prior to diagnosis . Our patient was successfully treated with anti - tuberculous chemotherapy without the use of corticosteroids . Repeated bronchoscopic examination after six months from initiating antituberculous treatment revealed complete resolution of the two lesions without residual bronchial stenosis . A 62 year old pakistani woman was admitted to hamad general hospital with history of fever for 10 days prior to admission . She denied any history of cough, hemoptysis, breathlessness, chest pain, nocturnal sweating or weight loss . Prior to admission she was prescribed a seven - day course of amoxicillin that was changed to cephalexin by her family physician without improvement . For more than a year prior to this admission she had frequent visits to emergency room and a hospital admission for recurrent episodes of fever and cough that were diagnosed as community acquired pneumonia based on the radiographic finding of right lung opacity and the response to antibiotic therapy . Three years earlier she was admitted for abdominal surgery due to a perforated duodenal ulcer and incidentally discovered to have type 2 diabetes for which she was commenced on glibenclamide . She had frequent visits to pakistan, the last of which was 2 years prior to her admission . Eight months prior to her admission she was refused entry to canada because of abnormal chest radiograph . She was a housewife, life - long non - smoker, and never consumed alcohol . Physical examination was remarkable for fever of 39.5 c and dull percussion note over the right lower and mid chest, without added sounds . Laboratory investigations at admission revealed leucopenia of 1.8103/ul with neutropenia of 0.5103/ul and normal hemoglobin and platelet count . Peripheral blood smear revealed marked leucopenia with severe neutropenia, few toxic, left - shifted neutrophils and reactive lymphocytes without malarial parasites seen (picture of severe infection or drug induced cytopenia). Bacterial culture of the sputum, 3 sputum samples for acid - fast bacilli smear and culture and human immunodeficiency virus (hiv) testing were all negative . Chest radiograph revealed right lower and mid zone non - homogenous opacity (figure 1). Computerized tomography (ct scan) of the chest and abdomen revealed a soft tissue enhancing mass in the lumen of the right main bronchus that was associated with distal parnechymal consolidation and multiple lymph node enlargement (figure 2). Chest radiograph showing opacification of the right lower zone ct scan of the chest showing right bronchial mass with post - obstructive consolidation (arrows) bone marrow examination revealed a cellular marrow without evidence of involvement by neoplastic or granulomatous process . Bronchoscopy was done and showed two large endobronchial masses, one in the right main bronchus and the other in the right upper lobe bronchus with glistening, whitish surface (figure 3). Endobronchial biopsy was taken from both masses and reveled caseating granuloma with presence of acid - fast bacilli on zeihl - nelsen staining (figure 4). Bronchoscopic picture showing a mass in the right main bronchus and another one in the right upper lobe bronchus histopathologic slides showing caseating granuloma with acid - fast bacilli (arrow) bronchoalveolar lavage culture for acid - fast bacilli was negative . She was started on intravenous meropenem for 14 days and antituberculous chemotherapy in the form of rifampicin, isoniazide, ethambutol and pyrazinamide for 2 months, and then continued on rifampicin and isoniazide for further 4 months . A repeated bronchoscopy 6 months later revealed complete resolution of the endobronchial masses without evidence of bronchial stenosis (figure 5). Bronchoscopic picture of the right main bronchus and the right upper lobe bronchus after six months of treatment showing disappearance of the masses with no residual stenosis the disease remained infrequently reported and was mainly a postmortem pathological diagnosis until the advent of bronchoscopy in the late 1920s . Ebtb is defined as tuberculous infection of the tracheobronchial tree with microbial and histopathological evidence [3, 4]. This form of tuberculous infection continues to be an important health problem for three reasons; firstly, its diagnosis is frequently delayed, particularly in developed countries, as the decreased incidence itself diminishes the suspicion of tuberculosis . Secondly, bronchial stenosis is a serious complication of the disease that may develop despite efficacious antituberculous chemotherapy and thirdly, it is often misdiagnosed as bronchial asthma or lung cancer . The exact pathogenesis of ebtb is unknown, however, direct extension from adjacent pulmonary parenchymal lesion, implantation of the organisms from infected sputum, dissemination from the blood or erosion of a lymph node into the bronchus have all been suggested as possible mechanisms of the disease [3, 8]. Chung and lee identified seven subtypes of ebtb on bronchoscopic appearance; the actively caseating type (43.0%), the edematous - hyperemic type (14.0%), the fibrostenotic type (10.5%), the tumorous type (10.5%), the granular type (11.4%), the ulcerative type (2.7%), and the non - specific bronchitic type (7.9%). Among these subtypes, the prognosis of tumorous ebtb was found to be most grave and unpredictable . The majority of the tumorous ebtb cases studied by chung and lee changed to fibrostenotic type within 3 months of treatment . Tumorous ebtb is characterized by an endobronchial mass whose surface is covered by caseous material and totally or near totally occludes the bronchial lumen . This form of ebtb is frequently mistaken for lung cancer, adenoma or carcinoid tumors . The two most important goals when treating ebtb are to eradicate tubercle bacilli and to prevent bronchial stenosis . Although anti - tuberculous chemotherapy is effective in controlling infection, it does not prevent residual bronchostenosis [5, 4]. Oral corticosteroids have been used empirically to prevent bronchial stenosis, nevertheless, their role remains uncertain and controversial [9, 10]. Many patients with ebtb will require aggressive treatment like repeated dilatation, the use of stents or even resection to treat bronchial stenosis . Some previous studies have suggested that delay in diagnosis of ebtb is an independent predictor of the development of persistent airway stenosis . Our patient presented with two tumorous growths that almost completely obstructed the lumens of the right main bronchus and right upper lobe bronchus and resulted in recurrent episodes of post - obstructive pneumonia for more than a year prior to diagnosis . Considering the prognosis of tumorous type ebtb and the delay in diagnosis as a predictor for the development of bronchial stenosis, healing without stenosis in our case seems interesting . It may suggest that the exact mechanism behind the tendency of some patients and certain types of ebtb to develop bronchial stenosis is not yet completely understood . Future research should focus on the pathogenesis of bronchial inflammatory reaction induced by ebtb in order to understand this mechanism.
The patients were subjected to specialists opinion (e.g., ophthalmologist, ent or medical specialist) and relevant investigations (e.g., fundus, x - ray skull, c.t . The cases suffering from organic mental disorders, chronic psychiatric disorders, epilepsy or drug dependence were excluded from the study . Out of 3245 patients seen during the study period, 100 (3.2%) were suffering from migraine . Maximum patients belonged to age - group of 31 - 40 years (40%) followed by 21 - 30 years (22%). A majority of migraineurs were married (76%), illiterate or just literate (55%), hindus (86%) and housewives (56%) [table 1]. Socio - demographic characteristics of patients with migraine family history of migraine was present in 12% cases whereas family history of depression was present in 6% . Maximum patients had a total duration of migraine as one to three years (40%) followed by less one year duration (32%). The commonest frequency of migraine was 1 - 2/week (54%) or 2 - 3/month (26%). The provoking factors were reported in 18 patients (18%) [table 2]. Migraine without aura (previously called common migraine) was the commonest variety (81%) followed by migraine with aura (previously called classis migraine) (17%) and complications of migraine (2%) (only two cases reported complications due to migraine both with fainting spells). The personality profile of the patients showed anankastic traits (25%), dysthymic traits (20%), histrionic traits (17%), anxious traits (14%), schizotypal traits (10%), cyclothymic traits (6%) and others (8%). The physical comorbidity included hypertension (12%), cervical spondylosis (8%), refractive errors (7%), chronic sinusitis (3%) and diabetes mellitus (2%). Characteristic of migraine generalized anxiety disorder (f41.1) was the commonest psychiatric diagnosis (34%) followed by mixed anxiety and depressive disorder (f41.2) (18%), 22 patients (22%) did not have any psychiatric disorder [table 3]. Migraine is reported to be more common in persons between the age of 20 and 45 years . In the present study also, migraine was found to be more common among age group of 31 - 40 years (40%) followed by 21 - 30 years of age (22%). This is also consistent with other studies[91416] and a majority of patients were married (76%). Unilateral type of headache was much more common than the bilateral type and the headache was throbbing in nature in a majority of migraneurs . There is a wide range of age of onset of migraine reported in the literature (5 to 28 years) with an average age at onset in mid - teens . They were fatigue, lack of adequate sleep, intake of alcohol, menstruation and oral contraceptives . The other provoking factors for migraine as reported in the literature e.g., aged cheeses, caffeine, chocolate, concentrated sugar, dairy products, fermented, pickled food, fruits (bananas, figs, raisins, pineapple etc .,) vegetables (onions, pea, pods, nuts, peanuts), yeast products, meats with nitrites, monosodium glutamate, saccharin etc ., could not be identified or reported by the patients in the present study . Migraine without aura (previously called common migraine) was the commonest subtype seen (in 81%). This is consistent with the reported findings that lifetime prevalence of migraine without aura is about 13% as compared to migraine with aura seen in less than 4% population . Generalized anxiety disorder (f41.1) was the commonest disorder followed by mixed anxiety and depressive disorder (f41.2) and depressive episode (f32). Mixed dissociative (coversion) disorders (f44.7) (fits and fainting) were also seen among female migraineurs . Previous clinical and community studies[1724] have also reported a strong association between migraine and depression as well as anxiety disorders and also vice - versa . The literature also indicates that patients with migraine are at reduced risk of suffering from anxiety, mood disorders and substance - related disorders compared with medication overuse headache sufferers . Retrospective studies on the onset and course of these syndromes showed that the onset of anxiety generally preceded that of migraine whereas the onset of depression tended to occur after that of migraine . The studies on association of personality traits and migraine demonstrate increased prevalence of neuroticism - anxiety and depression as compared to healthy controls . But the present study, a cross sectional one, did not determine whether the onset of anxiety disorder and depression preceded or followed the migraine . Health - related outcomes were worst in those with both migraines and a psychiatric disorder and intermediate in those with either condition alone . Future long term follow up studies on larger sample are warranted to study this association . The present study confirms that majority (78%) of patients with migraine had psychiatric disorders.
Medullary thyroid carcinoma (mtc) is a rare neuroendocrine cancer that originates from thyroid parafollicular calcitonin-(ct-) producing cells . Mtc accounts for approximately 4% of all thyroid malignancies; approximately 75% of these cases occur in the sporadic form, and 25% occur in the hereditary form [13]. Mtc usually has a favorable prognosis, with a 10-year survival rate of 70%80%, if it is diagnosed and treated at an early stage when the tumor is confined to the thyroid . Unfortunately, most cases of mtc present at diagnosis with metastases to the local and regional lymph nodes and to distant organs, especially the lungs, liver, and bones . Patients with metastatic mtc have a 10-year overall survival rate of 40%, and metastasis is the main cause of death in patients with mtc [4, 6]. Locally advanced and distant metastatic diseases are incurable, as surgical resection and conventional radio- and cytotoxic chemotherapies are not effective against metastatic mtc [7, 8]. Clinical trials of various combinations of chemotherapeutic drugs have yielded unsatisfactory results [9, 10]. However, research over the last years has led to a good understanding of the genetic defects and altered molecular pathways that are associated with the development of mtc . Thus, multiple promising therapeutic agents that target these genetic alterations have been developed to treat progressive and advanced mtc . Activating mutations of the tyrosine kinase receptor (tkr) rearranged during transfection (ret) this discovery has led to the development and introduction of targeted therapies, such as tyrosine kinase inhibitors (tkis) that target ret . Several tkis directed toward ret kinase have been tested in vitro, preclinical, and clinical studies with promising results . Unfortunately, these agents are not likely to be curative, as the longest duration of response observed was approximately 4 years, and the maintenance of agent - dependent effects may require continuous therapies, which are not without important side effects . The main reasons for the failure of these agents to cure mtc are the development of resistance to tkis that target the ret and other cell receptors and the activities of other signal transduction pathways that are involved in mtc tumorigenesis and progression but not directly targeted by tkis . In recent years, the discovery of mechanisms of resistance to tkis and of several other molecular events that contribute to mtc transformation and metastasis suggested that combinatory therapy may result in a more significant tumor growth inhibition . This has led to the development of novel compounds that have been used in several clinical trials, including tkis that can target multiple tkrs simultaneously in addition to ret and agents that can target other altered signaling pathways . Other studies have demonstrated the potential for immunotherapy in combination with agents that target signal transduction pathways that are important for mtc growth . Because the aim of these targeted therapies is to extend lifespan and increase the quality of life, it is very important to limit the toxicities of therapeutic agents, either alone or in combination . The possibility of testing these novel drugs in vitro (in primary thyroid cancer cells) and in vivo may help to improve the personalization of treatments . The role of the ret oncogene in the tumorigenesis of mtc has been characterized extensively . The ret gene encodes a transmembrane tyrosine kinase that binds to glial cell line - derived neurotrophic factor (gdnf) family ligands . Ret signaling leads to the activation of the ras / mitogen - activated protein kinase (mapk) and the phosphatidylinositol 3 kinase (pi3k)/akt pathways and has key roles in cell growth, differentiation, and survival . Activating point mutations of the tkr ret have been reported in nearly all hereditary cases of mtc; some of these mutations are included in the men2a, familial mtc, or men2b syndromes in which there is a genotypic / phenotypic correlation between the type of ret mutation and clinical features . Germline mutations in the ret proto - oncogene are responsible for hereditary mtc, while somatic ret mutations are responsible for sporadic mtc . However, this paper will mainly focus on additional cellular signaling pathways other than ret responsible of mtc tumorigenesis and progression and potential targeted approaches for the treatment of advanced or metastatic mtc . Although activating mutations of the tkr ret are believed to be the primary oncogenic event in the development of a majority of mtc cases, it is clear that ret cooperates with other signal transduction pathways to promote mtc tumorigenesis . In addition to ret, other kinase receptors may play a role in the development and progression of mtcs . Similar to the ret receptor, the epidermal growth factor receptor (egfr) is a tkr that is associated with the regulation of cell growth, proliferation, and apoptosis . Dimerization of the receptor following ligand binding results in transphosphorylation and the subsequent activation of several downstream signal pathways . Egfr has been shown to be frequently overexpressed in various types of thyroid carcinomas, including mtc, and to play a role in cancer development and progression . In contrast, a recent report analyzing different mtc on tissue microarrays has demonstrated that only 20% of cases revealed moderate to strong reactivity for egfr, whereas the majority of the cases revealed weak and very focal positivity . With respect to the numbers of egfr gene copies in mtcs, the researchers did not detect amplifications but did find polysomes in 15% of the examined tumors . Additionally, egfr was activated in a subset of mtcs, which suggests that this subset of patients might benefit from drugs that target also egfr . Recent findings have shown that the ligand - induced activation of egfr can stimulate ret activation beyond signaling and growth stimulation . Several egfr inhibitors have been shown to markedly inhibit the growth of the mtc tt and mz - crc-1 cell lines . Because ret activation seems to be influenced by egfr, a recent study investigated whether egfr activation could be related to specific ret mutations in mtcs . The researchers found that tumors with the most aggressive ret mutations (in codons 883/918) exhibited reduced egfr expression compared to other ret mutations . It could be speculated that the most aggressive ret mutations are less dependent on egfr activation . In fact, in the work by croyle et al ., in which cell lines with ret mutations in codon 634 and codon 918 were compared, the effect of egfr inhibition on the codon 918 mutated cell line appeared to be reduced, in agreement with the previous data . Because the activation status of egfr seems to be related to ret activation however, no differences have been found in egfr activation between ret - positive and -negative tumors, which likely indicates that other molecular mechanisms lead to ret activation, such as increased ret gene copy numbers, altered promoter activity, or increased transcription in the ret mutation - negative tumors . These data suggest that egfr status determination in mtcs might be important but certainly deserves further investigations . The vascular endothelial growth factor receptor (vegfr) pathway is also important in the pathogenesis of mtc . There are three transmembrane receptors that mediate the angiogenic and lymphogenic effects of vegf: vegfr-1, vegfr-2, and vegfr-3 . Overexpression of vegf and vegfr-2 has been found in mtc compared to normal thyroid tissue . The vegf proteins (vegf - a, b, c, and d), which are secreted by tumor cells, act as ligands for the vegfr-2 receptors on endothelial cells and promote a signaling cascade through different pathways, such as plc--pkc - raf - mek - mapk and pi3k - akt, that stimulate cellular proliferation, migration, and survival and induce neoangiogenesis . Angiogenesis is an essential alteration in cell physiology that predisposes the development of malignancy and is fundamental in tumor growth and metastasis . Similarly to egfr, the overexpression of vegfr-2 in mtc has been shown to correlate with metastasis . Several multitargeting tyrosine kinase inhibitors that block vegfr have shown promising clinical antitumor activity; unfortunately, in most thyroid carcinomas and other solid tumors, the antiangiogenic effects are often only transitory and really often may have late paradoxically protumorigenic effects . Additionally, it seems that a modest significant association has been observed between vegfr-2 expression and ret mutation status in primary tumors . The met proto - oncogene codes for the tk receptor for the hepatocyte growth factor (hgf). Met hyperactivation reportedly correlates with the metastatic abilities of tumor cells . Met and hgf coexpression has been observed in a subset of mtc tumors and is associated with multifocality in mtc, which makes this interaction a potentially important target . In one report importantly, ret can induce the overexpression of c - met in this type of thyroid tumor . The fibroblast growth factor receptor 4 (fgfr4) has also been reported to be overexpressed in mtc cell lines . Inhibition of fgfr phosphorylation with the small molecule fgfr inhibitor pd173074 resulted in an arrest of cell proliferation and tumor growth . Moreover, the dual inhibition of ret and fgfr combined with tyrosine kinase inhibitors resulted in greater suppressions of cell proliferation in vitro and tumor control in vivo than that which was achieved with either agent alone . These data highlight ret and fgfr4 as therapeutic targets and suggest a potential role for the use of combined tyrosine kinase inhibitors in the management of inoperable medullary thyroid cancers . Finally, the platelet - derived growth factor receptor (pdgfr) also seems to play a role in differentiated thyroid cancer, although its role and function have not been fully investigated in mtc . Several other signal transduction pathways have been implicated as contributors to mtc tumor growth, as illustrated in two recent studies [5, 30]. These pathways include ret interactions with prb, p53, p18, and p27 as well as the phosphatidylinositol 3-kinase / akt / mtor and ras / raf / mek / erk pathways . Ret interactions with tumor suppressor genes (a) prb and p53 . The tumor suppressor genes rb1 (retinoblastoma; prb protein) and tp53 (p53 protein) are frequently mutated in human cancers, and it appears that, in cancer, both pathways must be inactivated to overcome senescence or apoptosis . There is extensive genetic evidence that the prb and p53 pathways are involved in mtc in rodents . Further, the loss of tp53 further increased mtc formation in rb1-deficient mice [32, 33]. It has been shown that in mice, ret cooperates with the inactivation of prb / p53 to cause experimental mtc . Prb / p53 mutant mice have been shown to acquire ret mutations that are analogous to activating germline mutations that are observed in human men2a and familial medullary thyroid carcinoma (fmtc). This suggests that murine mtc requires mutational dysregulations within both the ret and nuclear tumor suppressor gene pathways . However, mouse models may not mimic human disease, and a systematic analysis of the genes in the rb1 and tp53 pathways in human samples will help to clarify their roles in human mtc formation . This information may be important for the development of novel targeted therapeutic approaches for mtc . Thyroid tumors show low expression of the cyclin - dependent kinase inhibitor (cdki) p27 (kip1), and recent evidence demonstrates that p27 is downregulated by the active ret mutant, ret / ptc1, which is found in papillary thyroid carcinomas . These data implicate decreased p27 activity as an important event during thyroid tumorigenesis . However, p27 mice develop men - like tumors only in combination with the loss of p18 (ink4c), another cdki . This suggests that p18 and p27 are functional collaborators in the suppression of tumorigenesis, that the loss of both is critical to the development of men tumors, and that both p18 and p27 are regulated by ret . The pi3k - akt - mammalian target of the rapamycin (mtor) cascade is important in tumorigenesis due to its ability to promote cell growth, proliferation, and survival . Several examples provide evidence to support a role for the activation of the pi3k / akt / mtor signaling cascade in medullary thyroid cancer [3638]. Several mechanisms have been shown to be involved in the activation of pi3k signaling in medullary thyroid cancer . A mutation of men2a (ret - men2a) has been shown to activate pi3k and its downstream effector, the serine / threonine kinase akt / protein kinase b . Previous studies have demonstrated that a mutation of tyr-1062, which is the intracellular docking site for shc and enigma on ret, abolishes the ret - men2a transforming activity . These studies further revealed that the mutation of tyr-1062 abrogates the binding of the p85 regulatory subunit of pi3k to ret - men2a and subsequent stimulation of the pi3k / akt pathway . Furthermore, retroviral transduction of rat fibroblasts with a dominant - interfering form of pi3k was shown to suppress ret - men2a - dependent transformation, whereas the overexpression of akt enhanced ret - men2a oncogenic potential . In summary, these data are consistent with the notion that ret - mediated cell - transforming effects are critically dependent on the activation of the pi3k / akt / mtor pathway . In cell lines, the pi3k - akt / mtor pathway has been shown to be important in the pathogenesis of men2b . Ret - men2b (ret m918 t) is more effectively autophosphorylated at ret y1062 than is ret - men2a, which subsequently leads to increased constitutive activation of the ras / mitogen - activated protein kinase (mapk) and pi3k / akt / mtor signaling cascades . Furthermore, previous data report other possible mechanisms of pi3k activation in thyroid carcinomas, such as the overexpression of rai (shcc / n - shc), which is a substrate of ret oncoproteins [5, 42]. Finally, the loss of expression of the phosphatase and tensin homologue (pten) gene, a tumor suppressor gene, may have a role in the activation of pi3k / akt in thyroid tumors . The absence of functional pten protein expression has been observed in various cancer cells and has led to the constitutive activation of downstream components of the pi3k pathway, including the akt and mtor kinases . Preclinical models showed that inactivation of these kinases is able to reverse the effects of pten loss . These data raise the possibility that drugs that target either these kinases or pi3k itself might have significant therapeutic activity against pten - null cancers . Mutations in major nodes of this signaling cascade have been observed in human cancers; these mutations include gain - of - function mutations and amplifications of the genes encoding pi3k and akt [44, 45]. However, a recent study on a series of 49 mtcs has shown that the pi3k genes were not mutated, and that the activation of the pi3k pathway was significantly associated with the status of ret mutations . In fact, using protein expression analysis, the same authors confirmed that the akt / mtor pathway was highly activated in mtc, especially in cases with germline ret mutations . Interestingly, this association was not dependent on the type of mutation (in either the codons of the juxta - membrane or of the tyrosine kinase portion of the receptors) but was dependent on the hereditary nature of the mutation . In contrast, medullary carcinomas with sporadic ret mutations or with wild - type ret were observed with heterogeneous expression of akt / mtor pathway molecules, which suggests the need for further elucidation of alternative activation mechanisms . In a recent study, the pi3k / akt / mtor pathway was shown to be activated in mtc, particularly in the metastatic lymph nodes, and this pathway was shown to sustain malignant features of different mtc cell models . Moreover, it has been shown that the selective inhibition of the mtor pathway in a germline - ret - mutated mtc cell line can effectively decrease cell viability and block the phosphorylated status of mtor signaling molecules, which confirms previously published in vitro data . Another study used metformin, which is an antidiabetic agent that decreases the proliferation of cancer cells through the 5-amp - activated protein kinase - dependent inhibition of mtor, in mtc cell lines to show that the growth - inhibitory effects on the cells were associated with the downregulation of both the mtor/6sk and perk signaling pathways . Altogether, these results strongly suggest that mtor might be a very efficacious target in patients with advanced or metastatic mtc . Noteworthy, mtor inhibitors are currently being used in clinical trials for the treatment of medullary thyroid carcinoma . Ras - raf - mek - erk pathway . Unlike hereditary mtc, in which ret mutations are the critical events, in sporadic mtc, the genetic or molecular biomarkers have not been fully established . Ras is a frequently mutated oncogene in a broad spectrum of human tumors, including thyroid carcinoma, mainly in the follicular forms . In this context, investigators aimed to determine whether mutations in the ras oncogene could play a possible role in the carcinogenesis of sporadic mtc . The initial study analyzed 15 sporadic mtcs for mutations in known hot spots (codons 12, 13, and 61) of the h- and k - ras oncogenes by a direct sequencing technique, although no ras mutations were detected in any of the examined tumors . A different study on 49 mtc confirmed that ras mutations are a rare event in this type of tumor, regardless of ret mutational status . By contrast, different studies have demonstrated the presence of ras mutations in mtc . A mutational screening for h-, k-, n - ras, and braf in 13 sporadic and inherited mtcs revealed one sporadic ret - negative mtc (stage iii) with a mutation in the h - ras codon 13 (g13r). Another study analyzed 188 hereditary and sporadic mtcs for ras mutational status, revealing a low prevalence of mutations, which were confined only to ret - negative sporadic mtc . Furthermore, recent studies have reported a quite high prevalence of ras mutations in sporadic mtc, particularly in ret - negative mtc; 68% (17 of 25) of the ret - negative mtcs had mutations of ras compared to only 2.5% (1/40) of the ret - positive mtcs . These findings were confirmed by a different study that analyzed 17 sporadic mtcs by exome sequencing and found dominant and mutually exclusive oncogenic mutations in ret and ras (h- and k - ras) genes in 17 sporadic mtcs . As expected, most ras mutations corresponded to mutational hot spots in exons 2 and 3, although some mutations were also detected in exon 4 . This study confirms that ret and ras mutations are mutually exclusive, and that they are probably 2 different oncogenic driver events in mtc . These results suggest that the activation of the proto - oncogenes ras and ret represents alternative genetic events in sporadic mtc tumorigenesis, and that more sensitive sequencing techniques such as next generation sequencing are necessary to detect mutations . For decades, the ras and raf families of oncogenes have been known to be transforming genes . However, in many normal cultured cell types, the sustained expression of activated ras or its downstream effector, raf, can elicit cell cycle arrest or senescence . The ras / raf - mediated growth arrest has been proposed as a defense mechanism against the inappropriate activation of the ras / raf signal transduction pathway [56, 57]. According to this hypothesis, spontaneous mutations in ras genes, which may occur stochastically in all cell types, would be innocuous for the organism because these mutations would lead to growth arrest or senescence . Hence, for carcinogenesis to occur in response to ras / raf activation, the growth arrest response must be inactivated . The growth arrest response to ras / raf activation is not limited to normal cells . Several tumor cell lines that were derived from different tumor types, including medullary thyroid carcinoma, also experienced growth arrest, usually accompanied by differentiation or senescence [5860]. These findings indicate that some tumors retain a capability for growth arrest in response to ras / raf activation . The mechanism by which ras or raf activation can induce growth arrest is not completely understood . Some investigators have reported that ras or raf activation could induce the expression and secretion of a protein that mediated differentiation and g1 cell cycle arrest in mtc cells . By protein purification and mass spectrometry, this protein has been identified as the leukemia inhibitory factor (lif). Stat3 activation was necessary for lif - mediated growth arrest and differentiation in mtc cells . In addition, the ras / raf / mek / erk pathway could also mediate growth arrest and differentiation by a second mechanism that is independent of lif / jak / stat3 . This novel autocrine - paracrine mechanism, which mediates crosstalk between the ras / raf / mek / erk and the jak - stat pathways, defines a novel mechanism of ras / raf - induced cell growth arrest [61, 62]. The inactivation of gsk-3beta in tt cells by well - known gsk-3beta inhibitors, such as lithium chloride (licl) and sb216763, is associated with both growth suppression and a significant decrease in neuroendocrine markers, such as human achaete - scute complex - like 1 and chromogranin a. growth inhibition by gsk-3beta inactivation was found to be associated with cell cycle arrest due to an increase in the levels of cyclin - dependent kinase inhibitors, such as p21, p27, and p15 . Additionally, tt xenografts mice, treated with licl, showed a significant reduction in tumor volume compared with those that were treated with a control . Therefore, gsk-3beta is a key downstream target of the raf-1 pathway in tt cells, and the inactivation of gsk-3beta alone is sufficient to inhibit the growth of tt cells both in vitro and in vivo . -catenin is a ubiquitously expressed multifunctional protein that plays an important role in cellular adhesion . A novel ret--catenin signaling pathway was found to be a critical contributor to enhanced cell proliferation and tumor progression in thyroid cancer . Gujral et al . Showed that ret could induce -catenin - mediated transcription, cell proliferation, and transformation in vitro and that -catenin nuclear localization and subsequent mediation of -catenin by ret are key secondary events in tumor growth and metastasis in vivo . This novel interaction suggests a mechanism that may underlie the broad and early metastatic potential of mtc . These data suggest an unrecognized role for -catenin signaling that may have implications for tyrosine kinase - mediated tumorigenesis in multiple tumor types and provide another potential target for therapeutic agents . In support, a recent study performed on tissue microarray observed that wnt pathway proteins, including wisp-1, wisp-2, and -catenin, were actively expressed in mtc . The nuclear factor kappa - b (nf-b) proteins, a family of transcription factors that are found virtually in all cells, are known to play crucial roles in the growth of many human malignancies . The ability of nf-b to target a large number of genes that regulate cell proliferation, differentiation, survival, and apoptosis provides clues towards its dysregulation during the processes of tumorigenesis, metastatic progression, and therapeutic resistance of tumors . Nf-b is constitutively active in mtc through the ret - induced phosphorylation, ubiquitination, and proteosomal degradation of inhibitors of nf-b (ikb), which allows nf-b to enter the nucleus and bind to dna . Nf-b is frequently activated in mtc, and the activation of ret by somatic or germline mutations may be responsible for nf-b activation in these tumors . These results suggest that the nf-b pathway may be an important target for drug development in mtc . A recent study examined the expression of proteins involved in angiogenesis, inflammation, apoptosis, cell cycle, cell - to - cell contact, and carcinogenesis using high - throughput tissue microarrays from 23 patients with mtc . These authors identified several novel potentially important protein targets such as cox-1/2, bcl-2a, gst-, gli-1, gli-2, gli-3, and bmi-1 that may be therapeutically targeted in mtc . For example, cox-1 and cox-2, which are two inflammation - related factors, were significantly expressed in these cases, suggesting that nonsteroidal anti - inflammatory drugs may provide benefit in some patients with mtc . Then, the finding of antiapoptotic bcl-2a and gst- overexpression in mtc suggests that bcl-2a and gst- inhibitors might be a treatment option for patients with advanced or metastatic mtc . The same is applied to gli-1, gli-2, and gli-3, members of sonic hedgehog homolog (shh) pathway, and bmi-1, a cell - cycle marker that resulted overexpressed in these mtc samples . The studies of these markers, particularly the members of the shh, may improve our understanding of mechanism of resistance to current chemotherapeutic and/or tki regimens and identify novel potential therapeutic approaches . Due to increased knowledge of the molecular pathogenesis of mtc, therapeutic agents that target specific altered pathways have been developed (figure 1). Because the alterations of protein kinases and their pathways are involved in mtc development, several tyrosine kinase receptors inhibitors (tkis) have been tested in vitro, preclinical, and clinical studies . Ret is certainly an attractive target for several types of tumors particularly for parafollicular c - cells - derived tumors, which are addicted to ret and its activity . Tkis are small organic compounds that affect tyrosine kinase - dependent oncogenic pathways by competing with atp - binding sites of the tyrosine kinase catalytic domains . Occupation of these sites inhibits autophosphorylation and activation of the tyrosine kinases and prevents the further activation of intracellular signaling pathways . Several tkis that are directed against ret kinase have been developed for the treatment of mtc, but there is no currently available tyrosine kinase inhibitor specific to ret . However, several multitargeted tyrosine kinase inhibitors have demonstrated significant activity against ret (table 1), including vandetanib, sorafenib, motesanib, imatinib, and sunitinib [66, 68]. The inhibition of only one kinase receptor may induce the compensatory activation of other tks and consequent resistance to treatment with tkis [69, 70]. Therefore, the simultaneous inhibition of multiple activated tks may be the best way to approach mtc [7173]. Vandetanib (zd6474) is an oral tki that targets ret, vegfr-2, and -3, and at higher concentrations, egfr . Vandetanib selectively inhibits pathways that are critical for tumor growth and angiogenesis without leading to direct cytotoxic effects on tumor or endothelial cells . Most of the mutant ret oncoproteins have demonstrated sensitivity to vandetanib, while mutations in which valine 804 is substituted by either leucine or methionine (as observed in some cases of men2a) rendered the ret kinase significantly resistant to vandetanib . This resistance is likely due to steric hindrance, as the val804gly mutation increased the sensitivity of ret to vandetanib . When ret activity was inhibited, overstimulation of egfr was able to partially compensate for ret through a partial rescue of mapk pathway activation . The inhibition of egfr by vandetanib has been shown to prevent this rescue of mapk pathway activation . These data support the idea that the dual inhibition of ret and egfr is important, as it may overcome the risk of an escape by mtc cells from a blockade of ret through the compensatory overstimulation of egfr . In addition, the expression of egfr has been demonstrated in tumor - associated endothelial cells . In this respect, anti - egfr agents have been shown to block the proliferation and migration of endothelial cells . Therefore, the anti - egfr activity of vandetanib might result in an additional direct antiangiogenetic mechanism . One phase ii clinical trial showed the antitumor activity of vandetanib (300 mg / day) in patients with hereditary mtc . In this study, 20% of the patients showed a partial response to vandetanib (> 30% reduction in tumor diameter), while an additional 53% of patients presented with disease stability at 24 weeks . Only 1 patient showed disease progression while receiving this agent . Of interest, this patient was not affected by any of two ret mutations correlated to vandetanib resistance in which valine 804 is substituted by leucine or methionine, but by y791f ret germline mutation . Another clinical trial, in which 19 patients with hereditary mtc were treated with vandetanib (100 mg / day), showed similar results . Vandetanib is the only tki approved for the treatment of symptomatic or progressive mtc in patients with unresectable locally advanced or metastatic disease . The approval of vandetanib in april 2011 by the us food and drug administration (fda) was based on the results of the phase iii clinical trial, study d4200c00058, in which 331 patients with unresectable locally advanced or metastatic mtc were randomly assigned to receive vandetanib (231) or a placebo (100). This study showed that the median progression - free survival duration (pfs) was 11 months longer in the group that received vandetanib than in the placebo control group and that 45% of the patients had an objective response rate (orr). Common adverse events (any grade) occurred more frequently with vandetanib compared to the placebo and included diarrhea (56% versus 26%), rash (45% versus 11%), nausea (33% versus 16%), hypertension (32% versus 5%), and headache (26% versus 9%). The impact of overall survival of mtc patients treated with this compound is presently unknown . Xl184 (cabozantinib) is an oral selective inhibitor of ret, c - met, and vegfr-2 . The phase i trial results indicated that cabozantinib is active in patients with mtc, including those who harbor somatic ret mutations and are potentially at high risk for progression and death . A global phase iii pivotal study in mtc is ongoing (http://www.clinicaltrials.gov/ number nct00704730). Sorafenib (bay 43 - 9006)is a multikinase inhibitor that targets braf, vegfr-2, vegfr-3, kit (a stem cell growth factor proto - oncogene involved in cell survival and differentiation), and pdgfr . A phase ii clinical trial, in which sorafenib (400 mg / twice daily) was given to 21 patients with metastatic medullary carcinoma, reported that of the patients with sporadic mtc, 87.5% achieved disease stability and 6.3% demonstrated partial responses . The treatment was prematurely terminated in mtc hereditary patients due to slow accrual . In a similar trial, recently, a study of sorafenib was conducted on advanced thyroid carcinoma patients, and partial responses were reported in six out of the 12 (50%) patients with mtc, although the small number of patients requires further prospective studies . Sunitinib (su011248) is a small molecule inhibitor that targets many of the same protein kinases as sorafenib, including vegfr, pdgfr, kit, and ret . In a phase ii clinical trial, 33 patients with either well - differentiated thyroid carcinoma or mtc were treated with sunitinib . One patient had a complete response, 28% of the patients had partial responses, and 46% of the patients exhibited disease stability . The intermediate results of the phase ii thysu study also showed the efficacy of sunitinib in advanced medullary thyroid carcinoma . Motesanib (amg 706) is a multikinase inhibitor that targets vegfr receptors 1, 2, and 3, pdgfr, and kit and exerts antiangiogenic and direct antitumor activities . A phase ii study performed in 91 patients with locally advanced or metastatic, progressive or symptomatic, mtc demonstrated that although the objective response rate was low, a significant proportion of the mtc patients (81%) achieved disease stability while receiving motesanib . A recent study investigated the effects of motesanib on wild - type and mutant ret activity in vitro and on tumor xenograft growth in a mouse model of mtc . The results of this study demonstrated that motesanib inhibited thyroid tumor xenograft growth, predominantly through the inhibition of angiogenesis and possibly via the direct inhibition of vegfr2 and ret, which were expressed in tumor cells . These data suggest that angiogenic pathways and specifically the vegf pathway are still important for mtc cells . Imatinib (sti571) is a tki that inhibits ret, pdgfr, and kit . A phase ii trial in which imatinib was tested in metastatic mtc patients yielded disappointing results . The patients showed no objective responses; however, a minority of patients achieved disease stability . Several tk inhibitors have been tested in clinical trials, but the most effective inhibitor and whether there is any specificity for particular ret mutations remain unknown . A recent study compared the effects of four tkis (axitinib, sunitinib, vandetanib, and xl184) on cell proliferation, ret expression and autophosphorylation, and erk activation in cell lines that express men2a (mtc - tt) and men2b (mz - crc-1) mutation . The findings showed that the inhibitors were specific for different mutations, with xl184 being the most potent inhibitor against the men2a mutation and vandetanib the most effective against the men2b mutation in vitro . No tk inhibitor was superior for all tested cell lines, which indicates that mutation - specific therapies could be beneficial in mtc treatment . One of the mechanisms for the resistance of mtc to chemotherapeutic drugs is multidrug resistance (mdr). Mdr in cancer cells has been attributed to the overexpression of several plasma membrane atp - dependent efflux pumps, such as mdr-1 . The enzyme cyclooxygenase (cox-2) has been shown to regulate mdr-1 expression in rat mesangial cells . Furthermore, a study has shown that in vitro treatment of an mtc - derived cell line with rofecoxib, a cox-2 inhibitor, was able to sensitize mtc cells to doxorubicin . A recent study, performed in vitro, has shown that celecoxib, another cox-2 inhibitor, was able to induce both mtc cell apoptosis and sensitization to vinorelbine, thus enhancing the chemotherapeutic effect of this drug . A clinical trial, in which the in vivo activities of celecoxib were explored in mtc patients who cannot benefit from available treatments, would be desirable after accounting for the possible cardiovascular risks of this drug . Several other therapeutic agents are being investigated for their uses in the treatment of thyroid carcinomas, including mtc . These agents inhibit targets that are involved in development of mtc other than the tyrosine kinase receptors . We previously discussed that ras operates in a complex signaling network with multiple activators and effectors, which allows them to regulate many cellular functions such as cell proliferation, differentiation, apoptosis, and senescence . Phosphatidylinositol 3-kinase (pi3k) is one of the main effector pathways of ras, regulating cell growth, cell cycle entry, cell survival, cytoskeleton reorganization, and metabolism . The presence of ras mutations in sporadic mtc and most importantly the frequent activation of the pi3k / akt / mtor pathway in several aggressive and metastatic mtcs strongly suggest that this cellular signaling pathway is a good candidate for targeted therapies against mtc . In fact, several in vitro evidences have demonstrated that the indirect blocking of this pathway, by pi3k inhibitors, or direct inhibition of mtor can mediate the induction of apoptosis and a decrease in cell viability in the mtc tt cell line . Currently, there are several clinical trials in which patients with radioiodine - refractory differentiated and medullary thyroid carcinomas were recruited to test the efficacy of everolimus (rad001), a novel inhibitor of mtor, in combination with other drugs (nct01625520 and nct01270321). Recently, researchers have developed a liposomal form of everolimus and have demonstrated the anticancer efficacy of this formulation against tt cells . Studies have shown that metformin can decrease the proliferation of cancer cells through 5-amp - activated protein kinase-(ampk-) dependent inhibition of mtor . Some researchers have reported growth inhibitory effects of metformin against mtc cell lines (tt and mz - crc-1), which were attributable to the downregulation of both mtor/6sk and perk signaling . The expression of the molecular targets of metformin in human mtc cells suggests that this drug may be potentially useful in the treatment of mtc . Pi3k - akt - mtor and raf - mek - erk signaling have been shown to be important in the resistance of thyroid cancer cells to apoptosis and the promotion of tumor progression . In this context, targeted anti - vegfr therapy or raf inhibition may be ineffective if pi3k signaling remains intact . Therefore, two promising drugs, raf265, a raf inhibitor that is active against vegfr2, and bez235, a pi3k inhibitor, were tested alone and in combination in preclinical mtc models that represented the key genotypes observed in refractory thyroid cancers . The study findings showed that a combination treatment with agents that inhibited both raf and pi3k pathways strongly inhibited growth both in vitro and in vivo . In addition, the investigators showed for the first time that raf265 potently inhibits the constitutively active ret, a form of the kinase that is observed in men2a . Persistent ret activation, a frequent event in mtc, leads to the activation of the pi3k / akt / mtor, erk / mapk, and jak / stat3 pathways . Recently, the efficacy of the jak1/2 inhibitor azd1480 against the growth of thyroid cancer was tested in vitro and in vivo in thyroid cancer cell lines that expressed oncogenic ret . The findings showed that azd1480 efficiently inhibited the growth and tumorigenesis of thyroid cancer cell lines that harbored oncogenic ret alterations, likely through the inhibition of pi3k - akt signaling; this result supports the use of this inhibitor in patients with thyroid cancer, particularly in those with advanced mtc, for whom there are no effective therapeutic options . Thus, somatostatin (srif) peptide analogues in combination with tkis may be a promising approach for the treatment of these tumors . The presence of different combinations of srif receptor (sstr) subtypes in a given patient may explain the variable clinical response to srif analogues and may promote the search for more selective drugs with different affinities to the various receptor subtypes . The currently available somatostatin analogues (octreotide and lanreotide) act preferentially through the somatostatin receptor subtype 2 (sst2). In mtc, these compounds have been reported to exert antisecretive effects on calcitonin but unfortunately are not reported to have antiproliferative effects . Pasireotide (som230) is a new somatostatin analogue that has a peculiar binding profile with high affinity for sst1, sst2, sst3, and sst5 . Preliminary data from a phase ii study of patients with metastatic carcinoma show that som230 is effective, and some clinical trials are exploring the efficacy of som230 alone or in combination with rad001 in patients with mtc (nct01625520 and nct01270321). The nf-b pathway is also a potential target for drug development, and a number of compounds have been developed to inhibit this pathway at different levels in cancer cells . Studies have demonstrated that the proteosome inhibitor bortezomib exerted a promising antitumor effect in human mtc cells through the inhibition of ib degradation, which led to the inactivation of the transcriptional factor nf-b . Patients are currently being recruited for a phase i / ii trial to study the combination of vandetanib plus bortezomib (http://www.clinicaltrials.gov/). Immunization with tumor antigen - pulsed autologous dendritic cells (dcs) resulted in protective immunity and the rejection of various established human tumors . Specifically, vaccination immunotherapy with calcitonin and/or carcinoembryonic antigen (cea) peptide - pulsed dcs was shown to result in the induction of a cellular, antigen - specific immune response in patients with mtc, which led to clinical responses in some patients . Therefore, for the first time, a potential dc vaccination therapy was developed for patients with metastatic mtc . Another study, which was performed in a transgenic mtc mouse model, has confirmed this finding . Have reported on the in vitro findings of a vaccination trial in 5 mtc patients, who were treated with dcs that were generated using a new protocol, which consisted of granulocyte - macrophage colony - stimulating factor and interferon - alpha (ifn - dcs). These investigators demonstrated that immunization with ifn - dcs led to a tumor epitope - specific th1 immune response in mtc patients . Furthermore, a pilot trial of 10 patients has assessed the safety and efficacy, in terms of immune responses and clinical activities, of the dcs . In this study monitoring of the patients included serial measurements of calcitonin tumor markers, radiological imaging, and immunological in vitro tests, including t - cell interferon - gamma detection and cytotoxicity assays . After a median followup of 11 months (range 726), 3 (30%) of the 10 patients exhibited disease stability, while 7 (70%) of the patients progressed during treatment . A combined treatment with different tumor cell lysate - pulsed dcs increased the likelihood of a calcitonin tumor marker response and should therefore be preferred over monotherapy with dcs pulsed with a single lysate . Thus, immunotherapy may be a promising alternative therapy in combination with agents that target specific signal transduction pathways for aggressive forms of mtc that are resistant to classical therapies . A significant antitumor effect was also observed with radioimmunotherapy using an anti - cea i - f6 monoclonal antibody in mtc - bearing nude mice . Nevertheless, no complete responses were observed . Similarly to chemotherapy, drugs that target the tumor microenvironment might improve the efficacy of radioimmunotherapy . This hypothesis was confirmed by a recent study in which pretreatment of mice grafted with the tt human medullary thyroid cancer cell line with antiangiogenic therapies was found to improve the efficacy of radioimmunotherapy with acceptable toxicity . Another independent study, which was conducted in a mouse model of mtc, has found similar results with the angiogenesis inhibitor bevacizumab . Future investigations will be performed to better understand how antiangiogenic agents enhance the efficacy of radioimmunotherapy . Epigenetic drugs are expected to target the two main mechanisms of epigenetic alterations, dna methylation and acetylation, and are regarded with increasing interest by both endocrinologists and oncologists . Concluded trials of such drugs have shown that few patients with advanced thyroid cancer responded completely, which suggests that these treatments were effective at stabilizing progressive disease . Therefore, definitive results from clinical trials will clarify the true effectiveness of epigenetic drugs in these tumors . Epigenetic drugs, when used in combination with other target molecules, might significantly increase response rates to treatment in advanced thyroid cancer patients, either by relaxing the chromatin structure to make dna more accessible to the effects of a dna targeting drug or by acting synergistically with antimitotic drugs . Thus, epigenetic therapy may be a promising novel approach for the treatment of some cases of mtc . Tumor cells often devise strategies to bypass the effects of antineoplastic agents, and the selection of therapy - resistant clones is frequently the reason for treatment failure . One characteristic of endocrine cancer is a general resistance to conventional chemotherapies or radiotherapies that would normally lead to apoptosis of the cancer cells . Mtc can develop resistances to cytotoxic drugs due to the expression of the multidrug resistance (mdr) 1 gene . Drugs that can oppose this mechanism of resistance to traditional chemotherapies may increase the sensitivity of mtc tumor cells to chemotherapy . For example, celecoxib, a cox-2 inhibitor, has been shown to potentiate the chemotherapeutic effect of vinorelbine in mtc . Therefore, the synergistic actions of a cytotoxic drug and a compound that increases the sensitivity of mtc cells to such a drug could provide a treatment method for patients who cannot benefit from tkis . However, the most promising results in patients with chemotherapy and radiotherapy - unresponsive mtc were obtained with tkis . Multitargeted tyrosine kinase inhibitors, which inhibit multiple rtks simultaneously, including ret, have been developed to bypass this potential resistance mechanism . One complication is that such inhibitors may not only be more effective for targeting receptors in tumor cells but may also exhibit greater toxicity . Thus, the challenge is to balance the increased efficacy of these inhibitors with the potential for a broader array of side effects . Moreover, some mtc patients cannot take advantage of these therapies due to specific ret mutations that confer resistance to tkis (e.g., ret v804 confers resistance to vandetanib) [76, 114]. Finally an important study reported the existence of cancer stem - like cells in mtc, which exhibit the features of self - renewal and of multiple lineage differentiation that is dependent on ret proto - oncogene receptor activity suggesting a potential mechanism of resistance to cytotoxic or tkis agents . Most cases of metastatic mtc are incurable due to resistance to conventional chemo- and radiotherapies . In recent decades, the identification of genetic defects and altered cellular signaling pathways involved in human mtc tumorigenesis have led to the development of targeted therapies, of which the most important are tyrosine kinase inhibitors . However, the low rates of partial responses or complete responses and the short duration of responses in mtc patients who were observed while taking these drugs prompted researchers to develop new drugs and alternative therapies to be combined with multi - tkis and to reduce potential cross - toxicity effects . To this end, a recent study has shown synergistic effects with a combination of sorafenib and the mek inhibitor azd6244 against a human mtc cell line . Concomitant use of a raf inhibitor, raf265, and a dual pi3k / mtor inhibitor, bez-235, was another effective combinatorial therapy against thyroid cancer in xenograft mouse models . The mtor cascade is emerging probably as one of the most important deregulated pathways in advanced and metastatic mtc and certainly deserves further study . Targeting mtor in combination might be efficacious in patients with this tumor types . However, a complete overview of all signaling pathways, including their interactions, role of the activating gene mutations that contribute to mtc tumorigenesis, and mechanisms of intrinsic and acquired resistance to treatments, is required and will permit us to identify the best therapy for each patient . Novel combined or sequential therapies request a further step in the knowledge of the cellular signaling of this tumor . Finally, larger multi - institutional clinical trials to fully understand the clinical benefits of these therapies are warranted.
All of the effects of antimicrobial agents against microbes, including the delineation of microbial resistance, are based upon the results of in vitro susceptibility testing . Most of these susceptibility tests only measure bacteriostatic activity even though the agent being tested may have bactericidal activity . These authors point out the paucity of studies that have critically evaluated the effectiveness of antimicrobial therapy with results of in vitro susceptibility tests . Such critical evaluations are not easily done, as susceptibility tests do not take into account the normal host defense mechanisms . However, the detection of resistance is somewhat predictive of poor outcome, although in the normal host this may be less clinically important due to the interaction of host defenses (17,18). The ability of bactericidal activity to influence therapeutic efficacy and clinical outcome has been evaluated in infections that typically are refractory to antimicrobial therapy . These infections include endocarditis, meningitis, osteomyelitis, and infections in the neutropenic host . All are similar in that antimicrobial penetration and host defense mechanisms at the site of infection are limited . Both experimental models of infection (1922) and clinical studies (2327) have shown that bactericidal activity predicts therapeutic efficacy and results in improved clinical outcome . Bactericidal activity has been considered less important in respiratory tract infections, with the exception being acute infectious exacerbations in cystic fibrosis (28). However, the relevance of pharmacokinetic and pharmacodynamics in the selection of antibiotics for respiratory tract infection has become increasingly recognized (29). Issues such as drug concentration at the site of infection, bactericidal activity, postantibiotic effect, and duration of therapy needed to achieve these effects are now being considered when antimicrobial agents are selected for the therapy of respiratory tract infections (29,30). Although host factors may allow a bacteriostatic agent to be used successfully in an infected patient, these factors appear to be less able to curtail the emergence of resistance . Resistance, as a rule, occurs more rapidly with bacteriostatic agents such as tetracyclines, sulfonamides, and macrolides than it does with bactericidal agents such as beta - lactams and aminoglycosides (3133). Beta - lactam agents have been the antimicrobial agents of choice for the therapy of pneumococcal pneumonia since penicillin was first clinically introduced in the 1940s (17). The emergence of macrolide resistance in s. pneumoniae has been rapid in comparison and has even been described during treatment of pneumococcal pneumonia (34). Bactericidal activity thus may be useful in the therapy of respiratory tract infections as a means to curtail, but not avoid, the emergence of resistance . The key to resolving the problem of antibacterial resistance lies in identifying the mechanisms that engender it (3133). Among the most important mechanisms are decreased ability of antibacterials to penetrate the bacterial cell wall, active efflux of antibacterial agents, inactivation of antibacterial agents, destruction of antibacterial agents, alteration of antibacterial target sites, development of bypass pathways around antibacterial targets, and constitutive phenotypic variation in bacterial physiology . Subsequent exposure of the microorganism to a specific agent may then select the mutant, leading to the emergence of resistance . Some resistance mechanisms, such as bacterial production of beta - lactamase, are inducible or can be derepressed (35), requiring either upregulation or mutation of genetic material . Thus, if resistance is to be suppressed, the opportunity for bacterial upregulation or mutation of genetic material must be minimized . One way to minimize upregulation, mutation, or both is by using bactericidal rather than merely bacteriostatic agents . Microorganisms inhibited by a bacteriostatic agent or exposed to an insufficient concentration of a bactericidal agent remain alive and, ipso facto, retain the potential to become resistant or promulgate any resistance selected by the exposure to the antimicrobial agent . An example of this principle can be seen with the upper respiratory tract pathogen, streptococcus pyogenes, which to date has not developed resistance to penicillin, a bactericidal agent, but has developed resistance to erythromycin, a bacteriostatic agent (3638). Erythromycin resistance in s. pyogenes largely is due to upregulation of efflux (36) or to ribosomal mutation (37). Antimicrobial agents that kill this pathogen should be less likely to promulgate any strains having such resistance . Another example is seen with the omp genes of gram - negative microorganisms . These omp genes encode porins that are sometimes flanked by insertion sequences . In the presence of the bacteriostatic agent, the mobility of insertion sequence flanking omp genes can be attenuated and will result in disruption of the omp genes . The reduced expression of these porins may lead to reduced uptake of the inducer, the antibacterial agent . Specifically, insertion sequence interruption of the ompk36 porin gene in respiratory tract pathogen klebsiella pneumoniae has been shown to interfere in the expression of this porin gene and has resulted in clinical failure (39). If a bactericidal agent kills a pathogen such as klebsiella before mutation of the porin gene, resistance is less likely to develop . These two examples illustrate the desirability of achieving bactericidal activity to curtail the emergence of resistance . Bactericidal activity can be achieved through the mechanism of action for a single antimicrobial agent or by the use of combination therapy, or both . Sulfamethoxazole / trimethoprim (smx - tmp) is an example of a combination of two agents, each of which alone is bacteriostatic, that achieves bactericidal activity . Sulfamethoxazole inhibits dihydropteroate synthase, the bacterial enzyme that catalyzes the incorporation of p - aminobenzoid acid into dihydropteroic acid, the immediate precursor of folic acid, while trimethoprim was specifically synthesized as an inhibitor of dihydrofolate reductase (40). Smx - tmp has long been used for the therapy of respiratory tract infection (41) and has proven particularly useful in the treatment of acute exacerbations of chronic bronchitis . In fact, the world health organization continues to be recommend smx - tmp as the first - line treatment for pneumonia in children because of its low cost and ease of dosing . Resistance to smx - tmp has emerged more slowly than for either agent used alone (42). However, emergence of resistance to s. pneumoniae has occurred (43) and now may limit the use of smx - tmp in respiratory tract infections . Combinations of antimicrobial agents are also used in the therapy of bacterial endocarditis to achieve synergism leading to increased bactericidal activity and improved sterilization of infected valves . Bactericidal synergy for s. epidermidis can be demonstrated in vitro for the combination of vancomycin, rifampin, and gentamicin, which correlates well with the therapeutic results in an experimental animal model (44). In a comparable clinical study of patients with prosthetic valve endocarditis caused by staphylococcus epidermidis, 90% were cured with a combination of vancomycin, rifampin, and/or gentamicin, compared with only 50% cured among those receiving vancomycin alone (45). Combination therapy for respiratory tract infections is less well studied except for acute respiratory tract infections occurring in cystic fibrosis patients . For example, combination therapy for treatment of pseudomonas aeruginosa pulmonary infections in cystic fibrosis patients achieved a cure rate of 89% if peak serum bactericidal titers were> 1:128 (28). In contrast, 100% of patients failed therapy if their peak serum bactericidal titers were <1:16 . Other examples of the importance of bactericidal activity are the fluoroquinolones . Studies of the bactericidal action of the quinolones against escherichia coli demonstrate at least two independent and important mechanisms of action . These bactericidal agents are only effective if the bacteria are actively dividing or synthesizing proteins and mrna . The bactericidal activity of the quinolone nalidixic acid, for example, is minimized by chloramphenicol, which prevents protein synthesis, and by rifampin, which prevents rna synthesis . However, ciprofloxacin and ofloxacin / levofloxacin respond differently . Although the bactericidal action of these fluoroquinolones against e. coli is reduced, bactericidal action is not entirely eliminated by chloramphenicol or rifampin . This lack of elimination of bactericidal action suggests that these agents possess a secondary bactericidal mechanism of action that does not depend on the synthesis of protein and rna, and that may be active when the bacteria are in a nonreplicating state (46). To understand this secondary bactericidal effect, consisting of approximately 20 genes, this system repairs structural damage to dna caused by antibacterial agents, mainly through bypass repair (4650). Another effect of the sos response, activated by fluoroquinolone - induced damage to the bacterial dna, is the discontinuation of cell replication . In addition to high concentrations of fluoroquinolone, which trigger the secondary bactericidal mechanism, higher concentrations at dna targets also play a role in the emergence of resistance because the postantibiotic effect of the fluoroquinolones is dependent upon concentration, time, and the microorganism . If the concentration of fluoroquinolone attained at the bacterial dna targets is high enough to activate the sos system for a duration that exceeds the capability of the particular microorganism to repair its dna damage and replicate, the microorganism dies . If the fluoroquinolone concentration is not adequate, however, a race occurs between cumulative damage over time and the selection of a resistant mutant . The concentration of fluoroquinolone required for sos - mediated discontinuation of cell replication is expressed as a peak concentration / minimum inhibitory concentration (mic) ratio and appears to require a ratio of approximately 10:1 (50,51). A rat model for pseudomonas sepsis demonstrated that peak concentration / mic ratios> 20:1 once per day produced significantly (p<0.5) better survival which may result in the selection of a mutant with altered topoisomerase than did regimens using the same dosage on a more fractionated schedule (52). Dosages that led to peak concentration / mic ratios <10 times the mic did not result in as high a survival rate . Indeed, when the peak concentration / mic ratio was <10 times the mic, the best survival was predicted by the area under the curve / mic ratio, since repeated exposure to the fluoroquinolone causes damage cumulatively . The length of time that fluoroquinolone levels in plasma exceeded the mic had no influence on survival . The emergence of fluoroquinolone resistance with respect to staphylococcus aureus and p. aeruginosa has been well - documented (53). This major problem is due to a wide variety of fluoroquinolone - resistance mechanisms (54,55), particularly the mutation of dna gyrase (56). While this type of resistance generally results in mics only four- to eight - fold higher than the susceptible isolate, recent studies have reported the development of high - level resistance (e.g., ciprofloxacin mic for p. aeruginosa of 1,024 mg / l) mediated by efflux pumps targeting multiple antibacterial agents (57,58). These multidrug efflux pumps could be overcome by high fluoroquinolone concentrations, some of which, however, would not be clinically achievable . A rabbit meningitis model further demonstrates how the inability to achieve peak concentration / mic ratios> 10:1 influences the postantibiotic effect . In an in vivo study, an exposure to ciprofloxacin at the mic had minimal impact (59), underscoring the value of bactericidal activity with respect to fluoroquinolone therapy . The greater the activity of the fluoroquinolone, the more likely the agent will achieve serum or tissue levels that are> 10 times the mic, which in turn determines the secondary bactericidal and postantibiotic effects . Consequently, newer fluoroquinolones such as gemifloxacin (60) and others now under development have markedly increased activity compared with traditional agents . For example, ciprofloxacin has mics against streptococcus pneumoniae of approximately 0.5 mg / l, while gemifloxacin has mics of approximately 0.03 mg / l . An important issue associated with the use of fluoroquinolones in the therapy of respiratory tract infections is the fact that fluoroquinolones also are used to treat other infections . The use of these agents for other infections means that the population already had been exposed to fluoroquinolones before their widespread use in respiratory tract infections . Exposure of normal flora in these patients to subbactericidal concentrations of fluoroquinolones may allow resistant strains to emerge . Cross - resistance is a well - recognized problem with fluoroquinolones (55), and the enormous prior exposure of the population to these agents may have created resistant strains in the normal flora of the mucosal surfaces, skin, gastrointestinal tract, and reproductive tract . In addition, prior exposure may result in increasing mics due to subtle mutations of topoisomerases, which then may leave the microorganism only one step from a mutation that will produce overt resistance (55). An example of such subtle topoisomerase mutation is seen with fluoroquinolones such as levofloxacin, which have been recommended and widely used for the therapy of pneumococcal pneumonia when penicillin resistance to s. pneumoniae is a problem (61). Unfortunately, the population has had considerable prior exposure to earlier fluoroquinolones, which has allowed rapid emergence of fluoroquinolone resistance in s. pneumoniae (62). Failure of treatment of pneumococcal pneumonia due to resistance to levofloxacin recently has been described (63). This example confirms the problem of cross - resistance and further mutations resulting in increased resistance and suggests that newer fluoroquinolones such as gemifloxacin may be less effective or even ineffective against s. pneumoniae . Other examples of the importance of bactericidal activity are the fluoroquinolones . Studies of the bactericidal action of the quinolones against escherichia coli demonstrate at least two independent and important mechanisms of action . These bactericidal agents are only effective if the bacteria are actively dividing or synthesizing proteins and mrna . The bactericidal activity of the quinolone nalidixic acid, for example, is minimized by chloramphenicol, which prevents protein synthesis, and by rifampin, which prevents rna synthesis . However, ciprofloxacin and ofloxacin / levofloxacin respond differently . Although the bactericidal action of these fluoroquinolones against e. coli is reduced, bactericidal action is not entirely eliminated by chloramphenicol or rifampin . This lack of elimination of bactericidal action suggests that these agents possess a secondary bactericidal mechanism of action that does not depend on the synthesis of protein and rna, and that may be active when the bacteria are in a nonreplicating state (46). To understand this secondary bactericidal effect, consisting of approximately 20 genes, this system repairs structural damage to dna caused by antibacterial agents, mainly through bypass repair (4650). Another effect of the sos response, activated by fluoroquinolone - induced damage to the bacterial dna, is the discontinuation of cell replication . In addition to high concentrations of fluoroquinolone, which trigger the secondary bactericidal mechanism, higher concentrations at dna targets also play a role in the emergence of resistance because the postantibiotic effect of the fluoroquinolones is dependent upon concentration, time, and the microorganism . If the concentration of fluoroquinolone attained at the bacterial dna targets is high enough to activate the sos system for a duration that exceeds the capability of the particular microorganism to repair its dna damage and replicate, the microorganism dies . If the fluoroquinolone concentration is not adequate, however, a race occurs between cumulative damage over time and the selection of a resistant mutant . The concentration of fluoroquinolone required for sos - mediated discontinuation of cell replication is expressed as a peak concentration / minimum inhibitory concentration (mic) ratio and appears to require a ratio of approximately 10:1 (50,51). A rat model for pseudomonas sepsis demonstrated that peak concentration / mic ratios> 20:1 once per day produced significantly (p<0.5) better survival which may result in the selection of a mutant with altered topoisomerase than did regimens using the same dosage on a more fractionated schedule (52). Dosages that led to peak concentration / mic ratios <10 times the mic did not result in as high a survival rate . Indeed, when the peak concentration / mic ratio was <10 times the mic, the best survival was predicted by the area under the curve / mic ratio, since repeated exposure to the fluoroquinolone causes damage cumulatively . The length of time that fluoroquinolone levels in plasma exceeded the mic had no influence on survival . The emergence of fluoroquinolone resistance with respect to staphylococcus aureus and p. aeruginosa has been well - documented (53). This major problem is due to a wide variety of fluoroquinolone - resistance mechanisms (54,55), particularly the mutation of dna gyrase (56). While this type of resistance generally results in mics only four- to eight - fold higher than the susceptible isolate, recent studies have reported the development of high - level resistance (e.g., ciprofloxacin mic for p. aeruginosa of 1,024 mg / l) mediated by efflux pumps targeting multiple antibacterial agents (57,58). These multidrug efflux pumps could be overcome by high fluoroquinolone concentrations, some of which, however, would not be clinically achievable . A rabbit meningitis model further demonstrates how the inability to achieve peak concentration / mic ratios> 10:1 influences the postantibiotic effect . In an in vivo study, an exposure to ciprofloxacin at the mic had minimal impact (59), underscoring the value of bactericidal activity with respect to fluoroquinolone therapy . The greater the activity of the fluoroquinolone, the more likely the agent will achieve serum or tissue levels that are> 10 times the mic, which in turn determines the secondary bactericidal and postantibiotic effects . Consequently, newer fluoroquinolones such as gemifloxacin (60) and others now under development have markedly increased activity compared with traditional agents . For example, ciprofloxacin has mics against streptococcus pneumoniae of approximately 0.5 mg / l, while gemifloxacin has mics of approximately 0.03 mg / l . An important issue associated with the use of fluoroquinolones in the therapy of respiratory tract infections is the fact that fluoroquinolones also are used to treat other infections . The use of these agents for other infections means that the population already had been exposed to fluoroquinolones before their widespread use in respiratory tract infections . Exposure of normal flora in these patients to subbactericidal concentrations of fluoroquinolones may allow resistant strains to emerge . Cross - resistance is a well - recognized problem with fluoroquinolones (55), and the enormous prior exposure of the population to these agents may have created resistant strains in the normal flora of the mucosal surfaces, skin, gastrointestinal tract, and reproductive tract . In addition, prior exposure may result in increasing mics due to subtle mutations of topoisomerases, which then may leave the microorganism only one step from a mutation that will produce overt resistance (55). An example of such subtle topoisomerase mutation is seen with fluoroquinolones such as levofloxacin, which have been recommended and widely used for the therapy of pneumococcal pneumonia when penicillin resistance to s. pneumoniae is a problem (61). Unfortunately, the population has had considerable prior exposure to earlier fluoroquinolones, which has allowed rapid emergence of fluoroquinolone resistance in s. pneumoniae (62). Failure of treatment of pneumococcal pneumonia due to resistance to levofloxacin recently has been described (63). This example confirms the problem of cross - resistance and further mutations resulting in increased resistance and suggests that newer fluoroquinolones such as gemifloxacin may be less effective or even ineffective against s. pneumoniae . The term macrolide was originally applied to specific compounds produced by various streptomyces species containing, as part of their structure, a macrocyclic lactone to which various deoxy sugars are attached . These bacteriostatic compounds bind to bacterial 50s ribosomes, inhibiting protein synthesis without a concomitant inhibition of nucleic acid synthesis . The classification has since been modified to include other structurally diverse agents, such as lincosamides and streptogramins, which are also produced by streptomyces species and target the 50s ribosome . The term mls (macrolide, lincosamide, and streptogramin) has become the accepted nomenclature for this important group of antibacterial agents except when the emphasis is on structural similarity, in which case the erythromycin congeners (erythromycin - a, clarithromycin, and azithromycin) are often referred to as the true macrolides (64). Although antibacterial agents in the mls class have been largely bacteriostatic, newer members demonstrate bactericidal activity . These new agents include quinupristin / dalfopristin and telithromycin . The bactericidal mechanism of action of quinupristin / dalfopristin, a combination of two streptogramins, is unique (65). Dalfopristin is an olefinic macrolactone that binds to the 50s subunit of the prokaryotic ribosome and interferes with the function of peptidyl transferase, thereby inactivating the donor and acceptor sites of the ribosome . In addition, dalfopristin triggers a conformational change in the ribosome that greatly increases the affinity of quinupristin, a peptidic macrolactone, which also binds to the 50s subunit of the ribosome and halts peptide chain elongation . Consequently, protein synthesis is not only halted transiently by either component used alone but also halted permanently by the two components in combination, resulting in synergistic and concentration - independent bactericidal activity against many pathogens . This binding of both macrolactones distinguishes quinupristin / dalfopristin from other antibiotic classes (66,67), with the attendant prolongation of the postantibiotic effect (68) representing a distinct advantage over older agents (69). Quinupristin / dalfopristin is bactericidal against staphylococci and streptococci such as s. pneumoniae, generally bacteriostatic against enterococcus faecium, and inactive against e. faecalis (70). Because quinupristin / dalfopristin is available only in an intravenous formulation, its utility for treating respiratory tract infections is limited to hospitalized patients moreover, clinical data on quinupristin / dalfopristin therapy of pneumococcal pneumonia caused by macrolide resistant strains of s. pneumoniae is lacking . Telithromycin, the first of a new class of antibacterials, the ketolides, is approved for use in europe and is currently being reviewed by the u. s. food and drug administration (71). The clinical use of telithromycin in germany, as well as safety data presented to the food and drug administration, suggests that the toxicity and adverse reactions are similar to those of clarithromycin . This similarity is not surprising, as the ketolides are novel semisynthetic erythromycin - a derivatives structurally similar to clarithromycin . The c6-hydroxyl of erythromycin - a has been replaced by a methoxy group, as in clarithromycin, improving acid stability . The main structural innovation is the lack of the neutral sugar, cladinose, in position c3 . The 3-l - cladinose sugar moiety is removed, and the resulting 3-hydroxy group is oxidized to a 3-keto group, which is responsible for preventing induction of macrolide resistance (72). Telithromycin is produced through substitution at positions 11 and 12 of the erythronolide a ring with a butyl imidazolyl pyridinyl side chain . The resulting c11,c12 carbamate extension facilitates a distinctly different and more effective interaction with domain ii of the 23s rrna than occurs with erythromycin - a or clarithromycin (73) and is responsible for increased activity against erythromycin - a resistant gram - positive cocci, such as s. pneumoniae, which develop resistance due to increased efflux (74,75). Moreover, the bactericidal action is effective against a number of other key respiratory pathogens, such as h. influenzae and c. pneumoniae (7678), other gram - negative bacilli, such as m. catarrhalis and bordetella pertussis, and the intracellular pathogen legionella pneumophila (79). Unlike erythromycin - a (which interacts with bacterial 23s ribosomal rna by contacts limited to hairpin 35 in domain ii of the ribosomal rna and to the peptidyl transferase loop in domain v), telithromycin is not a true macrolide because the l - cladinose moiety at position c3 has been replaced by a keto group and by alkylaryl side chains at positions c11,c12 . Although both erythromycin - a and telithromycin bind to the peptidyl transferase loop (the site of methylation by resistant bacteria), telithromycin binds much more avidly to hairpin 35 than erythromycin - a . In fact, telithromycin interacts strongly with two domains of the bacterial 23s rrna (domains ii and v), which fold together in the tertiary 23s rrna to form a single drug - binding pocket (80,81). The lack of the l - cladinose moiety, as well as the enhanced binding at domain ii and v, may explain why ketolides are associated with a low potential for inducing resistance (82,83) and contributes to telithromycin s sustained activity against mlsb - resistant strains (in particular those with domain v modifications) (73). These features, in addition to the mic and the amount of drug delivered to the infection site, are considered strong predictors of a positive outcome (29,30). However, the population has had enormous exposure to earlier macrolides . This influence means that resistance due to efflux or methylation of the 23s ribosome (domain v) may have already occurred in a large number of pneumococcal isolates . Macrolide - resistant strains of s. pneumoniae to date have had a low incidence of cross - resistance to telithromycin (82,83). However, increased efflux or other mutations might result in resistance to ketolides . To date, only two ketolide - resistant strains of s. pneumoniae have been identified (84) in over 10,000 pneumococcal isolates screened by the protekt study (10). Clearly, careful monitoring for ketolide resistance by surveillance studies such as the protekt study will need to be continued . Meeting the challenge presented by the increasing numbers of bacterial pathogens resistant to common antibiotic treatments will require new types of antibacterial agents . Therapies that maximize bactericidal effects are important because they reduce the development of bacterial resistance mechanisms . Therefore, the use of bactericidal agents such as telithromycin for therapy of respiratory tract infections may well ensure that the antibacterial era endures long into the 21st century . However, careful monitoring of resistance will be needed to ensure that this agent remains active against common pathogens . Stratton is associate professor of pathology and medicine and director of the clinical microbiology laboratory at the vanderbilt university medical center in nashville, tennessee . His research interests include the mechanisms of antimicrobial activity, antimicrobial resistance, and the pathogenesis of chlamydia pneumoniae.
Sponges play an important role in the benthic - pelagic coupling on coral reefs (lesser 2006). The sponge community sequesters and processes organic matter and as such conserve energy and nutrients for the reef ecosystem . It is generally assumed that sponges on the fore - reef slope mainly trap allochthonous organic matter that may compensate the losses of material from reef ecosystems (e.g., richter et al . Most reef sponges are extremely efficient in filter feeding (e.g., reiswig 1974; lesser 2006). They preferably filter the picoplankton fraction from the flowing water (e.g., pile 1999; ribes et al . 2003, 2005). The major food resource of coral reef sponges, however, may well be dissolved organic matter (reiswig 1990; yahel et al . 2003) in coral cavities are fueled mainly by dissolved organic matter (dom) (de goeij et al . Encrusting sponges cover together with coralline algae> 50% of the walls in coral cavities, caves, and undersides of corals (vasseur 1974; richter and wunsch 1999; wunsch et al . This cryptic surface of 3-dimensionally well - developed reefs may exceed the open reef surface (ginsburg 1983; richter et al . The sheer size of this reef habitat already preludes the grand role of its biota in organic matter cycling . Dom removal by the cryptic biota on coral reefs can be huge (up to 500 mmol c m cryptic surface d), with cavity sponges accounting for 70% of the consumed dom in coral reef cavities (de goeij and van duyl 2007; these recent findings draw direct attention to the origin and sources of dom on coral reefs . Phytoplankton (including photoautotrophic bacteria) usually is the main source of reactive dom in oligotrophic ocean water; it releases dom as photosynthetic product or through food web processes and lysis (carlson 2002). On coral reefs extra sources of reactive dom include release of dom by corals through mucus production (johannes 1967; richman et al . 1975; crossland et al . 1980; naumann et al . 2010) and extracellular release of dom by benthic algae (e.g., wada et al . 2007; the main consumers of reactive dom are usually heterotrophic bacteria (e.g., harvey et al . The fate of mucus and dissolved organic matter in reef overlying waters has been ascribed to consumption and mineralization by bacteria in the reef ambient water and in sediments (e.g., gast et al . The first indication that reef - derived dom may also be assimilated by higher trophic levels came from the abundance of the dietary fatty acid biomarker 20:46 in the encrusting dom feeding cavity sponge halisarca caerulea (de goeij et al . 1991) and in coralline algae, rhodophyta (viso and marty 1993) and its presence in sponges suggests that reef - derived organic matter may be an important food source for coral reef sponges . This study aims (1) to determine whether cavity sponges mainly rely on reef - produced or open water - derived dissolved organic matter and (2) to identify key sources of dom for cavity sponges . As putative food compounds different fractions of suspended matter, bacterioplankton, coral mucus, and coralline algae as proxies for dom were analyzed . Through stable isotopes and fatty acid biomarkers, we characterized energy sources of cavity sponges collected from coral reefs and open water on the southwest coast of curaao, caribbean (1212n, 6856w). Stable isotopes are a classical way to trace food sources of aquatic animals (peterson and fry 1987). The carbon and nitrogen stable isotope signatures of 12 sponge species were compared with those of putative food compounds . Fatty acid biomarkers have been repeatedly used as source - specific indicators of dissolved and particulate organic matter both in environmental and in food web studies (e.g. Hall et al . The fa pattern of six sponge species and three types of reef food resources were analyzed, and the relative input of different sources to the diet of the sponges was determined . Samples were collected from march 14 to 22, 2006, along four transects perpendicular to the sw coast of curaao (fig . 1). Transects were placed 37 km apart from se to nw along the coast at lagun jan thiel (ljt), at the ocean cruise terminal in otrabanda (ct), at buoy 1 (b1) of the carmabi reef close to piscaderabaai, and at slangenbaai (sb). Transects from the shore to open water cross the narrow fringing reefs and water masses representative for the variation in coral community composition and water quality along the sw coast of curaao (van duyl 1985; gast et al . 1999; van duyl and gast 2001). Along each transect (ljt, ct, b1, and sb), we sampled 2 stations: fig . (ljt, ct, b1, and sb) along the southwest coast of curaao, with an inset of the geographic position of the island in the caribbeanan off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water anda coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope, approximately 0.5 m above the coral bottom . Position of sampling transects (ljt, ct, b1, and sb) along the southwest coast of curaao, with an inset of the geographic position of the island in the caribbean an off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water and a coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope, approximately 0.5 m above the coral bottom . Water samples were taken with a 6 l niskin bottle operated by a scuba diver . The niskin bottle was repeatedly filled and hauled on board a small open boat and emptied in a clean and sample washed 20 l container . At each station (n = 8), we collected 20 l. on the fore - reef slope stations (n = 4), we collected a few small pieces of the stony corals montastraea annularis and madracis mirabilis (also siderastrea siderea and porites astreoides but only at b1) between 15 and 17 m depth, which were kept in seawater under natural light conditions until mucus collection on the next day . From the entrance of coral cavities at 1517 m depth on the fore - reef slope, we chiseled crusts of calcareous algae . From the same cavities, various species of encrusting sponges were collected, up to eight different species per station . The 20-l water samples were filtered over 47-mm - diameter combusted glass microfiber filters (whatman), first over a gfc filter (nominal pore size 1.2 m) and then over a gff filter (nominal pore size 0.7 m). After sea water filtration, filters were shortly washed with milli - q water (mq) to remove salt and were dried at 50c in a stove and stored in aluminum foil in the freezer until processing . The remaining bacterioplankton in the gff filtrate was concentrated with a vivaspin filter cartridge driven by a master volt tube pump . The concentrate was subsequently filtered over a 0.2 m pore size 25-mm - diameter anopore disc (aluminum oxide membrane filter, whatman). The discs were briefly washed with mq after seawater filtration and dried at 50c in a stove (12 h). After drying, the filter was crumbled in a clean acid - washed glass funnel, the integrated polypropylene support ring of the filter was removed and the filter fragments were transferred to combusted silver capsules, which were closed with tweezers . Subsequently, the folded capsules were placed in coded trays and stored in the freezer until processing . Live corals were air - exposed during mucus collection and positioned upside down connected to a stand . After shortly spraying the live coral tissue with mq, the mucus produced by the coral was collected via an acid - washed glass funnel in combusted glass vials . After collection of approximately 2 ml mucus per coral, mucus samples were dried in a stove at 50c before being stored dry in the freezer . The cavity sponges and coralline algae were quickly washed with mq to remove salt and the tissue was subsequently removed from the underlying substratum by knife and scalpel . Small pieces were fixed in ethanol (80%) for taxonomical identification of the different sponge species . The rest of the pieces were collected in combusted glass vials dried at 50c and stored dry in the freezer . Sponges and putative food sources were subject to stable isotope analysis . Both carbon and nitrogen (except for bacteria for which only corg was measured) isotopic composition of the samples were determined using a fisons cn analyser coupled on line via a finnigan conflo 2 interface, to a finnigan delta s mass spectrometer . The carbon and nitrogen isotope ratios are expressed as corg and n relative to the vienna pee dee belemnite standard and air, respectively, and the standard error of the measurements is ~0.15. All carbon isotope samples (except bacteria that were caught on aluminum filters) were acidified (tissue directly with acid and glass filters in acid vapor) prior to measurements and corrected for individual sets of blanks (isotope mass balance corrections). Seawater as source of carbonates leading to possible enrichment of corg in case of un - acidified aluminum bacteria filters was eliminated by the rinse with mq water at the end of filtration . The dried sponge, coralline algae, and mucus material were first homogenized in a mortar . For isotope measurements, adequate amount of material was transferred to pre - combusted silver boats for acidification within cups, followed by oven drying to remove excess acid . From the remaining grounded material, samples from the b1 reef station were also analyzed for their total fatty acid composition using a method of one - step procedure of fatty acid extraction and methylation (masood et al . Fatty acid extraction and preparation of methyl esters (fame) were carried out according to masood et al . (2005) with reagent volumes adapted for use in 2.5-ml gc - vials using fame c19:0 as internal standard to calculate concentration of fas (van gaever et al . These individual samples were analyzed separately for their fa compositions employing a large volume splitless injection method on a thermo finnigan trace ultra gc . Main items of this method are the large volume liner with glass wool, pre - column deactivated silica 5 m 0.53 m, and analytical column sge bpx-70 50 m 0.32 mm 0.25 m . The identification of fames was based on the comparison of retention times with authentic commercially available reference material and standards . Fatty acid source designation was achieved using data on distinctive fa for bacteria, algal carbon, and higher organisms (e.g., parrish et al . 2000; boschker and middelburg 2002; volkman 2006). We ran one- and two - way anovas with non - transformed stable isotope data to determine whether variations in stable isotopes of sponges were due to sponge species and/or sponge location assuming no interaction effects (not enough replication for testing interaction). The tukey s hsd method was used for pair wise comparisons of different sponge species (multiple comparisons of means). Anova s were also run for isotope signals of reef and open water - derived suspended matter . The siar stable isotope mixing model analysis (parnell et al . 2010) was applied to investigate probable solutions for the diet of sponges based on dual stable isotope data of four sources (gfc and gff fractions of suspended matter, crustose coralline algae, and coral mucus). We used the following trophic enrichment factors with standard deviations for the sponges: 3.5 0.5 for n and 1 1 for c (vander zanden and rasmussen 2001; behringer and butler iv 2006). The siar model takes data on organism isotopes and fits a bayesian model to their dietary habits based upon a gaussian likelihood with a mixture dirichlet - distributed prior on the mean . Model fitting is via markov chain monte carlo (mcmc) which produces simulations of plausible values for each dietary source consistent with the data . The software package siar (stable isotope analysis in r) is freely available from the package section of the comprehensive r archive network website http://cran.r - project.org/ (parnell and jackson 2010). Fatty acid composition patterns were explored with multivariate analyses of fas composition profiles (non - transformed percentage abundance) using the program primer version 5 (clarke and gorley 2006). Multi - dimensional scaling (mds plots) of fa composition and dual isotope label patterns were compared for six sponge species and the three different reef - derived resources (cca, mucus of m. annularis, and mucus of m. mirabilis). Similarities between fa profiles were investigated using the simper (similarity of percentages) function, and statistical differences were determined using the anosim (analysis of similarities) function . Samples were collected from march 14 to 22, 2006, along four transects perpendicular to the sw coast of curaao (fig . 1). Transects were placed 37 km apart from se to nw along the coast at lagun jan thiel (ljt), at the ocean cruise terminal in otrabanda (ct), at buoy 1 (b1) of the carmabi reef close to piscaderabaai, and at slangenbaai (sb). Transects from the shore to open water cross the narrow fringing reefs and water masses representative for the variation in coral community composition and water quality along the sw coast of curaao (van duyl 1985; gast et al . 1999; van duyl and gast 2001). Along each transect (ljt, ct, b1, and sb), we sampled 2 stations: fig . (ljt, ct, b1, and sb) along the southwest coast of curaao, with an inset of the geographic position of the island in the caribbeanan off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water anda coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope, approximately 0.5 m above the coral bottom . Position of sampling transects (ljt, ct, b1, and sb) along the southwest coast of curaao, with an inset of the geographic position of the island in the caribbean an off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water and a coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope, approximately 0.5 m above the coral bottom . Water samples were taken with a 6 l niskin bottle operated by a scuba diver . The niskin bottle was repeatedly filled and hauled on board a small open boat and emptied in a clean and sample washed 20 l container . At each station (n = 8), we collected 20 l. on the fore - reef slope stations (n = 4), we collected a few small pieces of the stony corals montastraea annularis and madracis mirabilis (also siderastrea siderea and porites astreoides but only at b1) between 15 and 17 m depth, which were kept in seawater under natural light conditions until mucus collection on the next day . From the entrance of coral cavities at 1517 m depth on the fore - reef slope, we chiseled crusts of calcareous algae . From the same cavities, various species of encrusting sponges were collected, up to eight different species per station . The 20-l water samples were filtered over 47-mm - diameter combusted glass microfiber filters (whatman), first over a gfc filter (nominal pore size 1.2 m) and then over a gff filter (nominal pore size 0.7 m). After sea water filtration, filters were shortly washed with milli - q water (mq) to remove salt and were dried at 50c in a stove and stored in aluminum foil in the freezer until processing . The remaining bacterioplankton in the gff filtrate was concentrated with a vivaspin filter cartridge driven by a master volt tube pump . The concentrate was subsequently filtered over a 0.2 m pore size 25-mm - diameter anopore disc (aluminum oxide membrane filter, whatman). The discs were briefly washed with mq after seawater filtration and dried at 50c in a stove (12 h). After drying, the filter was crumbled in a clean acid - washed glass funnel, the integrated polypropylene support ring of the filter was removed and the filter fragments were transferred to combusted silver capsules, which were closed with tweezers . Subsequently, the folded capsules were placed in coded trays and stored in the freezer until processing . Live corals were air - exposed during mucus collection and positioned upside down connected to a stand . After shortly spraying the live coral tissue with mq, the mucus produced by the coral was collected via an acid - washed glass funnel in combusted glass vials . After collection of approximately 2 ml mucus per coral, mucus samples were dried in a stove at 50c before being stored dry in the freezer . The cavity sponges and coralline algae were quickly washed with mq to remove salt and the tissue was subsequently removed from the underlying substratum by knife and scalpel . Small pieces were fixed in ethanol (80%) for taxonomical identification of the different sponge species . The rest of the pieces were collected in combusted glass vials dried at 50c and stored dry in the freezer . Sponges and putative food sources were subject to stable isotope analysis . Both carbon and nitrogen (except for bacteria for which only corg was measured) isotopic composition of the samples were determined using a fisons cn analyser coupled on line via a finnigan conflo 2 interface, to a finnigan delta s mass spectrometer . The carbon and nitrogen isotope ratios are expressed as corg and n relative to the vienna pee dee belemnite standard and air, respectively, and the standard error of the measurements is ~0.15. All carbon isotope samples (except bacteria that were caught on aluminum filters) were acidified (tissue directly with acid and glass filters in acid vapor) prior to measurements and corrected for individual sets of blanks (isotope mass balance corrections). Seawater as source of carbonates leading to possible enrichment of corg in case of un - acidified aluminum bacteria filters was eliminated by the rinse with mq water at the end of filtration . The dried sponge, coralline algae, and mucus material were first homogenized in a mortar . For isotope measurements, adequate amount of material was transferred to pre - combusted silver boats for acidification within cups, followed by oven drying to remove excess acid . From the remaining grounded material, samples from the b1 reef station were also analyzed for their total fatty acid composition using a method of one - step procedure of fatty acid extraction and methylation (masood et al . Fatty acid extraction and preparation of methyl esters (fame) were carried out according to masood et al . (2005) with reagent volumes adapted for use in 2.5-ml gc - vials using fame c19:0 as internal standard to calculate concentration of fas (van gaever et al . These individual samples were analyzed separately for their fa compositions employing a large volume splitless injection method on a thermo finnigan trace ultra gc . Main items of this method are the large volume liner with glass wool, pre - column deactivated silica 5 m 0.53 m, and analytical column sge bpx-70 50 m 0.32 mm 0.25 m . The identification of fames was based on the comparison of retention times with authentic commercially available reference material and standards . Fatty acid source designation was achieved using data on distinctive fa for bacteria, algal carbon, and higher organisms (e.g., parrish et al . We ran one- and two - way anovas with non - transformed stable isotope data to determine whether variations in stable isotopes of sponges were due to sponge species and/or sponge location assuming no interaction effects (not enough replication for testing interaction). The tukey s hsd method was used for pair wise comparisons of different sponge species (multiple comparisons of means). Anova s were also run for isotope signals of reef and open water - derived suspended matter . The siar stable isotope mixing model analysis (parnell et al . 2010) was applied to investigate probable solutions for the diet of sponges based on dual stable isotope data of four sources (gfc and gff fractions of suspended matter, crustose coralline algae, and coral mucus). We used the following trophic enrichment factors with standard deviations for the sponges: 3.5 0.5 for n and 1 1 for c (vander zanden and rasmussen 2001; behringer and butler iv 2006). The siar model takes data on organism isotopes and fits a bayesian model to their dietary habits based upon a gaussian likelihood with a mixture dirichlet - distributed prior on the mean . Model fitting is via markov chain monte carlo (mcmc) which produces simulations of plausible values for each dietary source consistent with the data . The software package siar (stable isotope analysis in r) is freely available from the package section of the comprehensive r archive network website http://cran.r - project.org/ (parnell and jackson 2010). Fatty acid composition patterns were explored with multivariate analyses of fas composition profiles (non - transformed percentage abundance) using the program primer version 5 (clarke and gorley 2006). Multi - dimensional scaling (mds plots) of fa composition and dual isotope label patterns were compared for six sponge species and the three different reef - derived resources (cca, mucus of m. annularis, and mucus of m. mirabilis). Similarities between fa profiles were investigated using the simper (similarity of percentages) function, and statistical differences were determined using the anosim (analysis of similarities) function . The sponge species collected on the reef stations were identified on basis of their tissue and skeletal characteristics . 2007) to 20.7 (scopalina ruetzleri) and n values ranging from 2.9 (monanchora arbuscula) to 7.1 (scopalina ruetzleri) (table 1). Variations in corg and n data were significantly related to sponge species (anova, f(5,17) = 30.3 and f(5,17) = 15.8, p <0.01 for both) and not to reef station (f(3,17) = 1.16 and f(3,17) = 0.83, p> 0.35 for both). 0.05) were found between s. ruetzleri and h. caerulea, s. ruetzleri and niphates erecta, n. erecta and m. arbuscula, which were sampled at three to four reef sites (table 1). Differences in dual stable isotope values between sponge species were small when compared to isotope values of sources . Therefore, the sponge data of the different transects were combined in the fig . 2a, b. the stable isotope signals of particulate organic matter size fractions were not significantly different between the open water and reef water (anova, p> 0.05), but were kept separate in fig . 2a, b. figure 2a shows that open water and reef water bacteria have on average slightly different c signatures . Variations in corg values of bacterioplankton were large between stations (ljt and sb vs. ct and b1, table 2). Only the reef water bacteria of station sb (c: 17.9) were in trophic reach of sponges (<2 difference). The sponge trophic range overlaps with the range of coralline algae (average c of 16.9 4.2). Coral mucus of montastraea annularis and madracis mirabilis was on average heavier in corg content than the sponges (table 2). Coral mucus and coralline algae are potential sponge food because of a trophic level n increase of 34 (fig . 2b).table 1sponge species collected at four reef stations with their respective average isotope signaturescryptic biotastationljtlagun jan thielctcruise terminalb1carmabi reefsbslangenbaaicodecncncncn halisarca caerulea n = 7sp118.793.6918.454.1218.333.1618.484.0218.204.0917.874.0718.734.63 clathria (thalysis) raraechelae n = 1sp218.914.03 chondrilla caribensis n = 1sp317.163.83 chelonaplysilla erecta n = 1sp419.944.68 desmapsamma anchorata n = 1sp518.815.61 scopalina ruetzleri n = 6sp619.765.9020.264.8520.795.4820.026.1319.417.0720.065.86 eurypon laughlini n = 218.955.6718.515.78 topsentia ophirhaphidites n = 219.635.3719.275.82 niphates erecta n = 617.704.0117.654.7917.934.4717.994.2117.974.7118.004.71 callyspongia vaginalis n = 217.723.7917.474.37 monanchora arbuscula n = 520.383.8320.403.4219.823.2819.952.8419.473.63 phorbas amaranthus n = 118.864.40codes sp1sp6 refer to sponges collected at b1 and correspond to sponge data presented in fig . 3 fig . 2plots of carbon (a) and nitrogen (b) stable isotope signatures of material collected from the four reef and four open water stations (average and standard error). Sponges (n = 35), bacteria (bact n = 8), coral mucus (n = 9), glass microfiber filters coarse (gfc) and fine (gff) represent values of suspended matter (spm) collected either from reef water or from open water offshore (n = 4 or 5). Crustose coralline algae from two reef stations (n = 3)table 2average isotope signatures of putative food sources for sponges collected from reef stations ljt, ct, b1, and sb (replicates, n = 23, standard errors range from 0 to 0.4, not shown)substrate sourcesstationljtlagun jan thielctcruise terminalb1carmabi reefsbslangenbaaicodecncncncnspm - gfc open water21.775.2723.873.3722.967.0021.613.94 reef water23.724.5123.385.1723.833.6722.532.66 crevice water21.402.96spm - gff open water20.863.8123.921.9725.872.8421.524.69 reef water21.194.5324.863.0024.364.4022.093.80 crevice water24.083.20bacteria open water21.93nd26.02nd27.31nd19.42nd reef water15.36nd26.40nd27.41nd17.85ndmacroalgae coralline algaecca13.373.6025.201.3012.124.05coral mucus m. annularis mu115.460.5415.784.1216.462.3514.243.21 m. mirabilis mu217.952.1216.534.2417.641.71 s. siderea 17.800.55 p. astreoides 16.871.11suspended particulate matter (spm) fractions collected on coarse (gfc) and fine (gff) glass fiber filters . Codes cca and mu1, mu2 refer to data collected at b1 and correspond to data presented in fig . 3 nd not done sponge species collected at four reef stations with their respective average isotope signatures codes sp1sp6 refer to sponges collected at b1 and correspond to sponge data presented in fig . 3 plots of carbon (a) and nitrogen (b) stable isotope signatures of material collected from the four reef and four open water stations (average and standard error). Sponges (n = 35), bacteria (bact n = 8), coral mucus (n = 9), glass microfiber filters coarse (gfc) and fine (gff) represent values of suspended matter (spm) collected either from reef water or from open water offshore (n = 4 or 5). Crustose coralline algae from two reef stations (n = 3) average isotope signatures of putative food sources for sponges collected from reef stations ljt, ct, b1, and sb (replicates, n = 23, standard errors range from 0 to 0.4, not shown) suspended particulate matter (spm) fractions collected on coarse (gfc) and fine (gff) glass fiber filters . Bacterioplankton (bacteria) was collected on aluminum oxide (anopore) membrane filters . Codes cca and mu1, mu2 refer to data collected at b1 and correspond to data presented in fig . 3 pooled analysis with the mixing model (no distinction between sites or sponge species) show that mucus (mu1 and mu2 combined) contributed to the average cavity sponge diet between 44 and 57% (= 95% low and high confidence limits, mode 50%), cca between 0 and 10% (mode 2%), and the different spm fractions between 0 and 33% (mode 7%) for gfc and 14 and 47% (mode 37%) for gff (table 3a). Of the overall diet 51% (mode) was reef - derived . Therefore, we ran the siar mixing model also separate for the stations for which cca data were available, ct and b1 (tables 2, 3b, c). Pooled analysis of sponges at ct (no distinction between sponge species) reflected a higher cca contribution (between 6 and 43%, mode 31%) than mucus (046%, mode 17%). Together suspended matter supplemented the diet between 0 and 40% for the gfc fraction (mode 17%) and 1155% for the gff fraction (mode of gfc and gff fractions together 51%, table 3b). At b1, where coral cover is higher than at ct (van duyl 1985; pers comm), the diet of an average cavity sponge (no distinction between sponge species) was dominated by reef - derived sources (73%) with coral mucus and cca contributing for 60 and 13% (mode) and with 95% confidence between 5068% and 030%, respectively (table 3c). The contribution of suspended matter fractions gfc and gff was within the 028/030% range (modes 11 and 5%), respectively.table 3dual isotope mixing model analyses of the diet of spongessourceslow 95%high 95%modemeanmode%mean%(a) average diet of sponges (four stations) gfc ro00.3260.0710.138 gff ro0.1400.4740.3710.32144.245.9 cca00.0950.0150.039 mucmix0.4350.5720.4980.50251.354.1(b) diet of sponges at ct gfc ro00.4020.1700.194 gff ro0.1120.5520.3350.33350.552.7 cca0.0630.4280.3080.254 mucmix00.4550.1720.2184847.2(c) diet of sponges at b1 gfc ro00.2750.1060.122 gff ro00.3000.0530.13015.925.2 cca0.0010.3010.1310.155 mucmix0.5020.6820.5960.59372.774.8the sources comprise two suspended matter size fractions, gfc ro> 1.2 m and gff ro> 0.7 and <1.2 m from reef overlying and open water (ro), cca representing crustose coralline algae and mucmix representing coral mucus of two different coral species, m. annularis and m. mirabilis . The 95% credibility intervals are presented of the different sources as well as the mode and the mean . Mode% and mean% show the contribution of plankton - derived (gfc and gff) and reef - derived organic matter (cca and mucmix) in the diet as% dual isotope mixing model analyses of the diet of sponges the sources comprise two suspended matter size fractions, gfc ro> 1.2 m and gff ro> 0.7 and <1.2 m from reef overlying and open water (ro), cca representing crustose coralline algae and mucmix representing coral mucus of two different coral species, m. annularis and m. mirabilis . The 95% credibility intervals are presented of the different sources as well as the mode and the mean . Mode% and mean% show the contribution of plankton - derived (gfc and gff) and reef - derived organic matter (cca and mucmix) in the diet as% for six sponge species, cca and mucus of two coral species at b1 dual isotopes as well as fatty acid patterns were measured (fig . 3; table 4). Fas in sources were also present in most sponges, but the diversity in fas was higher in sponges . Differences between sources (cca and mucus) and sponges in the fatty acid compositions are illustrated in fig . The euclidean distances show that the fas of sponges cluster together and are distinct from the sources . Main fas of the sponge cluster included, in order of importance 16:0, 20:46, 18:0, 20:53, 18:17c, and branched 20:0 (phytanic acid) whereas in the case of the potential energy sources this included 16:0, 18:0, 18:19c, and 20:46 (table 4). The source groups were significantly different (anosim, global r = 0.8, p <0.05) from the sponge group and simper analysis revealed that the differences are the relatively higher percentage abundance of 16:0, 20:46, 18:0, and 18:19c in coral mucus and coralline algae but higher percentage abundance of phytanic acid, 24:0 and 20:53 in the sponges . These 7 fas together accounted for ~60% of the fa dissimilarity (table 4; fig . 4). Among the three different sources, coralline algae, mucus of montastraea annularis, and madracis mirabilis, composition patterns were also significantly different (anosim, global r = 1, p <0.05). Simper analysis revealed two very dominant fatty acids in the coralline algae (16:0 and 20:46) that together accounted for ~73% of the fa; in mucus from m. annularis (mu1), four abundant fas made up ~70% (16:0, 18:0, 20:53, and 18:19c); in mucus from m. mirabilis (mu2), three abundant fas made up ~70% (16:0, 18:0, and 20:46, table 2). The major fas accounting for the dissimilarity between mucus from the two different coral species is the relatively higher percentage abundance of 20:46 and 18:0 in m. mirabilis (mu2) but a relatively higher percentage abundance of 18:17c and 20:53 in m. annularis (mu1) with these 4 fas accounting for ~60% of the dissimilarity between the coral species (table 4). Three groups of sponges were distinguished among the 6 sponge species (fig . 4: h. caerulea (sp1), c. caribensis (sp3) and c. erecta (sp4) make up the first group; c. raraechelae (sp2) and d. anchorata (sp5) the second and s. ruetzleri (sp6) the third group). Simper analysis revealed different combinations of fas, in order of dominance, accounting for ~70% of sponge group similarity: for the first group (sp1, sp3, and sp4) fas 16:0, br 20:0 (phytanic acid), 18:0, 20:46, i15:0, and 16:17c are the main fas . In the second group (sp2 and sp5) fas 16:0, 20:46, 24:0, 18:17c, 22:0, 20:53, and 20:63 determined primarily the composition pattern . In the third group (sp6), these were the five fas: 16:0, 20:46, 18:0, 20:53, and 14:0 (table 4).fig . 3carbon and nitrogen isotopes of six sponge species (sp1sp6) and putative organic matter sources for sponges at reef site b1 . The average and standard error for sp1 (n = 3) and sp6 (n = 2), gfc - spm (n = 3), gff - spm (n = 3) is presented . Other data points (sp2, 3, 4, and 5, cca and mucus from two coral species, montastraea annularis (mu1) and madracis mirabilis (mu2) do not have replicates other than repetitive sample analysis of the same specimen). See also tables 1, 2 table 4fatty acid composition of six sponge species (sp1sp6, see table 1), one crustose coralline alga (cca) and mucus (mu) from two coral species (see table 2), all collected from reef site b1sp1sp2sp3sp4sp5sp6ccamu1mu2i14:0 0 (0)0 (0)0.7 (0.02)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)14:06.6 (0.55)2.6 (0.05)2.3 (0.08)3.6 (0.40)3.8 (0.55)9.1 (0.24)3.5 (0.10)5.3 (0.21)2.6 (0.05)ai15:0 0.6 (0.05)0 (0)2.6 (0.02)0.5 (0.27)0.1 (0.07)0.3 (0.06)0.04 (0.04)0 (0)0 (0)i15:0 5.3 (0.24)0.3 (0.06)9.8 (0.05)5.4 (0.25)0.8 (0.04)0.5 (0.16)0 (0)3.8 (1.90)4.2 (0.08)15:01.2 (0.11)0.5 (0.01)1.1 (0.07)1.4 (0.07)1.7 (0.15)7.5 (0.23)0.3 (0.07)0 (0)0 (0)i16:0 0.6 (0.08)0.4 (0.02)1.3 (0.02)0.4 (0.20)0.7 (0.05)1.9 (0.05)0.3 (0.02)0 (0)0 (0)10me-16:0 0 (0)0 (0)0 (0)0 (0)0.4 (0.07)0 (0)0 (0)0 (0)0 (0)16:260 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0.51 (0.03)16:240 (0)0.2 (0.03)0 (0)0 (0)0.5 (0.00)0.1 (0.09)0.04 (0.04)0 (0)0 (0)16:15c0 (0)0.7 (0.03)0.9 (0.03)0.4 (0.18)0.6 (0.03)0.4 (0.02)0 (0)0 (0)0 (0)16:17c 3.3 (0.16)1.6 (0.02)12.6 (0.03)4.0 (0.11)4.2 (0.16)2.1 (0.04)0.5 (0.06)3.9 (0.50)0.6 (0.04)16:17 t 0 (0)0.15 (0.02)0.79 (0.01)0 (0)0.1 (0.07)0.3 (0.04)0 (0)0 (0)0 (0)16:017.1 (1.73)13.2 (0.27)18.4 (0.19)20.5 (0.39)12.1 (0.62)19.6 (0.52)40.7 (0.21)30.8 (0.84)27.8 (0.66)10me-17:0 0 (0)0 (0)0.8 (0.15)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)17:17c0.9 (0.66)0.1 (0.00)1.9 (0.10)8.5 (0.42)0.5 (0.11)0.7 (0.22)0.4 (0.12)0 (0)0 (0)17:01.9 (0.08)0.5 (0.04)0.5 (0.49)2.6 (0.13)1.4 (0.00)0.5 (0.09)0.3 (0.00)0.5 (0.03)0 (0)i18:0 0 (0)0.6 (0.05)0.3 (0.05)0 (0)0.6 (0.09)0.4 (0.02)0 (0)0 (0)0 (0)18:530.2 (0.22)1.1 (0.03)0.2 (0.05)0 (0)1.7 (0.23)0.1 (0.05)0.1 (0.00)1.5 (0.04)0 (0)18:50 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)2.1 (1.03)0 (0)18:360.6 (0.56)0.3 (0.02)0.1 (0.04)0 (0)0 (0)0 (0)0 (0)4.1 (0.31)0 (0)18:330.5 (0.25)0.1 (0.07)0 (0)0.8 (0.21)0.3 (0.26)0 (0)0 (0)0 (0)0 (0)18:26c1.8 (0.12)0.8 (0.07)0.3 (0.02)2.2 (0.09)0.6 (0.30)0.9 (0.06)0.8 (0.02)0.4 (0.20)0.8 (0.05)18:17c5.7 (0.12)9.7 (0.06)3.3 (0.10)5.5 (0.04)6.6 (0.15)2.0 (0.06)4.5 (0.05)8.1 (0.33)0.7 (0.03)18:19c2.5 (0.50)1.9 (0.06)1.9 (0.11)4.2 (0.14)1.4 (0.26)2.0 (0.08)11.2 (0.10)9.1 (0.32)7.3 (0.12)18:09.4 (0.25)4.0 (1.61)9.7 (0.23)10.2 (0.29)5.6 (0.46)11.5 (0.06)3.0 (0.02)15.5 (0.34)25.4 (0.74)i20:0 0.2 (0.20)0.8 (0.01)0 (0)0 (0)1.1 (0.14)0 (0)0 (0)0 (0)0 (0)20:534.5 (0.26)6.3 (0.24)3.4 (0.01)3.0 (0.25)5.0 (0.36)11.7 (0.26)0.1 (0.05)11.0 (0.15)4.4 (0.44)20:430 (0)0.10 (0.05)0 (0)0 (0)0.4 (0.08)0.7 (0.35)0.3 (0.30)0 (0)0 (0)20:4610.6 (0.68)11.1 (0.24)9.1 (0.25)8.1 (0.11)10.7 (0.48)15.2 (0.27)32.2 (0.75)0 (0)15.0 (0.34)20:360.7 (0.13)0.7 (0.12)0.5 (0.06)0.6 (0.08)0.5 (0.03)0.5 (0.05)0.4 (0.03)0 (0)0 (0)20:330 (0)0.1 (0.07)0 (0)0.1 (0.12)0.3 (0.13)0.1 (0.13)0 (0)0 (0)0 (0)phytanic acid15.5 (1.34)2.9 (0.13)13.4 (0.26)8.3 (0.29)1.8 (0.30)1.3 (0.19)0.2 (0.03)0 (0)0 (0)20:19c0.6 (0.39)0.2 (0.05)0.1 (0.00)0 (0)0.5 (0.10)0.1 (0.05)0.2 (0.04)0 (0)0.3 (0.28)20:290.3 (0.15)0.3 (0.05)0 (0)0.8 (0.02)0.9 (0.40)2.6 (0.04)0.1 (0.04)0 (0)0 (0)20:00.9 (0.04)2.2 (0.06)0.8 (0.04)1.7 (0.05)3.5 (0.16)2.5 (0.03)0.3 (0.05)3.1 (0.14)6.4 (0.21)22:631.0 (0.01)8.4 (0.14)0.1 (0.06)2.6 (0.27)3.6 (0.28)1.9 (0.02)0 (0)0 (0)0 (0)22:530 (0)0 (0)0.1 (0.09)2.8 (0.30)0 (0)0 (0)0.1 (0.03)0 (0)0 (0)22:460.5 (0.06)1.9 (0.14)0 (0)0.6 (0.58)0.3 (0.12)0 (0)0 (0)0.9 (0.44)1.9 (0.14)22:1110.2 (0.20)0.1 (0.03)0.5 (0.06)0.1 (0.11)0 (0)0 (0)0.1 (0.03)0 (0)0 (0)22:19c0 (0)0 (0)0.1 (0.05)0 (0)0 (0)1.0 (0.08)0.1 (0.07)0 (0)0 (0)22:01.9 (0.18)4.2 (0.25)0.7 (0.03)0.4 (0.19)18.1 (0.89)0.8 (0.20)0.2 (0.05)0 (0)2.2 (0.09)23:01.5 (0.17)2.1 (0.34)0.9 (0.05)0.1 (0.12)2.0 (0.14)0.1 (0.06)0 (0)0 (0)0 (0)24:03.5 (0.31)20.3 (0.96)1.1 (0.10)0.6 (0.06)7.8 (0.32)1.8 (0.04)0.3 (0.05)0 (0)0 (0)% bact - spec6.6/9.92.2/3.816.2/28.76.3/10.33.7/7.83.4/5.50.3/0.83.8/7.74.2/4.8average% se (n = 3) bacteria - specific fa and last row is average% bacteria specific fa (bact - spec) with / without inclusion of 16:17cfig . 4multidimensional scaling (mds) plot showing similarity in fatty acid composition profiles of six sponge species (sp16), crustose coralline algae (cca) and the mucus of two coral species, montastraea annularis and madracis mirabilis, at reef site b1 (see table 4 for list of fatty acids) carbon and nitrogen isotopes of six sponge species (sp1sp6) and putative organic matter sources for sponges at reef site b1 . The average and standard error for sp1 (n = 3) and sp6 (n = 2), gfc - spm (n = 3), gff - spm (n = 3) is presented . Other data points (sp2, 3, 4, and 5, cca and mucus from two coral species, montastraea annularis (mu1) and madracis mirabilis (mu2) do not have replicates other than repetitive sample analysis of the same specimen). See also tables 1, 2 fatty acid composition of six sponge species (sp1sp6, see table 1), one crustose coralline alga (cca) and mucus (mu) from two coral species (see table 2), all collected from reef site b1 average% se (n = 3) bacteria - specific fa and last row is average% bacteria specific fa (bact - spec) with / without inclusion of 16:17c multidimensional scaling (mds) plot showing similarity in fatty acid composition profiles of six sponge species (sp16), crustose coralline algae (cca) and the mucus of two coral species, montastraea annularis and madracis mirabilis, at reef site b1 (see table 4 for list of fatty acids) for these three distinguished sponge groups at b1, we also ran the isotope mixing model (table 5). The first group appears to rely mainly on reef - derived sources (mucus and cca, mode and mean both> 75%). The second group probably relied less on mucus and more on cca and used more plankton - derived food compared with group 1 . Ruetzleri only) consists for about 51% (mean) of reef - derived and 49% (mean) of suspended matter (plankton) derived food . Group 1 has a smaller centroid euclidean distance (23.64) to the average mucus mixture than groups 2 and 3 (32.43 and 24.55) in fig . This concurs with a larger contribution of mucus (66%) to the diet of group 1 than that of the other two groups (36 and 33%) (fig . 4; table 5). The lower contribution of cca in the diet of group 1 (10% mode) compared to group 3 (19% mode) was also reflected in fig . 4 . We did not find this for group 2, which had the longest euclidean distance to cca (41.81 vs. 33.78 of group 3 and 37.37 of group 1), while cca - derived food comprised 22% in the diet of this group . To further explore the relation between the stable isotope and fa data sets, we compared the matrices of fas and dual isotope signatures of sponges and reef resources (figs . 3, 4) and found a significant correlation between the two matrices (primer, rho = 0.625, p = <0.01).table 5results of dual isotope mixing model analyses for different sponge groups at b1sourceslow 95%high 95%modemeanmode%mean%(a) diet of group 1 h. caerulea, c. caribensis, c. erecta (sp1, sp3, sp4)gfc ro00.2840.0360.117gff ro00.2440.0360.1047.222.1cca00.2860.0950.132mucmix0.5040.7960.6580.64775.377.9(b) diet of group 2 c. raraechelae, d. anchorata (sp2, sp5)gfc ro00.4320.1670.216gff ro00.430.2020.20836.942.4cca00.4510.2190.219mucmix0.0770.6060.3570.35757.657.6(c) diet of group 3 s. ruetzleri (sp6)gfc ro0.0030.4870.2920.259gff ro00.4530.2850.23257.749.1cca00.4210.1880.207mucmix0.0230.5160.3270.30251.550.9 for further explanation, see table 3 results of dual isotope mixing model analyses for different sponge groups at b1 for further explanation, see table 3 cryptic encrusting sponges living in coral cavities on the fore - reef slope of fringing reefs sequester most of their organic matter from the passing water . They efficiently filter the pico- and nanoplankton, but dissolved organic matter (dom) appears to be the major resource of various sponge species living on the open reef and in coral cavities (yahel et al . 2003; de goeij et al . . It may be dom released from phytoplankton, dom supplied to the reef from outside or dom released from the reef benthos . Gradients in dom concentrations over the reef suggest that there is a net release of dom from coral reef waters to adjacent open waters (van duyl and gast 2001). Only 1020% of the dom in reef water appears to be available for sponges (de goeij et al . 2008a). By analyses of dual stable isotope signatures (corg and n) and fa patterns of sponges and their potential food sources, we obtained circumstantial evidence that the reef itself mainly feeds her cavity sponges . This remarkable finding implies that cryptic sponges support reef internal nutrient recycling and conservation of reef organic matter . It was surprising that none of the 12 sponge species examined appeared to live mainly on suspended particulate organic matter or dom derived from this source . The corg values of the spm fractions were in the range reported for marine suspended matter (peterson and fry 1987). Bacterioplankton values were within 2 of spm in open water, which indicates that bacteria were the primary consumers of spm . This makes it highly likely that spm represents predominantly phytoplankton and that the bacterioplankton reflects the c isotope ratio of reactive dom released by phytoplankton (e.g., harvey et al . The c of spm did not change during passage over the reef, for instance by obtaining a typical c spm reef signal (17 to 20: land et al . The n of spm did not change either and remained ~4. Moreover, at two of the four stations (ct and b1) comparable corg values of predominantly heterotrophic bacterioplankton (26, 27, table 2) between open water and reef bottom water suggest that this bacterioplankton remained dependent on phytoplankton doc . Such low c values have been reported, for e.g., synechococcus (c 33 to 25, brutemark et al . 2009) and prochlorococcus, both abundant in reef and open water along curaao (van duyl et al . 2002). Residence time of the spm and bacterioplankton in reef overlying waters may have been too short for changes in isotopic ratios either due to rapid water exchange with the open water and/or due to spm removal by benthic suspension feeders . Phytoplankton concentrations in reef surrounding waters in curaao are usually low (van duyl et al . 2002), and the organic matter demand of cryptic biota, cryptic sponges in particular, is high . Cavity biota between 10 and 15 m depth on the fore - reef slope in curaao consume on average 350 mmol c m d of which cavity sponges consume on average 256 mmol c md (73%) with the doc fraction comprising> 90% of the diet (de goeij et al . This organic matter supply is orders of magnitude higher than the supply of pelagic primary production to reefs (richter et al . It is evident that the supply of open water - derived phytoplankton and its dom release is insufficient to satisfy the total organic carbon requirements of coral reef cavity sponges . In accordance, the isotope mixing model results confirmed a spm contribution of less than <50% in the diet of most sponges . This implies that the examined sponges with average corg of 18.9 and n of 4.6 mainly assimilate other sources than pelagic primary production . Presence of distinct reactive dom in reef bottom water compared to open water was demonstrated by the increased c value of bacterioplankton at two of the four stations (ljt and sb). Bacterioplankton apparently assimilated a source of carbon not available in the open water, a source, which may also be available to the dom feeding cavity sponges . Benthic primary producers usually have higher corg values than pelagic primary producers (france 1995; fry 2006). Thus, assimilation of benthic algae - derived reactive doc may explain the elevated c values in bacterioplankton in reef bottom water at ljt and sb . Bacteria respond quickly when exposed to changing resources in the vicinity of the reef bottom . Enhanced bacterioplankton production in reef bottom waters, cavity waters, and coral mucus point to the reef bottom as the source of inorganic nutrients and reactive dom (van duyl and gast 2001; scheffers et al . However, the c reef signal of bacterioplankton (17.9 to 15.4) was higher than that of most examined sponges (20.8 to 17.2) suggesting that sponges and bacterioplankton may not fully depend on the same source of reef - derived dom . Sponges may exploit a wider size range of the operationally defined dom fraction than bacterioplankton (de goeij et al . Benthic primary producers such as corals and benthic macroalgae have been reported to release reactive dom (e.g., crossland 1983, 1987; wild et al . The c values of the benthic substrates (coral mucus of two dominant coral species and crustose coralline algae) were on average higher in c than the spm and open water bacterioplankton and were more in range of the sponge stable isotope signals . The n values of reef - derived substrates with values 34 lower than those of sponges on average suggest a direct trophic link (one trophic level distance). The lower n values of reef substrates versus open water substrates may be due to enhanced n2 fixation by the reef benthos (davey et al . Discharge from land or pollution may counteract this effect by introducing organic and inorganic n enriched in n. this may partly explain the variations in n in mucus, coralline algae, and sponges between different stations . The range of corg in crustose coralline algae (cca) of 25.2 to 12.1 was unexpectedly large, possibly due to the unique ontogeny of cca . Younger portions of the cca may have lower corg values than older portions possibly because rapid photosynthesis in younger parts depends more on respired co2 than photosynthesis in older parts (lee and carpenter 2001). Anyway, the lower range of corg values of cca was within 2 of our sponges . Moreover, the n of cca (1.34.0) make it a likely food source for the majority of cavity sponges with 34 higher n values than the cca . Little is known of exudation of organic matter by cca apart from the releases of allelochemicals (e.g., kim et al . Total dom release by cca has not been determined as far as we know, but their productivity equals that of fleshy macroalgae and turf algae on reefs (chrisholm 2003). Reported c values of 18.7 to 16.8 for dictyota sp.,19.3 for halimeda sp . (raz - guzman macbeth and de la lanza espina 1991; lepoint et al . 2000), and n values of 0.53 of macroalgae on coral reefs (yamamuro et al . 1995; france et al . 1998) fall in the same range as cca (corg 25.2 to 12.1, n 1.34). Therefore, dom released from these brown and green macroalgae may have also contributed to the isotope signal in sponges . Trophic transfers of organic matter derived from benthic macroalgae and mangroves, to sponges have been reported before (behringer and butler iv 2006; granek et al . 2009) and appear to be important in the nutrition of sponges . Unlike cca, coral mucus has already been described as an important food source on coral reefs (wild et al . 1980; wild et al . 2004) and may be a suitable source of dom for cavity sponges . The c of the mucus samples of montastraea annularis and madracis mirabilis (range 17.9 to 14.2) is higher than that of most cavity sponges, implying that sponges do not feed exclusively on mucus or mucus - derived dom . Coral - derived organic matter is a reactive substrate for bacterioplankton growth (ferrier - pags et al . 2000) and may have contributed to the c reef signal of bacterioplankton at ljt (15.4). The average n of mucus (1.9) and that of cavity sponges (4.6) are consistent with mucus / mucus - derived dom as a food source for most cavity sponges . It is evident that individually, neither phytoplankton, bacterioplankton, cca (benthic macroalgae) nor coral mucus can account for the sponge dual isotope signatures . The isotope mixing model analysis showed that cavity sponges incorporate from half to three quarters of their organic matter from mucus and cca (benthic macroalgae) with mucus as the dominant source of reef - derived organic matter (up to 66% of the diet). It appears that with decreasing coral cover the contribution of coral mucus to the diet of sponges decreases and shifts to a larger contribution of cca (benthic macroalgae) and phytoplankton . At station ct with a lower coral cover than at the other reef stations, mucus only contributed 17% (mode) to the diet of sponges while the bulk food was provided by cca including other benthic macroalgae (31%) and small phytoplankton (34%, gff fraction). This was different at b1, where coral cover on the slope is relatively high (van duyl 1985; bak and nieuwland 1995) and the sponges reflect a diet of mainly mucus (60%, mode) with 13% cca . This suggests that the sponge community is opportunistic and consumes om according to availability irrespective of the dom source . This does not imply that all examined sponge species at a particular reef site have similar diets . This is further corroborated with our fa profiles of sponges at b1 . The overall similarity in fa composition pattern of the three groups within these six sponge species (based on significantly different fa compositions) also had different diets according to the isotope mixing model analysis, implying differences in the proportional use of mucus, benthic algae (including cca), and phytoplankton - derived dom . This suggests that there is trophic niche segregation among sponges which may be an important factor facilitating co - existence of different sponge species (thurber 2007). Furthermore, the differences in diet may to some extent be reflected in the fa compositions of sponge groups suggesting that the selected food resources may indeed form part of the diet of sponges . The fatty acid profiles of our coral mucus and cca sources resemble those reported for coral tissue and cca (e.g., latyshev et al . 1991; although many dominant fas such as 14:0, 16:0, and 18:0 (table 2) are common to many organisms, some fas have been identified as potential tracer of food source in sponges . For this study area specifically, for example, de goeij et al . (2008b) conclude from isotope tracer experiments that the dominant fa 20:46 found in the sponge halisarca caerulea has an exogenous source . Interestingly, 20:46 is found dominant in all 6 sponge species examined and it is also dominant in cca and m. mirabilis mucus . The high cover of cca in cavities (30% of the hard bottom surface in cavities, scheffers et al . 2004), its close proximity to cavity sponges and the fact that cca was rich in 20:46, may have contributed to the 20:46 content in sponges . In sponge groups 2 and 3, this fa was the second most abundant (> 10% of total fas) and the diet of these sponge groups consisted for 1922% (mode) of cca (including other macroalgae). In sponge group 1, the predominantly mucus feeding group, 20:46 was the third most abundant fa with a lower relative abundance than in the other groups (<10%). This coincided with a lower contribution of cca in their diet (10% mode). Trophic transfer of this fa may be directly linked to the consumption of cca as part of macroalgal - derived organic matter . Phytanic acid, which can be considered as a sponge biomarker (de goeij et al . 2008b) was the second most abundant fa in group 1 . For its synthesis, degradation products of chlorophyll a are required, possibly delivered to the sponge by sponge associated phototrophic microbes, considering the relatively high amount of the likely bacterial specific fa 16:17c as well as the overall high% of bacteria specific fas in group 1 (up to 29% compared with up to 10% of total fas in the other groups, table 4). Sponge species in group 1 indeed harbor - rich microbial communities (hill et al . 2005; erwin and thacker 2007). Mutualism between sponges and their associated microorganisms may have influenced the diet of group 1 compared with groups 2 and 3 . Weisz et al . (2007) show that sponges with high versus low abundances of associated microbes may have distinct diets . In line, we show that the diet of sponges (based on stable isotopes as well as fas) varies with abundance of bacteria specific fas . Interestingly, sponges with a relatively high abundance of associated microbes (group 1) appear to be more dependent on reef - derived food than other sponges . The fa 20:53, a dominant fa in (benthic) diatoms and the mucus of corals, particularly in mucus of m. annularis was most abundant in s. ruetzleri (group 3). The siar model analysis showed that the contribution of phytoplankton - derived food was highest in this sponge (mean 49% and mode 57%, both plankton size fractions together), which may suggest that it feeds on diatoms or diatom - derived om rich in 20:53 . The other sponge groups (1 and 2) may obtain 20:53 predominantly by consuming mucus considering the higher contribution of mucus and lower plankton - derived food in the diet of these groups than in the diet of s. ruetzleri (group 3). Diatom - derived om as well as mucus may have contributed to the abundance of 20:53 in sponges . Considering the congruencies between the fa compositions and the dual stable isotope signals in the trophic transfer and relations between sources and consumers, it was not surprising that the matrices (based on euclidean distances) of the reef sources and consumers of both approaches were significantly correlated . Both methods apparently lead to comparable results with fa composition and biomarkers identifying the food items of consumers, and evidencing trophic transfer and with dual stable isotope analyses estimating the contribution of the different sources to the diet of consumers . Results of both methods strongly support a trophic transfer from zooxanthellate corals and cca to cavity sponges . The quantitative contribution of cca to the diet of sponges remains unresolved, because its dual isotope signal overlaps with that of other benthic macroalgae . Results unambiguously point to the reef benthos as the main source of organic matter for encrusting cavity sponges on coral reefs . The contribution of open water - derived organic matter as food for the cavity sponge community was usually less than 50% . Food sources for sponges on the reef comprise dom derived from coral mucus and benthic macroalgae (cca). The prominent presence of a characteristic fatty acid of coral mucus and cca, 20:46 in sponges further confirms this trophic transfer . (2008b, 2009) found that the cavity sponge halisarca caerulea converts assimilated dom in sponge biomass and detrital material . Combining this with the knowledge that (1) the cover of cavity sponges is high on fore - reef slopes (scheffers et al . 2004), (2) dom assimilation by cavity sponges is high (de goeij et al . 2008a), and (3) most of the om assimilated by sponges is reef - derived (this study), we argue that cryptic sponges play a key role in conserving reef - produced dom for the reef system by converting it into pom . Whether the cryptic sponge link in the coral reef food web is favorable for the coral reef health status remains to be investigated.
The asialoglycoprotein receptor (asgpr) (also known as the ashwell receptor) mediates the capture and endocytosis of galactose- (gal) and n - acetylgalactosamine- (galnac) terminating glycoproteins . The relevance of this function has been the subject of much debate; the primary role may be the removal of potentially hazardous glycoconjugates arising from normal tissue turnover, tissue injury, disease, and other causes . Studies using knock - out mice have provided evidence for direct involvement of the asgpr in removal of abnormally sialylated plasma glycoproteins . Mice lacking the sialyltransferase st3gal4 showed prolonged bleeding which was attributed to asgpr - mediated clearance of at least one plasma hemostatic component, von willebrand factor (vwf), that showed decreased sialylation . Findings in mice lacking the asgpr demonstrated that, during sepsis, the receptor removed components of hemostasis (vwf and platelets) that had been desialylated by bacterial neuraminidase and thereby allowed hemostatic adaptation that moderated disseminated intravascular coagulation and improved host survival . The asgpr may therefore be poised for rapid clearance of plasma glycoproteins that, for whatever reason, show decreased or abnormal sialylation . The highest level of expression of the asgpr is in the liver, in which it is located on the sinusoidal face of hepatocytes . Low - level expression has been shown in various other cell types, such as, peritoneal macrophages in rat, human intestinal epithelial cells, mouse testis, and the rat thyroid gland . The galactosyl homeostasis theory proposes that the balance of both gal and galnac glycoconjugates is important for normal tissue physiology [1, 9]; whether or not expression of the asgpr at these other sites represents a need for localized constitutive control of such glycoconjugates is not known . A major area of interest focussing on the asgpr is the targeted gene transfer / delivery of drugs to the liver [10, 11]. For example, using galnac as a ligand on a sirna - containing complex, the latter was successfully targeted to hepatocytes after simple intravenous injection into the tail vein in mice . Moreover, sirna - mediated knock - down of targeted genes was demonstrated within the hepatocytes . Besides its potential importance in allowing liver - specific drug targeting, the asgpr is a key factor in the design and administration of glycoprotein pharmaceuticals more generally: the activity of the receptor can impact upon drug half life and thereby the window of therapeutic efficacy . Human asgpr is composed of two types of subunit: a major subunit (asialoglycoprotein receptor 1, asgr1) and minor subunit (asialoglycoprotein receptor 2, asgr2). Both subunits are type ii, single pass proteins that broadly comprise a cytoplasmic domain, transmembrane domain, and extracellular carbohydrate recognition domain (crd) [14, 15]. The subunits may exist as asgr1-asgr2 heterooligomers, asgr1homotrimers and homotetramers, and asgr2 homodimers and homotetramers . These different quaternary forms may allow for functional differences, such as, substrate specificity or rate of endocytosis [1, 16]. The genes encoding asgr1 and asgr2 (asgr1 and asgr2, resp .) Are located on the short arm of autosome 17, approximately 58.6 kilobases (kb) apart . The genes are evolutionarily related but differ significantly in their structural organization: asgr1 comprises 8 exons and is approximately 6 kb long, asgr2 contains 9 exons occupying 13.5 kb of dna [14, 15]. Until recently, asgr1 was thought to yield one transcript encoding a single protein . However, in 2010, liu et al . Demonstrated the existence of two alternatively spliced transcripts . The longer transcript, t1, contains all 8 exons and is by far the more abundant; it encodes full - length asgr1 (isoform a, 291 aminoacids). The shorter transcript, t2, has an in - frame deletion of exon 3 resulting in the loss of 39 residues (isoform b, 252 amino acids). Asgr2 gives rise to five transcripts (th2, t1, t2, t3, and t4) encoding four isoforms (a to d) that contain different in - frame deletions arising from alternative exon splicing events . Isoforms a and c contain 5 aminoacids that serve as a proteolysis cleavage signal near the junction between the transmembrane domain and the crd . Cleavage at this site results in secretion of the crd as a soluble protein [18, 19]. Isoforms b and d lack this signal therefore they are not proteolytically cleaved but rather remain membrane bound where they may oligomerize with asgr1 isoform a to form native asgpr at the cell surface . The secreted forms of asgr1 and asgr2 are able to associate into soluble asgpr [17, 19]. There is evidence to suggest that the soluble receptor may bind free substrates in the circulation and carry them to the liver for uptake and degradation . Aside from membrane attachment / secretion, it is not known whether further functional variation, such as, substrate specificity, may be associated with the different isoforms of asgr1 and asgr2 . Based on the observation above that the asgpr is expressed in rat peritoneal macrophages, it was considered possible that monocytes, the lineage precursor of tissue macrophages, may also express the receptor . To the best of our knowledge, the present study investigated the expression of asgr1 and asgr2 in human peripheral blood monocytes . The data showed that both asgr1 and asgr2 are expressed in human monocytes in the circulation, that expression cannot be detected in lymphocytes and granulocytes, that the transcripts of both genes differ between individuals and that, in a given individual, the transcription profile for asgr2 is restricted to one of two patterns . The findings are of potential importance for health and disease in a variety of disciplines . Genes, transcripts, and proteins are referred to by their formal scientific names as listed in the national centre for biotechnology information (ncbi), which complies with standardized international nomenclature . Gene sizes, exon numbering, and so forth were obtained from the reference sequences listed in table 1 . Edta - anticoagulated whole blood in excess of that required for routine blood tests was anonymized and handled in accordance with medical research council guidelines . Citrate- or edta - anticoagulated whole blood (5 ml) was centrifuged at 200 g for 10 minutes, ambient temperature to prepare platelet - rich plasma (prp). Two - thirds of the volume of the prp was carefully removed from above the buffy coat, centrifuged at 1800 g for 10 minutes to pellet the platelets, and then the supernatant plasma returned to the original blood sample . As described above, the blood sample was loaded onto a discontinuous histopaque (sigma aldrich, dorset, uk) gradient comprising histopaque 1119 (2 ml, lower layer) and histopaque 1077 (3 ml, upper layer). Following centrifugation at 800 g for 1 h at ambient temperature, the cells at the interface between the plasma and histopaque 1077 (monocytes and lymphocytes) were harvested; the cells at the interface between histopaque 1077 and 1119 (principally granulocytes with a small proportion of lymphocytes) were also harvested . Harvested cells were washed by resuspension in 10 ml phosphate buffered saline ph 7.2 (pbs) followed by centrifugation at 250 g for 10 minutes at ambient temperature . The cell pellet was resuspended in pbs (0.7 ml) and an aliquot (0.2 ml) was diluted 1: 1 (v / v) with pbs and used for determination of cell counts on a pentra 120 (horiba abx, montpellier, france). Citrate- or edta - anticoagulated whole blood (5 ml) was depleted of platelets as described above (separation of white blood cells). The blood sample (3 ml) was then loaded onto histopaque 1077 (3 ml) and centrifuged to separate the white blood cells (wbc) (400 g, 30 min, ambient temperature). The wbc interface was harvested, washed, and an aliquot used for determination of cell counts as described above (separation of white blood cells). The remaining cells, suspended in pbs, were separated according to forward scatter and side scatter light characteristics using a moflo high speed cell sorter (beckman coulter, high wycombe, bucks, uk). Gating was restrictive rather than permissive: each gate was set only for the core population of cells that had the required scatter characteristics . In particular, the lymphocyte gate was set to minimise the possibility of small monocytes being harvested . Purity checks were subsequently performed by reanalysis of aliquots of the sorted cells in the flow cytometer; purity was typically around 98% . All reagents and consumables for cell culture were supplied by invitrogen life technologies ltd, paisley, ireland . (human hepatocyte carcinoma) and thp1 (human acute monocytic leukemia) cells were cultured in rpmi1640 medium + l - glutamine, supplemented with 10% (v / v) fetal calf serum and containing penicillin (50 units / ml) and streptomycin (50 g / ml). Cells were grown at 37c in water - saturated air (95%, v / v), co2 (5%, v / v) in 25 cm flasks . Hepg2 cells (adherent cell line) were liberated from the flask wall mechanically using a plastic scraper and were separated by exposure to shear force . Hepg2 has been shown by others to express high levels of the ashwell receptor and was used as a positive control in all relevant experiments . Rna was extracted using rneasy kits (qiagen, west sussex, uk) according to the manufacturer's instructions . Yield was determined spectrophotometrically and then 1.0 g was reverse transcribed into cdna using random hexamers and the high capacity cdna reverse transcription kit (life technologies ltd / applied biosystems, paisley, uk) according to the manufacturer's instructions . Standard polymerase chain reactions (pcrs) typically contained approximately 30 ng cdna in a mixture of dntps (100 mol / l each), tris - hcl ph8.0 (10 mmol / l), mgcl2 (1.5 mmol / l), taq dna polymerase (1u) (applied biosystems, warwickshire, uk), and primers (figure 1) in a final volume of 25 l . All primers were used at 0.5 pcr was done using a 2720 dna thermal cycler (applied biosystems, warwickshire, uk). The primer sequences (5 to 3) were as follows: asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac primers were designed for rt - pcr according to the following criteria: (1) they flanked at least one intron; (2) they were specific for asgr1 or asgr2 transcripts, cross hybridization was not possible despite the sequence homology between the coding sequences of the two genes . N13f and n13r are, respectively, modified m13 universal and reverse sequencing primers as previously described . Underlined nucleotides are not part of asgr1 or asgr2 sequence but are tails corresponding to n13f or n13r to facilitate sequence analysis . For nested pcr, the first - round product was then diluted 10-fold with water and 1 l of diluent was used as the substrate in the second round of pcr . Pcr conditions were as follows: standard pcr: 94c for 30 s; 60c for 30 s; 72c for 1 min . Nested pcr: 1st round 94c for 30 s; 60c for 30 s; 72c for 1 min 30 s. nested pcr: 2nd round 94c for 30 s; 60c for 30 s; 72c for 1 min.routinely, 30 cycles of amplification were used; however, for real time pcr, 55 cycles were employed . Standard pcr: 94c for 30 s; 60c for 30 s; 72c for 1 min . Nested pcr: 1st round 94c for 30 s; 60c for 30 s; 72c for 1 min 30 s. nested pcr: 2nd round 94c for 30 s; 60c for 30 s; 72c for 1 min . Asgr1 and asgr2 transcript levels were measured using lightcycler faststart dna master sybr green i (roche products ltd, hertfordshire, uk) according to the manufacturer's instructions, with 3 mmol / l mgcl2 final concentration in the reaction . Reactions contained 2 ng cdna per 20 l and relevant primers (figure 1). Analyses were done in duplicate in a lightcycler ii using lightcycler v4.0 software (perkin elmer - applied biosystems, warwickshire, uk) using the following conditions: 94c for 10 min followed by 55 cycles comprising 94c for 10 s; 64c for 5 s; 72c for 10 s. pcr products were purified using the highpure kit (boehringer mannheim, nottingham, uk) and then sequenced using bigdye3.1 according the manufacturer's instructions (perkin elmer - applied biosystems, warrington, uk). Sequencing primers were either the 5 pcr primer, 3 pcr primer, n13f or n13r according to the amplification product . Sequencing reaction products were purified using qiaquick pcr purification columns (qiagen, west sussex, uk) and then electrophoresed on an applied biosystems 3130xl genetic analyser . Agarose gel electrophoresis: the analyses used 2% (w / v) gels and 1x tbe buffer (tris (90 mmol / l), boric acid (90 mmol / l), edta (1.25 mmol / l), ph 8.0); visualization was done using ethidium bromide staining and uv light . Polyacrylamide gel electrophoresis: gels comprised polyacrylamide (total acrylamide = 5%, w / v; cross link = 3.3%, w / v) and 1x tbe buffer, visualization was done using silver staining . The dna size standard pbr322/mspi (new england biolabs, hertfordshire, uk) was used for all electrophoretic analyses . Initially, peripheral blood mononuclear cells (pbmcs) were harvested and screened for asgr1 and asgr2 expression without fractionation into monocytes / lymphocytes / granulocytes . Rt - pcr of rna extracted from pbmcs demonstrated the presence of both asgr1 and asgr2 transcripts (figure 2(a)). These were also detected in the monocyte cell line thp1 (figure 2(a)). Following these initial findings, pbmcs were fractionated in order to localize the cells in which asgr1 and asgr2 expression was present . Histopaque gradients allowed separation of cells into monocytes + lymphocytes (m + l) and granulocytes + lymphocytes (g + l). These cell preparations typically contained 10% monocytes/90% lymphocytes (m + l) and 94% granulocytes/10% lymphocytes (g + l) (data not shown). Using rt - pcr, asgr1 and asgr2 transcripts were detected in rna from the m + l fraction but not in rna from the g + l fraction (figure 2(b)). These findings were reproducible for blood samples taken from 3 different individuals (data not shown). The g + l fraction did not yield a product for the transcripts even after 50 cycles of rt - pcr amplification (figure 2(b)). Some nonspecific products were obtained as a result of this high number of cycles; however, these did not interfere with the main result of the experiment (figure 2(b)). Because lymphocytes were common to both cell fractions, and because the g + l fraction was reproducibly negative for asgr1 and asgr2 transcripts, the data suggested that expression of the two genes was localized to monocytes . To confirm this, monocytes and lymphocytes were formally cell sorted using flow cytometry, rna extracted and screened using rt - pcr . Monocytes gave a positive result for both asgr1 and asgr2 transcripts, whilst lymphocytes did not give a pcr product, even after 50 cycles of amplification (figure 2(c)). This high cycle number resulted in the burst - through of some nonspecific products; however, these did not interfere with the interpretation (figure 2(c)). These data provide strong evidence for expression of asgr1 and asgr2 in monocytes but not in lymphocytes or granulocytes . The longer transcript (t1) encodes isoform a (full - length asgr1), the shorter transcript (t2) has an in - frame deletion of 117 nucleotides in the coding sequence resulting in a shorter isoform (isoform b) (figure 1(a)). The latter lacks the transmembrane domain and is secreted as a soluble protein . In the liver, t1 has been shown to be the predominant isoform, with very little t2 detectable . Using a nested pcr approach to screen rna from the m + l cell fraction of peripheral blood, different individuals showed the presence of either t1 or of both t1 and t2 (figure 3). Among the five individuals screened, none showed the presence of transcript t2 on its own . In combination with the data in figure 2 (which showed that asgr1 transcripts are detected in monocytes and not lymphocytes), these data suggest that the monocyte transcription profile for asgr1 differs between individuals . Five transcripts have been described for asgr2, giving rise to four protein isoforms (figure 1(b)). Using a rt - pcr designed to detect transcripts encoding different isoforms, the product profiles obtained for rna extracted from the histopaque m+l cell fraction differed among individuals . Two distinct profiles were obtained, the first corresponded to transcripts encoding isoforms a, b, c, and d, the second to transcripts encoding isoforms b and d only (figure 4). Asgr2 isoforms a and c can give rise to soluble protein via proteolysis between the transmembrane domain and the crd . Isoforms b and d lack the proteolysis site and cannot produce the soluble form . The data therefore indicate that in some individuals, monocytes may produce both soluble and membrane - bound asgr2, whilst in others, the soluble form is not produced by these cells . Real - time pcr was optimized for primer pairs asg1rtf + asg1rtr, asg2rtf + asg2rtr (which, respectively, amplify all asgr1 and all asgr2 transcripts) and b2mrtf + b2mrtr (which amplify the reference target gene, b2 m). For each primer pair, a specific product was obtained that had a characteristic melting curve (figure 5). Following pcr optimization, transcripts were measured using relative quantification, in which the target was asgr1 or asgr2, the reference was b2 m, the calibrator was hepg2, and the unknown was flow sorted monocytes or thp1 . B2 m is a recommended reference target for quantitative pcr, having the advantages of a single transcript, no processed pseudogene and expression at similar levels in a wide range of tissues . Flow - sorted monocytes and thp1 cells gave similar results: relative to expression in hepg2, asgr1 transcripts were between 1.53e-07 to 7.53e-06-fold less, whilst asgr2 transcripts were between 7.16e-05 and 3.78e-04-fold less . Figure 5 illustrates relative quantification of asgr1 and asgr2 transcripts in cell - sorted monocytes . The ratio of expression of asgr1: asgr2 in monocytes and the monocyte cell line thp1 was approximately 1: 100 . To ascertain whether thp1 would be a suitable cell line for future asgpr studies in monocytes, the coding sequences of the asgr1 and asgr2 transcripts produced by these cells were determined . A nested pcr strategy was used as follows: the first round of synthesis amplified the entire coding sequence plus some 5 and 3 flanking sequence and then second round pcrs amplified nested portions within the first round product . One of the nested portions contained the region that differed between transcripts and gave products of different size according to the transcript . These products were electrophoresed, excised from the gel, reamplified individually, and then sequenced, to give the sequence of each of the coding regions that differed between transcripts . Thp1 asgr1 and asgr2 transcripts corresponded with previously described splice variants found in the liver (data not shown). The findings demonstrate that thp1 cells have the capacity to transcribe and process correctly, transcripts encoding functional isoforms of the asgpr . Taken together with the results in figures 3 and 4, the data provide evidence that monocytes express correctly processed transcripts from both asgr1 and asgr2 and thereby have the potential to produce functional asgpr . The coding sequence for asgr1 in thp1 differed from the ncbi reference sequence (table 1) by a single nucleotide: c.267g> a, for which the monocyte cell line was homozygous (data not shown). This change is silent at the protein level (codon 89, aag, changes to aaa, both encoding lysine). The change is a naturally occurring variant (rs55714927) listed in the international snp database (dbsnp). The thp1 asgr2 coding sequence for any transcript did not differ to the corresponding ncbi reference sequence (table 1) (data not shown). In this study, expression of asgr1 and asgr2 was demonstrated in peripheral blood monocytes . For both genes, transcript profiles were obtained that corresponded with known splice variants found in the liver . To the best of our knowledge, this is the first report of the expression of correctly processed transcripts of asgr1 and asgr2 by human monocytes . In rat, a transcript encoding an asialoglycoprotein - binding protein was isolated from a peritoneal macrophage cdna library and was highly homologous to that of the rodent hepatic asgpr . The data were interpreted to indicate that the rodent macrophage asialoglycoprotein - binding protein and the liver asgpr were encoded by related genes; however, it now seems possible that alternative splicing may underlie the differences . The findings of the present study do not suggest expression of alternative asgpr - related genes in monocytes, rather they are entirely consistent with transcription of asgr1 and asgr2, as occurs in the liver . The various transcripts of asgr1 and asgr2 encode different isoforms of the proteins (figure 1). It is not known whether the isoforms differ in their specificity or functionality, however it is predicted that certain isoforms have the potential to give rise to soluble forms of each protein . Asgr1 transcript t2 has an in - frame deletion of 117 bp that encode the transmembrane domain; the resulting isoform, th2 and t3 encode isoforms a (t1 and th2') and c (t3) which contain a proteolysis signal that, upon cleavage, gives rise to soluble protein . Transcripts t2 and t4, respectively, encode isoforms b and d which lack the proteolysis signal and are membrane bound . The data presented here indicate that monocytes are able to express transcripts encoding soluble and membrane - bound isoforms of the asgpr proteins . Asgr2 was found to give rise to two transcript profiles, only one of which was present in the monocytes from any given individual . One profile corresponded with transcripts encoding both soluble and membrane - bound asgr2 isoforms (a, b, c, and d), the other with membrane - bound asgr2 isoforms (b and d) only . This novel finding indicates a fundamental difference between individuals . The underlying basis for this and whether or not it has physiologic significance in health or disease merit further exploration . The level of asgr1 and asgr2 expression was considerably less in monocytes and the monocyte cell line thp1 compared with the liver cell line hepg2 . It should be borne in mind that hepg2 expresses high levels of the receptor and the monocyte expression was relative to this . That monocyte transcripts were not rare within the cells was indicated by the fact that they were readily detected using rt - pcr at routine cycle numbers . Low level of expression of the asgpr has been reported previously in certain nonhepatic tissues (rat macrophages, human intestinal epithelial cells, mouse testis, and rat thyroid gland). It would be relevant to explore whether asgr1 and asgr2 transcription alters upon monocyte activation . The relative expression of asgr1 and asgr2 in monocytes and thp1 (1: 100) differed notably from ratios reported in liver (1: 2 and 1: 6). The difference may be real, or it may reflect differences in methodology between studies or possibly a difference in the amplification efficiency of the primer pair used for asgr1 compared with that used for asgr2 . The true relative expression of the two genes by monocytes therefore remains to be established . An important question arising from these results is whether monocytes translate asgr1 and asgr2 transcripts and produce functional asgpr . The restricted expression of the genes in monocytes, but not in lymphocytes or granulocytes, suggests the transcripts are not produced randomly but specifically . Based on the fundamental principles of biology, this is likely to be for translation, it is difficult to think why else different transcripts encoding different isoforms may be produced by one specific cell type in the blood . The restricted tissue specificity for asgpr expression in the body, and the lower expression level observed at the nonhepatic locations, could signal a specific role or function at those sites . In the case of monocytes, the receptor could, at the very least, serve a scavenger function where there is infection or tissue injury . Expression of correctly processed transcripts of asgr1 and asgr2 by circulating monocytes has potentially significant implications in several important areas . If monocytes express functional asgpr, they may contribute towards the normal physiological processes undertaken by the hepatocyte receptor . Whilst hepatocyte asgpr is localized to the liver and relies upon the circulation to deliver ligands to it, the monocyte receptor would represent a mobile pool that can reach ligands in most parts of the body . Monocyte asgpr may additionally interact with ligands in the blood, as does liver asgpr . Thus, the monocyte receptor, if it is produced, may overlap functionally with that of the liver but may have additional physiological roles elsewhere in the body . Hepatic asgpr has been shown to be directly involved in the normal turnover of an important protein of primary hemostasis, vwf . Studies in knock - out mice indicated that the asgpr is engaged in the constitutive control of vwf level and can, additionally, remove hemostatic components (vwf and platelets) desialylated by bacterial neuraminidase, a possible survival mechanism in disseminated intravascular coagulation . The results in these studies were ascribed to the activity of the liver receptor; however, our data raise the possibility that monocytes may contribute to the relevant physiological processes via the asgpr . The findings have implications for the design of drugs targeting the liver via the asgpr and drugs that are cleared by this receptor [29, 30]. Various strategies have been used, for example, conjugation of drug with galactosyl terminating molecules, as has been done with antiviral nucleoside analogues in the treatment of chronic viral hepatitis . Besides drug targeting, strategies to deliver genes or other nucleic acids to the liver have also made use of the asgpr [1012]. Relatively recently, successful in vivo delivery of sirnas to the liver in mice has been achieved via simple intravenous injection employing asgpr - specific conjugates containing galnac . Pharmacological targeting of the asgpr could not be considered to be predominantly liver - specific if monocytes express the receptor . Asgr1 and asgr2 are expressed in peripheral blood monocytes in humans . For both genes, monocytes have the ability to produce correctly spliced transcripts encoding each of the known protein isoforms . However, there are interindividual differences in the transcript profiles; of particular note, despite several possible asgr2 transcripts, just two combinations were found to occur . This observation indicates that, in any given individual, asgr2 mrna splicing is restricted to one of two profiles . Quantitative studies indicate that expression of both asgr1 and asgr2 is lower in monocytes than in the liver, but none - the - less is readily detected in monocytes (in comparison to other blood cells in which expression could not be demonstrated). The liver may represent a static site to which blood carries glycoconjugates for asgpr - mediated removal, whilst monocytes may represent a mobile pool that can reach sites where the activity of the receptor is needed . The data presented here open various important avenues for future research, a notable one of which is the measurement and characterization of monocyte asgpr protein . The results for the cell line thp1 indicated it could be used as a model system for the investigation of monocyte aspgr function and activity . Monocytes play a pivotal role in inflammation and immunity, the finding of asgpr transcripts within these cells offers new insight into their biochemistry and functional potential.
The prevalence of obesity in the united states has increased over the past several decades . According to the national health and nutrition examination survey (nhanes) results, between the years of 1988 and 1994, 22.9% of adults aged 20 years and older exceeded the criteria for adult obesity [body mass index (bmi) 30 kgm] (17). By the 20112012 survey, that percentage had increased to 35.1% (19). This represents more than a 50% increase in obesity prevalence among american adults aged 20 years and older over the course of two decades . Perhaps more concerning is the prevalence of obesity among american youth, defined by the centers for disease control and prevention (cdc) as a bmi greater than or equal to the 95 percentile on the cdc growth charts (2). Among children and adolescents aged 2 19 years, the prevalence of obesity increased from 5.5% between the years of 1976 and 1980 to 16.9% between 2007 and 2008 (18) and remained 16.9% between 2011 and 2012 (19). Analyses of several large - scale data pools confirm that obesity contributes to the risk for development of many negative health outcomes including coronary heart disease, hypertriglyceridemia, hypercholesterolemia, hypertension, and type ii diabetes (20, 23). Using secondary data, thompson and colleagues developed a model to analyze the relationship between bmi and several disease conditions in adults (23). Notably, they found that the risks for hypertension and type ii diabetes are at least 2- and 3-fold higher for obese individuals with bmi values of 32.5 kgm and 37.5 kgm, respectively, as compared to normal - weight individuals with bmi values of 22.5 kgm . Obesity - related health risks are not limited to adults . According to an analysis of bogalusa heart study data, the odds ratios between childhood obesity and many cardiovascular disease risk factors, including hypercholesterolemia, hypertriglyceridemia, hyperinsulinemia, and hypertension are between 2.4 and 12.6, indicating a strong, positive association between childhood obesity and these specific risk factors (8). Finkelstein and colleagues estimated that in 2006, the annual per capita medical expenditure for an obese person was $1,429 (adjusted to reflect 2008 dollars) higher than for a person of normal weight, which represents 42% higher medical costs for obese individuals compared to individuals with normal body weights (5). Data from over 3,000 counties and county equivalents across the united states indicate that in 2006, approximately 54 million individuals met the criteria for obesity (16). This equates to an extra $77 billion (adjusted to reflect 2008 dollars) in medical spending attributable to obesity in 2006 alone . Beginning in the 2013 2014 school year, the president s council on fitness, sports & nutrition adopted the presidential youth fitness program to replace the president s challenge physical fitness test (22). This program aims to encourage healthy, active lifestyles among youth . As part of this program, schools use the presidential youth fitness program s fitnessgram to assess health - related fitness and use these data to inform physical education instruction . The fitnessgram scientific advisory board has developed four categories for classification of body composition: very lean, healthy fitness zone (hfz), needs improvement some risk (ni sr), and needs improvement high risk (ni hr). Risk level was established based on body fat percentage, and body fat cutoff percentages were converted to corresponding bmi values . For ten - year olds, the ni hr category includes boys with a bmi 20.8 kgm and girls with a bmi 21.0 kgm (12, 13, 15). These bmi cutoff values are lower than those utilized by the cdc, which defines childhood obesity as having a bmi at or above the 95 percentile on sex - specific bmi - for - age growth charts (2). The corresponding bmi values that the cdc uses to indicate obesity are 22.03 kgm for boys aged 10.00 10.49 years, 24.16 kgm for boys aged 10.50 10.99 years, 23.18 kgm for girls aged 10.00 10.49 years, and 23.35 kgm for girls aged 10.50 10.99 years (11). Thus, using the cdc childhood obesity estimates could result in a substantial underestimation of the number of children at risk for negative health outcomes based upon bmi . Children identified as obese by bmi have an increased risk of developing health complications that were previously thought to be limited to adults such as hypertension and type ii diabetes mellitus (3). These conditions are also well - known risk factors for the development of cardiovascular disease . Obese children aged ten years and older are likely to remain obese into early adulthood (28), and therefore, accrue medical costs associated with obesity - related conditions . Knowledge of the medical costs associated with childhood obesity can provide a basis by which to justify the cost of childhood obesity prevention and treatment efforts . To this end, finkelstein and colleagues analyzed the lifetime direct medical costs for an obese ten - year - old beyond the costs that a ten - year - old at a normal body weight would incur over his or her lifespan (7). The six investigations included in the meta - analysis each estimated longevity using a variety of factors such as probability of survival based on weight status (6), gender, and race (4, 14, 2325, 27). Based upon this meta - analysis, two low- and high - end cost estimates were provided: one that accounted for adulthood weight gain among normal - weight children and one that compared against children who remained at normal weight through adulthood . Results suggested that an obese ten - year - old, typically in the fifth grade, will incur between $12,660 (low - end; recommended) and $19,630 (high - end) of incremental direct medical costs when accounting for weight gain through adulthood and between $16,310 (low - end) and $19,350 (high - end) with a recommended cost estimate of $19,000 when contrasted with a child who remains at normal weight throughout adulthood (4, 7, 14, 23, 24, 27). Using these recommended estimates along with results from the fitnessgram body composition classifications, the purpose of this analysis is to estimate the lifetime economic impact of childhood obesity for this single age cohort in the two most populous states, california and texas . Fitnessgram data from the school years 20102011, 20112012, and 20122013 were obtained for california (1) and texas (21). These data were school - level and included boys and girls from all public school districts in these two states . The total number of fifth grade students tested for bmi in california and in texas and the number of fifth grade students in each bmi category were calculated for each of the three school years . The fitnessgram scientific advisory board has determined that bmi values at or above 20.8 kgm for ten - year - old boys and 21.0 kgm for ten - year - old girls represent high health risk (15). The california report included the total number of fifth graders tested for body composition as well as the number and percentage of students in each fitness zone . The texas report included data for each grade level and further separated the data by district and gender . The total number of fifth graders tested for body composition and the number and percentage of students in each fitness zone were calculated using excel . Then, using the low, high, and recommended cost estimates suggested by finkelstein and colleagues (7), the lifetime direct medical costs attributable to obesity were calculated for students in the ni hr category for each of the three school years in california and in texas by multiplying the number of students in this category by the corresponding cost estimate per obese student the first set of estimates compared the direct medical costs for obese children against the direct medical costs for normal - weight children who gain weight as adults . The second set of estimates compared the direct medical costs for obese children against the direct medical costs for normal - weight children who remain at normal body weight as adults the results reflect the lifetime direct medical costs attributable to obesity for each fifth grade cohort over the three - year period in california and texas . The analysis used the costs estimated for a ten - year - old obese child; however, it should be noted that students in the fifth grade range from ages 911 . The percentage of fifth grade students with bmi values in each category remained stable from the 2010 2011 school year through the 2012 2013 school year within each state (see table 1). Just over half of fifth graders in each state were identified as having bmi values in the hfz, whereas at least one - third of fifth graders in each state were identified as having bmi values in the ni hr for bmi, and in texas, between 36.5 and 36.8 percent of students were categorized as ni hr for bmi during this timeframe . Despite their geographical distance from one another, california and texas had comparable percentages of students in each category for each of the three school years . Hr zone for each year in each state was multiplied by the estimated per capita lifetime direct medical costs of obesity previously established by finkelstein and colleagues (7). The resulting values represent the low, high, and recommended statewide lifetime costs of obesity for the ten - year - old cohorts accounting for adulthood weight gain (see table 2) and compared to children who maintain normal weight as adults (see table 3). Using the presidential youth fitness program s fitnessgram body composition data, results indicate that in each of the two most populous states, childhood obesity for each cohort of fifth graders over the 3-year timeframe will cost between $1.4 and $3.0 billion (compared to normal - weight children who become overweight as adults) and $1.8 and $3.0 billion (compared to normal - weight children who remain at normal weight as adults) beyond the direct medical expenses for children of normal weight who remain at normal weight throughout adulthood . These results represent the costs solely for fifth graders in california and texas and not the additional accrued expenses for children of other ages as finkelstein and colleagues only estimated costs for the ten - year - old age group (7). Additionally, these values represent only the direct medical costs and not indirect costs, such as absenteeism, which would result in higher estimates . Throughout the three years for which data were analyzed, the number of fifth graders who presented with bmi values in the ni this underscores the need for the development of effective childhood obesity prevention and reduction efforts . Fitnessgram results indicate that on average, 33.9% of fifth graders in california and 36.7% of fifth graders in texas have bmi values that place them at high risk for problematic health outcomes . The number of ten - year - olds in the us population was just over 4 million on july 1 each year from 2010 to 2012 (26). If the percentage of fifth graders with bmi values in the ni hr category in california and texas were extrapolated to the us population of ten - year - olds, this results in a potential lifetime economic burden of approximately $17 billion (accounting for adulthood weight gain) or $25 billion (not accounting for adulthood weight gain) in direct medical costs beyond that of individuals at a healthy weight for each single - year age cohort . In contrast to these findings, nhanes data from 2011 2012 indicate that 17.7% of children aged 6 11 were classified as obese by bmi according to the cdc standards (19). Using this obesity estimate along with recommended cost estimates, the increased lifetime economic burden of obesity would be approximately $9 billion (accounting for adulthood weight gain) or $13.5 billion (not accounting for adulthood weight gain) in direct medical costs for each single - year age cohort . This discrepancy might be partially due to the method used for the determination of childhood obesity . The cdc defines obesity for youth ages 2 19 as having a bmi greater than or equal to the 95 percentile on sex - specific bmi - for - age growth charts (2). Using this method, the minimum bmi values that indicate obesity are 22.03 kgm for boys aged 10.00 10.49 years, 24.16 kgm for boys aged 10.50 10.99 years, 23.18 kgm for girls aged 10.00 10.49 years, and 23.35 kgm for girls aged 10.50 10.99 years (11). The bmi values that indicate childhood obesity per the cdc method are higher than those utilized in the fitnessgram to indicate high risk of excess adiposity - associated health problems . The fitnessgram scientific advisory board has identified body fat percentages that correspond with increased metabolic syndrome and cardiovascular disease risk factors in children and calculated the associated bmi values (9, 13). These bmi values, 20.8 kgm for ten - year - old boys and 21.0 kgm for ten - year - old girls, were identified as the cutoff values for high - risk bmi (15). Meta - analysis conducted by javed and colleagues suggests that the cdc bmi standard to determine childhood obesity status compared to reference measures of adiposity defined as a high body fat percentage (i.e., dual - energy x - ray absorptiometry scan, hydrostatic weighing, or air - displacement plethysmography) is highly specific (pooled specificity = 0.93) but less sensitive (pooled sensitivity = 0.73) and thus might fail to detect excess body fatness in over 25% of cases (10). Therefore, the lower bmi cutoff values used to determine high - risk bmi in the fitnessgram will increase the sensitivity of the childhood obesity estimate . While the fitnessgram is a useful tool to help identify children who are at increased risk based on bmi and researchers can use this information to estimate the economic impact of obesity, a limitation of this study is that fitnessgram results were not available for many states . Is administered to students nationwide as part of the presidential youth fitness program, more data will become available and more rigorous analysis should be performed on nationwide data . However, the current analysis uses data from the two most populous states in the union and underscores the large economic impact of childhood obesity . Using bmi data from the presidential youth fitness program s fitnessgram over a three - year timespan and the estimated lifetime direct medical costs associated with obesity as recommended by finkelstein and colleagues (7), results indicate that the estimated lifetime medical costs of childhood obesity in the two most populous states, california and texas, are between $1.4 and $3.0 billion for each single - year age cohort analyzed . This information can be used to encourage spending, resource development, and prevention program implementation to reduce obesity in these two states . Further analyses should be conducted to estimate the economic burden associated with childhood obesity using the criterion - referenced fitnessgram bmi standards across the united states when data are available.
Brown tumor is a non - neoplastic giant cell lesion characterized by increased circulating levels of parathyroid hormone (pth). It is usually an uncommon lesion occurring with the frequency of 4.5% in primary hyperparathyroidism (hpt) and 1.5 - 1.7% in cases of secondary hpt, with overall incidence of 0.1% . Hpt can be classified into: primary, which occurs due to hyperplasia, benign or malignant neoplasm of one or more parathyroid gland . Secondary hpt is caused as a result of hypocalcemia, vitamin d deficiency or secondary to chronic renal insufficiency, which acts as a stimulus for pth production . Tertiary hpt is associated with renal failure and autonomous functioning glands in long - standing secondary hpt cases . The fourth type of hpt has been recognized, which occurs due to increased pth levels synthesized in patients with malignant diseases . We report an interesting and rather unique case of a brown tumor of maxilla and mandible developing after acute exogenous thyroxine poisoning in a young female patient under treatment for hypothyroidism and ectopic intrathoracic parathyroid adenoma . A 23-year - old female reported to our department with the chief complaint of a swelling on the left side of the lower jaw for past 4 months producing facial asymmetry . Patient was a known hypothyroid and was under exogenous levothyroxine (l - thyroxine) therapy for the past 3 years . She gave history of l - thyroxine poisoning (approximately 4000 mcg stat dose) 4 months back after which she developed rapidly growing swelling on the left side of the jaw . Extraoral examination revealed the presence of a well - circumscribed expansile swelling in the left mandibular body region measuring 5 cm 4 cm, which was hard, non - tender and non - mobile without any surface changes . Intraorally, obliteration of buccal vestibule on the left side with intact normal mucosa was seen . No mobility, loss of vitality or tenderness was elicited with any teeth in the left quadrant . Biochemical assay and blood analysis revealed an increased value of serum alkaline phosphatase (420 u / l; normal range: 100 - 172 u / l), serum pth (370.40 pg / ml; normal range: 50 - 300 pg / ml) and serum calcium (13.3 mgs / dl; normal range: 8.5 - 11.0 mg / dl). The serum phosphorus level was decreased (2.4 mg / dl; normal range: 2.7 - 4.5 mg / dl). Cone beam computed tomography (ct) scan of the facial region revealed a well - defined soft tissue lesion within the left body of the mandible of approximately 3.5 cm 2.8 cm [figure 1a and d]. It also represented well - defined hypodense lesions in relation to the right body of the mandible measuring 2.5 cm 1.0 cm [figure 1d] and anterior maxilla, measuring 3.5 cm 3.6 cm [figure 1b]. There was also lytic lesion on the left side skull bone with generalized reduction in bone density [figure 1c]. A full body skeletal survey was also performed, which revealed no such lesions in long bones . (a) computed tomography scan (axial section) showing well - defined soft tissue lesion within the left body of the mandible . (d) 3d reconstruction showing bilateral lytic lesion within the body of the mandible and generalized reduction in the bone density (arrow indicating the lesion) ultrasound of neck failed to reveal any pathology in thyroid and parathyroid glands . To further assess the parathyroid gland status tc sestamibi - spect parathyroid scintigraphy was carried out, which demonstrated relatively prominent flow of activity toward left submandibular salivary gland region . Abnormal ovoid region of intense tracer concentration in the anterior mediastinum in right paratracheal region was noted . The findings were suggestive of ectopic (intrathoracic) parathyroid gland with neoplastic changes in left submandibular salivary gland region [figure 2a]. (a) tc sestamibi - single photon emission computed tomography parathyroid scintigraphy image showing intense tracer concentration in right paratracheal region and left submandibular region . (b) computed tomography scan (axial section) showing well defined mass in intrathoracic prevascular space ct scan of the chest was taken, which revealed a moderate size nodular lesion showing heterogeneous enhancement in right prevascular space measuring 3.0 cm 2.4 cm [figure 2b]. The history, biochemical values and imaging reports corroborated with the clinical features of the brown tumor of hpt associated with pathologic ectopic parathyroid gland . An incisional biopsy of the mandibular lesion was performed under local anesthesia that revealed fibro collagenous tissue containing plenty of osteoclastic giant cells dispersed throughout the lesion with small fragments of reactive bone, the features consistent with reparative giant cell granuloma . Thoracotomy was carried out and ectopic intrathoracic parathyroid gland was excised [figure 3a]. A combination of sharp and blunt dissection was used to excise the mass and it was delivered per oral in total [figure 3b]. Post - operative serum calcium level was 10.6 mg / dl and pth level 11.90 pg / mg . Intra - operative view of (a) ectopic parathyroid gland . (b) left mandibular lesion the intrathoracic mass and mandibular specimen was sent for histopathological examination . The intrathoracic mass revealed parathyroid neoplasm suggestive of atypical parathyroid adenoma [figure 4a]. The mandibular lesion presented a giant cell proliferation in the background of a variably fibrotic stroma . The giant cells were arranged in sheets with little intervening spindle cell stroma . At the periphery osteopenic bone trabecule these features were suggestive of brown tumor of hpt [figure 4b]. (a) histopathological section of mandibular lesion showing giant cell proliferation with variable areas of haemorrhage and hemosiderin deposition (h and e, 20). (b) histopathological section of parathyroid neoplasm composed of nuclear pleomorphism with cystic changes, suggestive of parathyroid adenoma (h and e, 20) pth plays a key role in calcium and phosphate balance between extracellular fluid and bones . Brown tumor is relatively an uncommon lesion associated with hpt, which results in an abnormal osteoclastic and osteoblastic activity resulting in resorption and fibrous replacement of the bone . Brown tumor is more commonly found in ribs, clavicles, pelvis, femur and facial bones . In craniofacial region mandible radiographically, this lesion appears as well - defined unilocular or multilocular radiolucencies causing cortical plate expansion and often thinning of the cortical plates . The density of jaw is decreased due to generalized demineralization of the medullary bones along with change in trabecule pattern giving a mixed radiopaque - radiolucent appearance . Brown tumor mimics giant cell lesions and it can be distinguished from the latter based upon the clinical history and biochemical profile of the patient indicating hpt . Due to overlapping clinical and radiological features, patients presenting in maxillofacial department with suspected giant cell lesion should undergo biochemical assay to rule out hpt . Other differentials to be included are cherubism, aneurysmal bone cyst, paget's disease, langerhans cell histiocytosis, osteosarcoma and osteomyelitis . Histopathologically, brown tumor reveals multinucleated giant cells in a background of spindle cell proliferation along with a large amount of hemosiderin deposition, vascularity and hemorrhage giving brown appearance to this lesion . The most interesting aspect of this case report is association of brown tumor with ectopic intrathoracic parathyroid gland with normal functioning anatomic parathyroid glands . Ectopic parathyroid glands are uncommon, mainly arising due to abnormal migration of parathyroid tissue during embryogenesis . It has been reported that in almost 16% cases of hpt, ectopic parathyroid glands are present, which may often go unnoticed and are a cause for failed parathyroid exploration . The uniqueness of the case is further defined by its occurrence at a very young age (23 years) along with its bilateral presentation with simultaneous involvement of maxilla, mandible and skull bones in a brief period . This patient was hypothyroid, under thyroxine therapy for past 3 years with an episode of acute poisoning of l - thyroxine before the onset of swelling of the jaw . The routine biochemical examination of patient taken 3 months prior to the onset of swelling revealed normal serum calcium and phosphorus levels and hypothyroid state . Unfortunately, consultant endocrinologist and physicians failed to observe any relation between the hyperparathyroid state of the patient and exogenous thyroxine . To best of our knowledge, no case of brown tumor of hpt with such aggressive behavior and wide spectrum of clinical findings associated with acute thyroxine ingestion has been reported in the past . Hence, we assume that either bolus toxic dose of thyroxine or chronic state of hypothyroidism has caused a high pth and serum calcium levels resulting in a hyperparathyroid state causing bone remodeling events in the craniofacial region . Few authors have reported that prolonged thyroid - stimulating hormone (tsh) stimulation may lead to hpt or a state of hpt in hypothyroidism and vice versa . This case report establishes a credible support for this hypothesis and brings out a definite correlation between tsh inhibition and onset of hpt . The treatment of brown tumor mainly focuses on correction of the underlying disorder and maintenance of normal pth and serum calcium levels . Use of systemic or intralesional corticosteroid have been reported to reduce the size of the lesion . Long - term follow - up of such lesion is mandatory as variable clinical behavior of the lesion following normalization of the pth and serum calcium levels has been reported . We have also adopted a similar protocol with surgical excision of the pathological ectopic parathyroid gland and mandibular tumor, which was causing severe disfigurement of the patient's face . Pth and serum calcium levels were found to be normal within 3 days after surgery . Follow - up radiographs of the patient has revealed marked regression in the craniofacial lesions . Ultra sonographic scan, ct scan and full body skeletal survey in conjunction with complete biochemical analysis can be carried out to assess the pathological parathyroid gland and extent of lesions in long bones . Latest imaging techniques such as tc - sestamibi scan and fluorine - fluorodeoxyglucose - positron emission tomography / ct have been proved to be an effective and useful diagnostic modality in assessing location and functioning of parathyroid glands . Our patient represents a rare case of brown tumor with a wide spectrum of associated clinical findings . In conclusion, the management of the brown tumor should involve early diagnosis, complete biochemical assay and full body skeletal survey followed by normalization of pth, serum calcium and phosphorus levels and parathyroidectomy, if indicated . In the absence of any pathology of anatomic parathyroid this case emphasizes the need for periodic biochemical investigations in the hypothyroid patients on exogenous thyroxine therapy.
During april october 2009, bird bandings were conducted in the protected area of finca ribavellosa in la rioja, spain (4214n, 254w). Ticks were collected from birds and classified through taxonomic keys (7) and molecular methods (8). Dna was individually extracted by using 2 incubations of 20 minutes each with ammonium hydroxide (1 ml of 25% ammonia and 19 ml of milli - q water that had been autoclaved) at 100c and 90c . Dna extracts were used as templates for pcrs targeting fragment genes for tick classification and for bacteria detection (table 1). Two negative controls, 1 containing water instead of template dna and the other with template dna but without primers, and a positive control (a tick extract, a. phagocytophilum, b. burgdorferi sensu stricto, or r. slovaca) were included in all pcrs . Amplification products were sequenced, and nucleotide sequences were compared with those available in genbank by using a blast search (www.ncbi.nlm.nih.gov/blast/blast.cgi). Phylogenetic and molecular evolutionary analyses were conducted by using mega4 (16 in technical appendix)., reference; msp, p44 major surface protein gene; flab, flagellin gene; ompb, 120-kda genus common antigen gene; ompa, 190-kda protein antigen gene; glta, citrate synthase gene . R = a / g; w = a / t . A total of 222 ticks belonging to the species haemaphysalis punctata (n = 1), ixodes frontalis (n = 7), i. arboricola (n = 26), i. ricinus (n = 181), and other ixodes spp . Two nucleotide sequences for the 16s rrna fragment gene of i. arboricola ticks were recorded (genbank accession nos . Jf791812 and jf791813) (table 2). * l, larva; msp, p44 major surface protein gene; n, nymph; flab, flagellin gene; 5s-23s is, 5s-23s rrna intergenic spacer; ompb, 120-kda genus common antigen gene; ompa, 190-kda protein antigen gene; glta, citrate synthase gene . A. phagocytophilum was detected only in 1 larva of an i. ricinus tick (0.5%). The most prevalent genospecies was b. garinii (n = 19), which was detected in i. ricinus (n = 16), h. punctata (n = 1), i. frontalis (n = 1), and ixodes sp . B. valaisiana was amplified in 9 samples (8 i. ricinus and 1 ixodes sp . R. monacensis (n = 1), r. helvetica (n = 1), r. sibirica sibirica (n = 1), and rickettsia spp . Furthermore, according to glta, ompa, and ompb sequence analysis, a possible new rickettsia sp . Was found in 25 i. arboricola ticks and 2 i. ricinus ticks . For these 27 samples, highest identities with r. heilongjiangensis (97.1%) and r. japonica (99.1%) were found for ompa (genbank accession no . Jf758826) nucleotide sequences, respectively, whereas glta nucleotide sequences were identical to those from both rickettsia spp . According to multilocus sequence typing (data not shown) and genetic criteria agreed on by experts, a candidatus status could be assigned . We named it candidatus rickettsia vini (17 in technical appendix) (table 2). (figure). The phylogenetic position of candidatus rickettsia vini based on the ompa nucleotide sequences in a study of the role of birds in dispersal of etiologic agents of tick - borne zoonoses, spain, 2009 . The percentage of replicate trees in which the associated taxa clustered in the bootstrap test (1,000 replicates) is shown next to the branches . The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree . The evolutionary distances were computed by using the kimura 2-parameter method and are in the units of the number of base substitutions per site . The presence of anaplasma, borrelia, and rickettsia species in ticks removed from passerine birds corroborates the role of these vertebrates in the epidemiology and dispersion of tick - borne pathogens in spain and in other zones of the planet . Some of the parasitized birds in our study, such as the european robin (erithacus rubecula) or eurasian blackcap (sylvia atricapilla), are considered migratory or partial migratory birds . In addition, these species share an ecologic niche and ectoparasites (horizontal transmission) with other migratory birds that cover long distances from africa to the eurasian region . Except for i. arboricola, the tick species captured in this study previously had been found on birds in spain (18 in technical appendix). The high prevalence of i. ricinus ticks was expected because it is the most frequent tick in this area, and the immature stages of this tick frequently parasitize birds . I. ricinus ticks are the main vectors of a. phagocytophilum in europe, and this microorganism has been detected on vegetation in the studied area (1). However, the low prevalence (0.5%) of a. phagocytophilum in the ticks in our study corroborates data from other studies (19,20 in technical appendix). The presence of a. phagocytophilum in a larva in our study supports the role of birds as reservoirs of a. phagocytophilum . The prevalence (13.1%) of b. burgdorferi in our samples is similar to prevalences reported in other studies in europe in which i. ricinus is the main species of tick captured from birds (19 in technical appendix). In spain, b. garinii, b. valaisiana, and b. afzelii have been detected in ticks from birds (18 in technical appendix). According to our data, the human pathogen b. garinii was the most prevalent species, as reported in birds from europe (21 in technical appendix). Although it has been recently detected in ticks from birds in norway (22 in technical appendix), its finding in spain was unexpected . Regarding rickettsia species, r. monacensis and r. helvetica are among the human pathogens detected in our study . Both species have been identified in ticks from birds in europe (19,20,23 in technical appendix). On the contrary, candidatus rickettsia vini, a potential new rickettsia species, also detected in our study, has not been related to human disease (17 in technical appendix). Several genospecies closely related to r. heilongjiangensis and r. japonica have been identified in ixodes spp . R. sibirica sibirica, responsible for siberian tick typhus in western people s republic of china and in siberia, was also amplified in an i. ricinus larva in this study . Our data confirm the involvement of birds in the cycle of human tick - borne diseases.
Korea became an aging society in 2000, and in 2008, the prevalence of individuals aged 65 years or older was 10.3% . In 2018, korea will become an aged society when 14.4% of its population comprise the elderly, and a super - aged society by 2026 [1, 2]. To overcome this situation, the korean government introduced a new social insurance scheme for long - term care (ltc) in july 2008 . The ltc insurance program provides social services for elderly people with a few functional limitations . The purpose of this insurance system was to meet the markedly increased demand for elderly healthcare as a result of a rapidly aging population, elevated expectations for healthcare, and a change in the pattern of medical conditions in the elderly from acute illness to chronic disability . This insurance uses the ltc grade for denoting how much help is required for an elderly person in their daily lives . After the implementation of ltc insurance, the number of nursing facilities in korea also increased sharply from 1717 locations (68,581 people) in 2008 to 3751 locations (116,782 people). Researchers have documented the widespread incidence of inappropriate medication use in elderly persons and reported an estimated prevalence from 4.8 to 45.6% [511]. The proper use of medicines and monitoring for adverse effects are important factors in the treatment of elderly patients . Aging is associated with a reduction in first - pass metabolism and therefore an increase in the bioavailability and distribution of drugs, which increases the risk of adverse effects; these risks grow exponentially when a number of different drugs are used . Because of the potentially serious consequences of exaggerated or incorrect prescriptions, screening tools have been created to detect inadequacies in drug prescriptions . In 2012, the american geriatrics society (ags) and an interdisciplinary panel of experts in geriatric care and pharmacotherapy reached a consensus on the 2012 ags beers criteria . Fifty - three medications or medication classes encompass the final updated criteria, which are divided into three categories: potentially inappropriate medications (pims) or classes to avoid in older adults; pims or classes to avoid in older adults with certain diseases and syndromes that the listed drugs can exacerbate; and medications to be used with caution in older adults . Elderly nursing home residents regularly receive complex multi - drug therapy because of the presence of both acute and chronic diseases . For this reason, there have been few reports dealing with the prevalence of pim prescriptions or their adverse effects on elderly patients in south korea [14, 15]. To our knowledge, there have been no reports on the prevalence of pim prescriptions in south korea ltc facilities using the 2012 version of the beers criteria . Hence, we evaluate the frequency of inappropriate medication use in elderly patients admitted to nursing homes in korea by applying the newly revised 2012 ags beers criteria . A retrospective cross - sectional survey study was performed in patients aged 65 years or older, which produced a sample of 824 people admitted to 20 nursing facilities in northwest korea from january 2012 to february 2012 . We excluded four patients who did not take any medications, 259 patients with incomplete medical records, and 32 patients who were not included in any ltci programs . We assessed the patients age, sex, co - medication, comorbidity, activities of daily living (adl), length of stay, grade of ltc insurance for seniors, and the bed size and business type of the ltc care facilities . The ltc grade is based on standards of five areas of physical functions (adl), cognition, behavioral changes (behavioral problems), demand on nursing care, and need for rehabilitation, and judgment standards made in consideration of service necessary according to the state of functions . On a checklist with a maximum score of 100, a score of 55 and over makes an individual eligible for insured care . Categories of ltc grade are defined as follows: grade 1 (most severe)the elderly person has one of the following handicaps: he or she cannot go to or get out of bed unaided; experiences behavioral difficulties, impaired judgment, and frequent memory loss as a result of severe brain injury; or completely needs full assistance with all the activities of daily life and records a ltc acknowledgment score of at least 95; grade 2 (severe)the elderly person cannot eat, defecate nor dress themselves unaided; has impaired judgment and memory loss due to dementia; needs considerable help in moving or moving in a wheelchair; spends most parts of daily life in bed and records an ltc acknowledgment score of at least 75 but less than 95; grade 3 (moderate)the elderly person partially needs considerable ltc protection; some degree of help for eating, dressing / undressing, using the toilet, looking after himself or herself, performing household tasks, and performing their everyday activities outside the home; and records an ltc acknowledgement score of at least 55 but less than 75; no grade (mild)the elderly person needs some help in one or two activities of daily life, including bathing and dressing / undressing and records an ltc acknowledgment score of less than 55 . Prescriptions were assessed for the use of pims according to the 2012 ags beers criteria . We focused on evaluating 34 pims to avoid in older adults and one of the categories in the 2012 update to the ags s beers criteria . Drug disease interactions and drugs to be used with caution in geriatric patients were also assessed using the beers criteria . Anti - cholinergics include brompheniramine, carbinoxamine, chlorpheniramine, clemastine, cyproheptadine, dexbrompheniramine, dexchlorpheniramine, diphenhydramine (oral), doxylamine, hydroxyzine, promethazine, and triprolidine . Cardiovascular medications include alpha blockers, alpha agonists, guanabenz, guanfacine, methyldopa, reserpine (> 0.1 mg / day), anti - arrhythmic drugs (class ia, ic, iii), and amiodarone . Central nervous system drugs include tertiary tricyclic antidepressants, antipsychotics, barbiturates, and benzodiazepines . We calculated the descriptive statistics to illustrate characteristics of the study population by comparing persons on pims with those not on pims . The distributions of baseline descriptive statistics are expressed as proportions and means with standard deviations . In the case of categorical variables, cross - tabulations with chi - square tests were used in comparing the differences . For continuous variables, the statistically significant difference in means was determined by the independent t test . Concurrent pim use was defined as the number of pim prescriptions within an individual incidence year . Logistic regression analysis was performed to identify the risk factors for pim exposure where pim use (0 or 1) was the dependent variable and the independent variables included age, sex, adl, length of stay, number of comorbidities, number of co - medications, and grade of ltc insurance . Use of pims has been consistently associated with female sex, higher number of medications, higher number of chronic diseases, and older age [1621]. All statistical analyses were performed using spss 18.0 for windows (spss inc ., chicago, il, usa). This study recruited 529 patients; 221 of these did not use a pim, while the remaining 308 patients were currently taking pims . Significant differences between those prescribed and those not prescribed a pim were found for sex, age, deductible class, number of different medications used, number of chronic conditions, total healthcare costs in the previous year, and number of concurrent pims . The average number of medications in the pim group was 4.0 2.3, while the non - pim group s average number of medications was 6.4 2.9 (p <0.001). In addition, the average number of comorbidities was 3.3 1.4 in the pim group and 3.8 1.5 in the non - pim group (p <0.001). The number of patients whose ltc insurance for seniors was grade 3 was relatively higher in the pim group than it was in the non - pim group . The six most commonly prescribed classes of medicines within the anatomical therapeutic chemical classification system were as follows: central nervous system (n = 930; 36.4%), alimentary tract and metabolism (n = 553; 21.6%), cardiovascular system (n = 388; 15.1%), blood and blood - forming organs (n = 236; 9.2%), respiratory system (n = 115; 4.5%), and musculoskeletal system (n = 72; 2.8%). Table 2 presents the number of pims prescribed in ltc facilities.table 1general characteristics of the residents in long - term care facilitiesvariablesnon - pims [n = 221 (%)] pims [n = 308 (%)] p valueage (years)81.6 8.980.2 8.40.067sex (male)64 (29.0%)59 (19.2%)0.080number of co - medications4.0 2.36.4 2.9<0.001 03105 (47.5%)51 (16.6%) 4582 (37.1%)112 (36.4%) 6732 (14.5%)103 (33.4%) 82 (0.9%)42 (13.6%)number of co - morbidities3.3 1.43.77 1.5<0.001 0270 (31.7%)58 (18.8%) 352 (23.5%)90 (29.2%) 461 (27.6%)66 (21.4%) 538 (17.2%)94 (30.5%)number of adls1.2 1.21.3 1.20.405 adl bathing8 (3.6%)7 (2.3%)0.357 dressing52 (23.5%)62 (20.1%)0.348 eating132 (59.7%)209 (67.9%)0.054 toileting58 (26.2%)87 (28.2%)0.611 walking22 (10.0%)42 (13.6%)0.200length of stay (months)28.4 25.926.7 29.20.494grade of long - term care insurance for senior 138 (17.2%)31 (10.1%)0.008 283 (37.6%)100 (32.5%) 3100 (45.2%)177 (57.5%)bed size of long - term care facilities <2954 (24.4%)74 (24.0%)0.950 305966 (29.9%)96 (31.2%) 60101 (45.7%)138 (44.8%)business type of long - term care facilities corporation159 (71.9%)223 (72.4%)0.908 private operator62 (28.1%)85 (27.6%)values are presented as number (%) pim potentially inappropriate medication, adl activities of daily living p value applied to row 47 inclusive p value applied to row 912 inclusive p value applied to row 2022 inclusive p value applied to row 2325 inclusive p value applied to row 2627 inclusivetable 2number of potentially inappropriate medications in the residents of long - term care facilitiesnumber of potentially inappropriate medicationsnumber (%) 0221 (41.8)1189 (35.7)292 (17.4)320 (3.8)46 (1.1)51 (0.2)total529 (100.0) general characteristics of the residents in long - term care facilities values are presented as number (%) pim potentially inappropriate medication, adl activities of daily living p value applied to row 47 inclusive p value applied to row 912 inclusive p value applied to row 2022 inclusive p value applied to row 2325 inclusive p value applied to row 2627 inclusive number of potentially inappropriate medications in the residents of long - term care facilities the six most commonly prescribed classes of medications in our patients were as follows: central nervous system (n = 271; 58.7%), anticholinergics (n = 98; 21.2%), cardiovascular system (n = 50; 10.8%), endocrine system (n = 22; 4.8%), analgesics (n = 9; 1.9%), and anti - parkinsonian drugs (n = 9; 1.9%) (table 3). Specifically, the most common pim subtype was quetiapine (n = 131; 28.4%), followed by chlorpheniramine (n = 73; 15.8%), risperidone (n = 30; 6.5%), zolpidem (n = 27; 5.8%), and spironolactone (n = 26, 5.6%) (table 4). Multivariate logistic regression analyses were applied, and the factors that exhibited significant associations with pim prescriptions are shown in table 5.table 3six most commonly prescribed potentially inappropriate medications classesmedications class (atc code)number (%) central nervous system (n05-n06)271 (58.7)anticholinergics (n04a)98 (21.2)cardiovascular system (c)50 (10.8)endocrine system (g03)22 (4.8)analgesics (n02)9 (1.9)anti - parkinsonian drugs (n04) 9 (1.9)medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classificationtable 4prevalence of potentially inappropriate medications according to individual drugsdrugs (atc code)number (%) quetiapine (n05ah04)131 (28.4)chlorpeniramine (r06ab04)73 (15.8)risperidone (n05ax08)30 (6.5)zolpidem (n05cf02)27 (5.8)spironolactone (c03da01)26 (5.6)olanzapine (n05ah03) 21 (4.5)lorazepam (n05ba06)19 (4.1)alprazolam (n05ba12)16 (3.5)hydroxyzine (n05bb01)13 (2.8)cyproheptadine (r06ax02)12 (2.6)doxazosin (c02ca04)12 (2.6)sliding scale insulin (a10ab01)12 (2.6)amitriptyline (n06aa09)11 (2.4)megestrol (g03ac05)10 (2.2)meloxicam (n01ac06)9 (1.9)benztropine (n04ac01)7 (1.5)nifedipine (c08ca05)7 (1.5)diazepam (n05ba01)6 (1.3)clonazepam (n03ae01)5 (1.1)terazosin (g04ca03)3 (0.6)total462 (100)medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classificationtable 5logistic regression analysis for potentially inappropriate medications used in the residents of long - term care facilitiesvariables standard error p valueadjusted or (95% ci)age0.0030.0120.8001.00 (0.981.02)sex (female)0.1360.3160.6661.15 (0.622.13)number of co - medications 031.00 450.9030.243<0.0012.47 (1.533.97) 671.6880.316<0.0015.41 (2.9110.06) 83.6000.761<0.00136.61 (8.24162.68)number of co - morbidities 021.00 30.4880.2710.0731.63 (0.862.76) 40.0740.2780.7910.93 (0.541.60) 50.4380.2940.1371.55 (0.872.76)grade of long - term care insurance for seniors 11.00 20.2710.3120.3851.31 (0.712.42) 30.7090.3440.0392.03 (1.043.99)adjusted for activities of daily living, length of stay, bed size and business type of long - term care facilitiesgrade of long - term care insurance for seniors made based on standards of five areas of physical functions (activities of daily living), cognition, behavioral changes, demand on nursing care, and need for rehabilitation and judgment standards made in consideration of service necessary according to the state of functions . Categories of ltc grade are defined as follows: grade 1 (most severe); grade 2 (severe); grade 3 (moderate) six most commonly prescribed potentially inappropriate medications classes medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classification prevalence of potentially inappropriate medications according to individual drugs medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classification logistic regression analysis for potentially inappropriate medications used in the residents of long - term care facilities adjusted for activities of daily living, length of stay, bed size and business type of long - term care facilities grade of long - term care insurance for seniors made based on standards of five areas of physical functions (activities of daily living), cognition, behavioral changes, demand on nursing care, and need for rehabilitation and judgment standards made in consideration of service necessary according to the state of functions . Categories of ltc grade are defined as follows: grade 1 (most severe); grade 2 (severe); grade 3 (moderate) the present study focuses on a growing public health problem: inappropriate medication prescriptions in ltc facilities . A disturbingly high level of pims were prescribed (58.2%), which is of concern, indicating room for improvement . A comparison with the results from studies conducted previously worldwide is not straightforward owing to variations in methods, such as data and duration of collection, study criteria, and characteristics of the population groups . Despite these variations, this prevalence was similar to those observed in the usa, with values of 49% of elderly patients who were admitted with one or more of the seven most common medical diagnoses and 55.3% in those undergoing surgery during their hospitalization, and 56.1% of those in acute care hospitals in japan . The results described in the multivariate analysis regarding the factors associated with a potentially inappropriate prescription showed that the likelihood was determined by the number of drugs prescribed during the patient s hospitalization ., the results of a logistic regression model showed that multiple diseases and a higher use of drugs during hospital stay predicted pim prescription . Multivariate analyses also revealed that the number of drugs prescribed seemed to be one of the most important independent predictors for receiving an inappropriate medication [27, 28]. Furthermore, inappropriate medication use was higher with the ltc insurance grade 3, which means less dependence and a requirement of low - level care . This can be explained by the fact that most of the residents in korean ltc facilities have been diagnosed with dementia or another neurodegenerative disorder . Considering central nervous system drugs (58.7%) were the most prescribed class of inappropriate medications, such prescriptions are used to manage behavioral and psychiatric symptoms . When interpreting the findings of the current study, some limitations to the methodology that could bias estimates are worth mentioning . The first limitation lies with the fact that the study was cross sectional, which does not allow us to identify the causal relationship of pim with associated factors in nature . Second, the beers criteria have been examined extensively in research since their development and found to be effective in identifying pim and advising close monitoring of certain medications . However, evidence supporting the effectiveness of the beers criteria in consistently reducing the adverse effects of drugs or decreasing costs or mortality is lacking [29, 30]. The beers criteria does not take into account geriatric patients in palliative care or hospice, does not detect prescribing omissions, underuse of medications, inappropriate dosing of medications, or duplication of drug classes [31, 32]. Third, although the information was gathered mainly from a chart review, recall bias may have been a problem because patients reported their current medications through a structured interview that took place before admission, including the duration of treatment and the dosage; this information may have been inaccurate . Fourth, this sample is unlikely to be representative of all koreans because the study was conducted in one region of the country and, therefore, the ability to generalize the findings is questionable . Central nervous system drugs (58.7%) were the most prescribed class of inappropriate medications in korean ltc facilities . Inappropriate medication use was associated with the number of co - medications and ltc insurance grade 3, which means less dependence and a requirement of low - level care . Central nervous system drugs (58.7%) were the most prescribed class of inappropriate medications . There was a relationship between inappropriate medication use and the number of co - medications . The frequency of inappropriate medication prescriptions was higher among patients whose ltc insurance for seniors was grade 3, which means less dependence and a requirement of low - level care . This retrospective study was carried out after obtaining the permission of the institutional review board of myoung - ji hospital in korea and has been performed in accordance with the ethical standards of the declaration of helsinki . Kang soo lee, sang - hwan kim, and hee - jin hwang have no conflicts of interest to declare . Kang soo lee, sang - hwan kim, and hee - jin hwang certify that no funding has been received for the conduct of this study and/or preparation of this manuscript.
In patients with chronic hepatitis and in those with liver cirrhosis, detection of increasing incidences of hepatocellular carcinoma (hcc) requires careful monitoring every 36 months using ultrasound sonography (us), computed tomography (ct), magnetic resonance imaging (mri), and frequent blood tests . Once hcc is detected, patients experience repeated recurrence, despite the fact that a variety of hcc treatment methods have been developed, such as anti - viral agents, surgical treatment, percutaneous ethanol injection (peit), radiofrequency ablation (rfa), trans - catheter arterial chemoembolization (tace), and molecular - target drugs . In the last 10 years, tumor vaccines generated from patients' own formalin - fixed hcc tissues the autologous formalin - fixed tumor vaccine (aftv) has been reported to reduce the recurrence risk of primary resected hepatitis b virus - background hcc by 81% 1 . In one case, recurrence of multiple - recurrent hepatitis c virus (hcv)-back ground hcc was clearly suppressed long - term without any additional treatment 2 . Here, we report a case in which aftv injection resulted in suppression of multiple - recurrent hcv - background hcc recurrence . In this case, we detected a significant density of glypican-3 (gpc3)-specific cytotoxic t lymphocytes (ctl) in the blood at 12 months after the last intradermal injection of aftv . A 55-year - old female patient was diagnosed with hcv - related hepatitis in 2002 . Liver biopsy showed active chronic hepatitis accompanied by bridging fibrosis and necrotic inflammatory reactions . To reduce the activity of chronic hepatitis, the patient was treated with consensus interferon for 24 weeks . Results showed complete remission of the hepatitis as liver transaminases normalized, as well as conversion of seropositive hcv to negative up to the present . When she was 57 years old, two 20-mm hccs were observed in left lobes s2 and s3, and a left hepatic lobectomy was performed in june 2004 . In addition, two 10-mm hccs in s5 and s7 were treated with radiofrequency ablation (rfa) in september 2008 . The 10-mm hcc in s5 was detected again in january 2011, and was treated with trans - catheter arterial chemoembolization (tace) and rfa . In january 2012, a new 10-mm hcc was found in s6, and a resection was done after treatment with rfa . Pathologies obtained after the two hepatectomies showed poorly differentiated hcc in the 2004 specimen and moderately differentiated hcc in the 2012 specimen (fig.1). The liver function has been kept good and the bilirubin levels were <2 mg / dl . The patient did not hope liver transplantation but desired aftv therapy because of the rapid decline in the recurrence interval, that is, 51-, 28-, 12-, and 4-months . Pathology and glypican-3 (gpc3) expression in hepatocellular carcinomas . (a) h&e staining and (b) gpc3 immunohistochemistry of representative tissue from a 2004-resected hepatocellular carcinoma (hcc) specimen of the present case . (c) h&e staining and (d) gpc3 immunohistochemistry from a 2012-resected specimen . Gpc3 expression (b, d) was observed in areas with hcc (arrows), but not in cirrhotic areas (white stars). We prepared aftv as reported previously 3 using a total of 1.56 g of autologous hcc tissue recovered from formalin - fixed and paraffin - embedded tumors from the two operations . According to the therapeutic schedule employed 1, a single course of aftv therapy applied from september to october 2012 consisted of the following: (1) a delayed - type hypersensitivity (dth) test with immunoadjuvant - free fixed hcc fragments applied to a forearm was initiated 48 h before the first aftv injection to check for allergic reaction . (2) up to three rounds of aftv were injected intradermally into the upper arm at 2 week intervals . (3) a second dth test, performed 2 weeks after the last aftv injection to the other forearm, showed a positive dth response . (4) ultrasound sonography and blood tests for tumor markers which were conducted every 3 months, and computerized tomography every 6 months, revealed no evidence of recurrence or generation of new hcc lesions for more than 27 months . Immunohistochemistry to detect gpc3 4 in the hcc specimen resected in 2004 revealed strong expression of gpc in the hcc lesion (fig.1b). We also detected gpc3 expression in the 2012 specimen resected after treatment with rfa (fig.1d). However, we did not observe any gpc3 expression within cirrhotic lesions in either specimen (fig.1b and d). To evaluate aftv - induced gpc3-reactive ctl, we carried out interferon--specific elispot assays as described previously 5, using a target human hcc cell line expressing gpc3 (sk - hep-1/gpc3). The cell line was developed from sk - hep-1/hla - a0201/2402 cells by transfecting with human gpc3-gene . A control cell line (sk - hep-1/vec) although hla subtypes of the patient and the target cell line differ (hla - a0206/3303 and hla - a0201/2402, respectively), hla - a2 (a0201)-restricted gpc3 epitopes are cross - reactive with hla - a0206, allowing detection of gpc3-specific ctl that are reactive to the target cell line 5 . Glypican-3-specific ctls were clearly observed in peripheral blood drawn 12 months after the first injection of aftv (average 21.5 spots against sk - hep-1/hgpc3 cells vs. nine spots against sk - hep-1/vec control cells) (fig.2). Lymphocytes were prepared from the patient's blood drawn at 12 months after autologous formalin - fixed tumor vaccine (aftv) injection . We detected hla - a2-restricted glypican-3 (gpc3) peptide - specific cytotoxic t lymphocytes in the 12-month blood . Sk - hep-1/hgpc3, human gpc3 gene - transfected sk - hep-1 cells (sk - hep-1 with hla - a a0201/2402), a human hepatocellular carcinoma cell line unable to express gpc3; sk - hep-1/vec, control vector gene - transfected sk - hep-1 cell line . Effector cells (cd8 t cells), 1 10 cells / well; target cells (sk - hep-1 cells), 5 10 cells / well . Gpc3, a heparan - sulfate proteoglycans linked to the outer surface of cell membrane via a glycosylphosphatidylinositol anchor 6, is frequently overexpressed in hcc 7,8 and in precancerous lesions in the liver 9 . For this reason, a recombinant humanized monoclonal antibody against gpc3 10 and a gpc3-peptide vaccine 11 have been developed for treatment of hcc . Treatments with these new agents were well tolerated, and noted measurable immune responses and antitumor efficacy . However, clinical outcome were not necessarily prominent in these phase i trials compared to the previous expectations derived from preclinical studies . Autologous formalin - fixed tumor vaccine differs from these specified molecule - targeted agents in that the autologous tumor, containing a wide array of unidentified antigens, is the source of antigens . Thus, ctl induced with aftv made from tumor tissue must be polyclonal by nature; for example, polyclonal ctl induced in vitro with a formalin - fixed carcinoembryonic antigen protein 12 . At present, no one provided any evidence that the impure tumor antigenic formalin - fixed autologous hcc tissue is truly active to induce a specific cellular immune response against a specified tumor antigenic molecule . The present case is the first one we could identify gpc3-specific cellular immune response based on the autologous formalin - fixed hcc . While we detected gpc3-specific ctl in the patient's blood 12 months after aftv treatment, few gpc3-specific ctl were detected 16 months after the treatment (data not shown). These results may suggest that, although the conspicuous life span of gpc3-specific ctl in blood is <16 months, the immunoprotective effect of aftv continues beyond gpc3-specific ctl lifespan in blood, since this patient presently continued to show no evidence of hcc recurrence 32 months after the second resection of hcc . We consider two hypotheses to explain this continued protection: (1) the gpc3-specific ctl may have differentiated into memory t cells, which migrate to lymphatic tissues and are therefore not conspicuously detectable in peripheral blood . (2) the gpc3-specific ctl apoptosed after killing all target hcc cells in vivo, thereby eliminating all tumor antigens and preventing replicative stimulation to active ctl . This is the first case we could identify gpc3-specific cellular immune response based on impure tumor antigenic formalin - fixed autologous hcc tissue . Present results suggest that aftv should be taken in consideration as one of treatment modalities in cases involving potential hcc derived from chronic hepatitis and liver cirrhosis.
In this and the next issue of critical care, john haddad presents a comprehensive review on the contributions of transcription factors to lung injury . The topic is large and ever changing, and the complete coverage of nuclear factor-b (nf-b) and hypoxia - inducible factor (hif)-1 is spread over two issues . In critical care the majority of these patients progress to the point at which they require intubation and mechanical ventilation, with an associated high mortality . Recent studies have demonstrated that low tidal volume (6 ml / kg) ventilation strategies dramatically reduce this mortality . However, many other clinical trials of various treatments have failed at either reducing the lung injury or accelerating the healing to the end - point of reduced mortality . In this age of genomics and proteomics we continue to explore the association of gene and environment . With respect to lung injury, we need to identify and understand the mechanisms that predispose patients to the excessive inflammation resulting from an overactive innate immune response that characterizes sepsis and lung injury . These include stimuli, signal transduction (receptors, enzyme cascades, transcription factors), gene(s) response and the measured clinical phenotype . John haddad, in his two - part review, identifies many' clinical stimuli' in cell culture, animal model and patient studies representing an oxidative stress that can generate a response via nf-b or hif-1 dependent signalling . Nf-b was originally described in b lymphocytes, but it is now recognized as a member of the rel family of transcription factors and is a critical response element in many cytokine - dependent events or inflammatory conditions . As a result of this link, nf-b has become a major target for new therapeutic approaches in such clinical disease states as asthma, cancer, arthritis, and cardiovascular and neurodegenerative conditions . Haddad discusses the roles of critical care conditions such as hyperoxia, haemorrhage and resuscitation; the' stress response' to illness (interleukin-6, interleukin-8, tumour necrosis factor, rantes [regulated upon activation, normal t cell expressed and secreted]); and mechanical ventilation and ischaemia / reperfusion . In all of these conditions these dynamic variations in cellular redox or oxidative stress, if in disequilibrium, may regulate gene expression and lead to apoptosis (cell death without inflammation), inflammation and lung injury . The master regulatory element of hypoxic conditions and adapting oxidative stresses to gene expression is hif-1 . Hif-1, a dna - binding protein, has increased stability and binding in hypoxic conditions and is degraded rapidly in normoxia . The accumulation of the -subunits allows for heterodimer formation and translocation into the nucleus during hypoxia . This process leads to selective upregulation of genes whose products are involved in hypoxia and inflammatory lung injury . These include erythropoietin, vascular endothelial growth factor (vegf) and glucose transporter . Work by haddad has demonstrated that proinflammatory cytokines also activate hif-1 stability and dna binding . This effect was most profound in hypoxic conditions and was, in fact, greater than that in hypoxaemia alone . It is felt that hif-1, via its action on vegf expression, is directly related to lung injury by endothelial barrier dysfunction mediated by vegf and recognized clinically as increased pulmonary vascular permeability . Haddad discusses in detail how hypoxia and inflammatory stimuli initiate many signalling cascades via hif-1 to generate a response phenotype to these oxidative stresses . Understanding the molecular signalling that couples oxidative stresses via nf-b or hif-1 to acute lung injury should generate new therapeutic options . Haddad discusses the rationale for the use of tyloxapol to reduce proinflammatory cytokines, n - acetyl cysteine (a glutathione precursor) to reduce neutrophil - associated alveolitis in chronic conditions such as cystic fibrosis, and the use of pyrrolidine dithiocarbamate in transplantation to reduce neutrophil - associated oxidant lung injury . Two new compounds, isohelenin and lisofylline, a phosphodiesterase inhibitor, are described as being able to reduce proinflammatory cytokines and ameliorate oxidant lung injury in animal models . As exciting as this emerging field is, with its predictable contribution to future' bench to bedside' discussions, a more complete mechanistic understanding and future clinical trials will assist in the realization of improved treatment and reduced mortality from oxidant - mediated lung injury . Hif = hypoxia - inducible factor; nf-b = nuclear factor-b; vegf = vascular endothelial growth factor.
We enrolled 13 consecutive patients between march 2005 and march 2009 and who met the following inclusion criteria: 1) they were diagnosed with acral lentiginous melanoma by punch biopsy; 2) their skin lesion confined to the foot; 3) there was no skin or soft tissue disease on the ipsilateral lower leg . We routinely checked the preoperative ultrasonography for popliteal and inguinal lymph node metastasis, and we performed computed tomography of the chest and positron emission tomography to assess for distant metastasis . A distally - based island sural flap was used in 10 cases for hindfoot reconstruction, and the lateral supramalleolar fasciocutaneous flap was used in 3 cases for lateral arch reconstruction of the mid- and forefoot after wide excision of malignant melanomas (table 1). Eight patients were women and 5 were men with mean age of 60.3 years (range, 35 to 73 years). The mean duration of follow - up was 23.3 months (range, 6 to 48 months). One patient had ipsilateral inguinal and popliteal lymph node metastasis, and one patient had ipsilateral inguinal lymph node metastasis at the time of diagnosis . We performed wide excision of the malignant melanoma with a 2 cm margin in all the patients . After wide excision, we confirmed that the margin of resection was free of tumor by frozen section, and then we measured the exact size of the defect . The distally based island sural flap was outlined at the junction of the two heads of g the astrocnemius muscle . A line of incision was traced over the presumed course of the sural nerve and the lesser saphenous vein . The pivotal point of the pedicle was three fingers breadth proximal to the tip of the lateral malleolus . 1). The lateral supramalleolar fasciocutaneous flap need an essential landmark, which is the perforating branch of the peroneal artery as it pierces the interosseous membrane at the distal tibiofibular angle about 5 cm proximal to the tip of the lateral malleolus . The fasciocutaneous flap contained the superficial peroneal nerve, the perforating branch from the peroneal artery and the venae comitantes (fig . 2). We attempted neurorrhaphy between the proximally cut superficial peroneal nerve and the distally cut lateral plantar nerve in the two lateral supramalleolar flaps . At a mean time of 21 days after the first operation, the skin graft on the flap donor site and opening the pedicle tunnel was carried out with full thickness skin, which was obtained from the ipsilateral inguinal area . Inguinal lymph node dissection was concomitantly performed, after harvesting the full thickness skin graft, in 10 patients who had " thick melanomas " (> 1.0 mm in thickness by breslow microstaging) and who had lymph node metastasis seen on the preoperative ultrasonography . Three patients with " thin melanoma " (1.0 mm in thickness by breslow microstaging) had a split thickness skin graft that was harvested from the thigh without inguinal lymph node dissection.9) low molecular weight dextran was routinely used for 5 days postoperatively . Partial and full weight bearing ambulation could be started after 6 weeks and 12 weeks after the first operation without concern for wound healing . We performed wide excision of the malignant melanoma with a 2 cm margin in all the patients . After wide excision, we confirmed that the margin of resection was free of tumor by frozen section, and then we measured the exact size of the defect . The distally based island sural flap was outlined at the junction of the two heads of g the astrocnemius muscle . A line of incision was traced over the presumed course of the sural nerve and the lesser saphenous vein . The pivotal point of the pedicle was three fingers breadth proximal to the tip of the lateral malleolus . 1). The lateral supramalleolar fasciocutaneous flap need an essential landmark, which is the perforating branch of the peroneal artery as it pierces the interosseous membrane at the distal tibiofibular angle about 5 cm proximal to the tip of the lateral malleolus . The fasciocutaneous flap contained the superficial peroneal nerve, the perforating branch from the peroneal artery and the venae comitantes (fig . 2). We attempted neurorrhaphy between the proximally cut superficial peroneal nerve and the distally cut lateral plantar nerve in the two lateral supramalleolar flaps . At a mean time of 21 days after the first operation, the skin graft on the flap donor site and opening the pedicle tunnel was carried out with full thickness skin, which was obtained from the ipsilateral inguinal area . Inguinal lymph node dissection was concomitantly performed, after harvesting the full thickness skin graft, in 10 patients who had " thick melanomas " (> 1.0 mm in thickness by breslow microstaging) and who had lymph node metastasis seen on the preoperative ultrasonography . Three patients with " thin melanoma " (1.0 mm in thickness by breslow microstaging) had a split thickness skin graft that was harvested from the thigh without inguinal lymph node dissection.9) partial and full weight bearing ambulation could be started after 6 weeks and 12 weeks after the first operation without concern for wound healing . One patient, who had a split thickness skin graft without lymph node dissection, was revealed to have pulmonary and inguinal lymph node metastasis at 4 months postoperatively, and the patient died of disease at 13 months . Among those who underwent elective inguinal lymph node dissection, 2 patients were revealed to be alive with disease and 3 patients died of disease at 7, 10, 13, 15 months later after operation respectively . The length of the flap varied from 7.5 to 12 cm (mean length, 9.6 cm) and the width varied from 6.5 to 12 cm (mean width, 8.8 cm). In 4 cases, superficial necrosis developed, but this was successfully treated by debridement and suture or skin graft (table 1). All 13 flaps survived completely and they provided stable defect coverage, good contour and normal weight bearing ambulation . As for the patients who had neurorrhaphy, the recovery of sensation was not observed . Distally based fasciocutaneous flaps on the leg were first introduced in 1983.10) the main advantages of these flaps are a well - defined surface that is independent of a lengthwidth ratio and the preservation of the main vascular axis . In most cases, the sural nerve descends in between the two heads of the gastrocnemius muscle and it penetrates the deep fascia at the median point of the leg . The superficial sural artery originates from the popliteal or sural arteries, and it reaches the sural nerve at 2 cm to 3 cm after its emergence, then subdivides into the medial, median and lateral superficial sural arteries . The median superficial sural artery follows the course of the sural nerve, and then it emits numerous branches toward the skin at the lower half of the leg, along its superficial path . The peroneal artery, in turn, makes other anastomoses, notably through its descending branch, and especially with the anterior tibial artery . Several authors have stated that the principal anastomosis occurs at above to 5 centimeters from the lateral malleolus.2,11 - 13) although there are some reports of a preoperative lesser saphenous vein mapping method that used doppler ultrasound4) or using a simple rubber tourniquet for making the superficial vessels prominent,2) we did not use these techniques . However, the incision was initiated in the proximal extreme of the flap, we identified the lesser saphenous vein, sural artery and nerve, and then we made further incision with centralizing on the presumed vessel course as much as possible . The distally based sural flap had a tendency of having a short flap pedicle for coverage of a forefoot defect, as compared to that of the lateral supramalleolar flap . The lateral supramalleolar flap is a distally based fasciocutaneous flap that is vascularized by branches of a perforating branch of the dorsal peroneal artery . This branch is constant and it emerges 5 cm above the lateral malleolus, with 2 or 3 ascending cutaneous branches and a deep descending branch . The ascending branches are included in the intermuscular septum between the extensor digitorum longus and the peroneus brevis, and the ascending branches perforate the fascia and then they supply the skin over the lower lateral half of the leg . The descending branch runs distally below the deep fascia, and it anastomoses with the anterolateral malleolar branch of the tibialis anterior artery, and then it continues into the foot to form anastomoses with the tarsi arteries and dorsal arch . The point of emergence of the perforating branch of the dorsal peroneal artery could be detected " by palpating the groove just above and anterior to the lateral malleolus. "14) this represents the pivot point . The axis of the flap is represented by a midline drawn from the anterior tibial crest to the posterior margin of the fibula . Voche et al.5) distinguished the type of arterial blood supply to the lateral supramalleloar flap depending on how far distally the flap is raised, and this can include a mixed antegrade and retrograde blood supply . So this flap can have a longer pedicle length due to the various possible vascular networks and the flap can reach to the forefoot . Almeida et al.2) reported on the complications in their 71 cases of a reverse - flow island sural flap, including partial (22.1%) or total (4.2%) flap necrosis, infection (8.5%) and venous congestion (4.1%). Voche et al.5) reported venous congestion and partial flap necrosis (5 to 30%) in their 41 cases of using the lateral supramalleolar flap . They presented the delayed neurofasicocutaneous sural flap, which is initially completely elevated and it is then fixed again at the donor site using running sutures for 7 to 15 days . After confirming the flap's survival, the flap was raised again and transposed into the defect . This delayed procedure could be an alternative to overcome these problems and to increase the reliability and viability of the flap . Tan et al.15) treated three patients with a supercharged reverse flow sural flap to reduce venous congestion and edema, and the venous drainage was achieved by end - to - end anastomosis between the free end of the lesser saphenous vein and a superficial vein on the medial site of the ankle . Among our 4 patients with partial necrosis, 2 occurred in the distally based sural artery flap . Partial necrosis developed on the lateral margin of the flap that was transposed medially on the plantar surface . The flap sizes of these patients were not too much larger than that of the other patients, but the routes of passage of the sural vascular pedicle were more laterally located from the flap center . Therefore, at the time of sural flap dissection, the skin island should be redrawn and shifted either medially or laterally as the dissection progresses, while trying to keep the pedicle centralized with regard to the flap . The other two cases of partial necrosis developed on the distal portion of the transposed lateral supramelleolar flap . These flaps were large size (12 9, 10.5 9 cm) with long pedicle lengths to reach the metatarso - phalangeal joint of the fifth toe . We confirmed well - blanched, transposed flap color to the lateral arch of the forefoot and then we completely sutured the pedicle tunnel . From these cases, we suggest that an opened pedicle tunnel can be beneficial for the long length pedicle and a large flap size . When the defects are larger and more anterior, free tissue transfer is often required because it can provide a large amount of tissue.6) however, there are some disadvantages such as donor - site morbidity, an increased operation time, the use of a major vessel of the leg and the necessity of microsurgical expertise . Moreover, langstein et al.16) reported the free tissue transfer for limb salvage of soft tissue malignancies on the foot . According to their results, over 50% of the patients with local recurrence and persistent disease required below knee amputation . Voche et al.5) suggested the lateral supramalleolar flap is reliable and useful for coverage of the lower leg, ankle and foot skin defects, but coverage of the weight - bearing surface of the foot should be avoided . However, we had satisfactory results for a the large defect of the lateral half of the midfoot and forefoot, including a weight bearing area, so there seems to be no problem if the pedicle can be placed in a non - weight bearing portion or delayed weight bearing is performed . One patient developed multiple inguinal lymph node and lung metastases after a late split thickness skin graft on the donor defect area and the patient had received a lateral supramalleolar flap . This all suggested the necessity of inguinal lymph node biopsy or dissection, and many articles have emphasized that sentinel lymph node biopsy needs to be done in a patient in the malignant melanoma.17) if this patient had received a full thickness skin graft instead of a split skin graft, then we would have performed inguinal lymph node dissection . Our delayed full thickness skin graft had benefits with respect to confirming the flap's viability in a critical period, the one - time - approach for ipsilateral lymph node dissection after harvesting the full thickness skin and the safety for the pedicle tunnel that remained open rather than performing primary closure . In conclusion, the distally based sural flap and lateral supramalleolar flap provide effective coverage of variable sized soft tissue defects on the foot after wide excision of malignant melanoma, this is quick and safe surgery without the necessity of microsurgical expertise, it preserves the major arteries of the leg and the donor - site morbidity is acceptable . The distally based sural flap is useful for the hindfoot, and the lateral supramalleolar flap is good for lateral archs of the mid- and forefoot.
Techniques and equipment to accomplish endotracheal (et) intubation were the precursor to modern day invasive mechanical ventilation . In recent years, however, the popularity of the et tube has waned . Clinically, the et tube is seen as an impediment to spontaneous breathing, a transit route for bacteria to the lower airway, and with the advent of noninvasive ventilation a device to be avoided when possible . Of particular interest has been the effect of the et tube on work of breathing and methods to eliminate this work . Commonly, pressure support ventilation (psv) has been suggested as the technique of choice for eliminating imposed work due to the et tube . More recently, the technique of automatic tube compensation (atc) has become available to specifically address this issue . In this issue of critical care, maeda and colleagues compare the technique of atc, as provided by the drager evita 4 (dragerwerks, lubeck, germany) and the puritan bennett 840 (carlsbad, ca, usa), versus psv in reducing imposed work of breathing in a lung model . Before i comment on the merits of the study, clearly, before the advent of pressure support ventilation in the early 1980s, patients were successfully weaned using t - piece trials and intermittent mandatory ventilation, with no apparent untoward effects . In 1986, shapiro and coworkers presented data from three normal volunteers breathing through et tubes at a constant tidal volume of 500 ml . That report is widely quoted but is limited by the use of unintubated normal individuals and the requirement for a constant tidal volume during increasing respiratory rates . Additionally, close review of the data demonstrates that with a size 8.0 et tube the work of breathing in joules per minute does not become excessive until minute ventilation exceeds 15 l / min . Brochard and colleagues compared work of breathing during assisted ventilation, four levels of pressure support, continuous positive airway pressure, and after extubation in an effort to determine the role of pressure support in overcoming the imposed work presented by the et tube . That trial evaluated both patients with normal lungs and those with chronic obstructive pulmonary disease (copd). The authors concluded that the pressure support level that eliminated imposed work was between 3 and 14 cmh2o . Interestingly, this was determined retrospectively by matching the work of breathing after extubation to the level of pressure support that resulted in equivalent work of breathing during mechanical ventilation . Recent work suggests that the work of breathing postextubation may actually increase compared with work of breathing through the et tube, raising questions about the conclusion of the study by brochard and colleagues . Weissman evaluated flow - volume loops in 18 postoperative patients intubated with size 7.0 and 8.0 et tubes and found that only' minimal limitation to airflow' occurred at volumes and frequencies associated with tidal breathing . That study is one of the very few that contemplate the idea that et tube resistance may not be important when the appropriate size is chosen and the patients pulmonary function has improved to the point that weaning may be considered . Of course, there are numerous other studies that suggest that et tube resistance may represent a significant impediment to spontaneous breathing . However, it is important to note that although there remains concern about et tube resistance, and the literature is replete with lung model studies of increased work of breathing, there is not a single clinical trial that suggests that spontaneous breathing through the et tube results in untoward outcomes . The report by maeda and coworkers in this issue of critical care evaluates the two most popular methods of overcoming et tube resistance, namely psv and atc . The authors concluded that tube compensation could not overcome the pressure time product associated with triggering and that pressure support is as effective as atc at 100% . There are, however, tremendous disadvantages to a lung model study in comparing these techniques . Calculating the pressure time product and work includes the work required to trigger the ventilator, which can only be overcome by direct measurement of tracheal pressure and triggering from the tracheal signal . This method has been proposed by many, and advanced by the group from gainesville . Additionally, although the lung model allows consistency, it cannot react to differences in gas delivery . In several human studies comparing psv with atc, the slow flow and longer inspiratory time associated with psv has been associated with dysynchrony . When used in a patient with copd, the patient's high airway resistance and increased compliance allow even small amounts of psv to cause hyperinflation and auto - peep (positive end - expiratory pressure). Alterations in pulmonary mechanics, along with the preference of the copd patient for short inspiratory times and long expiratory times, result in neuromechanical dysynchrony during psv . The main proposed advantages of atc over psv are reduced work of breathing as patient demand varies, preservation of a normal, variable breathing pattern, and improved synchrony . In a recent trial of spontaneous breathing before extubation, haberthur and coworkers failed to show any advantage of atc over psv or t - tube trials . One issue not addressed in the study by maeda and coworkers is the role of expiratory compensation . One distinct difference in the operation of the drager evita 4 and puritan bennett 840 is that evita 4 provides both inspiratory and expiratory compensation for et tube resistance . In these cases, the airway pressure may be allowed to drop below peep to facilitate expiratory flow . New modes and new techniques are developed in the hope of resolving clinical problems and often concentrate on a short - term physiologic end - point . Conventional wisdom suggests that the et tube is an impediment to efficient spontaneous breathing, yet clinical evidence during spontaneous breathing trials appears to argue to the contrary . The real question may be whether overcoming et tube resistance is necessary, not whether atc is as good as or better than psv . The future of atc, like many new techniques, may not be in overcoming et tube resistance, but as a method of support during spontaneous breathing that improves patient - ventilator synchrony as compared with psv . Additional clinical studies are required to complement the excellent laboratory work by the group from osaka reported in this issue . Atc = automatic tube compensation; copd = chronic obstructive pulmonary disease; et = endotracheal; peep = positive end - expiratory pressure; psv = pressure support ventilation.
Bed rest, heart failure, depletion of intravascular volume, and aging often induce hypotension when the body or trunk is upright.15 generally, a tachycardic response occurs due to vagal withdrawal according to the downward blood shift that occurs under orthostatic stress in healthy humans,6 although orthostatic hypotension presents as an excessive drop in cardiac output (q) and lower tachycardic response in frail and elderly patients as a consequence of inadequate vascular contraction or autonomic dysfunction.7,8 numerous studies have suggested that advancing age is associated with decreases in vagal nerve activity.912 age - related decreases in vagal nerve activity have been suggested as contributing factors for orthostatic hypotension in elderly individuals.7,13 orthostatic hypotension has been reported in more than 60% of frail older patients in an acute geriatric ward.5 previous studies have observed orthostatic hypotension in 54% of seated older inpatients resting on a bed for more than 12 h.14 in light of these facts, methods of preventing hypovolemia and hypotension during orthostatic stress need to be investigated . Pointed out that studies of orthostatic hypotension in frail patients, such as those with decompensated heart failure, are scarce and preventive interventions remain insufficient.2 clinically, frail patients are placed in fowler s position or a semiseated position on the bed . These positions are often clinically used without distinction between acute- or chronic - phase illness . The patient is placed in a reclined position with the backrest between 30 and 60 and with flexed or straight knees in fowler s position.15,16 breathing, eating, and other routine daily activities are considered to be facilitated in fowler s position.15,1720 some studies have suggested a relationship between trunk angle and hemodynamics during fowler s position.2124 cicolini et al . Reported that blood pressure in fowler s position was intermediate between the seated and supine positions in both young healthy individuals and hypertensive patients.23,24 those studies indicated that the effects of orthostatic stress on hemodynamics in fowler s position may be substantial in frail patients . How posture can prevent the hypovolemia and hypotension caused by orthostatic stress during fowler s position is important and should be addressed . Our previous study indicated that fowler s position with an upright upper trunk is effective for maintaining circulatory volume with lower tachycardia via vagal withdrawal compared with having the whole trunk upright in younger subjects.25 however, whether an upright upper trunk in fowler s position allows easy maintenance of circulatory volume in cases with autonomic hypofunction associated with aging remains unclear . We postulated that stroke volume (sv) would be higher and heart rate (hr) would be lower with the upper trunk upright than with the whole trunk upright in fowler s position in both older and younger subjects . In addition, we presumed that the lower hr would be caused by reduced sympathetic activation in older individuals but by reduced vagal withdrawal in younger individuals . The present study was performed as a cross - sectional study to assess our hypothesis with a fundamental study of the effects of the two fowler s positions on hemodynamics and hr variability parameters in healthy older and younger subjects . We assessed hemodynamics and hr variability in 11 male younger subjects (mean age standard error of the mean [sem]: 20.50.2 years; range: 2022 years; weight: 60.61.8 kg; height: 170.21.8 cm) and 11 male community - dwelling older subjects (mean age sem: 69.51.2 years; range: 6479 years; weight: 62.02.1 kg; height: 165.41.8 cm). All subjects were interviewed regarding medical history, and blood pressure was checked after a period of rest . Final decisions on subject selections were made by consultations between a medical doctor and researchers . Potential subjects were excluded when they had a history of cardiovascular disease, respiratory disease or other chronic medical disease, or were not normotensive (systolic bold pressure below 140 mmhg and diastolic blood pressure below 90 mmhg). All subjects in the final analysis were healthy and had no history of chronic or acute cardiovascular or respiratory disease or other chronic diseases . Subjects were instructed to refrain from beverages containing caffeine or alcohol for 24 h before starting experiments and to refrain from eating and drinking after 2,200 h on the day prior to the experiments that started in the morning or to consume a light breakfast before experiments that started in the afternoon . All experiments were implemented between 1,100 and 1,400 h, because blood pressure fluctuates according to a circadian pattern stabilizing at approximately noon . The ethics commission of the international university of health and welfare approved the study, and all participants provided voluntary written consent to participate after being fully informed about the procedure, risks, and protocol . We collected physiological data with the patient in the supine position and two fowler s positions . Prior to experiments, subjects rested in a thermoneutral room at 28c for 15 min and were set up for electrocardiography (ecg), noninvasive arterial pressure monitoring, and impedance cardiography (icg). Measurements in the supine position were made with sufficient time between measurements in the two fowler s positions . Between measurements in each fowler s position, subjects rested for more than 3 min . Data were recorded for 5 min in each of the supine position and the two fowler s positions . Subjects were placed in the fowler s positions on a bed at 30 of lower trunk inclination and 60 of upper trunk inclination (ut60) and 60 of whole trunk inclination (wt60) (figure 1). We defined the upper and lower segments at ut60 around the spinous process of the 10th thoracic vertebra . The height of the bottom of the upper and lower trunk was adjusted according to individual trunk size . All experiments were performed in our laboratory (odawara, kanagawa, japan) under controlled thermoneutral temperature . Hr was estimated from type ii ecg (ecg 100c; biopac systems, goleta, ca, usa) in all experiments . Icg (nico 100c; biopac systems) was performed using eight spot electrodes (vitrode m; nihon kohden, tokyo, japan) attached to the neck and lower thorax of each subject for icg based on a previous study.26 sv was estimated from transthoracic bioimpedance using bernstein s method that has been validated as offering high reliability comparable to the technique of thermodilution.26 icg allows continuous noninvasive evaluation of sv . Noninvasive continuous arterial pressure was measured in the radial artery by tonometry using an arterial pressure monitor (bp-608ev; omron colin, tokyo, japan). Mean arterial pressure (map) was estimated as one third pulse pressure plus diastolic pressure . Ecg, thoracic bioimpedance, and continuous arterial pressure signals were recorded on a personal computer using the mp150 data acquisition system (biopac systems) at a sampling rate of 1 khz . We performed frequency domain and time domain analysis of ecg for the assessment of vagal function . We calculated logarithm - transformed respiratory sinus arrhythmia (ln rsa) from the power spectrum of the rr intervals (0.150.4 hz). We thus calculated the square root of the mean of the sum of the squares of differences between adjacent rr intervals (rmssd), number of pairs of adjacent rr intervals differing by more than 50 ms (nn50) and the proportion derived by dividing nn50 by the total number of rr intervals (pnn50) for 5 min . All parameters of hr variability reflect vagal modulation.27,28 changes in hemodynamic variables from supine and hr variability parameters in the three positions in subjects from the two age groups were compared by two - way mixed - design analysis of variance (anova). When three positions two age group interactions were significant, one - way repeated - measures anova of the three positions in each subject and one - way anova of subjects from the two age groups in each position were used to evaluate simple main effects . Subsequent post hoc analysis to determine differences between the three positions in each age group were evaluated using a paired t - test with shaffer s multiple comparison procedure in each age group.29 the level of statistical significance was set at p<0.05 . Data were statistically analyzed using r for windows version 3.3.0 statistical software (www.r-project.org) and the car 2.14 package . We assessed hemodynamics and hr variability in 11 male younger subjects (mean age standard error of the mean [sem]: 20.50.2 years; range: 2022 years; weight: 60.61.8 kg; height: 170.21.8 cm) and 11 male community - dwelling older subjects (mean age sem: 69.51.2 years; range: 6479 years; weight: 62.02.1 kg; height: 165.41.8 cm). All subjects were interviewed regarding medical history, and blood pressure was checked after a period of rest . Final decisions on subject selections were made by consultations between a medical doctor and researchers . Potential subjects were excluded when they had a history of cardiovascular disease, respiratory disease or other chronic medical disease, or were not normotensive (systolic bold pressure below 140 mmhg and diastolic blood pressure below 90 mmhg). All subjects in the final analysis were healthy and had no history of chronic or acute cardiovascular or respiratory disease or other chronic diseases . Subjects were instructed to refrain from beverages containing caffeine or alcohol for 24 h before starting experiments and to refrain from eating and drinking after 2,200 h on the day prior to the experiments that started in the morning or to consume a light breakfast before experiments that started in the afternoon . All experiments were implemented between 1,100 and 1,400 h, because blood pressure fluctuates according to a circadian pattern stabilizing at approximately noon . The ethics commission of the international university of health and welfare approved the study, and all participants provided voluntary written consent to participate after being fully informed about the procedure, risks, and protocol . We collected physiological data with the patient in the supine position and two fowler s positions . Prior to experiments, subjects rested in a thermoneutral room at 28c for 15 min and were set up for electrocardiography (ecg), noninvasive arterial pressure monitoring, and impedance cardiography (icg). Measurements in the supine position were made with sufficient time between measurements in the two fowler s positions . Between measurements in each fowler s position, subjects rested for more than 3 min . Data were recorded for 5 min in each of the supine position and the two fowler s positions . Subjects were placed in the fowler s positions on a bed at 30 of lower trunk inclination and 60 of upper trunk inclination (ut60) and 60 of whole trunk inclination (wt60) (figure 1). We defined the upper and lower segments at ut60 around the spinous process of the 10th thoracic vertebra . The height of the bottom of the upper and lower trunk was adjusted according to individual trunk size . All experiments were performed in our laboratory (odawara, kanagawa, japan) under controlled thermoneutral temperature . Hr was estimated from type ii ecg (ecg 100c; biopac systems, goleta, ca, usa) in all experiments . Icg (nico 100c; biopac systems) was performed using eight spot electrodes (vitrode m; nihon kohden, tokyo, japan) attached to the neck and lower thorax of each subject for icg based on a previous study.26 sv was estimated from transthoracic bioimpedance using bernstein s method that has been validated as offering high reliability comparable to the technique of thermodilution.26 icg allows continuous noninvasive evaluation of sv . Noninvasive continuous arterial pressure was measured in the radial artery by tonometry using an arterial pressure monitor (bp-608ev; omron colin, tokyo, japan). Mean arterial pressure (map) was estimated as one third pulse pressure plus diastolic pressure . Ecg, thoracic bioimpedance, and continuous arterial pressure signals were recorded on a personal computer using the mp150 data acquisition system (biopac systems) at a sampling rate of 1 khz . We performed frequency domain and time domain analysis of ecg for the assessment of vagal function . We calculated logarithm - transformed respiratory sinus arrhythmia (ln rsa) from the power spectrum of the rr intervals (0.150.4 hz). We thus calculated the square root of the mean of the sum of the squares of differences between adjacent rr intervals (rmssd), number of pairs of adjacent rr intervals differing by more than 50 ms (nn50) and the proportion derived by dividing nn50 by the total number of rr intervals (pnn50) for 5 min . Changes in hemodynamic variables from supine and hr variability parameters in the three positions in subjects from the two age groups were compared by two - way mixed - design analysis of variance (anova). When three positions two age group interactions were significant, one - way repeated - measures anova of the three positions in each subject and one - way anova of subjects from the two age groups in each position were used to evaluate simple main effects . Subsequent post hoc analysis to determine differences between the three positions in each age group were evaluated using a paired t - test with shaffer s multiple comparison procedure in each age group.29 the level of statistical significance was set at p<0.05 . Data were statistically analyzed using r for windows version 3.3.0 statistical software (www.r-project.org) and the car 2.14 package . Figure 2 shows the results of changes in hemodynamic variables from supine at all positions . Change in hr (hr) increased and change in sv (sv) decreased with the change from supine to an upright trunk in younger and older subjects . Two - way mixed - design anova of hr and sv revealed significant main effects of the three positions (hr, f = 31.73; sv, f = 15.73; p<0.05), but no significant main effects of the two age groups (p>0.05) and no significant three positions two age groups interactions (p>0.05). Multiple comparisons for each age group showed that hr (ut60 and wt60 in younger, 2.91.2 beats / min and 6.61.4 beats / min, respectively; ut60 and wt60 in older, 2.80.7 beats / min and 5.00.9 beats / min, respectively) was significantly lower at ut60 than at wt60 and at supine than at ut60 and wt60 . In addition, sv (ut60 and wt60 in younger, 4.42.8 ml and 13.72.9 ml, respectively; ut60 and wt60 in older, 0.33.3 ml and 7.43.1 ml, respectively) was significantly higher at ut60 and supine than at wt60 in older and younger subjects (p<0.05). Anova for changes in q (q: ut60 and wt60 in younger, 0.10.2 l and 0.30.2 l, respectively; ut60 and wt60 in older, 0.20.2 l and 0.00.2 l, respectively) revealed a significant main effect of the three positions (q, f = 3.55, p<0.05) but no significant main effect of the two age groups (p>0.05) and no significant interaction of three positions two age groups (p>0.05). Multiple comparisons among each age group showed no significant differences between the three positions (p>0.05). Anova of changes in map (map: ut60 and wt60 in younger, 1.21.9 mmhg and 4.24.0 mmhg, respectively; ut60 and wt60 in older, 0.52.8 mmhg and 2.72.6 mmhg, respectively) revealed no significant main effects for the three positions (p>0.05) or two age groups (p>0.05) and no significant interaction of the three positions two age groups (p>0.05). Although all parameters decreased with the change from supine to upright trunk in younger subjects, significant differences were not seen between all positions in older subjects . These parameters in older subjects were lower compared with younger subjects for each position (table 2). Two - way mixed - design anova of ln rsa, rmssd, nn50, and pnn50 revealed significant main effects of the three positions (p<0.05) and two age groups (p<0.05) but significant three positions two age groups interactions (p<0.05). Post hoc analysis revealed significant simple main effects of the three positions in younger subjects (ln rsa in younger, f = 8.67; rmssd in younger, f = 6.71; nn50 in younger, f = 5.95; pnn50 in younger, f = 7.12; p<0.05) but no significant simple main effect of the three positions in older subjects (p>0.05) and significant simple main effects of the two age groups among each position (ln rsa of supine, f = 34.6; rmssd of supine, f = 25.18; nn50 of supine, f = 27.45; pnn50 of supine, f = 29.77; ln rsa of ut60, f = 24.72; rmssd of ut60, f = 19.87; nn50 of ut60, f = 20.43; pnn50 of ut60, f = 19.46; ln rsa of wt60, f = 14.36; rmssd of wt60, f = 4.95; nn50 of wt60, f = 6.59; pnn50 of wt60, f = 6.12; p<0.05). Multiple comparisons among the three positions showed that all hr variability parameters were significantly higher at ut60 and supine position than at wt60 in younger subjects (p<0.05). Figure 2 shows the results of changes in hemodynamic variables from supine at all positions . Change in hr (hr) increased and change in sv (sv) decreased with the change from supine to an upright trunk in younger and older subjects . Two - way mixed - design anova of hr and sv revealed significant main effects of the three positions (hr, f = 31.73; sv, f = 15.73; p<0.05), but no significant main effects of the two age groups (p>0.05) and no significant three positions two age groups interactions (p>0.05). Multiple comparisons for each age group showed that hr (ut60 and wt60 in younger, 2.91.2 beats / min and 6.61.4 beats / min, respectively; ut60 and wt60 in older, 2.80.7 beats / min and 5.00.9 beats / min, respectively) was significantly lower at ut60 than at wt60 and at supine than at ut60 and wt60 . In addition, sv (ut60 and wt60 in younger, 4.42.8 ml and 13.72.9 ml, respectively; ut60 and wt60 in older, 0.33.3 ml and 7.43.1 ml, respectively) was significantly higher at ut60 and supine than at wt60 in older and younger subjects (p<0.05). Anova for changes in q (q: ut60 and wt60 in younger, 0.10.2 l and 0.30.2 l, respectively; ut60 and wt60 in older, 0.20.2 l and 0.00.2 l, respectively) revealed a significant main effect of the three positions (q, f = 3.55, p<0.05) but no significant main effect of the two age groups (p>0.05) and no significant interaction of three positions two age groups (p>0.05). Multiple comparisons among each age group showed no significant differences between the three positions (p>0.05). Anova of changes in map (map: ut60 and wt60 in younger, 1.21.9 mmhg and 4.24.0 mmhg, respectively; ut60 and wt60 in older, 0.52.8 mmhg and 2.72.6 mmhg, respectively) revealed no significant main effects for the three positions (p>0.05) or two age groups (p>0.05) and no significant interaction of the three positions two age groups (p>0.05). Although all parameters decreased with the change from supine to upright trunk in younger subjects, significant differences were not seen between all positions in older subjects . These parameters in older subjects were lower compared with younger subjects for each position (table 2). Two - way mixed - design anova of ln rsa, rmssd, nn50, and pnn50 revealed significant main effects of the three positions (p<0.05) and two age groups (p<0.05) but significant three positions two age groups interactions (p<0.05). Post hoc analysis revealed significant simple main effects of the three positions in younger subjects (ln rsa in younger, f = 8.67; rmssd in younger, f = 6.71; nn50 in younger, f = 5.95; pnn50 in younger, f = 7.12; p<0.05) but no significant simple main effect of the three positions in older subjects (p>0.05) and significant simple main effects of the two age groups among each position (ln rsa of supine, f = 34.6; rmssd of supine, f = 25.18; nn50 of supine, f = 27.45; pnn50 of supine, f = 29.77; ln rsa of ut60, f = 24.72; rmssd of ut60, f = 19.87; nn50 of ut60, f = 20.43; pnn50 of ut60, f = 19.46; ln rsa of wt60, f = 14.36; rmssd of wt60, f = 4.95; nn50 of wt60, f = 6.59; pnn50 of wt60, f = 6.12; p<0.05). Multiple comparisons among the three positions showed that all hr variability parameters were significantly higher at ut60 and supine position than at wt60 in younger subjects (p<0.05). The major findings of the present study were as follows: 1) the reductions in sv and tachycardic response were smaller with the upper trunk upright compared with the whole trunk upright, in healthy young and older individuals, and 2) the reduced tachycardic response with the upright upper trunk would be caused by decreased vagal withdrawal in younger subjects and reduced sympathetic activation in older subjects . Orthostatic stress reportedly occurs with the shift in blood volume to the abdomen and legs in healthy individuals.30,31 at ut60, subdivision of the trunk into upper and lower segments was defined by the spinous process of the 10th thoracic vertebra, under the presumption that since the heart is located close to the center of rotation of the bottom of the dorsal thorax, even if the upper trunk is upright, the level of the heart is lower with ut60 than with wt60 . In addition, the abdomen and pelvic segments at ut60 were not upright compared with wt60 . Orthostatic stress might therefore be smaller at ut60 than at wt60, suggesting differences in the distribution of the blood volume shift to lower parts of the body at ut60 compared to wt60 in both subject groups . Moreover, these results were observed to be similar to the findings of our previous study in healthy young subjects.25 some previous studies have reported the effects of advancing age on sv under orthostatic stress induced by lower body negative pressure (lbnp). These previous studies revealed that the reduction of sv was significantly lower among older individuals than among younger individuals under higher lbnp, although changes in sv did not differ between age groups under lower level lbnp.32,33 tsutsui et al . Indicated that hypovolemia was less among older subjects than among the younger during higher level lbnp because leg compliance in the older subjects was reduced according to decreased capacitance function with age.33 with the present findings, significant differences in sv between age groups with the two fowler s positions were not observed . These results appear similar to previous findings during lower level lbnp but appear to differ from previous findings for higher - level lbnp.33 in fowler s position, since only the trunk and head were upright and the lower extremities were similar to the level in the supine position, orthostatic stress would be limited . Differences in leg compliance with aging were thus indicated to have no effect on differences in sv between younger and older subjects, because the shift in blood volume to the lower extremities was regarded as too small . In this study, sv was less than approximately 14 ml during the two fowler s positions in both age groups . Positive hr occurred with the change from supine to upright trunk and hr was lower at ut60 than at wt60 in both age groups . These tachycardic responses were suggested to be the result of the negative sv being lower at ut60 than at wt60 . However, since all hr variability parameters in older subjects differed from those of younger subjects in the three positions, the mechanisms underlying the tachycardic responses reflected in the present results were suggested to differ between younger and older subjects . Generally, tachycardic response less than 100 beats / min is attributed to vagal withdrawal.34 we therefore concluded that the tachycardic responses in the present results were caused by vagal withdrawal in younger subjects . In addition, vagal withdrawal would be lower at ut60 than at wt60 because ln rsa, rmssd, nn50, and pnn50 were higher at ut60 compared with wt60 in younger subjects . However, no significant differences were seen among all positions and ln rsa, rmssd, nn50, and pnn50 were lower in older subjects than in younger subjects in each position . Vagal function is well known to reduce with age.912 these results suggested that vagal function was reduced in older subjects and tachycardic response was caused by mechanisms other than vagal withdrawal . Nevertheless, the tachycardic response was significantly different between the two fowler s positions in older subjects . Some previous studies have indicated that sympathetic nerve function and sympathetic baroreflex function are maintained with age.10,32,3537 the tachycardic response of older subjects with an upright trunk might thus be suggested to result from sympathetic activation in the present study, rather than vagal withdrawal . From the above, compared with wt60, ut60 might inhibit decreases in sv and inhibit tachycardic response by reducing vagal withdrawal in younger subjects and by reducing sympathetic activation in older subjects . Although sv was higher at ut60 than at wt60 in both age groups, q and map did not differ between the two fowler s positions in either age group or between the two age groups in either fowler s position . These results suggest that the tachycardic response and vasomotor contraction response maintained q and map to compensate for reduced sv under orthostatic stress regardless of age . Such findings may be attributed to the regulation of tachycardic response and vasomotor contraction via vagal withdrawal in younger individuals and via sympathetic activation in older individuals . Our findings indicate that an upright upper trunk during fowler s position allowed maintenance of sv and inhibited tachycardic response compared to an upright whole trunk regardless of age, although the autonomic mechanisms underlying tachycardic responses differed between younger and older adults . An upright upper trunk in fowler s position might help to reduce orthostatic stress and facilitate routine activities and conversation in frail patients . Some studies have suggested that leg compression bandaging could prevent orthostatic hypotension in older patients.2,38 although that method might indeed be effective, that approach requires a more time - consuming procedure and the patient may feel a sense of uncomfortable restriction from the bandaging . Our proposed method offers the advantages that the procedure to tilt the upper trunk is very simple and patients do not require compression bandaging or use of stockings to maintain circulatory volume when the patient wants to raise the body on the bed . The present results suggest that reduced tachycardic response with an upright upper trunk may be regulated by reduced sympathetic activation compared with having the whole trunk upright during fowler s position in older subjects . However, the present study did not directly assess sympathetic nerve activity in the two fowler s positions or while supine . To corroborate our findings, confirmation by direct measurement of sympathetic nerve activity or venous plasma norepinephrine concentration in fowler s positions in younger and older subjects may be necessary . In consideration of using a fowler s position such as ut60 at clinical sites, validation in patients with orthostatic intolerance is needed because the influences of an upright upper trunk on hemodynamics and cardiovascular regulation in such patients have yet to be completely clarified . We demonstrated that an upright upper trunk during fowler s position allowed maintenance of sv and inhibited tachycardic responses compared to having the whole trunk upright in both younger and older subjects . Such inhibition of tachycardic responses might be caused by reduced vagal withdrawal in younger subjects and by reduced sympathetic activation in older subjects . An upright upper trunk during fowler s position might be useful to maintain circulatory volume for reduced orthostatic stress and to facilitate daily activities in frail patients at clinical sites.
Alzheimer's disease (ad) is a progressive, neurodegenerative brain disorder which affects over 37 million people worldwide with an estimated global cost of over $600 billion in 2010 [1, 2]. Ad is a growing socioeconomic and financial burden due to its strong correlation with ageing; around 1 in 3 people aged over 80 years have ad, which means that a rapid rise in ad cases is anticipated as life expectancy continues to increase . Although several therapeutics are currently available to slow disease progression, there is currently no way to halt or prevent ad . Ad is characterized by the presence of extracellular senile plaques and intracellular neurofibrillary tangles in the brain . The major constituents of senile plaques are the amyloid- (a) peptides, which are derived from the proteolytic processing of the amyloid precursor protein (app) within lipid rafts . The a peptide, notably a142, is highly aggregation prone and self - assembles to form a heterogeneous mixture of oligomers and protofibrils, ultimately depositing as fibrils in senile plaques . An accumulating body of evidence indicates that soluble a oligomers, which correlate strongly with disease onset and severity, are the major neurotoxic species in ad [58]. Although a oligomers are neurotoxic at nanomolar concentrations and cause ad - related memory deficits, the cellular mechanisms of toxicity are poorly characterised . Recently, several neuronal receptors which bind a oligomers have been identified, including the cellular prion protein (prp) and glutamate receptors [10, 11] among others . Interestingly, these receptors reside primarily within, or partition into, cholesterol - rich microdomains within the plasma membrane known as lipid rafts . The three steps which underlie a oligomer - mediated neuropathology in ad, are (1) a production, (2) a assembly into oligomers and (3) a oligomers interacting with neuronal receptors . Crucially, all three of these processes occur in lipid raft domains of the plasma membrane which are considered to play a key role in the development of ad . In this paper, we will outline the pivotal role that lipid rafts play in linking together the generation, self - assembly and toxicity of a oligomers, which underlie the development of the neuropathology in ad . A major focus will be upon the interaction between a oligomers and their putative cellular receptors . The multitude of different lipids and proteins within the plasma membrane were once thought to be distributed homogeneously across the entire lipid bilayer, as proposed by the fluid mosaic model in 1972 . However, the plasma membrane is now known to be more akin to a sea of disordered phospholipids, in which float microdomains with distinct lipid compositions, known as lipid rafts . Lipid rafts are small (10200 nm), heterogeneous and highly dynamic assemblies that are enriched in specific components, namely cholesterol and sphingolipids (figure 1) [14, 15]. Biochemically, lipid rafts are defined by their relative insolubility in nonionic detergents at low temperature, conferring upon them the alternative name, detergent - resistant membranes (drms). Lipid rafts are also known as liquid - ordered domains because the highly saturated sphingolipid acyl chains enable closer lipid packing, and therefore more restricted lateral movement, than the mainly unsaturated acyl chains of the phospholipids in the surrounding nonraft regions of the membrane . Functionally, lipid rafts serve to compartmentalise cellular processes by concentrating certain proteins and lipids within the same microenvironment . Lipid rafts are particularly enriched in glycosyl - phosphatidylinositol (gpi)-anchored and acylated proteins due to the preferential intercalation of the saturated acyl chains into the liquid - ordered environment . Other proteins can also associate with lipid rafts either directly or through binding to other cofactors or ligands . The dynamic clustering and pinching off of lipid rafts regulates the spatial and temporal assembly of signalling and trafficking molecules, forming short - lived but vital signalling platforms . Lipid rafts are implicated in various essential cellular functions, including signal transduction, cell adhesion and protein / lipid sorting . Of particular relevance here are cell signalling, sorting and axon guidance, as these processes are essential for neural development and synaptic plasticity [19, 20]. Crucially, neuronal lipid rafts are also required for the maintenance of dendritic spines and healthy synapses, which are vital for neural communication including learning and memory; processes which fail in ad . The observation that lipid rafts are much more abundant in mature hippocampal neurons than in other cell types emphasises their physiological importance within the memory centre of the healthy brain, and may explain why hippocampal neurons are a primary target for a oligomer toxicity and destruction in ad . Lipid rafts are involved in the regulation of app processing and the generation of the a peptide which is the driving force in ad pathology [23, 24]. For comprehensive reviews detailing the involvement of membrane rafts in ad and a production, the a peptide is produced by the lipid raft dependent amyloidogenic processing of its precursor protein, app (figure 1). The amyloidogenic cleavage of full - length app is initiated by the -site app cleaving enzyme-1 (bace1), a transmembrane aspartic metalloprotease . A large, soluble ectodomain (sapp) is released to leave behind a membrane - anchored c - terminal fragment (c99) which retains the intact a sequence . The second amyloidogenic cleavage of app involves a -secretase complex which contains presenilin-1 or presenilin-2 (the catalytic component), presenilin enhancer-2 (pen2), nicastrin and anterior pharynx defective-1 (aph1). The -secretase complex cleaves the remaining c99 stub to release a peptides of between 3942 residues in length, depending upon the precise cleavage site, along with the app intracellular domain (aicd). Although the majority of full - length app is localised to nonraft regions of the plasma membrane, where nonamyloidogenic cleavage by the -secretases adam 9, 10, and 17 precludes a formation, a subset of both app and bace1 partitions into lipid rafts along with -secretase components . Both bace1 and the -secretase subunits undergo posttranslational s - palmitoylation which aids their targeting to lipid raft domains . In the case of app, a direct interaction with cholesterol the major component of lipid rafts was recently identified . High cholesterol increases the partitioning of app, along with bace1 and -secretase components, into lipid rafts . A large body of evidence points towards lipid rafts being the physiological site of amyloidogenic a production by bace1 and the -secretase complex . For example, both the copatching of app and bace1 by cross - linking antibodies and the exclusive targeting of bace1 to lipid rafts by the addition of a gpi - anchor significantly increased app cleavage at the -secretase site . Furthermore, enrichments in lipid raft components, namely cholesterol and ganglioside gm1, promote the generation of a [31, 33]. All four of the -secretase subunits are also enriched and active within lipid raft fractions derived from human brain [34, 35] and lipid raft - type membranes in vitro [36, 37]. In the brain, the majority of a is found within detergent - resistant, glycolipid - enriched rafts, along with -secretase components . The composition of lipid rafts purified from ad brains has been shown to be abnormal, with the rafts being more ordered and more viscous, which implies that the modulation of lipid raft composition may present a therapeutic avenue for modulating ad - related neuropathology . This has led to a number of researchers investigating whether depleting lipid raft components could lower a production and therefore prevent ad . Cholesterol, being a major component of lipid rafts and a risk factor for ad, was the obvious choice to target . For a recent review of the involvement of cholesterol in ad, cholesterol depletion has indeed been shown to reduce app partitioning into lipid rafts which precludes its interaction with bace1 and -secretase components, thus lowering a production . Hypercholesterolaemia is linked to increased a production and deposition in the brain, both in humans [4345] and in rodents [4648] and is linked to an increased risk of developing ad . Cholesterol depletion also lowers a production in cultured cells and one study showed that a 70% reduction in cholesterol in living hippocampal neurons was sufficient to completely abolish a production . Taking this into account, cholesterol - lowering drugs known as some retrospective epidemiological studies have shown that the administration of statins, which lower cholesterol levels, can reduce the incidence of dementia, including ad [5153]. However, other studies have shown no correlation between statin usage and dementia and the effect of statins upon disease progression and cognitive decline in ad patients has been challenged . Intriguingly, it was revealed recently that a production actually reduces cholesterol in cultured cells of neuronal origin by increasing efflux, possibly acting as a chaperone to remove excess cholesterol from the brain to the circulation . Although a reduction in cholesterol may go some way towards reducing a levels in the brain, much longer - term epidemiological studies and clinical trials initiated before significant neuronal loss and cognitive function are apparent are required in order to further elucidate the effects of lowering cholesterol levels upon ad onset and neuropathology . Lipid rafts contain many essential components other than cholesterol, such as sphingolipids, and it is likely that the modulation of just one factor will not completely abolish a production in vivo . It is important to remember that cholesterol metabolism in the brain is largely isolated from the rest of the body by the blood - brain barrier . As nearly all of the cholesterol in the brain is synthesised in situ, the modulation of cholesterol levels within neurons represents a more difficult pharmaceutical challenge and the blood - brain barrier permeability of the drugs used needs to be considered . Furthermore, even if cholestxerol depletion mediates a reduction in a levels, a oligomers effect neurotoxicity and memory impairments at low nanomolar concentrations . Therefore, residual levels of a production may be sufficient for continued a oligomer - mediated toxicity . The a peptide is natively unfolded and, under certain conditions, it aggregates to form a heterogeneous mixture of soluble oligomers, protofibrils and fibrils . It was accepted for a long time that the a fibrils that deposit in neuritic plaques, which are observed post mortem in diseased brains, were responsible for neurotoxicity in ad . A fibrils have been reported to induce neuronal dysfunction and cell death, although fibrils are less potent neurotoxins than soluble forms of a [60, 61]. Interestingly, fibrils have been found to become more neurotoxic upon fragmentation, raising the possibility that soluble species released from fibril ends may underlie their neurotoxicity . A plethora of studies have now demonstrated that levels of soluble a oligomers in the brain correlate much better than plaques or fibrils with ad onset, progression and severity [5, 6, 8, 63, 64]. Within the last fifteen years, a large number of studies from research groups worldwide have reported the existence of many different oligomeric assemblies from various sources, including ad brain and cerebrospinal fluid (csf) samples, secreted into the conditioned medium of cultured cells or prepared artificially from recombinant or synthetic a peptides . A heterogeneous range of sizes and peptide conformations have been observed among these natural and artificial a oligomers, including dimers and trimers [66, 67], tetramers, hexamers and the dodecameric a*56, globulomers, ring - shaped annular protofibrils and higher molecular weight a-derived diffusible ligands (addls) which can comprise hundreds of monomeric subunits [9, 70] (figure 2). However, despite the disparity in size and source, a oligomers appear to share important functional properties . Notably, both natural and synthetic a oligomer preparations bind to hippocampal neurons and cells of neuronal lineage, causing a loss of dendritic spines, neurotoxicity, the inhibition of long - term synaptic potentiation (ltp: an electrophysiological correlate of learning and memory) and impairments in working memory at nanomolar concentrations [64, 67, 68, 7073]. The preferential binding and toxicity of a oligomers towards neurons in the hippocampus may explain why a oligomers correlate with ad severity and disease progression [9, 68, 70]. A is a physiological peptide which is present in the brain tissue and csf of healthy subjects throughout life, without necessarily causing neurodegeneration [7476]. Many studies have shown that monomeric, nonaggregated a does not cause the neurotoxic effects that are mediated by a oligomers . In fact, monomeric a has recently been reported to have neuroprotective roles in the brain [77, 78]. The aggregation of a is necessary for its toxicity and the emerging picture is that soluble a oligomers are the proximate neurotoxins in ad [8, 80]. The aggregation of a is therefore a critical step in the development of ad pathogenesis, and one in which lipid rafts appear to play a fundamental role . Neuronal sensitivity to a-induced toxicity has been found to be dependent upon a binding to the cell membrane and a has been identified in lipid rafts from cultured cells and from human and rodent brains . Soluble a dimers accumulate rapidly, and have been found at elevated levels, in lipid raft fractions isolated from human and transgenic mouse model ad brains . Importantly, a has been shown to accumulate in presynaptic terminals in ad cortex where it colocalises with the lipid raft markers cholesterol and ganglioside gm1 . Taken together, these data suggest that a accumulation and aggregation within lipid rafts may underlie ad neuropathology . As cholesterol is a major component of lipid rafts, it was postulated to facilitate a oligomerisation on neuronal membranes . The brain is particularly enriched in cholesterol, harbouring over 23% of the body's total complement but comprising only around 2% of total body mass . However, the role of cholesterol in promoting the assembly of a is controversial and conflicting evidence has been presented in recent years . The main difficulty is being able to distinguish between the key role of cholesterol in building the lipid raft domains necessary for a production and the suggested role of cholesterol in promoting a oligomerisation . As discussed previously, raised cholesterol has been linked to ad; is this solely due to an increase in total lipid raft composition of the plasma membrane which increases amyloidogenic processing of app to yield more a peptide or due to a direct effect on a oligomerisation? A growing body of evidence suggests that certain components of lipid raft domains may play a much more sinister role in catalysing the conversion of the aggregation - prone a peptide to its neurotoxic, oligomeric states . Cholesterol is known to modulate the interaction of the a peptide with lipid bilayers . Further, a oligomers isolated from ad patients associate with drms in a cholesterol - dependent manner, and cholesterol depletion reduces the aggregation of a . It is currently unknown, however, whether this latter effect is due to a direct interaction between a and cholesterol, or due to the overall depletion in lipid raft domains and/or the subsequent change in composition and properties brought on by a reduction in cholesterol . Conversely, a recent study revealed that increasing the level of cholesterol in human neuroblastoma cells actually reduced the ability of synthetic a oligomers to bind, in spite of the colocalisation of the a oligomers with the lipid raft component ganglioside gm1 . These data agree with the authors' previous finding that an increased level of membrane cholesterol exerts a protective effect against a oligomer toxicity . In the more recent study it was proposed that a fluctuation in cholesterol levels may alter the physical properties of lipid rafts thereby modulating oligomer binding . Cholesterol can also facilitate a aggregation through the structural modification of other lipid raft components . A recent study using reconstituted membranes revealed a structural role for cholesterol in modulating the conformation of glycosphingolipids . Depending on the type of glycosphingolipid, cholesterol can either facilitate (such as for ganglioside gm1) or inhibit the interaction of a peptides with lipid rafts through fine - tuning of the glycosphingolipid conformation . This reinforces the notion that a binding to, and aggregation upon, neuronal lipid raft domains cannot be ascribed to a single component, but rather that multiple players are likely to be involved . In fact, mounting evidence suggests that gangliosides within lipid rafts appear to be the main driving force behind the oligomerisation of a on neuronal membranes . The development of ad within certain brain regions has been found to correlate with increased ganglioside levels . Gangliosides are glycosphingolipids with one or more sialic acid moieties attached to the sugar chain . Gangliosides are found predominantly in the central nervous system, where they are enriched in lipid rafts due to the preferential packing of their saturated acyl chains within the liquid - ordered phase . A study in 1995 revealed that a population of membrane - bound a tightly bound to gangliosides exists in ad brains . More recently, exogenously - applied a was shown to bind to neuronal membranes and to redistribute into lipid rafts where it colocalised with ganglioside gm1 in a time - dependent manner . Gm1 facilitated the binding and accumulation of a oligomers at lipid raft domains and appeared to be required for the a oligomer - mediated lipid peroxidation of drms . Ganglioside gm1 contains just one sialic acid moiety and plays important physiological roles in neuronal function . A appears to interact with the sialic acid moiety of gangliosides such as gm1 and these bound aggregates can go on to seed further a aggregation . The interaction between sialic acid and a induces a conformational rearrangement of the a peptide chain which may potentiate a oligomerisation . Drms derived from ganglioside - rich rat brain, but not from liver, were found to promote the oligomerisation of a . Further, this study revealed that the removal of cholesterol or protein from these raft fractions did not prevent a aggregation, providing evidence that neither cholesterol nor protein is essential for this process . However, lipid raft fractions containing very low levels of gangliosides still retained some a oligomerisation ability, and therefore ganglioside - independent aggregation mechanisms cannot be ruled out . When the first synthetic a oligomers were prepared from a142 peptide by the klein laboratory in 1998, it was observed that their binding to hippocampal neurons and cultured nerve cells was abolished by treating the cells with trypsin . This, coupled with the low oligomer concentration (5 nm) required for neurotoxicity, implied that specific protein receptors were responsible for the binding of a oligomers and for the subsequent transduction and amplification of neurotoxicity . Indeed, a recent study found that a oligomer binding to neurons was saturable with an estimated apparent kd of ~0.4 nm . This finding implied that one or more high - affinity receptors are responsible for a oligomer binding and subsequent neurotoxicity . Immunofluorescence microscopy has revealed that a oligomers bind to dendritic spines of hippocampal neurons where they colocalise with postsynaptic markers [9, 98, 99]. Interestingly, a oligomer binding to neurons has a punctate appearance, which is reminiscent of the appearance of lipid raft localised proteins . Several putative neuronal receptors for a have been identified in recent years, namely proteins that are related to mechanisms of memory and neuroprotection in the brain . Noteworthy, all of these receptors either reside primarily within, or can partition into, lipid raft domains at the surface of neurons . Lipid rafts may therefore hold the key to understanding how the deleterious effects of a oligomers are transduced through binding to specific receptors within these microdomains . In 2009, laurn and colleagues reported that the cellular prion protein (prp) is a specific, high - affinity neuronal receptor for a142 oligomers . Prp is a gpi - anchored protein that is expressed at high levels in the brain, particularly at synapses and axons, where it resides in lipid rafts . The misfolded form of the prion protein (prp) is infamous for being the causative agent in mad cow disease (bovine spongiform encephalopathy, bse) and its human equivalent, creutzfeldt - jakob disease (cjd). Although the correctly - folded prp is critical for prion disease pathogenesis, its physiological function remains enigmatic, with potential neuroprotective roles in oxidative stress defence, metal ion homeostasis and antiapoptosis . In a search to identify neuronal receptors for a oligomers, laurn et al . Screened a mouse brain expression library of 225,000 cdna constructs from which only two positive clones, both encoding full - length prp, were isolated that were able to bind a oligomers with high affinity and specificity . Interestingly, the prp homologues shadoo and doppel were found not to bind a oligomers to any significant degree . A further, more focussed screen of 352 clones encoding transmembrane proteins identified amyloid- precursor - like protein 1 (aplp1) and transmembrane protein 30b (tmem30b) as weak a receptors, although their specificity for oligomeric a was poor . The 7 nicotinic acetylcholine receptor (nachr7) and the receptor for advanced glycation end products (rage) were also assayed due to their previously reported affinities for a peptides [103, 104], although neither displayed high - affinity a oligomer binding . Therefore, prp was the only identified receptor to display both high affinity and high specificity for a oligomers . A direct interaction between prp and a oligomers was confirmed and the core oligomer binding region of prp was narrowed down to amino acids 95110, a positively charged cluster rich in lysine residues . Prp was also shown to mediate the inhibition of ltp that is induced when hippocampal slices were incubated with a oligomers at nanomolar concentrations . A follow - up in vivo study revealed that the presence of prp is required for the a oligomer - mediated memory impairments in an ad model mouse . Taken together, these data indicate a strong association between a oligomers binding to prp within lipid rafts of hippocampal neurons and the induction of memory deficits that are characteristic of ad . Nevertheless, there has been some dispute over the role of prp in transducing the deleterious effects of a oligomers in vivo, as other studies have reported data which oppose this theory . First, balducci and colleagues reported that although a oligomers bind tightly to prp they cause impairments in long - term memory in mice independently of prp . In this study, the effects of synthetic a oligomers upon wild - type mice were observed, whereas gimbel et al . Further, the synthetic depsipeptide and the oligomer preparation method utilised by balducci et al . Differed from those used by gimbel and coworkers, raising the possibility that prp does not have the same binding affinity for all types of a oligomers . Second, the aguzzi group crossed an ad mouse model, which suffers from a-dependent memory deficits in the form of ltp impairment, with mice expressing either wild - type prp, a secreted form of prp (lacking its gpi anchor) or no prp . They found that the presence or absence of wild - type prp had no effect upon the a-mediated inhibition of ltp . However, expression of the secreted form of prp was found to suppress the impairment in ltp, which the authors proposed may be due to the potential chelation and subsequent degradation of a oligomers by soluble prp in the extracellular milieu . Third, kessels and coworkers reported the influence of prp upon hippocampal neurons expressing a c - terminally truncated form of app in a viral expression construct . The same loss of dendritic spines and inhibition of ltp were observed in the presence and absence of prp, suggesting that a-mediated synaptic defects do not require prp . However, laurn and colleagues have emphasised the differences in the model system utilised by kessels and coworkers in their study which may account for the opposing data, namely the viral expression of app, a higher concentration of a oligomers and a difference in the observed suppression of synaptic plasticity . Further investigation is needed to clarify the role of prp in modulating the a oligomer - mediated impairments in memory and ltp . Differences in the oligomer preparations, age and genotype of the mouse models, the nature of the promoter elements driving gene expression and the particular memory tests employed by the different authors may account for the discrepancies in the data . The binding of a oligomers to prp is not the first time that prp has been linked to ad . Senile plaques from a subset of ad patients were observed to contain prp and abundant a deposits have been observed in some cjd cases . Furthermore, the met / val 129 polymorphism in the prnp gene that encodes prp is a risk factor for early - onset ad . In 2007, we demonstrated that prp negatively modulates a production through inhibition of the app cleaving enzyme, bace1 . These data, along with the recent discovery that prp binds to a oligomers and transduces their deleterious effects, raises the intriguing possibility of a feedback loop . We propose that, physiologically, prp maintains a production at a low level through bace1 inhibition, but in ad this interaction may be disrupted by a oligomers binding to prp and causing its segregation from bace1 . Therefore, a oligomers binding to prp may also promote their own production through the ablation of bace1 inhibition by prp . More recently, levels of prp have been shown to be reduced in ad brains [115, 116] possibly arguing against prp being involved in mediating the neurotoxic effects of a oligomers, at least in the terminal stages of the disease . It is important to note that laurn and colleagues reported that the removal of prp from hippocampal neurons only reduced a oligomer binding by approximately 50% . This suggests that other receptors not identified in the expression library screen due to nonpreferential binding conditions or a low affinity for the particular type of a oligomers that were used, and/or nonprotein lipid raft components, may play equally crucial roles in a oligomer binding and neurotoxicity . Glutamate receptors, which possibly exist in a complex with prp, represent a candidate interacting partner for a oligomers which could explain the deleterious effects upon hippocampal synaptic plasticity . Synaptic failure and impairments in synaptic plasticity are hallmarks of early ad neuropathology [100, 118, 119]. Ltp and long - term depression (ltd) are mechanistic dimmer switches which facilitate synaptic plasticity by strengthening or weakening communication across a synapse, respectively, with ltp being essential for hippocampal - dependent learning and memory [120, 121]. Numerous lines of study have confirmed that soluble a oligomers from various sources, including those isolated from ad brains, disrupt hippocampal ltp in vitro and in vivo and cause impairments in learning and memory [9, 67, 70, 107, 122, 123]. Although not all studies agree, it has also been demonstrated that a oligomers can provoke ltd which opposes ltp [67, 124, 125]. Neuronal receptors which modulate ltp and/or ltd are therefore likely candidates for the specific binding of a oligomers . Additionally, glutamate receptor dysfunction has been implicated in ad which is characterised by memory deficits caused by impaired synaptic plasticity . Glutamate receptors consist of two classes; ionotropic (cation - specific ion channels) and metabotropic (g - protein - coupled). N - methyl - d - aspartate receptors (nmdars) constitute a major class of glutamate receptors in the mammalian brain which localise to the postsynaptic membrane of excitatory synapses . The membrane channel is usually blocked by mg ions which are displaced when synaptic transmission results in depolarisation and glutamate release and binding . Nmdar channel opening leads to the rapid influx of ca which triggers ltp induction . Longer - term effects which maintain the reinforced synapse include the activation of -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (ampars), altered gene expression and kinase activity and the growth of new dendritic spines . Interestingly, nmdar activation can also stimulate ltd, having the opposing effect of synapse weakening, and this appears to depend upon the nature of the stimulus and the subtype of nmdar involved . Nmdars localise to lipid raft domains where they interact with flotillins [131, 132] although they can move laterally between raft and nonraft domains in response to cues including phosphorylation . Statins, which deplete cellular cholesterol thus reducing lipid raft formation, have been shown to reduce the localisation of nmdars to lipid raft domains, which has a neuroprotective effect . Mounting evidence points towards a central role for nmdars in the modulation of a oligomer toxicity . Soluble a oligomers inhibit nmdar - dependent ltp [70, 135] and exhibit postsynaptic binding to hippocampal neurons which express nmdar subunits glun1 and glun2b . A reduction in nmdar subunits glun1 and glun2b crucially, a recent study has confirmed that a oligomer - mediated early synaptic dysfunction depends upon the activation of glun2b - containing nmdars . A oligomers were found to decrease the nmdar - dependent influx of ca into dendritic spines, and to reduce dendritic spine and synapse density in a mechanism which involve the subsequent phosphorylation of tau . Nmdar antagonists, including one which is specific for glun2b subunits, were able to reverse the a-induced loss of dendritic spine density [100, 137, 139]. These effects are consistent with a oligomers blocking the nmdar - mediated stimulation of ltp whilst promoting nmdar - mediated ltd . In addition, a oligomers have been shown to stimulate the excessive generation of reactive oxygen species (ros) through an nmdar - dependent mechanism, suggesting a link between aberrant ros regulation and a-induced cognitive impairment . Furthermore, evidence to confirm a direct interaction between a oligomers and nmdar subunits has recently been presented . Partial colocalisation was observed between nmdar glun2b and a oligomers in hippocampal slices, which increased upon the addition of glutamate, although the maximum colocalisation was less than 50% . However, an indirect model proposed by venkitaramani and colleagues suggests that the a oligomer - mediated decrease in glun2b - containing nmdars results from the former binding to -7 nicotinic acetylcholine receptors (7nachr), which activates striatal - enriched tyrosine phosphatase (step), in turn stimulating nmdar internalisation . More recent data has revealed elevated levels of step in a mouse model of ad and in human ad brains, and that the removal of step abrogates the a-mediated reduction in nmdars at the cell surface . Whether or not a oligomers interact with nmdars directly, growing evidence suggests that nmdars play an important role in transducing the deleterious effects of a oligomers upon synaptic functionality . The mglur5 metabotropic glutamate receptor plays important regulatory roles in neuronal calcium mobilisation and the modulation of ltp and excitatory postsynaptic potentials in hippocampal neurons [144, 145]. Recently, mglur5 was identified as a novel a oligomer receptor in a study of the behaviour of fluorescently - labelled a oligomers on hippocampal neurons and their interaction with neuronal receptors . The a oligomers bound to excitatory synapses where their mobility decreased as they aggregated to form larger clusters over time . Consistent with previous data, a oligomers caused a removal in nmdars from synapses and were found to coimmunoprecipitate with nmdar subunits . Interestingly, the a oligomers also formed complexes with mglur5 receptors, which caused their lateral redistribution into dendritic spines followed by ca dysregulation . Renner and colleagues also observed a time - dependent increase in lipid raft - localised mglur5s which suggests that a oligomers reduce the mobility of mglurs, causing their aberrant aggregation within pathological signalling platforms . When mglur5 was removed from mouse hippocampal neurons, a oligomer binding was reduced by approximately 80% and the loss of nmdars from the cell surface was prevented . Metabotropic glutamate receptors have been implicated previously in the pathogenesis of ad and other neurodegenerative disorders . Impaired mglur signalling in the cortex of ad patients has been shown to correlate with ad - related neuropathological changes . A recent study revealed that the a peptide upregulates the expression of mglur5s in astrocytes, protective nonneuronal cells which are implicated in ad pathogenesis and inflammation . Increased levels of mglur5s were observed in the brains of down's syndrome patients; a disease in which elevated levels of a result from the triplication of the app gene . Various other lipid raft - associated proteins have been reported to effect a-mediated synaptic dysfunction . For instance, the removal of nerve growth factor receptors (ngfrs), including trka and p75 neurotrophin receptor, from cells treated with gm1-induced a oligomers caused a significant reduction in oligomer - mediated cytoxicity . Ngfr dysfunction and aberrant ngf signalling is associated with ad and increased a production [152, 153]. Although no direct interaction has been shown to our knowledge, it is possible that interplay between a oligomers and ngfrs may form part of a positive feedback loop which serves to reinforce a oligomer production, whilst blocking ngf signalling with deleterious effects upon neuronal survival . Physiologically, ngf binds to trka causing the translocation and clustering of receptors within lipid rafts . The binding of a oligomers to trka and other ngfrs may therefore cause aberrant lipid raft clustering which prevents or disrupts the formation of the normal signalling platforms . Recent research proposes that impaired insulin signalling may be involved in ad, even leading to the hypothesis that ad represents a third type of diabetes . Insulin receptors, which are robustly expressed in hippocampal neurons, were found to bind a oligomers and to undergo internalisation from dendritic spines . Perturbations in insulin signalling in the brain caused by a oligomers may impair memory and ltp . Interestingly, insulin receptor subunits are also enriched in lipid raft domains in hippocampal neurons . The emerging picture is that lipid rafts accommodate multiple receptors for a oligomers, namely prp along with nmdar, mglur5 and possibly other, lower affinity receptors . Interestingly, there is evidence to suggest that these three lipid raft - associated receptors interact together . It has also been reported that prp inhibited nmdar function in hippocampal neurons and coimmunoprecipitated with nmdar subunits . The functional and physical links between these a oligomer receptors suggest the existence of a multi - component, a oligomer binding raft complex, comprising of prp, mglur5 and nmdar (figure 3). Whether the formation of this complex is required for oligomer binding, or whether the interaction of a oligomers with the individual proteins induces its assembly, is a chicken and egg situation . One possible hypothesis is that a oligomers promote the clustering of prp and glutamate receptors into pathological mega - scaffolds which induce both toxic loss- and gain - of - function downstream effects . For instance, the aberrant localisation of glutamate receptors may impede neuronal signalling mechanisms including ltp, while the clustering or internalisation of nmdars may promote their ltd - inducing functionality . The combined effects of oligomer binding upon more than one glutamate receptor is likely to be a large disturbance in ca homeostasis which results in pathological signalling cascades . Interestingly, the prp - mediated response to oxidative stress is thought to induce signalling cascades which can modulate ca flux and synaptic plasticity . Furthermore, a oligomers may cause the internalisation or loss of function of components such as prp thus reducing neuroprotection against oxidative stress at the cell surface . The clustering of a oligomers at lipid raft domains may also cause damage to physiologically important signalling rafts, thus impairing neuronal function . Furthermore, the a oligomer - induced redistribution of neuronal proteins into lipid rafts may influence their nonraft interacting partners, with additional deleterious effects upon neuronal function and integrity . Neuronal lipid rafts are crucial modulators of a production and aggregation, leading to the accumulation of neurotoxic a oligomers in the brain which drive ad pathology . Recent evidence now incriminates lipid rafts as pathological signalling platforms in which a oligomer receptors, such as prp and glutamate receptors, cluster . A oligomer binding appears to induce the aberrant localisation of these proteins with deleterious effects upon their physiological functions including hippocampal ltp, which underlies memory, and defence against oxidative stress . In this way, lipid rafts appear to be directly responsible for the transduction of a oligomer - mediated memory impairments and neurotoxicity which characterise ad . Lipid rafts are not only implicated in ad but may also be the key to a range of neurodegenerative proteinopathies, including parkinson's disease, huntington's disease, amyotrophic lateral sclerosis and prion diseases (reviewed in). Indeed, lipid raft disruption protects neurons against the toxicity of other oligomers besides a and lipid rafts may therefore represent generic platforms for oligomer - mediated neurotoxicity . Understanding the cell biology of the downstream effects of amyloid oligomers binding to neuronal lipid raft proteins may uncover potential therapeutic targets for the prevention of ad and other neurodegenerative diseases.
In dentistry, the concept of aesthetics is extremely subjective and is related to beauty, harmony and the needs of the patient . The interactions between new restorative materials and techniques allow the reproduction of dental structures, restoring form and function in such a way that restorative procedures become imperceptible . Nevertheless, during the evaluation of aesthetically compromised teeth, we encounter unfavorable clinical situations of great complexity, characterized by deep invasions of the mineralized structures . The reproduction of the optical characteristics of the teeth, such as translucency, opalescence and fluorescence, requires a considerable knowledge of restorative techniques and the materials currently available . Dental enamel defects have been associated with a broad spectrum of aetiologies, including genetic and epigenetic factors such as systemic, local and environmental factors . A serious disturbance that occurs during the stages of enamel formation will impact the quality and/or quantity of the enamel formed, depending on the phase of amelogenesis that is affected and the duration of the stimulus on the ameloblasts . The consequence of this disturbance in the formation of the organic enamel matrix is enamel hypoplasia, which can be characterized as small grooves, depressions and cracks in the enamel surface that can be viewed in mild cases . This article presents a case report of a restorative treatment of enamel hypoplasia using hybrid composite resin to mask color alteration and enamel defects of the anterior upper teeth . A 22-year - old female patient was referred to the dental clinic, reporting a visual discomfort from the presence of irregularities and discoloration in the maxillary incisors . Dental history and clinical examination revealed that she had a soft form of enamel hypoplasia [figure 1]. Clinical examination also evidenced an enamel defect in the maxillary lateral and central incisors, with rough surfaces with irregular limits that principally involve the middle third of the crown [figure 2]. Initial clinical aspect of the maxillary incisors a buccal view of the central and lateral incisors with hypoplastic alterations the clinical situation revealed that it was not possible to re - establish aesthetics and function without the use of a restorative procedure . The position and pattern of the enamel irregularities, the occlusion and a tooth remnant with a large substrate suggested that a composite resin restoration would be a reliable option for this case . The patient was systemically healthy, presented an overall plaque index and gingival index of below 10% and the restorative area was free from visible plaque . A slight enameloplasty, using a spherical 1015f diamond bur (kg sorensen, so paulo, brazil) and manual instruments, was performed on both the irregularities and the limits of the tooth defect [figures 3 and 4]. The regularization of the defects created a good substrate that was favorable for adhesive restorations . Delimitation of the tooth irregularities with graphite enameloplasty with a spherical diamond bur for smoothing out defects the color was recorded using the vitapan classical scale (vita zahnfabrik, bad sckingen, germany), and the shade a2/a3 was considered as the initial color . Briefly, the dental surface was acid etched (35% phosphoric acid) [figure 5], rinsed for 30 s and dried with absorbent paper . A two - component adhesive system (adhese, ivoclar vivadent ag, schaan, liechtenstein) was applied on the dentin and the enamel and was light - cured for 10 s with an intensity of 1400 mw / cm (radii led curing light, sdi, australia) [figure 6]. The dental surface was acid etched (35% phosphoric acid) a two - component adhesive system was applied on the dentin and on the enamel a combination of the incremental and stratified layering technique was used to fill the tooth using a highly aesthetic nanohybrid composite resin, ips - empress (ivoclar vivadent ag). The composite was added in increments of 1.52 mm and was light - cured after every layer, according to the manufacturer's instructions . First, the dentin was simulated with a thin layer of a microhybrid composite (da3) and a final layer with an enamel composite (ea2), which was placed with a fine #2 brush (cosmedent, chicago, usa) for fine detailing / texturizing to simulate the enamel, increasing the final brightness of the restoration [figure 7]. A clinical view of the central incisor immediately after the restorative procedures the contouring was refined using 30-blade carbide trimming burs (9714ff, kg sorensen), and the final polishing was performed with a high - luster polishing paste (opal l, renfert gmbh, hilzingen, germany) using goat - hair brushes and cotton buffs (renfert gmbh). Four months after the restoration, a good final aspect was observed and the lateral smile view exhibited an imperceptible restoration [figures 8 and 9]. With the valuation of aesthetics, minimally invasive restorative techniques have provided an expansion of the current conservative philosophy . Nevertheless, during the evaluation of aesthetically compromised teeth, we encounter adverse clinical conditions of great complexity, marked by the invasion of the mineralized structures at depth . Enamel hypoplasia is an incomplete or defective formation in the organic matrix of the enamel and remaining certain areas susceptible to decay; it is responsible for a major proportion of lesions . The irregularities present in a hypoplasia provide favorable conditions for the retention of plaque and the early development of caries lesions, which progress and reach deep into the enamel and the dentin . One of the signs of hypoplastic lesions is diminishing enamel luster and dental surfaces that have become eroded with cavitations and irregular wear because of the loss of the microanatomy affecting the color, morphology and texture of teeth . On some occasions, hypoplasia is mistaken for fluorosis; however, enamel hypoplasia is an incomplete or defective formation in the organic matrix of the enamel, triggered by diseases, systemic disorders, trauma and infections in the pulp of deciduous teeth . It manifests with partial or complete absence of the enamel, which can be systemic (when it affects a group of teeth) or local (when it has asymmetric distribution and is relegated to a single tooth). Because it is neither fully transparent nor fully opaque, some modern composites provide optical similarities consistent with natural teeth, yielding satisfactory levels of opalescence, value and chroma . It is important to consider that the final restoration is dependent on both the thickness and the varying degrees of translucency and opacity of the several layers of the composite . Of all dental structures describe a minimally invasive technique performed in cases of enamel hypoplasia based on enamel microabrasion and complemented with composite resin restorations . The procedures employed are simple, but they require knowledge of the real causes of the staining and comprehension of restorative techniques . Various treatment protocols may be performed, depending on the level of involvement and the severity of the lesions . Composite resin restorations are fully capable of reproducing the appearance of a natural tooth with highly aesthetic outcomes . In this context, the main goal of the treatment of enamel hypoplasia is to re - establish the anatomical harmony between occlusion, function and aesthetics and to restore patient self - esteem, promoting social and psychological benefits . In conclusion, this case report demonstrates that restorative rehabilitation, in addition to promoting health, may provide a more favorable aesthetic appearance for the smile, matching the tooth polychromatic and raising the self - esteem of the patient.
Gastrointestinal lipomas are rare, mostly small and detected incidentally during endoscopic examination (1). These tumours are benign proliferations of mature fatty tissue arising in the submucosa and predominately arise in the large intestine (51 - 70%) preferentially on the right side . The majority of symptomatic lesions occur in adults in the sixth decade of life (2). Lipohypertrophy of the ileo - caecal valve is classified as a variant of normal (1). The vast majority are asymptomatic but they can manifest due to intussusceptions, ulceration leading to haemorrhage or iron deficiency anaemia, intestinal obstruction or present as an abdominal mass . Most are compressible and submucosal although they can rarely develop in the serosa and appear as a fold or polyp . They contain mature adipose tissue and usually have a thick capsule surrounding the tumour (2). These changes if extensive can mimic a liposarcoma; however, frank liposarcoma of the colon is extremely rare and requires the presence of lipoblasts (2). Mucosal biopsies can be unhelpful and yield either intact mucosa, granulation / inflammatory changes or fat necrosis . . It can be difficult to separate the two and even endoscopic ultrasound can be non - diagnostic and adequate histology sampling may require a resection (3). Where a biopsy diagnosis has been made endoscopic resection or limited resection can be undertaken removing the need for major resectional surgery (3). Where this is not technically feasible a minimally invasive approach using either mini - laparotomy or laparoscopic resection has successfully been reported (4,5). A 74 year old man with a background of chronic obstructive airways disease (coad) was referred for urgent assessment by his general practioner with a 1 month history of lower abdominal pain and altered bowel habit . Abdominal and rectal examination was unremarkable and routine blood testing including carcinoembryonic antigen (cea) was normal . A large ulcerating polypoidal lesion was found at his hepatic flexure (figure 1). Colonoscopy demonstrating large pedunculated ulcerating lesion found at hepatic flexure histology from biopsies taken showed no evidence of neoplasia or dysplasia but was felt to most likely be unrepresentative of the endoscopic lesion . A staging ct scan of chest, abdomen and pelvis was arranged as part of pre - operative staging protocol and this demonstrated a large 3.3 x 4.3 x 3.4 cm heterogeneous enhancing colonic polyp, which predominately enhanced with fatty attenuation (figure 2). Proximal to the lesion was circumferential colonic wall thickening and surrounding fat stranding suspicious of colonic malignancy . There was concern about colonic malignancy and following discussion at a mdt meeting he was offered a surgical resection . Ct scan of the abdomen showing the lesion (marked a) a laparoscopic extended right hemicolectomy was performed under general anaesthesia . There were no complications and the patient made an excellent recovery and was discharged home . Gross and microscopic histological examination showed a submucosal lipoma with areas of fat necrosis and surface ulceration with extensive granulation tissue . Polypoidal tumour measuring 4 cm with an area of central ulceration gross slices of the tumour show adipose tissue expanding the submucosa . There are areas of fat necrosis and mucosal ulceration microscopy shows lobules of mature adipocytes . Imaging may reveal tissue with the signal and uptake of adipose tissue but a confident diagnosis may not be possible . Endoscopists, radiologists and pathologists need to be aware of this entity . Careful discussion and review of the investigations at an mdt meeting may permit a pre - operative diagnosis . Endoscopic resection can be used where technically feasible but where doubt remains or this is not feasible then laparoscopic or open resection may be required.
Pekinensis) is a diploid (2n = 2x = 20) dicot with a genomic size of 550 mb (http://www.brassica.info/resource/). The species originated in china and now has become one of the most important and widely cultivated leaf vegetables in asia . The tight leafy head is the main edible part . After a long history of domestication, chinese cabbage evolves into different cultivars with a variety of characteristics, such as rosette leaf morphology, heading leaf morphology, leafy head shape, size, and structure, flowering time, nutrient composition, and resistance to biotic and abiotic . A better understanding of the molecular mechanism of evolution of chinese cabbage and further development of marker - assisted selection (mas) will accelerate the selection process of improved cultivars to meet the growing consumers and environmental needs . Although progress has been made in underlining the molecular mechanism [25], many aspects are still unclear . Molecular markers have been widely used to study the genetic basis of important traits and map regulatory genes in plants . Markers tightly linked with important agronomic traits can potentially be used for molecular breeding to develop improved cultivars . Many molecular markers and genetic maps of chinese cabbage have been reported previously [625]. However, there is still a great need to develop novel molecular markers for construction of high - density linkage maps for genetics and molecular studies of important traits in chinese cabbage . Simple sequence repeat (ssr) markers or microsatellite markers are among the most important markers in plants . Ssrs have been widely used in genetic mapping and molecular breeding in plants because they are highly abundant and have significant polymorphism . Other factors, like accessibility for detection, reliability, and codominance, also make them perfect markers for such purposes . Ssrs found in transcribed sequences are called expressed sequence - simple sequence repeats (est - ssrs). Compared with genomic - ssrs detected in noncoding sequences, est - ssrs are more efficient for qtl mapping, gene targeting, and mas . As transcribed sequences are more conserved than noncoding sequences, the transferability of est - ssrs is better than genomic - ssrs [2830], which can be utilized for cross genome comparison and evolutionary analysis [27, 31]. Additionally, abundant ests were generated in recent years with the development of next - generation sequencing approaches, making identification of est - ssrs more practical and cost - efficient . Many est - ssrs have been identified in chinese cabbage [16, 20, 25, 3336]. Because whole genome sequencing of chinese cabbage is still underway, new est - ssrs could also be identified for further studies such as high - density genetic linkage map construction, gene / qtl mapping, and cultivar identification . In our previous study, the whole transcriptomes were analyzed for the rosette leaves and folding leaves of a typical heading chinese cabbage, namely, fushanbaotou, using a solexa / illumina rna - seq platform, and a large - scale est database was generated . In this study, we further assembled those ests from the rl and fl libraries into nonredundant unigenes . A total of 10,420 est - ssrs were identified, among which 2744 est - ssrs are detected for the first time, according to the ssr marker database for brassica (http://oilcrops.info/ssrdb). We characterized these identified est - ssrs and designed 7877 pcr primer pairs for 1561 est - ssrs . Furthermore, serving as a validation purpose, we tested polymorphisms of 24 est - ssrs . We expect this study can pave the road for further investigation of new est - ssr markers and for construction of high - density genetic maps . For est - ssr identification and primer design, a typical heading chinese cabbage, namely, fushanbaotou, was used in this study . For primer assessment and ssr polymorphism analysis, a panel of twenty - four cultivars of chinese cabbage was used, including nineteen morphologically diverse cultivars of brassica rapa l. ssp . Pekinensis (b. pekinensis l.) and five brassica rapa l. chinensis (b. chinensis l.). Leaves were collected after they were grown for two weeks from ten seedlings of each cultivar and were pooled together for dna extraction . We assembled the clean read dataset presented by wang et al . From the rl and fl libraries according to the methods described by wang et al . Using the trinity software (http://trinityrnaseq.sourceforge.net/). Redundant sequences were removed and overlapping unigenes were assembled into continuous sequences by the tigr gene indices clustering (tgicl) tools . Similarity was set at 94% and an overlap length was set at 100 bp . Parameters were set with a minimum number of 12, 6, 5, 5, 4, and 4 repeat units for identification of mono-, di-, tri-, tetra-, penta-, and hexanucleotide motifs, respectively . Primer length ranged from 18 to 28 bp (with an optimality at 23). The physical positions of the est - ssrs identified in the study were determined by aligning the ssrs and flanking sequences (50 bp at each side) to the brassica rapa (chiifu-401) reference genome (http://brassicadb.org/brad/) using blastn . New est - ssrs were identified by comparing with previously reported ssrs in the ssr marker database for brassica (http://oilcrops.info/ssrdb). The dna sample of the chinese cabbage fushanbaotou was used as template to detect the availability of ssr primers designed above . The dna samples of those aforementioned twenty - four cultivars of chinese cabbage were used as templates for ssr polymorphism analysis . The polymorphisms of est - ssrs were validated by 6% denaturing polyacrylamide gel electrophoresis, 12% nondenaturing polyacrylamide gel electrophoresis, and sequencing . High quality clean read data from the rl and fl libraries by wang et al . A total of 99,684 and 95,411 contigs were obtained, with an average length of 333 and 342 bp and a median length (n50) of 531 and 536 bp, from the rl and fl libraries, respectively (table 1). Contigs from the same transcript were detected with paired - end reads, as well as the distances between these contigs . Using the trinity software package, we assembled these contigs into unigenes, in which ns were removed . A total of 46,294 and 48,473 unigenes from the rl and fl libraries were obtained with an average length of 707 and 680 bp and a median length (n50) of 1000 and 980 bp, respectively (table 1). Size distribution of the contigs and unigenes is consistent with the rl and fl libraries as shown in figure 1, indicating that our illumina sequencing solution is reliable and reproducible . Unigenes from the two samples were combined; redundant unigenes were removed; and the rest was assembled with tgicl to form a single dataset, which represents 40.7 mb of sequence and contains a total of 51,694 nonredundant unigenes, with an average read length of 788 bp, and a median read length (n50) of 1154 bp (table 1). The sequences of the unigenes are listed in table s1 (see supplementary material available online at http://dx.doi.org/10.1155/2015/473028). The length of 24,271 nonredundant unigenes (46.95%) is between 200 and 500 bp; the length of 13,613 (26.33%) is between 501 and 1,000 bp, and the length of 13,810 (26.72%) is longer than 1,000 bp (figure 1). A total of 10420 est - ssrs were detected with the microsatellite software (misa; http://pgrc.ipk-gatersleben.de/misa/) in 8571 unigenes, accounting for 16.6% of total nonredundant unigenes (tables 2 and s2). The mean ssr density is one per 3.9 kb, corresponding to one for every 5.0 nonredundant unigenes . 1502 unigenes (17.5%) harbored more than one ssr and 666 ssrs (6.4%) were present in compound formation that had more than one repeat type (table 2). The ssrs with tri- and dinucleotide repeat motifs were the most common (4,405, 42.27%; 4,043, 38.80%, resp . ), followed by mono- (1,644, 15.78%), hexa- (126, 1.21%), penta- (112, 1.07%) and tetra- (90, 0.86%) nucleotide repeat motifs (figure 2). The most common two repeat motif types accounted for 81.07% of the total ssrs detected, and the rest repeat motifs types only accounted for 18.93% . The iterate number of repeat units in an est - ssr ranged from 4 to 25 . The occurrence frequency of est - ssts with different iterate numbers was found to be unequal either . Est - ssrs with iterate number of 5 (2832, 27.18%) were the most common ones, followed by 6 (2739, 26.29%), 7 (1368, 13.13%), 8 (703, 6.75%), 12 (542, 5.20%), and 9 (480, 4.61%) (table s3). A dinucleotide containing est - ssrs with a maximum of 25 repeat units was identified . For est - ssrs with more than 10 repeat units, the mononucleotide repeat motifs were the most abundant, accounting for 93.46% of these est - ssrs . The lengths of est - ssr sequences ranged from 12 to 65 bp (table s4). The longest one is a pentanucleotide containing est - ssr with 65 bp in length . The lengths of most est - ssrs are from 12 to 20 bp, accounting for 91.47% of the total est - ssrs, followed by est - ssrs with 2130 bp in length (874 ssrs, 8.39%). Only 13 est - ssrs were identified with over 30 bp, accounting for 0.12% of the total est - ssrs . A total of 124 est - ssr motifs were identified, including 2 mono-, 3 di-, 10 tri-, 13 tetra-, 33 penta-, and 63 hexanucleotide repeat units containing est - ssrs . The dominant motif identified in our est - ssrs was ag / ct (3,519, 33.8%), followed by a / t (1,562, 15.0%), aag / ctt (1,445, 13.9%), agg / cct (776, 7.4%), atc / atg (627, 6.0%), aac / gtt (392, 4.4%), acc / ggt (392, 3.8%), ac / gt (349, 3.3%), and agc / ctg (317, 3.0%) (figure 3). The other 115 motifs have low frequency, accounting only for 9.3% of total est - ssrs . Physical locations of the est - ssrs were assigned by searching against the nonredundant (nr) protein database of ncbi (http://www.ncbi.nlm.nih.gov/) and the brassica database (http://brassicadb.org/brad/) using blastx . Our results showed that 4329 est - ssrs (44.4%) were located in coding regions (cdss), 3456 (35.5%) in 5-utrs, and 1297 (13.3%) in 3-utrs (figure 4, table s4). Locations of the remaining 672 est - ssrs (6.9%) were not successfully assigned (figure 4, table s4). For the est - ssrs localized in the cds region, trinucleotide repeats were the most common ones, accounting for 62.72% of the total est - ssrs localized in this region, followed by dinucleotide repeats (897, 20.72%), mononucleotide repeats (325, 7.51), and compound formation (287, 6.63%) (table s4). Dinucleotide repeats (1909, 55.24%) were the dominant types in 5-utrs, followed by trinucleotide repeats (730, 21.12%), mononucleotide repeats (483, 13.98%), and compound formation ones (214, 6.19%) (table s4). Mono-, di-, and trinucleotide repeat est - ssrs were the top three types found in 3-utrs, accounting for 35.08%, 30.07%, and 28.60% of the total est - ssrs localized in these regions, respectively . The est - ssrs and the flanking sequences (50 bp on each side) were aligned to the brassica rapa (chiifu-401) reference genome (http://brassicadb.org/brad/) using blastn to determine their physical positions . New est - ssrs were identified by comparing with the earlier reported ssrs in the ssr marker database for brassica (http://oilcrops.info/ssrdb). A total of 2744 new est - ssrs (26.3%) were identified in the study . Of the 7676 known ssrs (73.6%), 2317 est - ssrs (22.2%) show polymorphism with different repeat numbers, and 5359 (51.4%) were exactly the same with the earlier reported ssrs based on the brassica rapa (chiifu-401) genomic sequence (table s2). A total of 7877 pcr primer pairs from the unique sequences flanking 1561 est - ssr loci were designed according to the criteria described in section 2 using primer 3 (table s5). For each est - ssr locus, a maximum of 5 alternative primer pairs was designed . The other 8859 est - ssrs, which had no appropriate pcr primer pairs designed as their flanking sequences, did not fulfill the primer design criteria mentioned above . For the 1561 est - ssrs with pcr primers designed, pcr primers of those aforementioned 24 loci with n 20 bp were selected for primer synthesis and amplification evaluation in chinese cabbage fushanbaotou . Nineteen (79.2%) of these 24 est - ssr loci successfully yielded pcr amplicons in fushanbaotou . We sequenced these nineteen pcr amplicons and found that the amplicons in thirteen loci were exactly the same as expected; two were longer than the expected size, and four were shorter (table 3). Size deviation of five est - ssrs loci with the expected sizes (br - es6, br - es7, br - es8, br - es12, and br - es18) was due to the variations of ssr repeat motifs (table s6). One amplicon (br - es16) deviated from the expected sizes and had an additional 86 bp containing a (tc)9 motif near the ssr repeat motif region (table s6). Nineteen effective primer pairs were used for polymorphism validation for these aforementioned 24 chinese cabbage cultivars . The results showed that 17 loci (89.5%) were polymorphic (figure 5). A total of 56 alleles at the 17 polymorphic loci were identified and the average number of alleles per ssr locus was 3.29 with a range between 2 and 6 . A maximum of 6 alleles was detected for br - es16 and br - es18 loci . Br - es6 and br - es11 had no polymorphic allele in all 24 cultivars in this study (figure 5, tables 3 and s4). Of the 17 polymorphic loci, twelve loci were polymorphic in all cultivars of b. pekinensis l. and b. chinensis l. three loci (br - es2, br - es9, and br - es19) had no polymorphism in the cultivars of b. pekinensis l. but had polymorphism in the cultivars of b. chinensis l., while two loci (br - es4 and br - es7) were polymorphic in the cultivars of b. pekinensis l. but were not polymorphic in the cultivars of b. chinensis l. (figure 5, table s8). We sequenced the polymorphic alleles of the 17 polymorphic loci and found that polymorphisms of 9 loci (br - es1, br - es4, br - es7, br - es8, br - es10, br - es14, br - es17, br - es18, and br - es19) were because of different iterate numbers of ssr repeat motifs . In another 6 polymorphic loci (br - es2, br - es3, br - es12, br - es13, br - es15, and br - es16), the most polymorphic alleles were found in the repeat motifs with additional changes in other regions (table s7). For example, compared with the allele br - es3 - 160 bp in fushanbaotou, the polymorphic alleles br - es3 - 163 bp and 145 bp had different iterate numbers of the tag / atc repeat motif, while the polymorphic allele 99 bp had not only a different number of the repeat motif, but also a deletion in another region (table s7). The other two polymorphic loci, br - es5 and br - es9, had polymorphisms that are not related with the repeat numbers of ssr motifs (table s7). Illumina paired - end rna sequencing is one of the fast immerging next - generation sequencing (ngs) technologies . Because of its advantages in high - throughput, high accuracy, and low cost, illumina paired - end sequencing has been widely used for de novo transcriptome sequencing and assembly and transcriptome quality and quantity analysis in many plants [37, 38, 42, 43]. In our previous study, the transcriptome of rosette and folding leaves in chinese cabbage was analyzed using the illumina paired - end rna sequencing technology, and abundant clean reads and ests with high quality were obtained . The large quantity of clean reads would increase coverage depth of transcriptome nucleotide, enhance sequencing accuracy, and provide useful information for developing new tools for genetic mapping and molecular breeding of chinese cabbage . In this study, we further assembled the clean reads into contigs and unigenes from the rl and fl libraries, respectively . The parameters for both contigs and unigenes between the two libraries had no significant differences (table 1), indicating our illumina sequencing solutions have high reliability and reproducibility . The unigenes of the two libraries were further assembled and a total of 51,694 nonredundant unigenes were obtained from the 40.7 mb sequence data . We discovered more nonredundant unigenes than those in previous studies [35, 36], which represent a large portion of the chinese cabbage transcriptome and are important for a comprehensive understanding of est - ssrs . A total of 10,420 ssrs with over 12 bp were identified from the deep transcriptome sequence dataset of chinese cabbage . The frequency of occurrence of ssrs is slightly higher than those reported in previous studies on chinese cabbage (about 8.415.6%) [20, 3436] and also higher than those of other dicotyledonous species such as peanut (6.8%), sweetpotato (8.2%), sesame (8.9%), pigeonpea (7.6%), grapes (2.5%), pepper (4.9%), and flax (3.5%), but it is lower than those of coffee (18.5%), radish (23.8%), and caster bean (28.4%). Detection of est - ssrs depends on a number of factors such as genome structure, tools and parameters for est - ssrs detection and exploration, and size of dataset for unigene assembly . The frequency of ssrs with different sizes of repeat units is not evenly distributed in plants . Previous studies showed dinucleotide ssr loci are the most abundant class in safflower, pigeonpea, and sesame, whereas trinucleotide repeats are the most frequent ones in barley, sweetpotato, jatropha curcas, iris, pepper, caster bean, flax, cucurbita pepo, and radish . In ramie and wheat, dinucleotide and trinucleotide trinucleotide (4405, 42.3%) was found to be the most common repeat motif class in chinese cabbage, followed by dinucleotide (4043, 38.8%) (figure 2). However, on the genomic level, of chinese cabbage, dinucleotide is the most common repeat motif, followed by trinucleotide . We found the most dominant mononucleotide repeat motif in chinese cabbage was a / t (1,562, accounting for 15.0% of the total est - ssrs), which is consistent with previous reports for chinese cabbage and for other plants such as arabidopsis, rice, wheat, radish, castor bean, gossypium raimondii, oil palm, and eggplant . For dinucleotide motif, ag / ct was the most common repeat motif, accounting for 87.0% of the total dinucleotide est - ssrs . It is in close agreement with the results in previous studies for genic ssrs in chinese cabbage [20, 36] and those in most other plants such as sweetpotato, iris, sesame, and radish . The ag / ct repeat motif was also the most dominant repeat among all the est - ssrs identified in this study, accounting for 33.8% of the total est - ssrs . However, for genomic - ssrs in chinese cabbage, at / ta is the most common dinucleotide motif . The aag / ctt (1,445, 13.9%) motif was the most frequent motif among trinucleotide est - ssrs in the study, which is consistent with the results in previous studies in chinese cabbage [25, 36] and many dicot species, for example, arabidopsis, soybean, peanut, sweetpotato, radish, and sesame . In many monocot species such as maize, barley, and sorghum [66, 67], ccg / ggc is the most dominant trinucleotide repeat motif . It is considered a specific feature of monocot genomes due to the high gc content in monocot genomes . Of all 10420 est - ssrs identified in this study, more than 70% have been identified and presented in the ssr marker database (http://oilcrops.info/ssrdb), among which over half were exactly the same with the earlier reported ssrs based on the brassica rapa (chiifu-401) genomic sequence (table s2). 2317 est - ssrs (22.2%) with polymorphism in different repeat numbers could further be used for identification of chiifu-401 and fushanbaotou and for genetic linkage map constructions using these two cultivars as parents . A total of 2744 new est - ssrs (26.3%) were identified in the study, which, in combination with previously discovered est - ssrs, could be used for high - density genetic linkage map construction, gene / qtl mapping, cultivar identification, and so forth . In the present study, 79.2% of the est - ssrs primer pairs selected for primer evaluation successfully generated high quality amplicons, indicating that the ests from the high - throughput rna sequencing of chinese cabbage transcriptome are suitable for specific primer design . The unsuccessfully designed primer pairs may be due to splice sites, large introns, chimeric primer(s), or poor quality sequences . We found that all amplicons contained the expected ssrs and the ssrs in 13 amplicons were exactly the same as predicted (table s6). The deviation of est - ssr pcr amplicons from the expected size is likely due to the presence of introns, large insertions or repeat number variations, a lack of specificity, or assembly errors . In the present study, we found five of six amplicons with unexpected sizes had different iterate number of ssr repeat units, while the other one had a 86 bp insertion near the expected ssr repeat motif region (table s6). These results suggested that the unigenes assembled from the high - throughput rna sequencing of chinese cabbage transcriptome are reliable, and the est - ssrs identified in our dataset could be used for further studies, such as genetic mapping and cultivar identification . Most of the est - ssr loci (accounting for 89.5% of the tested loci) were found to be polymorphic among the 24 tested cabbage cultivars . The mean number of alleles per ssr locus was 3.29 with a range between 2 and 6 (table 3), indicating that polymorphism of est - ssrs in chinese cabbage is relatively high . Most of the polymorphisms of the tested est - ssr loci are due to the variations of ssr repeat motifs in this study . There were only two loci where the polymorphisms were not related to the ssr repeat motif variations (table s6). The results indicate that the est - ssrs identified and the pcr primers designed in this study could further be used for constructing high - density genetic linkage maps, mapping quantitative trait loci, assessing germplasm polymorphism and evolution, marker - assisted selection, and cloning functional gene in chinese cabbage . In summary, we assembled a large set of clean reads with high quality derived from the chinese cabbage transcriptome using high - throughput rna sequencing technology with a solexa / illumina platform . A total of 51,694 nonredundant unigenes were obtained from 40.7 mb sequence data, providing substantial knowledge for est - ssr identification and characterization . 10,420 est - ssrs were identified and characterized, and pcr primer pairs for 1561 est - ssrs were designed . By comparing with previously reported ssrs in the ssr marker database for brassica (http://oilcrops.info/ssrdb), we identified a total of 2744 new est - ssrs . Primer pairs for 24 est - ssrs were selected for primer evaluation, and 79.2% of the 24 est - ssr loci successfully generated high quality amplicons . Among the effective primers, 89.5% of them showed polymorphism in 24 cultivars of chinese cabbage . The est - ssrs developed in this study, in combination with previously reported est - ssrs, will provide valuable resources for constructing high - density genetic linkage maps, mapping quantitative trait loci, assessing germplasm polymorphism and evolution, marker - assisted selection, and cloning functional gene in chinese cabbage . To our knowledge, this is the first successful attempt to develop large quantity of est - ssrs with high quality based on the transcriptome of chinese cabbage using high - throughput rna sequencing technology.
Much of the current success in clinical positron emission tomography (pet) can be attributed to the development of 2-(f) fluoro-2-deoxy - d - glucose (f18-fdg). It is the most commonly used radiopharmaceutical in the pet, with a half - life of 110 min . Before the release of f18-fdg for human use, the quality control tests need to be performed to check the safety of the product . The bet using gel clot method is a 60-min test and typically performed after the decay of the f18-fdg sample to determine the endotoxin content . The gel clot is technically the most simple and was the first bet approved by the food and drug administration (fda). Endotoxin is a subset of pyrogens that are strictly of gram - negative origin, a natural complex of lipopolysaccharides occurring in the outer layer of the bilayered gram - negative bacterial cell . From the circulating blood cells of limulus polyphemus, called amebocytes, a clear lysate is obtained that forms an opaque gel in the presence of extremely low concentrations of bacterial endotoxins . Pharmacopeia (usp), pharmacopeia, f18-fdg should not contain more than 175/v usp endotoxin units (eu) per milliliter of f18-fdg injection, in which v is the maximum administered total dose in milliliters, at the expiration time . However, no such standards have been recommended by indian pharmacopoeia commission (ipc) till date . The ipc is taking measures to include radiopharmaceuticals in the indian pharmacopoeia . The objective of this study protocol was to set up a standard pyrogen testing facility and to establish documented evidence if the process employed for bet testing of f18-fdg by gel clot method produces the desired results consistently, when performed as per the standard operating procedures . Random samples of the f18-fdg from september 2010 to march 2011 were subjected to the gel clot bet . F18-fdg was synthesized in the in - house medical cyclotron and radiochemistry lab at the department of nuclear medicine and pet centre, using the tracerlab mxfdg (ge healthcare, mnster, germany). The assay was performed at four different maximum valid dilutions (mvds, i.e. 1:10, 1:100, 1:350 and 1:700). The ph of the samples was measured to ensure a ph within the range 6.08.0 for the validity of the gel clot procedure . The standard gel clot test for assessing the bacterial endotoxin content consisted of four controls: negative water control (nwc), positive water control (pwc), negative product control (npc) and positive product control (ppc). The nwc is the endotoxin - free limulus amaebocyte lysate (lal) reagent water . The matched control standard endotoxin (cse), lal reagent and lal reagent water obtained from charles river laboratories india private limited, bangalore, india, were used in this study . The sensitivity of the lal reagent contained in each vial was 0.125 eu / ml . The test for confirmation of lysate sensitivity was carried out with every new batch of the lysate as per the usp <85> recommendations . The cse having predetermined amount of endotoxin was prepared according to the directions for use given in the specific certificate of analysis (coa). The cse stock solution of 20 eu / ml was prepared with endotoxin - free water and vortexed for 5 min . All the dilutions were made in the depyrogenated 16 125 mm glass tubes using endotoxin - free water and pyrogen - free sterile pipettes tips . Depyrogenations were performed in the dry heat oven at 250c for 1 hour, when the endotoxin - free glass tubes were not obtained commercially . The bet was performed using 0.1 ml of f18-fdg sample and 0.1 ml of reconstituted lal reagent per tube . The lal reagent was constituted after the addition of lal reagent water (endotoxin free) in the freeze - dried power of lysate . The pwc and ppc used for these tests were at the endotoxin concentration of 0.5 eu / ml . The four dilutions of the f18-fdg, i.e. 1:10, 1:100, 1:350 and 1:700, were freshly prepared from the batches and subjected to the gel clot assay . The ppc was separately prepared for all the dilutions at the endotoxin concentration of 0.25 eu / ml . The reaction solution was mixed thoroughly and placed immediately in the incubator at 37c1c for 602 min . At the end of the incubation period, if the gel had formed and remained intact in the bottom of the reaction tube after an inversion of 180, the test was considered positive . A positive test indicated that the concentration of endotoxin in the tube is greater than or equal to the sensitivity of the lal reagent . Any other state of the reaction mixture constituted a negative test, which indicated an endotoxin concentration less than the lal reagent sensitivity . The test was considered negative when the tube is inverted and the gel breaks or collapses . Random samples of the f18-fdg from september 2010 to march 2011 were subjected to the gel clot bet . F18-fdg was synthesized in the in - house medical cyclotron and radiochemistry lab at the department of nuclear medicine and pet centre, using the tracerlab mxfdg (ge healthcare, mnster, germany). The assay was performed at four different maximum valid dilutions (mvds, i.e. 1:10, 1:100, 1:350 and 1:700). The ph of the samples was measured to ensure a ph within the range 6.08.0 for the validity of the gel clot procedure . The standard gel clot test for assessing the bacterial endotoxin content consisted of four controls: negative water control (nwc), positive water control (pwc), negative product control (npc) and positive product control (ppc). The nwc is the endotoxin - free limulus amaebocyte lysate (lal) reagent water . The matched control standard endotoxin (cse), lal reagent and lal reagent water obtained from charles river laboratories india private limited, bangalore, india, were used in this study . The sensitivity of the lal reagent contained in each vial was 0.125 eu / ml . The test for confirmation of lysate sensitivity was carried out with every new batch of the lysate as per the usp <85> recommendations . The cse having predetermined amount of endotoxin was prepared according to the directions for use given in the specific certificate of analysis (coa). The cse stock solution of 20 eu / ml was prepared with endotoxin - free water and vortexed for 5 min . All the dilutions were made in the depyrogenated 16 125 mm glass tubes using endotoxin - free water and pyrogen - free sterile pipettes tips . Depyrogenations were performed in the dry heat oven at 250c for 1 hour, when the endotoxin - free glass tubes were not obtained commercially . The bet was performed using 0.1 ml of f18-fdg sample and 0.1 ml of reconstituted lal reagent per tube . The lal reagent was constituted after the addition of lal reagent water (endotoxin free) in the freeze - dried power of lysate . The pwc and ppc used for these tests were at the endotoxin concentration of 0.5 eu / ml . The four dilutions of the f18-fdg, i.e. 1:10, 1:100, 1:350 and 1:700, were freshly prepared from the batches and subjected to the gel clot assay . The ppc was separately prepared for all the dilutions at the endotoxin concentration of 0.25 eu / ml . The reaction solution was mixed thoroughly and placed immediately in the incubator at 37c1c for 602 min . At the end of the incubation period, if the gel had formed and remained intact in the bottom of the reaction tube after an inversion of 180, the test was considered positive . A positive test indicated that the concentration of endotoxin in the tube is greater than or equal to the sensitivity of the lal reagent . Any other state of the reaction mixture constituted a negative test, which indicated an endotoxin concentration less than the lal reagent sensitivity . The test was considered negative when the tube is inverted and the gel breaks or collapses . The mean ph was 7.05 (6.57.5). The total numbers of tests performed on the f18-fdg were 100 excluding nwc, pwc and ppc . Table 1 summarizes the results of the undiluted f18-fdg on the positive control solutions at an endotoxin concentration of 0.5 eu / ml (4). Of the 10 undiluted f18-fdg batches, this indicated that all the batches did not contain endotoxin greater than 0.5 eu / ml . All the 20 positive endotoxin control pwc vials gelled . Only 18 out of 20 ppc vials gelled after incubation at 37c for 60 min . Results for undiluted f18-fdg sample table 2 summarizes the results for the 60-min gel clot assay on the four different dilutions of the f18-fdg samples . All the 20 positive endotoxin control pwc vials gelled . None of the 20 1:10 f18-fdg sample vials gelled after 60-min incubation at 37c . However, 1 out of 20 ppc vials for the 1:10 dilution did not gel probably due to some interference with the gel formation at the lysate sensitivity of 0.125 eu / ml . All the remaining vials for the 1:100, 1: 350 and 1:700 dilutions did not gel . This indicated that all the vials did not contain endotoxin greater than 0.125 eu / ml . Results for the diluted f18-fdg samples the gel clot method is often considered as the most accurate and sensitive procedure for testing endotoxin content in injectable radiopharmaceutical products because fewer false - positive and false - negative results are observed when this method is used . The total time taken to complete the lal reaction requires optimal ph range . In the undiluted samples, the measured ph (7.05) was well within the acceptable range (i.e. 6.08.0) for the gel clot assay . The f18-fdg produced in the tracerlab mx synthesis module is neutralized in the citrate buffer which contains multivalent ions . Nakao et al . Reported the effect of the citrate salt concentration on the endotoxin test for the f18-fdg preparations . These authors reported that the undiluted sample showed the recovery less than 20%, beyond the acceptance of the usp . Similar results were found in the present study with the undiluted samples as two vials of the ppc (endotoxin concentration equal to 0.5 eu / ml) did not gel, indicating the interference with the gel formation . The interference may be due to the presence of the citrate ions . At the expiration time, the maximum administered total dose in milliliters of fdg should contain less than 175 eu . Therefore, the total f18-fdg preparation at any time did not contain more than 8 eu (0.5 eu / ml 16 ml). However, the undiluted sample did show the inhibition of the gel formation as shown in table 1 . Therefore, the sample was tested for the various dilutions 1:10, 1:100, 1:350 and 1:700 . The 350 and 700 dilution factors were considered according to the limit of 175 eu / ml (single patient dose supplied to the other institute or when the final elution is in 23 ml due to some technical errors). The rate of inhibition improved with the dilutions in table 2 . The gel clot assay has a major drawback which limits its use for the short - lived radiopharmaceuticals . In addition to this drawback, errors made by technical personnel and the misinterpretation of results are also common problems . The 60-min bet is described in usp<85>, bacterial endotoxins test, and is also recommended for pyrogenicity testing in the draft guidance of the fda on current good manufacturing practice (cgmp) for pet drug products . Because the remainder of the required quality assurance (qa) testing for f18-fdg injection, with the exception of the sterility test, can be completed in approximately 2030 min, delaying the release of the short - lived f18-fdg injection for an additional 3040 min is not practical and is, in fact, wasteful . An in - process 20-min bet must be performed before release of the drug product, and a standard 60-min bet must also be completed . Some other techniques to determine endotoxins are also known, such as the chromogenic (color development) and the turbidimetric (turbidity development) tests, both of which can provide valuable quantitative and qualitative information about the endotoxin concentration in samples . Regardless of which method is used, pet laboratories and pharmacies should ensure that their technicians are well trained and educated in the endotoxin testing method of choice . This study suggests that the bet needs to be performed, standardized and documented in each cyclotron and pet facility . The dilution of the test sample is the easiest means to resolve the potential product inhibition / enhancement problem during the gel clot testing procedure . The final f18-fdg preparation at any time point did not contain more than 8 eu, thus making it safe for human administration.
Prostate cancer becomes one of the most common cancers in developed and developing countries [13]. It is because life expectancy rised; age is one of the prostate cancer risk factors . Moreover there is wide availability of prostate - specific antigen (psa) serum test, which makes possible to diagnose clinically silent, low stage disease . Number of such patients is growing and makes management of this disease even harder in every day oncology care; optimal management is still controversial . There is a wide range of treatment methods and one of the most important outcome risk factors is local tumor control . There are risk categories, in which are propositions of treatment (table 1). Very low risk category was introduced by national comprehensive cancer center (nccn) in 2010 . Risk categories and treatment options according to nccn prostate specific antigen density if predicted probability of nodal involvement is 2% neoadjuvant, concomitant or adjuvant in selected patients without fixation radical prostatectomy (rp) remains one of basic curative therapy for prostate cancer, especially for low and inermediate risk patients . Complications include perioperative short- term side effects as blood loss, wound infection or from anesthesia, and long - term, postoperative, as incontinence or impotence [58]. Three - dimensional conformal radiotherapy (3dcrt), dynamic techniques like intense - modulated (imrt) or arc radiotherapy and extracranial stereotactic techniques allow to prepare normal tissue sparing plans with clinical target volume (ctv) high dose prescription . Not only photon beams, but also particles, e.g. Protons are used for highly conformal irradiation . Every day image - guided radiotherapy (igrt) use, especially with intraprostatic seed markers, makes possible dose escalation and less toxicity with smaller margins contouring . Brachytherapy, combined with external - beam radiotherapy (ebrt) or alone, remains one of best tools for absolute dose escalation inside prostate . Due to low alpha / beta ratio for prostate cancer these protocols are favorable, in which hypofractionation is used . Both low - dose (ldr) and high - dose rate (hdr) brachytherapy (bt) are used in prostate cancer patients . 27 kev, half - life: 59 days) or palladium-103 (pd; mean photon energy 21kev, half - life: 17 days) hdr brachytherapy is, particularly, based on iridium-192 (ir; mean photon energy 400 kev, half - life: 74 days) stepping source, which is driven into temporary implant catheters by computer - controlled unit . It also makes high dose escalation possible, but interstitial implant is needed [12, 13]. Radiotherapy complications are acute and late, mostly in bladder and rectum, like incontinence, diarrhea, urinary stricture, impotence and proctitis . Outcome is similar to surgery, however tolerance of treatment seems better for radiotherapy excluding proctitis rates, which are higher in irradiated patients . Patient for rt are usually those, who cannot undergo surgery, older than 65 years or with locally advanced disease, e.g. Extracapsular spread [5, 14, 15]. Patients with shorter life expectancy or inconvinced to treat their disease are recommended for psa testing at least every six months, digital rectal examination (dre) at least every twelve months and, especially those with longer life expectancy, for repeated prostate biopsy at least every year . If there is disease progression observed, then patient should undergo clinical evaluation to choose optimal treatment option . Although clinical progression is still not well defined and requires physician judgement and treatment option should be chosen wisely after patient discussion with his doctor [5, 16]. Comparative analysis of psa free survival outcomes by prostate cancer results study group has been published, recently . It contains comparison of results from 848 articles selected from over 18000 published between 2000 and 2010 . Only radical treatment was considered containing bt (including hdr), ebrt (including imrt), rp, proton thereapy, hifu and cryotherapy . Pcrsg agreed unanimously for study inclusion criteria as: patient stratification into pretreatment groups (according to d'amico, zelefsky or nccn), psa free time endpoint (astro, phoenix, psa <0.2 ng / ml for rp), both clinical and pathological staging, minimum of 72 gy ebrt (imrt or 3dcrt), results published in peer - review journals only, minimum median follow - up of 5 years . Morover minimum patients number for each risk group was accepted as 100 for low and intermediate and 50 for high risk group . Results of this study suggest that bt alone, particularly seed implant, provides superior psa free survival in low risk patients . Ebrt combined with bt seems to be equal to bt alone, and better than ebrt alone or rp, in intermediate risk group . Combined irradiation (ebrt with bt) with or without androgen deprivation therapy seems to be superior for high - risk patients . Although these results are encouraging to choose bt as an element of managment, it should be remembered that selection bias may play main role, mostly in intermediate risk group . According to lack of large, randomized studies these may help to choose ultimate treatment decision both for physician and his patient . Bt seems to be superior option for dose escalation and psa control in prostate cancer patients . This is also reason to recall guidelines of european and north american societies on prostate cancer brachytherapy, both hdr and ldr . European association of urology states that transperineal bt alone qualification criteria are: clinical stage between t1c and t2a, without nodal involvment or metastases, six or less gleason score diagnosed with sufficient number of random biopsies, initial psa level of 10 ng / ml or less, no more than 50% of biopsy cores with cancer, prostate volume of less than 50 cm and a good ipss (<20 fair tolerance; <9 good tolerance). Ldr - bt is recommended both by eau and gec / estro as safe and effective in low risk group of prostate cancer patients with life expectancy longer than 5 years . Post - turp patients should avoid this procedure, however if turp was performed several years earlier some patients can undergo ldr - bt after careful evaluation . Hdr - bt is recommended as a dose escalation technique combined with ebrt for patients with intermediate or high risk of failure with life expectancy longer than 5 years . The exclusion criteria are: prostate volume bigger than 60 cm (hormonal downsizing to reduce benign prostate hyperplasia is indicated), transurethral resection of prostate within six months, infiltration of external sphincter of the bladder neck, significant urinary obstructive symptoms (residual urine volume> 50 cm, ipss> 12 and qmax <15 cm / s), technical issues (pubic arch interference, trus prostate - rectum distance less then 5 mm, lack of proper positioning of patient, anaesthesia or complementary ebrt contraindications). Moreover these guidelines state that hdr - bt alone should be considered as an investigational treatment with proper fractionation . Salvage hdr - bt should be also performed in a prospective clinical trial, only . Abs states that hdr - bt provides highly conformal treatment with less irradiation for pelvic organs - at - risk and excellent outcome . All patients should be considered for these aproach, particularly for intermediate and high relapse risk patients as an irradiation boost or as a monotherapy for low risk patients . Prior rectal surgery or pelvic irradiation, i.e. Rectal cancer treatment, in prostate cancer patients should be carefully evaluated and complications and outcome risk factors should be discussed with special hdr - bt center expertise . Inflammatory bowel disease patients should be considered for hdr - bt if not suitable for rp, asymptomatic and not required treatment for at least 0.5 to 10 years . Hdr - bt alone seems to be better than ebrt alone or combined with hdr boost, because of smaller bowel volumes irradiated . Turp should be performed at least 90 days before hdr - bt, an aerated gel should be given into urethtra to outline its shape and special attention should be given to not exceed 110% of prescription dose . Most feasible glands for hdr - bt are those beneath 50 cm, but abs guidelines allow to treat larger ones . Pubic arch interference, baseline urinary function and application technique (fixed template or freehand) should be carefully considered . Patients should be informed about potential risks of erectile dysfunction or acute and late urinary side effects . Abs states that absolute contraindications include preexisting rectal fistule, impossibility of anaesthesia and no proof of malignancy . Absolute contraindications include poor performance status and life expectancy shorter than 10 years, spinal or general anaesthesia not possible, large post turp defects and lack of rectum, which makes trus impossible . Ipss value over 20 points can correlate with increased urinary toxicity and needs careful evaluation . Prostate volume over 60 cm is not a contraindication and even with pubic arch interference can be considered for ldr - bt with short adt course (3 - 4 months) to downsize the gland . Also freehand implantation is acceptable, but experienced practitioners should perform ldr - bt in such cases . Abs states that ldr - bt alone should be done in low risk patients and as option for intermediate group . Ebrt and permanent seed combination is considered as standard of care for high risk patients . Hdr - bt, according to gec / estro - eau recommendations, should be done under trus guidance with template, its proper fixation and treatment planning software . Additional imaging with ct or mri after implantation may be used . Clinical target volume (ctv) for hdr - bt can be whole gland (prostate surface) with homogenous needles distribution or with addition of visible tumor boost inside ctv . Prostate surface dose prescription differs among cancer centers and is between 6 to 10 gy per fraction with total dose of 12 - 20 gy in 2 to 4 fractions combined with ebrt of 45 to 54 gy in 6 - 7 weeks . Organs - at - risk doses should not exceed 120% of mtd for urethra and less then 6 gy per fraction for rectum . Those doses should be precisely stated and valuated in clinical trials with long follow - up including penile bulb maximum dose . Proximal tips of catheters should be visualized and images should be taken at least 9 mm above and below ctv . Organs - at - risk should be confined including rectum, urethra, bladder and penile bulb . Minimum of 14 catheters should be placed or more, particularly if boost within boost is planned . Especially urethra piercing should be avoided . At least 90% of ctv should be covered with prescribed dose with aiming 95% of ctv . Hdr - bt boost is given in one to six and hdr - bt alone in three to six fractions . Due to wide heterogeneity of fractionation schedules, oar constraints are based on experienced hdr centers references, e.g. From less then 105% to less then 125% for urethra . Ldr - bt should be performed under trus guidance according to gec / estro guidelines . If possible gross tumor volume (gtv) should be delineated on pre - treatment scans . Ctv should contain whole prostate with 3 mm margin in all directions except posterior (rectal wall) and cranial (bladder neck) if needed . Dose prescription to 100% isodose should be 145 gy for i and 125 gy for pd seeds . At least 95% of ctv should be covered with 100% isodose with no more than 50% of ctv with isodose 150% . Maximum dose in 2 cm for rectal wall should be no more than 145 gy and in 0.1 cm less than 200 gy . 150% of prescribed dose should cover less than 10% of urethra volume and 130% of this dose should cover less than 30% of its volume . It should be done as a preplanning, either as a separate procedure or on the implanting day in operational room . Main procedure should be performed with trus and template; patient position and probe angle should be similar to preplanned . Minimum is biplanar, high resolution (5 - 12 mhz) trus with dedicated planning software . Team should consist at least of trained radiation oncologist and qualified medical physicist, but presence of urologist, certified dosimetrist or other supportive staff is appropriate . Abs does not suggest any seed deposition technique, however it should have excellent outcome, be reproducible and with optimal dosimetry . Both stranded and loose seeds can be chosen for implantation . I and pd implants showed excellent outcomes, so abs do not favor any of them . Ldr - bt alone prescription dose to ptv should range from 140 - 160 gy for i seeds and 110 - 125 gy for pd . If combination of ebrt and seed implantation is planned, i ptv dose should be between 108 - 110 gy and pd ptv dose should be between 90 - 100 gy . Ebrt dose should be 41.4 - 50.4 gy (1.8 gy / day, but 2 gy / day is also acceptable). Ldr - bt is usually performed 0 - 8 weeks after ebrt, but there is no evidence for optimal sequence of these . Reverse approach is also accepted, which may theoretically be better, because of simultaneous irradiation from implant and ebrt and possibility of adjusting ebrt if needed . Dose constrains for organs at risk should not exceed 150% of prescribed dose in 5% and 125% of prescribed dose in 30% of urethral volume in the preplan . Prescribed dose should be in less then 1 cm of rectum on day 1 dosimetry and in less then 1.3 cm on day 30 . Although ct performed immediately or one day after the implantation has several positives, e.g. Early detection of dosimetric problems, but after implant oedema can derive dosimetric underestimations . It is 12 - 20 days after implantation for pd and 23 - 37 days for i. erectile function organs at risk e.g. Penile bulb are still not agreed, though there are no recommendations on these . Both ldr and hdr - bt patients should be seen 6 weeks after implantation (last one for temporary implants) according to gec / estro recommendations . Should be examined every 3 months, every 6 months until 5 years after treatment and then annually . Dre, psa test, side effects evaluation (urinary, rectal, potency toxicity and ipss) and trus should be done [18, 20]. Abs suggests to follow - up hdr - bt patients every six months for first 2 - 3 years, and then at least annually . It should consist of dre, psa test and toxicity evaluation (urinary, rectal and sexual function). Phoenix definition of biochemical relapse is recommended, although case individual assessment is required and patient should be informed about psa bounce . Ldr - bt patients should be seen every six to twelve months with regular intervals . Post bt rectal biopsies or urinary instrumentation should be avoided and all of the risks and benefits should be considered [21, 22]. Brachytherapy is supreme tool in prostate cancer management with a wide range of options in every risk group (table 2). Excellent outcomes and relatively small irradiated volume seems more beneficial than any risk of intraoperative implantation, particularly in wisely selected patients . Feasibility of seeding or catheterization is basic for choosing appropriate candidates for bt, however there are articles describing series of patient with non - fitting anatomy, i.e. Prostate smaller than 20 cm or bigger then 50 cm or post turp patients [24, 25]. Assesment should consist of careful clinical examination including dre, patient's history (i.e. Urologic, prior pelvic rt, surgery or trauma, inflammatory bowel disease, connective tissue dissorders), pretherapy psa serum level, biopsy proven cancer with gleason score and clinical staging . Trus stays basic imaging, but ct and mri are also very useful, either before procedure and as a planning guidance . New abilities of mri, i.e. Spectroscopy and diffusion, and 11c pet - ct should be discussed more in next recommendations [2628]. Gec / estro and eau recommendations on prostate cancer treatment with temporary implants with stepping sources are from 2005 and on permanent seeds from 2000 with 2007 update . Although general approach for bt, both hdr and ldr, has not particular differences across the world, european recommendations need an update . Recommendations comparison for gec/ estro and abs [18, 2022] under investigation for high risk patients to institutional review board
Only 2030% of patients with group a beta hemolytic streptococcus (gabhs) pharyngitis presents with classical symptoms of the disease . Reliance on clinical judgment alone has a poor predictive value and results in 80% to 95% overestimation of disease [2, 3]. Diagnostic strategies for acute gabhs pharyngitis are thus based on epidemiological factors, signs, and symptoms, as well as the result of throat cultures (tcs). Several studies have shown that the use of throat culture leads to more judicious use of antibiotics [57]. Physicians prescribe antibiotics for acute pharyngitis as they are concerned that patients with this complaint may be suffering from gabhs infection that if left untreated might develop suppurative complications, such as, tonsillar abscess or nonsuppurative complications, such as, rheumatic fever [6, 8]. Antibiotics, however; confer only minor symptomatic benefits for gabhs sore throat . They shorten the duration of symptoms by merely half a day on average [8, 9]. More recent studies have shown that antibiotic use only reduced the incidence of rheumatic fever by a mere 0.5 cases per 100,000 . The importance of preventing rheumatic fever has lessened as the incidence of rheumatic fever and rheumatic heart disease has declined significantly in the last 20 years, from a mean annual incidence of 13.4 per 100,000 to 5 per 100,000 . Prevalence has decreased as well from 5.7 per 1,000 in the eighties to 0.5 per 1,000 in 2000 [8, 10, 11]. This failure probably stems from the fact that about 20% of children with gabhs is infected with bacteria which contain m protein, a virulence factor located on the surface of the bacterial wall that confers resistance to commonly used antibiotics . Newer beta - lactamase - resistant antibiotics did not prevent this treatment failure [13, 14]. Review of the literature from 1945 to 1999, which includes 10,484 cases of gabhs sore throat, found that antibiotic treatment reduced the occurrence of acute otitis media, a common complication of this disease, by a mere 25%, compared to the placebo group and sinusitis by only 50% . Rheumatic fever, a nonsuppurative complication, was reduced by less than 33%, compared to placebo [8, 10, 11, 15]. In addition to the uncertainly in the scientific literature, parents seem to be uncertain regarding the benefits of antibiotic treatment for acute gabhs pharyngitis and tend to stop treatment earlier than prescribed . In a pilot study, we randomly followed 75 children with gabhs pharyngitis for 6 months and have found that more than 75% of them did not complete ten days of antibiotics . This finding led us to conduct a multisite, prospective cohort observational study, the results of which are reported here . The goal of this study was to determine whether noncompliance with antibiotic treatment affects short - term or long - term complications . Two central, primarily rural, and agricultural regions of the largest health maintenance organization (hmo) in israel, comprising approximately one million patients . Using a standard protocol, we located from our computerized data base 107,840 patients, aged 6 months to 18 years, who were examined by their primary care physician for upper respiratory tract infection, tonsillitis, pharyngitis, sore throat, tonsillopharyngitis, neck pain, cervical lymphadenopathy, pta, rpa, from january 1, 1999 until december 31, 2000 . We then accessed the charts of 78,473 of these children who were diagnosed with infected throat or one of the differential variants, excluding all children diagnosed as having viral upper respiratory infections . 47,000 of these patients were formally diagnosed with acute pharyngitis or acute tonsillitis and received a prescription for antibiotics, indicating that their physician suspected bacterial disease . In the index visit, 35,000 of these children had at least four out of five symptoms in the modified centor criteria used for this study and nadir modified breese epidemiological and clinical score card (ecsc) that has 91% sensitivity and 98% specificity when the score was above 15 (score between 4 and 36) for the diagnosis of gabhs [1719]. Colonies yielding beta - hemolysis were grouped for surface carbohydrate assessment by using a latex bead agglutination test (figure 1). Of the 6336 children (with positive cultures with 4 or more centor criteria and 15 or higher ecsc), 4,775 parents consented to enroll their children to the study (figure 1). Excluded from the study were children who were diagnosed as gabhs chronic carriers or who had suffered from post - gabhs complications; had any chronic illness, such as, renal or hepatic impairment; had bleeding disorder; had congenital or acquired immunodeficiency or suffered from malignancy . Initial patient / parent contact was made by one of the authors (m. sarrell) within 3 to 5 days of the initial positive throat culture . At that time, initial information regarding the illness and whether a prescription for antibiotics was given by the primary care physician . The attending physicians of the two thousand study patients were contacted by email within 48 hours of the enrollment by one author (m. sarrell). The physicians were requested to inform the authors of any additional cultures taken during therapy, and to request that they obtain two additional throat cultures and engage in improve adherence strategies by providing information, counseling, reminders, reinforcement, and if needed personal attention or supervision . While repeated cultures are not routinely recommended for asymptomatic patients who have completed a course of antimicrobial therapy, in light of the poor compliance with treatment in the pilot study, performance of such follow - up cultures was considered important for the purposes of the study . The first follow - up culture was performed within 10 to 14 days of the initial positive culture regardless of treatment status . The purpose of this culture was verification of antibiotics treatment failure or persistence of gabhs in the oropharynx of the untreated patients . The second additional throat culture was taken between days 21 and 30 after the initial positive culture, regardless of treatment status, to ascertain the presence of residual gabhs or recurrences . Treating physicians were also requested to obtain blood for liver enzymes, renal function tests, and urine analysis from all the participants and to perform annual follow - up evaluation thereafter . A second patient / parent contact was made by our study coordinator within 10 to 14 days of initiation of antibiotic treatment . She collected information about demographic characteristics, past medical history, febrile status, need for repeat throat culture during the treatment period (that was not part of the study protocol), and type of medication prescribed . During this contact she obtained information about the number of days of actual treatment, omission compliance and complications, the patients / parents perceived as deriving from the treatment (or lack thereof). The computerized charts of the participants were searched within 2 to 4 weeks of the second patient / parent contact for additional information, including demographic characteristics, medical and environmental history, initial clinical data, such as, in - office fever evaluation, results of the physical examination, additional culture taken, type of antibiotics used, and disposition of prescription received . A second search of the computerized medical charts was performed by our research assistant between 30 and 90 days of initiation of medical treatment, to ascertain that the 2 requested throat cultures were obtained . Relapse or recurrence of clinical or bacterial pharyngitis, suppurative or nonsuppurative complication, or even whether the participants complained of any sore throat within 30 days of completion of treatment were also evaluated . In order to assure that all possible short - term complications that occurred within 90 days of the index case were obtained, an additional comprehensive search of the hmo database was done within 120 days of the second computer search . We ascertained that findings that were either not available on the original computerized chart or were seen by other than their primary care physician, (e.g., emergency departments, patients that relocated), were not overlooked . The charts of the participants were then reviewed by one of the authors on a yearly basis, from january 2000 to january 2010, noting possible late nonsuppurative complications of gabhs infection . No patients were lost to followup, even if they had changed physicians, due to our ability to track them through the centralized database to their new physician or another hmo . The children that were enlisted to the army (and thus not members of any hmo during their military service) were contacted either through their former attending physician or the military physician . Minor treatment failure was defined as any clinical or bacterial recurrence of pharyngitis during the short - term follow - up period and its correlation to compliance with treatment . Major treatment failure was defined as retropharyngeal or peritonsillar abscess or long - term complications, such as rheumatic fever . Suppurative complications were chosen as a model, because the nonsuppurative complications (rheumatic heart disease, arthritis, carditis) have been practically eradicated in our region . This cohort study was designed to analyze rare events (according to the cioms classification 110 events per 10,000 children years). The annual incidence of peritonsillar abscess (pta) in our region is 24 cases per 100,000 and the incidence of retropharyngeal abscess (rpa) is 57 cases per 100,000 . Power calculations suggested 6,500 to 7,000 person - years of intervention would be needed to detect a 22% difference in pta and rpa between the fully treated (ft) and partially treated (pt) arms of the study population . Furthermore, one - sided alpha of 0.025, a statistical power of 95%, and the pta / rpa incidence given above showed that approximately 19,000 children - years would be needed to show the noninferiority of ft versus pt . Since the primary outcome of interest is the pta / rpa hazard ratio between ft and pt . The null hypothesis to be tested is hr pta / rpa> 2 (i.e., the pta / rpa hazard ratio for ft versus pt is higher or equal to 2). The pta / rpa hazard ratio was calculated for ft versus pt . For purposes of analysis, participants were divided into four subgroups based on length of treatment: 1st subgroup (untreated), those who did not receive any treatment, 2nd subgroup (partially treated), children that received antibiotics for 1 to 3 days, 3rd subgroup (mostly - treated), children treated for 4 to 6 days, and 4th subgroup (fully - treated) children treated between 7 to 10 days . Data are presented as proportions (with 99% confidence intervals [cis]), means (with sds), or medians (with interquartile ranges), using pearson tests, student's tests, or fisher exact test . Comparisons of length of treatment according to time and treatment were assessed using the repeated measures and analysis of variance and the paired t test . A 2-tailed p value of.05 was used to determine the statistical significance of differences observed between groups and to calculate confidence intervals around differences in sample means and odds ratios . We used the mcnamara test to measure the changes between the groups and their subgroups regard to the length of antibiotic treatment . Over half of their children (1023, 51%) were between the ages of 6 months and 6.9 years, and over half 1,039 (52%) were female . The majority of children (1,821, 91%) were prescribed penicillin or amoxicillin, allergic or intolerant to penicillin were treated with cephalosporin 25 (1.5%), erythromycin 109 (5.5%), and azithromycin 45 (2.5%), all medication were prescribed twice daily for 10 days, except azithromycin once daily for 5 days . No statistical correlation was found between the type of antibiotics, the children received, or the demographic characteristics and the complications found in the later medical examinations . Only 196 children (9.8%) actually completed 10 days of antibiotic treatment . Despite having received a prescription from their physician, two hundred and thirteen participants (11%) did not start taking any treatment whatsoever, including those who did not even purchase antibiotics . As shown in table 1 a no statistical correlation was found concerning length frequency and duration, palatability, number of daily dose of treatment, but a statistically significant difference was found between all the subgroups concerning the length of antibiotics treatment (p <the majority of children (1192, 59.6%) had 3 days or less of fever, defined as any rectal temperature less than 38.5c or oral temperature less than 37.8c . The majority of children (1591, 80%) received medication for four to six days at the most (partially treated subgroup). As illustrated in table 1, the association between the duration of fever and the number of days of treatment was statistically significant (p <.0001). Of the 306 (15.3%) children with clinically diagnosed recurrent tonsillopharyngitis, only 236 (12.3%) had positive gabhs findings on the throat culture taken within 10 to 14 days after conclusion of the primary infection . An additional thirty - four (1.7%) had a positive second study culture (taken 2130 days after the index positive gabhs culture). Of note is the fact that the majority (156, 66%) of the positive study culture at 1014 days were found among the subgroup treated for 7 to 10 days . No such positive results were found in the subgroup treated for 1 up to 3 days . Furthermore, no positive gabhs throat cultures were found on the second study culture in the untreated group . The majority (26, 76%) of positive gabhs cultures were in the mostly treated subgroups . As illustrated in table 2, these findings were both statistically significant (p <.0001) (table 2). Cervical lymphadenitis, acute otitis media, and impetigo were the only suppurative complications noted . 110 (5.5%) children developed cervical lymphadenitis, most (52, 47%) among the 6 to 7 days treatment subgroup and 33 (33%) among the 4 to 5 days treatment subgroup, a significant difference among the treatment subgroups (p <.0001). Additionally, no children developed nonsuppurative complications during 10 years of followup nor did any of the children develop iga nephropathy during the follow - up period . Furthermore, they were no association between the five modified centor criteria and development of complication, even when stratified by type of antibiotics or the season of the year . Altogether, 304 (15%) new onset cases of acute otitis media (aom) were diagnosed within 30 days of the initial diagnosis . However, only 31 (10%) of those were in the untreated subgroup, as compared to 141 (46%) in the 7 to 10 days treatment subgroup, 98 (38%) in the 4 to 6 days treatment subgroup and 98 (33%) in the 1 to 3 days subgroup, a statistically significant difference among the all treatment subgroups (p <.0001). Attempting to elucidate the possible causes for the differences between the recurrence of gabhs and the length of antibiotic treatment or clinical score on enrolment or illness severity, a multivariate stepwise logistic analysis was performed . The duration of fever was the most significant predictor for such recurrence, age under 6 years being less significant, while treatment for 7 to 10 days had no significant influence on the recurrence of gabhs . Of note is that the contribution of the duration of fever was apparent even after controlling for the concomitant influence of age, gender, medical history, single- or two - parent home, type of antibiotics or the season of the year, and concomitant illnesses, such as, conjunctivitis, otitis media, upper respiratory infection, gastroenteritis, or lymphadenitis, which may have otherwise explained the influence of the length of treatment in relation to those illnesses (table 3). This study found a very poor parent / child compliance to antibiotic treatment prescribed for symptomatic, culture - positive gabhs tonsillopharyngitis . 11% of children did not start taking any treatment at all, and only 10% completed a full course of treatment . The reason for this low rate of compliance is unclear, but it coincides with other reported studies [14, 16]. We speculate that a large proportion of lack of compliance is the parent's sensation that antibiotics are potentially dangerous and overprescribed [18, 19]. Despite this poor compliance, in our study as in others, there was a very low rate of suppurative complications . Furthermore, despite the poor compliance, we found no increase in the incidence of acute rheumatic fever, the most dreaded complication of gabhs, in our patients . In fact, since the year 2000, the incidence of rf in our region has declined from 2.2 per 100,000 to 0.2 per 100,000 in 2008, according to the epidemiological department of the israeli ministry of health . This is in concordance with other developed countries, including, the united states, where the original recommendation for 10 days of antibiotic treatment of gabhs originated . In that country, currently there are only 10 cases of rf per 100,000 patients with gabhs pharyngitis, and only 1 case per 10,000 patients with acute rheumatic fever develop rheumatic heart disease [2022]. In fact, concomitant with the increased use of antibiotics, recurrence of gabhs in the usa rose from 9% and 10.7% in the years 1975 to 1979, respectively, to 25.9% and 37.5% in the years 1995 to 1996, despite the decline in acute rheumatic fever . 14% of patients in our study had a recurrent infection, proven by a gabhs - positive throat cultures . This percentage is similar to other studies which found that penicillin failed to eradicate gabhs from the throat in approximately 13% to 26% of the patients evaluated [23, 24]. The majority of recurrences in our study were in the younger group (mean age of 10.2 years, and 60% of them younger than 9.9 years). This is consistent with other published studies where such recurrences were more frequent among children aged 1 to 8 years than among children aged between 13 and 19 years [24, 25]. Historically, prescribing 10 days of oral penicillin began in the 1950s, substituting the intramuscular injections of long - acting parenteral penicillin, based on surrogate markers of eradication of gabhs from the tonsillopharynx . However, no study has conclusively proven that this practice unequivocally prevents acute rheumatic fever [26, 27]. Even though orally prescribed penicillin appeared to be equally effective for clinical and laboratory resolution of signs and symptoms, it is difficult to administer and expensive, considering the staggering financial burden of approximately 140 office visits per annum per 1,000 children younger than 15 years [28, 29]. Substituting azithromycin or cephalosporins for penicillin was found to produce better bacteriological and clinical results and also required a shorter course of treatment [30, 31]. Our results may not apply to adults, sick people, or chronic gabhs carriers . It does not address the optimal length of treatment required to achieve appropriate eradication of the microbe or whether complete eradication is required at all . The method of pill / doses counts is not a good measure of adherence, but due to it simplicity and empiric nature it was found adequate for this study . We were unable to assess the true variation of the incidence of acute rheumatic fever, due to the fact that this disease has been practically eradicated from our population . Our data suggest that the large majority of parents / patients stop administering antibiotics to their children who suffer from gabhs prior to the completion of the recommended course . A more judicious use of antibiotics would promote and improve compliance, cut costs, and prove more convenient to parents and children alike.
Myofascial pain syndrome (mps) can be caused by frequent muscle or fascial stiffness as a result of prolonged tension and muscle fatigue due to repetitive stress of muscles or overuse of particular muscles1, 2 . Mps activates trigger points in 54% of women and 45% of men, and is regarded as the most common cause of pain in the musculoskeletal system3 . In particular, the upper trapezius requires head movement according to the direction of view, but it can be vulnerable to damage when the hands and arms are used repetitively in work that requires precise control4,5,6 . Once myofascial trigger points are activated, changes in the structural characteristics and contraction function of the muscle will occur . The most distinctive changes are taut bands, tender nodules, referred pain, local twitch response, muscle weakness, and restricted range of motion3 . To evaluate the contraction function of skeletal muscle, various methods can be used . Among them, surface electromyography (emg) analyzes functional changes in muscle by measuring quantitative changes in motor unit action potential that is activated by muscle contraction7, 8 . Surface emg is widely used in kinetic analysis to diagnose normal or abnormal function in muscles and nerves according to amplitude and frequency9 . It has several advantages, as it is noninvasive and convenient, and can perform measurement even during dynamic motion10, 11 . Although a number of clinical reports on the pathologic mechanisms or clinical diagnosis and treatment of mps can be found, few studies have been conducted on the changes in contraction function in myofascial trigger point areas or on the electrophysiological characteristics and neuromuscular physiological information . This study aimed to compare the electrophysiological characteristics of normal muscles versus muscles with latent or active myofascial trigger points, and to identify their neuromuscular physiological characteristics, in order to provide a quantitative evaluation of mps and clinical foundational data for its diagnosis . This study was approved by the research agency, and all participants provided written informed consent . Subjects were selected among those with no known neurologic disease, no regular exercise habit, and no drug use that could affect the experimental result . Subjects in the active myofascial trigger point group were those diagnosed with mps by a physician and whose clinical characteristics were pain in the upper trapezius during rest, taut bands, tender nodules, referred pain, local twitch response, and muscle weakness . Subjects in the latent myofascial trigger point group were those not diagnosed with mps but who felt tenderness when the upper trapezius was stimulated . Mean age, height, and weight, respectively, were 23.27 4.21 years, 172.32 8.44 cm, and 64.14 6.54 kg in the active trigger point group; 23.74 6.47 years, 174.76 6.22 cm, and 66.74 5.74 kg in the latent trigger point group; and 24.17 3.14 years, 171.21 9.64 cm, and 63.44 7.51 kg in the control group . To measure maximum voluntary isometric contraction (mvic), the shoulders and heads of the subjects were firmly fixed and pulled as the dynamometer as maximum power, thereby measuring mvic against the upper trapezius . Endurance time was measured from the start of mvic to a 50% reduction in contraction force . Median frequency (mdf) was measured by using emg at the muscle belly of the upper trapezius during mvic . Muscle fatigue index was calculated by obtaining the mdf at a section where the mvic force was reduced from 100% to 50%, and remove the 50% mdf from 100% mdf was divided into 100% mdf . The sampling rate for the surface emg signal was set at 1,000 hz, and the frequency band filter was set at 20 to 450 hz, using one channel . Storage and analysis of the emg signals was performed using acqknowledge 3.8.1 (biopac systems, goleta, ca, usa). The average of three measurements was calculated and used in the analyses; 10 minutes of rest was given between measurements to prevent muscle fatigue . Statistical analyses were performed using spss version 18.0 for windows (spss, inc . One - way analysis of variance was conducted to examine differences among groups with respect to the measured items, while the tukey test was conducted for post hoc analysis . There were no significant differences in mvic or endurance time among the three groups . However, mdf was significantly different among all three groups (p <0.05) (table 1table 1.comparison of mvic, et, mdf, and fi among the three groupsgroup a (n = 30)group b (n = 30)group c (n = 30)post hocmvic, kg19.811.5 * 22.19.423.510.2/et, s48.59.749.510.251.28.8/mdf, hz102.521.488.523.184.517.4a <cmfi0.150.070.080.040.060.04a <cdata are presented as mean sd . * significant difference among the three groups (p <0.05). Group a: active myofascial trigger points; group b: latent myofascial trigger points; group c: control . Et: endurance time; mdf: median frequency; mfi: muscle fatigue index; mvic: maximal voluntary isometric contraction). Tukey post hoc results showed that the active myofascial trigger point group was significantly different from the control group . Muscle fatigue index also was significantly different among all three groups (p <0.05) (table 1). Tukey post hoc results showed that the active myofascial trigger point group was significantly different from the control group . Data are presented as mean sd . * significant difference among the three groups (p <0.05). Group a: active myofascial trigger points; group b: latent myofascial trigger points; group c: control . Et: endurance time; mdf: median frequency; mfi: muscle fatigue index; mvic: maximal voluntary isometric contraction this study aimed to measure mvic, endurance, mdf, and muscle fatigue index of normal muscles versus muscles with latent or active myofascial trigger points, thereby identifying the neuromuscular physiological characteristics of muscles with active myofascial trigger points and providing clinical foundational data that are applicable for the quantitative evaluation and diagnosis of mps . Surface emg, which was used to evaluate the functionality of trigger points in this study, is nonintrusive and convenient; thus, it is widely used in studies on the functional characteristics of muscle, by analyzing the electrical activity of muscle . The results of mdf according to surface emg show changes in recruitment of fast - twitch muscle fibers and conduction velocity of motor unit action potential12 . In addition, increases in mdf reflect recruitment of type ii fibers, and muscle fatigue index can be analyzed according to the relationship between type ii fibers and mdf13, 14 . In the present experiment, mdf was significantly higher in the active trigger point muscles than in normal muscles . The above results indicate that as trigger points were activated, recruitment of motor unit action potential of type ii fibers also increased . In addition, muscle fatigue index also increased due to the increased distribution of type ii fibers . However, mvic was lower in active trigger point muscles than in normal muscles . Although a high correlation between muscle strength and mdf has been reported15, 16, the same correlation was not found in this study . This result was due to increased recruitment of motor unit action potential of type ii fibers in active trigger point muscles, which more easily induced muscle fatigue as a physiological phenomenon, thereby reducing muscle strength . In other words, the greater the fatigue, the weaker the muscle strength17; endurance also was decreased due to muscle weakening . Therefore, this study s results will be effective in complementing the physical therapy diagnosis of mps which, until now, has focused on physical examination only by understanding not only the usefulness of electrophysiological analysis in mps diagnosis, but also the neuromuscular physiological characteristics of active trigger point muscles.