Split (1)

train · 133k rows

text stringlengths 0 868k
It may be regarded as the localized equivalent of the systemic inflammatory response seen after any trigger of inflammation, which recently has been described as systemic inflammatory response syndrome . The complex nature of surgical infections, the multifaceted aspects of treatment, and the complexity of intensive care unit (icu) support makes evaluation of new diagnostic and therapeutic advances in this field very difficult . Mannheim peritonitis index (mpi) is a scoring system used in peritonitis which is simple and cost - effective . Mpi was originally derived from data collected from 1253 patients with peritonitis treated between 1963 and 1979 and was developed by discriminant analysis of 17 possible risk factors, by wacha, 8 of these were of prognostic relevance and was currently employed widely for predicting mortality from peritonitis . The information is collected at the time of admission and first laparotomy [tables 1 and 2]. The study was done in fifty patients with peritonitis who presented at government medical college, amritsar, and were operated after taking informed consent . Patients were followed up for the final outcome, and results were analyzed with the score of mpi . In this study, majority of patients belonged to age group of 21 - 50 years . The youngest patient was 8-year - old female, whereas to oldest was a 65-year - old male . There were 82% male patients and 18% female patients with the male to female ratio being 4.6:1 [figure 1]. It was further found that mortality for female patients was 55.56%, and for male patients, it was 9.76% . In patients with localized peritonitis, there was no mortality as compared to diffuse peritonitis which had mortality of 20.45% . Majority of the patients presented to hospital after 24 h (86%), and most commonly during 48 - 72 h (44%). The mortality of patients was highest (66%) who were presented to hospital after 72 h, and it was 33% who were presented between 48 and 72 h. there was no mortality for patients who presented within 48 h. the mortality of patients who had clear, cloudy, and fecal character of exudates was 12.5%, 15%, and 100%, respectively . For patients with no malignancy, patients having no organ failure preoperatively, mortality was 7.14% as compared to patients having organ failure, mortality was 75% [table 3]. Summary of risk factors of mannheim peritonitis index and mortality the study showed that mortality steadily increases with increase in mpi score showing statistically significant results [p <0.001, figure 2]. Various postoperative complications seen in the study group were wound sepsis, wound dehiscence, acute renal failure, pneumonitis, acute respiratory distress syndrome, and shock . The study also showed that morbidity steadily increases with mpi score [p <0.001, figure 3]. Mortality and mannheim peritonitis index score morbidity and mannheim peritonitis index score for a score of 27, the sensitivity was 66.67%, specificity was 100%, and positive predictive value for mortality is 100% at an accuracy of 94% [p <0.001, table 4]. Sensitivity and specificity of mannheim peritonitis index score 27 peritonitis, inflammation of serosal membrane lining the abdominal cavity and abdominal viscera, is associated with high mortality rate . Peritonitis remains a hot spot for the surgeons despite advancements in surgical technique and intensive care treatment . Various factors such as age, sex, duration, site of perforation, extent of peritonitis, and delay in surgical intervention are associated with morbidity and mortality . Bacteria and digestive enzymes act on the peritoneal serosal surface lead to enzymatic digestion and necrosis and an outpouring of serum protein and electrolytes from the blood to the cavity . There is formation of exudate rich in granulocytes, which may be diffuse or confined to an abscess . Systemically, there is paralysis of the bowel, hemoconcentration occurs, and alterations of the cardiac output due to the shift of fluids and later acidosis . Intrapulmonary shunting, hypo- or hypercapnia, hypoxemia, progressive azotemia, acute tubular necrosis, weight loss by protein consumption, fall of body temperature, loss of heat production, and exhaustion are other complications that may lead to the death of the patient, if the process is not interrupted . A successful outcome depends on early surgical intervention, source control, and exclusive intraoperative peritoneal lavage . It may also depend on exact recognition of the seriousness of the disease, an accurate assessment, and classification of the patient's risks . Despite the surgical treatment and sophisticated icus, last generation antibiotics and a better understanding of pathophysiology of peritonitis mortality rate are still very high, i.e., 1020% even in good institutions . Early prognostic evaluation is necessary to select high - risk patients for more aggressive therapeutic procedures such as radical debridement, lavage systems, open management, and planned reoperations . Classification of the severity of disease means the definition of groups by risk, and it is of confirmed value in both controlled and uncontrolled clinical trials . An accurate risk index classification is only method to settle a standard of comparison between groups of patient and different treatment methods which would allow further prospective adequate comparative study . The mpi has a definite score for an individual, which has a good accuracy . Mpi can be used to define risk groups as well as predict outcome in patients with peritonitis, as indicated by various studies . Showed patients who obtained <21 points and more than 29 points, mortality rate was 6% and 50%, respectively . Showed mortality at score of above 21 and 29 of 60% and 100%, whereas fgger et al . Showed below 21, no mortality; between 21 and 29, mortality was 29%; and more than 29, it was 100% . Studies showed mortality among patients who obtained <21 points varied between 0% and 2.3%, in the 2129-point group between 3.85% and 60%, and in patients with score of> 29 between 15% and 100% . Billing's meta - analysis showed the following mean mortality rates in the groups with <21 points, between 21 and 29 points, and above 29 points: 2.3% (011%), 22.5% (10.650%), and 59.1% (4187%), respectively . Other studies have also shown statistically significant relation of morbidity and mortality with increasing mpi score . Yoshiko and masayuki showed patients with mpi score of 26 or less have mortality of 3.8%, whereas score of 26 or more had mortality of 41% . Such difference in cutoff values might be due to different demographics and therapeutic options offered to patients at different institutions . In our study, score of 27 showed the sensitivity, specificity, and positive predictive value at 66.67%, 100%, and 100%, respectively, at an accuracy of 94% . In our study showed mortality rate with score <21, 21 - 27, and> 27 was 0%, 27.28%, and 100%, respectively . Similarly, morbidity rate for patients with a score <21, 21 - 27, and> 27 was 13.33%, 65.71%, and 100%, respectively . The predictions resulting from mpi were reliable, indicating stratification of risk groups can be done by probability intervals . Study showed that age> 50 years out of a total of 79.3% death was seen in 85.2% and survival in 67.6% and p = 0.04, thus showing that age> 50 years is a significant risk factor . In our study, patients <50 years, mortality rate is 13.16%, and for patients more than 50 years, the mortality rate is 33.33% although it did not reach statistically significant values (p = 0.113). Wittmann showed in his study, a high mortality rate (50%) when the diagnosis of peritonitis was made after 48 h. the observed high frequency of patients with preoperative peritonitis duration longer than 24 h (65.5%) was correlated with high death rate . Our study also showed similar results with mortality of patients who presented between 48 and 72 h was 33% and> 72 h was 66% as compared to no mortality who presented within 24 and 48 h (p <0.001). A study by basnet and sharma, out of the fifty patients included in the study, 21 (42%) were female and 29 (58%) were male . About 24.1% of the males and 19% of females requiring relaparotomy expired in the study, making female sex not a bad prognosticator in their study (p = 0.100). Mortality for female patients was 55.56% as compared to male patients having mortality of 9.76% (p = 0.001). The study by notash et al . Had mortality 17.5% mostly due to organ failure and septicemia . Our study also showed organ failure, a significant risk factor as patients having organ failure had mortality of 75% as compared to no organ failure having mortality of 7.14% (p <0.001). Another study concluded that with age more than 50 years, late presentation, diffuse peritonitis, purulent exudate, noncolonic pathology, and organic failure associated with high mpi score and more mortality . This study proves that mpi scoring system is a simple and effective tool for assessing the morbidity and mortality in patients with peritonitis with statistically significant results . Duration of pain> 24 h, organ failure on admission, female sex, and feculent exudate were found to be independently significant factors in predicting the mortality . Such patients should be monitored closely with close attention to be given to support the vital systems . To conclude, mpi is a simple and reliable tool in predicting the outcome in cases of peritonitis.
During 20092010, serum samples from patients with suspected dengue were received by the fdoh for dengue diagnostic testing; the samples came from 16 of florida s 67counties . Specific, real - time rt - pcr (8) and igm anti - denv elisa (9). Samples with highly positive rt - pcr results were spread onto cultured ae . Albopictus c6/36 cells, and the presence of virus and genome were confirmed by immunofluorescence (10) and rt - pcr, respectively (11). Isolates were further propagated and viral rna was extracted from culture supernatants by using the universal biorobot system (qiagen, valencia, ca, usa). The envelope glycoprotein (e) gene was amplified (technical appendix), and the e gene open - reading frame (1,485 bp) was sequenced . Multiple sequence alignments were performed by using the muscle module available in mega 5 (www.megasoftware.net). Evolutionary history was inferred by using maximum likelihood and phylogenetic trees constructed by using neighbor - joining methods . Evolutionary distances were computed, and several e gene sequences from genbank were included in the phylogenetic tree to support tree topology by genotype (technical appendix). In 2009, five denv-1positive cases were identified by rt - pcr in key west . Subsequently, in 2010, the fdoh tested 195 serum samples by real - time rt - pcr . Fifty - six (29%) samples were positive for denv rna: denv-1 (37 [66%] samples), denv-2 (13 [23%] samples), denv-3 (3 [5%] samples), and denv-4 (3 [5%] samples). Monroe county submitted 73 serum samples, of which 31 (42%) had results positive for recent dengue infection: denv-1 was detected in 22 by rt - pcr, and 9 had positive igm anti - denv elisa results . None of the denv-1 patients from monroe county had a history of recent travel to a dengue - endemic region before the onset of symptoms . Fifteen other florida counties submitted serum samples: 13 counties submitted <10 specimens, 1 submitted 2030 specimens, and 1 submitted> 60specimens . Denv-1 was found in 15 serum samples from 6 of these counties; however, all the patients had a history of recent international travel . We sequenced the e gene of 12 denv-1 strains isolated in florida during 20092010 to determine their genetic relatedness; of the 12 strains, 8 were from key west and 1 each was from dade, broward, orange, and pinellas counties . In addition, 23 denv-1 e sequences published in genbank, including the 2010 key west isolates obtained from a blood donor and a mosquito pool (6,7), were used to construct a maximum - likelihood phylogenetic tree . This phylogenetic analysis showed that all the florida denv-1 isolates belong to the american african genotype (genotype v) (12,13) together with other viruses isolated throughout the americas (figure 1). Maximum - likelihood phylogenetic tree of dengue virus type 1, including isolates from key west, florida, usa, and representative isolates from 5 genotypes with global geographic distribution . Solid circles, 8 key west viruses (monroe county) isolated during 20092010; solid diamonds, isolates from other florida counties (dade, pinellas, orange, and broward counties). Each taxon represents a single virus isolate and is labeled with the geographic origin and collection year . Thirty - six envelope glycoprotein gene sequences obtained from genbank were included to support tree topology and identify genotypes . All genotypes except the american african genotype (v) have been collapsed . Key west denv-1 viruses grouped among central american viruses, which configure a distinct lineage separate from the caribbean viruses . This divergence between the central american and caribbean lineages is well supported by high bootstrap values . Moreover, the key west and monroe county viruses grouped together and indicated a distinct sublineage supported by a high bootstrap value (99%), separating them from viruses isolated in dade, orange, pinellas, and broward counties that were more closely related to other central american viruses (figure 1). One 2009 isolate (iq425062) from a key west patient is related to this group, suggesting a separate introduction of denv-1 in key west . The sequence similarity between the 2009 and 2010 key west strains was <0.9%; however, the evolutionary distance and taxa positions between the 2009 and 2010 strains presented in the phylogenetic tree suggests that the 2010 strains diverged from the 2009 strains . The observed differences between e gene sequences for the key west strains (20092010) and the rest of the strains in this phylogeny were <2.1% with the other florida strains, <1.2% with central american strains, and <4.8% with the rest of the american african genotype . Evolutionary distances and the topology of the central american lineage suggest this lineage is the genetic origin of the florida denv-1 strain . Most viruses isolated in monroe county diverged from the central american lineage into a distinct sublineage the key west denv-1 strain associated with the 20092010 outbreak . The high level of genetic similarity among the viruses isolated in monroe county, their close evolutionary distances, and the lack of recent international travel for the case - patients suggest endemic transmission and microevolution of this denv . Conversely, the scattered and separate phylogenetic positioning of virus strains from patients with travel - associated cases from other florida counties indicates a different origin from the majority of key west isolates . Although the 2009 broward isolate (jq425067) is positioned near the central american lineage, the low bootstrap value (53%) does not support lineage ancestry . The epidemiologic and phylogenetic evidence suggests that the 2010 cases appeared to be a continuation of the 2009 outbreak . Unlike cases along the texas mexico border (14), in addition, denv-1 was detected in a blood donation from the monroe county in 2010, further supporting local transmission of denv (7). Collectively, these findings indicate that endemic denv-1 was transmitted in key west over a period of> 2 years . Table showing the dengue virus type 1 (denv-1) envelope gene reverse transcription pcr and another showing denv-1 strains used in a study of the genetic relatedness of dengue viruses in key west, florida, usa, 20092010.
Corneal epithelium is able to alter its thickness to mask subepithelial stromal irregularities and maintain a smooth anterior surface of the eye . Laser refractive surgery such as lasik alters the anterior corneal contour and leads to remodeling of corneal epithelium . We estimated the extent of the epithelial remodeling after lasik with a mathematical model in a previous study . However, in that study, we did not have the capability to measure the corneal epithelial thickness to validate the model directly . Instead, we constructed the model constants based on regression in manifest refraction after lasik . Direct measurement of epithelial thickness change may help to better understand corneal epithelial remodeling after lasik and improve lasik ablation patterns with less regression and surgery - induced aberrations . Previous studies used confocal microscopy to measure epithelial thickness, but the number of points measured was limited and the measurement was time consuming . Very high - frequency digital ultrasound was also used to map corneal epithelium and stromal thickness [4, 5]. However, because ultrasound cannot pass through air, this technique required immersing the cornea in a fluid bath . Though both confocal microscopy and very high - frequency digital ultrasound are feasible in measuring corneal epithelial thickness, they are not often used in routine lasik because they required touching the cornea . Optical coherence tomography (oct) is a noncontact imaging technique based on principles of low - coherence interferometry . The current generation of oct is based on fourier - domain technique [6, 7]. In a recent article, we demonstrated that a commercial fourier - domain oct could automatically map the corneal epithelial thickness with good repeatability . In this study, we use this algorithm to map corneal epithelial thickness for eyes before and after myopic lasik surgeries . The changes in epithelial thickness were used to validate the smoothing model we mentioned above . This prospective observational study was conducted at doheny eye institute, los angeles, ca . The lasik subjects enrolled in this study had no history of eye surgery and were comprehensively examined to exclude any eye diseases including dry eye . Soft contact lenses wearers were asked to stop wearing contact lenses at least two weeks prior to lasik . The treatment of study subjects was in accordance with the tenets of the declaration of helsinki . The laser settings were based on manifest and cycloplegic refractions calculated at the corneal plane . The lasik flap was created with a 60 khz femtosecond laser (intralase, abbott medical optics, santa ana, ca). The femtosecond flap thickness was programmed to 110 m with a diameter of 9.0 mm and a 70-degree angled side cut . The stromal ablations were performed with visx star s4 ir customvue excimer laser (abbott medical optics, santa ana, ca). The optical zone was set to 6.5 mm in diameter centered on the pupil center with blend / transition zones up to 8.0 mm . To measure epithelial thickness before and after lasik, a commercial fourier - domain oct system (rtvue, optovue inc ., fremont, ca) with a speed of 26,000 axial scans per second was used . A pachymetry + cpwr scan pattern (6 mm scan diameter, 8 radials, 1024 axial - scans each, repeated 5 times) centered at the pupil center was used to map the cornea . The subjects were asked to look straight ahead and fixate on the internal fixation target of the oct system . The oct scan pattern was repeated 2 times on each eye during the same visit . The algorithm was described in a previous article and was available in the commercial rtvue software . The average epithelial thickness over the central 1 mm diameter, 1~2 mm, 2~3 mm, 3~4 mm, 4~5 mm, and 5~6 mm annular zones, was used in the analysis . Correlation of lasik - induced change in epithelial thickness with the amount of spherical equivalent of lasik correction was investigated . A smoothing constant based on our epithelial smoothing model, the change in epithelial thickness could be calculated by applying a first - order, 2-dimensional butterworth low - pass filter to the ablation profile . The cutoff frequency of the butterworth filter was the reciprocal of the smoothing constant . If we simulated the ablation profile for 1 d special myopic lasik using munnerlyn algorithm and assumed the optical zone diameter to be 6.5 mm, the smoothing contact could be estimated . The smoothing constant has a unit of length and can be thought of as the radius over which epithelial smoothing occurs . Ablation simulations were performed using matlab software version 5.3 (the mathworks, inc ., paired t - test was used to compare the difference of preoperative and postoperative epithelial thickness . Generalized estimating equation was used to account for the intereye correlation in the variance of t - test . Statistical analysis was performed using the microsoft excel and sas 9.1 (sas institute inc ., cary, nc, usa). Nineteen eyes (10 right eyes, 9 left eyes) from 11 myopic lasik patients (6 women, 5 men) were analyzed in the study . The spherical equivalent of lasik correction ranged from 1.69 d to 6.75 d (mean: 4.39 1.63 d). Corneal epithelium was thicker on the inferior side compared to that on the superior side both before (figure 1(a)) and after lasik (figure 1(b)). The average central epithelial thickness was measured to be 52.6 4.1 m (40.9~60.6 m) before lasik and 56.2 4.3 m (50.0~65.5 m) 3 months after lasik (p = 0.013, figure 2). The average epithelial thickness at 5~6 mm annular zone was 51.6 6.6 m (39.6~67.4 m) before lasik and 54.8 4.3 m (49.8~68.0 m) 3 months after lasik (p = 0.024, figure 2). The epithelial thickening reached maximum at about 4 mm diameter and tapered off toward the peripheral (figure 3). The change in average central epithelial thickness was significantly correlated with lasik spherical equivalent setting (figure 4). The slope of 1.15 indicated that, for every diopter of myopic lasik correction, the central epithelial thickness increased by 1.15 m, which corresponded to a smoothing constant of about 0.46 mm . Based on this smoothing constant pattern; that is, the maximum epithelial thickening occurred at an annular area around the center (figure 5). Previous studies have demonstrated that it is feasible to use oct to measure the thickness of different layers of the cornea, such as the epithelium, stroma, and lasik flap using time - domain oct . However, the axial resolution of the earlier oct systems was low and the manual computer - caliper measurement was time consuming . In this study, we used newer fourier - domain oct which has faster scan rate and higher axial resolution with automated measurement of epithelial thickness . The finding agreed with previous oct studies [8, 12] as well as results with very high - frequency digital ultrasound . The asymmetry might be caused by the movement of upper eyelids during blinking [4, 13]. Similar inferior / superior asymmetry in the thickness of corneal epithelium was also found after lasik (figure 1(b)). The average central epithelial thickening was about 3.6 m at the 3-month followup for a mean spherical equivalent correction of 4.39 d. this finding is in agreement with previous studies that demonstrated the correlation between central epithelial thickening and the amount of myopia correction [5, 1419]. Using confocal microscopy, spadea et al . Demonstrated that epithelial thickness increased within the first week after lasik, with a maximum increase of approximately 6.5 m by the third month for a mean spherical equivalent correction of 10.48 d. using very high - frequency digital ultrasound, reinstein et al . Found that there was a central approximately 5 mm zone of epithelial thickening of up to 7.5 m 1 year after lasik for a mean spherical equivalent correction of 3.34 d. in a recent study where a similar oct system was used, kanellopoulos and asimellis found that increases in central (0~2 mm diameter), midperipheral (5 mm diameter), and overall mean epithelial thickness appeared to be in almost a linear correlation with the amount of targeted myopic correction (1.39 m / d for midperipheral region). The authors hypothesized that epithelial hyperplasia might be caused by a thinned cornea which was biomechanically unstable . This hypothesis was also supported by a study of epithelial thickness changes after collagen cross - linking (cxl). However, the epithelial thickness changes could actually be explained by the simultaneous topography - guided ablation to reduce the cone . In other words, the epithelial thickness changes could be a response to focal curvature changes in addition to corneal biomechanical properties . The average central epithelial thickening was significantly correlated with lasik spherical equivalent setting . For every diopter of the 1.15 m per diopter epithelial thickening was matched to a smoothing constant of 0.46 mm . This value was larger than our previous estimate (0.32 mm) probably because of the mix of spherical astigmatism subjects in this dataset . Our results showed more epithelial thickening centrally (1 mm diameter zone) than that paracentrally (5 - 6 mm annular zone). This does not agree with a previous study with very high - frequency digital ultrasound where epithelial thinning was observed between the 5.6 mm and 8 mm diameters except superiorly . We speculated that the discrepancy may be caused by larger optical zone (6.5 mm) and use of transition zone (up to 8.0 mm diameter) in our study compared to the 6 mm optical zone used in the previous study . In figure 2, if we could measure epithelial thickness beyond 6 mm diameter and the plot could be extrapolated, epithelial thinning would have been observed at the periphery . However, because we did not have access to the proprietary ablation profiles of the laser companies nor had our current oct system the ability to measure a larger area, we could not provide a more concrete explanation for the disagreement . On the other hand, both clinical data (figure 3) and simulation (figure 5) showed that the maximum epithelial thickening occurred at an annular area about 3~4 mm in diameter, not at the center . The difference was more obvious on the average epithelial change map from the clinical data than the simulation . We speculated the reason being that the actual lasik ablation pattern might precompensate for the laser - induced spherical aberration, which meant that the actual ablation at the paracentral area would be deeper than munnerlyn's algorithm used in the simulation which did not account for spherical aberrations . In addition, after the compensatory remodeling of corneal epithelium to surface curvature changes, the area with increased epithelial thickening was most likely to be annular because of the ring shape of spherical aberration . One limitation of this study was that it only included epithelial thickness measurements 3 months after lasik . However, central epithelial thickening has been reported 1 year up to 7 years after excimer laser ablation, all of which found no statistically significant change in central epithelial thickness after 3 months . Therefore, it may be reasonable to assume that the epithelial thickness is stable 3 months after lasik . It also should be pointed out that, besides focal corneal curvature, changes in corneal biomechanical properties, such as dry eye and cross - linking [23, 24], may result in corneal remodeling as well . Therefore, it is important to take multiple factors into consideration if they are mixed . In summary, fourier - domain oct was demonstrated to be a valuable tool for noncontact measurements of corneal epithelial thicknesses change caused by lasik . The maximum epithelial thickening occurred at an annular area about 3~4 mm in diameter . However, wider scans are needed to measure epithelial thickness change toward the edge of the ablation zone.
This is particularly the case of the health of people living in contaminated site(s) (cs) which is affected by the legacy of past industrialization and current industrial activities, often in absence of environmental remediation . European community legislation addresses the concept of cs only in the context of the thematic strategy for soil protection and the soil framework directive proposed by the european commission (ec) in 2006; for details on the legal framework and definitions at eu level refer to who 2013 . According to 2007 estimates, soil contamination requiring clean up is present in approximately 250,000 sites in the european environment agency (eea) member countries . Although main polluting sources may vary across europe, industrial production and commercial activities, oil industry and waste disposal and treatment are reported to be the major ones . National reports indicate that heavy metals and mineral oils are the main soil contaminants, while mineral oils and chlorinated hydrocarbons are the most frequent pollutants found in groundwater . A general definition, following the public health perspective, is areas hosting or having hosted human activities which have produced or might produce environmental contamination of soil, surface or groundwater, air, and food chain, resulting or being able to result in human health impacts . Given this definition, an area affected by a single chemical contamination of a single environmental matrix (e.g., the soil contamination caused by a given pesticide) and a large area with soil, water, air, and food chain contamination by multiple chemicals (e.g., the contamination caused by long - term emissions of a petrochemical complex) can be both considered contaminated sites . There are several approaches and methods for assessing the health impact of national priority contaminated sites (npcs). On the one hand, one can apply risk assessment techniques, where available data on the degree of contamination (typically measures of concentration of specific hazardous chemical agents) are used to quantitatively estimate the risk of occurrence of health endpoints causally associated with the agents; on the other hand, epidemiological approaches applicable to npcss involve the inclusive collection of available health information of resident population, and various agents and exposures . In these assessments, a first descriptive level is based on epidemiological tools that do not require an ad hoc collection of data and aims at describing the health profile of populations documenting ascertained or suspected associations with local environmental risks and the potentiality to provide efficient answers . More detailed analyses can be carried out, at a higher level of definition, by collecting specific data on health outcomes and/or on exposure . Sentieri project (epidemiological study of residents in italian contaminated sites) [6, 7] is an example of first level descriptive approach adopting an ecological study design, looking at the aggregate population level rather than at individual level . Sentieri project is a national project developed to evaluate the health profile of populations residing in the italian sites of national interest for environmental remediation - national priority contaminated sites (npcs). These sites were labelled as sites of national interest because of their substantial contamination, documented in qualitative and/or quantitative terms, and the consequent potential impact on the health of residents . The methods proposed under the approach exemplified by sentieri can be generalized and applied to other npcss . This paper's objective is to present the rationale and methods underlying sentieri project and to describe data and resources required to apply a similar approach in other countries . When studying how the environment can adversely affect human health, it is usually very difficult to identify clear cause - effect relationships because they are characterized by multicausality with different strengths of association . In addition, these relationships are influenced by individual factors (e.g., genetic, diet, life - style, occupation, and socioeconomic status) that can also have a role on both exposure level and disease development . It describes the health profile of residents in contaminated sites through small area analysis by applying the multistep procedure described in the following sections . A selection of epidemiologic terms are defined in glossary to facilitate the reading of the paper . As a first step, npcss to be studied should be chosen, and the criteria adopted to define npcs / npcss are clearly indicated . The npcs selection will depend on the aims of the study to be undertaken, on the availability of the npccs - related information, and on any other consideration researchers would make and consider appropriate . In many instances, npcss to be studied are chosen by third parties, such as an environmental authority, by public concern, and media pressure . It is advisable that the criteria used throughout this phase are clearly stated . In most instances npcss are characterized by the presence of numerous and different environmental sources of contamination possibly leading to human exposures . All the available npcs data should be collected and described in a standardized, homogeneous way . Geographical characteristics, extension of the contaminated area, and demographic information about residents potentially affected should be listed . Detailed description of contamination characteristics should be included as well as the presence of industries and all other human activities that have contributed to the environmental deterioration of the npcs . Researchers will specify the sources used for this task: scientific reports, acts, and so on . Populations at risk can be identified as people living in the neighborhood of npcss sources or living in areas defined as contaminated . Typically, the distance from the areas affected by contamination is used, but also dispersion modelling results are used . In the latter case, the definition of the areas most affected by contamination, and the consequent identification of at - risk populations, depends on the accuracy of the model . There are several models used to evaluate the areas affected by contaminants; their implementation and improvement depend on the available information on several parameters . For example, in the case of emissions into the air from oil refineries, the parameters to be considered should be characteristics of emission sources: for example, height, flow rate, composition of emissions, exit temperature, local orography, and meteorological conditions . Areas characterised by contamination processes different from direct industrial emissions require other parameters . In the case of landfills many early disposal sites did not have liners to trap rainwater that percolate through the landfill, and some newer landfills have liners that leak . The percolating water leaches toxic chemicals (e.g., from batteries, electronic equipment, and discarded household chemicals) that can contaminate soil and groundwater in ways that make it difficult to adequately identify the population at risk . Furthermore, in defining contaminated areas in case of complex industrial contamination, it should be considered that populations can experience several routes of exposure, mainly through inhalation of pollutants emitted into the atmosphere, and through ingestion when contaminants are accumulated in soil, water, and food chain . For the reference population the same data of the area units under study are needed: cases and populations stratified by gender and age categories . The reference population should be selected considering two different needs: (1) it should be comparable to the studied populations for factors that can affect the health profile with the exception of the contamination at study the differences in the health profile between the compared populations should be ideally due only to the differences in environmental exposures, namely, to the contamination; (2) it should be sufficiently numerous to obtain stable reference rates also for rare diseases . These two needs have opposite requirements, as the first one is usually negatively correlated with the dimension of the population, while the second one is positively correlated with the dimension of the population . Usually one or two populations among the following are selected as reference population: national, and regional, local (i.e., a population composed of populations residing in the neighbourhood of the contaminated area). The aims of the study will imply a sound outcomes selection to include the ones for which environmental exposure / s (see environmental data) is suspected or ascertained to play an etiologic role . The possible health impact from environmental exposures is measured in terms of mortality, morbidity, incidence of neoplastic diseases, and so forth . General considerations about the quality of available information and data as well as intrinsic limitations of the selected outcome measures should be described and discussed . Health indicator characteristics should be carefully examined and multiple aspects considered taking into account the inherent uncertainty . Sources of national or local routinely collected data, spatial and temporal coverage, and quality aspects are all of extreme importance for the validity of study results and their usefulness in terms of general knowledge and public health relevance . An appropriate length of the period under study will make research results and conclusions more informative for diseases with long latency times; precision of the epidemiological parameters will also improve with a longer study period . The specific value of small - area analysis is that it permits the examination of data for population which tend to be more homogeneous in character and in their environmental circumstances than the larger and more widely spread populations . The smallest territorial unit that can be used in small area studies depends on data availability that may vary in different countries . For example, in italy small area studies can be carried out at the census tract (average of 200 residents) and municipality levels . In 2001 about 70% of the italian municipalities included less than 5,000 residents; this compares with great britain, where small area studies can be carried out at the following levels: enumeration districts400 residents, electoral wards5,100 inhabitants, and postcode sectors6,600 people . In geographical studies of environment and health, confounding from social and economic factors may occur . To control such confounding effect, standardisation techniques have been extensively used since the mid-1990s . To account for possible confounding from socioeconomic factors in sentieri project, deprivation can be defined as a state of observable and demonstrable disadvantage relative to the local community or the wider society or nation to which an individual, family, or groups belong . Deprivation indices are area - based measures of material and social disadvantageous circumstances, that is, indicators of relative deprivation at population level . A detailed discussion on the use and critical aspects of the application of di in small area studies of environment and health can be found in an open access systematic review . When performing epidemiologic studies, there is a risk for researchers to become data - driven . This can be the case when commenting results for causes showing an increase, possibly on the basis of statistical significance . As an example, sentieri dealt with the complexity of the relation between area contamination and health effects . For each npcs studied the project focused on those causes identified a priori from the epidemiological evidence of their association with selected environmental exposures . It is suggested that researchers use environmental contaminants information considering the available level of details . In sentieri possible relevant exposures were abstracted from legislative decrees, that is, administrative sources defining npcss boundaries and coded on a productive sectors basis (i.e., petrochemicals and/or refineries, harbours areas, etc . ). While for some npcss information on specific chemical contaminants was available, for others only productive plants were listed . This is to point out that researchers should be able to adapt this approach to their specific situation . When studying factors that determine changes in the occurrence of a given health condition or its predictive factors, it should always be kept in mind that most diseases have a multiple etiology . Therefore also exposures different from those specifically present in npcss should be considered, as well as every known cause or risk factor, such as smoking habits, alcohol consumption or other sources independent from those at study, that is, socioeconomic factors and occupational exposures, and air pollution due to combustion of fuels for transport activities and domestic heating . The latter aspects are particularly relevant when studying complex industrial settings close or overlapping to urban highly populated areas . Once the environmental exposures of interest identified, researchers should examine the updated scientific literature to evaluate the associated health effects . This apparently easy task is in fact quite demanding, because by browsing the literature different kinds of publications are collected: handbooks, original articles, letters to scientific journals, multicentric studies, editorials, reviews, meta - analyses, and so on . Therefore, the first decision to be taken is about the relevance to give to the collected material and how to use it to define the strength of the association between the specific health outcome and the environmental exposure / s that characterize / s the npcss . Sources expressing the epidemiological community consensus, evaluating scientific evidence by means of standardized criteria, and weighting the study design and the occurrence of biased results were considered most important (i.e., iarc monographs, who publications, european environment agency reports, handbooks of environmental, and occupational medicine). They were followed in the hierarchy by quantitative meta - analyses . Consistency among sources was a criterion used to classify the strength of the causal association . This process was performed considering not only the environmental exposures, but also those risk factors previously mentioned (smoking habits, alcohol consumption, air pollution, socioeconomic aspects, and occupational exposures). Literature sources were presented in the final report in a tabular form to let the reader follow the entire process of evaluation for each cause combined with different exposures . On the basis of explicit criteria the strength of the causal association for each cause - exposure combination was classified (matrix of a priori evidence evaluation). Expertise in environmental and occupational epidemiology, statistics, and public health clinical medicine, toxicology, and analytical chemistry are needed to tackle this complex environmental issue . All data about contamination sources and characterization of contamination should be collected and examined to identify the contamination diffusion and finally define the areas and populations possibly affected by contaminants . Sentieri project studied populations residing in the sites of national interest for environmental remediation (national priority contaminated sites npcss). In sentieri the production activities and sources of contamination listed in the decrees defining the sites' boundaries were used as a proxy for environmental residential exposures; they are coded as chemical industries, petrochemicals and refineries, steel plants, power plants, mines and/or quarries, harbour areas, and asbestos or other mineral fibres, landfills, and incinerators . For each npcs contamination data the study population comprised residents in 44 npcss; each one included one or more municipalities, a total of 5.5 million inhabitants in the 44 npcss, about 10% of the italian population at the time of 2001 census . In sentieri project the italian 2001 standard population was used as a reference to calculate crude and standardized rates . Each outcome and cause analysed should be characterized to define its specific contribution in evaluating the possible health impact of contamination . For this aim, mortality, morbidity (e.g., hospital discharge records), cancer incidence, and congenital malformations prevalence could be of major interest . As described in the previous section, for each outcome a matrix of a priori evaluation each outcome can be considered usable for the sentieri approach if its validity is previously verified, and appropriate epidemiological parameters can be estimated . Briefly, sentieri studied mortality in 44 npcss using data at municipality level (19952002), calculating indicators such as crude and standardized rates (italian 2001 standard population as reference) and standardized mortality ratio (smr), using regional comparison rates, both crude (smr) and adjusted for an ad hoc deprivation index (smr i d). To control for confounding from social and economic factors an ad hoc deprivation index was built and applied to the smr estimates in sentieri project (sentieri di). The deprivation index was constructed using the 2001 national census variables representing the following socioeconomic domains: education, unemployment, dwelling ownership, and overcrowding . The epidemiological evidence was examined on the basis of explicit criteria to build a matrix of the a priori epidemiological evaluation of the strength of the causal association for each combination of selected outcome and environmental exposure . For details concerning the a priori evaluation firstly a multidisciplinary group of researchers (see the previous section) draws up the list of causes to be submitted to the evidence evaluation . Secondly, the epidemiologists classify the strength of the causal association of each outcome / exposure combination . Firstly a multidisciplinary group of researchers (see the previous section) draws up the list of causes to be submitted to the evidence evaluation . Secondly, the epidemiologists classify the strength of the causal association of each outcome / exposure combination . To complete this phase in sentieri project, the epidemiologists developed a procedure to examine the epidemiological literature published from 1998 to 2009 on the health risk of populations living in npcss . The epidemiologists examined each cause of death / exposure combination (mortality was the first outcome to be analyzed) in terms of strength of causal inference . Environmental exposures the former were fixed on the basis of the possible sources of contamination in npcss listed in the decrees that defined each site boundaries (e.g., chemical industry, steel plants); the other exposures were the environmental, lifestyle and occupational most important known etiological factors: air pollution, active and passive smoking, alcohol intake, occupational exposures, and socioeconomic status . The procedure finally led to classify the evidence of the causal association into three categories: sufficient to infer the presence of a causal association, limited to infer the presence of a causal association, and inadequate to infer the presence or the absence of a causal association . The criteria adopted for the classification are reported in table 1 . At the end of the second phase, a matrix of epidemiological a priori evidence about the strength of each outcome - cause / environmental exposure or outcome - cause/other exposure causal association was prepared (example in table 2). Specific causes with a certain level of strength of causal association with the environmental exposures present in each npcs were reported and discussed in detail in sentieri . In order to have a general description of the residents' health profile, main broad groups of causes of death the assessment and appropriate consideration of previous studies performed on the same npcs, if any, ameliorate the level of knowledge, reducing scientific uncertainties about the heath impact of contamination and facilitating the process of identification and implementation of remediation interventions . When more than one npcs are studied, a homogeneous way of presenting and discussing results can make the study results clearer and more readable . It included a summary description of population and contamination data: specific sections dedicated to (a) results by gender (general health profile and specific, a priori selected causes); (b) previous studies carried out in the investigated area; and (c) a conclusive paragraph with suggestions for further scientific and/or remediation priorities as well as recommendations for public health interventions . In single sites examples of recommendations aimed at a better description and clarification of the observed health effects include the investigation of the respiratory diseases prevalence in children, the conduction of occupational and residential cohort studies, and health surveillance activities as well as exposure assessment and biological monitoring investigations . An example is the one of sassuolo - scandiano npcs presented in a following paragraph . The presence of asbestos or asbestiform fibres was the motivation for including six npcss in the national environmental remediation programme . In five of these sites increases in malignant pleural neoplasm mortality were observed; in four of them the excess was in both genders . In four out of six other sites where in addition to asbestos other sources of environmental pollution most causes of death analyzed in sentieri have multifactorial etiology; furthermore in most npcss multiple sources of different pollutants are present, sometimes concurrently with air pollution from urban areas: in these cases, drawing conclusions on the association between environmental exposures and specific health outcomes might be a hard task . Notwithstanding these difficulties, in a number of cases the attribution could be possible on the basis of the increases observed in both genders and in different age classes, and the exclusion of a major role of occupational exposures was thus allowed (in italy most of the workforce in industrial setting is still represented by males). For example, a role of emissions from refineries and petrochemical plants was hypothesized for the observed increases in mortality from lung cancer and respiratory diseases in two npcss; a role of emissions from metal industries was suggested to explain increased mortality from respiratory diseases in two other sites . In six npcss an etiological role of air pollution in the raise of congenital anomalies and perinatal disorders was suggested, and a causal role of heavy metals, pah's, and halogenated compounds was suspected for mortality from renal failure in six sites . According to the 2001 census, the npcs sassuolo - scandiano includes 6 municipalities with a 102,811 overall population . The perimetration decree of this npcs lists the presence of pottery manufacturing plants, an environmental exposure that sentieri qualifies as c (plants producing chemicals and/or chemical products). Sentieri results among the main causes of death show in this npcs some excesses for all causes and circulatory and respiratory systems diseases in men . Some excesses are also observed for digestive system diseases in women (table 3). For the causes of death with an a priori sufficient or limited evidence of causal association with the environmental exposure in this npcs, an excess for respiratory diseases and asthma was observed in men (table 4), and for congenital anomalies (malformations) in all age classes, both genders (table 5). Previous studies in this npcs showed that lead, a metal used in the pottery production, polluted subsoil, surface, and ground waters . Notwithstanding a decrease in occupational exposure between the beginning of the seventies and half of the nineties, in 1995, the lead levels remained high . At the beginning of the eighties, lead exposure levels in children were high; during the second half of the nineties a sharp decrease was observed, and blood concentrations were lower than the 10 g/100 ml limit . According to sentieri, the evidence of the causal association between occupation and respiratory system diseases and asthma was classified as sufficient . Since silicosis was not separately analyzed in sentieri and its risk is known to increase in pottery production, as observed in the cohort study of workers compensated for silicosis in italy, it was probably conducive to the observed respiratory diseases excess in this npcs . The occupational exposure to lead in pottery production might have contributed to the mortality excess due to parkinson's disease and hypertension . A hypertension excess was pointed out for both genders (men: smr = 192 (90% c.i . Data acquisition for the appraisal of the present lead environmental pollution and occupational exposure is suggested . The mortality for causes of death with a priori sufficient or limited evidence of causal association with the environmental exposure showed, for the period 19952002, 3,508 excess deaths for all causes, corresponding to 439 deaths / year; the number of excess deaths was 1,321 for respiratory diseases, 898 for lung cancer, and 588 for pleural neoplasms . When considering excess mortality with no restriction to causes of death with a priori sufficient or limited evidence of causal association with the environmental exposure, the number of excess deaths for all causes was 9,969 (smr 102.5, about 1,200 excess deaths / year); the excess was 4,309 for all neoplasms (about 538 excess deaths / year), 1 887 for circulatory system diseases, and 600 for respiratory system diseases . The ecological approach used in sentieri does not allow to draw firm conclusions on the causal relationships between residential exposure and health status in residents in a contaminated site; furthermore, the causal inference might be complicated for causes with multifactorial etiology in areas with multiple sources of different pollutants and concurrent presence of air pollution from urban areas . Notwithstanding these difficulties, in a number of instances, the a priori evaluation of the epidemiological evidence as carried out in sentieri reinforced the findings and strengthened the case of an etiological role to some environmental exposures . This has varying degrees of persuasiveness for example, an increased lung cancer and respiratory disease risk was observed in sites hosting refineries and petrochemical plants, suggesting the need for further studies; the ascertained exposure - disease association between pleural neoplasm mortality and asbestos was confirmed in sites with documented presence of asbestos and asbestos - like fibres . Another aspect which could increase the persuasiveness of environmental - related health effects is the identification of raised health risks in children living in contaminated sites . In the 44 combined npcss, among children 0 - 1 year old, mortality from all causes and from perinatal conditions was, respectively, 4% (3,328 cases) and 5% higher (1,903 cases) than the italian reference population, and the overall mortality was significantly increased in one or more age groups (0 - 1, 014, and 019 years) among children living in 11 (25%) npcss . The value of an ecological study like sentieri should be measured, as recently suggested, against the baseline level of knowledge; in this context sentieri contribution can be considered high given the absence of systematic and standardized epidemiological investigations of the health impact of residents in npcss . Exposure ascertainment is a key phase in ecological environmental investigations; the exposures affecting the study population should ideally be described in detail, while in practice a number of limitations affect this crucial aspect in most studies . In some investigations the exposure / s is a time - bound event in a limited geographical area, leading to a point source emission of a limited number of contaminants whose nature has been identified and whose toxicological properties can be partially known . Events such as the explosion of seveso in 1976 and bhopal in 1984 belong to this category . More frequently the environment has been progressively and perhaps surreptitiously contaminated by a heterogeneous mixture of pollutants originating from industry (often a variety of industrial activities) or waste treatment / disposal activities . In this case several environmental matrices are contaminated over a period of years, leading to multiple sources of exposure to a variety of exogenous agents, possibly changing qualitatively or quantitatively overtime . For example, in sentieri project the sources of environmental exposures were abstracted from the legislative decrees defining sites' boundaries, and chemical industry, petrochemicals and refineries plants, steel plants, power plants, mines and/or quarries, harbour areas, asbestos or other mineral fibres, landfills, and incinerators subsequently coded . Such data are insufficient to give a full picture of space and time distribution and variability of the exposures . In addition, for most npcss no information is available on sources of exposure that can have a health impact, such as concurrent air pollution from road traffic and exposures in the occupational setting . Another limitation in exposure ascertainment lies in the implicit assumption that all residents in the area under investigation experience the same exposures, while exposure variability is likely to be substantial, due to many factors (e.g., concentration of contaminants and their diffusion to soil and water, distance of residence from polluting sources). The possible consequences of such nondifferential exposure misclassification are complex, and direction of the resulting bias is not predictable . An additional limitation in exposure ascertainment derives from the territorial size and the population dimension of the areas at study for which vital statistics are available . Whatever the administrative boundaries are, they hardly correspond to the distribution of environmental pollutants, so that the misclassification of exposure (and loss of statistical power) is common . As far as outcome measures . However, the analysis of hospital discharge records, ad hoc registry data of specific pathologies (e.g., cancer, congenital malformations) can give a better picture of the health profile of residents in npcss . Each vital statistics is able to provide information only about the events that is designed to record, and databases need to be validated for use in epidemiological studies . In the majority of countries death rates from all causes are unlikely to be biased because reporting the event of death is exhaustive . Therefore the overall mortality, which is an important indicator of conditions of life, can be analyzed with confidence . In italy mortality data are available for the whole country, and validity of cause of death certification has been documented for specific diseases [1922]. In most european countries hospital discharge records (hdrs) are indicators of hospital activity, and their main use is for administrative purposes: validity when employed in ecologic studies some italian reports [24, 25] comment on some critical aspects of this novel utilization of hdrs . The analysis of cancer incidence and congenital malformations data in environmental epidemiology investigations can be considered, subject to validity evaluation . In italy in the context of contaminated sites congenital anomalies have been used in a descriptive study and the investigation of cancer incidence has been planned . Mortality statistics and hospital discharge statistics have been using the succeeding versions of the international classification of diseases (icd) that guarantees homogeneity and comparability of results obtained in different places . However, particularly for cancer, the resolution power of the icd is far lower than that of classifications based on pathological diagnosis such as the succeeding versions of the international classification of diseases for oncology (icd o). Some associations between environmental agents and cancer are limited to specific pathological variants of the disease (e.g., wood dust and adenocarcinoma of the nose and nasal sinuses); for populations served by cancer registries where the histological type of cancer is systematically recorded this problem is solved . In environmental health studies factors as socioeconomic status, occupational exposures, and individual lifestyles can have an etiologic role on the health effects under study thus possibly confounding the exposure - disease relationships . Socioeconomic status is a determinant of health and disease . Since the mid-1990s ecologic studies of environment and health in uk adjusted for deprivation using census data; for a review refer to pasetto 2010 . To account for deprivation in sentieri project mortality data were analyzed both crude and adjusted based on an ad hoc deprivation index (sentieri di). Occupational exposures are potential confounders in ecological studies of environment and health; individual based studies may be needed to disentangle environmental and occupational risk . The present paper referred as a common thread to sentieri project, in its main components of mortality study and a priori evaluation of the epidemiological evidence . Its major strengths are the standardization of the mortality analysis and npcss classification in terms of environmental exposure which allow the study of all npcss in one country; the a priori evidence evaluation to comment and interpret study results is a key characterizing element of the project . Additional assets are that the mortality analysis can be updated and other vital statistics data can be analysed; also the a priori evidence evaluation can be brought up to date following the established criteria and procedures . The sentieri approach allows the description of the health status of populations living in the italian npcss . Furthermore, it is suitable for an overall analysis of data from different npcss and comparative analysis of data from npcss with the same contamination sources . The sentieri approach is, in its essence, a tool to describe the health profile of residents in npcss to document ascertained or suspected associations with local environmental risks; it does not require an ad hoc data collection . The approach can also be of value for health surveillance activities in npcss (possibly analysing different outcomes); in addition it can contribute to etiological evaluation of cause - effect associations if additional data from biomonitoring investigations, risk assessment studies, and individual - based epidemiological studies are available . The links between environmental exposures and health effects depend on the environmental pollutants and diseases being considered but are also influenced by factors such as genetic constitution, age, nutrition and lifestyles, occupation, and socioeconomic factors such as poverty and level of education . Identifying these relationships is therefore challenging; however, the effort is often worthwhile as it may help to redefine priorities and unlock resources . Other strengths of the sentieri approach are that the a priori evidence evaluation and mortality analysis can be updated; other health outcomes in addition to mortality can be analyzed, for example, cancer incidence, morbidity, and adverse reproductive effects; also the a priori evaluation can be carried out for environmental exposures different from the ones in sentieri project . Notwithstanding the remarkably laborious activities required to set up a national project such as sentieri, major benefits in terms of quality and quantity of findings, and a favourable cost / gain balance can be expected inasmuch as this becomes a permanent system of epidemiological observation on health of residents in npcss.
The study population included 1177 patients who underwent different types of cardiac surgeries with cardiopulmonary bypass method at sina private hospital (isfahan, iran), between april 2008 and september 2009 . All patients underwent a cardiovascular diagnostic procedure requiring the use of a contrast agent for left ventriculography, coronary or carotid angiography, and thoracic and/or abdominal aorta angiography before their surgeries . Thus, the patients requiring emergency dialysis therapy or those that underwent the off - pump method surgery were excluded . Data for the studied patients including demographics, clinical characteristics, laboratory data, medical treatments, angiographic data, (including amount and type of the contrast agent used), comorbid conditions and cardiac procedural data (including its timing in relation to the preceding angiography), were collected by reviewing hospital record files in a computerized database . The study was approved by the research ethics committee of isfahan university of medical sciences, isfahan sina heart center . The contrast agent used were meglumine compound 76% (urografin, bayer, usa) as hyperosmolar, iopromide 370 (ultravisit, berlex montville, usa, mfd . In: germany) and iohexol 300 (iopaque, iran or omnipaque 300, usa) as low - osmolar contrast agents . Use of nonsteroidal anti - inflammatory agents and other nephrotoxic drugs were avoided or withheld for 48 hours before angiography . Postoperative renal risk was assessed using 2 different risk scores of a simplified predictive index for renal replacement therapy after cardiac surgery and a risk score for prediction of contrast - induced nephropathy.9 the main outcome of interest was the incidence of postoperative arf, defined as postoperative serum creatinine> 2 times baseline and/or the need for renal replacement therapy . The mean value of baseline creatinine was 0.99 mg / dl.6 the obtained results are presented as mean sd, frequency, and percentage . Comparisons were made using chi - square test or fisher's exact test for categorical variables and nonparametric test for continuous variables . The amount of contrast media was entered into the model as both a linear (continuous variable) and a dichotomous term (median or less and greater than median value). Multivariable logistic regression analysis was used to identify independent predictors of arf using variables found to have marginal association (p> 0.10) on univariate analysis . Odds ratio (or) and 95% confidence interval (ci) were constructed to provide an estimate of adjusted risk posed by post - procedural arf . Comparisons were made using chi - square test or fisher's exact test for categorical variables and nonparametric test for continuous variables . The amount of contrast media was entered into the model as both a linear (continuous variable) and a dichotomous term (median or less and greater than median value). Multivariable logistic regression analysis was used to identify independent predictors of arf using variables found to have marginal association (p> 0.10) on univariate analysis . Odds ratio (or) and 95% confidence interval (ci) were constructed to provide an estimate of adjusted risk posed by post - procedural arf . Comparisons were made using chi - square test or fisher's exact test for categorical variables and nonparametric test for continuous variables . The amount of contrast media was entered into the model as both a linear (continuous variable) and a dichotomous term (median or less and greater than median value). Multivariable logistic regression analysis was used to identify independent predictors of arf using variables found to have marginal association (p> 0.10) on univariate analysis . Odds ratio (or) and 95% confidence interval (ci) were constructed to provide an estimate of adjusted risk posed by post - procedural arf . Of 1177 patients who underwent different types of cardiac surgeries after angiography, arf occurred in 465 subjects, 2 of these patients needed dialysis . Mean dose of hyperosmolar and low - osmolar contrast agents used overall were 1.23 and 1.21 ml / kg, respectively . Baseline clinical features between the two cohorts with and without postoperative arf are listed in table 1 . Postoperative arf was more prevalent in older and male patients (p = 0.003 and 0.002, respectively), and those with a higher history of hypertension(p = 0.012), but prevalence of other risk factors as well as left ventricular ejection fraction were similar in both group of patients . There was a significant difference between last pre and post- operative creatinine in both groups (p <0.001). Patients with arf were also more likely to have undergone combined coronary artery bypass grafting and valve surgery the same day as angiography and also underwent more postoperative intra - aortic balloon pump insertion (iabp) (table 2). The patients with arf were more likely to have received higher doses of both hyper - osmolar and low - osmolar contrast agents compared to mean doses (p = 0.17 and 0.035, respectively). However, the time interval between cardiac surgery and last catheterization was not different between the patients with and without arf (p> 0.05) (table 2). Clinical and demographic characteristics of the studied population contrast agent and cardiac surgery data overall postoperative peak creatinine was highest on day 0 (figure 2), then decreased and remained significantly unchanged after this period (p <0.05). However, overall prevalence of acute renal failure during follow - up period (figure 2) had a changeable trend and had the highest rates in days 1 (53.57%) and 6 (52.17%) (p <0.05). Relationship between the time interval flanked by angiography and surgery and postoperative serum creatinine relationship between the time interval flanked by angiography and surgery and postoperative acute renal failure independent correlates of postoperative arf in a multivariate model are listed in table 3 . Combined coronary artery bypass grafting (cabg) and valve surgery was the strongest predictor of postoperative arf (or: 4.976, p = 0.002), followed by intra - aortic balloon pump insertion (or: 6.890, p = 0.009) and higher dose of contrast agent (or: 1.446, p = 0.031). The major findings of the present study were that the higher dose of the used contrast agents besides some other determinants such as combined coronary bypass and valvular surgery as well as iabp insertion could effectively predict post - procedure acute arf . On the other hand, the use of high dose of contrast agent was strongly related to the incidence of arf after combined cardiac surgery . In fact, our data confirmed findings of other investigations that arf after cardiac surgery was associated with the amount of prescribed contrast agents . In a similar study by ranucci and his colleagues,6 cardiac surgery performed on the day of cardiac catheterization and higher dose of contrast agent although these investigators demonstrated a correlation between the time interval of cardiac catheterization and surgical procedure with the incidence of acute arf, we could not demonstrate this relationship in our multivariable regression model . In another study by del duca et al4 cardiac catheterization performed within 5 days before operation, baseline glomerular filtration rate of less than 60 ml / min and prolonged cardiopulmonary bypass duration, were significant risk factors for acute renal failure after cardiac surgery . Moreover, other studies established similar clinical and surgical characteristics associated with increased risk of arf after cardiac surgery, including age,168 baseline serum creatinine,10 diabetes mellitus,1113 congestive heart failure,1012 emergency surgery,1114 concomitant valve surgery with coronary artery bypass grafting,11 preoperative use of iabp,14 and low cardiac output syndrome in the postoperative course.1415 however, these studies consistently failed to account for the influence of the timing between previous angiography and cardiac surgery and the amount of the contrast agent used in this event . Multiple mechanisms have been suggested to contribute to the renal damage following cardiac diagnostic procedures, including non - pulsatile flow, embolization, and trauma to the blood constituents, hypothermia, and activation of known inflammatory pathways.16 iodinated contrast as a common contrast agent, after causing a brief period of vasodilation, can cause sustained intrarenal vasoconstriction and ischemic injury . The ischemic injury sets off a cascade of events largely driven by oxidative injury, causing death of renal tubular cells . If a sufficient mass of nephron units are affected, then a recognizable rise in serum creatinine will occur.1718 therefore, minimizing the amount of contrast agent during preceding angiography is recommended . Similar studies need to be conducted regarding alternate imaging modalities that do not use iodine - based contrast agents to obtain information about ventricular function, valvular dysfunction and aortic pathologic characteristics.6 finally, strategies to prevent contrast - induced nephropathy during angiography that is continued in the postoperative period may also have the potential to decrease arf after early cardiac surgery . Mms designed the study and drafted this manuscript; mg carried out the study and drafted the tables; pn carried out the study and drafted the tables; hsh helped in designing the study; hms helped in final drafting; ak helped in designing and carried out the study; pms data analysis; and nf data collection.
Colorectal cancer (crc) is one of the most common human malignancies in western countries . Colorectal adenomas have high malignancy potential when they are large in diameter and/or present with severe dysplasia and/or a villous component . Colonoscopic polypectomy has been documented to significantly reduce the incidence of colorectal cancer [3, 4]. Therefore, the identification of factors associated with the development of colorectal adenoma represents a major goal in colorectal cancer prevention . They could indeed allow the selection of individuals at risk of crc who may benefit from a screening by colonoscopy . The adenoma - carcinoma sequence suggests that colorectal adenomas and adenocarcinomas share common environmental and genetic risk factors . An increased risk of colorectal tumors has been found in relatives of patients with large adenomas [5, 6]. A case - control study had suggested that family history of colorectal cancer influenced only the growth of adenomas or their malignant transformation . However, relatively few epidemiologic studies explored genetic risk factors in colorectal adenomas . We investigated, through a case - control study, the relation between polymorphisms within a series of candidate genes involved in colorectal tumorigenesis and putatively in the formation and the development of colorectal adenomas such carcinogen metabolism enzymes, methylation enzymes, dna repair genes, oncogenes and tumor suppressor genes . The genetics of adenomas (geade) study is a case - control and family study of patients with high - risk adenomas (10 mm). The data were obtained from 18 participating gastroenterology units of general hospitals in france . From september 1995 to march 2000, 306 consecutive patients with newly diagnosed colorectal large adenoma (la) were enrolled in the study . Patients with personal cancer history, familial adenomatous polyposis, established hereditary nonpolyposis colorectal cancer or inflammatory bowel disease were excluded . To distinguish genetic factors involved in the occurrence of adenomas or in their growth, 307 cases with small adenomas (with a diameter smaller than 0.5 cm) (sa) and 572 polyp - free controls (with normal colonoscopy) (pf) reason for referral, family history of crc, completeness of colonoscopy were registered for all patients and controls . Two pf per la cases were selected as controls within over 2000 pf for matching on age, gender, and geographic area . Blood specimens were obtained at time of colonoscopy and those patients who presented with a polyp were included only when histological examination revealed the adenomatous nature of the lesion . As polyps were totally removed during colonoscopy, their natural evolution could not be scored . After longitudinally section, half of the tumor material was fixed for histologic analysis and half was frozen for molecular characterization . Twenty individuals had to be excluded because of insufficient tumor material: 11 patients with la, 5 with sa, and 4 pf . The final groups contained 295 patients with la, 302 with sa, and 568 pf as controls . All patients and controls signed an informed consent after approval of the study by an ethic committee for biomedical research (le kremlin - bictre) and the database was declared to the national committee commission nationale de linformatique et des liberts (cnil). Genes have been selected for their role in colorectal tumorigenesis and for the presence of frequent neutral polymorphisms . The polymorphisms of mmp1, mmp3, and mmp7 gene promoters, that are responsible for the degradation of extracellular matrix components, had been previously studied and were not considered in the present analysis . Three genes, ts, ugt1a1, and mdr1, are implicated in folates, bilirubin metabolism, and transport of xenobiotic respectively . All these pathways are suspected to play a role in cancer occurrence or in the transformation of benign lesions, folates by interfering with dna synthesis and repair, bilirubin by its known antioxydant properties, and transport of xenobiotic by its detoxication function . Case - control reports exemplified the relevance of these three genes in addition to hras1 . Three additional pathways have been secondary studied including the wnt pathway (apc, ctnnb1, axin2), the p53 pathway (tp53, bax), the tgfb pathway (tgfbr2), the main mmr and ber genes (msh2, mlh1, myh), and card15 as part of the family with lrr domains . All these genes have been strongly assessed for their major role in oncogenesis, cycle cell control, apoptosis regulation, cell adhesion and migration, proliferation, dna repair as their main functions . The vntr of hras1 was studied by conventional electrophoresis after pcr amplification on 1.2% agarose gels at 2 volts / cm for 1518 hours . Hardy - weinberg proportions were tested for each polymorphism . Linkage disequilibrium (ld) between pairwise loci genotype - specific odds ratio (or) and 95% confidence intervals (cis) were computed using unconditional logistic regression adjusted on matching factors; wald test was used to assess the global effect of each polymorphism . The homozygous genotype for the more frequent allele among controls was set as the reference class . The association was further examined using the combination test, that allows the analysis of all possible combinations of snps within a given gene or tightly linked genes to test their association with the disease . For each snps combination, the method computes a statistic test contrasting the genotypic (or haplotypic) distribution between cases and controls . Because all these tests are correlated (many of them are nested in each other and the snps are likely to be in ld), a permutation procedure has been implemented which displays a significance level adequately adjusted for multiple testing . First, we used the famhap12 software to apply this method by performing haplotypic tests . Then the combintest (jannot, personal communication) was used to perform genotypic tests . The method was extended to the test of combined polymorphisms on different genes that may act interactively . To avoid multiple tests biases, we chose a three - step strategy that minimizes the number of comparisons . First, we considered two - by - two combinations of polymorphisms chosen on their plausibility to interact with each other, for instance, apc and myh both responsible, when mutated, for adenomatous polyposis . Finally, as a combination of polymorphisms may have an effect even if the genes are not suspected to interact with each other and are not involved in the same pathway, all possible combinations were considered if the first two steps did not reveal any significant association . When several combinations of polymorphisms were significant within a given test, it was possible to test nested combinations using chi - square calculation to determine whether a given polymorphism adds a significant contribution to the association found . The average age was very similar in patients (62 years for la and 61 years for sa) and in pf controls (61 years). The sex ratio (male / female) was quite similar in la (1.7) and in pf controls (1.5), slightly lower in sa (1.2) because of the absence of matching . Table 1 describes the characteristics of the polymorphisms studied and the allele frequencies in controls . The distribution of genotypes in controls was consistent with hardy - weinberg proportions for all polymorphisms except for tp53.3 (p = .0013 without correction for multiple testing). A similar departure from h - w proportions (p = .010) was found in the hapmap european population (http://www.ncbi.nlm.nih.gov/projects/snp/) for this polymorphism . All polymorphisms within a same gene were moderately or not found in ld except myh; myh.1 and myh.2 are in quasicomplete disequilibrium (d = 1 and r = 0.99). Analysis of single polymorphisms for the different comparisons, la versus pf, la versus sa, and sa versus pf did not reveal any association for most of the genes studied . The p - values found to be less than .05 were obtained for apc.1, mdr1.2, and axin2.9 . The results of the haplotypic and genotypic combination tests performed for each gene or gene combination are shown in table 4 . When considering each gene separately, only apc displayed a significant difference between small and large adenomas (p = .014 in haplotypic analysis and p = .07 in genotypic analysis). As apc.1 alone and the combination apc.1-apc.2 appeared both significant, we tested whether apc.2 provided a significant contribution to the association, which was not the case (= 2.12, 1df) showing that the association was solely due to the apc.1 (p.glu1317gln) polymorphism . The combination apc - myh appeared also significant with a global p - value of .045 . However, the only significant combination was apc.1-apc.2 already found, showing that myh does not provide any additional contribution to the association between apc and adenomas . No difference was found for the other two comparisons, that is, sa versus pf and la versus pf . Finally, the analysis of all possible combinations did not provide any significant result . We investigated the role of candidate gene polymorphisms in a case - control study of patients with large adenomatous polyps (n = 295), compared to patients with small adenomatous polyps (n = 302) and polyp - free controls (n = 568). The 38 polymorphisms studied belonged to 14 genes possibly involved in increasing of colorectal cancer risk . The reason for comparing these different groups of patients was that different genes might be involved in the different steps of carcinogenesis . Using this case - control study, we had shown that mmp polymorphism was most probably involved in the occurrence, but not in the growth of polyps . Using the combination test, we had shown that the effect was due to a specific combination of mmp1-mmp3 polymorphisms which was not found using logistic regression . Indeed, a major property of this test is that it allows the detection of polymorphisms with low marginal effects . Multiple testing may be a limitation of studies in which several polymorphisms in several genes are tested . The combination test allows a correction for multiple tests on tightly linked markers, which other methods of correction such as bonferroni, benjamini - hochberg, or fdr (false discovery rate) do not . In the present study, we could show that the positive results obtained for axin2 and mdr1 when analyzing single polymorphisms were false positives as these results were not confirmed when using the combination test . For independent markers, there was no need for correcting for multiple testing as our results were essentially negative . Our study did not give evidence for an effect of any of the gene polymorphisms studied except the p.glu1317gly variant of the apc gene . Some studies reported an effect of this variant in patients with multiple adenomas or colorectal cancer [1517], and some others found an effect in adenomas but not in cancer [18, 19]. More recently, hahnloser et al . Reported an effect of this variant in a group of patients with a small number of adenomas (1 to 3 lifetime adenomas) and in a group of crc cases . None of these studies considered the size of adenomas and could differentiate adenomas at high - risk from those at low - risk of cancer . Our results favour the hypothesis that the p.glu1317gly variant would influence the growth and not the occurrence of adenomas, and would have thus indirectly an influence on colorectal cancer risk . Nevertheless, although the three groups are paired on gender and geographic origin, it is not stated if other known risk factors would influence adenoma growth . It is thus important to plan a specific multivariate analysis when building a replication sample . Regarding the ts polymorphisms chen et al . Found a significant effect of the 3r allele of ts.2, particularly of the 3r/3r genotype (or = 3.3). In our study, the or associated with 3r/3r genotype was 1.43 (ci 0.942.16) for la versus pf and 1.10 (ci 0.681.78) for la versus sa . On the other hand, ulrich et al . Found no marginal effect with any of these two polymorphisms but found a significant interaction of ts.2 with folate intake . Similarly, the most recent studies [23, 24] found no marginal effect of either polymorphism but a slight interaction with folate or vitamin b6 intake . The groups' sizes in our study were of the same order of magnitude as in the study of chen et al ., but the three other studies which did not show any marginal effect included larger groups (more than 500 individuals in each group). Given the size of our population, we could a priori detect an or of 1.7 with a power of at least 80% . It is highly probable that the ts gene, which produces a key enzyme in folate metabolism, has an effect only in interaction with dietary exposures, which would explain why this effect was not found in our study . Moreover a new snp has been recently identified in the second repeat of the 3r allele leading to split the allele 3r in 3rc and 3rg alleles as a tri - allelic polymorphism . This variant could explain these discrepant results since patients with 3rc/3rc genotype have a transcriptional activity of ts comparable to those with 2r/2r genotype . In our study, the problem of multiple testing was adequately controlled for each test performed by the permutation procedure implemented in the combination test . In the last analysis step, the tremendous number of comparisons resulted in a drastic correction of each p - value, which considerably lowered the testing power . Thus, our negative results certainly do not definitively demonstrate the absence of specific combination influencing colorectal tumorigenesis, but more probably that, if it exists, this (of these) effect(s) is (are) low and could be found through the initial (and further) genome - wide association studies of colorectal cancer testing much larger numbers of patients and controls [26, 27].
A 56-year - old man suffering from diabetes and hypertension was admitted to the neurology department in a hospital elsewhere with signs of epileptic seizure . After a brief period, a diagnostic laparotomy with gastrotomy was performed, at which over 3 liters of blood were found, but no active bleeding . The site of origin of hemorrhage was suspected at the gastroesophageal junction, although no peptic ulcer could be discovered . Gastroscopy was performed 1 day later, demonstrating a large, ulcerating tumor at the cardia, of which biopsies were taken . Because the patient was now diagnosed with a bleeding tumor at the gastroesophageal junction, he was transferred to the icu of the canisius - wilhelmina hospital in nijmegen (in formation with the radboud university hospital comprising the esophagus centre eastern netherlands, scon). A computed tomography (ct) scan was performed, showing a large tumor at the gastroesophageal junction, extending towards the pancreatic tail (fig . A second gastroscopy with new biopsies, 8 days later, proved the same results . At the time of the third gastroscopy, a second ct scan revealed a remarkable decline of the entire process, emanating from the pancreatic tail as a pseudocyst (fig . Our patient experienced hypovolemic shock following massive gastrointestinal hemorrhage caused by a burst - through of a pancreatic pseudocyst to the stomach . The incidence of upper gastrointestinal hemorrhage in the netherlands is 45 - 70 per 100,000 per year, most of which are caused by peptic ulcers of the stomach and duodenum . A pseudocyst of the pancreas consists of one or several collections of pancreatic fluid, surrounded by inflamed pancreatic tissues . The wall is formed by the enclosing structures, i.e. Stomach, transverse colon or omentum . The pseudocyst is usually connected to the pancreatic duct . The distinctive feature between a genuine cyst and a pseudocyst is the lack of an epithelial layer . Pseudocysts of the pancreas arise as a result of episodes of acute pancreatitis or blunt force abdominal trauma . The cause is often disruption or obstruction of the pancreatic duct, with subsequent accumulation of pancreatic fluids, containing high concentrations of pancreatic enzymes . In acute pancreatitis, (pseudo)cyst and necrosis can be difficult to distinguish by contrast - enhanced ct scan, whereas magnetic resonance imaging (mri) is distinctive . Pseudocysts can damage adjacent arteries by means of mechanical pressure and digestion by pancreatic enzymes, hereby causing the formation of pseudoaneurysm with possible subsequent hemorrhage into the pancreatic duct . Usually, this involves the splenic artery, but also the gastroepiploic arteries and gastroduodenal branches can be affected . The old motto is to drain pseudocysts larger than 6 cm or existing longer than 6 weeks, although literature on the subject scarcely supports this . The possibilities for drainage are to marsupialize the pseudocyst through laparotomy or laparoscopy to the stomach or jejunum, or to perform resection of the pancreatic tail pseudoaneurysms or hemorrhages are eligible for endovascular embolization, and transgastric drainage of cysts is contraindicated during hemorrhages, unless embolization is performed first . Case series and case reports in the available literature on hemorrhaging pseudocysts all advocate endovascular embolization, followed by resection of the pancreatic tail [5, 8, 9, 10, 11, 12, 13]. Our patient was diagnosed with hemorrhaging pseudocyst 16 days after admission and initial laparotomy . Because of the improving clinical condition and decline of the pseudocyst on ct scan, it was decided to pursue a the initial plan was to perform pancreatic tail resection after clinical recovery; however, ultrasonography and ct scan revealed a rapid decline and full disappearance of the pseudocyst . Our patient made a full recovery and has adjusted his life style . In all case reports, operative intervention is advocated, precipitated by endovascular embolization in case of serious hemodynamic instability . One case series of 16 patients reports a 62% mortality rate, in which endovascular embolization is combined with pancreatic tail resection . There is evidence to support the role of angiography in case of acute upper gastrointestinal hemorrhage, simultaneously offering the possibility for endovascular treatment [2, 5, 8, 9, 10, 11, 12, 13]. Embolizing the splenic artery does not inevitably necessitate splenectomy, for the remaining blood supply to the spleen is routed through the vasa brevia, which should be sufficient . Furthermore, the course of our patient proves that surgical intervention such as pancreatic tail resection is not always an absolute necessity . However, surgery is nowadays not the only option for treatment, as possibilities in radiological endovascular diagnostics and techniques are increasing and will eventually be the first step in treating acute upper gastrointestinal hemorrhage.
Today, implant therapy is regarded as an extremely reliable approach to replace missing teeth . The introduction of osseointegrated implants in dentistry represented a turning point in dental clinical practice.1 as a general principle in implant surgery implant surfaces should be surrounded by alveolar bone.2 following loss of teeth, natural process of bone resorption occurs.3 sometimes due to prosthetic or anatomical limitations of alveolar ridge, it is not possible to insert implants in bone appropriately.2 and also, while preparing implant sites in narrow ridges, dehiscence or fenestration defects may occur frequently that threaten the survival of implants.4 successful implant treatment depends on sufficient bone volume at the implant surface.5 insufficient amount of supporting bone, will limit the effectiveness of osseointegrated dental implants3 and will have an adverse effect on dental implant prognosis.6 several clinical studies have shown that to ensure long term success of implants, at least one millimetre thickness of bone in buccal surface and lingual surface of implant is essential . If the implant surface is not completely covered with bone, it will result in gingival recession, unpleasant appearance, problems in keeping good oral hygiene and ultimately increases the risk of infection around the implant.7 implants can be placed in alveolar ridges with defects including dehiscence, intraalveolar defects, and fenestration.8 several methods are presented to reconstruct the destroyed alveolar bone which include osteoconduction, osteoinduction and guided bone regeneration (gbr).6 many surgical techniques are introduced to enhance alveolar bone volume for placing implants that include various grafting techniques, bone - building using emineral method, and expanding the bone and guided tissue regeneration (gtr).5 among these techniques, gbr is widely used . Gbr procedures performed in dental implants enable clinicians to increase the width and height of defected alveolar ridges or to treat fenestrations and dehiscence around implants . Many researchers have reported predictable results in the simultaneous use of gbr technique when placing implants.7 in most cases of gbr, membranes are supported by protective materials consisting allografts, synthetic materials and xenografts.6 using autograft in augmentation has always been considered as a gold standard, but limited access to autogenous sources, particularly in the areas inside the mouth, prolongation of surgical procedures and bacterial contamination complication have always been considered as the limiting factors in autogenous transplantation . In addition, general surgical risks such as infection, bleeding, pain and swelling, damage to inferior alveolar nerve and the adjacent teeth should also be noted . Therefore, using biomaterials on its own or in combination with autogenous bone is very common.9 dfdba can be named as one of the allograft materials which has osteoinductive potential, because this substance contains some major bone morphogenetic proteins (bmps) of donor tissue matrix . Against this view, many recent reports have shown that augmentation with dfdba is not os - teoinductive, because it does not contain the necessary bmps to induce bone formation . In the united states, emineralised bone matrix (dbm) is considered a transplantable tissue and therefore, is regulated primarily by the american association of tissue banks.10 treatment of dehiscence and fenestration lesions with gbr technique and placing of implants simultaneously have predictable results.11 recent clinical studies have proven that the use of bone substitute materials together with placing implants led to successful coverage of pre - exposed implant surfaces.12 this prospective clinical trial animal study was conducted in professor torabinejad dental research centre isfahan university of medical sciences, isfahan, iran . Samples dissection was carried out in the department of materials science and engineering, sharif university of technology, tehran, iran . Studied population included three healthy adult iranian dogs that were chosen by convenient method . Inclusion criteria included healthy 2 to 4 years old dogs that held all the teeth . At the beginning of the study, after examination to confirm their health and having the required criteria; seven step vaccination was carried out and the dogs were quarantined for 15 days . All the mandibular premolars teeth were extracted and then, the area was left to heal for three months . After healing period, the area assessed by periapical radiography in order to ensure full recovery, after preparing two sits on one side of each mandible and three sites on the other side which were more appropriate in terms of size and bone quality to place the implants, dehiscence bone defects, were prepared with dimensions of 5 mm apicocronaly, 4 mm mesiodistaly and 3 mm buccolingual in buccal plate using high - speed handpiece and diamond fissure bur and abundant irrigation . 10 mm periodontal probes were used to measure dimensions of the artificial dehiscence defects; all measurements were performed by a specialist investigator . Euroteknika implants with 10 mm in length, 4.1 mm in diameter and sla surface (natea system) inserted into the prepared sites . Implant stability quotient (isq) of each implant was recorded using ostell device (ostell integration diagnostics, svedalen, sweden) which was higher than 56% in all cases, indicating good initial stability of all implants placed . After that in two lesions, that was chosen in random, dfdba cenobone, hamanand saz baft, iran and in two other lesions dfdba dembone, pacific coast tissue bank, u.s were placed and the fifth lesion was left empty; finally, they all were covered by collagen membranes (bicon, usa). Both dfdba brands were powder in sahape in 0.5 and 1 grams vials the size of the particles were almost similar and of the existing type to treat small lesions . Dfdba particles were placed in the lesions and were gently pressed against the implant; the lesion were with particles filled up in a way that all the screws were covered and the primary bone contour was maintained . Then, the grafted material and surrounded bone were covered completely by collagen membrane . Moreover, the gingival flaps were replaced without stretching to submerge the implant and were stitched by polyglycolic acid sutures (vicryl) using simple and interrupted loop sutures . Then, final status of implants were determined by periapical radiography . During the first week after surgery, animals were examined several times a day to control the health and complications after the operation and also to ensure the sutures are not opened . The animals mouth was washed twice a day using 0.2 chlorhexidine mouthwashes during the first week and thereafter, once a week . After four months of osseointegration period, dogs were anesthetized and periapical radiographs were taken to observe implants situation within the bone . Then, crestal incision was done and the implants were exposed and the value of isq was recorded . Samples were taken and immediately transferred to formaldehyde 10% and kept for 24 hours to be prepared for optical microscope study . Samples were sectioned by with the ground section method using microtome (accutom-50 cutting machine, copenhagen, denmark). Sectioned samples were obtained buccolingualy and parallel to the axis of implants in 100 micron thickness . Sectioned samples prepared with trichro massons staining studied by optical microscope (olympus, japon). Using histomorphometric method, the percentage of bone implant contact (bic) was cal - culated and type of bone (lamellar, woven) was determined at 40 times magnification and recorded by an experienced pathologist using optical microscope . In this method, the area of 2 mm around the implants is evaluated . Spss 11.5 software was used to analyse data, using one - way anova and pearson correlation and regression tests . Average bic in cenobone group (iranian dfdba), dembone group (american dfdba) and control group were 77.36% 9.96 (max 89.1% and min 63.4%), 78.91% 11.99 (max 91% and min 56.3%) and 71.56% 5.61 (max 75.8% and min 65.2%), respectively . Therewas no significant difference in bic amounts among the three groups (p = 0.607). There was not significant difference in the bic amounts among the three groups defects (p=0.388). Comparison of average bic of lamellar bone, woven bone, cenobone and dembone groups defects and control group is presented in figure 1 . Comparison of average bic of lamellar bone, woven bone, cenobone and dembone groups defects and control group (lamellar bone p = 0.298 and woven bone p = 0.380). Furthermore, there was not meaningful difference in rate of lamellar bone (p=0.298) and woven bone (p = 0.380) formation in defects among the three groups . The total sample average isq was 70.83% 6.30 (max 82.5% and min 61.5%). Average isq in cenobone group, dembone group and control group were 70.29% 7.74 (max 82.25% and min 61.5%), 72.25% 6.81 (max 82.5% and min 65.25%) and 69.08% 2.67 (max 72% and min 66.75%), respectively . There was no significant difference in isq amounts among the three groups (p = 0.781). There was a positive relationship between total sample bic and isq (p = 0.004, r = 0.692). Histological view under light microscope showes contact of lamellar new bone with implant in cenobone group magnification x40 massons's trichrom staning . Histologic view under light microscope showes contact of lamellar new bone with implant in dembone group (magnification x40 massons's trichromstaning). Results of the current study indicated that adding dfdba (dembone and cenobone) to membrane, on its own did not significantly increase the obtained bic and isq amounts . Caplanis and colleagues placed, implants in the alveolar defects which treated with membrane on its own and membrane plus dfdba in dogs, the average bic was about 70%13 which is consistent to our study . And also, the bic obtained in this study is consistent with the findings of von arx and colleagues study14 that placed implants in areas grafted with dfdba and other hybrid materials in dogs and gained a high percentage of bic (59% to 75%). In this study, adding dfdba to the collagen membrane did not lead to strengthen induction of bone formation, and these findings were consistent with the results of other studies that showed adding dfdba to the membrane on its own did not significantly increase the clinical results obtained with the gbr procedure.151920 there were significant differences between the products of bone banks in terms of induction of bone formation . Some studies found the use of dfdba to have a positive impact to increase bone growth while others considered it not to be beneficial . Schwartz and colleagues have shown that there is a wide variety of dfdba products on the market which have different inductive capabilities.21 these differences may be related to the origin and methods of preparation of dfdba and if the preparation methods were the same in different bone banks, this would be due to individual donors ages and sexs, disease and injury, medical treatment or genetic differences . Also, the variations of time between death and the bone extraction, may result in significant loss of the bone inductive ability . There are many differences in size and the surface shape of dfdba particles that may affect their inductive ability . Bone cells distinguish different surface shapes and roughness and this will lead to differences in phenotypic diversity.22 in de vicente and colleagues study, the implants which the bone defects around them were filled with dfdba showed similar bic to the implants which their defects had just covered with collagen membranes.23 therefore, adding dfdba did not have any advantages over membrane on its own, which was in line with other studies.15161920242526 in stentz and colleague's study,26 using dfdba together with membrane in bone defects around implants improved the healing of the bone density . Since they had used radiographic method, the obtained information could not determine the value of bic, which is a better evaluating index for outcome of implant treatment and for these reason, they could not show the dfdba efficiency to increase bic . Becker and colleagues27 did not find the use of dfdba beneficial for periodontal regeneration and bone regeneration around implants, while abolfazli and colleagues found the use of dfdba (cenobone) beneficial to repair periodontal lesions in two or three walls alveolar bone defects and reported its effect on bone - formation being the same as aotogenous bone graft . In some studies dfdba was enriched with rhbmp-2 and growth factors and produced better results.2230 the current study results indicated that the relationship between indices of bic and isq was positive and significant . These findings are compatible with huang and colleagues study31 as well as nkenke and colleagues study32 which also found the significant and positive relationship between bic and isq amounts in implants placed in human cadaver bone . Results of this study are coincident with the findings of other researchers in efficiency of using the resonance frequency analysis method to determine the implants stability3133 and showed the resonance frequency analysis is a suitable and reliable method to determine implant stability . Adding dfdba (dembone and cenobone), either the american or iranian type, to membrane on its own did not significantly increase the obtained bic and isq with the gbr procedure . The resonance frequency analysis is still a suitable and reliable method to determine implant stability.
The goal to achieve ideal pediatric drug therapy is a worldwide challenge for regulatory bodies and clinicians . Children are treated with medicines not tested for safety and efficacy and are frequently supported by the low quality of evidence . In the absence of standard prescribing information, clinicians prescribe drugs in an off - label manner . Off - label use means use of medicine which is outside the terms of product license with respect to dose, route of administration, indication, or age . Off - label medicine use among children represents an important health issue as the effects and health risks may be unexpected . Various national and international studies have been published about the amount of and problems associated with off - label medicines in children . The magnitude of off - label prescribing is accounted to be between 18% and 60% in infants but it may be up to 90% in neonates [39]. Most of these studies have been conducted outside india and may not be applicable as hospitalization and prescribing patterns differ based on culture, healthcare infrastructure, and health policies . Only one previous study has been conducted in india which reported 50.62% of off - label prescribing based on british national formulary . Currently there is no study conducted in india based on national formulary of india (nfi). Hence, the objective of the research study was to quantify off - label use based on nfi, various predictors and discusses some strategies to monitor it . The prospective observational study was carried out at a tertiary care hospital in ahmedabad (india) for the period of six months . All the pediatric patients in ages between 0 and 12 years receiving at least one medication and admitted in pediatric ward were included in the study . The pediatric ward was of 60 bed size and attended by 10 academic pediatricians and 28 postgraduate students . Patients were not considered if they were in age of more than 12 years, not taking any prescription medication and undergoing surgery . Demographics, clinical characteristics, and medication usage were obtained from the medical records using predefined paper case record forms . The data collection was carried out by one of the researchers (mms) who discussed each of the medicines with attending pediatrician and clinical pharmacologist (dr). Drugs were entered into the database using the world health organization anatomical therapeutic chemical (who - atc) classification system . We utilized national formulary of india (nfi, 4th edition, 2011) which is an official publication of indian pharmacopoeia commission, ministry of health and family welfare, government of india . Categories for off - label use were allocated for each medicine according to the reason(s) why their use was deemed off - label when compared to the terms of the product labeling for that medicine in nfi . We followed a published algorithm and used these dimensions to determine whether there is strong scientific evidence for frequently prescribed off - label medicines (table 4). Variables such as age, number of medications, number of diagnoses, and length of hospital stay were regarded as continuous and expressed as mean with standard deviation (sd). The odds ratio (or) with 95% confidence interval (ci) was used to determine the predictors for off - label prescribing . The data were analyzed using statistical package for the social sciences (spss inc ., this study was reported according to the strengthening the reporting of observational studies in epidemiology (strobe) guidelines . The study included a total of 320 patients admitted in pediatric general ward of the public teaching hospital over a period of six months . The mean age was 2.73 years (range = 0.1 to 12 years and standard deviation: 3.09). The most common age group was 0 to 1 years representing 43% of total sample size . On average each patient had 1.2 number of diagnosis and 48 patients (mean = 2.5) had more than one diagnosis during hospitalization . The majority of patients suffered from respiratory diseases (33%), central nervous system diseases (16.5%), and gastrointestinal disease (11%). A total of 1645 medications were prescribed to the study cohort during hospitalization, with a total hospital stay of 1743 days . This constituted the mean number of five (sd = 2) medications prescribed per patient and 5.48 (sd = 3.62) days of hospital stay . The number of medications and hospital stay ranged from one to 13 and one to 33 days, respectively . The majority of patients received antibiotics, cough, and cold preparations, antipyretics, inhaled corticosteroids, bronchodilators, and antiepileptic drugs . Medications were mostly administered by oral route (40%) and intravenous route (35%) followed by inhalation route (25%). Of the 320 patients included in the study, 310 (97%) patients received at least one off - label medication . A total of 1645 medications were administered during the hospitalization; 1152 (70%) medicines were prescribed in off - label manner when its usage was validated with national formulary of india, 2011, for five different off - label categories . Patients received on average (sd) 3.66 (2.13) off - label medicines within a range of one to 10 . The most common cause of off - label prescribing 893 (63%) was due to higher dose use (category 1) than stated for particular pediatric patients . Off - label medicines use for age (category 2) and indication (category 3) was found to be 282 (19.8%) and 145 (10.2%), respectively . Those medicines which had no pediatric information (category 5) were 76 (5.3%). Use of ipratropium, salbutamol, and dextromethorphan was common for different dose and age limits . Lorazepam (seizures) and ondansetron (nausea and vomiting) were frequently used for off - label indication . The study also attempted to distribute the receipt of off - label medicines in different age groups as shown in table 2 . The extent off - label prescribing was highest (76%) in age group of more than 1 to 2 years, followed by age group of more than 1 to 12 months which accounted for 69% of off - label use . Off - label use in dose (category 1) was consistent among the patients in age of 0 to 6 years . The use of medicines in patients for restricted age limits (category 2) was highest in 112-month age group . Indication (category 3) and absence of pediatric information (category 5) were most prominent in 612-year patients . Highest proportion of off - label medicines were prescribed in anti - infectives for systemic use 389 (73%) and respiratory system 378 (82%) as shown in table 3 . The amount of off - label prescribing in nervous system and alimentary tract and metabolism system was 220 (53%) and 85 (86%), respectively . Majority of off - label medicines prescribed were ceftriaxone, amikacin, amoxicillin, and vancomycin in antibiotics class and inhaled corticosteroids, ipratropium, salbutamol, chlorpheniramine, phenylephrine corresponding to respiratory system . Blood and blood forming agents 16 (89%), hormonal preparation 32 (80%), and cardiovascular medicines 24 (71%) had substantial high amount of off - label use . Adrenaline, nifedipine, prednisolone, and dexamethasone were also used in off - label manner . Antiparasitic products 8 (16%) had minimum off - label use . Antibiotics (75%) and inhaled corticosteroids (79%) were mostly prescribed in higher doses (category 1) than recommended . In respiratory system, many medicines (39.5%) were prescribed below age limits (category 2) as indicated in the formulary . Medicines used for unapproved indication (category 3) largely confined to alimentary tract and metabolism system and blood and blood forming agents . Medicines which had no pediatric information were predominantly in antihypertensive drug class . On multivariate regression analysis as shown in table 5, we found that pediatric patients in age of 0 to 2 years (or 1.68, 95% ci, 1.262.24,) were more likely to receive off - label medicines than any other age group . Female patients (or 1.41, 95% ci, 1.131.77) received substantially high amount of off - label medicines compared to male . Hospital stay of six to 10 days (or 1.91, 95% ci, 1.332.75) also carried higher risk of off - label prescription . Using the data of the pediatric ward of a tertiary care hospital, we found that 70% of medicines were prescribed in off - label manner . The magnitude off - label prescribing is substantial higher than reported in the recent studies [1416]. Cuzzolin et al . Performed a literature review of published studies on off - label and unlicensed drug use in children . Seven studies involved neonatal intensive care units (nicus), fifteen studies included pediatric wards, and twelve studies were conducted in community setting . Cuzzolin et al . Found off - label prescribing in pediatric ward ranging between 18 and 60% . Various reasons for different rates of off - label use are off - label classification methods, sample sizes, pediatrician's prescribing habits, in - house treatment protocols, and diseases characteristics most importantly pediatric drug regulation . Patients in ages between 0 and 2 years are most likely to receive off - label medicines and had highest representation in study sample . Previous studies also established that age group of 0 to 2 years is the highest recipient of off - label prescriptions [16, 17]. This is mainly due to absence of specific dosing guidelines and route administration in 0-to-2-year age group in nfi . Of the medicines prescribed during the period, it was observed that antibiotics, respiratory medicines, and nervous system medicines were frequently prescribed in off - label manner . Several studies had shown high rate of off - label prescribing in respiratory, antibiotics, analgesics, and antiepileptics . About 82% of medicines in respiratory system were off - label which is more than what is reported in studies in us (n = 312 million, 70%) and portugal (n = 500, 77%). If asthma therapies are considered, inhaled corticosteroids are frequently prescribed (30.7% of all prescriptions). The mainstay therapy for asthma is inhaled corticosteroids (ics), but guidelines often do not give specific recommendations for upper doses limits specially in children . Various combinations of antihistaminics, decongestants, and/or analgesics were prescribed to patients in off - label doses for common cold . Still, the off - label use of paracetamol is substantial, mainly due to off - label classification for dose or age . Although paracetamol is normally considered safe in pediatrics care, a previous cochrane review pointed out that there is limited evidence regarding the efficacy and safety for paracetamol in the treatment of fever in children . Lorazepam and ondansetron were widely prescribed for off - label indication but are supported by well conducted clinical studies [27, 28]. Better medicines for children to improve monitoring medicine safety in the pediatrics and highlighted its concern on off - label medicines . The strict drug approval procedure is the way to ensure quality data on quality, safety, and efficacy for different pediatric age groups . Despite many regulatory amendments and policies, we still have apathetic outlook to pediatric clinical trials . The pharmaceutical companies should be convinced to have appropriate pediatric information in the label and they are not being permitted to market drugs likely to be used in children without suitable pediatric labeling . Indian drug regulatory authorities should also develop pediatric specific drug development regulation so that the tendency to market medicines without pediatric specific data is discouraged . This might ensure pediatric labeling for new medicines yet to be introduced in the market; but it is unlikely that drug companies will carry out trials to confirm pediatric use for drugs already marketed and used in children, although in an off - label manner . Alternatively, the situation can be improved when prescribers report their pediatric experiences with different off - label medicines in form research articles or discussion at scientific platforms . When medicines are used as off - label, each patient is unique and risk - benefit pertaining to him should be assessed by high quality evidence . The doctor needs to be updated with latest evidence which could be accomplished by using several useful drug compendia like drugdex, clinical pharmacology, and so forth . Only such focused and coordinated actions would make sure that children's right to safe, cost - effective, and quality medicines would be realized . Based on national formulary of india, our data suggest that magnitude of off - label prescribing in pediatric inpatients is considerable higher than reported in some of the countries . Dose discrepancy and use in restricted age limits were identified as main contributor to off - label prescribing . There is need for strict drug regulation for pediatric population to ensure safety and effectiveness of pharmacotherapy . Further studies are needed to examine why there are inadequate dosing guidelines and generation of more clinical data especially in respiratory medicines . Understanding various risk factors and spectrum of off - label medicine use can assist developing prevention strategies.
The role of the thyroid gland in pregnancy and the impact of thyroid disorders on the course of pregnancy and development of the offspring have drawn a considerable interest in the recent years, both in the medical and in the general society . About 2 and 4% a growing body of evidence suggests that subclinical hypothyroidism may be associated with in vitro fertilization failure, subfertility, infertility, spontaneous abortion, placental abruption, gestational hypertension, preeclampsia, preterm delivery, postpartum thyroid dysfunction, depression (including postpartum depression), conversion to overt hypothyroidism, and impaired cognitive and psychomotor child development . American thyroid association in its recently published guidelines have stated against universal screening of pregnant women for hypothyroidism . It seems that prevalence of hypothyroidism is more in asian countries compared to the west . In a recent study by dhanwal et al . Looking at these data the purpose of the study was to know whether routine screening would prove to be beneficial in our country . The study was an out - patient department (opd) based prospective cohort, observational study in which 305 women were randomly selected and screened on opd basis by thyroid - stimulating hormone (tsh) levels (cutoff level 0.10 - 2.50 miu / ml) as per recent guidelines . These women were followed till term and subsequent delivery to study the effect on maternal and perinatal outcome . Known cases of other medical disorders and women who did not give consent for tsh estimation were excluded from the study . 0.10mu / l, the reference values for tsh were 0.1 - 2.5miu / l, 0.2 - 3.0 miu / l and 0.3 - 3.0 miu / l in the first, second, and third trimesters of pregnancy respectively, considering the recent literature . The statistical difference between variables in the study following are the observations made: the mean age of women was 24.46 years (sd = 2.00). The mean gestational age at time of screening 9.09 weeks . (sd = 4.09) 38.68% of women were of gestational age less than 9 weeks and 61.31% were with gestational age 913 weeks . Cut off of 9 weeks was taken to identify those who presented early in first trimester, 55.08% women were nullipara, 31.14% were primipara, 11.47% were para 2, 2.2% women were para 3 and more . It was seen that 4.9% women were already having symptoms of thyroid diseases (main symptoms seen were weakness, lethargy, loss of appetite, weight gain), 4.2% had history of previous thyroid diseases (which is either hypo or hyperthyroidism), 0.65% women had history of other autoimmune diseases (apla syndrome) 4.9% women had history of previous caesarean section, 1.6% women had family history of thyroid diseases, 0.3% had history of irradiation, 1.6% had history of medication (thyroxine for hypothyroidism). On this screening . However, the incidence of hypothyroidism in high risk population was 20.58% and in normal population was 6.7% which shows a significant association of thyroid disorders with high risk factors (p <0.001). In the euthyroid women 7.2% had an adverse perinatal outcome, 92.7% had normal outcomes . This shows statistically significant association abnormal tsh values with adverse pregnancy outcomes (p <0.001). Considering the route of delivery, 88.85% women had normal delivery, out of them 0.36% were hyperthyroid, 5.5% were hypothyroid rest were euthyroid . In abnormal perinatal outcomes 6.2% women had lower segment caesarean section (lscs) out of them 73.68% were euthyroid and 26.31% were hypothyroid . The main indications for lscs in these cases were fetal distress, maternal cephalopelvic disproportion (cpd), contracted pelvis, and failed induction . 1.9% had preterm labour, out of them 50% were euthyroid, 50% were hypothyroid . In all, there was only one preterm fresh still birth in a euthyroid woman . Out of 2.2% spontaneous abortions 28.5% were in euthyroid group while 71.4% were in hypothyroid group . This study shows significant association between abnormal tsh values and adverse perinatal outcomes (p <0.001). This prospective screening of thyroid function in a cohort of unselected pregnant women shows that high - risk women (with a personal or family history of thyroid disorders or a personal history of other autoimmune diseases) have more significant (p <0.001) increased risk of hypothyroidism (subclinical or overt) during early pregnancy . However, testing only the high - risk pregnant women, as the consensus guidelines recommend, would miss about one- of women with hypothyroidism . Therefore with the growing evidence for an association between maternal subclinical hypothyroidism and adverse pregnancy outcomes but lack of intervention trials showing beneficial effect of thyroxine (t4) in preventing these adverse outcomes, the controversy between targeted high - risk case finding and universal screening continues . The consensus guidelines recommend the use of t4 in pregnant women with subclinical hypothyroidism, justified on the basis of potential benefit to risk ratio . Our study shows that, without universal screening, a significant number of such pregnant women with thyroid dysfunction will not be picked up . Free thyroxine (ft4) increases with suppression of tsh in response to placental human chorionic gonadotrophin during the first trimester, whereas ft4 tends to decrease in late gestation . This is likely to be the cause for the high prevalence of suppressed tsh in this cohort . Furthermore increased serum thyroid - binding globulin and decreased albumin during pregnancy result in assay - dependent variations in ft4 levels . These observations have led to the call for using trimester and assay - specific reference ranges for thyroid function tests in pregnancy . If the trimester specific reference range is used, 9.8% pregnant women in this cohort will be considered to have hypothyroidism . Whereas there will be less of a controversy to use the trimester - specific reference range in titrating the dose of t4 in pregnant women on t4 replacement, further studies are needed to determine the threshold level of tsh at which initiation of t4 replacement should be considered . Clinical studies have confirmed that the increased requirement for t4 (or exogenous lt4) occurs as early as 4 - 6 weeks of pregnancy . Such requirements gradually increase through 16 - 20 weeks of pregnancy, and thereafter plateau until time of delivery . These data provide the basis for recommending adjustments to thyroid hormone in affected women once pregnant and for the timing of follow - up intervals for tsh in treated patients . The levothyroxine (lt4) adjustment, when necessary, should be made as soon as possible after pregnancy is confirmed to reduce the probability of hypothyroidism . A prospective, randomized study has recently provided evidence in support of one dose adjustment strategy for women receiving lt4 who are newly pregnant . For women who are euthyroid while receiving once - daily dosing of lt4 (regardless of amount), a recommendation to increase by two additional tablets weekly (nine tablets per week instead of seven tablets per week; 29% increase) can effectively prevent maternal hypothyroidism during the first trimester and mimic gestational physiology . This augmented dose should occur immediately after a missed menstrual cycle or suspected pregnancy occurs . A separate option is to increase the dosage of daily lt4 by approximately 25 - 30% . There is also an uncertainty regarding the most appropriate initial screening test for thyroid dysfunction in pregnancy . The consensus guidelines recommend using tsh as the initial test, whereas others have stressed the importance of testing ft4 by highlighting the fact that ft4 (and ft3) is responsible for thyroid hormone action and that maternal hypothyroxinemia (normal tsh but low ft4) is associated with neuropsychological deficit in the offspring . In our study, the cause of maternal hypothyroxemia is not fully understood, but iodine deficiency is thought to be a major factor although urinary iodine was not analyzed in the present cohort, a previous study in this same population has shown that 7 and 40% pregnant women have urinary iodine excretion of less than 50 g / l (suggestive of dietary iodine deficiency) and 50 - 100 nearly one - quarter of hypothyroid women on t4 replacement in this study had raised tsh at their first antenatal visit . Given the fact that the fetus relies entirely on maternal thyroid hormones for its development until about 13 week of gestation, it is critical to ensure adequate t4 replacement in pregnant women during the first trimester . Hypothyroid pregnant women on t4 require an increased dose from as early as the fifth week of gestation to maintain optimum t4 replacement . Some recommend a 30% increase in the t4 dose as soon as the pregnancy is confirmed, with further dose adjustments based on tsh measurements . In addition, through education of all hypothyroid women in the reproductive age, every attempt should be made to ensure an adequate t4 replacement before a planned pregnancy . So screening of thyroid disorders should be done in early pregnancy . It will help to diagnose the cases at the earliest and to carry out timely intervention to prevent adverse perinatal outcomes . But still there is a controversy regarding universal thyroid function screening or high - risk screening in early pregnancy . But if we screen only high risk population we would miss 4.6% cases which could have been diagnosed and treated earlier . So this study emphasizes high risk screening in early pregnancy but also supports that universal screening should be a part of our screening protocols so that all thyroid disorders are screened and treated at the earliest . So in our country we must follow indian thyroid society guidelines which clearly recommend that all pregnant women should be screened at 1 antenatal visit by measuring tsh levels, and highlight that ideally screening should be carried out during prepregnancy evaluation or as soon as pregnancy is confirmed.
Esophageal cancer is a devastating disease with rapidly increasing incidence in western . Despite important advances in therapy,> 50% of patients have incurable disease at diagnosis and only 510% of these patients have life expectancy> 5 years . Dysphagia is the most common symptom that afflicts these patients, causing 70% of complaints, and leading to severe malnutrition and reduced quality of life [1, 2]. This factor prevents curative treatment in the majority of them, thus making palliative care a more realistic option [1, 3]. Although surgical resection remains the treatment of choice for early cancers, palliative esophagectomy is not recommended due to high mortality rates . However, surgical procedures in order to bypass the dietary route with relief of dysphagia have been reported in the literature but have fallen into disuse because of the morbidity and mortality of the procedure itself and advances in endoscopic treatment . This paper demonstrates the use of surgical treatment using the laparoscopic approach in the palliative care of a patient with advanced esophageal cancer . A 69-year - old male presented with progressive dysphagia, retrosternal pain and weight loss of 10 kg in 2 months . The finding was a circumferential lesion from 19 to 25 cm of the incisors, with biopsy diagnosing squamous cell carcinoma . Radiological examinations showed lymphadenopathy in the celiac trunk and in the mediastinal area . A bronchoscopy diagnosed tracheal infiltration by neoplasia . The patient was treated with external radiotherapy (13 250 cgy) with symptom relief and regained performance status (from 3 to 1). However, after re - staging exams, the persistence of the disease was diagnosed, with dysphagia worsening . The technique, as described by lacerda et al . In a previous report, involves the creation of a gastric tube close to 3 cm in width and with an average length of 30 cm (fig . 1) and preservation of the right gastroepiploic vessels by laparoscopy . Figure 1:gastric tube . The tube is then passed along a retrosternal path and end - to - side anastomosis using a circular stapler is performed with the cervical esophagus prepared earlier by left cervicotomy . A laminar drain is applied in the cervical incision (fig . 2). The patient was discharged from the hospital on the fifth post - operative day with oral intake . No leakage or other complication the patient survived for 4 months, gained 10 kg in this period and did not refer any dysphagia after the procedure . Currently, there are several methods for this purpose, including the esophageal stent, endoscopic dilation, radiotherapy (both external and endoluminal brachytherapy), chemotherapy and laser recanalization (yag). The choice of procedure and the response to treatment should be properly related to life expectancy, which has also been related to performance status, weight loss, tumor extension, clinical stage, sex and age . Dysphagia from inoperable esophageal cancer is a common and complex management problem, and there is no consensus on the ideal treatment approach . All methods have their own advantages and disadvantages in rapid or late onset effect in symptom relief as in recurrence . No single intervention palliates dysphagia at all time for every patient; therefore, healthcare providers must assess the risks and benefits of each palliative intervention for individual patients . Surgical resection is still cited in the literature as a way to palliate esophageal cancer but is restricted to patients with severe risk of complications (e.g. Perforation or incontrollable tumor bleeding) due to high morbidity and mortality in relation to non - surgical palliative options . That there are no randomized controlled studies to compare the addition of surgery to palliative chemotherapy with chemotherapy alone . They also state that such studies may become possible and worthwhile if minimal access surgery can be achieved that has reduced complications and better recovery of health - related quality of life than standard open surgery . In 1979, postlethwait proposed a technique for esophageal bypass surgery with an isoperistaltic gastric tube, and this method is still used despite its morbidity . This report demonstrates that an update in the technique proposed by postlethwait for palliation of esophageal cancer with the use of minimal access surgery is feasible . According to the current literature, the bypass procedure in order to palliate dysphagia could be reserved for patients in which the stent has failed or contraindicated . High costs can sometimes make the lesser invasive procedure more prohibitive to the patient than surgery itself.
A 35-year - old female presented with a painless, slowly growing mass in the right inferior orbit for the past four years . She did not complain of diminution of visual acuity, diplopia or field defect . On examination, visual acuity in both eyes the right side demonstrated a solid, non - tender, freely mobile mass in the inferior orbit, which became more prominent on applying pressure on the upper part of the globe . The mass measured approximately 20 mm 15 mm and the size did not vary with valsalva maneuver, ocular movements or posture . Slit - lamp and fundus examination of the eye showed normal anterior and posterior segments . B - scan ultrasonography revealed an extraconal, homogenous lesion in the inferior part of the right orbit . Computed tomography revealed a non - enhancing well- defined homogenous mass measuring 20 mm 12 mm in the right inferior orbit which was displacing the inferior rectus and inferior oblique muscle upwards . The mass was separate from the above - mentioned muscles and produced no globe indentation or displacement [figure 1a]. A provisional diagnosis of orbital dermoid was made and the patient was taken up for an excision biopsy . Peroperative findings were of a smooth, well - encapsulated mass with no attachments to the surrounding muscles . On histopathological examination, the gross specimen consisted of a smooth well - encapsulated solid mass measuring 25 mm in the greatest diameter [figure 1b]. Microscopically, a biphasic pattern of tumor cells was seen with areas of closely packed spindle cells having fusiform nuclei and eosinophilic cytoplasm (antoni a) admixed with looser myxoid tissue having ovoid cells (antoni b). At places, these tumors cells were arranged in palisades and this arrangement of cells is referred to as verocay bodies . Orbital schwannoma is a tumor of adulthood usually presenting between 20 to 70 years of age . Schwannomas are usually asymptomatic when small and may produce progressive, painless proptosis on enlargement . A variable combination of signs and symptoms may be present due to the variable origin and location of the tumor in the orbit.2 displacement of the globe is related to the site of the tumor mass . Most schwannomas arise from branches of either the supraorbital or supratrochlear nerves and hence produce downward displacement of the globe . Less commonly, the tumor may arise from the infraorbital nerve and produce upward displacement of globe . Larger tumors may produce diplopia, particularly when they arise from the orbital portion of the third, fourth or sixth nerve . The growth of the tumor may cause compression of the optic nerve with papilledema or optic atrophy . Surgical excision is the treatment of choice and the tumor should be removed intact at the earliest to prevent compression of the optic nerve.3 incomplete excision can lead to recurrence or even intracranial extension . Highly cellular tumors have greater chance of recurrence and malignant transformation . Therefore an early treatment is indicated to avoid the complications related to progressive growth of the tumor . In our patient, we were successful in achieving the above objectives with timely and complete excision of the tumor . Orbital schwannoma arising from the infraorbital nerve is rare and clinical diagnosis is often difficult . Extensive literature search revealed only a few case reports of an orbital schwannoma arising from the infraorbital nerve.4 - 10 our patient presented with the tumor in this uncommon location . A solitary schwannoma, though rare, should be considered as a preoperative differential diagnosis of a unilateral slow- growing orbital mass in an adult and prompt management is warranted to prevent development of vision - threatening complications.
Risperidone has been reported to be effective in management of disruptive behaviors, including hyperactivity, irritability, aggression, and temper tantrums . Increased appetite, weight gain, headache, and sedation literature search revealed only four published reports of risperidone - related bleeding, including hemorrhagic cystitis,1) nasal bleeding,2,3) and gastrointestinal bleeding.4) we hereby describe the first pediatric case of gingival bleeding during risperidone treatment . An 11-year - old - girl was referred to our out - patient clinic for her hyperactivity, temper tantrums, sleep problems, and self - injurious behaviors . According to her psychiatric assessment and psychometric evaluation, she was started on risperidone 0.25 mg / day treatment for her disruptive behaviors and two weeks later the dose was increased to 0.5 mg / day . One - week after the dose increase, she experienced gingival bleeding when she brushed her teeth . Risperidone was considered to be the reason for bleeding, therefore we decided to reduce the dose to 0.25 mg / day . Gingival bleeding ceased within a week . Because worsening of her behavioral problems, her mother increased the dose to 0.33 mg / day . She experienced gingival bleeding rarely (twice a month) and mildly during this dose regime, therefore we stopped the medication . We decided to change risperidone to methylphenidate; however, her parents refused to continue to the treatment because of their worries about the potential side effects . She had no history of any bleeding disorder or any other medical condition including current allergies . She was not taking any other medication other than risperidone at the time of the development of bleeding . There are several case reports about risperidone - related bleeding; however, to our knowledge, there is no report of gingival bleeding associated with risperidone in the literature . We presented a case who experienced gingival bleeding when risperidone dose was increased to 0.5 mg / day, and subsided after decreasing the dose to 0.25 mg / day, suggesting a dose - dependent side - effect . However, the chronological relationship between the time of risperidone 0.5 mg / day administration and emergence of bleeding in the absence of an identifiable medical condition suggests risperidone to be the causative agent . There was no other agent likely to be the cause of bleeding, except risperidone, and bleeding ceased when the dose was decreased . Although an etiological relationship between risperidone use and gingival bleeding cannot be drawn from a single case, the naranjo probability scale score (8) reveals a probable relationship.5) the bleeding side effect of risperidone might be caused by several mechanisms, including thrombocytopenia and 5-hydroxytryptamine 2a (5-ht2a) receptor antagonism.3) thrombocytopenia is a known adverse effect of atypical antipsychotics and has also been reported during risperidone.6) in our reported case platelet count was normal, therefore, gingival bleeding could not be a consequence of thrombocytopenia . Antagonism of 5-ht2a receptor was suggested to cause bleeding by inhibiting the release of vasoconstrictors from platelets and reducing the platelet aggregation.4) therefore, we may speculate that risperidone s high affinity to 5-ht2a receptors might have probably resulted gingival bleeding . This case suggests that bleeding associated with risperidone may be a dose - dependent side effect . However, these potential explanations may not describe the entire mechanism of this adverse reaction . It is also possible that she might have some undetermined predisposing factors for bleeding that is triggered by risperidone . There are several reports on gingival bleeding during anti - depressants;7) however, this is the first case on gingival bleeding associated with risperidone . Although bleeding is a rare side effect, clinicians should be aware that risperidone may cause bleeding . Risperidone may also increase the risk of bleeding in susceptible patients with a history of coagulation disorders, and with concomitant use of other drugs, including non - steroidal anti - inflammatory drugs, aspirin, or other medications that affect coagulation.
Intestinal obstruction can be a result of mechanical or functional obstruction of the intestines, thereby preventing the normal transit of the products of digestion . Intestinal pseudo - obstruction (adynamic), characterized by abdominal pain, nausea, vomiting, constipation, and severe abdominal distension, is a clinical syndrome caused by severe impairment in the ability of the intestines to push the food through, in the absence of any lesion in the intestinal lumen . Secondary pseudo - obstruction is more common than the primary and is commonly associated with neuroleptics, opiates, diabetes mellitus, and severe metabolic illnesses . Intrathecal baclofen has been reported to cause intestinal pseudo - obstruction and life - threatening constipation . Though baclofen might sometimes cause constipation, there are only very few reports on intestinal pseudo - obstruction complicating oral baclofen therapy . A 50-year - old male, post cervical discectomy (c3 - 4) for prolapsed intervertebral disc with quadriparesis, neurogenic bladder, and spasticity, was on baclofen at a dose of 50 mg / day for 6 months . He presented to the emergency department with acute onset of bilious projectile vomiting, abdominal distension, and constipation since 3 days . One and half months back, he had a traumatic urethral injury for which open suprapubic cystostomy was performed . He had no history of other co - morbidities or drug intake other than baclofen . On examination, his vitals were stable but he was dehydrated . Plain radiograph of the abdomen revealed dilated large and small bowel loops without any air fluid levels . The possibility of adhesive intestinal obstruction was considered and the patient was kept nil per oral with nasogastric aspiration . A diagnosis of pseudo - obstruction was considered secondary to long - term baclofen intake, as he had gradually improved over 1 week without any active intervention except for the discontinuation of baclofen since admission . The patient was able to tolerate oral diet after 7 days of admission with no recurrence of symptoms . Currently, at 1 month of follow - up, he is asymptomatic with no recurrences . Colonic pseudo - obstruction is characterized by distension of the colon with features of colonic obstruction, in the absence of mechanical obstruction . Primary pseudo - obstruction is rare and is a motility disorder involving the autonomic innervation of the intestinal wall . Secondary pseudo - obstruction is more common and it has been associated with conditions like severe metabolic illness, diabetes mellitus, myxedema, scleroderma, parkinson's disease, hyperparathyroidism, and drugs like neuroleptics and opiates . Baclofen, a derivative of gamma - aminobutyric acid (gaba), is an agonist for the gaba b receptors, and is used to treat spasticity following spinal cord injury, multiple sclerosis, and cerebral palsy . Tolerance to baclofen mainly develops after many years to intrathecal route, but this beneficial property can be potentially harmful necessitating baclofen withdrawal in patients developing adynamic intestinal obstruction . Intestinal pseudo - obstruction has been reported after intrathecal baclofen, but till date, only a single case has been reported in literature describing adynamic intestinal obstruction caused by therapeutic dose of oral baclofen at 20 mg / day for 2 years in a 75-year - old male . Animal studies have shown that gaba - ergic mechanisms are involved in synaptosomal nitric oxide synthesis resulting in relaxation of rat ileum . In human preparations obtained from patients with malignant tumors, baclofen suppressed both amplitude and frequency of spontaneous and pharmacologically induced contractions in the longitudinal muscle of jejunum, eventually causing a complete block at higher concentrations while not affecting spontaneous motility of circular or longitudinal colon muscles . Gabaergic neurons, which are predominantly inhibitory interneurons, are distributed throughout the central nervous system and the enteric nervous system in humans . Hence, baclofen being a competitive gaba b agonist, affects the gastrointestinal function by acting both peripherally in the intestinal tract by inhibiting the myenteric plexus and centrally on brainstem nuclei which coordinate afferent input from and efferent output to the intestine by crossing the blood brain barrier . In our case, we considered the possibilities of baclofen - induced pseudo - obstruction of the intestine and adhesive intestinal obstruction . Hence, baclofen was discontinued and patient was put on nasogastric decompression . Considering the remote possibility of adhesive obstruction, water - soluble contrast enema, colonoscopy, or neostigmine was not tried . Colonoscopic decompression was planned in case of deterioration, but the patient recovered completely with prompt discontinuation of baclofen, nasogastric decompression, and maintenance of electrolytes . Considering the temporal relationship of the occurrence of symptoms after 6 months of baclofen therapy, improvement after withdrawal of the drug, and presence of pharmacological explanation for the occurrence of obstruction and evidence of similar reports earlier, we considered the possibility of baclofen - induced pseudo - obstruction . On causality assessment, baclofen - induced pseudo - obstruction in our case belongs to the probable / likely category as per the world health organization - uppsala monitoring centre (who - umc) system and to the objective evidence in the form of blood levels of baclofen was not available, and re - challenging was not attempted because intestinal pseudo - obstruction could be fatal . The remote possibility of adhesive obstruction is mostly unlikely as the patient recovered with withdrawal of baclofen . Oral baclofen used for spasticity can cause constipation, but intestinal pseudo - obstruction is a rare possibility and in such cases, prompt discontinuation of the drug can be therapeutic . This rare cause of intestinal pseudo - obstruction needs to be borne in mind to avoid potentially morbid investigations like gastrograffin enema or colonoscopy, which are associated with complications like perforation.
The incidences were getting higher and higher . Increased intramyocellular lipid accumulation plays a very important role in obesity and diabetes, as well as their complications [2, 3]. This attracted great interest in the effect of accumulated lipid intermediates on insulin resistance [4, 5]. Lipotoxicity was regarded as the link of high levels of lipids with impaired insulin signaling [6, 7]. This sparked the interest in how excessive lipid affects -oxidation and mitochondrial biogenesis, which may have a great impact on glucose utilization and insulin resistance [710]. Carnitine palmitoyl transferase 1 (cpt1) is an important rate - limiting enzyme of mitochondrial -oxidation, by controlling the mitochondrial uptake of long - chain acyl - coas . Its muscle isoform, cpt1b, is the predominant isoform rich in the heart and skeletal muscles . It was suggested that inhibiting cpt1 activity by specific cpt1 inhibitors alleviates insulin resistance in diet - induced obese mice . However, there is no study investigating if specific cpt1b deficiency in skeletal muscles had significant impact on lipids and insulin sensitivity . Therefore, in this study, by establishing a mouse model, we directly explored this issue . With specific knockout of carnitine palmitoyl transferase-1b (cpt1b) in skeletal muscles of mice, cpt1b m/ mouse model was established as per previously described [12, 16, 17] by using male c57/bl6 mice (12 weeks old; 2025 g) with cre - lox technology [17, 18]. Mice were genotyped by standard pcr of tail dna with pcr master mix (applied biosystems inc . ). Twenty mice from each group (cpt1band cpt1b m/) were kept on a 12 h/12 h light / dark cycle, in temperature - steady rooms, and had ad libitum access to water and chow diet . All experimental procedures were conducted according to the care and use guide of laboratory animals and were approved by the iaec of the huzhou central hospital . General and metabolic profiles were measured at 12, 18, 24, and 30 weeks of age, including the following: body weight, lipids in serum, food intake, body mass, and fat mass, as per related protocols [19, 20]. Skeletal muscle mrna and protein were extracted and purified with standard protocols as per our previous protocols [7, 21]. Rt - pcr was performed for mrna quantization per standard protocols with the reagents from abi system inc . Quantitative real - time rt - pcr analyses were carried out by using step one real - time pcr system (applied biosystems inc . ). Cycles were 50c for 2 min, a 2 min 95c denaturing step, followed by 50 cycles of 95c denaturation, incubated at 60c for 2 min, and denatured at 95c for 1 sec for the final step . The sequences of the primers are as follows: for cpt1b: forward: gac cat agaggc act tct cagcat gg, reverse: gcagca gcttca ggg tttgt; -actin: forward: gtc ctc tcc caa gtc cac ac, reverse: ggg aga cca aaa gcc ttc at; pakt forward: taa tac gac tca cta tag ggc caa ggagatcatgc, reverse: gatttaggtgacactatagctccaagctatcgtcc; glut4 forward: accgtggtccttigctgtgtt, reverse: acc cca atg ttg tac cca aac t. as described previously [16, 22, 23], a modified mitochondrial cpt1 assay was performed to measure cpt1 activity . Briefly, quantified mitochondria (100 g protein) from skeletal muscles were incubated with reaction buffer (117 mm tris - hcl, 0.28 mm reduced glutathione, 4.4 mm atp, 4.4 mm mgcl2, 16.7 mm kcl, 2.2 mm kcn, 40 mg / l rotenone, 0.1% bsa, and 50 mm palmitoylcoa) at 37c for 5 min . Initiate the reaction by adding 2 mm [c]-carnitine (0.1 ci) and queued it 10 min later with 50 l 1.2 mm ice cold hcl . [c]-palmitoyl carnitine was extracted with water saturated butanol and measured via liquid scintillation counting . As previously described [24, 25], fao was examined with radiolabeled palmitate fao assay . Skeletal muscle tissues were homogenized, and mitochondria were isolated and quantified (100 g proteins). Palmitate oxidation assay was performed with reaction buffer (75.5 mm sucrose, 12.5 mm k2hpo4, 100 mm kcl, 1.75 mm mgcl2 - 6h2o, 1.75 mm l - carnitine, 0.125 mm l(-) malic acid, 1.75 mm dtt, 0.07 mm nad+, 2 mm atp, 10 mm tris - hcl, and 0.07 mm coenzyme a). The reaction started when 200m [c]-palmitate-15% bsa (1: 6) complex (0.04 ci / reaction mixture) was added and stopped by 3.5 m perchloric acid after incubation at 37c for 30 min . Co2-trapping medium (naoh, 0.1 m) for c radioactivity was measured by liquid scintillation to calculate palmitate oxidation rate . After incubation, co2 and c - asps were measured (ls 6500; beckman coulter). Calculations were then performed accordingly . As previously reported [2628], tags, dags, and ceramides were tested with kc - esi - ms and gas chromatography (applied biosystems inc . ). After the solution was evaporated dry and reconstituted, the samples were analyzed with mass spectrometry (ms). The analysis was performed in positive ion mode electrospray ion (esi - ms) source and precursor ion scans m / z 264 and 282 (ceramides). Ceramides were quantified by taking the ratios of the integrated intensity for each subspecies to the intensity of c17:0 . As described [2931], an intraperitoneal glucose tolerance test (igtt) and insulin tolerance test (itt) were performed on nonanaesthetized mice after 8 hours' fasting . Blood glucose was measured with lancet glucometer (johnson and johnson). For igtt, 20% glucose (2.0 blood samples were collected from tail vein at 30, 60, 90, and 120 min for glucose levels . For itt, glucose blood levels were sampled at 5, 10, 15, 20, 25, and 30 min following intraperitoneal injection of human insulin (0.75 u 4.5 nmol / kg; novolin r, novo nordisk). As described previously [32, 33], skeletal muscles were homogenized in ice - cold buffer (250 mm sucrose, 10 mm tris - hcl, 2 mm edta, and 1 mm atp (ph 7.4)). For glucose oxidation, fresh skeletal muscle tissues were homogenized in ice - cold buffer (5 mm kcl, 2 mm tris - hcl, 0.5 mm tris base, 0.25 mm mgcl2 - 6h2o, 0.05 mm edta, and 0.05 mm atp (ph 7.4)), 400 l homogenate was used and the reaction started when 200 m [c]-glucose (0.1 ci / reaction mixture) was added . Co2-trapping medium (naoh, 0.1 m) for c radioactivity was measured by liquid scintillation to calculate glucose oxidation and quantified by weight of the skeletal muscle tissue homogenate . Student's t - test was used to evaluate the statistical significance of differences between knockout and controls . As shown in figure 1(a), the mrna expression of cpt1b decreased specifically in skeletal muscles (rt - pcr) but not in the heart muscle in cpt1b m/ mice . Cpt1 activity is barely detectable (dtnb assay at 412 nm) in mitochondria (figure 1(b)) for the knockout mice, even up to 10 minutes . Compared to the mice in cpt1b group, those mice in cpt1b m/ group had similar daily food intake . However, as shown in table 1, their body weights were lower, starting about 12 weeks of age, along with lower fat mass (p <0.05, resp . ). Their lipids levels were higher (p <0.05), but their glucose and insulin levels were similar . As shown in figure 2(a), fao was decreased in isolated mitochondria (radiolabeled palmitate) in skeletal muscles of cpt1b m/ mice . This was accompanied by elevation of ceramides, tags, and dags (figures 2(b) and 2(c)). Interestingly, for the ceramides, c16, c18, and c18:1 had significant increases for cpt1b m/, but not for c24 or c24:1 . Both dags and tags are dramatically elevated in cpt1b m/ mice . As shown in figure 3(a), cpt1b m/ mice maintain insulin sensitivity (insulin tolerance test). Compared with wild type, glucose tolerance test of cpt1b m/ mice had improved significantly (as shown in figure 3(b)). Pyruvate oxidation went up (figure 3(c)) and so did insulin - stimulated pakt and glut4 (figure 4). The relationship of fatty acid oxidation, lipids accumulation, and insulin sensitivity in skeletal muscles has been quite interesting . Imbalanced fatty acid uptake and fatty acid oxidation (fao) have been linked to insulin resistance in muscles, which in turn worsens and complicates obesity and diabetes, as well as their complications [7, 34, 35]. Our study demonstrated that in mice with conditional knockout cpt1b in skeletal muscles, mitochondrial fatty acid oxidation was depressed dramatically . This was accompanied by increased accumulation of lipids in skeletal muscles, such as dags, tags, and ceramides . Regardless of these changes, insulin tolerance test, glucose tolerance test, and pyruvate oxidation all proved better insulin sensitivity for the knockout mice . This is partially consistent with the recent results in high - fat diet - induced obese mice, when given cpt1 inhibitor oxfenicine, as far as the major findings are concerned . Another study done with different cpt1 inhibitor, etomoxir, suggested that lipids intermediates increased . 70% of total insulin - induced glucose disposal occurs in skeletal muscles, this may indicate that increased fatty acid intermediates in skeletal muscles could damage insulin sensitivity . Our study showed that regardless of the characteristics of lipids accumulation, the mice are still insulin sensitive . First, due to the knockout of cpt1b in skeletal muscles, the major fuel sources were in deficit . This may suggest that signaling pathways related to energy were impaired or injured such as ampk or mtor . Second, abnormal mitochondrial biogenesis and mitochondrial dysfunction may contribute to insulin resistance and diabetes [39, 40]. We explored from these aspects the enzymes involved in mitochondrial activity such as -had and citrate synthase, genes related to transcriptions such as nrf (nuclear respiratory factor), and the major nuclear receptor activator pgc1 . Thirdly, considering the correlation of adaptation of peroxisomal and amino acid to mitochondria, we further explored these changes . We will report these results in our next paper and further discuss the mechanism involved . In summary, it suggested that with specific knockout of cpt1b in skeletal muscles, although there were lipids accumulations in skeletal muscles, the insulin sensitivity still remains.
Pelvic organ prolapse (pop) is a major healthcare problem in middle - aged and elderly women and is usually accompanied by pelvic floor dysfunction (pfd). The introduction of mesh repair in vaginal prolapse surgery showed possible advantageous results in early reports . However, pelvic floor structures progressively weaken in the elderly women, contributing to the high rate of recurrence . It has been reported that more than 30% of patients undergoing prolapse repair need reoperation . Recent announcements from the us food and drug administration (fda) describe increasing concern for complications after transvaginal mesh (tvm) surgery . The risk factors for mesh exposure have been explored for decades, but it remains unclear what leads to the mesh exposure and operation failure . We analyzed clinical data to identify possible risk factors for mesh exposure to reduce the tvm complication rate and to improve patients quality of life . A retrospective study of patients undergoing tvm surgery between january 2004 and december 2012 was conducted in the department of obstetrics and gynecology at the first affiliated hospital of chinese pla general hospital . The operative methods included prosima anterior leaf fixation, prolift anterior leaf fixation, small mesh fixation, prosima posterior leaf fixation, prolift total pelvic fixation, tension - free vaginal tape (tvt), and tvt - obturator . Clinical data were collected including age, menopause status, body mass index (bmi), gravidity and parity, stage of the pop, tvm types, concomitant procedures, operation time, blood loss, postoperative morbidity, and postoperative mesh exposure . Only patients with at least 3 months of follow - up time the study was approved by the institutional review board of first affiliated hospital of chinese pla general hospital . Quantitative data were expressed as mean standard deviation (minimum, maximum) while categorical data were expressed as absolute number and rate . Statistical analysis was performed to analyze the risk factors for mesh exposure using the spss 10.0 software (spss inc . Independent sample's t - test was used for comparisons between the two groups while binary logistic regression was adopted to explore the risk factors for mesh exposure . A retrospective study of patients undergoing tvm surgery between january 2004 and december 2012 was conducted in the department of obstetrics and gynecology at the first affiliated hospital of chinese pla general hospital . The operative methods included prosima anterior leaf fixation, prolift anterior leaf fixation, small mesh fixation, prosima posterior leaf fixation, prolift total pelvic fixation, tension - free vaginal tape (tvt), and tvt - obturator . Clinical data were collected including age, menopause status, body mass index (bmi), gravidity and parity, stage of the pop, tvm types, concomitant procedures, operation time, blood loss, postoperative morbidity, and postoperative mesh exposure . Only patients with at least 3 months of follow - up time the study was approved by the institutional review board of first affiliated hospital of chinese pla general hospital . Quantitative data were expressed as mean standard deviation (minimum, maximum) while categorical data were expressed as absolute number and rate . Statistical analysis was performed to analyze the risk factors for mesh exposure using the spss 10.0 software (spss inc . Independent sample's t - test was used for comparisons between the two groups while binary logistic regression was adopted to explore the risk factors for mesh exposure . A value of p <0.05 was considered statistically significant . Data from 218 patients who had received reconstruction pelvic surgery (rps) due to pfd from january 2004 to december 2012 data were collected . A total of 195 (89.4%) subjects were enrolled and 150 (68.8%) subjects were followed up for more than 2 years . The median follow - up time was 35.1 23.6 months (range: 2.0104.0 months). The average age was 63.9 11.2 years (43.089.0 years, mean age 65.0 years). The median duration of menopause was 14.8 10.7 years (range: 035.0 years). The average gravidity was 3.6 1.6 times (range: 111 times) and the average parity was 2.6 1.5 times (range: 19 times). Seven patients had a history of pelvic surgery, including 3 with hysterectomy plus anterior wall colporrhaphy, 1 with posterior wall colporrhaphy, and 1 with hysterectomy . A total of 195 patients underwent transvaginal rps with polypropylene (pp) mesh; 180 (92.3%) received anterior prolapse surgery, 1 (0.5%) received posterior prolapse surgery, and 14 (7.2%) received combined anterior and posterior prolapse surgery . A total of 209 transvaginal pp meshes were placed; 194 in the anterior wall and 15 in the posterior wall . Concomitantly, transvaginal hysterectomy was performed in 189 (96.9%) cases, high uterosacral ligament suspension in 176 (90.2%), sacrospinous ligament fixation in 5 (2.5%), posterior wall colporrhaphy in 130 (66.7%), perineal repair in 160 (82.1%), and tvt in 61 (31.3%). The mean operative time was 2.4 1.1 h (range: 1.04.0 h). The mean body temperature in the first 3 days after the operation was 37.1 0.3c (range: 36.838.2c). The average follow - up time was 35.1 23.6 months (range: 2104 months). A successful operation was defined as stage 2 or less by pop quantification (pop - q) examination . All other patients were found by pop - q to be stage 2 or less up to half a year after the surgery . The objective success rate was 98.9%, and no patient was reoperated because of recurrence . Mesh exposure was defined by criteria established by the international urogynecological association and the international continence society [figure 1a and 1b]. Mesh exposure was found in 32 patients, whose age ranged from 43 to 81 years . The mean exposure diameter was 0.6 0.3 cm (range: 0.31.5 cm) [table 1]. The management of vaginal mesh exposure included regular observation, local application of estrogen ointment and metronidazole suppositories, and removal of exposed mesh . Most cases gradually healed in half a year . No mesh exposure progression was detected . There were eight patients who were admitted for removal of exposed mesh and after mesh resection the vaginal mucosa healed completely . (a and b) mesh exposure was found in the follow - up checkup, as the black arrows show . Demography of patients with mesh exposure (n = 32) bmi: body mass index; ci: confidence interval; sd: standard deviation . Thirty - two patients with mesh exposure were recruited into the exposed group and the other 163 patients were recruited into the nonexposed group . As shown in table 2, the median age, the operative time, and the blood loss were comparable in the nonexposed and exposed groups . Statistical analysis revealed no significant difference for menopausal status, gravidity and parity, bmi, blood loss, age, or postoperative morbidity . However, the number of concomitant procedures in the nonexposed group was significantly lower than those in the exposed group . Sslf: sacrospinous ligament fixation; hus: high uterosacral ligament suspension; tvt: tension - free vaginal tape; tvt - o: tension - free vaginal tape obturator technique; pop - q: pelvic organ prolapse quantification . Logistic regression analysis of the risk factors for mesh exposure was performed in 195 patients [table 3]. Risk factors for mesh exposure in our analysis included operative duration and the concomitant procedures (p = 0.043, p = 0.001). The relative risk was 1.899 and 0.376, respectively, for operative time and number of operations . Other factors such as age, menopausal status, gravidity, parity, bmi, and blood loss were not related to mesh exposure . Risk factors for mesh exposure bmi: body mass index; ci: confidence interval; or: odds ratio . Data from 218 patients who had received reconstruction pelvic surgery (rps) due to pfd from january 2004 to december 2012 data were collected . A total of 195 (89.4%) subjects were enrolled and 150 (68.8%) subjects were followed up for more than 2 years . The median follow - up time was 35.1 23.6 months (range: 2.0104.0 months). The average age was 63.9 11.2 years (43.089.0 years, mean age 65.0 years). The median duration of menopause was 14.8 10.7 years (range: 035.0 years). The average gravidity was 3.6 1.6 times (range: 111 times) and the average parity was 2.6 1.5 times (range: 19 times). Seven patients had a history of pelvic surgery, including 3 with hysterectomy plus anterior wall colporrhaphy, 1 with posterior wall colporrhaphy, and 1 with hysterectomy . A total of 195 patients underwent transvaginal rps with polypropylene (pp) mesh; 180 (92.3%) received anterior prolapse surgery, 1 (0.5%) received posterior prolapse surgery, and 14 (7.2%) received combined anterior and posterior prolapse surgery . A total of 209 transvaginal pp meshes were placed; 194 in the anterior wall and 15 in the posterior wall . Concomitantly, transvaginal hysterectomy was performed in 189 (96.9%) cases, high uterosacral ligament suspension in 176 (90.2%), sacrospinous ligament fixation in 5 (2.5%), posterior wall colporrhaphy in 130 (66.7%), perineal repair in 160 (82.1%), and tvt in 61 (31.3%). The mean operative time was 2.4 1.1 h (range: 1.04.0 h). The mean body temperature in the first 3 days after the operation was 37.1 0.3c (range: 36.838.2c). The average follow - up time was 35.1 23.6 months (range: 2104 months). A successful operation was defined as stage 2 or less by pop quantification (pop - q) examination . All other patients were found by pop - q to be stage 2 or less up to half a year after the surgery . The objective success rate was 98.9%, and no patient was reoperated because of recurrence . Mesh exposure was defined by criteria established by the international urogynecological association and the international continence society [figure 1a and 1b]. Mesh exposure was found in 32 patients, whose age ranged from 43 to 81 years . The mean exposure diameter was 0.6 0.3 cm (range: 0.31.5 cm) [table 1]. The management of vaginal mesh exposure included regular observation, local application of estrogen ointment and metronidazole suppositories, and removal of exposed mesh . Most cases gradually healed in half a year . No mesh exposure progression was detected . There were eight patients who were admitted for removal of exposed mesh and after mesh resection the vaginal mucosa healed completely . (a and b) mesh exposure was found in the follow - up checkup, as the black arrows show . Demography of patients with mesh exposure (n = 32) bmi: body mass index; ci: confidence interval; sd: standard deviation . Thirty - two patients with mesh exposure were recruited into the exposed group and the other 163 patients were recruited into the nonexposed group . As shown in table 2, the median age, the operative time, and the blood loss were comparable in the nonexposed and exposed groups . Statistical analysis revealed no significant difference for menopausal status, gravidity and parity, bmi, blood loss, age, or postoperative morbidity . However, the number of concomitant procedures in the nonexposed group was significantly lower than those in the exposed group . Sslf: sacrospinous ligament fixation; hus: high uterosacral ligament suspension; tvt: tension - free vaginal tape; tvt - o: tension - free vaginal tape obturator technique; pop - q: pelvic organ prolapse quantification . Logistic regression analysis of the risk factors for mesh exposure was performed in 195 patients [table 3]. Risk factors for mesh exposure in our analysis included operative duration and the concomitant procedures (p = 0.043, p = 0.001). The relative risk was 1.899 and 0.376, respectively, for operative time and number of operations . Other factors such as age, menopausal status, gravidity, parity, bmi, and blood loss were not related to mesh exposure . Risk factors for mesh exposure bmi: body mass index; ci: confidence interval; or: odds ratio . Epidemiological studies have shown that 29.2% of the pop patients need to be reoperated after traditional operation, especially in advanced pop . The synthetic pp mesh has been used more widely in pelvic reconstructive surgery for the past 1020 years . However, the related complications of pp mesh have been reported occasionally and some of them are serious and life - threatening ., falagas reported that the incidence of mesh exposure rate ranged from 0% to 33% . Recently, a meta - analysis of 110 studies comprising 11,785 patients reported 10.3% overall rate of mesh exposure . In this study, we have found a higher mesh exposure rate in tvm of 15.8% . In this study, we identified risk factors for pp mesh exposure . We analyzed the onset of the exposure and found that 59% occurred within 1 year after the operation and 41% beyond 1 year . It was also found that 72.7% (24/33) of mesh exposure occurred within half a year . Among them, 39.4% (13/33) happened within 2 months . One year after the operation the onset of exposure was rather low (1/31). According to the literature, mesh exposure is more likely to occur in patients older than 70 years due to thinner vaginal mucosa caused by the low estrogen level . In 2005, achtari et al . Reported that patient age was a risk factor for mesh exposure . Kim et al . Reported that the rate of mesh erosion was not related to patient age when comparing a group> 70 years of age to a group <70 . In two recent retrospective cohort studies, which included patients over 80 with pop, no mesh exposure was found after the operation . In our study, mesh exposure was found to occur mainly in patients between 50 and 75 years old . The subsequent regression analysis has also not revealed any effect of age for mesh exposure . First, we tried to reserve the vaginal mucosa as much as possible during our operation . The number of concomitant operation procedures is another contributing factor for mesh exposure . In 2004, thompson et al . . Believed that risk factors for mesh exposure were concomitant hysterectomy and inverted t colpotomy while ganj et al . Thought the most important factor was the length of the incisions in vagina mucosa and the tension on the incision line controversially, stepanian et al . Found that concomitant hysterectomy would not increase the risk of mesh exposure . In our experience, exposure was significantly higher in patients who received posterior vaginal wall colporrhaphy, perineorrhaphy, and vaginal tape . Binary logistic regression analysis showed that the number of concomitant procedures and operative time were risk factors for mesh exposure . As the number of concomitant procedures increased, the rate of mesh exposure increased, possibly due to a longer operative time . In this study, we used 3 different types of meshes . Prosima was smaller and can be adjusted by clipping but is not as evenly placed as prolift . Ventricular septal defect is maintained for 28 days after prosima placement, which may arouse a local inflammation reaction . Our results showed that prosima, prolift, and mesh had an exposure rate of 19.1%, 15.9%, and 12.3%, respectively . Although prosima showed a higher exposure occurrence, statistical analysis did not reveal any difference among them, indicating they share similar exposure hazards . It was reported that surgeon's experience is also related with mesh exposure . In our hospital, the rate of mesh exposure was 14.6% in the first 5 years and 17% in the following 3 years . This indicated that the surgeon's experience might not be a strong protective factor for mesh exposure . In addition, it was found that the exposure rate of vaginal tape was only 1.6%, which indicated vaginal tape was safer and less likely to have mesh exposure . The warning from us fda regarding tvm indicates improper use of mesh may cause serious safety problems . Candidates should be carefully chosen, usually patients with advanced pop . Furthermore, alternative nonsurgical treatment or autologous tissue reconstructive surgery should be explored . Access system should be implemented to select eligible surgeons, and a standardized management system should be established for pelvic surgery . In general although exposure may occur after surgery, exposure rate was low and easy to manage . Epidemiological studies have shown that 29.2% of the pop patients need to be reoperated after traditional operation, especially in advanced pop . The synthetic pp mesh has been used more widely in pelvic reconstructive surgery for the past 1020 years . However, the related complications of pp mesh have been reported occasionally and some of them are serious and life - threatening ., falagas reported that the incidence of mesh exposure rate ranged from 0% to 33% . Recently, a meta - analysis of 110 studies comprising 11,785 patients reported 10.3% overall rate of mesh exposure . In this study, we have found a higher mesh exposure rate in tvm of 15.8% . In this study, we identified risk factors for pp mesh exposure . We analyzed the onset of the exposure and found that 59% occurred within 1 year after the operation and 41% beyond 1 year . It was also found that 72.7% (24/33) of mesh exposure occurred within half a year . Among them, 39.4% (13/33) happened within 2 months . One year after the operation the onset of exposure was rather low (1/31). According to the literature, mesh exposure is more likely to occur in patients older than 70 years due to thinner vaginal mucosa caused by the low estrogen level . In 2005, achtari et al . Reported that patient age was a risk factor for mesh exposure . Kim et al . Reported that the rate of mesh erosion was not related to patient age when comparing a group> 70 years of age to a group <70 . In two recent retrospective cohort studies, which included patients over 80 with pop, no mesh exposure was found after the operation . In our study, mesh exposure was found to occur mainly in patients between 50 and 75 years old . The subsequent regression analysis has also not revealed any effect of age for mesh exposure . First, we tried to reserve the vaginal mucosa as much as possible during our operation . The number of concomitant operation procedures is another contributing factor for mesh exposure . In 2004, thompson et al . Believed that risk factors for mesh exposure were concomitant hysterectomy and inverted t colpotomy while ganj et al . Thought the most important factor was the length of the incisions in vagina mucosa and the tension on the incision line controversially, stepanian et al . Found that concomitant hysterectomy would not increase the risk of mesh exposure . In our experience, exposure was significantly higher in patients who received posterior vaginal wall colporrhaphy, perineorrhaphy, and vaginal tape . Binary logistic regression analysis showed that the number of concomitant procedures and operative time were risk factors for mesh exposure . As the number of concomitant procedures increased, the rate of mesh exposure increased, possibly due to a longer operative time . In this study, we used 3 different types of meshes . Prosima was smaller and can be adjusted by clipping but is not as evenly placed as prolift . Ventricular septal defect is maintained for 28 days after prosima placement, which may arouse a local inflammation reaction . Our results showed that prosima, prolift, and mesh had an exposure rate of 19.1%, 15.9%, and 12.3%, respectively . Although prosima showed a higher exposure occurrence, statistical analysis did not reveal any difference among them, indicating they share similar exposure hazards . It was reported that surgeon's experience is also related with mesh exposure . In our hospital, the rate of mesh exposure was 14.6% in the first 5 years and 17% in the following 3 years . This indicated that the surgeon's experience might not be a strong protective factor for mesh exposure . In addition, it was found that the exposure rate of vaginal tape was only 1.6%, which indicated vaginal tape was safer and less likely to have mesh exposure . The warning from us fda regarding tvm indicates improper use of mesh may cause serious safety problems . Candidates should be carefully chosen, usually patients with advanced pop . Furthermore, alternative nonsurgical treatment or autologous tissue reconstructive surgery should be explored . Access system should be implemented to select eligible surgeons, and a standardized management system should be established for pelvic surgery . In general, our results showed that tvm surgery is beneficial for patients with advanced pop . Although exposure may occur after surgery, exposure rate was low and easy to manage.
5-fluorouracil (5-fu) is a widely used chemotherapeutic drug and cardiac complications are not rare . However myocardial infarction, tako - tsubo - like syndrome and cardiogenic shock are also described . A 50-year - old man (weight 70 kg, height 180 cm) was admitted to a primary care hospital following an episode of syncope . He reported acute orthopnea and an attack of sweating at night accompanied by nausea and vomiting before loss of consciousness for 1 min . In the emergency room, patient developed asystole and was immediately and successfully resuscitated for 2 min . Afterwards, he was fully oriented without any neurological dysfunction . Consequently, he was transferred to our heart center for further diagnostic work - up and therapy . Importantly, patient had no previous history of cardiovascular disease or risk factors, but was diagnosed with colorectal cancer (ct3 n1 m0) and underwent recent neoadjuvant chemotherapy with 5-fu (9500 mg by continuous infusion over a period of 120 h) until 1 day before his acute presentation . His physical examination revealed hypotensive blood pressures (89/58 mmhg) and heart rate at rest of 95 bpm . The electrocardiogram documented sinus rhythm at 95 bpm with non - significant st - elevation in leads ii, iii, avf . High - sensitive troponin t (60 ng / l; upper reference value 14 ng / l) and creatine kinase - mb fraction (0.74 mol / ls; upper reference value 0.41 mol / ls) were slightly elevated . Creatinine kinase showed a normal value of 0.93 mol / ls (upper reference value 3.17 mol / ls). Initial transthoracic echocardiography (tte) showed a normal sized left ventricle (left - ventricular end - diastolic diameter: 48 mm, left - ventricular end - diastolic volume: 103 ml) with global hypokinesia and severely decreased left - ventricular systolic function [left - ventricular ejection fraction: 16%; [figure 1a and b]. Transthoracic echocardiography on day 1 (a) apical four - chamber view during diastole, (b) apical four - chamber view during systole (there is global hypokinesia with severely impaired thickening of the left ventricular wall in systole) one day after admission, patient had persistent hypotension with increasing lactate levels as a sign of peripheral malperfusion . On repeat echocardiographic examination, left - ventricular systolic function was found to have further decreased with a left - ventricular ejection fraction of <10% . Due to the progressive cardiogenic shock, we decided to treat this condition by the use of an extracorporeal membrane oxygenation (ecmo) support by percutaneous implantation . On ecmo support, hemodynamic stabilization was evident and medical heart failure treatment including angiotensin - converting enzyme - inhibitor, diuretics and spironolactone was commenced . After 4 days with ecmo therapy, left - ventricular ejection fraction improved to 45% and lactate levels were in normal ranges (<2 therefore, ecmo - flow was reduced slowly up to 1.5 l / min . Due to the stable lactate levels (<2 the following course was uncomplicated with normalization of blood pressures and no signs of heart failure . Eight days after admission, he was transferred to the normal ward . Left - ventricular ejection fraction was now recovered to a normal value of 60% [figure 2a and b]. For confirmation and further differential diagnosis cardiac, magnetic resonance imaging (mri) the mri showed a normal sized left ventricle (left ventricular end - diastolic volume: 149 ml; normal value 102 - 235 ml) with normal ejection fraction of 57% and without any specific wall motion abnormality . Furthermore, t1-weighted imaging showed pronounced early contrast enhancement, indicating some degree of myocardial hyperemia . Patient was discharged from hospital in a stable cardiac condition without symptoms of heart failure 11 days after admission . Transthoracic echocardiography on day 10 (a) apical four - chamber view during diastole, (b) apical four - chamber view during systole . This report describes a patient with no history of cardiovascular disease who experienced acute left - ventricular failure after administration of 5-fu . Cardiac complications ranging from angina pectoris to cardiogenic shock after chemotherapy with 5-fu are not rare . Coronary vasospasm, endothelial damage with consequent thrombus formation, increased myocardial oxygen demand, block of myocardial cell metabolism and tako - tsubo - like syndrome with supraphysiologic levels of plasma catecholamines are discussed as potential pathogenetic mechanisms . Our patient did not report any angina and obstructive coronary lesions were excluded by angiography . Echocardiography did not reveal an apical ballooning as common in tako - tsubo - like syndrome . The cardiac mri of our patient strengthens the concept of an additional temporary myocardial inflammation . Increased global myocardial edema and evidence of myocardial hyperemia are compatible with a regressive inflammation . Unfortunately, the mri could not be performed in the acute setting with severely decreased left - ventricular function due to ecmo - therapy and therefore, the extent of myocardial edema and hyperemia might be underestimated . Treatment of cardiogenic shock is still a therapeutic challenge, especially if coronary artery disease was excluded . Usually, sympathomimetics are used as first line therapeutics, but several disadvantages in their use have to be taken into account . Sympathomimetics induced vasoconstriction can lead to perfusion mismatch or even deficit within the microcirculation and metabolic acidosis due to an increased oxygen demand can be observed regularly . In addition, some studies give evidence that use of sympathomimetics is directly linked to enhanced systemic inflammatory response due to an increased interleukin-6 expression . In our case with unclear pathogenesis of cardiogenic shock, we decided to use a mechanical hemodynamic support (intraaortic balloon counterpulsation or ecmo) to avoid above mentioned disadvantages with the use of sympathomimetics, especially with the knowledge about inflammation as a possible cause of 5-fu induced left - ventricular dysfunction . Recently, intraaortic balloon counterpulsation was shown not to reduce 30-day mortality in patients with cardiogenic shock complicating myocardial infarction . In our case with progressive cardiogenic shock, therefore, we decided to use ecmo - the most potent form of acute cardiorespiratory support, which enables complete relief of cardiac workload and prevents high - dose usage of sympathomimetics . Cardiogenic shock should be taken into consideration as a possible complication secondary to chemotherapy with 5-fu, even in patients without a history of cardiovascular disease . To the best of our knowledge, this is the first report of an ecmo support in this kind of chemotherapeutic induced cardiogenic shock . Ecmo support enabled complete relief of cardiac workload and together with medical therapy for heart failure, complete recovery of cardiac function was possible.
A summary of methods is provided below and a detailed description of methods is included in the supplementary information . The toxin nanosponges were prepared by fusing rbc membrane vesicles on preformed poly(lactic - co - glycolic acid) (plga) nanoparticles through an established extrusion process . The size of the nanosponges was obtained from three dynamic light scattering (dls) measurements using a malvern zen 3600 zetasizer . The morphology of the nanosponges after absorbing toxins was measured by transmission electron microscopy (tem). For preparation of human rbc nanosponges, the rbcs were collected from whole human blood (bioreclamation) and the characterization results were shown in fig . Reconstitution of the lyophilized samples was performed by solubilizing the samples in water and the characterization results were included in fig . The in vitro toxin neutralization ability of the nanosponges was examined by mixing 3 g of -toxin with 200 l of 1 mg / ml nanosponges for 30 min, followed by adding into 1.8 ml of 5% purified mouse rbcs . The in vitro toxin absorption capacity of the nanosponges was determined through titrating -toxin to a fixed amount of nanosponges . The interaction of the nanosponges with cells was examined by a scanning fluorescence microscopy by incubating fluorescent nanosponges and rbc membrane vesicles with human umbilical vein endothelial cells (huvec). The in vitro cellular cytotoxicity of nanosponge - sequestered toxins was examined by incubating nanosponges of different concentrations with varied amounts of -toxin, streptolysin - o, and melittin for 30 min, followed by adding to huvecs for 24 hr . The in vivo toxin neutralization ability of the nanosponges was tested through subcutaneous injection of the nanosponge / toxin mixture to the flank region of nude mice, followed by histological analyses . On - site neutralization of -toxin by the nanosponges was conducted by subcutaneously injecting 50 l of 36 g / ml of -toxin solution, immediately followed by a 100 l injection of 2 mg / ml nanosponges . The mice were imaged 3 days later for visualization of skin lesion formation (fig s11). The in vivo detoxification efficacy was tested through intravenous injection of nanosponges before or after administration of a lethal dose of -toxin to icr mice, followed by monitoring the survival rate of the mice . For the in vivo hepatotoxicity study, one group of mice was sacrificed on day 3 following the injection of the toxin - bound nanosponges and another group was sacrificed on day 7.
Hand, foot, and mouth disease (hfmd) is a common, acute, and mostly self - limiting enteroviral infection that presents with fever and vesicular lesions on the hands, feet, mouth, and frequently buttocks as characteristic features1,2,3,4). Although patients with hfmd recover without any sequelae within about 1 week, severe complications occur in a few cases, some of which are life threatening . Severe complications accompanying hfmd include encephalitis, pulmonary edema / hemorrhage, cardiopulmonary collapse, and myocarditis1,2). Enterovirus 71 can often lead to a more severe clinical course accompanied by neurologic and cardiopulmonary complications and may rapidly lead to death1,2,3). Enterovirus 71-induced hfmd developed in korea in 2000 but it was not an epidemic and fatal until 20081,4,5). In the spring of 2009, a large nationwide outbreak of hfmd caused by enterovirus 71 occurred in korea, and a few cases with encephalitis were fatal1,4,6). A multicenter study in korea performed by the enterovirus complication working group revealed that encephalitis with cardiopulmonary complications of hfmd occurred in 2.4% of patients, including 2 patients (1.2%) who expired1). Pulmonary hemorrhage in enterovirus 71-infected hfmd patients has been reported in taiwan, china, and malaysia2,7,8,9). However, to our knowledge, no cases of hfmd with sudden - onset massive pulmonary hemorrhage have been reported in korea . Here, we report a fatal case of enterovirus 71-induced hfmd that progressed rapidly with massive pulmonary hemorrhage and convulsion . A 12-month - old, previously healthy boy with hfmd was referred to inje university ilsan paik hospital because of 3 episodes febrile convulsions . He was born at full term weighing 3.87 kg through normal vaginal delivery by a vietnamese mother . He was admitted to a primary hospital with high fever (up to 39), throat vesicles, and vesicular rashes on his hands and feet for 2 days . On the second hospital day, he had 3 generalized tonic - clonic and atonic convulsions with vertical eyeball deviation within 5 minutes of each other . His chest radiography was normal . Within 5 hours after admission, he vomited 3 times after meals . Besides a body temperature of 38.3, his other vital signs were stable and he remained conscious . Desaturation to 76% percutaneous blood oxygen saturation (spo2) and tachycardia to 176 beats / min accompanied by perioral cyanosis occurred suddenly 6 hours after admission . His respiration rate was 34 breaths / min, and auscultation disclosed rales on the whole lung field . An endotracheal tube was inserted immediately, and a large amount of blood from a pulmonary hemorrhage came out through it . Comparison of laboratory test results between his initial and pulmonary hemorrhagic status revealed that his hemoglobin decreased from 9.6 to 8.3 mg / dl and his white blood cell count increased from 13,090 to 17,450 cells/l . Erythrocyte sedimentation rate was slightly increased from 15 to 32 mm / hr, but c - reactive protein level decreased from 1.06 to 0.2 mg / dl . Prothrombin time (pt) and pt international normalized ratio were slightly prolonged (16.5 and 1.39 seconds, respectively). Meanwhile, d - dimer (2,375.91 ng / ml) and fibrin degradation product (5 - 20 g / ml) were elevated . Eight hours after admission, his blood pressure decreased to 82/41 mmhg and heart rate increased to 220 beats / min . His body temperature ranged from 38.8 to 40.2. the patient was diagnosed as fatal hfmd with massive pulmonary hemorrhage . Intravenous immunoglobulin (ivig, 1 g / kg / dose), dexamethasone (0.3 mg / kg / day in divided doses every 6 hours), and cefotaxime (150 mg / kg / day in divided doses every 6 hours) were administered immediately . In addition, leukocyte - depleted red blood cells and fresh frozen plasma were transfused, and intravenous vitamin k and endotracheal epinephrine were administered . Lumbar puncture was scheduled but was ultimately not performed because of the patient's unstable vital signs . The patient expired 15 hours after admission, and it was within 3 days of fever onset and within 9 hours after intubation . We reported it to the korea centers for disease control and prevention (kcdc), sending his urine, serum, nasopharyngeal swab, and endotracheal aspirate . Enterovirus genome detection was attempted by realtime reverse transcription - polymerase chain reaction (rt - pcr) using a taqman system (applied biosystems, foster city, ca, usa). For genotyping, seminested rt - pcr was used to amplify part of the viral protein 1 (vp1) gene of enteroviruses according to the kcdc protocol, and sequencing analysis for the vp1 amplicon was performed by an automatic sequencer and the dnastar software package (dnastar inc ., madison, wi, usa). The kcdc isolated enterovirus 71 with subgenotype c4a from the patient's serum and nasopharyngeal swab . Bocavirus was also isolated from his nasopharyngeal swab by real - time rt - pcr at our hospital . To our knowledge, this is the first reported case of hfmd with sudden - onset massive pulmonary hemorrhage in korea . Pulmonary edema / hemorrhage is the mysterious hallmark symptom of enteroviral hfmd and can kill a child within 1 day2). An epidemic study conducted in taiwan from 1998 to 2005 reported that pulmonary edema / hemorrhage occurred in 43% of patients with severe culture - proven enteroviral hfmd / herpangina2). This discrepancy maybe due to different enterovirus virulence or subgenotypes, or differences in susceptibility with respect to ethnicity . Pulmonary edema / hemorrhage is characterized by respiratory distress, tachypnea, tachycardia, hemoptysis, and rapidly progressing diffuse infiltration or congestion on a chest film2). A study on the outbreak in taiwan in 1998 reported that enterovirus 71-infected hfmd patients with pulmonary edema had suddenonset tachypnea, tachycardia, and cyanosis within 1 - 3 days after disease onset, and pulmonary edema led to a rapid death within 12 hours after intubation10). The present patient exhibited a change in consciousness, respiratory distress, tachypnea, tachycardia, hemoptysis, rapidly progressing infiltration on a chest film, hypoxemia, and hypotension . This patient ultimately expired within 3 days of fever onset and within 9 hours after intubation . In this report, we had applied pulse oxymetry from the beginning, so we could find his desaturation immediately after pulmonary hemorrhage . We suggest saturation monitoring for hfmd patients with central nervous system (cns) involvements for early detection . It may be caused by increased pulmonary vascular permeability as a result of either brainstem encephalitis or a systemic inflammatory response caused by excessive cytokine release2,6). Cns involvement of enterovirus 71-induced hfmd may also trigger a sympathetic storm, resulting in vasoconstriction with high systemic vascular resistance, passive pulmonary volume loading, and pulmonary edema / hemorrhage8). The present patient had several episodes of convulsions, lethargy, and loss of consciousness . Therefore, we suspected encephalitis, although we were unable to perform a cerebrospinal fluid study because of his unstable vital signs . His suspected encephalitis may be a possible cause of the pulmonary hemorrhage . However, pulmonary edema / hemorrhage without cns involvement occurred in 11% of patients with severe culture - proven enteroviral hfmd / herpangina in an epidemic study in taiwan from 1998 to 20052). Another possible explanation for the pathogenesis is coinfection with a second virus2), as bocavirus coinfection was detected in the patient . However, the presence of both viruses would not result in increased mortality due to hfmd, according to a previous study2). A multicenter study performed by the enterovirus complication working group investigating enterovirus 71-induced hfmd in korea in 2009 reported that an hfmd rash pattern, fever longer than 4 days, peak body temperature> 39, vomiting, headache, neurologic signs, leukocytosis, serum glucose> 100 mg / dl, and isolated enterovirus 71 may be indicative of poor prognosis during hfmd epidemic periods1,10). In addition, young age at disease onset and a history of lethargy are associated with an increased risk of severe hfmd11). The present patient was young and presented with hfmd rashes and vesicles, fever up to 39, vomiting, lethargy, and convulsions as neurologic signs as well as leukocytosis, high serum glucose level, and isolated enterovirus 71 as poor prognostic factors . Hfmd patients are very frequently approximately 1 year of age, and deaths were reported to occur at around 1 year of age in other studies12,13,14,15). In the 2009 outbreak, 2 patients around 1 year of age expired, and the present patient was a 12-month - old baby . The gold standard for the diagnosis of enteroviral infection is viral culture and isolation in 2 or more specimens of cerebrospinal fluid, blood, nasopharyngeal swab or secretion, vesicular fluid, or stool to increased diagnostic sensitivity1,4,6,11). In the present report, enterovirus 71 was isolated from both the patient's serum and nasopharyngeal swab . In the 2009 korean outbreak, the subgenotype of enterovirus 71 was c4a, which was prevalent in china in 2008 . In the present case, the subgenotype of enterovirus 71 was also c4a . The administration of high - dose ivig is recommended for severe hfmd as optional treatment, because ivig therapy was effective in many reports4,5,6,7,11). Ivig neutralizes the virus and has nonspecific antiinflammatory properties11); this would significantly reduce mortality by attenuating sympathetic activity and cytokine production5). Furthermore, fluid restriction, inotropic agents, and early intubation with positive - pressure mechanical ventilation are recommended for severe hfmd with pulmonary edema or hemorrhage8). Pulmonary hemorrhage in enterovirus 71-infected hfmd is very rare; the present case is likely the first to have occurred in korea . The present case of fatal hfmd was rapidly aggravated and the patient expired within 3 days from fever onset . Therefore, all physicians should pay special attention to infants and young children with hfmd, particularly in enterovirus 71 epidemic areas such as korea, to enable early detection and management of severe hfmd . Above all, keeping the infected child at home until full recovery and controlling the preschool with infected child are very important for reducing infection6). In addition, the development of antiviral agents and vaccines is necessary especially for the control of severe hfmd with complication.
Since the increase in adiposity is related to general poor health factors such as an increase in type ii diabetes and increased incidence of coronary heart disease, exercise to reduce adiposity is recommended for the ageing population . A further consequence of the ageing process is that elderly individuals have an impaired ability to oxidise fatty acids, particularly after a meal . Since most individuals eat a meal prior to exercise in order to provide some form of sustenance, what should the meal contain if the exercise priority is to burn fat? Generally, a high - fat, low - cho meal increases fat oxidation during subsequent exercise [46], whereas the ingestion of cho before exercise depresses the rate of fat oxidation due to hyperinsulinemia in the postprandial period . Altering the type of cho consumed has been shown to have an effect on the magnitude of hyperinsulinemia and depression of fat oxidation [8, 9] postprandial increases in glucose and insulin concentration promote cho oxidation, resulting in decreased fatty acid oxidation . Wu et al . Found that the amount of fat oxidised was significantly higher during exercise commencing 3 h after consuming a low glycemic index (lgi) meal compared with a high glycemic index (hgi) meal . They also demonstrated that the hgi meal resulted in a greater glycemic and insulinemic response during the postprandial period compared with lgi meal . This is supported by stevenson et al . Who investigated the metabolic responses to hgi and lgi mixed meals after 60-minute exercise at 70% vo2max and found that significant differences in hyperglycemia and hyperinsulinemia can be achieved repeatedly by changing the glycemic index (gi) of the cho in a mixed meal . They observed that the amount of fat oxidised during the postprandial period following lunch was significantly higher in the lgi than the hgi trial . Thus, at least for several hours postprandial, both at rest and during exercise, fat utilisation is depressed after hgi compared with lgi meals . The effects of different meals (high fat, hgi, and lgi) on fat and cho metabolism at rest and during exercise in young subjects have been extensively studied, although this is not the case for elderly individuals . As mentioned previously, it is an important health benefit for the elderly to engage in some form of aerobic exercise for improvements in the cardiovascular system and to reduce body fat . Therefore, the present study was designed to investigate the effects of four different types of meals (normal, high - fat, hgi, and lgi) on fat and cho metabolism during exercise in elderly male subjects . Eight healthy males (mean sd, age 63.3 5.2 years, height 168 0.05 cm, body mass 78.1 14.0 kg, body fat 21 5.3%, and vo2 max 36.9 10.4 mlkgmin) gave informed written consent to participate in the study after gaining approval from the human ethics committee of liverpool john moores university . Blood pressure (dinamap pro series, ge medical systems, florida) was determined prior to performing any exercise as a screening for hypertension . Participants reported to the laboratory on five separate occasions . In the first session they were familiarised with the laboratory environment and physiological testing equipment . Height, body mass, and percent of body fat using dxa were also determined during this session . After familiarisation, vo2 max was determined on a cycle ergometer as described previously . After initial physiological measurements, participants reported to the physiology laboratory on four separate occasions, each of which was allocated for the performance of a 30-minutes exercise on a cycle ergometer at 60% vo2 max after having a high fat (hf), high carbohydrate hgi (hgi), high carbohydrate low lgi (lgi), and normal (n) meal . The rationale for 30-minutes exercise reflects a typical aerobic bout of exercise undertaken by such persons in a gym session and is recommended for health purposes . The four meals were given to subjects in a counterbalanced design and sessions were separated by at least 3 days . To avoid circadian variation, experiments were always performed at the same time of day (08:00 am) after an overnight fast . Participants completed a 2-day food diary on the day before their first test and were asked to repeat this diet before all subsequent trials . In addition, subjects were requested to refrain from drinking alcohol, nor to engage in any kind of strenuous exercise 24 hours before trials . Participants reported to the physiology laboratory after an overnight fast and remained seated for 20 minutes . After this rest period, blood pressure was checked and a blood sample (10 ml) was taken . They then consumed one of the meals which were provided in a random, counterbalanced order within 2030 minutes . At 3 h 20 min after the meal, subjects started the exercise protocol that included a 30-minutes cycling at 60% vo2 max . Two more venous blood samples were taken, immediately before exercise (3 hours after the meal), and immediately after exercise in each session . Oxygen consumption (vo2), carbon dioxide output (vco2), and respiratory exchange ratio (rer) were measured breath by breath throughout the exercise . Participants were provided with one of the four following isoenergetic test meals: (1) and (2) hgi and lgi: 65% carbohydrate, 20% fat, and 15% protein, (3) hf: 65% fat, 20% carbohydrate and 15% protein, or (4) n: 50% carbohydrate, 35% fat, and 15% protein . The glycaemic index values for hgi and lgi were 74.32 and 29.26, respectively . Before the meal, immediately before exercise and immediately after exercise venous blood samples were drawn in a seated position in each session . Two microhaematocrit tubes (l. i. p. shipley, england) and two -haemoglobin microcuvettes (hemocue ab, ngleholm, sweden) were filled with whole blood for determination of haematocrit and haemoglobin, respectively . Plasma was obtained by collecting the blood sample into tubes that had been pretreated with an anti - coagulant (lithium heparin). These samples were mixed and immediately centrifuged at 4c for 15 minutes at 1900 g. after centrifugation, plasma was separated and stored at 70c for the subsequent analysis of glucose, glycerol, nonesterified fatty acids (nefas), and b - hydroxybutyrate (3-ohb). The blood was stored at room temperature for 30 minutes before centrifuged at 20c for 15 minutes at 2000 g. serum was stored at 70c for subsequent analysis of insulin . Nefa, glucose, glycerol, and 3-ohb were analysed using appropriate kits on ilab 300 analyser (il instrumentation laboratories, warrington, uk). Insulin was assayed by elisa (drg instruments gmbh, germany) using a fully automated system (triturus, grifols, cambridge, uk). Insulin resistance (homa2-ir) and -cell function (homa2% b) in fasting state were determined using a homeostasis model assessment (homa - ir) and were calculated from fasting insulin and fasting glucose . All statistical analyses were performed using the software statistical package spss version 12 (chicago, usa). One - way anova was employed to evaluate differences in the resting mean values of all the variables measured over the four testing occasions . In addition, fat and cho oxidations values during exercise for four trials were compared using one - way anova . A two - way anova (4 3) with repeated measures across meals (4 levels) and conditions (3 levels) was employed to examine the differences in mean values for blood parameters . When anova indicated the presence of a significant difference, post hoc comparisons using the bonferroni method were applied to determine pairwise differences . No significant main effect of the meals was observed for rates of fat oxidation (f3,21 = 1.8; p = .177), although fat oxidation was demonstrably, but nonsignificantly, higher after hf (0.26 0.04 g / min) than n (0.21 0.04 g / min), hgi (0.22 0.03 g / min), and lgi (0.19 0.03 g / min). The rates of carbohydrate oxidation during exercise were 1.79 0.28, 1.58 0.22, and 1.68 0.22, 1.77 0.21 g / min for n, hf, hgi, and lgi, respectively . Statistical analysis revealed no significant effect of meal on the rate of carbohydrate oxidation during exercise . Statistical analysis showed a significant main effect of the meal on nefa concentration (f3,21 = 39.2; p = .001). Pairwise comparisons revealed a significant difference between nefa responses to n and hf (p = .02) as well as between hgi and lgi meals (p = .003). Pre - exercise nefa concentration increased significantly following hf (from 0.39 0.08 to 0.61 0.08 mmol / l) and decreased significantly after eating hgi (from 0.44 0.09 to 0.13 0.02 mmol / l) and lgi (from 0.55 0.08 to 0.27 0.07 however, nefa concentration increased significantly in response to exercise only after hgi (from 0.12 0.02 to 0.36 0.09 mmol / l) and lgi (from 0.27 0.06 to 0.64 0.18 figure 1 highlights data from nefa . A significant effect of meal was found for glycerol concentration (f3,21 = 9.7; p = .001). Pairwise comparisons revealed a significant difference between hf and hgi (p = .01). Resting glycerol values were increased significantly after all meals except for hgi (figure 2). Moreover, glycerol concentration increased significantly during exercise after all types of meals (figure 2). The statistical analysis revealed a significant effect of the meal on 3-ohb (f3,21 = 3.6; p = .03). However, pairwise comparisons did not show any significant difference among the four meals . Resting 3-ohb concentration a significant effect of meals on glucose concentration was found (f3,21 = 39.2; p = .001). Postprandial glucose concentration increased following all meals, though the changes were not statistically significant (figure 4). However, glucose concentration decreased significantly (p <.05) from 5.36 0.25 to 4.65 0.08 mmol / l during 30 minutes of exercise after hf and lgi, respectively . Although anova did not show a main significant effect of either meal or time on insulin concentration, the pre - exercise insulin concentration (18.9 1.7 u / ml) in hgi trial was significantly (p <.05) higher than resting values (15.2 1.1 u / ml). In addition, insulin concentration decreased significantly during exercise after n, hf and hgi (figure 5). The mean (se) resting value of homa2-ir (insulin resistance) for all subjects was 0.76 0.06 and that for homa2- (-cell function) was 78.5 69 . These resting values are indicators of normal insulin resistance and -cell function in our elderly subjects . The present study is the first study designed to investigate the effects of pre - exercise mixed meals on fat and carbohydrate metabolism during exercise in elderly individuals, and its principle finding was that in spite of some changes in fat metabolites, the composition of the meal did not result in differences in cho and fat oxidation . These results are in contrast to the data reported by previous studies in young subjects that observed a rise in fat oxidation after hf due to increases in fatty acid (fa) availability and mobilization [4, 6, 15, 16]. Moreover, a depression in the rate of fat oxidation following cho ingestion, attributed to hyperinsulinaemia, has also been observed in the postprandial period [79]. Availability and utilisation of plasma fa decreases after a cho meal partly because the cho - induced rise in insulin inhibits the mobilisation and availability of circulating fa, which reduces fat oxidation possibly by inhibiting the rate of long - chain fatty acids entry into the mitochondria for -oxidation [17, 18]. Despite cho - induced hyperinsulinemia and suppression of fa after cho ingestion, our results show that the cho oxidation was resistant to alteration during exercise in elderly males . Several mechanisms, including impaired insulin - stimulated glucose uptake, may have contributed to these results . Having said that, it should be noted that the homa scores indicate normal insulin resistance and -cell function for these elderly participants . The increased release of fas in older individuals, in excess of the energy needs and/or oxidative capacity of respiring tissues, increases the amount of non - oxidised fas . Excess non - oxidised fas with age may have several adverse metabolic effects including increased glucose production and impaired insulin - stimulated glucose uptake . Fas exert their effects through inhibition of pdh with subsequent increased intracellular concentration of glucose-6-phosphate and inhibition of hexokinase, which decreases glucose uptake . Another factor that may contribute to impaired glucose uptake with ageing is inhibition of glucose transport either due to less availability of the glut-4 transporters or, to the signalling processes for glut-4 vesicle translocation to the plasma membrane . These considerations need further exploration . Although after the hf meal, nefa, and glycerol concentrations were higher than for the other meals, the fat oxidation rates during exercise were not different . Evaluation of skeletal muscle samples has revealed that maximal mitochondrial oxidative enzyme activity is lower in older than in young subjects because of both decreased mitochondrial volume density and mitochondrial function . Lower activity of enzymes such as ampk, camp, and protein kinase c in elderly individuals results in activation of acc (acetyl - coa carboxylase). Activation of acc leads to an increase in concentration of malonyl - coa which has an inhibitory effect on cpt - i, thereby inhibiting the entry of long chain fatty acids into mitochondria and resulting in lower fa oxidation . Lack of changes in fat oxidation after hf was found in spite of increased lipolysis . It has been demonstrated that relative to the energy needs of the body, fa release is not impaired in the elderly . In fact, fas are released in excess of energy needs in older individuals when compared to younger controls . Thus, when considered relative to the energy demands of the body or the metabolically active tissue mass, ageing is not associated with impaired fa release which supports our findings for lipolysis . A higher rate of fat oxidation during submaximal exercise after ingesting lgi foods has been reported in young healthy males when compared to hgi [9, 11]. In terms of the effect of gi, the results of the present study were somewhat unexpected since the calculated amount of fat oxidation during 30 minutes of cycling commencing 3 hour after consuming hgi and lgi meals was not significantly different . One possible explanation for this discrepancy might be the impaired glucose uptake associated with ageing as previously discussed . In the present study, postprandial nefa concentration was increased after hf, which is in agreement with previous studies on young participants [6, 9]. The increase in plasma nefa concentration which occurred might be a result of tag hydrolysis by endothelial lipoprotein lipase (lpl). Both hgi and lgi resulted in suppression of nefa concentrations 3 hours after the meal consumption . However, nefa concentrations at the end of 30-minutes cycling in both hgi and lgi trials were raised to pre - meal levels . Higher post - exercise nefa is typical response to exercise - induced decrease in insulin and increase in catecholamines . The lack of a significant increase in glycerol after hgi might be due to the enhanced secretion of insulin following the hgi meal which would activate the enzyme lpl in adipose tissue . The insulin activation of lpl serves to increase tag uptake and storage after a single meal which eventually results in lower glycerol concentration . Studies in young subjects during low and moderate intensity exercise have demonstrated that increased blood glucose availability suppresses fat utilisation by inhibition of both fat mobilisation and fat oxidation within muscle [7, 18]. Postprandial glycerol concentration was significantly higher after hf than hgi and lgi in elderly subjects which reflects the lack of insulin response to hf in comparison to the other meals . These findings are in agreement with those of whitley et al . And murphy et al . Who reported increases in glycerol after hf in young participants . The present study demonstrated that in elderly individuals feeding isoenergetic meals containing different proportions of carbohydrate and fat alters the metabolic variables at rest and during subsequent exercise . Energy regulation during 30 min of cycling in elderly individuals following isoenergetic meals is associated with a relative increase in fat oxidation and a decrease in carbohydrate oxidation following hf and a corresponding increase in cho oxidation and a decrease following high carbohydrate (low fat) meals . Therefore, based on these finding, it could be concluded that fat and carbohydrate metabolism in elderly individuals in response to different meals at rest and during subsequent exercise are to some extent different from those of young individuals and further studies are warranted to investigate the mechanism / s responsible especially in relation to insulin action and sensitivity . What we can state is that, on balance, eating any type of meal 3 hours prior to a 30-minutes bout of exercise is unlikely to significantly impact on so - called fat burning in healthy elderly males.
Physical fitness is the ability that helps people to adapt with their environmental conditions and plays an important role in daily activities . It is highly associated to one's health status and has a striking effect on the quality of life, learning and working efficiency, and physical activity contributions . Physical fitness is composed of performance - related physical fitness and health - related physical fitness . Indeed, genetic somehow determines physical fitness, but environmental factors including physical activity levels, socioeconomic status, television viewing, and anthropometric factors highly modify it . Since fitness level drops with aging, physical involvement should be highly suggested . However, inactive life affects body muscle and functioning ability negatively, and people are vulnerable to chronic diseases as consequences . A higher quality of life can be obtained through moderate exercises to develop or maintain physical fitness . Lamb declared that individuals can successfully cope with challenges in their life via optimal physical fitness . Physical training program can be effective for athletes and nonathletes in different ages to improve aerobic power, muscle strength, anaerobic power, jumping ability, and local muscle endurance . Additional strength training and plyometric training in 912-year - old soccer players for 2 years showed a significant improvement of motor performance factors . Mini - trampoline exercises may need higher levels of involvement in the muscles of lower extremities . Since mini - trampoline exercises comprise a multicomponent approach, numerous physical factors including strength, body stability, muscle coordinative responses, joint movement amplitudes, and spatial integration can be affected positively . . Indicated not only balance and strength improvement but also muscular imbalances equalization of the two limbs due to mini - trampoline training . . Showed improvement in motor performance of participants with intellectual disabilities after applying trampoline training intervention . However, rebounding exercise for 11 weeks revealed minimal cardiorespiratory fitness improvement and no significant body composition changes in 17 sedentary women . Very few studies were conducted to detect specific contributions derived from trampoline exercise as a different training model approach . Therefore, the purpose of this study was to examine the effect of trampoline training intervention on anthropometric variables and physical fitness components of 1114-year - old male students, iran . Thirty - eight healthy school - aged male students (mean age: 12.6 years, standard deviation: 2.1) were selected randomly from the junior high schools of ardabil, iran . They were divided into two groups of 19 students based on gender, residential school, and no trampoline training experience . The first five students were omitted as they had prior experience, and the second five students were excluded because they had failed to attend the exercise sessions consistently [figure 1]. The study protocol received approval from the ethics committee of the university of urmia, and it was in accordance with the declaration of helsinki (last modified in 2000). Flow chart of the progress through the phases of the study according to the consort statements evaluation process of participants was conducted within a 2-day period by the same researcher . The 1 day was assigned to anthropometric measurement and the 2 day for motor ability tests . Anthropometry and motor ability of the participants were measured before and after the 20 weeks trampoline training intervention ., crymych, dyfed, uk) and weight (model ds-410, seiko, tokyo, japan) were assessed to the nearest 10 mm and 0.1 kg respectively, and body mass index was calculated using following formula: weight (kg)/(height [m]). Moreover, lower extremity girths including thigh and calf were measured on the right side of each participant . Skinfolds thickness was measured at three body sites (triceps, subscapula, and suprailiac) with a harpenden skinfold caliper . Participants in experimental group trained 20-week, 1.5 h / session with 10 min rest, in 4 times trampoline training programs per week . Although none of the students had balance problems, some important safety guidelines were considered to prevent the possibility of injury . All participants were instructed to perform variety of movements with eyes opened including one foot and two - foot jump, hop with rotation in different directions, hand and toe contacts in the air, and alternate sit and stand movement . The instructor started to teach forward and backward somersault when participants were familiar with spatial awareness, spatial orientation, and body control after performing all of the mentioned movements . Finally, students were asked to combine individual movements and execute them as a routine throughout the training sessions . However, participants in the control group only participated in school physical education classes 2 times / week for 45 min . Motor ability of all participants was assessed after a short period of warm up using standing long jump and vertical jump based on eurofit test battery . Each participant standing reach height, tip of middle finger in the hand closest to the wall while participant stood side on to the wall, was marked . Then, participant used both arms and legs contributions to project the body as high as possible while standing away from the wall . The standing reach height and the jump height difference were the score . Each participant stood behind the marked line on the ground with swinging arms and bending knees . The take - off was done when the arms reached forward to lead participant as far as possible . A two - way repeated measures analysis of variance (anova) (condition trial) with repeated measures on both factors was used . To further analyze the responses of the groups thirty - eight healthy school - aged male students (mean age: 12.6 years, standard deviation: 2.1) were selected randomly from the junior high schools of ardabil, iran . They were divided into two groups of 19 students based on gender, residential school, and no trampoline training experience . The first five students were omitted as they had prior experience, and the second five students were excluded because they had failed to attend the exercise sessions consistently [figure 1]. The study protocol received approval from the ethics committee of the university of urmia, and it was in accordance with the declaration of helsinki (last modified in 2000). Flow chart of the progress through the phases of the study according to the consort statements the 1 day was assigned to anthropometric measurement and the 2 day for motor ability tests . Anthropometry and motor ability of the participants were measured before and after the 20 weeks trampoline training intervention ., crymych, dyfed, uk) and weight (model ds-410, seiko, tokyo, japan) were assessed to the nearest 10 mm and 0.1 kg respectively, and body mass index was calculated using following formula: weight (kg)/(height [m]). Moreover, lower extremity girths including thigh and calf were measured on the right side of each participant . Skinfolds thickness was measured at three body sites (triceps, subscapula, and suprailiac) with a harpenden skinfold caliper . Participants in experimental group trained 20-week, 1.5 h / session with 10 min rest, in 4 times trampoline training programs per week . Although none of the students had balance problems, some important safety guidelines were considered to prevent the possibility of injury . All participants were instructed to perform variety of movements with eyes opened including one foot and two - foot jump, hop with rotation in different directions, hand and toe contacts in the air, and alternate sit and stand movement . The instructor started to teach forward and backward somersault when participants were familiar with spatial awareness, spatial orientation, and body control after performing all of the mentioned movements . Finally, students were asked to combine individual movements and execute them as a routine throughout the training sessions . However, participants in the control group only participated in school physical education classes 2 times / week for 45 min . Motor ability of all participants was assessed after a short period of warm up using standing long jump and vertical jump based on eurofit test battery . Each participant standing reach height, tip of middle finger in the hand closest to the wall while participant stood side on to the wall, was marked . Then, participant used both arms and legs contributions to project the body as high as possible while standing away from the wall . The standing reach height and the jump height difference were the score . Each participant stood behind the marked line on the ground with swinging arms and bending knees . The take - off was done when the arms reached forward to lead participant as far as possible . . A two - way repeated measures analysis of variance (anova) (condition trial) with repeated measures on both factors was used . To further analyze the responses of the groups anthropometric and physical fitness variables of the two groups are reported in tables 1 and 2 . The anova repeated measurement test showed a statistically significant main effect of time in calf girth p = 0.001, fat% p = 0.01, vertical jump p = 0.001, and long jump p = 0.001 . The anova repeated measurement test revealed a statistically significant main effect of group in fat% p = 0.001 . Characteristics of the study participants differences between pre- and post - training of anthropometric and physical fitness indicators in the trampoline and control groups post hoc paired t - tests indicated statistical significant differences in trampoline group between the two measurements about calf girth (t = 4.35, p = 0.001), fat% (t = 5.87, p = 0.001), vertical jump (t = 5.53, p = 0.001), and long jump (t = 10.00, p = 0.001). Post hoc paired t - tests showed statistical significant differences in control group between the two measurements concerning calf girth (t = 5.67, p = 0.001), vertical jump (t = 3.88, p = 0.002), and long jump (t = 4.22, p = 0.001). The analysis of independent t - test (pre- to post - subtraction between two groups) indicated significant differences in fat% p = 0.001, high jump p = 0.02, and long jump p = 0.02 . This study investigated whether anthropometric measures and motor performance components are changed via trampoline training considering that this is the first study in a relatively longer period . Since athletes increase metabolism through practice, our finding indicated significant changes of body fat% as a result of trampoline training that is not consistent with the findings of edin et al . Indeed, no significance changes of body composition variables in the study of edin et al (1990) may be attributed to the 11 weeks exercise that is limited in terms of training period compared to our study . Although trampoline exercises are not basically aerobic, long - term training program made significant changes in body fat% between the two groups . Lower limb characteristics such as thigh girth and calf girth were improved considering pre - test and post - test differences . However, we found no significant difference between experimental and control group in this regard . The improved lower limb muscle sizes are related to participant's growth process, and trampoline training has no significant effect on the hypertrophy of lower limb muscles . (2011) reported balance improvement due to mini - trampoline exercises in elderly participants . (2013) indicated improvement in motor performance of participants with intellectual disabilities after applying trampoline training intervention . Our findings are in agreement with those studies in this regard and showed significant improvement of jumping ability in healthy trampoline participants compared to control group . This improvement can be attributed to the higher amount of biomechanical stimuli with jumping on a trampoline compared to other forms of activity like running . Furthermore, body segments coordination due to training programs can help participants to use the ideal motor patterns for performing jumping tests . Trampoline training stimulates proprioceptive sense that can facilitate motor performance and prevent musculoskeletal injuries as a result of sudden fall in life . Since the nature of this training intervention is recreational, people in different ages can be involved to promote the quality of their life . Based on these finding, we can conclude that a 20-week trampoline training with four physical activity sessions / week in 1114-year - old students seem to have a significant effect on body fat% reduction and effective results in terms of anaerobic physical fitness . Therefore, it is suggested that different training model approach such as trampoline exercises can help students to promote the level of health and motor performance.
Optical buffers are recognized as essential components in wavelength routers, in which the packets of data can be stored for resolving packet contention problems and also delay the outgoing packets.1,2 in practice, the optical router patents have been proposed and recorded,35 which can be useful for various applications . Recently, the promising techniques of microscopic volume trapping and transportation within the add / drop multiplexer have been reported in both theory6 and experiment,7 respectively, in which the transporter is known as an optical tweezer . Here, the optical tweezer generation technique has become a powerful tool for the manipulation of micrometer - sized particles . To date moreover, the use of dynamic tweezers is now also understood in practical works.810 schulz et al11 have shown that the transfer of trapped atoms between two optical potentials can be performed . In principle, optical tweezers use forces exerted by intensity gradients in the strongly focused beams of light to trap and move the microscopic volumes of matters, in which the other combination of force is induced by the interaction between photons, which is caused by photon scattering effects . In application, the field intensity can be adjusted and tuned, in which the desired gradient field and scattering force can form the suitable trapping force . Hence, the appropriate force can be configured for the transmitter / receiver, which can perform the long distance microscopic transportation . In this paper, dynamic optical tweezers / vortices are generated using a dark soliton, bright soliton, and gaussian pulse propagating within an add / drop optical multiplexer incorporating two nanoring resonators (panda ring resonator). The dynamic behaviors of solitons and gaussian pulses are well described by tasakorn et al.12 by using the proposed system, the transceiver can be integrated and performed by using a single device . Here, the use of the transceiver to form the transportation of microscopic volumes of matter, especially13 for molecule transportation in liquid core waveguide,14,15 drug delivery, and dna transportation, in which the buffer is needed before reaching the required destination . In operation, the trapping forces are exerted by the intensity gradients in the strongly focused beams of light to trap and move the microscopic volumes of matters, in which the optical forces are customarily defined by the relationship:16 (1)f = qnmpc here q is a dimensionless efficiency, nm is the refractive index of the suspending medium, c is the speed of light, and p is the incident laser power, measured at the specimen . Q represents the fraction of power utilized to exert force . For plane wave incidences on a perfectly absorbing particle because biological specimens are usually contained in aqueous media, the dependence of f on nm can rarely be exploited to achieve higher trapping forces . Increasing the laser power is possible, but only over a limited range due to the possibility of optical damage . It depends upon the numerical aperture (na), laser wavelength, light polarization state, laser mode structure, relative index of refraction, and the geometry of the particle . Furthermore, in the rayleigh regime, trapping forces decompose naturally into two components . Since, in this limit, the electromagnetic field is uniform across the dielectric, particles can be treated as induced point dipoles . The scattering force is given by:16 (2)fscatt = nmsc, (3)=83(kr)4r2(m21m2 + 2)2 here is the scattering cross section of a rayleigh sphere with radius r. s is the time averaged poynting vector, n is the index of refraction of the particle, m = n / nm is the relative index, and k = 2nm/ is the wave number of the light . The scattering force is proportional to the energy flux and points along the direction of the propagation of the incident light . The gradient field (fgrad) is the lorentz force acting on the dipole induced by the light field . It is given by:16 (4)fgrad=2e2,where (5)=nm2r3(m21m2 + 2)is the polarizability of the particle . The gradient force is proportional and parallel to the gradient in energy density (for m> 1). The stable trapping requires that the gradient force is in the direction, which is against the direction of incident light (dark soliton valley). It is greater than the scattering force . By increasing the na, when the focal spot size is decreased, the gradient strength is increased,16,17 which happens within a tiny system, for instance, a nanoscale device such as the nanoring resonator . In our proposal, the trapping force is formed by using a dark soliton, in which the valley of the dark soliton is generated and controlled within the panda ring resonator by the control port signals . In this paper, we used the same theory of optical trapping and ring resonator, in which the simulation results and applications are differed from the previous work.18 from figure 1, the output field (et1) at the through port is given by:19 (6)et1=aei1bei2el2jknl2 [cet1(el2jknl2)2+dei2(el2jknl2)31f(e2ljknl2)2]where a (11)(12),b (11)(12)1(12)e0l, c 1(11)(12)2e0e0l, d (11)(12)1(11)2(12)e0e0l2, andf (11)(12)(11)(12)e0e0l . (11)(12)1(12)e0l, 1(11)(12)2e0e0l, (11)(12)1(11)2(12)e0e0l2, and (11)(12)(11)(12)e0e0l . Here, et and ed represent the optical fields of the through port and drop ports, respectively . = kneff is the propagation constant, neff is the effective refractive index of the waveguide, and the circumference of the ring is l = 2r, where r is the radius of the ring . 1 and 2 are the coupling coefficients of the add / drop filters, kn = 2/ is the wave propagation number for in a vacuum, and the waveguide (ring resonator) loss is = 0.5 dbmm . The fractional coupler intensity loss is = 0.1 . In the case of the add / drop device, the nonlinear refractive index does not affect the system, therefore, it is neglected . The electric fields e0 and e0l are the field circulated within the nanoring at the right and left side of add / drop optical filter . The power output (pt1) at through port is written as: (7)pt1=\|et1\|2 . The output field (et2)at drop port is expressed as:19 (8)et2=(12)(12)ei2 [(11)(12)12e0ei1el2jknl2+xe0e0lle2i(el2jknl2)21ye0e0l(e2ljknl2)2],where x (12)(11)(11)2(12),y = (11)(12)(11)(12) (12)(11)(11)2(12), (11)(12)(11)(12) the power output (pt2) at drop port is: (9)pt2=\|et2\|2 . In operation, the optical tweezers can be trapped, transported, and stored within the panda ring resonator and wavelength router, which can be used to form the microscopic volume (molecule) transportation and drug delivery via the waveguide,18 in which the manipulation of trapped microscopic volumes within the optical tweezers has been reported . Molecular buffers are devices that can be used to store or delay atoms / molecules for a period of time (see figure 2), where light intensity and velocity can also be controlled, which was described by rosenberry et al20 and lignie and woerdman,21 available for medical application . Molecular buffers are a new device, which are operated in the same way as gas buffers.22 the polarizability of the particle is calculated by using equation (5), in this case, we assume that the sphere particle is polystyrene (n = 1.5894) and the liquid medium is water (n = 1.33), and the optical power which is required to trap particles of a certain size / polarizibility is 9.1w, which is the slope as shown in figure 3a . In simulation, the bright soliton with center wavelength at 1.50 m, peak power 2w, pulse 35fs is input into the system via the input port, and the coupling coefficients are given as 0 = 0.5, 1 = 0.35, 2 = 0.1, and 3 = 0.35, respectively . The ring radii are radd = 10 and 30 m, rr = 50 and 100 nm, and rl = 50 and 100 nm, respectively . To date, the evidence of a practical device with a radius of 30 nm has been reported by piyatamrong et al.19 aeff are 0.50, 0.25, and 0.25 m . In this case, the dynamic tweezers (gradient fields) can be in the form of bright solitons, gaussian pulses, and dark solitons, which can be used to trap the required microscopic volume . There are four different center wavelengths of tweezers generated; the dynamical movements are seen in figure 4, where (a) \|e1\|, (b) \|e2\|, (c) \|e3\|, (d) \|e4\|, (e) through port, and (f) drop port signals, where in this case all microscopic volumes are received by the drop port . In practice, the fabrication parameters which can be easily controlled are the ring resonator radii instead of the coupling constants . The important aspect of the result is that the tunable tweezers can be obtained by tuning (controlling) the add (control) port input signal, in which the required amount of microscopic volume (atom / photon / molecule) can be obtained and seen at the drop / through ports, otherwise they propagate within a panda ring before collapsing / decaying into the waveguide . More results of the optical tweezers generated within the panda ring are shown in figure 5, where in this case, the bright soliton is used as the control port signal to obtain the tunable results . The output optical tweezers of the through and drop ports with different coupling constants are as shown in figure 5a, while the different wavelength results are as shown in figure 5b, which can be performed by the selected targets . In application, the trapped microscopic volumes (molecules) can move into the wavelength router via the through port, while the retrieved microscopic volumes are received via the drop port (connecting target). The advantage of the proposed system is that the transmitter and receiver can be fabricated on - chip and alternatively operated by a single device . The magnitude of the optical trapping force is the pico newton, which depends upon the relative refractive index of particle, which was given by kumar et al.23 the particle radius was given by hu et al,24 fischer and srensen,25 and nieminen et al,26 which is located in the cavity . We have proposed a new system that can be used to trap (delay) and transport molecules into an optical waveguide by using optical tweezers, which can be used for drug storage and as a delivery system . By utilizing the reasonable dark soliton input power, the dynamic tweezers can be controlled and stored (delayed) within the system before reaching the final destination . Tweezer amplification is also available by using the nanoring resonators, in which the signals can be modulated via the control port as shown in figures 4b and 5a . In conclusion, we have shown that the use of a transceiver for long distance microscopic volume by using the proposed system, in which the drug delivery or molecular communication can be performed via the wavelength router to the required (connecting) targets . However, the problems of large microscopic volume and neutral matter may cause a problem, in which the pursuit of new guide pipes and media,27 for instance, nano tubes and specific gases, will be the issue of investigation.
Assessment of effects of different assisted reproductive techniques (art) like in vitro fertilization (ivf) and intra cytoplasmic sperm injection (icsi) on speech and language development needs comprehensive studies . Some studies showed that they are more susceptible to cerebral palsy which causes speech and language defects . Development of speech and language consists of four periods: prelinguistic, linguistic, school and adolescence period . Defects in prelinguistic behavior, i.e. Physical defect like cleft palate, neurological defect like cerebral palsy or developmental defect like down syndrome produce speech defects . In two studies in belgium and finland in infants of art there was no difference between development of these children with infants of normal conception[5, 6]. In another study no differences in mental, motor, social and expressive language development were found, and while receptive language development was in the normal range, ivf infants scored lower than control infants . One study did not report any excess of neurodevelopmental disorders in ivf / icsi children . The majority of studies followed the children during infancy, thereby precluding pertinent conclusion on the risk of neurodevelopmental disorders which express at older ages such as fine manipulation disability or dyslexia . One study shows that a large proportions of preterm deliveries in ivf children have increased risk of cerebral palsy . Regarding the importance of this subject and the lack of a comprehensive study on the prelinguistic behavior of infants of art in iran, this study was designed . The aim of this study is to evaluate prelinguistic behavior of 9 month old art infants of royan institute . In this descriptive, cross sectional study, 151 term infants of art from royan institute have been evaluated in children's health and development research center of tehran from august 2007 until august 2009 . The research ethics committee of the academic center of education, culture and research (acecr) and royan institute approved the study . The sampling method was non random sequential with the inclusion criteria of infants conceived through one of the art methods (ivf / icsi), born in term and being resident in tehran . Preterm born infants were excluded . After signing of research consents by parents, prelinguistic behavior of 151 infants who were born full term (> 37 weeks) are assessed . This scale is used for assessment of development of speech and language in children from birth to 3 years old . It has sensitivity of 90 - 95% for primary detection of speech, language and cognition defects . The method of art, sex of infants, age of mother at pregnancy, time and speech and language defect of parents at present and past time also were mentioned in questionnaire . The prelinguistic behavior of infants include: crying at birth, different cries, smiling, cooing, babbling, reduplicated babbling and echolalia, which are assessed in this study . One - hundred one term infants of art were evaluated . In this study, 76 (50.5%) were male and 75 (49.5%) female . There was 129 (85.4%) of infants conceived by icsi and 22 (14.5%) by ivf . Prelinguistic behavior delay which had been assessed according to elm-2 is shown in table 1 . Number of infants with delay in reduplicated babbling in icsi method was more than un ivf . Prevalence of prelinguistic behavior delay in assisted reproductive techniques methods ivf: invitro fertilization; icsi: intra cytoplasmic sperm injection the prelinguistic behavior delays in different sex and mothers age is shown in table 2 . There was a significant difference only in echolalia delay in the two sexes . Prevalence of prelinguistic behavior delay in different sexes and mothers age mothers of 118 infants were younger than 35 years and 33 ones were older . Two studies showed that art infants had normal cognition development [11, 12]. Zhu jl in showed that infertility treatment, especially icsi, may be associated with a slightly delayed cognitive language development . Another study showed that there was no difference between cognitive development of infants of art and normal infants . In this study infants showed delay in reduplicated babbling and echolalia . In a study by sutcliffe children were assessed with the griffiths mental development scales . Icsi children were around the midpoint for the griffiths scales and did not differ significantly for griffiths quotients and suhquotients . One study reported significantly lower mental scores in 1 year old infants born after icsi than in age matched infants born after ivf and naturally conceived infants . Stratification for gender revealed that lower mental development index scores were only found in boys, not in girls . In our study delay of reduplicated babbling and echolalia were more in boys . There is no study about effect of mother's age on speech and language development in infants . Bonduelle and his collegues in their study, by selection of infants of mothers with the same age exclude affect of this variable . In our study delay of reduplicated there was no relation between speech and language defect of parents and prelinguistic behavior of infants . Limited sample size, difficult access to this group of infants and unwillingness of parents to complete the questionnaires render less reliable results . This study was a new study in our country which shows differences between art infants in some prelinguistic behavior such as reduplicated babbling and echolalia . This study showed that prelinguistic behavior of art infants are affected by art method, infants sex and mother's age at the time of pregnancy . Detection and correction of any defect or delay in this period prevent major speech and language problems . More studies with larger sample size to compare art infants with infants of normal conception would be desirable.
A number of drugs are currently available to treat malaria; however, treatment is becoming complicated by drug resistance, toxicity, and high cost . Recently, drug resistance against the new effective drug, artemisinin, is also emerging [4, 5], and we need new effective drugs to treat malaria . Therefore, the development of other classes of effective antimalarials, especially compounds that act against novel biochemical targets, is required . To develop such compounds, it is very important to characterize the structural and biochemical features of new drug targets . Among potential new targets for antimalarial chemotherapy proteases are druggable targets, and at present protease inhibitors are now licensed as well as in clinical development to treat different diseases for example osteoporosis, diabetes, cancer, hypertension, and infectious diseases [69]. Recent advances, including the sequencing of plasmodium genomes (http://www.plasmodb.org/) and development of new tools for manipulating plasmodium genes, have improved our understanding of the cysteine proteases of parasites . Therefore, given the importance of the cysteine proteases, this paper will focus on structural - functional relationship of falcipains, major cysteine proteases of p. falciparum . In cases of malaria, the parasite relies on human hemoglobin hydrolysis to supply amino acids for protein synthesis and to maintain osmotic stability [11, 12]. Cysteine proteases are involved in hemoglobin hydrolysis and have been validated as promising drug targets [13, 14]. In a recent report, ch'ng et al ., using cysteine protease inhibitors, demonstrate that clan ca cysteine proteases of p. falciparum are also involved in chloroquine - mediated programmed cell death . The best characterized plasmodium cysteine proteases are the falcipains, papain family (clan ca) enzymes (figure 1). Among the four p. falciparum cysteine proteases, falcipain-2 and falcipain-3 appear to be the principal food vacuolar hemoglobinases [1618]. When the falcipain-2 gene is disrupted, undegraded hemoglobin accumulates in the food vacuole, confirming that this enzyme participates in haemoglobin hydrolysis . However, disruption of falcipain-3 could not be achieved, but the gene was readily replaced with a tagged functional copy, indicating that falcipain-3 is essential for erythrocytic parasites . Falcipain-2 and falcipain-3 share 67% sequence identity and contribute more or less equally to the digestion of hemoglobin in the food vacuole . Comparing with other papain family proteases, specifically, this paper will survey available information on structure and function of different domains of falcipain-2 and falcipain-3 and their interaction with inhibitors . Falcipains are major cysteine protease, named due to the function of a catalytic cysteine, which mediates protein hydrolysis via nucleophilic attack on the carbonyl carbon of a susceptible peptide bond . Falcipains have two main domains, the prodomain and the mature domain . The prodomain is further divided into different small domains . At the n - terminus of the prodomain, the first 35 amino acids are cytosolic, followed by a 20 amino acid transmembrane domain and a 188 amino acid lumenal domain . The inhibitory domain is present in the c - terminal part of the prodomain (figure 2). Cysteine proteases of the parasite hydrolyze hemoglobin in the acidic food vacuole [20, 21]. Recently, it has been demonstrated that prodomain has unique motifs which are responsible for targeting the falcipains . Using transfection technology and constructing different chimeras with portions of the n - terminal part of prodomain fused to green fluorescent protein, it has been shown that the prodomains of falcipain-2 and falcipain-3 were sufficient to target green fluorescent protein to the food vacuole . Once enzymes are in the er, using the signal from transmembrane domain, the proteins appear to traffic to the plasma membrane . At the plasma membrane falcipain-2 and falcipain-3 appear to be endocytosed in a process requiring the presence of both cytoplasmic and luminal prodomain trafficking motifs, followed by vesicular transport to the food vacuole . In summary, serial truncation and deletion studies showed that both a 20-amino acid stretch of the lumenal portion and a 10-amino acid stretch of the cytoplasmic portion of the enzymes were essential for food vacuolar trafficking (figure 3). Like many other proteases, falcipains are synthesized as a zymogen, and the prodomain inhibits the activity of the mature enzyme . To investigate how the prodomain regulates the activity of falcipain-2, pandey et al . Expressed constructs encoding different portions of the prodomain and tested their ability to inhibit recombinant mature falcipain-2 . It has been found that a c - terminal segment (leu asp) of the prodomain, including two motifs (erfnin and gnfd) that are also conserved in cathepsin l subfamily proteases, mediates prodomain inhibitory activity . Earlier work with other cathepsin l subfamily proteases suggests key roles for conserved hydrophobic amino acids (phenylalanine and tryptophan) as well as the erfnin and gnfd motifs in maintaining prodomain structure . Later, pandey et al . Explored the roles of conserved motifs in maintaining prodomain structure by circular dichroism analysis . Secondary structure was seen in a fragment with potent inhibitory activity (leu asp), but not in two larger constructs that lacked any sequence downstream of the erfnin and gnfd motifs or in a peptide spanning the erfnin and gnfd motifs . These results indicate that, together with erfnin and gnfd motifs, an upstream region including two conserved phe * residues is required for proper folding or maintenance of secondary structure of the prodomain (figure 2). The 3d structures of the mature domain of falcipain-2 and falcipain-3 have been solved [25, 26], and the profalcipain-2 model suggests that conserved residues provide stability to the inhibitory domain (figure 4(a)). Modeling, based on the solved structure of procathepsin b and procathepsin l [27, 28], shows that the charged pair arg and glu of the prodomain appear to form a salt bridge (figure 4(b)). Further, glu from the gnfd motif may form a separate salt bridge with lys in the mature domain . Phe may participate in nonpolar interactions and possibly pi stacking interactions, with two tryptophan residues in the mature domain, trp and trp . The model also suggests that the prodomain of falcipain-2 binds the mature domain in a manner similar to that of procathepsin k and l, inhibiting catalytic activity by blocking substrate access to the active site (figure 4(a)). They encode short n - terminal extensions of the mature domain, which is unique among described papain family proteases [13, 14]. Looking at the family of c1a cysteine protease sequences on the merops database (http://merops.sanger.ac.uk/) have identified more than 40 members with an n - terminus extension of 12 amino acids at this location . Notably, 18 of these sequences were those of falcipains and homologues from other plasmodial species to better characterize the determinants of folding for falcipain-2, pandey and sijwali et al . Expressed multiple prodomain and mature constructs of the enzyme in e. coli and assessed their abilities to refold by checking their activity [23, 29] this folding study showed that refolding of the mature domain could be achieved when the mature domain was covalently joined with the n - terminus extension (figure 5). Only 12 amino acids of the n - terminus extension (refolding domain) are necessary for refolding . Deletion of 12 amino acids from n - terminus segment of the mature domain yielded a construct incapable of correct folding, but inclusion of this segment in trans allowed folding to active falcipain-2 . Correct folding also occurred when the catalytic domain was refolded with a separate prodomain - folding domain construct but not with an isolated folding domain peptide [23, 29] (figure 5). These results indicated that the prodomain mediates the interaction between the mature and folding domain when they were not covalently bound . However, it was not clear from these studies, whether the amino - terminal extension is required only for folding or whether it also plays an essential role in mediating enzyme activity . To determine whether the folding domain was required for activity, pandey et al after refolding and purification of the mature domain by anion exchange chromatography, the purified refolded mature domain still showed activity . Together, these results suggest that the refolding domain is only required for refolding, and once refolding is accomplished, the refolding domain is not required for activity . The n - terminus extensions of different falcipain subfamily enzymes have limited (2045%) sequence identity but are functionally conserved . Chimeras of the falcipain-2 catalytic domain with the refolding domain of six other plasmodial proteases folded normally and had similar kinetic parameters to those of recombinant falcipain-2 . These results showed that refolding domain can be swapped between the plasmodial proteases that harbor the same function . The above - mentioned experiment also indicates that all plasmodial cysteine proteases including falcipain-3 also use n - terminus extension as a refolding domain . Structural analysis further reveals that the folding domain, in fact, has a short but significant element of secondary structure . Glutamate of the mature domain forms a buried hydrogen bond with tyrosine and a salt bridge with arginine of the refolding domain . This suggests that the small folding domain, though shorter than the standard papain family prodomain, still plays a very important role in folding by stabilizing the mature domain by a hydrogen bond and a salt bridge . This is analogous to a similar interaction in falcipain-2, where tryosine of the refolding domain of falcipain-3 provides hydrogen bonding anchor to glutamate of the mature domain of falcipain-3 . These results indicate that the folding domains of falcipain-2 and falcipain-3 stabilize the mature domain in a similar fashion . Falcipain-2 and 3 efficiently hydrolyze human hemoglobin in the acidic food vacuole of parasite [17, 18]. It has recently been suggested that hemoglobin hydrolysis is not a highly ordered process but rather proceeds with rapid cleavage by falcipains at multiple sites . Falcipain subfamily proteases contain an unusual motif near the c - terminus, which is present between the highly conserved active site histidine and asparagine residues (figure 2). A motif of identical size (14 aa) is found in all studied proteases of this subfamily of falcipain, although sequence identity is modest . In case of falcipain-2 and falcipain-3, motifs smaller motifs are present in the sequences encoding p. falciparum serine repeat antigens (10 aa) and dipeptidyl peptidase i (8 aa), and larger (20 aa) motifs are present in two other putative p. falciparum dipeptidyl peptidase genes [14, 33]. To evaluate the function of the unusual c - terminal motif in falcipains, a mutant enzyme was made by deleting that motif lacking 10 amino acids from falcipain-2, and the biochemical properties of wild and mutant enzymes were compared . Native page, biacore, and gel filtration studies indicated that the motif mediates specific interactions with hemoglobin . In fact, falcipain-2 has relatively higher affinity for methemoglobin (kd is 0.8 m) than hemoglobin (kda is 3.3 m). It had been demonstrated that several factors contribute to the formation of methemoglobin during malarial infection, including acidic ph of plasmodial food vacuole, oxidative damage in rbc [35, 36], which causes an increase in methemoglobin content to up to 2042% in the plasmodial food vacuole . Thus, the higher affinity of falcipain-2 for methemoglobin looks like an adaptation to the specific conditions in the infected rbc . The enzyme without this motif showed negligible activity against hemoglobin or globin . Further, a peptide encoding the motif blocked hemoglobin hydrolysis but not the hydrolysis of casein, indicating that the motif specifically interacts with hemoglobin . Thus, this study suggests that the motif mediates the most biologically relevant activity of falcipain, the hydrolysis of hemoglobin during trophozoite stage . Falcipains may also have other functions in erythrocytic malaria parasites, and it would be interesting to explore the role of the motif in hydrolysis of other proteins of potential biological relevance . In the case of other members of the falcipain subfamily, it is likely that the encoded motifs share the same functions as the falcipain motif, because a number of members of this subfamily have been also shown to be hemoglobinases . The sequence conservation among the motifs of falcipain subfamily proteases is not high, but, as in the case of the n - terminal extension that mediates protein folding, the presence of these unusual motifs in all related proteases probably indicates a conserved function . For genes encoding more distantly related enzymes, including falcipain-1, dipeptidyl peptidases, and serine repeat antigens, c - terminal motifs vary greatly in sequence and size, and specific functions of predicted motifs are undefined . Data indicates that falcipain-2 captures hemoglobin via its c - terminal motif before subsequently cleaving the substrate at multiple sites . Further, the structure of falcipain indicates a protruding configuration for the motif, surrounded by a predominant negative charge, and it may be that charged residues are crucial for interaction with hemoglobin . It is proposed that hemoglobin, which has many charged surface residues, first binds at the motif through charge - charge interaction and brings hemoglobin closer to the active site before hydrolysis . The function of the motif in mediating catalysis despite its separation from the active site somewhat resembles that of the hemopexin domain of matrix metalloproteases . The hemopexin domain is required for both the efficient cleavage of collagen and the formation of complexes with both inhibitors and proteases to mediate biological activities . Thus, as is the case for the falcipain-2 motif, the hemopexin domain serves to facilitate biologically relevant protein - substrate and protein - inhibitor interactions . However, the hemopexin domain is approximately 20 times larger than the falcipain motif and, unlike the motif, is separated from the catalytic domain by a hinge region . Therefore, it appears that falcipains and matrix metalloproteases use similar means of biological control, but the specific mechanisms by which the proteases mediate interactions with substrates and inhibitors are different . Another papain family protease, cathepsin k, forms a pentameric complex with chondroitin sulfate to facilitate hydrolysis of collagen . Having analogy to falcipain-2-hemoglobin interaction, structural requirements for complex formation between cathepsin k and chondroitin sulfate it is interesting to raise a question, why do falcipains contain a unique motif that mediates the hydrolysis of hemoglobin? This mechanism might not have evolved simply to facilitate hemoglobin hydrolysis, because other papain family enzymes without c - terminus motifs still can hydrolyze hemoglobin . It looks like that the utilization of a specific motif at this region to mediate enzyme - substrate interaction is an unusual but conserved feature of plasmodial cysteine proteases . It may be possible that an evolutionary bottleneck occurred in ancestral plasmodial cysteine proteases, and those enzymes might not be that efficient in hemoglobin hydrolysis . In addition, plasmodial cysteine proteases might have evolved with introduction of specific motif for efficient hemoglobin hydrolysis . The interaction of a major hemoglobinase, falcipain-2, with most biologically relevant substrate, hemoglobin, could be an interesting starting point for the development of an effective drug . The structure of falcipain-2 hemoglobin binding domain will guide the design of inhibitors that should interfere with hemoglobin binding . There are two major classes of cysteine protease inhibitor, small inhibitors like leupeptin, vinyl sulfones, e64, and another class known as macromolecular inhibitor . These endogenous cysteine protease inhibitors have been described in a number of eukaryotic systems . Here, we will discuss three major cysteine protease inhibitors, cystatin, chagasin, and falstatin . Excluding the two unique motifs discussed earlier, the rest of the falcipains are structurally similar to homologous proteases in the papain family . Cystatin was used as a falcipain inhibitor with the expectation that protein - protein interaction over large surfaces would enhance crystal quality and thus facilitate structural determination . Cystatins inhibit a wide range of papain family cysteine proteases with high affinity making them ideal candidates for cocrystallization with falcipain . Falcipain and chicken egg white cystatin formed 1: 1 complex (figure 6(a)). The inhibitory constants (ki) of cystatin for falcipain-2 and falcipain-3 are 6.5 nm and 100 nm, respectively . It is interesting that cystatin is a more potent inhibitor of falcipain-2 than falcipain-3, which suggests that cystatin regulates both the falcipains with different rates . The falcipain - cystatin complex shares many features with two known cysteine protease - cystatin structures: cathepsin h - stefin a and papain - stefin b (the stefins are a subclass within the cystatin superfamily [41, 42]). These cystatins bind to target proteases in similar orientations, resulting in extensive interactions with the target proteases (figure 6(b)). Cystatin largely interacts with falcipain-2 at prime sites where substrate - binding pockets are relatively shallow and less defined, but falcipains also have binding specificity at nonprimed sites . Although, the binding preference is not as pronounced as that found at the s2 pocket (figure 6(b)). Cystatin is only able to access the solvent exposed periphery of the nonprime site of falcipain-2 and majority of its binding occurs at the prime end of the active site . Unlike most other cathepsin l - like cysteine proteases, crystal structures indicate that this preference may be due to ile in falcipains, because it creates a small protrusion in the otherwise flat base of the s2 pocket, which restricts aromatic side - chain binding (figure 6(b)). The falcipain cystatin complex can be exploited to design potent inhibitors of the malaria parasite . A recent study indicates that a peptide based on cystatin binding residues blocked the activity of falcipain-2 and led to accumulation of undegraded hemoglobin in the food vacuole . Chagasin is a cysteine protease inhibitor that was first identified in trypanosoma cruzi as the physiological regulator of cruzain, the major cysteine protease [45, 46]. Cruzain is also a papain - like (clan ca) cysteine protease that is expressed in all stages of t. cruzi life cycle . It is a key virulence factor of t. cruzi, the infectious agent responsible for the leading cause of heart disease in latin america, called the chagas disease . Chagasin is associated with cruzain during its trafficking to specific compartments of the parasite cell, and accumulated evidence suggests that the primary role of chagasin is in posttranslational regulation of protease activity . 1 binding with falcipain-2 (figure 7). The protease - binding loops (bc, de, and fg) in chagasin form a well - aligned wedge that fills the active site groove of falcipain-2 to obstruct substrate binding (figure 7). The bc loop is one of the three signature motifs that contribute to the inhibition of the cysteine protease . This is confirmed by a synthetic peptide corresponding to the bc loop of the chagasin like protein from e. histolytica, which specifically blocked the activity of cysteine proteases . It is noteworthy that thr 31 in the bc loop of chagasin binds to the catalytic cys at the falcipain-2 active site by water - mediated hydrogen bonds (figure 7). It is likely that the highly conserved thr serves as a key functional residue among chagasin - like inhibitors . Another interesting feature of the falcipain-2-chagasin interaction is the highly mobile de loop like in e64, a strong irreversible inhibitor of cysteine protease, which occupies the nonprime site . In summary, the bc loop, mobile de loop, and the rpw / f motif in the fg loop are the key elements for binding with falcipain-2 . Disturbance of the equilibrium between cysteine proteases and natural inhibitors is a key event in the pathogenesis of cancer, rheumatoid arthritis, osteoporosis, and emphysema . In case of malaria, falciparum parasites express falstatin, a potent inhibitor of falcipains and many other cysteine proteases . The stage - specificity of falstatin expression and the effects of anti - falstatin antibodies on parasite development suggest that this inhibitor facilitates a process that also requires proteolytic activity, the invasion of erythrocytes by p. falciparum merozoites . Falstatin is a competitive and reversible inhibitor of falcipains, as demonstrated by increasing calculated km values but similar vmax values with increasing concentrations of falstatin . To evaluate the mechanism of inhibition of cysteine proteases by falstatin, pandey et al . Tested the ability of active site - inhibited falcipain-2 to compete with active falcipain-2 for binding with falstatin . In contrast to results with the prodomain, the inhibitory effect of falstatin was not affected by the presence of active site inhibited falcipain-2 . Thus, the binding of falstatin to falcipain-2 appears to be via interaction with the enzyme active site . Leupeptin, e-64, and vinyl sulfones are major cysteine protease inhibitors that bind to the active site [26, 48]. The active sites of both enzymes are located in a cleft between the structurally distinct domain of the papain - like fold . The structures of falcipain-2 and falcipain-3 have been determined in complex with these small inhibitors . E-64, and leupeptin interact with residues in the s1, s2, and s3 subsites of falcipain-2 and falcipain-3, corresponding to the p1, and p2, and p3 position of the inhibitors (figure 8). The conserved catalytic residues of falcipain-2 and falcipain-3 (gln, cys, his, asn, resp .) Inhibitors display binding modes with their partner enzymes similar to those found in other papain family enzymes . The inhibitors bind to the main chain of falcipain-2 and falcipain-3 by glycine (gly in falcipain-2 and gly in falcipain-3) residue that is highly conserved in the s3 subsite of clan ca cysteine proteases (figure 9). In cocrystallization, these residues form hydrogen bonds with the o and n atoms of the inhibitor backbone . In the case of the falcipain-2 complex with e-64, enzyme active sites gln, ser, cys, asn, and his are involved in the formation of additional hydrogen bonds with e-64 . In the falcipain-3-leupeptin complex, gln, cys, and asn also act as hydrogen bonding partners to the inhibitor . The enzyme - inhibitor complex stabilize by a series of possible hydrophobic interaction using nonpolar region of gly, tyr, gly, leu, ser, leu, asn, and ala in falcipain-2, and tyro, gly, tyr, ile, and ser in case of falcipain-3 . The active site cysteine of falcipain-2 forms a covalent, irreversible hemithioketal with the e-64 epoxy carbon (figure 9). The active site cysteine of falcipain-3 forms a covalent, reversible hemithioacetal with the asymmetric carbonyl carbon of leupeptin (figure 10). The interaction pattern of e-64 and leupeptin with all papain family enzymes is conserved . The carboxyl group of e-64 and carbonyl group of leupeptin occupy the oxyanion hole formed by the conserved catalytic residues . Falcipain-2 and falcipain-3 have a clear preference for substrates / inhibitors that contains a leucine at p2 position, and both leupeptin and e64 contain a leu at p2 . Surprisingly, falcipain-3 has been shown to be much less efficient at hydrolyzing peptide substrates and more difficult to inhibit with small peptidyl - based inhibitors compared with falcipain-2 [16, 51]. The structure that forms the active site is highly conserved between falcipain-2 and falcipain-3, and there is no notable movement in the peptide backbone or loop region . However, superimposition of falcipain-2 and falcipain-3 structures highlights two important substitutions in the s2 subsite . This position of the s2 subsite is known to be a key determiner of the specificity (figures 9 and 10). In comparison to asp in falcipain-2, the additional side chain carbon in glu of falcipain-3, this increased the size as well as flexibility at this position . In case of falcipain-3leupeptin complex, the larger and more flexible residue (glu) at the bottom of s2 subsite and bulkier residue (try) create a narrow wall of the s2 subsite, as compared to the falcipain e-64 complex (figure 10). The overall structures of falcipain-3leupeptin and falcipain-2e-64 complexes show a similar mode of binding and inhibition compared with macromolecule inhibitors like chagasin and cystatin . Like e64 and leupeptin, vinyl sulphones (mu - leu - hph - vsph) have been shown to be effective inhibitors of a number of papain - family - like cysteine proteases . Mu - leu - hph - vsph is a potent irreversible inhibitor of falcipain-2 and falcipain-3 . The cocrystallization of falcipain-3 with mu - leu - hph - vsph indicates that inhibitor binds the respective s1 and s3 subsites to form an irreversible, covalent bond with the sulfur of the active site cysteine thiol in enzyme (figure 11). Given the hydrophobic nature of the p1 and p2 substituents in mu - leu - hph - vsph, the active site of falcipain-3 is lined with a number of residues that are able to make nonpolar contacts with their respective inhibitor (figure 11). As seen in the crystal structures of falcipain-3 with the above inhibitor, the residue at the bottom of the s2 subsite (glu) points out of the pocket to avoid a potentially unfavorable interaction with the bulky phe residue at the p2 position of inhibitor . Cysteine proteases of the malaria parasite may be targeted for inhibition by vinyl sulphones . Indeed, vinyl sulphones - based cysteine protease inhibitors are already being used in preclinical trials for the chagas disease . The understanding of the cysteine proteases of malaria parasites has increased markedly in recent years . Since cysteine proteases that play an important role in the parasite life cycle by degrading erythrocyte proteins, most notably hemoglobin, are attractive targets for antimalarial chemotherapy . Falcipain-2 and falcipain-3 are the best characterized cysteine proteases of malaria parasite, the structure and function of different domains and their interaction with small and macromolecular inhibitors are studied . The structure - function study of falcipains and interaction with inhibitors will provide detail insights to develop rational design of inhibitor against falcipains . Structure - guided approaches should have great role in the design of potent and highly selective inhibitor . Efforts to optimize current inhibitors based on the structure - function of falcipains are currently underway.
Alzheimer's disease (ad) is the most common cause of dementia in the aging population . This disease develops over time and leads to significant cognitive deficits affecting memory, insight, judgment, abstraction, and language functions . Ad affects more than 5 million people in the united states and this number is projected to rise to 35 million by 2050 [2, 3]. This estimate underscores both the scope of this health care issue for the society as a whole and the need for the development of therapeutic options for these patients . The diagnosis of this neurodegenerative disease relies on the presence of senile plaques and neurofibrillary tangles in affected brain areas at autopsy . These ad hallmark lesions are the results of the pathological deposition of proteins normally present throughout the brain . Senile plaques are composed of extracellular deposits of beta - amyloid (a) derived by proteolytic cleavage from the amyloid precursor protein (app) [410]. Neurofibrillary tangles, on the other hand, are intracellular bundles of self - assembled tau proteins [1138]. The formation of both senile plaques and neurofibrillary tangles is associated with progressive and irreversible degeneration of neuronal processes and the loss of synaptic connections [3950]. Initially, multiple studies focused on defining the characteristics of ad and on the analysis of the composition of senile plaques and neurofibrillary tangles . More recently, data have been obtained on the molecular mechanisms that link the formation of these lesions and underlie neurodegeneration and cell death in ad and related disorders . Calpains are ca - dependent proteases in which activity is dysregulated in ad and other neurodegenerative diseases [5154]. A growing body of evidence suggests that the abnormal activation of calpains might modulate not only the formation of senile plaques and neurofibrillary tangles but also the development of synaptic pathology in ad . These data reviewed below position calpains at the crossroads of the mechanisms involved in the formation of the main pathological alterations associated with ad . Furthermore, these findings underscore the importance of calpains as potential targets to block the activation of the signaling cascades leading to degeneration in ad . In turn, this information could be applied to the design of therapeutic options and prevention strategies for this devastating disease . In this review, we first summarized data on the properties of calpains and the mechanisms underlying their activation . Then, we reviewed findings on the dysregulation of calpain in the context of ad and its deleterious consequences for the morphology and function of affected brain areas . Calpains constitute a family of ca - dependent cysteine proteases involved in multiple and very diverse cell functions including cell development, proliferation, and differentiation, cell motility, growth cone motility and guidance, apoptosis, learning, and memory, among others [51, 52]. Originally, two members of this family were identified: calpain 1 (-calpain) and calpain 2 (m - calpain), also known as conventional or classical calpains . More recently, the other 14 members of the calpain family have been identified in mammals [51, 55]. In contrast to classical calpains that are ubiquitously distributed, the expression of some of these unconventional or nonclassical calpains is tissue specific . For example, calpain 3a and calpain 8 are mainly present in skeletal and smooth muscle cells, respectively . Calpain 11, on the other hand, is highly expressed in testes, while calpain 13 is concentrated in the lung and skin . Others, like calpains 5, 7, 9, and 10 have more widespread distributions . None of these new members of the calpain family are highly expressed in the central nervous system (cns). Both calpain 1 and calpain 2 are heterodimers composed of a large catalytic subunit (~80 kda) and a small regulatory subunit (~30 kda). Based on this sequence, the catalytic subunit has been divided into four distinct domains (reviewed in). Domain 1 corresponds to the n - terminal region of this subunit and undergoes autolysis upon ca binding . Domain 2 contains a catalytic unit formed by cys, his, and asn residues . Domain 4 has partial homology with calmodulin and contains several ef - hand calcium - binding motifs . The regulatory subunit can be divided into two domains, a calmodulin - like domain and a glycine - rich domain . While both proteases are present in neurons and glial cells, their relative abundance differs . Calpain 1 is more abundant in neurons, and calpain 2 is prominent in glial cells . Analysis of the subcellular localization of these enzymes demonstrated that calpain 1 is concentrated in the cell bodies and is also detected in the processes extended by central neurons, although at lower levels . Calpain 1 immunoreactivity has been also detected in postsynaptic densities as well as in dendritic spines . Astrocytic processes are also enriched in calpain 2 [62, 63]. Calpains cleave proteins generating large fragments . Initially, it was thought that these proteases' cleavage sites have a leu or a val residue in the p2 position . More recently, it has been shown that the cleavage site specificity is determined by conformation rather than amino acid sequence [6568]. The specificities of the substrates for both calpains are very similar but not identical . In vitro studies calpain substrates include cytoskeletal proteins (cadherin, catenin, desmin, dystrophin, gelsolin, filamin, fodrin, microtubule - associated proteins map 1 and map 2, neurofilament proteins, spectrin, tau, talin, troponin, tubulin, vimentin, and vinculin), signal transduction proteins (calcium / calmodulin - dependent protein kinase, epidermal growth factor (egf) kinase, pp60, protein kinase c, calcineurin, and caspases 3, 7, 8, 9, 12, and 14), synaptic proteins (dynamin 1, postsynaptic density (psd) 95, n - methyl - d - aspartic acid (nmda) glutamate receptors, and metabotropic glutamate receptor glur1), and transcription factors (p53), among others [51, 53]. Calpain activation is tightly regulated to prevent massive proteolytic activity in the cell . The binding of ca to either calpain results in conformational changes that initiate their proteolytic activity . While calpain 1 is activated in the presence of micromolar concentrations of ca, calpain 2 requires millimolar concentrations . The ca requirement for either calpain is significantly higher than the concentration of this ion in living cells . This fact has prompted a series of studies on potential mechanisms that could lead to a decrease in the ca requirement for the activation of these proteases in living cells . In vitro studies have shown that the interaction of calpains with a series of activator molecules lowers the concentration of ca required to initiate the activation of these proteases . Among them, phospholipids (i.e., phosphatidylinositol) are the most studied . However, the phospholipid to calpain molar ratio required for lowering the ca requirement for either calpain activation is not likely to be achieved in the cellular context [6971]. Nevertheless, it cannot be ruled out that higher concentrations of ca are achieved in limited cellular areas where ca is not easily detectable by available methods . In turn, these local micromolar or millimolar ca concentrations could trigger calpain activation in distinct subcellular domains . In addition to ca, calpastatin has a key role in the regulation of calpain . Calpastatin, a heat - stable protein ranging from ~70 to ~140 kda of apparent molecular weight depending on the cell type, is considered a specific endogenous inhibitor of calpains . Immunocytochemical analysis showed calpastatin immunoreactivity throughout the dendritic tree in pyramidal neurons and purkinje cells . Therefore, the ratio calpain / calpastatin plays a key role in the regulation of calpain activity [7880]. The inhibitory effect of calpastatin requires ca - dependent high - affinity binding to three sites of calpain . The kinases responsible for the phosphorylation of some of these sites have already been identified . Thus, two of those sites seem to be phosphorylated by protein kinase c (pkc), two by protein kinase a (pka), two by calmodulin kinase ii, one site by casein kinase i, and another by protein kinase g . Although the role of the phosphorylation of each site in calpain activation has not been completely elucidated, data suggest that phosphorylation mediated by mitogen - activated kinases (erk / map kinases) activates these proteases . On the other hand, phosphorylation by pka may decrease their activity [82, 83]. As briefly reviewed above, calpain activation is a tightly regulated process to prevent deleterious consequences of massive proteolytic activity . These regulatory mechanisms seem to decline with aging resulting in an increased calpain activity [8487]. Thus, several studies have reported significantly increased activation of calpains in ad brains [8894]. The hyperactivation of calpain in the context of ad is the result of several factors including enhanced intracellular ca concentration and decreased calpastatin levels . Experiments performed using an ad culture model system showed that oligomeric a induced a significant (5-fold) and instantaneous rise in ca in hippocampal neurons [9597]. These studies also addressed the source of the ca influx leading to calpain activation in the context of ad taking advantage of specific blockers of ca release from the endoplasmic reticulum, the major source of intracellular ca, and bapta, a chelator of extracellular ca . The data obtained showed that a induces calpain activation by enhancing extracellular ca influx [9597]. The mechanisms underlying the regulation of the enhanced ca influx and calpain activation in ad have also been studied . Both nmda receptors and voltage - gated calcium channels (vgcc) have been implicated in such regulation in central neurons [99101]. Specific nmda receptor inhibitors, mk801, and the fda approved nmda receptor antagonist memantine significantly attenuated the initial a-induced increase of ca and blocked a-induced calpain activation in cultured hippocampal neurons [9597]. In contrast, nimodipine, an l - type vsccs blocker, did not decrease the a-induced activation of calpain [9597]. These data suggest that nmda receptors play an important role in mediating the sustained ca influx and enhanced calpain activity induced by aggregated a. furthermore, these studies suggested that factors that affect nmda receptor - mediated ca influx could modulate calpain activation and its deleterious effects in central neurons . Recently, it has been shown that cholesterol regulates calpain activity in the context of ad . A population - based study demonstrated that not only high cholesterol levels but also moderately elevated cholesterol levels in midlife represent a significant risk factor for ad [106, 107]. Interestingly, cholesterol has been implicated in the susceptibility of cells to ca influx [108111]. Thus, elevated membrane cholesterol actually increased the susceptibility of cells to a-induced elevation in ca influx leading to cell death via a calpain - dependent mechanism [111, 112]. By regulating the nmda receptor content and changing their localization in membrane microdomains at the synaptic sites, cholesterol modulates the ability of a to induce ca influx, leading to calpain activation in hippocampal neurons [111, 112]. Calpastatin also seems to play an important role in the regulation of calpain activation in ad . Thus, it has been shown that calpastatin is markedly depleted in the cortex of ad brains at late stages of the disease as compared to age - matched controls . Focal areas of calpastatin depletion have been also detected along dystrophic neurites at early stages of ad . On the other hand, no changes in calpastatin levels were detected in neurons less susceptible to neurodegeneration in ad like purkinje cells . This decrease in calpastatin levels is the result of the proteolytic activity of caspases and calpain . In turn, the decrease in the ratio calpastatin to calpain causes calpain hyperactivation perpetuating this cellular deleterious effect [79, 113115]. These findings have been complemented with immunocytochemical studies on the distribution of calpain in ad . These studies have shown intense calpain immunoreactivity in dystrophic neurites associated with neurofibrillary tangles, neuritic plaques, and neuropil threads in the hippocampal region and entorhinal cortex of subjects suffering from ad and other tauopathies [116118]. Based on this information, it was hypothesized that the enhanced calpain activity observed in ad brains plays an important role in the formation of senile plaques, neurofibrillary tangles, and synaptic dysfunction in the context of ad (figure 1). These peptides are the result of the sequential proteolytic cleavage of app by two proteases . First, -secretase (-site app - cleaving enzyme (bace 1)) cuts app at the n - terminus of the a domain leaving a 99-amino - acid - long c - terminal fragment . Then, the -secretase complex (presenilin 1, presenilin 2, nicastrin, aph1, and pen2) cuts the c - terminus to generate a peptides of 38 to 43 amino acids in length [5, 119121]. Of these peptides, therefore, increased levels of bace 1 could lead to enhanced production of a, its aggregation, and consequently the activation of signaling pathways associated with the neurodegenerative process . Thus, a 2-fold increase in bace1 levels has been detected in ad brains [127129]. Recently, it has been shown that the calpain / calpastatin system can modulate the pathological deposition of a. calpain activation increases the levels of bace1 in a transgenic mouse model of ad . In addition, the bidirectional regulation of the activation of the calpain / calpastatin system and a metabolism has been established . Using transgenic mice overexpressing app, these authors showed that calpastatin deficiency enhanced calpain activation, a production, and increased mortality . In turn, the increased levels of a lead to enhanced ca influx and increased calpain activation . Senile plaques are often surrounded by dystrophic neurons that contain tau aggregates known as neurofibrillary tangles . Many studies have focused on the composition and the mechanisms underlying the formation of tau aggregates . Those studies have identified two types of tau filaments in the neurofibrillary tangles: straight and paired helical filaments . Tau hyperphosphorylation has been attributed to the increased activity of several kinases, including cyclin - dependent kinase 5 (cdk5), glycogen synthase kinase (gsk), and the mitogen - activated protein kinase (mapk) in hippocampal neurons [138, 143145]. Thus, it has been shown that calpain cleaves the inhibitory domain of gsk3 generating two fragments of 40 and 30 kda . The latter has a longer half life than p35 and therefore it is a more potent activator of cdk5 . Experiments using calpeptin, a cell permeable calpain inhibitor, blocked both erk 1 and erk 2 activation . Conditions that blocked the activation of these kinases induced a decreased in tau phosphorylation and resulted in enhanced neuronal survival in the presence of a . Besides tau phosphorylation, calpain activation might play a role in tau - mediated neurodegeneration by inducing tau cleavage . In vitro studies have shown that both fetal and adult tau isoforms are rapidly proteolyzed by calpains [151153]. On the other hand, tau present in paired - helical filaments is considerably more resistant to proteolysis by these proteases [153156]. These findings suggest that phosphorylation might regulate the susceptibility of tau to calpain - mediated cleavage . Tau obtained from cultured neurons incubated in the presence of this phosphatase inhibitor was more resistant to calpain cleavage than tau extracted from nontreated control neurons . Nevertheless, the effect of phosphorylation on calpain - mediated tau cleavage seems to be complex . This effect might depend on the site phosphorylated and/or the extent of phosphorylation under pathological conditions since highly phosphorylated fetal isoforms are readily cleaved by calpain . Calpain - mediated tau cleavage seems to play an important role under neurodegenerative conditions [157164]. It has been shown that calpain activation results in the generation of several n - terminal tau fragments . One of such tau fragments, of ~20 kda of apparent molecular weight, has been detected in mitochondria present in synaptosomal fractions obtained from ad brains . The levels of this tau fragment are partially reduced when cultured neurons are treated with a calpain inhibitor . It has been shown that tau fragments containing the 2644 tau amino acids affect mitochondria oxidative phosphorylation acting at the level of the adenine nucleotides translocator contributing to synapse dysfunction . A smaller tau fragment generated by calpain cleavage has been detected in mature hippocampal neurons treated with aggregated a oligomers [160, 161]. A-induced tau cleavage mediated by calpain 1 leads to the generation of a neurotoxic 17 kda tau fragment (tau 45230) in cultured hippocampal neurons [160, 161]. This fragment has also been detected in the neocortex of ad brains as well as in brain areas affected by other tauopathies . Furthermore, when expressed in neuronal and nonneuronal cell types or in an in vivo drosophila model system, the 17 kda tau fragment produced cell death in the absence of a oligomers [160, 161, 163]. These data provided strong evidence for an important role of calpain 1 and the generation of the 17 kda tau fragment in the progression of a-mediated neurodegeneration . It is worth noting that calpain 2 activation cleaves tau generating a smaller tau fragment that lacks neurotoxic effects in central neurons . In addition to the presence of senile plaques and neurofibrillary tangles, ad brains are characterized by a decrease in synaptic contacts . This synaptic loss seems to be the best morphological correlate of the functional deficits observed in the mid to late stages of ad [39, 40]. Although no significant decline in synapse number has been detected in the earliest stages of the disease, a stage of synaptic dysfunction seems to precede frank synapse loss [41, 46, 165]. By cleaving proteins in the presynaptic terminals and/or the postsynaptic elements changes in proteins involved in synaptic vesicle biogenesis and/or recycling at synaptic terminals are responsible, at least in part, for the synaptic dysfunction detected in ad . Recently, data obtained using culture and animal models of ad showed that a induced a significant reduction in dynamin 1 levels that preceded synapse loss . Dynamin 1 pinches off synaptic vesicles, freeing them from the membrane and allowing them to reenter the synaptic vesicle pool to be refilled for future release [167, 168]. Decreased levels of this protein lead to the depletion of synaptic vesicles and the accumulations of invaginated pits at presynaptic membranes adjacent to the synaptic clefts [9597, 169, 170]. The a-induced decrease in dynamin 1 is a result, at least partially, of calpain - mediated proteolysis [9597, 171]. Thus, it has been shown that calpain activation results in the breakdown of several proteins leading to changes in the ultrastructure of the postsynaptic density (psd). These changes in the psd are accompanied by the rapid cleavage of psd-95 and the nmda receptor subunits nr1 and nr2a and 2b [172175]. Calpain has been shown to truncate also mglur1 exacerbating nmda - mediated neurotoxicity [176178]. An additional mechanism by which calpain activation can result in synaptic dysfunction involved the cleavage of pka leading to a decrease in both the regulatory and the catalytic subunits of this kinase . The decrease in pka activity attenuates creb activation impairing memory [179, 180]. Taken together, the data reviewed above strongly suggest that calpains play an important role in the neurodegeneration mechanisms underlying ad in the aging population . Based on these data, it has been tempting to speculate that calpain inhibition could be a useful tool to prevent neurodegeneration in this disease . To obtain further insights into the beneficial effects of blocking calpain activation, several studies have been conducted using experimental approaches to either suppress the expression of these proteases or prevent their abnormal activation . Early studies using gene deletion of the calpain regulatory subunit by homologous recombinant techniques showed that the depletion of these proteases is embryonic lethal . The data obtained showed that indeed the suppression of calpain 1 expression by means of these specific probes prevented oxidative stress - induced cell injury in human hepatic cancer cell lines . Other studies have assessed the effects of calpain inhibitors on cell death in culture model systems of ad . Leupeptin and e64 calpain inhibitors had protective effects in those cultures [160, 183186]. The idea that calpain could be a potential therapeutic target in neurodegenerative diseases has been reinforced by studies performed in vitro and in culture using the calpain inhibitor mdl 28170 . Those studies suggested a protective effect of calpain inhibitors against excitotoxicity [178, 187, 188]. Unfortunately, the potential use of known calpain inhibitors as therapeutic tools in ad is limited due to their low cellular penetration, poor selectivity, and kinetics . Recently, this benzoylalanine - derived ketoamide is capable of inhibiting calpain in nanomolar concentrations and has improved oral bioavailability, water solubility, and metabolic stability . This calpain inhibitor is highly effective in preventing calpain - mediated cleavage of dynamin 1 and tau in cultured hippocampal neurons . This inhibitor is effective not only when added prior to the a treatment but also when added simultaneously with a and even when added after a has triggered the neurodegeneration process . The calpain inhibitor a-705253 also prevents a oligomer - induced neurodegeneration of the nucleus basalis magnocellularis . These experiments raised the possibility that more potent calpain inhibitors could have beneficial effects even at late stages of ad . Moreover, initial studies using calpain inhibitors in mouse and rat models of ad showed an encouraging recovery of cognitive function in these animals when they were treated with calpain inhibitors at an early age [186, 190]. Together, these data underscore the potential importance of calpain inhibitors as promising therapeutic tools in ad and related neurodegenerative diseases . In summary, the data briefly reviewed above provide strong support for the role of calpains in ad . They also highlight the tantalizing possibility that these proteases could serve as targets for the development of therapeutic interventions for this disease, one of the main challenges for decades to come in ad research.
For many years, the global community has observed the calamitous effects of the human immunodeficiency virus (hiv) on the human population . Hiv was historically viewed as an incurable disease that gradually progressed into acquired immune deficiency syndrome (aids) and led to one s untimely death . During his tenure (20012008), united states president george w. bush recognized the devastating impact of hiv as a global health crisis that required immediate action . Through bipartisan efforts between president bush and the 108 us congress, the passage of hr 1298 (public law 10825) led to the creation of the president s emergency plan for aids relief, commonly referred to as pepfar . The objective of pepfar was to provide $15 billion in aid, targeting 12 focus countries in sub - saharan africa: botswana, cote divoire, ethiopia, kenya, mozambique, namibia, nigeria, rwanda, south africa, tanzania, uganda, and zambia . In an empirical research that was conducted on the impact of international humanitarian assistance on combating hiv / aids, azuine et al . Discovered that the increase of donor assistance in developing countries led to an overall reduction of hiv infection rates . Pepfar has illustrated the pertinence of an interconnected world and the urgency to embrace those connections during stages of global stress . According to the united nations, the united states has contributed more funding to the fight against hiv / aids than any other country . The research presented here provides a better understanding of how well pepfar advanced that fight and whether the allocation of a large amount of dollars for pepfar was crucial in saving lives and decreasing hiv infection rates in sub - saharan africa . The general policy research question for this research was to determine whether the pepfar funding allocated to the 12 resource - scarce countries in sub - saharan africa had any relevant effect in reducing the hiv infection rates of males and females between the ages of 15 and 49 . An analysis to determine whether the pepfar policy was effective and efficient may influence future global humanitarian assistance provided to other countries by the united states . Researchers agree that the continent of africa is the focal point of the hiv pandemic and that hiv / aids is a detrimental problem for the global community . Even though other countries such as guyana, haiti, and vietnam were also recipients of pepfar funding, the majority of the crisis, population affected, and funding allocated for pepfar was concentrated in the above - mentioned 12 african countries . The specific focus addressed herein is whether the pepfar funding allocation was effective in meeting its intended purpose of reducing hiv infection rates in the 12 african countries that received funding . To this day, africa prevails as the most hiv / aids affected continent in the world, in particular the sub - saharan areas . Africans account for approximately two thirds of hiv infections and three quarters of deaths associated with hiv from around the world . The joint united nations programme on hiv / aids (unaids), united nations children s fund (unicef), and world health organization (who) determined that approximately 75% of people in sub - saharan africa between the ages of 15 and 49 are unaware of their hiv status . Together, hiv and aids have devastating effects on society and the economy . Together, hiv and aids create reproductive concerns, reduced revenues, increased healthcare expenses, decreased school enrollment, increased rates of absence at work, disruptions in the family environment, decreased human capital, increases in poverty rates, a lower gross domestic product (gdp), and more orphaned children. [9 - 14] due to high levels of poverty, many developing countries in sub - saharan africa do not have the necessary resources or funding to combat the hiv / aids pandemic occurring in their nations . The methods that were used to treat and prevent further growth in cases of hiv / aids were education, counseling, hiv testing, antiretroviral medication, and building health care infrastructure . The treatment category of funding from pepfar focused on the amount of monetary support given to an african country for hiv treatment, the purchase of antiretroviral (arv) drugs, and the building of health infrastructure . One of the most essential components of the pepfar program was the increased access to generic arv medication and therapy . The purpose of the arv medication is to reduce the plasma level of hiv viral load. [19, 20] the reduced viral load resulting from arv therapy not only improves the health of the infected individual, but also lowers the risk of passing the disease on to someone else . The availability of arv was critical in prolonging the lives of hiv infected individuals and reducing transmission rates . The prevention category of pepfar focused on the foundational strategy of preventing the proliferation of hiv . This foundation was known as the abc approach: (a) abstain, (b) be faithful, and (c) use condoms . There was strong emphasis on the abstinence from sex before marriage and be faithful aspects, which sometimes generated controversy because of the religious component in the program . Safe - sex education was also a pertinent program in the fight against hiv / aids . The care category of pepfar focused on counseling, testing people for hiv / aids, taking care of orphan children, and palliative care for individuals with hiv / aids . Since the majority of people in sub - saharan africa are unaware of their hiv status, this negligence could well lead to the rapid spread of the disease through sexual intercourse . The final category of pepfar efforts focused on training in health management, increasing health care staffing levels, and strengthening the healthcare management system . Health management and effective management systems are important because one of the common theories is that the spread of hiv / aids in africa is worsened by high corruption rates and lack of accountability among government officials . The rampant level of government corruption may prevent government officials from being effective leaders in addressing the hiv / aids pandemic . To this day, africa prevails as the most hiv / aids affected continent in the world, in particular the sub - saharan areas . Africans account for approximately two thirds of hiv infections and three quarters of deaths associated with hiv from around the world . The joint united nations programme on hiv / aids (unaids), united nations children s fund (unicef), and world health organization (who) determined that approximately 75% of people in sub - saharan africa between the ages of 15 and 49 are unaware of their hiv status . Together, hiv and aids create reproductive concerns, reduced revenues, increased healthcare expenses, decreased school enrollment, increased rates of absence at work, disruptions in the family environment, decreased human capital, increases in poverty rates, a lower gross domestic product (gdp), and more orphaned children. [9 - 14] due to high levels of poverty, many developing countries in sub - saharan africa do not have the necessary resources or funding to combat the hiv / aids pandemic occurring in their nations . The methods that were used to treat and prevent further growth in cases of hiv / aids were education, counseling, hiv testing, antiretroviral medication, and building health care infrastructure . The treatment category of funding from pepfar focused on the amount of monetary support given to an african country for hiv treatment, the purchase of antiretroviral (arv) drugs, and the building of health infrastructure . One of the most essential components of the pepfar program was the increased access to generic arv medication and therapy . The purpose of the arv medication is to reduce the plasma level of hiv viral load. [19, 20] the reduced viral load resulting from arv therapy not only improves the health of the infected individual, but also lowers the risk of passing the disease on to someone else . The availability of arv was critical in prolonging the lives of hiv infected individuals and reducing transmission rates . The prevention category of pepfar focused on the foundational strategy of preventing the proliferation of hiv . This foundation was known as the abc approach: (a) abstain, (b) be faithful, and (c) use condoms . There was strong emphasis on the abstinence from sex before marriage and be faithful aspects, which sometimes generated controversy because of the religious component in the program . Safe - sex education was also a pertinent program in the fight against hiv / aids . The care category of pepfar focused on counseling, testing people for hiv / aids, taking care of orphan children, and palliative care for individuals with hiv / aids . Since the majority of people in sub - saharan africa are unaware of their hiv status, this negligence could well lead to the rapid spread of the disease through sexual intercourse . The final category of pepfar efforts focused on training in health management, increasing health care staffing levels, and strengthening the healthcare management system . Health management and effective management systems are important because one of the common theories is that the spread of hiv / aids in africa is worsened by high corruption rates and lack of accountability among government officials . The rampant level of government corruption may prevent government officials from being effective leaders in addressing the hiv / aids pandemic . Based on theoretical evidence, this study expected that the 12 focus countries in africa that received pepfar funding would see a decrease in the hiv infection rates . Even though arv medications are able to prolong the lives of hiv infected individuals, the hiv infection rates that are calculated by the world bank take into consideration individuals who are taking the arv medication . The software used for the collection of hiv infection rates reduced the infectivity rates among people receiving arv treatments . Table 1 lists the 12 countries in africa that received pepfar funding and table 2 provides the amount of pepfar funding that was received from 2004 through 2008 in millions of us dollars . Table 3 shows the hiv infection rates of males and females between the ages of 15 and 49 in the 12 countries in africa that received pepfar funding from 2004 through 2008 . Pepfar focus countries in sub - saharan africa source: united states president s emergency plan for aids relief countries that received pepfar funding (millions of us dollars), 20042008 source: united states president s emergency plan for aids relief hiv infection rates (%) of males and females ages 1549, 20042008 source: united states president s emergency plan for aids relief the following theoretical models were applied to this research: hivrateit= 1 + 2%pepfar per gdpit+ it hivrateit= 1 + 2%pepfar per gdpit + 3%health per gdpit + 4corruptionit + 5gdppcit+ it the dependent variable was hiv infection rates in africa . The control independent variables were healthcare expenditure per gdp, corruption rate of a country, and gdp per capita . Where: 1 is the intercept of the models and it is the stochastic error term of the models.hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage (world bank).%health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars (world bank).gdppcit was the gdp per capita of each country in us dollars (world bank).%pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars (pepfar).corruptionit was the score of perceptions on the level of corruption in the public sector, based on the corruption perceptions index, where 0=very corrupt and 10=not corrupt (transparency international). 1 is the intercept of the models and it is the stochastic error term of the models . Hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage (world bank).% health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars (world bank). Gdppcit was the gdp per capita of each country in us dollars (world bank).% pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars (pepfar). Corruptionit was the score of perceptions on the level of corruption in the public sector, based on the corruption perceptions index, where 0=very corrupt and 10=not corrupt (transparency international). This study used panel data from 2002 through 2010 covering the 12 countries that received pepfar funding in the continent of africa . Even though pepfar was active from 2004 through 2008, this research includes two years before (2002 and 2003) and two years after (2009 and 2010) in order to increase the ability to estimate the actual effect of receiving pepfar funding . In order to analyze the correlation between pepfar funding and hiv infection rates in africa, this research used stata software version 13 and conducted a fixed - effects panel regression analysis . The fixed - effects technique was chosen based on results from the hausman and sargan - hansen tests, which were performed through stata . There was the possibilities of both heteroskedasticity and autocorrelation in this study because this analysis included a combination of cross - sectional and time - series data . The use of panel data for this research required statistical tests to determine if the regression model did indeed encounter a problem with heteroskedasticity and autocorrelation . As expected, the results of the tests indicated the presence of these problems in the regression model . In order to correct for the heteroskedasticity and autocorrelation problems, this research used the robust standard errors for panel regression with cross - sectional dependence model . Hivrateit= 1 + 2%pepfar per gdpit + 3%health per gdpit + 4corruptionit + 5gdppcit+ it the dependent variable was hiv infection rates in africa . The control independent variables were healthcare expenditure per gdp, corruption rate of a country, and gdp per capita . Where: 1 is the intercept of the models and it is the stochastic error term of the models.hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage (world bank).%health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars (world bank).gdppcit was the gdp per capita of each country in us dollars (world bank).%pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars (pepfar).corruptionit was the score of perceptions on the level of corruption in the public sector, based on the corruption perceptions index, where 0=very corrupt and 10=not corrupt (transparency international). 1 is the intercept of the models and it is the stochastic error term of the models . Hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage (world bank).% health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars (world bank). Gdppcit was the gdp per capita of each country in us dollars (world bank).% pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars (pepfar). Corruptionit was the score of perceptions on the level of corruption in the public sector, based on the corruption perceptions index, where 0=very corrupt and 10=not corrupt (transparency international). This study used panel data from 2002 through 2010 covering the 12 countries that received pepfar funding in the continent of africa . Even though pepfar was active from 2004 through 2008, this research includes two years before (2002 and 2003) and two years after (2009 and 2010) in order to increase the ability to estimate the actual effect of receiving pepfar funding . In order to analyze the correlation between pepfar funding and hiv infection rates in africa, this research used stata software version 13 and conducted a fixed - effects panel regression analysis . The fixed - effects technique was chosen based on results from the hausman and sargan - hansen tests, which were performed through stata . There was the possibilities of both heteroskedasticity and autocorrelation in this study because this analysis included a combination of cross - sectional and time - series data . The use of panel data for this research required statistical tests to determine if the regression model did indeed encounter a problem with heteroskedasticity and autocorrelation . As expected, the results of the tests indicated the presence of these problems in the regression model . In order to correct for the heteroskedasticity and autocorrelation problems, this research used the robust standard errors for panel regression with cross - sectional dependence model . Although several components have likely contributed to the declining hiv rates in the pepfar focus countries, the main objective of this research was to determine whether pepfar was an effective factor in lowering the hiv / aids infection rates, and, if so, by how much . Table 4 provides the results from the fixed - effects panel regression analysis for models 1 and 2 . In model 1, pepfar funding per gdp was statistically significant at the 0.01 level . In model 2, pepfar funding per gdp and gdp per capita were statistically significant at the 0.01 level . Even though this research found correlation between hiv infection rates and pepfar funding, as the adage goes, correlation does not imply causation . Thus, the results must be considered in light of this caveat, as is the case with all empirical analyses . In model 1, the results illustrate that on average, ceteris paribus, for every 1 percentage point increase in pepfar funding per gdp a country received, the country s hiv infection rate decreased by 0.41 percentage points . The within r value for this model was 0.1684, indicating that 16.84% of the variability in the dependent variable was explained by the independent variables . In model 2, the results illustrated that on average, ceteris paribus, for every 1 percentage point increase in pepfar funding per gdp a country received, the country s hiv infection rate decreased by 0.355 percentage points . For every $1,000 increase in gdp per capita a country received, the hiv infection rate decreased by 0.37 percentage points . For every 1 percentage point increase in healthcare expenditure per gdp, the hiv infection rate decreased by 0.10 percentage points . The within r value for this model was 0.3733, indicating that 37.33% of the variability in the dependent variable was explained by the independent variables . Figure 1 provides graphs depicting a comparison between the amounts of pepfar funding received by the 12 countries in sub - saharan africa and the hiv rates from 2002 through 2010 . Even though pepfar funding had steadily increased for each of the countries, most of the hiv infection rates decreased slightly, but remained relatively steady overall . Comparison of hiv infection rates and pepfar funding the united states provided large monetary support toward the pepfar program . Even though the results indicated that pepfar was statistically significant, the evaluation of whether pepfar was politically and economically significant remains subjective . Some may argue that any decrease in hiv infection rates highlights the relevance of the continued efforts of pepfar, while others could argue that the large amount of money invested in pepfar should have generated larger decreases in the hiv infection rates in africa than the rates found in this study . Based on this research, the overall hiv rate decreased, but the large amount of money invested to combat hiv infections did not drastically lower the hiv infection rates . The success of combating hiv / aids involves the collaboration of many public and humanitarian organizations . Future research should include analysis on the impact of public sector agencies, universities, faith - based organizations, private contractors, and non - governmental organizations in this philanthropic mission . The center for global development released data that provided specific dollar amounts on how much pepfar funding was allocated to the different organizations from 2004 through 2006 in the categories of treatment, prevention, care, and other . Although the data is sparse, analyzing the data supplied by the center for global development would provide a better indication of the role and impact each sector had in the pepfar program . A clear understanding of the global impact with the struggle against hiv / aids and the role that pepfar has played in that struggle is appropriate for future public policies, legislation, and programs . To the degree that it succeeded, the objectives and intentions of pepfar were met through an embrace of global connections and cooperation in order to reduce the increasing spread of hiv / aids in sub - saharan africa . The global community is becoming more interconnected and societies are becoming mutually dependent on one another to combat health crises . The increase of social, economic, and political globalization broadens the realization that hiv / aids does not recognize race, gender, ethnicity, sexual orientation, or geographic borders . Pepfar had some impact on the hiv pandemic in the 12 focus countries in sub - saharan africa through increasing humanitarian funding, providing access to cost - effective arv medication, developing improved healthcare infrastructures, and implementing a number of prevention programs . Even though hiv / aids cannot be cured as of yet, there is intrinsic value in preventing the rapid spread of this malady . Although the programs and allocated funding of pepfar accomplished most of the stated objectives, there remains even more that needs to be accomplished, for hiv / aids continues to persist as a global pandemic presenting significant challenges . Despite a few limitations, this study was able to analyze and illustrate the relative effectiveness of pepfar funding in lowering the hiv infection rates on the continent of africa, and has hopefully provided valuable insight for future policy considerations . The objectives and intentions of pepfar were met through an embrace of global connections and cooperation in order to reduce the increasing spread of hiv / aids in sub - saharan africa.on average, ceteris paribus, for every 1 percentage point increase in pepfar funding per gdp a country received, the country s hiv infection rate decreased by 0.36 percentage points.for every $1,000 increase in gdp per capita a country received, the hiv infection rate decreased by 0.37 percentage points.for every 1 percentage point increase in healthcare expenditure per gdp, the hiv infection rate decreased by 0.10 percentage points . The objectives and intentions of pepfar were met through an embrace of global connections and cooperation in order to reduce the increasing spread of hiv / aids in sub - saharan africa . On average, ceteris paribus, for every 1 percentage point increase in pepfar funding per gdp a country received, for every $1,000 increase in gdp per capita a country received, the hiv infection rate decreased by 0.37 percentage points . For every 1 percentage point increase in healthcare expenditure per gdp, the hiv infection rate decreased by 0.10 percentage points.
Descriptive investigation of a cluster of 5 sfts cases following exposure to an index patient who died from the disease was performed . A 77-year - old male farmer who died from sfts five other cases in the cluster included a 32-year - old male intensive care unit (icu) physician (case 1), a 48-year - old male icu consultation physician (case 2), a 42-year - old younger son of the index patient (case 3), and a 45-year - old older son of the index patient (case 4), as well as a 43-year - old male mortuary beautician (case 5). The investigation included a review of circumstances and medical records, specimen collection, virus isolation, real - time polymerase chain reaction for viral rna detection, and sequencing and serological tests (capture enzyme - linked immunosorbent assay [elisa] for immunoglobin [ig] m antibody, antigen sandwich elisa for igg antibody, and microneutralization tests [mnt]). As for risk assessment of transmission factors, all contactors of the index patient during the period from the beginning (25 september 2010) to the end (8 october 2010) were classified through 3 types of contacts, including blood, droplet, and possible airborne contacts . The investigation was reviewed and approved by the ethics committee of china center for disease control and prevention (cdc), which uses international guidelines to ensure confidentiality, anonymity, and informed consent . The index patient was from an sfts - endemic region and first had onset of illness on 25 september 2010; was admitted to a local hospital on 28 september with a high fever of 39.5c and vomiting; and the infection was identified through initial laboratory testing of thrombocytopenia, leukocytopenia, and elevated aspartate aminotransferase level . The patient was diagnosed as a suspected sfts case, and transferred to the intensive care unit the next day, where he received ribavirin, dexamethasone, omeprazole, and cryoprecipitation for therapy . On 2 october 2010, his condition deteriorated with hypersomnia, shortness of breath, and mouth mucosal bleeding . On 3 october, he appeared confused and showed dyspnea, then was intubated and mechanical ventilated . On 4 october, the patient was in shock and comatose, developed disseminated intravascular coagulation and multiple organ dysfunction syndrome, and died the next day . An important observation was that the index patient had unique hemorrhagic symptoms, including bleeding from mouth mucosa, gastrointestinal lumen, and lungs, which was rare in previously identified sfts patients . The patient s fever remained high (39c40c) until death, although lowered somewhat by giving dexamethasone . Clinical laboratory values (table 1) showed unusually high level of tissue enzymes, blood urea nitrogen, and creatinine, which might indicate impaired liver, heart, and kidney functions . Consistent with the largely reduced platelet count, the index patient had a significantly elongated activated partial thromboplastin time, which represented a largely impaired coagulation function . Immediately after death, the corpse was transferred to the patient s home in a local village for a funeral ceremony, then transferred to a crematorium 3 days later . Laboratory analysis of a cluster of severe fever with thrombocytopenia syndrome patients in china alt, alanine aminotransferase; ast, aspartate aminotransferase; ldh, lactate dehydrogenase; aptt, activated partial thromboplastin time ., negative; +, weak positive; + + +, strong positive . Viral rna copies were calculated according to standard reaction curves, which were established using serially diluted in vitro rna transcripts as standard samples . Virus load was determined based on an average conversion coefficient between virus copies and virus titer presented as 50% tissue culture infective dose (tcid50/ml). Serum samples collected in the acute phase were subjected to immunoglobin (ig) m detection with igm antibody capture enzyme - linked immunosorbent assay (elisa), with horseradish peroxidase conjugated recombinant severe fever with thrombocytopenia syndrome bunyavirus (sftsv) nucleoprotein as the detection agent . Serum samples collected in the convalescent phase were subjected to igg detection with sandwich elisa by using recombinant sftsv nucleoprotein as the detection agent . Values for igm antibodies, igg antibodies, and mnt are the reciprocals of the serum dilution . Risk factors were assessed using logistic regression analysis; p <.05 was considered to be statistically different . Epidemiologic investigations began with interviews with 5 secondary sfts patients and 58 other individuals who had exposure to the index patient from onset of the illness until cremation . We found that all 5 secondary cases had possible blood contact through skin or mucosa . Case 1, the local icu doctor, performed the intubation for the index patient, resuscitating the patient before his death . Case 2, the consultant doctor, traveled from a nonendemic area to the local hospital for a medical consult with the patient, and the patient s blood dropped on his hand when he was helping an icu nurse draw blood without wearing gloves . Case 3, the younger son of the index patient, was a long - distance truck driver not living in the same village, and directly touched the blood flowing from the deceased patient s mouth and nose when he cried on the corpse . Case 4, the older son of the index patient, was also a long - distance truck driver, and took care of the dead body and was wiping off the blood from the face of the corpse . Case 5, a local mortuary beautician, did the make - up for the corpse with gloves and mask, but took them off twice during the procedure . The above 5 cases all developed the disease 715 days after exposure, with only 3 of them having contact with blood after death . In comparison with the index patient, all 5 secondary cases had minor clinical features (table 1), without obvious hemorrhagic manifestations, so they did not receive dexamethasone therapy . Except for the major risk factor of blood contact, droplet contact (n = 4), which included 3 medical staff who were involved in the intubation and the index patient s daughter who cared for him before death, in addition, the risk factor of possible airborne transmission (being in the icu room or funeral room without mask protection) was also assessed among all 63 exposed individuals . Of them, the medical doctors and nurses (n = 16) were with protection; and the others were without (n = 47), including icu patients who were staying in the same room (n = 8), family members (n = 3), and visitors to the funeral room where the corpse was kept (n = 35). The multivariate analysis (logistic regression analysis) showed that blood contact was the most likely mode of transmission (p <.001; table 1). It is noticeable that the serum collected from the index patient on the day he died contained a relatively high amount of sftsv, which reached about 3.55 10 viral rna copies / ml (calculated as 9.67 10 50% tissue culture infective dose [tcid50]/ml). This number was about 100 000-fold higher than viral copies detected in the serum samples of the 5 secondary patients, which ranged from 10 to 10 copies / ml (table 1). All 5 patients had virus - specific igm antibodies in the acute phase, and elevated virus - specific immunoglobin g (igg) antibodies in the convalescent phase . The index patient, however, had minimal or undetectable levels of virus specific igm antibodies on day 11 after onset of fever (table 1). Compared with the entire genomic sequence of the virus strain isolated from the index patient, cases 2 and 3 were nearly 100% identical, and provided genetic evidence for the epidemic findings on the possible transmission of sftsv from the index patient to secondary patients . Here, we reported the person - to - person transmission of sftsv with a cluster of 6 sfts patients that occurred in shandong province of eastern china . Investigation studies revealed that all 5 secondary infected patients had possible contact with the index patient s blood . Of them, only case 1 (icu doctor) had evidence of droplet contact contamination (during intubation) but not blood contact, but we included him also as a blood contactor because he performed intubation without protective face shield and goggles, therefore he had an extremely high risk of blood contact through unprotected skin and mucosa . The risk assessment revealed that blood contact was the major risk factor for the human - to - human transmission of sftsv . Additionally, 3 secondary patients who only had contact with the index patient after death were still infected, which indicated that sftsv - infected blood may remain infectious for a long time, even after patient death . It is notable that the level of virus copies in the index patient s serum was extremely high, but with no detectable igm or igg antibodies, which suggested that his immune responses to limit the replication of sftsv were severely impaired . The patient had no immune system disease, thus the minimal immune responses might be due to the early and sustained application of glucocorticoid, which has a side effect of repressing immune functions; clinical physicians should take note of this finding . Clinically, sfts is easily confused with hemorrhagic fever with renal syndrome caused by hantavirus and human anaplasmosis . The hantavirus - specific igm antibodies were not detected in the sfts patients serum samples (data not show). Due to the limitation of our study, we were not able to detect rickettsia infection, which was previously reported in outbreaks of nosocomial infections . However, the methods we used for diagnosis of sfts patients were well validated, and the human - to - human transmission of sftsv we described in this study could not simply be classified as being nosocomial transmission; specially, 3 of the 5 secondary cases that occurred in the household . Additionally, the lessons of person - to - person transmission of sftsv we learned from this study highlighted the necessity of establishing standard precautions for avoiding direct contact and blood - based transmission . This work was supported by the china mega - project for infectious diseases (2008zx10004 - 001, 2009zx10004) from the ministry of science and technology and ministry of health of the people s republic of china . Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.
Therefore, the mother's knowledge about child care influences the nature and quality of care that is given to the child . Several studies have revealed that the mothers level of education has a positive impact on her knowledge and how she deals with child health care issues. [213] our experience in pediatric practice has revealed significant gaps pertaining to child health issues in the mothers knowledge . There seems to have been very little improvement in the knowledge of mothers on common child health matters over the years inspite of the many years of girls education in the country . This descriptive cross - sectional survey aimed to answer the following questions: (1) what is the level of mothers knowledge of certain aspects of child health matters? (2) what are the main sources of health information and which ones are the most useful? (3) is there a correlation between mothers level of knowledge and the number of years spent in formal education? (4) in the mother's view, does the current formal education of girls in schools / colleges have a significant impact on mothers knowledge of child health matters . It was reviewed and refined by two other colleagues who have a lot of experience in pediatrics . The first part comprised information about mothers nationality, age, work, level of education and the number of children she has in addition to sources of health information and the role of formal school education in child health matters . The second part contained 40 statements about different aspects of child health issues including nutrition, immunization, development, accident prevention, certain neonatal and infants problems or behaviors and some common childhood illnesses . Mothers who attended with their children at the pediatric outpatient clinic of king khalid university hospital in riyadh during the months of july and august, in 2007, were invited to participate in the study . Those who agreed were interviewed by a trained non - medical research assistant using the items and statements of the questionnaire as a basis for the structured interview . It was indicated clearly to the mothers that participation was voluntary and their non- contribution would have no adverse effect on the quality of care given to their child in the hospital . They scored one point for each knowledge question answered correctly and zero for wrong and do not know answers . The first 20 questionnaires completed were used as a pilot test to evaluate the clarity of language and level of information in the questionnaire . Data was entered in ms excel and analyzed using spss pc 11.5 version statistical software . Descriptive statistics, mean and standard deviation and proportion were used to quantify the study and outcome variables . Demographic data regarding nationality, age, work, education, and number of children are represented in table 1 . As the main source of health information, 295 (80%) cited family members (grandmothers, mothers, sisters, relatives etc . ), 30 (8.2%) cited schools, 68 (17.2%) cited tv and radio, 60 (16%) cited journals and magazines, 52 (14.2%) cited friends, colleagues and other members of society, 101 (27.1%) cited books and only 25 (7.1%) cited health care professionals . Demographic data of the mothers two hundred twenty - five (60.6%) of the mothers believe that formal girls education in schools and colleges does not provide sufficient child health education . On the question of where to obtain useful information of child health, 287 (77.6%) of the mothers supported the increase in instruction on child health in the curriculum in schools, 284 (77%) supported specific courses on child health targeting girls and women, 321 (86.8%) supported the use of the mass media, and 311 (84.1%) supported programs run by health care professionals . The mean knowledge score of the total sample was 25 (out of 40), the minimum score obtained was 14 and the maximum was 36 . We found no statistically significant correlation between the total score on mothers knowledge or any of the items on the knowledge questionnaire and mothers level of education . Table 2 indicates total knowledge score in relation to mothers education, age and number of children . The results of mothers responses to individual items on the knowledge questionnaire are indicated in table 3 . Association between the scores of mother's knowledge and mother's age, educational status and number of children mother's response to the knowledge questionnaire incorrect knowledge on certain specific items of the questionnaire included 131 (35.1%) who believed that on most occasions, fever in children was a symptom of serious disease, 313 (83.9%) believed that the best method to treat a child with a fever was to bathe him / her with cold water or wipe with cold or iced cloth . Questions on diseases covered by the national vaccination program revealed that 285 (76.4%) believed that mumps was not targeted, 245 (65.7%) believed that tetanus was not targeted, 203 (54.4%) believed that whooping cough (pertussis) was not targeted and 241(64.6%) believed that diphtheria was not targeted by the national vaccination program . Three - hundred and five (81.8%) of the mothers believed that the best course of action for parents of a child who was due for a scheduled vaccination but has a fever, cough and runny nose (symptoms of upper respiratory infection) was to defer the vaccination until he was completely symptom free . On the question of conditions which were regarded as serious and warranted urgent attention by a doctor, 176 (47.2%) did not see the need for the newborn baby who was sleeping all the time and was not interested in feeding to be seen by a doctor . Another 82 (22%) disagreed with seeking medical help for a child who cries continuously, does not sleep and who has pain with every movement . Three - hundred and one (80.7%) of mothers believed that the appearance of jaundice on the first day of the life of a newborn was physiological (natural) and so nothing other than more frequent feeding and exposure to sunlight was required . It is noteworthy that more than 30% of the mothers believed that a newborn baby who passes stools after each feed, or a newborn who is otherwise healthy but has repetitive movements of the chin, or one who strains and becomes red in the face during defecation, or a breast fed baby who passes stools only once every 5 days, may have a serious illness and needed urgent medical attention . On feeding practices, 200 (53.6%) of the mothers believed that there was no harm in giving a child a bottle of milk at bedtime in bed or whenever he cried during sleep; 90 (24.1%) did not agree that the most acceptable time to start solid food for children was at 6 months of age, 225 (60.3%) agreed with force - feeding when children refused to eat . Results on the items on safety practices revealed that only 84 (22.5%) of the mothers believed that it was harmless to let babies sleep by their mothers in the same bed . One - hundred and ninety (50.9%) thought that it was not harmful to let babies sleep on their tummy in bed (prone sleep position). Two hundred two (59.5%) believed that putting a baby who crawls in a walker protected him from household accidents . Two - hundred and five (55%) believed that the best place for a baby / an infant to sit or be carried in a car was the mother's lap . Our results revealed that the mean score of the sample which was just above the cut - off score, was an indication of a satisfactory knowledge level . If it had been fixed at 20, the knowledge of more than 90% would have been satisfactory, on the other hand, if it had been raised to 30 the knowledge of only 12% would have been satisfactory . A closer look at some items revealed significant and sometimes serious gaps in the mothers knowledge . Similar gaps have been reported from different societies. [71521] our results indicated that a majority of mothers believed that the best method to treat a child with a fever was to bathe him with cold water or rub him with ice cold cloth . This was worse than that reported by al eissa et al where 50% of the parents would use cold water and 7% ice water for the treatment of fever . Impicciatore et al reported that 9% of the mothers used iced packing to reduce fever . Knowledge of the diseases covered by the national vaccination program revealed that a high proportion of mothers were not fully informed about certain diseases targeted by the program . Impicciatore et al reported that only 26% of italian mothers were able to state the vaccinations which were compulsory . Our results revealed no statistically significant correlation between mother s knowledge score and their level of education, age or number of children . This is similar to the results of jan et al (jeddah, ksa, 2000) who found no correlation between parents level of education and safety practices, but contrary to the finding of moawed et al (riyadh, ksa, 2000) who found a statistically significant correlation between mothers knowledge and their practices during infants diarrheal episodes and mothers age, education and birth order . It is also not in accord with shawky et al (jeddah, ksa, 2001) who reported on the effect of maternal education on the rate of childhood handicap and found that the risk of having a handicapped child declined sharply with the increase in the level of maternal education . One possible explanation of this difference in the results could be the use of different research methodology (sample selection, data gathering and others). It is worrying to find that the majority of mothers believed that jaundice on the first day of life of a newborn was physiological (natural) and required no more than frequent feeding and exposure to sun light . Also disturbing is the fact that nearly half did not realize that a newborn baby who slept all the time and was not interested in feeding could be seriously sick and needed to be seen urgently by a doctor; another quarter did not realize that a child who cried continuously, who did not sleep and was in pain with every movement was sick enough to require urgent medical attention . Dongre et al from rural india reported that 23% of mothers were not aware of any danger signs in a newborn such as, poor sucking, low birth weight, lethargy/ unconsciousness, rapid / difficult breathing . These were indicated as danger signs by 34.4%, 25.8%, 25.5%, 10.3% mothers respectively, while hypothermia and convulsions were referred to as danger signs by 10.3% and 8.6% mothers respectively . The majority of mothers cited family members as their main source of health information, which is higher than what was reported by al eissa et al, where some 35% of the parents mentioned friends and relatives as their main source of information . Only few mothers cited health care professionals as their main source of health information . In the report by impecciatore et al from italy, only 42% of the mothers said that the pediatricians had spontaneously spoken to them about vaccination during consultation with a child . Al eissa et al reported that only a group of 37% of parents cited medical personnel as their source of information . These findings reflect a lack of active educational intervention by professionals . It is encouraging to find that more than three - fourths of the mothers believed that it was harmful to let babies sleep with them in the same bed . This is contrary to the finding of jan et al on which 75% of the mothers reported sleeping next to their infants in the same bed, though it is difficult to discern whether mothers were compelled to do so by social circumstances or they believed it was safer for their infant . Around two - thirds believed that schools did not provide sufficient information on child health and more than two - thirds supported the increase of education of child health in the curriculum of schools . According to kolbe, behaviors and attitudes about health that began during childhood were responsible for most of the deaths, illnesses and disability . Comprehensive health education programs in schools represent one effective way of providing students with the knowledge and skills to prevent health - impairing behavior . Several previous studies stressed that health education in school curricula was not adequate, and that the knowledge of high school girls and university students on health matters was deficient. [2730] furthermore, studies have shown that school teachers were not trained to give health education in schools . Their college curriculum did not equip them for such a role and so the teachers refrained from teaching health subjects . According to summerfield and others hundreds of studies have evaluated health education and concluded that it was effective, but its effectiveness depended upon factors such as teacher training, comprehensiveness of the health program, time available for instruction, family involvement and community support. [253234] the responsibility for health education was not to be left solely to schools . In addition to all other sectors of the community, health care personnel and other health care institutions should play a major role in health education . Milaat et al, agble et al and kari et al, reported successful involvement of health care personnel and medical students in targeted health education classes for school children and university students . Such efforts may prove more effective than formal general health education classes taught by uninterested, unenthusiastic, untrained school teachers . Every visit to a health care professional or every health care facility or institution by patients / parents should be an opportunity for the delivery of a short course in health education . Possible limitations of the study are that the sample of mothers selected may not have been representative of the community; mothers who volunteered to participate in the survey may prove to be different from the non - participants . Whether the respondents were serious in completing the questionnaire and whether research assistant had influenced the responses of the mothers to the questionnaires is not known . It also revealed that health education in schools was deficient and it also exposed the limited involvement of health care personnel and institutions in health care education . There is a need for health education programs that target high school girls, university students, mothers and other caregivers (e.g. Fathers). These should be delivered by trained personnel in classes, courses, and special sessions . In addition, health care facilities should be reformed to make health education an essential and compulsory part of health care delivery . Involvement in these educational activities should be a mandatory requirement for the issue of a license to practice.
Indications for covered self - expandable metallic airway stent removal include recurrent mucous plugging of the stent, excessive or recurrent granuloma formation, migration of the stent, stent infection, recurrence of stenosis, stent failure, stent fractures and accomplishment of treatment . Usually, it is tedious to remove a stent because of their embedding in the bronchial mucosa and epithelization of the inner surface . Granuloma formation at the extremities is a relative common occurrence in covered metallic stents possibly resulting from the radial force applied against the airway wall and the friction exerted . We report a case of covered self expandable metallic stent removal with a rigid bronchoscope under general anesthesia . The case is unique because it had almost all the common complications associated with the stent placement but it was successfully removed without much ado . To the best of our knowledge this is the first case of successful removal of a complete stent reported from india . A 21 year old female presented with complaints of increasing dyspnoea and cough with pain chest for last two weeks . Patient had a past history of benign tracheal stenosis which was opened up by endobronchial electro surgery followed by placement of a self expandable metallic airway covered stent . X - ray chest done one and a half year back showed stent well in place [figure 1]. X - ray chest done one and a half year back showing stent well in place bronchoscopy was done under local anesthesia and a stenosis was observed well above the level of the stent [figure 2] with granulation tissue inside the stent [figure 3], lower end of the stent was fractured, carina was not visualized and stent was seen entering upper part of right main bronchus [figure 4]. The beveled edge of the rigid scope was advanced between the stent wall and the airway mucosa thus creating a space between them . The circular extraction loop at the upper end of the metallic stent was grasped with a rigid optical alligator forceps and pulled in the lumen of rigid bronchoscope with continuous winding movements gradually separating the stent from the tracheal wall . Immediately after that this is one of the rare cases of successful removal of self expandable metallic airway covered stent in benign tracheal stenosis . Stenosis above the level of the stent granulation tissue inside the stent and at the margins fracture of stent at its lower end (stent is seen at upper part of right main bronchus, carina is not visualized) the stent after removal the management of patients with tracheal / bronchial strictures of benign etiology can be quite challenging . Though surgical tracheal sleeve resection and reconstruction remains the gold standard for most benign airway strictures, non - surgical modalities such as laser photocoagulation and resection, balloon dilatation, electrocautery and stenting of the airway have been developed to deal with airway stenosis . Various inoperable benign airway disorders are considered for airway stenting, like post intubation tracheal stenosis, tracheal burn or trauma, tracheo - broncho - malacia and extrinsic compression of trachea . Though silicone prostheses are considered to be first choice in benign diseases their use is less suited, especially in airway wall malacia or distal and angular stenosis where sems are preferred . The disadvantages of the silicone stents are high migration rate, small lumen to wall thickness ratio and difficulty in clearing the secretions . On the other hand, the major drawback for placement of sems in benign situations is their difficult repositioning and removal in situations like excessive granulation tissue, stent fractures and stent migration . The complications of stent removal include significant oozing, tracheal mucosal dehiscence, tracheal puncture requiring thoracotomy, retained stent pieces, need for restenting, respiratory failure, tracheotomy, and even death . In our case, various authors have come up with different methods of removal of the stent, like the technique of nashef et al ., which was similar to that of rolling spaghetti on a fork, but much more difficult and at least equally messy . They further observed that there may be several fractures of the stent, which have to be removed piece by piece . In our case filler et al ., used a metal suction catheter to dissect the stent from the airway wall before extraction with the forceps . Zakaluzny et al ., employed a rigid suspension laryngotracheoscope and used optical forceps to dissect the stent from the airway wall . Alligator forceps were then employed to grasp and extract the stent through the rigid scope while the scope was advanced further into the airway . We first separated the stent from the tracheal wall and then removed all the works (scope, forceps and the stent) in one piece . To conclude, this case is unique for many reasons, firstly, it had almost all of the complications that can be associated with stent placement (stenosis of trachea at the upper end of the stent, extensive granuloma formation, migration of the stent downwards and fracture of the stent at its lower end), secondly, we were able to remove the stent in toto [figure 5] and lastly, there were no complications after removal of the stent . Further studies are needed to re evaluate their removal successfully and safely and to produce better designed and technically superior stents like bio - absorbable stents which may not have to be removed at all.
Takayasu's arteritis (ta) is a chronic idiopathic occlusive inflammation of aorta and its major branches predominantly affecting females in over 85% of cases . The major clinical finding is loss of palpable pulses in the upper limbs and neck . The unsuspected ischemia of vital regional vascular beds may render these patients at risk for inappropriate management . This case report describes the management of a trauma patient in whom the diagnosis of ta was established by specific investigations done for the same . The role of meticulous monitoring and importance of anticipation of such disease for prompt diagnosis and management is emphasized . A 26-year - old female was brought to the emergency room (er) with history of motor vehicle accident . On initial evaluation her physical examination revealed unrecordable upper limb peripheral pulses and blood pressure, although lower limb pulses were easily palpated . The radiological investigations revealed multiple left - sided rib fractures with bilateral pleural collections and small lung contusions . After infusion of two liters of lactated ringer's solution, her blood pressure (bp measured in right upper limb) increased to 80/50 mmhg and heart rate (hr) was 140/min . She also had shaft and inter - trochanteric femur fractures on the right and left side, respectively . Focused assessment sonography in trauma (fast) was negative and x - ray of the pelvis was normal . Bilateral chest tubes were inserted and the patient was transferred to the intensive care unit (icu) with ongoing resuscitation with fluids, blood products and dopamine infusion (7 g / kg / min). Fluid resuscitation was continued to maintain a central venous pressure (cvp) of around 10 mmhg . Invasive arterial blood pressure monitoring was established via the right femoral artery and the bp recorded was 140/90 mmhg . Dopamine infusion was then discontinued and thereafter the patient was subjected to arterial doppler and computed tomography (ct) angiography studies to rule out traumatic aortic rupture as a differential diagnosis . Arterial doppler showed low - velocity monophasic flow in bilateral axillary, brachial and ulnar arteries . The erythrocyte sedimentation rate (esr) and c - reactive protein (crp) were normal . Electrocardiography (ecg), 2d echocardiography (2d echo) and funduscopy were normal . Thoracic epidural catheter was inserted for pain relief with continuous infusion of 0.125% bupivacaine and fentanyl (2 mcg / ml). Epidural catheter was removed on 5 day of hospitalization and patient was moved to the ward in a stable condition with advice for regular follow - up and advised to check bp measurements in the lower limb if ever required . The occlusive thromboaortopathy (ta) is a group of diseases in which there is no or feeble pulses in upper half of body . The natural course of disease often gives rise to four main complications: takayasu's hypertensive ischemic retinopathy, secondary hypertension, aortic regurgitation and aortic or arterial aneurysm . Most patients with ta present during their child - bearing age, and a high index of suspicion is required to make an early diagnosis . Patient may be entirely asymptomatic and the incidental finding of unequal pulse and blood pressure in upper and lower limb, bruit and hypertension may prompt further evaluation . Stroke, congestive heart failure, and rarely ruptured aneurysm may be the heralding events . Hemorrhagic shock is the commonest type of shock in trauma patients . Any hypotensive trauma patient is presumed to be hypovolemic and resuscitative attempts are made with fluid infusion as was with our patient . There was no contributory past history of symptoms or signs suggestive of ta in our patient . A cvp of around 10 mmhg suggested a normovolemia status unlike the impression got by the low blood pressure (as recorded in upper limbs). The presence of tachycardia in our patient could be attributed to pain and anxiety associated with trauma . There was no fall in hematocrit from the baseline (perhaps due to hemo - concentration). Dopamine infusion was started in our patient in an attempt to maintain perfusion and restore blood pressure but was discontinued when invasive monitoring revealed a normal bp . Normal value of esr and c - reactive protein suggested that the disease was not active at that moment . Our patient was perhaps asymptomatic for the disease and was incidentally diagnosed during workup after trauma . But ta as a differential diagnosis of exclusion may be considered for a pulseless trauma patient . Normocytic normochromic anemia, hyper - gammaglobulin, and elevated esr may occur, but are not pathognomonic . Medical treatment includes corticosteroids, anticoagulants and symptomatic therapy for which anti - hypertensive agents, digitalis and antibiotics are frequently used . Follow - up in cases of ta includes monitoring for disease activity and its complications like hypertension, organ failure, seizures etc . Long - term complications of corticosteroid use are also to be considered in the follow - up . Anesthesiologists may encounter these patients in operation theater for anesthesia or in icus or emergency units after trauma or after one of its complications like a ruptured aneurysm . Tas may be considered as a differential diagnosis in trauma patients, if examination reveals hypotension or unequal peripheral pulses in upper and lower limb in a young adult, provided hypovolemic shock is excluded . A thorough detailed physical examination with palpation of all the peripheral pulses as stressed in atls guidelines is reemphasized . Following the basic atls guidelines would assist clinicians in picking up this discrepancy as part of their routine evaluation for all trauma patients . Then, the clinician may suspect an atypical cause for hypotension if a blood pressure cuff on an upper extremity is reading a hypotensive measurement but the patient has strong, 2 + pulses in the lower extremities . These patients may be issued a special identification card containing the details of the disease and treatment course for future reference.
Neurotransmitters (nts) are signaling molecules, which play pivotal roles in neuronal communications in the central nervous system [1, 2]. It is reported that changes in nts quantitation in several brain regions involve the development of many psychiatric diseases and neurodegenerative diseases [3, 4]. Generally, neurotransmitters are classified into two categories based on their chemical styles: (i) the small molecules (dopamine (da), serotonin (5-ht), norepinephrine (ne), epinephrine (ep), glutamate (glu), -aminobutyric acid (gaba), histamine, and endocannabinoids and (ii) the neuropeptides (enkephalin, endorphin, and substance p). The quantitation of various nts as a small molecule in the brain, especially the aromatic monoamines, should be measured by using high - pressure liquid chromatography (hplc) separation coupled with amperometric electrochemical detection (ecd). This method has been applied in nts analysis over the last three decades [68]. However, it is still rather difficult to determine different types of nts simultaneously in one sample owing to the limited capability of accommodating changes in the mobile phase composition . Another difficulty of incorporating this method is that the analytes can only be identified by a stable retention time matching . Nevertheless, tandem mass spectrometry (ms / ms) can provide high specificity due to additional structure information and high sensitivity . Therefore, it has been commonly used for the quantification of nts in the brain by coupling with both gas chromatography (gc) and liquid chromatography (lc) [5, 11, 12]. Owing to various efficiencies and time consumption of derivatization, a simplified sample preparation using liquid chromatography coupled with electrospray tandem mass spectrometry (esi - ms / ms) is widely employed to quantify the nts and their metabolites in the brains without derivatization [5, 9, 13]. The use of isotope labeled internal standards is vital to the enhanced method performance because the isotope ratio measurements provide a measure of quality control for each analyte by compensating for changes in analyte, retention time, recovery, degradation, and changes in detector responses caused by coeluting contaminants . In this study, we developed a sensitive, simple, and simultaneous method to quantify the six major nts such as da, 5-ht, ne, ep, glu, and gaba in mouse brains [14, 15]. In addition, a tetrahydrobiopterin (bh4), a vital cofactor for the biosynthesis of the da, 5-ht, and ne, was also measured in the same sample . To establish a novel method for the direct measurement of biologically active levels of bh4, da, 5-ht, ne, ep, glu, and gaba in the brain samples, the present study was performed using a high efficiency hilic column for bh4 and da, a luna 3 c18 (3.0 mm 150 mm, i.d ., 3 m) column for 5-ht, ne, ep, glu, and gaba with reversed - phase hplc separation and an esi - ms / ms, which could minimize the sample interferences . At the same time, the multiple reactions monitoring (mrm) scan mode was sensitive enough to identify and quantify the bh4 and nts in this new method . The (6r)-5,6,7,8-tetrahydrobiopterin dihydrochloride, dopamine hydrochloride, serotonin hydrochloride, ()-norepinephrine, ()-epinephrine, d - glutamic acid, and -aminobutyric acid were purchased from sigma - aldrich corporation (st . Louis, mo, usa). Internal standards (is) with isotope labeling were 2-(3,4-dihydorxyphenyl) ethyl-1,1,2,2-d4-amine hcl (dopamine - d4, 98% at% d); serotonin-,,,-d4 creatinine sulfate complex (serotonin - d4, 98% at% d); ()-norepinephrine-2,5,6,,,-d6 hcl (norepinepherine - d6, 98% at% d); ()-epinephrine - d3 (n - methyl - d3) (epinephrine - d3, 98% at% d); l - glutamic-2,3,3,4,4-d5 acid (glutamate - d5, 98% at% d); 4-aminobutyric-2,2,3,3,4,4-d6 acid (-aminobutyric acid - d6, 98% at% d). Epsilon - acetamidocaproic acid (aaca) was donated by kuhnil pharmaceuticals (seoul, korea). Water was purified with a milli - q water purification system (millipore, bedford, ma, usa). Full - scan positive mass spectra of bh4 and the is (aaca) reveal the protonated molecules, [m + h], of m / z 242.1 and 174, respectively . The mass - to - charge ratios of fragments of bh4 after fragmentation were 166, 107, and 149 and fragments of is were 114, 156, and 79 . The most abundant ion in the product ion spectra was 114 for is (figure 1(a)) and 166 for bh4 (figure 1(b)). In parallel, full - scan positive mass spectra of bh2 and the biopterin showed the protonated molecules, [m + h], of m / z 240.0 and 238.0, respectively . The mass - to - charge ratios of fragments were 196.0, 164.9, and 168.0 in bh2 and of 177.9, 193.9, and 192.0 in biopterin . The most abundant ion in the product ion spectra was 196.0 for bh2 (figure 1(c)) and 177.9 for biopterin (figure 1(d)). Full - scan positive mass spectra of da and the is (dopamine - d4) showed that m / z of protonated molecules [m + h] are 154.1 and 158.1, respectively . The mass - to - charge ratios of fragments of da after fragmentation were 137.0, 90.9, and 64.9 and of da - d4 141.0, 95.0, and 67.9 . The most abundant ion in the product ion spectra was 137.0 for da (figure 2(a)) and 141.0 for is (figure 2(b)). But da mrm had 154.1 to 90.9 due to matrix effects, which increased the mass - to - charge ratio level . Full - scan positive mass spectra of 5-ht and the iss (serotonin - d4) showed that the mass - to - charge ratios of protonated molecules [m + h] were 177.0 and 181.0, respectively . After fragmentation, fragments of 5-ht seen were m / z 160.0, 114.9, and 132.0 and fragments of 5-ht - d4 m / z were 164.0, 118.0, and 136.0 . The most abundant ion in the product ion spectra was at 160.0 for 5-ht (figure 2(c)) and at 164.0 for is (figure 2(d)). Full - scan positive mass spectra of ne and the is (norepinephrine - d6) showed that the mass - to - charge ratios of protonated molecules [m + h] were 170.1 and 176.1, respectively . After fragmentation, fragments of ne were m / z 152.0, 107.0, and 76.9 and fragments of ne - d6 m / z were 158.0, 111.0, and 112.0 . The most abundant ion in the product ion spectra was at 152.0 for ne (figure 2(e)) and at 158.0 for is (figure 2(f)). But m / z 170.1 to 107.0 and 176.1 to 111.0 was selected for ne and is (ne - d6) mrm due to matrix effects, which increased the mass - to - charge ratio level . Full - scan positive mass spectra of ep and the is (epinephrine - d3) showed that the mass - to - charge ratios of protonated molecules [m + h] were 184.1 and 187.1, respectively . The m / z of fragments of ep after fragmentation were 166.0, 76.9, and 107.0 and of ep - d3 169.0, 76.9, and 107.0, respectively . The most abundant ion in the product ion spectra was at 166.0 for ep (figure 3(a)) and at 169.0 for is (figure 3(b)). Full - scan positive mass spectra of glu and the is (glutamate - d5) showed that the mass - to - charge ratios of protonated molecules [m + h] were 148.0 and 153.0, respectively . The mass - to - charge ratios of fragments of glu after fragmentation were 129.0, 83.9, and 55.9 and of glu - d5 were 135.0, 84.8, and 88.0, respectively . The most abundant ion in the product ion spectra was at 129.0 for glutamate (figure 3(c)) and at 135.0 for is (figure 3(d)). But m / z 148.0 to 84.0 and m / z 153.0 to 88.0 for glutamate and is (glutamate - d5) mrm were selected due to matrix effects, which increased the mass - to - charge ratio level . Full - scan positive mass spectra of gaba and the is (gaba - d6) showed the protonated molecules, [m + h], of m / z 104.0 and 110.1, respectively . The mass - to - charge ratios of fragments of gaba after fragmentation were 87.0, 44.9, and 85.0 and of gaba - d6 were 93.0, 49.0, and 91.9, respectively . The most abundant ion in the product ion spectra was at 87.0 for gaba (figure 3(e)) and at 93.0 for is (figure 3(f)). Individual stock solution of each nt and isotope - labeled standard was prepared by accurate weighing of each compound (1 mg / ml methanol as the stock solution). The solution of bh4, da, 5-ht, ne, ep, glu, and gaba was prepared as a stock (1 mg / ml of each) with pure acetonitrile and then diluted with acetonitrile (50%) for each experiment . Standard solutions of bh4, da, 5-ht, ne, ep, glu, and gaba for calibration curves were prepared by spiking the blank solution prepared to the appropriate amounts, but added volumes were less than 10% of total dw volume . The final yielding concentrations for the standard curve were 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, and 10000 ng / g for bh4 and dopamine . In parallel, the final concentrations for the standard curve were 20, 50, 100, 200, 500, 1000, 2000, 5000, and 10000 ng / g for 5-ht, ne, and ep . Likewise, the final concentrations for the standard curve were 0.2, 0.5, 1, 2, 5, 10, 20, 50, 100, and 200 g / g for glu and gaba . The tolerance for reliable detection was 10 ng / g for bh4 and dopamine, 20 ng / g for 5-ht, ne and ep, and 0.2 g / g for glu and gaba . The linear ranges and correlation coefficient of the calibration curve were summarized in table 1 . Icr mice (male, body weight 2030 g, n = 24), (daehanbiolink inc ., chungju, south korea), were used . The mice were kept under a controlled condition (ambient temperature of 20 to 25c, 12-h light / dark cycle). Nih's guidelines for animal research were followed for all animal procedures and were approved by institutional animal care and use committee (iacuc; dku-12 - 018) which adheres to the guidelines issued by the institution of laboratory of animal resources (ilar). The specific brain regions of mouse were quickly dissected on an ice bath and, subsequently, isolated brain tissues were homogenized with acetonitrile (1 mg/10 l) according to the internal standard (aaca: 100 ng / ml; dopamine - d4, serotonin - d4, norepinephrine - d6, epinephrine - d3, glutamate - d5, and gaba - d6: 1 g / ml). After a thorough homogenization, the bh4 and nts (da, 5-ht, ne, ep, glu, and gaba) from brain tissues were extracted by sonication for 60s . The homogenates of brain tissue were centrifuged at 12,000 rpm for 10 min at 4c . Supernatants were carefully transferred to 96-well plates and then injected onto the lc - ms / ms system by an autosampler for subsequent analysis . For determination of bh4 and nts in mouse brain tissues, d - water was used as blank matrix . The liquid chromatographic system used was the accela system (thermo fisher scientific inc ., waltham, ma, usa), equipped with a nanospace si-2 3133 solvent delivery module as an autosampler (shiseido inc ., japan) and connected to discovery max (thermo fisher scientific, inc .) Quadrupole tandem mass spectrometer coupled with electrospray ionization (esi - ms / ms). System control and data analysis were performed using the xcalibur software (thermo fisher scientific, inc . ). Chromatographic separation was achieved using hydrophilic interaction chromatography (hilic) sepax polar - imidazole (2.1 mm 100 mm, i.d ., 3 m particle size) hplc column (sepax technologies, delaware, usa) to assay bh4 and dopamine, and luna 3 c18 (3.0 mm 150 mm, i.d ., 3 m particle size) to assay serotonin, norepinepherine, epinephrine, glautamte, and gaba with a phenomenex c18 guard column (4 mm 2 mm, phenomenex). A nanospace si-2 3004 column oven (shiseido, japan) was used online . To assay bh4 and dopamine, the mobile phase consisted of 10 mm ammonium formate (ph 3) in an acetonitrile / water (75: 25, v / v) mixture . The flow rate was 300 l / min and the injection volume was 5 l . To assay 5-ht, ne, ep, glu, and gaba, the mobile phase consisted of an acetonitrile / water (20: 80, v / v) mixture . The flow rate was run at 350 l / min and the injection volume was 5 l . The electrospray ionization (esi) mass spectrometer was operated in the positive ion mode . The optimal condition was as follows: the esi needle spray voltage was 4000 v, the sheath gas pressure 35 unit, the auxiliary gas pressure 20 unit, the capillary temperature 206c, the collision gas (ar) pressure 1.5 mtorr, the skimmer offset 5 v, and the chrome filter peak width 10 s. scanning was performed in profile mode with the sim width 0.700 fwhm, scan time 0.200 s, and scan width 0.5 da . It was successful to qualify bh4 using hydrophilic interaction chromatography (hilic) sepax polar - imidazole (2.1 mm 100 mm, i.d ., 3 m particle size) hplc column (sepax technologies, delaware, usa). Moreover, the peaks had a symmetric shape, and we confirmed the lc - ms / ms chromatogram of bh4, aaca, da, and da - d4 (figure 4). Following the same strategy, we analyzed successfully for 5-ht, ne, ep, glu, and gaba by using luna 3u c18 (3.0 mm 150 mm, i.d ., 3 m particle size). The whole validation experiments followed the guideline of fda (us) [guidance for industry; handling and retention of ba and be testing samples], may 2004 . Linear regression of the ratio of peak area of bh4 or nts to that of is was done with weighting of 1/x (least - squares linear regression analysis, where x is the concentration of the analyte). Precision and accuracy were evaluated by three different concentrations of qc solutions: interday precision was evaluated for 5 replicates per a single concentration . The value of accuracy was expressed as the mean of 25 replicates of determined concentration from 5 different analytical tests to the qc concentration (table 2). All the values, tables, and figures given in the text are expressed as mean sd . Statistical differences between means were evaluated with two - tailed student's t - test . For simple sample preparation, protein precipitation was attempted using acetonitrile . To prevent sample degradation and oxidation, an ascorbic acid with 0.01% (w / v) the peaks of bh4, dopamine, and is were best when acetonitrile was used for protein precipitation and as an organic solvent of the mobile phase when using the hilic column (polar - imidazole, 2.0 mm 150 mm; i.d ., 3 m) (figure 4). Because bh4 and dopamine are easily dissolved in water, they are difficult to match the reverse column (c18) in chromatography analysis the other nts (5-ht, ne, ep, glu, and gaba) were matched with a c18 column (luna 3 c18 (3.0 mm 150 mm, i.d ., 3 m particle size)) (figure 5), but the hilic column could not separate peak of nts clearly . The optimized electrospray ionization condition should be sensitive enough to detect bh4, da, is, bh2, and biopterin in positive ion detection mode . The most abundant protonated ion peaks ([m + h]) in the q1 mass spectra of bh4, da, is, bh2, and biopterin were at 242.1, 154.1, 174.0, 240.0, and 238.0, respectively (figures 1 and 2). The product ions in q3 mass spectra and proposed fragmentation patterns were bh4, which becomes at 2-amino-7,8-dihydropteridin-4(1h)-one of m / z 166.0 by losing propane-1,2-diol . Da becomes butane-1,2-diol of m / z 90.9 by losing (e)-3-methylpent-3-en-1-amine; is, (e)-n - ethylidenepentan-1-amine of m / z 114.0 by losing both carboxyl and hydroxyl groups; bh2, 2-amino-7,8-dihydro-6-(hydroxymethyl)pteridin-4(1h)-one) of m / z 196.0 by losing propan-2-ol; biopterin, 2-amino-6-(hydroxymethyl)pteridin-4(1h)-one) of m / z 196.0 by losing propan-2-ol . Also, to confirm separation between bh4 and other biopterins in biological samples, experiments were previously conducted to quantify biopterin, bh2, and bh4 in a mixed matrix . The optimized electrospray ionization condition should be sensitive enough to detect bh4, da, 5-ht, ne, ep, glu, gaba, and iss with positive ion detection mode . The most abundant protonated ion peaks ([m + h]) in the q1 mass spectra of bh4, da, 5-ht, ne, ep, glu, gaba, and iss are listed in table 3 . The product ions and collision energy in q3 mass spectra of bh4, da, 5-ht, ne, ep, glu, gaba, and iss were listed in table 3 . Previously, our lab reported bh4 and dopamine levels in rat brain region . To extend this method to mouse brain regions, we applied it the bh4 and nts in the mouse brain . The peak areas of the spiked standard were constructed by subtracting the corresponding areas derived from the matrix . Meanwhile, calibration using internal standardization with deuterated analogues was performed . In biological specimen analysis, the isotope - labeled analogues of the targeted analyte are often recommended . Due to their similar physicochemical properties, compared to deuterated analogues, the variability during sample preparation and ionization efficiency in the transfer of analytes from liquid to gas could be compensated for, and they could be differentiated ideally by their distinct mass - to - charge (m / z) ratios . All analytes were subjected to hplc - ms / ms analysis, and their distinct mass - to - charge (m / z) ratios were determined . There are representative lc - ms / ms chromatograms of bh4, da, and iss (aaca and dopamine - d6) in the dw matrix (figure 4). Also, there are 5-ht, ne, ep, glu, gaba, and iss lc - ms / ms chromatograms in the dw matrix (figure 5). We tested the newly developed method using olfactory bulb (ob), frontal cortex (fc), hippocampus (hp), striatum (st), hypothalamus (ht), pituitary gland (pt), midbrain (mb), cerebellum (cb), and brainstem (bs) from the mice and subsequently confirmed that the quantity of bh4 and nts (table 4). Eight different concentrations from 10 to 2000 ng / g of bh4, from 10 to 5000 ng / g of da, from 20 to 10000 ng / g of 5-ht, ne, and ep, and from 0.2 to 200 g / g of glu, gaba is plotted against is for the standard curves . The correlation coefficients (r), lod, and loq of the standard curve are shown in table 1 . The lc - ms / ms methodology was used to measure the levels of bh4 and nts in nine brain regions including ob, fc, hp, st, ht, pt, mb, cb, and bs from mice . The newly - developed lc - ms / ms method was used to analyze the quantity of bh4 and nts in mice brain regions (table 4). The endogenous levels of bh4, da, 5-ht, ne, ep, glu, and gaba were successfully detected and measured in mice brain regions . The present study was undertaken in order to describe a sensitive and specific lc - ms / ms method for simultaneous detection of bh4, da, 5-ht, ne, ep, glu, and gaba from mouse brain tissue . The principal advantages of using lc - ms / ms method include a simple purification procedure and a simple chromatographic condition using the mrm scan mode . The use of a hilic column overcame the limitations of separating hydrophilic materials . Therefore, hilic column could separate bh4 and da from matrix effect with an appropriate retention time . The other nts (5-ht, ne, ep, glu, and gaba) were matched well with a luna 3 c18 column . So, the current developed method should be very useful for brain tissue works of research, regarding the analysis of the alternation of the levels of bh4, da, 5-ht, ne, ep, glu, and gaba . This new method can enable measurement of bh4 and nts rapidly and accurately in brain tissues . Previously, bh4 levels have been indirectly calculated by measuring the concentrations of biopterin in biological samples . However the limitation of this indirect method is that it is unable to measure the exact bh4 levels owing to rapid oxidation and degradation . To avoid the problem, we tested several experimental conditions and found that a low temperature is a critical factor to prevent decomposition of bh4 in the brain tissues extract . But the addition of antioxidant (dte) and/or acid (hcl) to the samples does not affect dramatically the stability of bh4 . Keeping the treated extracts at 4c is necessary and enough to maintain bh4 stable for 4 hours, which is long enough to finish the analysis of the targets in samples . By using hilic column, bh4 and da were separated into single peaks . Under other methods, many unknown materials in the biological matrix interfered with the analysis of bh4 and da in the biological samples . But the use of a hilic column could overcome the limitation to separating hydrophilic materials . So, hilic column could separate successfully the bh4 and da from matrix effect with an appropriate retention time (figure 4). In addition, it could increase the sensitivity, selectivity, and accuracy of bh4 and da in brain samples using mrm scan mode . Using luna 3 c18 column, 3 m particle size), 5-ht, ne, ep, glu, and gaba were separated into single peaks . Also, the luna 3 c18 column could separate nts from matrix effect with an appropriate retention time, and the usage of mrm scan mode could increase the sensitivity, selectivity, and accuracy of nts detection in brain samples (figure 5). The levels of bh4 and nts were measured in several brain sections by using the newly - developed experimental method (table 4). The bh4 is an essential cofactor for the aromatic acid hydroxylases, which are essential in the formation of nts (da, 5-ht, and ne), as well as for nitric oxide synthase (nos), a vital enzyme for normal vascular and cardiac nitric oxide . Therefore, it is necessary to reliably measure the biological concentration of bh4 for the evaluation of various diseases and for screening potential therapeutic candidates in neurological diseases . These results showed that the bh4 level was at its highest in olfactory bulb, followed by cerebellum, frontal cortex, striatum, midbrain, pituitary gland, hypothalamus, brainstem, and hippocampus in a decreasing order . However, the da level was at its highest in striatum, followed by hypothalamus, midbrain, pituitary gland, and olfactory bulb in a decreasing order . Interestingly, there were no detectable da in hippocampus, frontal cortex, cerebellum, and brainstem . However, the lower limit of quantification in our method is 10 ng / g in samples . Therefore, even though there are some da transmissions in these regions, the amount of da in hippocampus, brain cortex, and brainstem could be below 10 ng / g . These data indicate that the level of bh4 could be distinctly correlated with the level of da in the mouse brain tissue . The 5-ht levels were at their highest in midbrain and brainstem, followed by hypothalamus, striatum, hippocampus, frontal cortex, occipital lobe, and cerebellum in a decreasing order . The ne level was at its highest in hypothalamus and pituitary gland, followed by brainstem, midbrain, olfactory blub, cerebellum, striatum, and frontal cortex in a decreasing order . The ep level was at its highest in hippocampus, followed by hypothalamus, brainstem, midbrain, olfactory blub, frontal cortex, and pituitary gland in a decreasing order . However, there was no detectable ep in cerebellum; the levels of ne and ep have similar order in mouse brain sections . The glu level was at its highest in hippocampus, followed by frontal cortex, striatum, hypothalamus, cerebellum, midbrain, brainstem, olfactory blub, and pituitary gland in a decreasing order . The gaba level was at its highest in hypothalamus, olfactory bulb, and hippocampus, followed by midbrain, frontal cortex, striatum, cerebellum, striatum, and brainstem in a decreasing order . Interestingly, the levels of glu and gaba were detected as microgram based units, but others were detected as nanogram based units . These results suggested that the neurotransmitters in mouse brain were differentially released to do their function in brain sections . However, a simple and rapid liquid chromatography tandem mass spectrometry (lc - ms / ms) method has been developed for the determination of bh4, da, 5-ht, ne, ep, glu, and gaba in mouse brain; the quantitative determination of endogenous neurotransmitters in brain regions by chromatographic coupled mass spectrometry presented here still has a limitation because of the typical lack of analyte - free matrix . There is no analyte - free sample of the authentic matrix; therefore, we have to use a surrogate matrix containing the authentic analyte . A simple and rapid liquid chromatography tandem mass spectrometry (lc - ms / ms) method has been developed for the determination of bh4, da, 5-ht, ne, ep, glu, and gaba in mouse brain using epsilon - acetamidocaproic acid (aaca) and isotopically labeled neurotransmitters as an internal standard . Although it is clear that further studies are necessary to understand the physiological meaning of the different levels of bh4 and nts, this new method could be applied for tracking the changes of the endogenous bh4 and nts which are affected significantly by various stimuli or in neurodegenerative diseases [10, 23].
It plays several important physiological and pathological roles in not only reproductive system but also other systems . Estrogen disorder results in various diseases, such as endometrial diseases, skeletal diseases, and reproductive system tumors . Increasing attention has been paid to revealing of the functions of estrogen in physiological and pathological conditions . Estrogen receptors (er) and, the two well established nuclear estrogen receptors, have different physiological functions depending upon their various distributions . Lots of evidences show that estrogen induces the proliferation of cancer cells in breast, uterus, and ovarian cancer through er. On the contrary, activation of er can reverse this effect . Notably, a novel transmembrane estrogen receptor, known as g - couple estrogen receptor (gper), was found . Er are involved in the initiation, migration, and progression of estrogen - related multiorgan cancers, such as breast cancer, ovarian cancer, prostate cancer, testicular cancer, liver cancer, and lung cancer as well . Although increasing studied are focused on the roles of gper-1 in different types of cancers, the functions of gper-1 in cancers remain unclear yet . Characteristics and functions of reproductive system cancer will be summarized and discussed in the present review . G - protein - coupled estrogen receptor-1 (gper-1), a seven - transmembrane - domain receptor localized in cell surface, was first identified in 1996 . Gper-1 is detected broadly in numerous human tissues, such as breast, prostate, ovary, placenta, subcutaneous adipose, visceral adipose, arteries, vessels, heart, liver, lung and intestine tissues . Gper-1 is a member of gpcr superfamily, which is structurally unrelated to the classical er and er. There are four transcriptional variants encoding 375 amino acids composing seven transmembrane proteins . But gper-1 binding domain exists inside the plasma membranes and the endoplasmic reticulum [58]. Estradiol, the major type of estrogen, binds to gper-1 with a high affinity to gper-1 while the other two isoforms, estrone and estriol, have very low binding affinities [5, 9]. Furthermore, numbers of environmental estrogen bind to gper-1 and activate the downstream signaling pathways, such as bisphenol a, genistein, and nonylphenol . Gper-1-specific compound 1 (g-1) is a specific agonist of gper-1, which has no function of er and er and was identified using virtual and biomolecular screening in 2006 . G-1 has been widely used as a target tool to evaluate the function of gper-1 in different cells and disease models . Gper-1 mediates both genomic and nongenomic response with its ligands . To date, gper-1 signaling pathways have not been fully elucidated yet . The binding ligands of gper-1, such as estrogen, g-1, tamoxifen, and ici182,780, cross the plasma membrane and bind to the gper-1 on endoplasmic reticulum where they activate its and subunits and subsequently activate both src and adenylyl cyclase (ac) leading to the intracellular camp production . The phosphorylation of src induces matrix metalloproteinase (mmp) production, which cleaves pro - heparan - bound epidermal growth factor (pro - hb - egf) releasing free hb - egf . Hb - egf binds to the egfr leading to activation of multiple molecules such as ras, pi3k, akt, and erk1/2 . The downstream signal of pi3k and akt results in several nuclear receptors activation which is closely related the proliferation and migration of cancer cell . Gper-1 also binds to the g - couple protein subunit and activates the phospholipase c (plc), ac, and camp . Activated plc results in inositol triphosphate (ip3) production, which further binds to its receptor and leads to intracellular calcium mobilization . Breast cancer is generally classified into estrogen receptor positive (er+) and er negative (er). In clinical practices, the endocrine treatments such as tamoxifen and aromatase are recommended in the er positive breast cancers, while there is no benefit in the er negative cancers . Gper-1 is widely expressed in both of these breast cancer types and the primary breast cancers . Recent clinical study results showed that the expression of gper-1 might correlate with clinical and pathological poor outcome biomarkers . Other results also showed that the expression of gper-1 was inversely correlated with the er expression . Coexpression of gper-1 and er was found in almost 24% patients with inflammatory breast cancer, while 19% only express er and 46% only express gper-1 . The gper-1 mrna levels were significant higher in er positive breast cancer cells compared to er negative cancer cells, and the expression of gper-1 depends on er mrna level . Interestingly, gper-1 preformed a different proliferation manner in er positive mcf-7 breast cancer cell line . G-1 enhanced migration of mcf-7 breast cancer cells by activating erk1/2 and egfr signaling pathway, which is tremendously attenuated by g15 . The other evidences also approved that gper-1 is an initiator of tamoxifen resistance in breast cancers [1921]. The promotion roles of gper-1 in cancer cells proliferation and migration may be correlated with the autolysis of calpain 1, cleavage of cyclin e, or the expression of target gene . There are also some studies which found that gper-1 inhibits the growth of er positive mcf-7 cells, which is probably through g - couple and subunits activating without camp signal activation [2124]. However, combination treatment with g-1 and her2 antibody trastuzumab exerted an additive growth inhibitory effect on breast cancer cells . Thus, gper-1 inhibits er positive breast cancers proliferation which is a potential target for er positive breast cancers and drug - resistant breast cancer . Deficiency of er in breast cancer is correlated with poor response to endocrine therapy . In er negative breast cancers, gper-1 stimulates the erk1/2 through the egfr / mapk signal cascade, inducing target gene like c - fos expression, which is involved in the progressing of breast malignancies [2729]. Estrogen and antiestrogens can also promote the production of the early growth response-1 (egr-1), connective tissue growth factor (ctgf), and insulin - like growth factor 1 (igf-1) through the gper-1 [28, 30, 31]. Grp30 activation stimulated breast cancer cells migration through ctgh, cxc receptor (cxcr1), and notch pathways . Furthermore, gper-1 agonist g-1 promoted inflammation in breast cancers . Gper-1 was reported to affect the deformation of breast glandular structure inducing the malignant transformation of breast tissue . Gper-1 can also induce expression of cancer - associated fibroblasts (cafs) in tumor microenvironment [34, 35]. On the contrary, a recent study showed that activation of gper-1 by g-1 resulted in g2/m - phase arrest and induction of mitochondrial - related apoptosis . The other studies also proved that g-1 treatment suppressed the growth of skbr3 cancer cells and increased the survival rate by inducing the erk1/2 signal activation [36, 37]. 1520% of breast cancers are included in triple negative breast cancers (tnbc), characterized by lack of er, progesterone receptor (pr), and egfr2 (her-2). A higher rate of recurrence and aggressive biological features were found in younger females [38, 39]. Gper-1 expression was found in majority of tnbcs patients . In the gper knockdown mice model, the proliferation of tnbcs, these findings suggest that gper plays a key role in putative mechanism for tnbcs and gper might be a therapeutic target for tnbcs . Snps of gper-1, histone acetylation, and transcription factor recruitment were significantly associated with tumor size and histological grading [42, 43]. Gper rna as well as gper-1 protein presents in both primary and malignant ovarian tumor tissues . The expression of gper-1 was significantly increased in ovarian carcinomas compared to pericarcinomatous tissues impendent with the expression of egfr, er, and er . Estrogen and g-1 induce ovarian cancer cell growth responses via egfr - mapk signaling pathways . Furthermore, gper-1 promoted the migration and invasion of ovarian cancer cells ovcar5 which is characterized by negative er and positive gper by increasing the expression mmp-9 [48, 49]. Atrazine, one of the most common pesticide contaminants, promoted ovarian cancer cells proliferation via induction of erk and expression of estrogen target gene through gper-1 pathway . But other studies results showed that g-1 suppressed proliferation and induced apoptosis of human ovarian cancer cells probably through inhibition of cell cycle progression in g2/m - phase in ovarian carcinomas [51, 52]. Gper-1 has been shown to be involved in a variety of hormone - dependent cancers . It is well understood that estrogens play a critical role in pathological germ cell proliferation in testicular germ cell tumors . Gper-1 seems to be involved in modulating the growth of estrogen dependent testicular cancer cells . Estrogen induces the high expression of gper-1 correlated with low levels of er in human testicular carcinoma in situ and seminomas [53, 54]. Bisphenol a, a common environmental estrogen, can also promote the proliferation of testicular seminomas cells through gper-1 . The above findings suggested that gper-1 may be a potential therapeutic target [56, 57]. Estrogen has an efficacy for advanced prostate cancer (pc) via the mediation of the classical estrogen receptors . The effects of er on pc growth and metastases have different mechanisms in different cellular microenvironments . The expression of gper-1 is higher in the preneoplastic lesions and normal areas of benign prostate than the basal epithelial cells . G-1, the selectively activating gper-1, inhibited the growth of multiple pc cells in vitro and in vivo through erk1/2 and c - jun / c - fos signaling pathways, which indicates that the g-1 may be a new option for pc through targeting gper-1 . G-1 inhibited castration - resistant phase but had no effect on androgen - sensitive tumors . The antitumor effect of g-1 on cr tumors was related to necrosis (approximately 65%) accompanied with neutrophils infiltration . G-1 can also upregulate neutrophil - related chemokines and inflammation - mediated cytokines in the cr tumors . In one word there are other studies which proved that gper-1 induced proliferation, differentiation, and drug resistance of lung cancers [63, 64], thyroid cancers, bladder cancers, and oral squamous carcinomas . More studies to reveal the functions and mechanisms of gper-1 in the other system cancers are warranted . Majority of the study results addressed that activation of gper-1 by estrogen and g-1 results in the downstream signals and target genes activation, which promotes the proliferation, migration, and invasion of cancer cells . And this effect is in nonclassical er expression dependent manner in most cancers except for ovarian cancers . It is interesting that several other studies showed that g-1, the special agonist of gper-1, promoted the expression of gper-1 and inhibited the proliferation of er negative breast cancer cells, ovarian cancer cells, and prostate cancer cells . The opposite effects of gper-1 in cancer cells may be associated with the epigenetic of gper-1, such as the snps and histone acetylation . The different cell types, tumor microenvironment, and hormonal level may also affect the functions of gper-1 . Controversies still exist on the gper-1 localization and related signaling pathways, in particular the potential action as proapoptotic mediator . Since the function and mechanisms of gper-1 are still unclear, more researches and clinical studies are strongly warranted to clarify the different function and mechanisms in different cancer types and conditions.
Ensemble hi - c protocol to create a method to determine the contacts in an individual nucleus (fig . 1a, supplementary information). We used male, mouse, spleenic cd4 t cells, differentiated in vitro to t helper (th1) cells to produce a population of cells (> 95% cd4), of which 69% have 2n genome content, reflecting mature cell withdrawal from the cell cycle . Chromatin cross - linking, restriction enzyme (bgl ii or dpn ii) digestion, biotin fill - in and ligation were performed in nuclei (fig . 1a) as opposed to ensemble hi - c where ligation is performed after nuclear lysis and dilution of chromatin complexes . We then selected individual nuclei under the microscope, placed them in individual tubes, reversed cross - links, and purified biotinylated hi - c ligation junctions on streptavidin - coated beads . The captured ligation junctions were then digested with a second restiction enzyme (alu i) to fragment the dna, and ligated to customized illumina adapters with unique 3 bp identification tags . Single cell hi - c libraries were then pcr amplified, size selected and characterized by multiplexed, paired - end sequencing . De - multiplexed single cell hi - c libraries were next filtered thoroughly to systematically remove several sources of noise (extended data fig . Hi - c in male diploid cells can theoretically give rise to at most two ligation products per autosomal restriction fragment end, and one product per fragment end from the single x chromosome . Using bgl ii, the total number of distinct mappable fragment - end pairs per single cell cannot therefore exceed 1,201,870 (extended data fig . Deep sequencing of the single cell hi - c libraries demonstrated that following stringent filtering our current scheme allows recovery of up to 2.5% of this theoretical potential, and has identified at least 1000 distinct hi - c pairings in half (37/74) of the cells . Deep sequencing confirmed saturation of the libraries complexity, and allowed elimination of spurious flow cell read pairings and additional biases (extended data tables 1 - 3). Based on additional quality metrics we selected ten single cell datasets, containing 11,159 - 30,671 distinct fragment - end pairs for subsequent in - depth analysis (extended data fig . Visualization of the single cell maps suggested that despite their inherent sparseness, they clearly reflect hallmarks of chromosomal organization, including frequent cis - contacts along the matrix diagonal and notably, highly clustered trans - chromosomal contacts between specific chromosomes (fig . We used the same population of cd4 th1 cells to generate an ensemble hi - c library . Sequencing and analysis of 190 million read pairs produced a contact map representing the mean contact enrichments within approximately 10 million nuclei . The probability of observing a contact between two chromosomal elements decays with linear distance following a power law regime for distances larger than 100 kb . We found similar regimes for the ensemble, individual cells and a pool of 60 single cells (fig . 1c). Moreover, after normalizing the matrices given this canonical trend, comparison of intra - chromosomal interaction intensities for the pool and ensemble, by global correlation analysis of contact enrichment values at 1 mb resolution generates a highly significant correspondence (fig . This is emphasized by the high similarity observed in comparisons of individual chromosomes from ensemble and pooled hi - c maps (fig . Despite different experimental procedures and sparse nature of the single cell matrices, the pooled matrix retains the most prominent properties of the ensemble map, confirming the validity of the approach and prompting us to further explore the similarities and differences among the individual cell chromosomal conformations . A key architectural feature of ensemble hi - c datasets is their topological domain structure . As expected 1403 domains were identified in the th1 cell ensemble hi - c map (supplementary information table 1, and supplementary information). We used the ensemble domains to ask whether the same domain structure can be observed at the single cell level . Visual inspection of the domain structure overlaid on individual intra - chromosomal contact maps (fig . 2a), and global statistical analysis of the ratios between intra- and inter - domain contact intensities in individual cells (approximately 2-fold enrichment on scales of 100 kb to 1 mb, fig . 2a), both supported the idea that domains are observed consistently in the single cell maps . To test whether domain structures are variable between individual cells, we estimated the distributions of intra - domain contact enrichments across cells and compared it to the distributions derived from reshuffled maps . We reasoned that cell - to - cell variation in intra - domain contact intensities would result in an increase of the variance of this distribution compared to the expected variance resulting from sampling contacts in uniformly (shuffled) intra - domain contacts . 2c), showed that the distributions for the intra - domain enrichments in real cells are not more varied than expected (kolmogorov - smirnov p <0.52). A similar observation was derived by comparison of the correlations between intra - domain contact enrichments for pairs of real and pairs of reshuffled maps (extended data fig . While this analysis cannot quantify variability in the high - resolution internal structure of domains, the data suggests that domain intactness is generally conserved at the single cell level . Visual comparison of whole chromosome contact maps (fig . 2d) suggested that unlike intra - domain interactions, inter - domain contacts within single cell chromosomes are structured non - uniformly . The maps showed large - scale structures as indicated, for example, by specific insulation points separating chromosomes into two or more mega - domains in a cell - specific fashion . To rule out the possibility that this can be explained by sparse sampling of contacts in each single cell map real or randomized) we quantified the frequency of loci that strongly polarize the matrix into two weakly connected submatrices (using an insulation score; supplementary methods). We confirmed that single cell maps indeed show many more such loci than reshuffled maps (fig . The reshuffled controls made by mixing contacts from different single cell maps, are in fact similar to sparse versions of the ensemble map, which do not show specific structure at the intra - domain level . Along similar lines, the correlation in contact intensities between domains on the same chromosome in pairs of single cell maps is lower compared to reshuffled controls (fig 2f). Taken together, these data show that domains form a robust and recurrent conformational basis that is evident in each of the single cells . However, inter - domain contacts are highly variable between individual cells, suggesting large - scale differences in higher - order chromosome folding that are obscured in ensemble maps, averaged over millions of such structures . To determine whether the single cell hi - c data is consistent with unique chromosome conformations we developed a modeling approach to reconstruct the conformations of the single - copy, male x chromosome . We used intra - chromosomal contacts as distance restraints and calculated structural models using a simulated annealing protocol to condense a particle - on - a - string representation of individual chromosomes from random initial conformations (supplementary information), to produce both fine - scale and low - resolution models, with backbone particles representing either 50 or 500 kb of the chromosome, respectively . For fine - scale calculations, each intra - chromosomal contact restrained its precise position on the chromosome, while low - resolution calculations combined contacts into larger bins . Tests of our simulation protocol demonstrated that restraint density was the most important parameter for modeling (extended data fig . Hence, from the ten high - quality single cell datasets, we selected six with the largest numbers of intra - chromosomal x contacts, plus one with a lower number of contacts (cell-9) for contrast . Repeat calculations starting from random positions generated 200 x chromosome models for each cell at both scales . The fine - scale models displayed very low numbers of restraint violations (extended data fig . We introduced an estimated average unit dna distance length to approximate packaging of chromatin fibers (~0.15 m/50 kb) (supplementary information). This resulted in models with a mean x chromosome territory diameter of 4.3 m (range 3.3 - 5.9 m), in good agreement with x chromosome paint fish in th1 cells (fig . We confirmed that the restrained points in a single cell are indeed close in the structures calculated from them (extended data fig . Interestingly, the single cell distance matrix demonstrates how the network of contacts in a model imparts further structural information beyond the directly observed contacts (extended data fig . Comparison of the low - resolution models demonstrated convergence toward a single conformation for each single cell dataset (fig . Hierarchical clustering revealed 4 - 5 that were most representative of the data (fig . 4a, b). Highlighting four regions of the x chromosome showed large - scale conformational differences between cells (fig . Models created by shuffling hi - c contacts, or combining contacts from two cells resulted in structures smaller and more compact than observed chromosome territories (extended data fig . 4c, d) with many restraints stretched toward or exceeding their upper bounds (extended data fig . These results reaffirm that the variation in single cell contacts is not the result of partial sampling of a single underlying structure . We next asked whether despite their cell - to - cell variability, x chromosome structures share common folding properties that could be tested in real cells . One such important property, which is often consistent within a cell population, and with multiple potential functional implications, is localisation within the chromosomal territory relative to its surface . To predict loci with consistent positions within their chromosome territory we calculated the structural density along the x chromosome (supplementary information) and identified regions with consistently high or low structural density (fig . We chose five such regions (p1-p5) with predicted positions near the surface (p1, p2, p5; low structural density) or inside (p3, p4; high structural density) the model x chromosome territories using the 1200 models from the six cells (extended data fig . We then performed double label dna fish with x chromosome paints and p1-p5 bac probes (fig . The distances between dna fish signals and edge of the chromosome territory in over one hundred th1 cells showed that probes p1, p2 and p5 were indeed found predominantly outside or toward the edge of the chromosome territory, whereas signals for probes p3 and p4 were found at internal positions (fig . These data show that despite highly variable inter - domain structure of the x chromosomal territory, some of its key organisational properties are robustly observed across the cell population . Overlaying data from trans - chromosomal contacts on the x chromosome models demonstrates that trans - chromosomal contacting regions are strongly enriched toward the inferred surface of the models (fig . These observations prompted us to further explore the structural characteristics of interfaces between chromosomal territories, and the relationships between such interfaces and the domain structure of the territory itself . We found that trans - chromosomal contact enrichments of domains vary across cells (fig . 4a), showing a significant difference between the mean contact enrichment per domain in the real and reshuffled maps (p <1.2e-9, kolmogorov - smirnov test). The higher variance of the distribution for the real data suggests some domains are more likely to contact elements on other chromosomes . Previous work has suggested that active genomic regions on the sub - domain scale often loop out of their chromosome territories, which might imply less defined local domain structures and disassociation from their chromosome territory . However, our analysis shows that trans - contacting domains retain domain organisation, as demonstrated by the intra - domain contact probabilities within them (fig . Trans - contacting domains show slightly reduced contact intensity to other domains on the same chromosome (fig . 5c, d), consistent with localisation on the interfaces of their territories rather than dissociation from them . Analyses of ensemble hi - c data have previously shown that active marks correlate with enrichment of trans - chromosomal contacts . Using the single cell maps combined with annotation of domains based on their enrichment for histone h3 lysine 4 tri - methylation (h3k4me3) hotspots (fig . 4d), we tested whether this correlation is the result of low frequency re - localisation of active domains to other chromosome territories (looping out), or from frequent localisation of active domains on territory interfaces . As shown in fig . 4e, domains with high trans- to cis - chromosomal contact ratios (excluding intra - domain) are highly correlated with h3k4me3 enrichment in all cells . However, the data show that domains (including active ones) retain their association with the territory in almost all cases . Very few domains with strong trans - contacts were found to lack association with their own territory (i.e., upper left points in graphs in fig . 4e). Some of this lack of perfect territory re - localisation can be explained by having two copies of each autosomal domain, but the overall reduction with territory association for trans - contacting domains is much smaller than the 50% expected by this explanation (reduction estimated at 15 - 20% and 10% for contacts across 1 - 5 mb and 10 mb, respectively, fig . 4c). Comparison of active domain localization shows that different active domains are highly trans - contacting in each cell (extended data fig . 5e). Together, these data show that preferential localisation of active domains to territory interfaces is a hallmark of chromosome organisation in all cells . Active domains maintain their intra - domain organisation, and only partially lose intra - chromosomal contacts with other domains . Our data are consistent with the concept that chromosomal territories are maintained robustly despite the trans - chromosomal contacts between active domains . Interestingly, domains associated with lamin - b1, which are thought to be primarily inactive regions, are also found toward the surface of the models (fig . 3h). However, these domains are highly anti - correlated with h3k4me3 domains (spearman s correlation = 0.73) and typically depleted of trans - chromosomal contacts (extended data fig . Superposition of h3k4me3, lamin - b1 enriched domains and trans - chromosomal contacts on the x chromosome models illustrates spatial partitioning of the active, trans - contacting regions from those that are lamin - associated, although both types of domains tend toward the surface of the chromosome territory, supporting the above descriptions of differential positioning of domains (extended data fig . Ensemble hi - c maps generate a highly complex view of chromosomal contacts, including low intensity contacts between all possible chromosomal pairings . In contrast, years of single cell analyses by microscopy have suggested that individual cells have much simpler and discrete chromosome structures involving a limited number of interfaces between spatially constrained chromosomal territories . Our single cell maps bridge the gap between the genomic and imaging techniques, showing cell - specific clusters of trans - chromosomal contacts associating some pairs of chromosomes, and a lack of contacts between other chromosome pairs (fig . 5a, red) confirming it is not a consequence of sparse contact sampling (extended data fig . Trans - chromosomal contact clusters bring pairs of domains together, as shown by comparing the enrichment in trans - contacts between pairs of elements connecting the same two domains and pairs connecting one domain with two different domains (fig . Such synergistic contacting preferentially brings together pairs of active domains, with interaction between active and inactive domains being underrepresented (fig . Although inactive domains are depleted as a group from trans - chromosomal interactions (fig . 4e), inactive domains that engage in trans - contacts are more likely to interact with other inactive domains . Interestingly, analysis of interacting pairs of domains suggests that the number of chromosomes contacted by each chromosome is relatively constant (less than 30% difference) despite the> 3-fold change in chromosome size, the total number of trans - chromosomal contacts in the map, or a number of other factors (fig . We note that even though the total number of chromosome - chromosome interfaces per single cell is bounded, the detailed interface between chromosome pairs can involve multiple domain - domain contacts reflecting higher order organization (extended data fig . Overall, these results indicate that each chromosome contacts a discrete and fairly constant number of other chromosomes in a single cell, with little dependency on the chromosome size . At the single cell level both the microscopic and genomic observations therefore indicate highly defined territory structures, which can be hypothesised to harbor much of the chromosome within the territory, and expose a limited, relatively constant surface area engaged in chromosome - to - chromosome interfaces . Since these interfaces are highly variable among different cells, their averaging by ensemble hi - c contributes toward the relatively uniform trans - chromosomal contact matrices previously reported . We have presented a new experimental strategy to create hi - c contact maps from single cells . The approach allows for characterization of thousands of simultaneous contacts occurring in individual cells, and provides unique insights into hi - c technology and 3d chromosomal architecture (supplementary videos 3 and 4). Single cell contact maps reflect conservation of domain structure that was recently characterized, but show that inter - domain and trans - chromosomal contact structure is highly variable between individual cells . Genome - wide statistical analysis and reconstruction of the single copy x chromosome models gave us the opportunity to quantify key features of chromosomal architecture . For example, active domains tend to locate on the boundaries of their chromosomal territories in the majority of nuclei, while maintaining associations with other domains on the same chromosome . Our results do not exclude chromosome territory intermingling, but argue against domains becoming completely immersed in other territories . Coupled with previous observations of small and large - scale chromatin mobility a highly dynamic view of chromosomal organization ermerges, where territories are continuously being remodeled, while maintaining some key local (domain) and global (depth from surface) organisational features . Male th1 cells were fixed and subjected to modified hi - c, in which nuclei were maintained through restriction enzyme digestion, biotin fill - in labelling and ligation . Single nuclei were isolated and processed to prepare single cell hi - c libraries for paired - end sequencing . Sequences were mapped to the mouse genome, and abnormal read pairs were discarded . Read pairs that occurred only once (without duplication) in the library sequencing were removed . We chose 10 single cell datasets for further in - depth analyses based on several quality criteria (see supplementary information). To validate the single cell hi - c procedure, we pooled the single cell hi - c datasets and compared them to ensemble hi - c dataset prepared from approximately 10 million cells essentially as described . We created reshuffled datasets by randomly redistributing contacts of the analyzed single cells to create the same number of cells with the same number of contacts in each cell as a control to statistically analyse the variation among single cell datasets . We reconstructed three - dimensional x chromosome structure models using restrained molecular dynamics calculations employing a simulated annealing protocol . A combination of unambiguous distance restraints from the x intra - chromosomal contacts in the single cell hi - c dataset and anti - distance restraints between regions that were found not to contact each other in the ensemble hi - c dataset was used . To assess the precision and accuracy of the structure generation process we used the protocol to generate synthetic hilbert curve structures, and explored the impact of varying the number of restraints . For pair - wise comparison of the structures, we calculated the root - mean - square deviation (rmsd). To compare the x chromosome models to x chromosome structure in vivo, we selected five loci with consistently high or low structural density in the models, and compared distances between the loci and the x chromosome territory surface in cells (dna fish). . A, shown are the numbers of read - pairs in the original and re - sequenced runs, the number of fend - pairs in the original one, the number of fend - pairs when combining the sequences of the two runs, and the addition to fend - pairs the re - sequencing contributed .% valid non - amplified are the percentages of singly covered fend - pairs in the original sample that were supported by more read - pairs in the re - sequenced one . These fend - pairs were discarded as potential spurious pairs in the original run, but proved by the re - sequencing to be valid pairs . This gives a sense of the fraction of valid pairs we discard when removing the read - pairs suspected to be sequencing pairing errors . B, shown are fend - pair coverage contingency tables of the original and the re - sequenced runs for the five single - cells . Mouse and human nuclei or single cell hi - c samples were mixed in different stages of the experiment (group a, before fixation; group b, before library construction [so all the mouse and human samples in each library have the same identification tag]; group c, before library amplification [so mouse and human samples in each library have different identification tags]). We created single cell (for group a) or human / mouse two cell (for groups b and c) hi - c libraries and analysed them . The table shows the percentages of the three possible read - pairs: mouse - mouse (mm9-mm9), human - human (hg18-hg18) and human - mouse (hg18-mm9). For group a, we selected mouse cells based on morphology . In group a, all six libraries contain almost exclusively mouse - mouse read - pairs with insignificant human - human or mouse - human pairs . Each group b library has both human - human and mouse - mouse read - pairs as expected, and the number of spurious human - mouse read - pairs is extremely low . In each group c library, which was created by amplifying the distinctly tagged human (c1-c6) and mouse (c7-c12) single cell samples in the same tube (e.g., c1 and c7, c2 and c8, etc . ), the fractions of foreign pairs (human reads with a mouse tag and vice versa) and of spurious pairs (human - mouse) were consistently extremely low . To estimate the fraction of foreign and spurious pairs that could have originated simply from mapping a truly pure mouse library to a concatenated human - mouse genome, libraries from pure mouse cells (group d) were mapped to such a genome . The mean percentages of both foreign and spurious fend - pairs in this lane are the same as those found in the different human - mouse mixed lanes, suggesting there is no inter - cellular contamination . Phix174 dna library was added to four lanes of single cell hi - c multiplexed libraries . In theory, no mixed mouse - phix174 read - pair is expected, but in fact a small number were detected . Shown are the fraction of phix174 dna loaded to each lane capacity, the percentage of phix174 read - ends in the lane, and the observed number of read - pairs by type . The pairing probability was crudely estimated from these figures, and from it the number of expected spurious mouse - mouse read - pairs was calculated . Most of these spurious pairs are discarded when the unique identification tags at the beginning of each read - end are matched . Shown is the estimated number of spurious mouse pairs that coincidently have matching identification tag and are therefore not detected and removed . A, efficiency of biotin labelling at hi - c ligation junctions for two hi - c ligation products, showing 90 - 95% efficiency (supplementary information). C, discarding the missed re2 read - pairs removes a uniform blanket of non - specific contacts from the map . Shown is the dependency between the number of fend - pairs in a sample and the estimated number of autosomal fends covered by more than two fend - pairs under different models . The binomial model (grey line) distributes fend - pairs to fends randomly without any constraint, as if sampling fend - pairs from an infinite number of chromosomes . Number of fends in each 250 kb genomic bin for bgl ii or dpn ii as re1 . Tail of bins with few fends is for bins of low mappability and near the chromosomes edges . F, median fend length (distance from re1 to the first upstream re2) in each 250 kb genomic bin for bgl ii or dpn ii as re1 . G, information on the two restriction enzymes we used for re1, bgl ii (6 cutter, which we used predominantly) and dpn ii (4 cutter, only used for cell-8). Fends in which their first re2 site starts a non - unique 36 bp sequence are marked as non - unique fends . We discarded both blind and non - unique fends and used only the unique fends . The number of actual fends in a male mouse genome, which have two copies of each autosome and a single x chromosome are shown as well as the median fragment length (chromosomes y and mitochondrial genome were ignored throughout the analysis). H, information on the ten single - cell datasets that successfully passed the quality control filters . P - value of the number of autosomal fends with more than two covering fend - pairs was calculated from the binomial model (panel d and supplementary information). K, distribution of fend - pair coverage (number of read - pairs that support each fend - pair) in the ten single - cell datasets . L, distribution of mean contacts per fend calculated for each mappable 1 mbp, normalized by the mean value in each cell, and averaged across autosomal or x chromosomes from the ten single - cells . A, ratios between intra - domain and inter - domain contact enrichments over genomic distance . Chromosomes are grouped into four groups: group 1 (chromosomes 1, 8, 15, 16 and x), group 2 (chromosomes 2, 6, 10, 13 and 18), group 3 (chromosomes 3, 5, 11, 14 and 17) and group 4 (chromosomes 4, 7, 9, 12, 19). The intra- over inter- domain enrichment is persistent in all chromosome groups and does not seem to stem from peculiar chromosomes . B, distribution of correlations between intra - domain contact numbers of all domains from pairs of real and reshuffled controls . C, distribution of the insulation score at each fend in nine single cell hi - c datasets (where re1 is bgl ii; real cells) is shown in red . Fifty sets of reshuffled cells were produced (see supplementary methods) and their insulation score distribution is shown in black . Real cells have a heavier tail of highly insulating loci, which is indicative of non - uniform and cell - specific inter - domain contact structure . A, results of structure calculations using restraints from a space - filling hilbert curve test structure with 4096 particles and four typical results of structure modelling using different numbers of restraints are shown (upper panels). Structure calculations of the hilbert curve from random positions using different sets of 1024 restraints (lower panel). B, comparison of rmsd values from hilbert curve and single cell x chromosome models . Structure calculations for hilbert curves were repeated 100 times with variable numbers of restraints as shown . The root mean square deviation (rmsd) values between 100 models (precision) using the indicated number of restrains (mean + / sd) are plotted in blue . The rmsd values between the original hilbert curve and each of the 100 models (accuracy) for the same numbers of restraints are plotted in green (mean + / sd). Rmsd values from 100 repeated calculations of fine - scale (50 kb backbone) x chromosome structure from the seven single cell datasets are also plotted (red; mean + / sd). The distances between directly restrained positions in fine - scale (50 kb backbone) x chromosome models are shown . Models for the six single cell datasets (cell-1 to cell-6; red) show no values exceeding the upper bound (dashed line). Calculations with six shuffled interaction maps (created from cell-1 dataset; blue) show significant violations . Structure calculations performed on merged pairs of datasets (yellow; all possible combination of cell-1 to cell-4) have a few violations and are significantly closer to the upper limit . D, comparison of structure - derived distance matrix from 200 fine - scale x chromosome models from cell-1 (orange) and its single cell hi - c contacts (black crosses). The orange colour indicates the minimum distance between backbone particles . E, comparison or x chromosome structural models for six cells computed using low - resolution (500 kb binned) single - cell hi - c interaction data . The bundles shown represent minimised structural alignments of five models from repeat calculations for each cell . A, pair - wise comparison of fine - scale x chromosome structural models by rmsd analysis . Each pixel represents an rmsd value for a pair - wise comparison of two models . The order of 200 models in each panel was determined by hierarchical clustering of the rmsd values . Numbers shown are the mean rmsd values and the standard deviations for all the comparisons for each cell calculated by comparing the hi - c contact particles . B, cell - to - cell comparison of 200 fine - scale x chromosome structural models by rmsd analysis . Each pixel represents an rmsd value for a pair - wise comparison of two models . C, fine - scale x chromosome structures calculated from cell-1 and cell-3 datasets, and a structure from the combined dataset . D, typical structure calculated using a randomised dataset, where the interacting points for cell-1 have been shuffled with a pairing probability proportional to one over the square root of the sequence separation . Colours and scale as shown in c. e, distribution of measurements of depth from the surface for five loci p1 - p5 (fig . 3e) in 1200 x chromosome models (200 fine - scale models for each of the six cells). Whiskers on box plots define 10th and 90th percentiles and the outliers are shown as individual dots . A, intra - domain contact enrichment for each quartile of trans - chromosomal contacting domains . B, same as a but subtracting the mean quartile enrichment in each genomic distance emphasizing the differences shown in a. c, using the same sets as in a but plotting the enrichment of inter - domain contacts within the same chromosome . D, same as c but subtracting the mean quartile enrichment in each genomic distance . E, percentage of cells in which high and low h3k4me3 enriched domains are trans - interacting . For each cell the domains with top 10th percentile trans intensity were defined as trans - interacting in that cell . We then counted for each domain the fraction of cells in which that domain was trans - interacting . Shown are the distributions of these fractions for h3k4me3 enriched and non - enriched domains (the top and bottom 25th percentiles, respectively). F, distribution of the average laminb1-damid enrichment in chromosomal domains, color coded according to the enrichment value . G, domains plotted according to their number of trans- and cis - chromosomal (but excluding intra - domain) contacts, color - coded as in f. the domain laminb1-damid enrichment and h3k4me3 peak density are highly anti - correlated (spearman s correlation = 0.73). H, intra - domain contact enrichment for high vs. low quartile of domains stratified by their mean laminb1-damid enrichment . Error bars indicate 95% confidence intervals . I, using the same sets as in h but plotting the enrichment of inter - domain contacts within the same chromosome error bars as in h. j, lamin - b1 domains show a minor decrease in intra - domain contact intensities that might suggest less compacted domains, and significantly increased cis inter - domain contact, maybe due to lack of trans - chromosomal contacts . Topology of lamin b1, h3k4me3 and trans - contacts on five - model bundles of low - resolution x chromosome models . Scale bar, 1 m . A, comparison of observed coverage of the trans - chromosomal 1 mb square bins of each cell (red lines), versus predicted coverage assuming a binomial model (random uniform distribution of contacts to bins; black dashed line). Observed coverage is consistently higher than the uniform model, indicating the highly non - random distribution of trans - chromosomal contacts to genomic bins . B, trans - chromosomal contact enrichment around observed trans contacts as a function of the contacts total distance on both chromosomes (manhattan distance in the contact map). Observed and expected (by random uniform contact distribution) number of contacts are counted around each trans contact, and their ratio is shown for the 9 real cells (blue; where re1 is bgl ii) and reshuffled cells (red), at two different scales . C, left panel, trans contacts were classified according to h3k4me3 density of the domains they associate: high and low for top and bottom 25th percentiles, respectively, mid for 25th-75th percentiles . Shown is the log ratio of the contingency table counts with the expected counts generated by multiplying the corresponding marginal probabilities for each group (chi - square test; p = 5.8e-18). To make sure this phenomena is not caused by the trans enrichment of active domains and depletion of non - active ones, only the top 15th percentile trans enriched domains from each cell were used . Middle panel, similar to left panel but contacts are classified by their associated domain gene density (chi - square test; p = 2.3e-12). Right panel, similar to left panel but using domains in the top 40th percentile of gene density, classifying by their h3k4me3 density, to test h3k4me3 enrichment beyond gene density (chi - square test; p = 3.6e-06). In all cases active / gene - rich domains preferentially interact with each other, although active domains (high h3k4me3 density) interact beyond that expected by their gene density . A, the number of interacting chromosomes per chromosome is depicted in circles sized according to the number of single cells the value was observed in, while ordering chromosomes by the number of transcription start sites (tsss) in each chromosome which is shown by blue bars . Spearman correlation between the number of tsss and the mean value of the number of interacting chromosomes per chromosome is 0.18 . Two chromosomes were defined as interacting when they had at least one domain - domain interaction (see main text) supported by two or more contacts . However, the change is small, and the number of interacting autosomal chromosomes per chromosome (the plotted value divided by two) remains between 4 and 6 . B, same as a except that chromosomes ordered by the number of active h3k4me3 domains (the top 25th percentile h3k4me3 peak density domains). C, same as a except that chromosomes are ordered by the number of non - lad basepairs in the chromosome . The fraction of a chromosome covered by lads ranges from 31% to 53% and is correlated with chromosome size (0.52 spearman). Thus, chromosome lengths span a range of 3.2 fold change, while their non - lad fraction spans a smaller range of 2.8 fold change . The mean number of contacts of each chromosome with others it interacts with is shown for the ten single cells, ordering chromosomes by their size . Chromosome size is correlated with the number of contacts it has, but the dynamic range of this number is small . E, the number of interacting chromosomes per chromosome is depicted in circles sized as the number of single cells the value was observed in, while ordering the ten single cell datasets by the number of trans contacts in each dataset, shown by blue bars . Only autosomes are displayed . Spearman correlations between the number of trans contacts in each dataset and the mean value of the number of interacting chromosomes per chromosome is 0.73 . However, the change is small, and the number of interacting autosomal chromosomes per chromosome (the plotted value divided by two) remains between 4 and 6 . Top and bottom 30th percentiles of h3k4me3 peak density domains are marked in light pink and light grey, respectively . Note the grid - like trans contacts arrangement, and the correspondence between the two large trans contact clusters and the organisation of cis contacts in both chromosomes to large mega domains.
Oligonucleotides were synthesized on an expedite automated dna / rna synthesizer (applied biosystems, foster city, ca) using nucleoside phosphoramidites purchased from glen research (sterling, va). All oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis (page) and desalted using a c18 sep - pak cartridge (waters, milford, ma). Histidine - tagged t7 rna polymerase was purified from e. coli strain bl21 containing plasmid pbh161 (kindly provided by william mcallister, state university of new york, brooklyn). Thermus aquaticus dna polymerase was cloned from total genomic dna and purified as described previously30 . M1 rna, the catalytic subunit of rnase p, was obtained from e. coli genomic dna (sigma - aldrich, st . Louis, mo) by pcr amplification and subsequent in vitro transcription, as described previously1 . Calf intestine phosphatase and t4 polynucleotide kinase were purchased from new england biolabs (ipswich, ma), yeast inorganic pyrophosphatase was from sigma - aldrich, and bovine pancreatic dnase i was from roche applied science (indianapolis, in). Nucleoside and deoxynucleoside 5-triphosphates, theophylline, and fmn were purchased from sigma - aldrich, [-p]atp (7 ci / pmol) was from perkin elmer (waltham, ma), and caffeine was from mp biomedicals (solon, oh). Photinus pyralis (firefly) luciferase, saccharomyces cerevisiae adenosine-5-triphosphate sulfurylase, adenosine 5-phosphosulfate, and d - luciferin were from sigma - aldrich . Bovine calf serum was from omega scientific (tarzana, ca) and superasin (rnase inhibitor) was from ambion (austin, tx). All rna enzymes and substrates were prepared by in vitro transcription in a reaction mixture containing 0.4 m dna template, 0.8 m synthetic oligodeoxynucleotide having the sequence 5-ggactaatacgactcactata-3 (t7 rna polymerase promoter sequence underlined), 2 mm each of the four ntps, 15 u/l t7 rna polymerase, 0.001 u/l inorganic pyrophosphatase, 15 mm mgcl2, 2 mm spermidine, 5 mm dithiothreitol, and 50 mm tris - hcl (ph 7.5). The mixture was incubated at 37 c for 2 h, quenched by adding an equal volume of 15 mm na2edta, treated with 1 u/l dnase i, and extracted with a 1:1 mixture of phenol: chloroform . Transcription of m1 rna was performed similarly, except employing a double - stranded dna template that was generated by pcr . The a and a substrates could not be obtained reliably by in vitro transcription due to heterogeneity at the 3 end of the transcripts . Instead, these substrates were prepared from the corresponding e or e molecules by cleaving off the b or b portion using e. coli m1 rna, as described previously1 . The external guide sequence rna for cleavage of etheo and efmn had the sequence 5-cguaaguugcggucucacca-3, and for etheo and efmn had the sequence 5-auauucaugcggucucacca-3 (nucleotides complementary to the target rna underlined). For the second pair of etheo and etheo molecules used in the multiplex experiments, the external guide sequence rnas had the sequence 5-cguaguaugcggucuacca-3 and 5-gaauaucauugcggucucacca-3, respectively . The a and a substrates were [5-p]-labeled by first dephosphorylating using calf intestine alkaline phosphatase, then phosphorylating using t4 polynucleotide kinase and [-p]atp . The labeled substrates were purified by page and desalted using a nensorb 20 cartridge (nen life sciences, waltham, ma). Rna - catalyzed rna ligation was performed in a reaction mixture containing 5 m e or e, 0.1 m [5-p]-labeled a or a, 6 m b or b, 25 mm mgcl2, and 50 mm epps (ph 8.5), which was incubated at 42 c . Aliquots were taken at various times and quenched by adding an equal volume of gel - loading buffer containing 50 mm na2edta and 18 m urea . The products were separated by page and quantitated using a pharosfx molecular imager (bio - rad, hercules, ca). The data were fit to the equation: ft = fmax(a1ek1t)(a2ek2t), where ft is the fraction reacted at time t, fmax is the overall maximum extent of the reaction, a1 and k1 are the amplitude and rate of the initial fast phase, and a2 and k2 are the amplitude and rate of the subsequent slow phase, respectively . In the presence of 5 mm theophylline, the reaction catalyzed by etheo exhibited a fast phase with an amplitude of 0.57 and rate constant of 1.4 min, followed by a slow phase with an amplitude of 0.24 and rate constant of 0.044 min; the reaction catalyzed by etheo had an amplitude of 0.52 and rate constant of 0.59 min in the fast phase, and an amplitude of 0.26 and rate constant of 0.045 min in the slow phase . Cross - catalytic exponential amplification was performed in a reaction mixture containing 0.02 m each of e and e, 5 m each of [5-p]-labeled a and a, 5 m each of b and b, 25 mm mgcl2, and 50 mm epps (ph 8.5), which was incubated at 42 c . The reaction was initiated by mixing equal volumes of two solutions, one containing the enzymes and substrates, and the other containing the mgcl2 and epps buffer . Aliquots were taken at various times, quenched, and the amounts of newly - synthesized e and e were quantitated as described above . The data were fit to the logistic growth equation, as described in the main text . Known concentrations of inorganic pyrophosphate or samples taken from the cross - replication reaction were diluted 10-fold into a reaction mixture containing 0.15 g/l luciferase, 0.00045 u/l atp sulfurylase, 10 m adenosine 5-phosphosulfate, 0.5 mm d - luciferin, 25 mm magnesium acetate, 0.1% bovine serum albumin, 1 mm dithiothreitol, 0.4 g/l polyvinylpyrrolidone (mw 360,000), and 100 mm tris - acetate (ph 7.75). The pyrophosphate standards were prepared in a solution identical to that employed in cross - replication, but lacking the rna enzymes and substrates . Luminescence was detected using a perkin elmer ls55 luminescence spectrometer operating in bioluminescence mode, with a pmt voltage of 900 v, cycle time of 200 ms, gate time of 180 ms, and delay time of 0 . The flash count was set to 1, the emission filter was fully open, and the emission slit width was 12 nm . Following addition of the sample to the luciferase mixture, luminescence was monitored for 5 min with a 0.1 s integration time . The amount of light generated was linear over a pyrophosphate concentration range of 0.110 m . Oligonucleotides were synthesized on an expedite automated dna / rna synthesizer (applied biosystems, foster city, ca) using nucleoside phosphoramidites purchased from glen research (sterling, va). All oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis (page) and desalted using a c18 sep - pak cartridge (waters, milford, ma). Histidine - tagged t7 rna polymerase was purified from e. coli strain bl21 containing plasmid pbh161 (kindly provided by william mcallister, state university of new york, brooklyn). Thermus aquaticus dna polymerase was cloned from total genomic dna and purified as described previously30 . M1 rna, the catalytic subunit of rnase p, was obtained from e. coli genomic dna (sigma - aldrich, st . Louis, mo) by pcr amplification and subsequent in vitro transcription, as described previously1 . Calf intestine phosphatase and t4 polynucleotide kinase were purchased from new england biolabs (ipswich, ma), yeast inorganic pyrophosphatase was from sigma - aldrich, and bovine pancreatic dnase i was from roche applied science (indianapolis, in). Nucleoside and deoxynucleoside 5-triphosphates, theophylline, and fmn were purchased from sigma - aldrich, [-p]atp (7 ci / pmol) was from perkin elmer (waltham, ma), and caffeine was from mp biomedicals (solon, oh). Photinus pyralis (firefly) luciferase, saccharomyces cerevisiae adenosine-5-triphosphate sulfurylase, adenosine 5-phosphosulfate, and d - luciferin were from sigma - aldrich . Bovine calf serum was from omega scientific (tarzana, ca) and superasin (rnase inhibitor) was from ambion (austin, tx). All rna enzymes and substrates were prepared by in vitro transcription in a reaction mixture containing 0.4 m dna template, 0.8 m synthetic oligodeoxynucleotide having the sequence 5-ggactaatacgactcactata-3 (t7 rna polymerase promoter sequence underlined), 2 mm each of the four ntps, 15 u/l t7 rna polymerase, 0.001 u/l inorganic pyrophosphatase, 15 mm mgcl2, 2 mm spermidine, 5 mm dithiothreitol, and 50 mm tris - hcl (ph 7.5). The mixture was incubated at 37 c for 2 h, quenched by adding an equal volume of 15 mm na2edta, treated with 1 u/l dnase i, and extracted with a 1:1 mixture of phenol: chloroform . Transcription of m1 rna was performed similarly, except employing a double - stranded dna template that was generated by pcr . The a and a substrates could not be obtained reliably by in vitro transcription due to heterogeneity at the 3 end of the transcripts . Instead, these substrates were prepared from the corresponding e or e molecules by cleaving off the b or b portion using e. coli m1 rna, as described previously1 . The external guide sequence rna for cleavage of etheo and efmn had the sequence 5-cguaaguugcggucucacca-3, and for etheo and efmn had the sequence 5-auauucaugcggucucacca-3 (nucleotides complementary to the target rna underlined). For the second pair of etheo and etheo molecules used in the multiplex experiments, the external guide sequence rnas had the sequence 5-cguaguaugcggucuacca-3 and 5-gaauaucauugcggucucacca-3, respectively . The a and a substrates were [5-p]-labeled by first dephosphorylating using calf intestine alkaline phosphatase, then phosphorylating using t4 polynucleotide kinase and [-p]atp . The labeled substrates were purified by page and desalted using a nensorb 20 cartridge (nen life sciences, waltham, ma). Rna - catalyzed rna ligation was performed in a reaction mixture containing 5 m e or e, 0.1 m [5-p]-labeled a or a, 6 m b or b, 25 mm mgcl2, and 50 mm epps (ph 8.5), which was incubated at 42 c . Aliquots were taken at various times and quenched by adding an equal volume of gel - loading buffer containing 50 mm na2edta and 18 m urea . The products were separated by page and quantitated using a pharosfx molecular imager (bio - rad, hercules, ca). The data were fit to the equation: ft = fmax(a1ek1t)(a2ek2t), where ft is the fraction reacted at time t, fmax is the overall maximum extent of the reaction, a1 and k1 are the amplitude and rate of the initial fast phase, and a2 and k2 are the amplitude and rate of the subsequent slow phase, respectively . In the presence of 5 mm theophylline, the reaction catalyzed by etheo exhibited a fast phase with an amplitude of 0.57 and rate constant of 1.4 min, followed by a slow phase with an amplitude of 0.24 and rate constant of 0.044 min; the reaction catalyzed by etheo had an amplitude of 0.52 and rate constant of 0.59 min in the fast phase, and an amplitude of 0.26 and rate constant of 0.045 min in the slow phase . Cross - catalytic exponential amplification was performed in a reaction mixture containing 0.02 m each of e and e, 5 m each of [5-p]-labeled a and a, 5 m each of b and b, 25 mm mgcl2, and 50 mm epps (ph 8.5), which was incubated at 42 c . The reaction was initiated by mixing equal volumes of two solutions, one containing the enzymes and substrates, and the other containing the mgcl2 and epps buffer . Aliquots were taken at various times, quenched, and the amounts of newly - synthesized e and e were quantitated as described above . The data were fit to the logistic growth equation, as described in the main text . Known concentrations of inorganic pyrophosphate or samples taken from the cross - replication reaction were diluted 10-fold into a reaction mixture containing 0.15 g/l luciferase, 0.00045 u/l atp sulfurylase, 10 m adenosine 5-phosphosulfate, 0.5 mm d - luciferin, 25 mm magnesium acetate, 0.1% bovine serum albumin, 1 mm dithiothreitol, 0.4 g/l polyvinylpyrrolidone (mw 360,000), and 100 mm tris - acetate (ph 7.75). The pyrophosphate standards were prepared in a solution identical to that employed in cross - replication, but lacking the rna enzymes and substrates . Luminescence was detected using a perkin elmer ls55 luminescence spectrometer operating in bioluminescence mode, with a pmt voltage of 900 v, cycle time of 200 ms, gate time of 180 ms, and delay time of 0 . The flash count was set to 1, the emission filter was fully open, and the emission slit width was 12 nm . Following addition of the sample to the luciferase mixture, luminescence was monitored for 5 min with a 0.1 s integration time . The amount of light generated was linear over a pyrophosphate concentration range of 0.110 m.
Neoadjuvant chemotherapy actually takes an important place in treatment of operable breast cancer in the hope of improving conservative surgery rate of female patients . Neoadjuvant chemotherapy includes today on target therapies involving the research on expression of specific molecules by tumoral cells . In routine practice, estrogen receptors (er), progesterone receptors (pr), and human epidermal growth factor receptor 2 (her2) are the common used biomarkers . New pharmaceutical molecules, other than er / pr or her2, are now already evaluated in clinical research as new biomarkers and new target for neoadjuvant therapy . Fine - needle aspiration cytology (fnac) of the breast is wellknown as a safe, effective, economical, and accurate technique for diagnosing palpable breast lesion [24]. This last decade, fnac technique is improved by the development of new cytological methods allowing standardization of fixation and assuring constant results with ancillary tests such as immunocytochemistry and in situ molecular biology . Also, one of the advantages of fnac is the management of small tissue fragments permitting a repetitive evaluation of the chronological evolution in expression of tumoral biomarkers . Previously, the role of fnac has been challenged by results obtained with cnb that seems more robust than fnac . In general, nevertheless, cnb carries disadvantage in terms of a long tissue processing time and patient discomfort such as pain (1.7% to 3.7%), hematoma (0.72%), and very rarely pneumothorax [6, 7]. Fnac includes more advantages than cnb such as minimal invasiveness and minimal discomfort (more painless) that could be interesting for aged or frailty patients with comorbidities . In palpable lesions, fnac could perform repetitively and is a serious candidate for the chronological followup of neoadjuvant chemotherapy response . An important quality of fnac is its ability to give rapid diagnostic information equivalent to that of frozen sections . In our experience, the result of rapid fnac prior to cnb improves the quality of cnb and gives an immediate diagnosis decreasing anxiety of patient . Other indications of fnac are staging of multiple tumors or suspicious zones and apparition of a new suspicious lesion during neoadjuvant chemotherapy . Finally, fnac could be an excellent alternative when radiographic screening of breast is not available . Table 1 compares the main advantages and disadvantages of fnac versus cnb . Other clinical fnac indications . Palpable breast lesion.rapid diagnosis to decrease anxiety of patient.patient with morbidity (senile, cardiac, diabetic etc. ).clinical staging: multiple lesions, suspicious lymph node, and so on . Apparition of new lesion in patient treated for breast cancer.evaluation of biomarkers.evaluation of biomarker changes following time or metastasis . When cnb technique is not available . Evaluation of biomarker changes following time or metastasis . When cnb technique is not available . It is well known that the combination of clinical evaluation, mammography, and fnac, called triple diagnosis, gives a precise diagnosis [10, 11]. Yu et al . Recently demonstrated in meta - analysis of 46 studies that fnac had a sensitivity of 92.7% and a specificity of 94.8% except the unsatisfactory samples . The roc curve showed an excellent area under the curve of 0.986, presenting a high level of accuracy . On the other hand, if the fnac result was negative, the probability of breast cancer is approximately 8% . These authors concluded that fnac was an accurate material for evaluation on breast malignancy if rigorous criteria are used . Also, they said that fnac may provide a favourable screening method and permit an improvement of treatment planning . Therefore, when fnac is unsatisfactory, cnb is required to minimize the probability of a missed malignant diagnosis . In a study of fnac and immediate diagnosis performed in 408 palpable breast lesions, liew et al . In 2010 reached the same conclusions: 98.1% sensitivity, 89.5% specificity, and 95.8% accuracy . In 508 cnb followed by jackman et al ., the rate of false negative for all lesions was 4.4%, for microcalcifications alone 1.2%, and for tumoral mass 0.8% . These results of cnb are quasi - identical to those obtained with the satisfactory fnac . Most of false negative fnac results of sampling error or discordance between clinical and histological observations [6, 14]. In a comparison between cnb and repeat fnac after an indeterminate diagnosis with fnac, kooistra et al . Suggested that cnb should be performed after an indeterminate fnac to obtain a reliable preoperative diagnosis . Other authors concluded that, although the fnac is easier to perform, this technique was not efficient for small and nonpalpable lesions or diagnosis of microcalcifications as those for in situ carcinoma . These comments are likely true because some preneoplastic lesions are associated with slight cell atypia . However, bilous emphasized that cnb shows also problems with similar lesions such as atypical proliferative lesions (atypical ductal hyperplasia, in situ lobular neoplasia, etc . ), cellular fibroepithelial lesions, papillary tumors, mucinous carcinoma, radial scar, spindle cell lesions . Moreover, fnac interpretation requires serious experience of the cytopathologist and they think that this is one of the main reasons that overall cnb is to be preferred . A recent japanese study of 5693 fnac and 7 different laboratories illustrated a great variability between the institutions suggesting likely difference between education of cytologists and the lack of clinical or radiological information (triple diagnosis). These last years a new cytological technique, called liquid - based cytology (lbc), has been developed and approved by the food and drug administration . Briefly, lbc standardises the cell fixation, concentrates epithelial cells, and discards blood cells and/or cell debris that obscure the smear . The efficiency of lbc in the breast cytology has been demonstrated by numerous publications . The main advantage of lbc is surely to adjunct ancillary tests such as immunocytochemistry, flow cytometry, or molecular biology [1820]. Compared the er and pr statuses from fnac (immunocytochemistry) and cnb (immunohistochemistry), both performed on surgical breast tumors . They found that both methods give similar results with a concordance between the 2 tests of 98% for er (with kappa correlation score = 0.93) and 96% for pr (kappa = 0.91). . Demonstrated similar data in a comparative study between primary breast tumours and their metastasis . Interestingly, the concordance between these both localisations was 81% for er, 65% for pr, and 71% for her2, suggesting a possibility of biological difference between primary tumors and their metastasis . Other publications showed a long - time storage at 20c and 80c at least 6 months without significant loss of immunoreactivity of pr and ep from breast fnac . The cell block cytology is an attractive cytological method for ancillary techniques or long - time cell conservations and consists in putting cells of fnac directly in formol fixative fluid identically at a classical histology (figures 1 and 2: er, her2 and fish on cell block cytology). Briefly, after centrifugation to concentrate cells, the pellet was embedded in a synthetic polymer gel that is then processed in paraffin block that could be cut at 4 m, as classical biopsy slides . With this technique, ferguson et al . Found a concordance rate of 95% for er, 90% for pr, and 88% for her2 . Similar results were observed by shabaik et al . With high specificity (100% for both) and lower sensibility (85% and 80% resp . For er and pr). Finally, in fnac, false negative er or pr immunostaining exists but false positive tests are very unlikely . False negative immunohistochemical results are also observed in cnb: in a retrospective study, seferina et al . Calculated a rate of false negative of 26.5% and a rate of false positive of 63.8% for both er and pr . For her2, they showed 5.4% for false negative rate and 50% for false positive rate . Nevertheless, in our experience, this discordance is often associated with the manipulation of cnb before the fixation (crush artefacts) or with a defect of fixation as desiccation . Fortunately the concordance with molecular biology by hybridisation in situ using fish, cish, and sish is very good and can help when her2 is uncertain [6, 25, 27]. The fish is accurate for lbc cytology [22, 25, 28, 29]. The extraction of mrna or dna is also feasible from lbc and fnac, allowing all gene expression analyses [2932]. In our experience, the clinical staging and preoperative lymph node status are important for the evaluation of eligible patient to neoadjuvant therapy . In the axillary lymph node fnac, chang et al . Fnac in lymph node is a cost effective and safe method, false positive is virtually non - existent, and false negative can occur when lymph node is partially involved such as by micrometastase, or isolated tumor cells . In our experience, we improve axillary lymph node fnac / lbc by immunocytochemistry using cytokeratin antibody . Thus, axillary fnac plays a role in staging of advanced cases for systemic and neoadjuvant therapy and in evaluating candidates for sentinel lymph node surgical procedure or axillary lymph node dissection . Despite the fact that cnb has been progressively replaced by fnac in the investigation of nonpalpable lesions or microcalcifications without a clinical or radiological mass lesion, fnac has yet a role in palpable lesions in the triple diagnosis association and performed by experienced cytologists . In these conditions, fnac is a safe, effective, economical, and accurate technique for breast cancer evaluation . Recently, cytological methods using lbc technology, associated or not with the cellblock cytological technique, improve immunocytological and molecular tests with the same efficiency as classical histology . If the limits of its indications are well known, fnac still plays a role in the modern oncological practice.
Understanding how and why vector - borne diseases like malaria remain a persistent problem despite being tools for diagnosis and treatment is essential for developing effective control measures for sub - saharan africa . Temperature is one of the key climatic variables that determine the range of malaria transmission and hence global warming is likely to result in an increase in malaria prone areas especially where temperatures have generally been lower than the optimal range of 2527c for mosquito development . Furthermore degradation of the environment and social and economic pressures due to population growth may boost the expansion of malaria prone areas . Population migrations, drug and pesticide resistance, and deterioration of health service delivery systems will also influence the level of malaria transmission . The epidemiology of malaria is very complex, involving factors pertaining to the malaria parasites, the insect vectors, the human hosts, and the environment . An understanding of the link between malaria transmission, climatic variables, and other human related factors is therefore necessary for developing appropriate measures that will significantly reduce transmission and perhaps eliminate malaria in endemic areas . In most cases these human related risk factors the level of risk to human populations living in malaria endemic areas varies markedly across continents and also within countries and different areas within the same countries . Several studies have shown that malaria vector distribution, transmission rates, and incidence can vary widely over short distances, between neighbouring villages and even within a single settlement, as a result of small area variations in risk factors [5, 6]. Identification and understanding of this variation are important in the detection of high risk groups and for selective targeting of intervention . Many studies have attempted to identify household and individual level factors associated with malaria . Some of the factors studied include access to health facilities, type of housing that people live in, proximity of human settlements to vector breeding sites [1012], vector abundance, socioeconomic status, gender, occupation, residential mobility, travel, presence of domestic animals near homesteads, and use of preventive methods such as bed nets . Information on how these factors interact to expose communities and individuals to malaria infections needs to be investigated systematically in each geographical setting, in conjunction with climate related factors . Documented information about individual and household risk factors associated with malaria transmission is lacking in botswana . In order to address this paucity of information we assessed household and individual risk factors that may be contributing to malaria transmission in tubu village community in the okavango subdistrict in northern botswana . The study was conducted in the context of a larger project, botswana ecohealth project (bep), which is investigating the impacts of hydroclimate change on population health . Apart from contributing towards the objectives of bep, the results of this study are relevant to an initiative by the ministry of health in botswana to eliminate malaria by year 2016 . The study was conducted in tubu village on the banks of the thaoge river, one of the distributaries of the okavango delta . Tubu village is located in the okavango subdistrict at an altitude of about 950 m above sea level and between latitude 1935s and longitude 2227e . According to the national central statistics office report of 2011 the area is subjected to annual flooding but the extent of flooding varies from year to year . The community practices flood recession farming locally known as molapo farming . They plough their fields along the banks of the river as the flood recedes and in some instances they plant crops taking advantage of a raised water table caused by flooding . Community development and everyday governance issues pertaining to law and order in the area are conducted at a central place (locally known as the kgotla) within the village . Tubu has a village development committee (vdc) established as a local government structure to guide development planning and implementation in the village . The village also has a primary school, a resident social worker, and a health post staffed with a nurse, nurse aid, and a health education assistant . Gumare hospital, located 10 km east of the village, offers an array of general health services to the local community . The hospital also serves as the district health centre for critically ill patients referred from all district health posts including tubu . Malaria cases in the okavango subdistrict have been fluctuating since 2005 with unconfirmed cases ranging between 4,686 in 2005 and 10,993 in 2006 and confirmed cases ranging between five (in 2012) and 791 (in 2006) (ministry of health annual report, 2012). The maximum number of deaths between 2005 and 2012 was 16, recorded in 2006 . Data from clinic records for the period of 2005 to 2010 indicated that 2009 had the highest with 131 unconfirmed cases and 2005 the lowest with 50 cases . However during the same period information on rapid diagnostic tests (rdts) was inconsistent and available only for years 2006, 2008, and 2010 with 9, 4, and 5 cases, respectively . Pretesting of the questionnaire involved trained field research assistants with higher secondary education qualifications and field supervisors with degree qualifications who eventually administered the final questionnaire . The questionnaire had four thematic sections; first part focused on sociodemographic characteristics such as gender, age, marital status, education level, farming practice, household income, ethnicity, respondent's relationship to household head, employment status, and occupation and the second part included aspects on how the community or individuals got exposed to mosquito bites due to late night activities, location of homesteads in relation to animal shelters and mosquito breeding sites, visits made to other areas outside tubu village in the last 8 months, and history of malaria episodes in the last 8 months . A short period of 8 months was chosen so as to minimise on - recall bias as the time frame included the previous malaria transmission season which fell between the months of october 2011 and june 2012 . The third part of the questionnaire focused on malaria prevention methods being practiced and health delivery services for the study area . The last part involved general observations made at each homestead during the interview with regard to house structure and use, type of eaves, and vegetation cover surrounding the homesteads . To ensure accuracy and good quality data, pretesting of questionnaires was carried out two weeks prior to the actual data collection exercise in etsha 1, a village with similar environmental and sociodemographic patterns to tubu village . Following the pretest survey the questionnaire was revised, on the basis of responses given, for improvement of clarity and addition of essential questions that had been omitted in the original questionnaire . Vague questions in the original questionnaire were either omitted from the final questionnaire or improved . The pretest exercise was also used to standardize the manner in which the interviewers would conduct the interviews and to ensure that they had a common understanding of each question . From the household listing compiled for the bep project the target sample size, as determined by raosoft inc . However, due to the fact that tubu is a relatively small village a census survey was done consisting of individuals representing all the 71 households . The questionnaire was administered at the household level to any person who is 18 years and above with preference being given to the heads of the household if they were present . Only one person per household was interviewed . During the interviews the respondents answered some of the questions pertaining to children and other members of the same household such as visits outside study area and possession and use of nets . Numbers 1 to 4 were assigned to individuals from the community who had come to attend the pras for the major bep project . All individuals assigned a similar number were grouped together to participate in the malaria risk survey . Pra technique, using the closed scoring / ranking approach, was used to cross - check on some of the responses from the questionnaire interviews . The maximum number of individuals at any one given time during the pra discussions was 16, thus providing a total ranking capacity (n) of 160 . The respondents were asked whether they had suffered from malaria within the past 8 months (the period between october 2011 and june 2012), which included the traditional peak malaria transmission season in botswana . Mosquito sampling was conducted in houses, in pit traps, and in larval breeding sites located within the study area . Adult mosquitoes were sampled from pyrethrum space spray knockdowns in 6 selected huts used as bedrooms and from 4 pit traps . The physiological conditions of the adult mosquitoes collected from indoors and pit traps were scored as non - blood - fed, blood - fed, half gravid, and full gravid . All adult mosquito specimens, from both adult and larval sampling, were identified to species level by the polymerase chain reaction (pcr) technique . A geographic positioning system instrument (gps) was used to determine straight line distances of study homesteads from the nearest mosquito breeding habitats . Permission to carry out the study was obtained from the ministry of health, republic of botswana (permit number: ppme 13/18/1 vol . Meetings with the community leadership and other interested community members were held to introduce the study, clearly explaining its objectives . On the day of the interview verbal consent respect for privacy was maintained during adult mosquito sampling in selected rooms used as bedrooms . Participants were informed that they could refuse to participate in the study and not be prejudiced . Respondents were assured that all the information captured on the data sheets would be treated with confidentiality and that no answers would be linked to individuals in the final analysis and presentation of findings . Descriptive statistics were carried out to determine relative frequencies of all the survey variables . Some of the variables had provisions for multiple responses . Appropriate graphs and tables were generated to show differences in the relative frequencies of various variables . Levels of association between various variables were determined by the pearson test and fisher's exact test in situations where the expected frequencies were less than five . Where appropriate, p values and confidence intervals (ci) for odds ratios (or) are shown . The level of association between various factors and history of malaria was calculated based on the respondents' views . The maximum number of people residing in a single homestead was 20 and the minimum was one . A total of 483 individuals resided in all the 71 study homesteads, thus giving an average household size of seven people . About two - thirds of the respondents had some years of schooling (table 1). The majority of households earned an income of less than us$63 per month (figure 1). Only 7% of the respondents earned more than us$250 per month . Eighty - one point seven percent (58) of the respondents resided within 1 km from the nearest health facility . Eighteen - point three percent (13) resided 1 km to 2 km from the clinic . All the 71 respondents indicated that it took them less than an hour to get service at the clinic from the time they joined the queue . At the time of the study (june 2012) 53.5% (38) of the respondents said that they had suffered from malaria within the past 8 months whilst 46.5% (33) did not remember ever suffering from malaria in their entire life . Forty - seven point nine percent (34) mentioned that at least one member of their family had suffered from malaria within the past 8 months . Among family members who had suffered from malaria, 73.5% (25) were above five years old and 26.5% were below the age of five years . There was an association between household income and history of a malaria episode (table 2). Almost all of those who had experienced a malaria attack were in the lowest bracket for household monthly income . In the whole village only two house roof types were observed . These were either of grass or iron sheet . A general observation noted that houses in the village were either grass thatched, built of reeds, pole, and mud or home - made bricks (referred to as traditional hut / house) or built of bricks and roofed with iron sheets (referred to as modern hut / house). Among those structures used as bedrooms by the respondents, 52.1% (37) were traditional and 47.9% (34) were modern houses / huts . In traditional houses / huts large eave openings were observed in 89.2% (33) and the rest (10.8% (4)) had small eave openings . In modern houses 2.9% (1) had large eave openings and the rest (97.1% (33)) had virtually no eave openings . There was an association between history of malaria episode and use of traditional huts / houses as bedrooms (table 3). Majority of individuals who experienced a malaria attack used traditional houses / huts as bedrooms . Low vegetation cover surrounding homesteads was observed at 81.7% (58) of the homesteads . Moderate vegetation cover was observed at 14.1% (10) of the homesteads whilst only 4.2% (3) of the homesteads were surrounded by dense vegetation cover . Individual contact with mosquito bites was categorized into always, sometimes, often, and rarely . Out of 98.6% (70) who experienced mosquito bites, 54.9% (39) mentioned that they seven percent (5) and 8.5% (6) often and rarely got bitten by mosquitoes, respectively . No association was found between house eave size and getting bitten by mosquitoes and between house eave size and frequency of bites (table 2). Out of the 70 individuals who experienced mosquito bites 84.5% (60) indicated that they received the bites in the evening . The rest got mosquito bites during daytime (1.4% (1)), after dawn (1.4% (1)), or throughout the day (1.4% (1)). No association was found between house eave size and time of mosquito bites (table 2). About 93% (66) of respondents reported that they opened doors in the morning whilst 7% (5) during the day . Ninety - seven point two percent (69) reported that they closed doors in the evening whilst only 1.4% (1) indicated that they closed doors after dawn and 1.4% (1) before dusk . Eighty - eight point seven percent (63) mentioned that they were involved in late outdoor activities that included social gatherings (28.2% (20)), relaxing outdoors (74.6% (53)), preparing meals (50.7% (36)), and doing other things (8.5% (6)). A strong relationship was established between late outdoor activities and history of malaria episode (table 3). Most of the outdoor activities were said to be done between 2000 hrs and 2200 hrs by 63.4% (45) of the respondents . A borderline association between the period spent outdoors and history of malaria episodes was established (table 2). Ninety - three percent (93% (66) (of the respondents mentioned that they prepared meals outdoors using firewood . Only 2.8% (2) said they used gas for cooking and the remainder (4.2% (3)) used both gas and firewood . Eighty - five point nine percent (61) of the respondents mentioned that they were fulltime farmers . Among them 60.7% (37) had field structures erected on the farm and these were in the form of mud houses (28.2% (20)), brick houses (2.8% (2)), or other form of materials (21.1% (15)) such as the grass - made temporary shelters locally known as the mathibelo . There was no evidence of association between history of malaria episode and being a full time farmer (table 2). Seventy - six point one percent (54) of the respondents indicated that they had other residential homesteads elsewhere outside tubu village . Seventy - three point two percent (52) had other homesteads in gumare village, 1.4% (1) in the cattle post areas, and another 1.4% (1) in shakawe village, about 150 km from tubu village . It is defined as an area designated solely for keeping domestic animals, mainly cattle, goats, and a few donkeys and horses . Cattle posts are usually located away from defined residential areas . Majority (69.1% (49)) of respondents fifty - nine point two percent (42) of respondents mentioned that they had travelled outside tubu village in the last 8 months . Ninety - five point two percent (40) of them had travelled to malaria endemic areas in the north of the village whilst 4.8% (2) had travelled to non - malaria - endemic areas . There was a significant association between travel outside tubu village and history of malaria disease (table 3). Twenty - six point eight percent (19) of respondents mentioned that 8 months prior to the date of the interview they had received visitors who stayed overnight . They reported that 94.7% (18) of the visitors were coming from malaria endemic areas . Ninety - four point four percent (67) of the respondents indicated that they owned mosquito nets (insecticide treated or untreated mosquito nets). More than half of the respondents who possessed mosquito nets had not experienced any malaria attack indicating an association between previous malaria episode and possession of mosquito nets (table 3). Number of nets per household were reported to range from zero (2.8% (2)) to more than six (5.6% (4)), with 39.4% (28) possessing one or two nets, 33.8% (24) possessing three or four nets, and 18.3% (13) possessing five or six nets . However, there was no association between history of malaria attack and the number of mosquito nets owned by a household (table 2). Insecticide treated mosquito nets (itns) were possessed by 78.9% (56) of the responses whilst 50.7% (36) also possessed untreated mosquito nets . It was not unusual to find some households with a mixture of insecticide treated and untreated mosquito nets at the same time . Two point eight percent (2) of the respondents were not sure of the status (treated or not treated) of their mosquito nets indicating poor knowledge on mosquito nets . Ninety - one point five percent (65) of the respondents indicated that they always used mosquito nets . Only 1.4% (1) mentioned that they used mosquito nets more often whilst 5.6% (4) sometimes used them and 1.4% (1) never used mosquito nets . Usage of mosquito nets, among those who always used them, was reported to be relatively high (46.2% (30)) during summer and very low (3.1% (2)) in winter . Most of the respondents were aware of government's efforts to control malaria through indoor residual spraying (irs) (97.2% (69)) and distribution of itns [97.2% (69)]. Only 2.8% (2) of the respondents were not aware of what the government did to control malaria in tubu village . Twenty nine respondents got their mosquito nets from the town council (figure 2). Other respondents acquired their mosquito nets from the shops (14), both shops and town council (14), both clinic and council (5), clinic (4), and both clinic and shops (3). Other personal malaria prevention methods reported as commonly practiced by the community included taking antimalarial drugs (1.4% (1)), clearing of surrounding vegetation (12.7% (9)), avoiding stagnant water (12.7% (9)), wearing long sleeved clothes (2.8% (2)), and use of aerosols (2.8% (2)) and repellents [8.5% (6)]. A total of 13 individuals (4 males and 9 females) participated in the pra discussions . During the discussions this shortage resulted in some household members using emptied maize meal bags to construct mosquito nets . However these self - made nets had disadvantages in that they did not kill mosquitoes since they were not treated with an insecticide . Furthermore they were deemed uncomfortable as they tended to retain heat and could not fit well around modern beds . In winter (june - july), most households did not use the nets so often since mosquitoes were not a major problem during that time . The group was satisfied with the spraying exercise but expressed concern regarding coverage of areas inaccessible to the spraying teams due to flooding and also the fact that some households refused to have their homes sprayed claiming that the insecticide caused allergic reactions . Mosquitoes were obtained from larval breeding (22) and adult sampling (64). Using the pcr species identification technique all the 86 specimens in addition other nonvector mosquitoes, namely, two an, demeilloni and one an . Apart from anopheles species, more than 200 culicine mosquitoes were also caught resting either indoors or outdoors and breeding in the sites where the vector mosquitoes were found . Forty - eight point four percent (31/64) of the anopheles arabiensis mosquitoes caught resting indoors in selected huts were blood - fed and at different stages of their gonotrophic cycle . Mosquitoes were also observed resting outdoors in animal burrow pits located within the village and close to breeding sites . These included vegetated areas at periphery of water bodies, animal hoof prints, open sunlit puddles created by receding floods, and man - made temporary puddles within farming fields . Six homesteads were located within 100 m from mosquito breeding habitats, 17 were between 100 m and 500 m, 38 were between 500 m and 1000 m, and 10 were between 1000 m and 3000 m (figure 3). Previous malaria episode was significantly associated with distance from water bodies (table 2). Majority of our study population earned income far less than the botswana national poverty datum line pegged at us$81.94 (bwp611.30) by the ministry of finance and development planning as of 22 april 2013 . This is consistent with the country statistics that show that about 44.8% of rural people (30.6% in towns) in botswana are classified as poor . Such communities have been found to be at greater risk of malaria disease because they are poorer and face higher transmission rates than their urban counterparts . Malaria parasiteamia was associated with a reduced household socioeconomic status in a rural area in tanzania . Social and economic factors aggravate the contribution of climate related factors in influencing the malaria burden . For many social and economic reasons the community in tubu village according to the world health organisation such sedentary communities living in malaria prone areas and who cannot afford to move out of flood - affected areas due to low economic status have an increased chance of acquiring infection . This is particularly true for children, pregnant women, and older people, who form the high risk groups . Other important factors that contributed to individual exposure to mosquito bites were the limited use of personal protection methods such as taking antimalaria tablets and use of aerosols and repellents . Cost of these prevention tools may have been the limiting factor especially in a community regarded as leaving below the national poverty datum line . Similar observations were made in nouma, burkina faso, where the use of aerosols was not a popular method perhaps because of the costs associated with such measures . Minimum use of these simple measures not only affect individual exposure to mosquito bites but is also an indicator of very low socioeconomic status, which in itself has been proposed as an important factor associated with malaria . Residential house status or structure has some implications in malaria transmission as poorly constructed houses expose individuals to mosquitoes that may find the dwelling more comfortable as a resting place . Traditional huts / houses with large eave gaps present in tubu village played a role in allowing free movement in and out of the huts / houses and providing suitable shelter for mosquitoes that eventually attacked the bedroom occupants . Previous studies have shown that traditional grass thatched houses with open eaves and lacking ceilings provided more favourable resting places for mosquitoes and put the occupants at risk of contracting malaria than houses with closed eaves, iron corrugated / asbestos covered roofs, and having ceilings . Nevertheless, in poorly constructed houses where cooking and sleeping take place in the same room, smoke could repel mosquitoes through the eaves at the time that cooking is taking place [9, 25]. However the community in tubu village did not benefit from the protective effects of smoke since most of the respondents prepared their meals outdoors . Our findings indicated that the community was equally exposed to mosquito bites anytime of the night regardless of the size of eaves . Therefore closing doors early in the evening did not provide any protection since mosquitoes could still freely enter the dwellings through the eaves as was evident from the anopheles and culicinemosquitoes caught resting indoors . Arabiensis mosquitoes in the village verified that the community was at risk of being bitten by an infected vector mosquito . The fact that some study participants spent time in other homesteads away from tubu village did not make any difference since the structure of the dwellings there was the same and most of the alternative homesteads were in the same geographical area with similar climatic and environmental characteristics . Most of the respondents who reported history of malaria attack also reported that they spent much of their night time outdoors during the peak biting period and therefore could have picked the infection during that period when they are not yet sleeping under a mosquito net . Arabiensis could also expose individuals in the community who may not necessarily be involved in late outdoor activities . Arabiensis has been shown to have early biting activities, which peak between 1900 hrs and 2000 hrs, with over 70% of biting activity occurring before 2200 hrs . The documented peak biting period coincided very well with the time that most of the individuals in tubu village would be involved in late outdoor activities since the vector mosquito is also known to bite humans both outdoors and indoors . Arabiensis is an opportunistic species that feeds preferentially on humans in many parts of africa but can be diverted to domestic animals as their density increases . In tubu village the presence and number of livestock near or within 3000 m from the homesteads could have some influence on the degree of malaria transmission at community and household levels . It is most likely that the risk of getting mosquito bites could have been reduced due to zooprophylaxis especially in situations where the species predominantly displays zoophagic foraging tendencies . However, the benefit of keeping livestock close to human dwellings has been refuted by many authors from studies conducted in the gambia and the ethiopian highlands . It is clear that the association between the presence of livestock as a risk factor and malaria transmission is a complex issue that needs further investigations in botswana, where the ratio of cattle to humans is very high . More than half of the respondents had travelled outside tubu village in the last 8 months, to other more intense malaria endemic areas . Although active screening for malaria parasites was not done among the respondents, the responses to questions crafted to determine malaria risk implications of travel outside the study area indicated that travel to more intense malaria transmission areas exposed individuals to malaria . Reported visitors from malaria endemic areas could also have played an important role in importing malaria parasites to the village . In a study conducted in urban kisumu, kenya, children who reported spending at least one night per month in a rural area endemic to malaria were found to be at risk of contracting infections, indicating that exposure during rural travel was an important element of risk . The risks of acquiring malaria through travel were also observed in an urban area situated in the largest port of the pacific coast in columbia . Insecticide treated nets (itns) have become quite significant as the most practical method of mosquito control by protecting at - risk individuals from mosquito bites and hence malaria infections . In this study participation of different organisations such as the council, clinic (ministry of health), and shops in supplying mosquito nets and the promotion done by the government could have resulted in overwhelming possession and use of mosquito nets by the community . Similar findings were reported in nouma, burkina faso, and also in an urban area of burkina faso where it was attributed to regional promotion . Reported mosquito net use in tubu village was very high regardless of whether it is treated or not . The use of untreated mosquito nets has also been found to have some protective measures against mosquito bites [19, 33]. In burkina faso mosquito net use was relatively more frequent in summer than winter, thereby conferring protection from mosquito bites during the peak malaria transmission period [22, 32]. For an average family size of 6.8, with some homesteads possessing as many as 6 nets, it is most likely that each individual in the community had the opportunity to use a mosquito net . However, actual mosquito net use was not investigated and overreporting by the respondents was possible since ownership does not necessarily translate to actual use . Innovativeness by the community in mosquito net making using waste maize - meal sacks has also been reported by the doane college which implemented the doane nets project in kenya whereby recycled plastic bags were converted into mosquito nets . Since the quality of material used to make maize - bag mosquito nets was of major concern there is need for the ministry of health to promote the initiative and provide the community with the proper netting material for making more comfortable mosquito nets ., it shows that the community was aware of the protection given by nets and willing to contribute towards this initiative, thereby rendering the nets intervention more sustainable and not just waiting for handouts . Irs, in addition to itns, is a mainstay of all national malaria control programmes in southern africa . Irs is based on the assumption that mosquitoes feed and rest indoors, thereby coming in contact with the sprayed surfaces . Mosquito survey conducted in tubu village showed that almost half of the vector mosquitoes caught resting indoors were blood - fed, an indication that the community was at risk of potentially infective mosquito bites . Therefore, more should be done in terms of indoor residual spraying, to deter mosquitoes from seeking indoor shelter . In addition the ministry of health should devise strategies to cover those high risk areas for malaria transmission that are considered inaccessible due to flooding . Although blood - meal analysis was not done, there is a high likelihood that some of the malaria vector mosquitoes might have fed from human beings, thus making the community vulnerable to potentially infective mosquitoes . This facilitated prompt treatment of malaria and other diseases . From similar observations made in ghana it was suggested that in such situations a higher health education standard could have an additional effect in reducing malaria disease . Most of the homesteads were surrounded by low vegetation cover not ideal as resting places for mosquitoes . In general, the area does not support thick vegetation and probably this resulted in daytime resting mosquitoes taking shelter in animal burrow pits . Incidentally, during the pra discussions, the community lamented increased activities of pests such as squirrels and porcupine which create burrow pits that have become convenient resting places for mosquitoes . The location of homesteads relative to mosquito breeding habitats was one of the major risk factors for malaria transmission . Arabiensis infested water bodies, a distance considered to be within the general flight range of most mosquito species . Such closeness of homesteads from breeding sites, in addition to the presence of animal burrow pits within the village, made the human population vulnerable to mosquito bites . Year - round sampling through the major bep project established that larval breeding in tubu village took place throughout the year in a variety of habitats created interchangeably by either rainfall or floods (bep fifth report, 2012), thus exposing the community to year - round mosquito bites . The presence of culicine mosquitoes breeding in the same habitats exacerbated the problem of mosquito biting, though the species were of no medical importance in botswana . Abundance of larvae and larval habitats and proximity of humans to larval habitats have been found to correlate very well with vector mosquito biting rates . Close proximity of homesteads to vector mosquito breeding sites increased the risk of malaria in many countries including uganda and ethiopia . The ministry of health changed its policy on malaria case management and recording in botswana . As from october 2010 to date all suspected malaria cases are not handled at any clinic, tubu included, but promptly referred to gumare district hospital . All recordings are done at central / district hospital . Retrieving information from the district attendance register of patients originating from tubu village was not possible because cases were pooled together onto one district register, with other patients presenting with other diseases . Furthermore the outcome on malaria patients referred to gumare district hospital is never conveyed back to the clinic of origin . As a result of these anomalies, there is a possibility of both over- or underreporting of malaria episodes by the respondents . However a previous study among the same community / individuals showed that the community was well aware of the disease (95.6%) in terms of signs and symptoms (88.7%) and prevention measures (98.6%) and 100% of the respondents who had suspected a malaria attack sought medical treatment at the clinic . Because of the small sample and population sizes of the study area, the results can only be extrapolated to other villages with similar demographic, ecological, and environmental characteristics and cannot be generalized to all malaria prone villages in botswana . Similar case studies in different malaria prone settings in botswana should be undertaken for comparative purposes . In conclusion, socioeconomic status, exposure to mosquito bites through individual nocturnal outdoor activities, and mobility of the community were identified as high risk factors for malaria transmission in tubu village . Limited use of malaria protective measures such as insecticide treated nets, house structure (traditional or modern), and close location of homesteads in relation to breeding sites exposed individuals to mosquito bites . However the number of mosquito nets possessed in each household and the farming status were not considered as risk factors for malaria . Hut / house eaves used as bedrooms by the respondents did not have any influence on the level, time, and frequency of mosquito bites . The overwhelming use of mosquito nets treated, untreated, or home - made proved to be a viable tool for malaria control in the village . Satisfactory service provided at and the close proximity of the health facility were added advantages to the community . Furthermore the community benefited from the low vegetation cover surrounding their homesteads, which did not provide enough shelter for even nuisance mosquitoes . It is recommended that the ministry of health should develop a health education package encompassing some of the risk factors identified in this study and other indicated similar studies to be conducted in different settings . From our findings the most important issues to be addressed through the health education package include behavioural changes during nocturnal outdoor activities, ways of protecting oneself during visits to other malaria endemic areas, advice on the ideal location of homesteads in relation to mosquito sources, and promoting the use of insecticide treated eave curtains . Ways of promoting household based control methods, based on these specific risk factors, should be devised . The ministry of health should support community initiatives in mosquito net making, in addition to strengthening irs activities in inaccessible flood prone areas of the delta . Future research should comprehensively look at the role of other potential risk factors, such as zooprophylaxis and firewood smoke, in malaria transmission and on the possibility of incorporating the benefits derived, if any, into community based malaria control initiatives.
The prevalence of pancreatic cystic neoplasms (pcns) is around 2.5%.1,2 pancreatic cysts are increasingly discovered probably because of the ubiquitous presence of multi - detector computed tomography (ct) scans and their increased use to evaluate patients with abdominal complaints . Endoscopic ultrasound (eus) plays a pivotal role in the evaluation of patients with pancreatic cysts but eus and cross - sectional imaging alone have proven to be inaccurate in identifying the exact nature of the cysts . There is inadequate information on the natural history of pancreatic cysts but our knowledge base cannot be expanded without being able to determine the exact nature of the cyst noninvasively . Toward this end, eus with fine needle aspiration (fna) along with cyst fluid analysis has been advocated to improve the utility of eus in the diagnosis of pancreatic cysts . Size> 3 cm and/or the presence of mural nodules appear to be the best indicators of malignant change in patients with the side branch form of intraductal papillary mucinous neoplasm (sb - ipmn) and mucinous cystic neoplasms (mcn).3 eus with cyst fluid aspiration and/or fna can play a role in differentiating pcns . This paper will review the role of eus - fna in the evaluation of pcns . If the cysts are incidental (the patient has no symptoms referable to the pancreas), the great majority are determined to be neoplastic.4 in one study, the majority of incidentally detected pancreatic cysts (58%) were mucinous and therefore had some malignant potential.4 these data suggest that all incidentally found pancreatic cysts should undergo further evaluation . Serous cyst adenomas consist of multiple " micro cysts " with thin septae coursing through the lesion . However, 20% have a dominant macrocystic or even solid component which can result in confusion with mucinous cysts.5,6 mcns are almost exclusively located in the tail of the pancreas and are either unilocular or have only a small number of discrete compartments . Rarely they will have peripheral (eggshell) calcification which is highly predictive of cancer.7 mcn almost never communicate with the pancreatic ductal system . The cystic component of the side branch form of ipmn is essentially a dilated side branch(s) and by definition, is part of the pancreatic duct . Magnetic resonance imaging (mri) is superior in imaging sb - ipmn by virtue of its ability to visualize the pancreatic ductal system . Secretin stimulated mri / magnetic resonance cholangiopancreatography can be used to highlight the ductal anatomy8 and is commonly used in pancreatic centers but its superiority to non - secretin studies in the evaluation of ipmn has not been proven . Identification of sb - ipmn with eus can be made by visualizing a dilated side branch(s) with connection to the main pancreatic duct . Depending on the plane of imaging, they may appear as a chain of lakes - separate cysts that become confluent when scanning back and forth across the cyst . The primary problem with imaging alone in the evaluation of pancreatic cysts is that there are no clearly differentiating features that allow a high degree of diagnostic accuracy . Studies have shown that imaging alone is inaccurate in differentiating each of the types of cystic neoplasms.9 in a recent study from the group at the academic medical center in amsterdam, the accuracy in identifying the nature of a pancreatic cyst using eus imaging alone was only 23% to 46% amongst a group of expert endosonographers.10 this study used 4 criteria to differentiate cysts: 1) septations, 2) mural nodules, 3) a solid component, and 4) communication with the pancreatic duct . As a result of these discouraging reports, eus - guided cyst aspiration and analysis along with cytology have been used to improve diagnostic accuracy; especially the differentiation between macrocystic serous cyst adenoma, sb - ipmn and mcn . Difficulties in establishing an accurate diagnosis with imaging alone have prompted investigators to pursue adjunctive measures . The idea of using analysis of cyst aspirates to diagnose pcn dates back to 1991.11 the massachusetts general hospital surgical group is credited with advancing the clinical application of this concept12 and brugge13 then applied eus - fna techniques to obtain cyst fluid noninvasively . 1 to 2 ml of fluid is needed to perform carcinoembryonic antigen (cea) analysis . As a result, the cyst should be 1 to 2 cm in size to obtain sufficient fluid for cea analysis . Recently, it has been possible to perform cea on as little as 500 l of fluid (redpath integrated pathology, pittsburgh, pa, usa). Because the fluid may be quite viscous, a 19 or 22 gauge needle is preferred . Intravenous antibiotics are recommended during the procedure with oral antibiotics given for 3 to 5 days afterwards . It is recommended that the fluid be sent for cea, amylase and/or lipase, and cytology . The rationale for analyzing for amylase or lipase is to aid in determining if there is ductal communication . The cooperative pancreatic cyst study group then reported that cyst fluid analysis for cea was the best test to differentiate a mucinous from a nonmucinous cyst.14 however, the sensitivity and specificity for cea is 73% and 84%, respectively, and 25% of mucinous cysts will have a cea level less than 192 ng / ml.14 it may be possible to improve the analysis of cyst fluid by combining cea and molecular analysis (dna quantity, k - ras mutations and allelic imbalance mutations). Sawhney et al.15 reported a 100% sensitivity of discrimination between mucinous and nonmucinous cysts using a combination of cea and molecular analysis . It has also been reported that combining an extracellular mucin stain with cea analysis can provide an accurate discrimination between mucinous and nonmucinous cyst.16 problems with eus - guided cyst aspiration were delineated in a paper by de jong.17 one hundred forty - three consecutive patients with indeterminate pancreatic cysts underwent eus - guided cyst aspiration and the fluid was sent for cea, ca19 - 9, amylase and cytology . Only 90% could be punctured (cyst in inaccessible location or too small). Of the remaining 128 patients, only 31% had adequate cellularity for analysis and there was sufficient fluid for cea in only 68 (49%). Fluid specimens from pancreatic cysts seldom yield cells because few viable cells are shed from the lining . The lining epithelium can be patchy which also contributes to the difficulty in obtaining adequate samples . The lining of serous cyst adenomas is a glycogen - rich cuboidal epithelium whereas mucinous cysts have a mucin containing columnar epithelium (mcn is differentiated from ipmn by having ovariantype stroma). A cytology brush within a 19 gauge needle has been developed in an attempt to improve cytologic yield during eus - guided cyst aspiration (echobrush; cook endoscopy, winston - salem, nc, usa). The needle is passed into the cyst and then the brush is advanced against the inner wall of the cyst . The 1st report of using the cytology brush for pancreatic cyst cytology came from al - haddad et al.18 they studied 10 patients with pancreatic cysts and compared the cellular yield for standard fna compared to brush cytology of the cyst wall . In 7 of 10 patients, the cellular yield and detection of diagnostic cells was superior for the echobrush . Sendino et al.19 reported results in 30 patients with pancreatic cysts evaluated with the echobrush (cook endoscopy). In 8/30 patients (27%) however, the brush cytology provided a specific diagnosis in 20/22 (91%) patients in which the technique succeeded . The brush technique was superior to fluid aspiration (73% vs. 36%; p=0.08). Three patients experienced complications (10%): 1 self limited pancreatitis, 1 self limited bleed, and 1 retroperitoneal bleed resulting in patient death at 30 days . A recent report presents better results in obtaining cytology by performing cyst wall puncture (cwp).20 the technique reported was to advance a 22 gauge needle into the cyst and aspirate all the fluid contents . Then, without withdrawing the needle, the needle tip is moved back and forth across the residual hypoechoic cyst wall . If the cyst wall was not visualized, the needle was moved 2 to 3 mm from the needle tip location where the aspiration was completed . Using this technique, the authors reported obtaining material adequate for cytologic assessment in 81% of cysts (60/66). Thirty percent of cysts with cea <192 ng / ml were proven to be mucinous by cytology . In 67% of cases where the cyst fluid volume was insufficient for cea analysis, cytology demonstrated mucinous epithelium the complication rate was 1.45% (1 episode of pancreatitis which was graded as mild and self - limited). An alternative or adjunct to cyst wall cytology might be to directly examine the cyst wall . There have been recent reports of using a small confocal microscopy probe (mauna kea technologies, paris, france). The cellvizio system is a probe based confocal microscopy system and a very small probe has been developed which can be passed down a 19 gauge needle . Like any other optical biopsy system, konda et al.21 reported use of this technology on 18 patients; 12 of whom had pancreatic cysts . Imaging succeeded in 17/18 patients and in 10/17, the images were considered to be high quality . Future studies will need to address safety issues and determine if a specific diagnosis can be made easily and safely . There have also been reports using the optical catheter used in the spyglass system (boston scientific, natick, ma, usa) to directly visualize the cyst lining . Direct visualization of both cysts revealed smooth lining and biopsies revealed a mucinous cystadenoma in both cases . There were no immediate complications in either case but one developed severe pancreatitis 1 month after the procedure . Identification of masses or nodules emanating from the cyst wall can indicate the presence of cancer or high grade dysplasia.3 however, it is important to make a differentiation between a mural nodule and an aggregate of mucin . This distinction was studied by zhong et al.23 who reviewed pathology, eus and ct examinations from 57 patients who had undergone surgical resection of mucinous cysts . Cancer or high grade dysplasia was found in 23% of cysts with mural nodules verses 3% without nodules (p=0.02). Mucin balls accounted for 65% of the intracystic lesions detected by eus and were characterized by being round, having smooth edges and being anechoic in the center with an echogenic rim . Eus had sensitivity of 75% for the detection of mural nodules compared to 24% for ct . Aspiration of cyst contents is indicated if identification of the cyst cannot be made with imaging alone . However, if there is an associated mass or mural nodule, then the mass itself should be targeted for cytologic examination . While mucinous cysts are the most common indication, cystic degeneration of neuroendocrine tumors and adenocarcinoma as well as solid pseudopapillary neoplasm and acinar - cell cystadenocarcinoma represent cystic neoplasms of the pancreas that present with a solid component . In these cases any of the 3 gauges of needles (25, 22, or 19) could be used . In the instance of a mass multiple punctures into a cyst is the main risk factor for infection . In the case of a mural nodule, it is best if the cyst fluid can be removed 1st leaving a solid mass to target . Our practice is to combine fluid aspiration (performed 1st) and then the needle is re - directed to the mass . We prefer to have the 1st pass stained and interpreted before considering a 2nd pass to minimize the number of passes needed to establish the diagnosis and decrease the rate of complications . There has been concern in performing eus - fna of a cyst in the body or tail of the pancreas if malignant transformation is suspected . Our japanese colleagues have been most vocal in expressing concerns about the potential of needle tract seeding of cancer cells.24,25 a resectable cystic mass in the body of the pancreas should be considered for surgical resection without fna in most circumstances . Pancreatic cysts are being increasingly recognized and when detected incidentally, they are likely neoplastic and should undergo further evaluation which should include eus . The cyst fluid should be sent for cea, amylase and cytology . In the future, safe techniques should be developed to improve the cytologic yield because it appears that the exact nature of the lining in mucinous cysts is predictive of their malignant potential.26,27
Brucellosis is a zoonotic disease mostly transmitted to humans through consumption of unpasteurized dairy products and can lead to a systemic disease with any organ involvement . In this report, we describe a case of brucellosis - induced avascular necrosis of the hip . Brucellosis was diagnosed through serological tests, and avascular necrosis of the femoral head was confirmed by pelvic mri . The patient was treated with a combination of antimicrobial treatments and referred to the orthopedic service for total hip arthroplasty . Brucellosis may present with unusual manifestations and should be always taken into consideration, particularly in endemic areas . Brucellosis is a zoonotic disease mostly transmitted to humans through consumption of unpasteurized dairy products of infected animals (1). It is a serious public health problem particularly in endemic areas, and is accompanied by . The disease is endemic in iran and has a high prevalence in lorestan province, central iran (3). Brucellosis is a systemic disease that may involve any organ in the body (4). Osteoarticular involvements including arthritis, spondylitis, osteomyelitis, tendonitis, and bursitis occur frequently and are reported in 3085% of patients with brucellosis (5). The involvement of the large peripheral joints is usually manifested as monoarthritis (1). Although the hip joints involvement may happen in brucellosis, brucellosis - induced avascular necrosis of the hip, we describe a case of brucellosis that complicated by avascular necrosis of the femoral head . The patient was a 50-year - old rural farmer and rancher who presented with groin pain for six months before admission . He reported no history of trauma, underlying diseases, and steroids and alcohol use . Over the previous six months, he had experienced symptoms including .fever, night sweats, weakness, fatigue, anorexia, and weight loss of 10 kg . The patient was visited by a local therapist; in addition there was a delay in timely referral due to his addiction to opium . The groin pain was his most severe complaint on admission so that he could not bear his weight on the right leg . The physical examinations on admission showed stable vital signs, there was no organomegaly, and the right hip was in flexion and external rotation position so that any active and passive motion increased the pain . The results of laboratory study were as follows: complete blood count (cbc): nl, liver function test (lft): nl, rheamatic factor (rf): neg, antinuclear antibody (ana): neg, blood culture: neg, elevated erythrocyte sedimentation rate (esr), c - reactive protein (crp): positive, and standard agglutination test for brucellosis: positive (table 1). Pelvic radiography and magnetic resonance imaging (mri) were administered showing avascular necrosis of right femoral head (fig . 1, 2). The patient was subsequently treated with standard antibrucellosis regimen: streptomycine 1gr / d i m for three weeks, doxycycline 100mg / bid po, and rifampin 600mg / d po . .despite the improvement in the patient s general condition and laboratory evidence showing infection control, the patient was suffered from right groin pain and limitation of motion in the hip joint . Although osteoarticular involvements, especially arthritis in the large peripheral joints, are among the most common manifestations of brucellosis, no joint destruction has been reported in many studies (5). Despite few reports on the permanent joint complications of brucellosis - induced peripheral joint arthritis, hip joints pyogenic infection has a poor prognosis, particularly if treatment is delayed (6). Delays in diagnosis and treatment of brucellosis - induced hip arthritis could lead to complications including dislocation and avascular necrosis of the femoral head (4). Although aspiration and examination of the joint fluid were not performed due to lack of synovial effusion on admission, considering the positive serological tests for brucellosis and concurrent avascular necrosis of the femoral head on mri, it seems that the delay in diagnosis and treatment of brucellosis in this patient had led to avascular necrosis of the femoral head . Finally, the following questions arise: was avascular necrosis caused by increased intra - articular pressure related to the infection or due to direct involvement of the femoral head by the organism? Since brucellosis is a systemic infection with a broad clinical spectrum ranging from asymptomatic forms to deaths in severe cases, this disease should be taken into considerations when dealing with any patient with various and nonspecific symptoms in endemic areas with extension of the clinical signs of brucellosis . Moreover, early diagnosis and long - term treatment and follow - up are of great importance in brucellosis.
Since the framingham heart study first reported risk factors for atherosclerotic cardiovascular disease, numerous efforts have aimed at improving risk assessment in the asymptomatic population . Over time, these efforts have resulted in the introduction of framingham risk score (frs) and other biomarkers including the use of noninvasive imaging modalities such as coronary calcium scoring with ct scan and carotid imt and plaque measurement . While these methods have shown prognostic values independent of risk factors, mainstream medicine is still relying on the frs, which tends to be inaccurate for individualized risk assessment and fails to assess the current status of vascular health . Moreover, frs and risk factor - based scoring systems are neither designed nor used to monitor response to therapeutic interventions . A comprehensive cardiovascular risk assessment requires measurement of risk factors as well as structural and functional markers of the arterial system . For the widespread acceptance and clinical adoption of a new test, it must be (1) incrementally predictive over risk factors, (2) responsive to therapy, (3) operator - independent and reproducible, (4) low - cost and widely accessible in primary care settings, and (5) posing no significant side effects . In recent years, endothelial function measurement has emerged as a reasonable candidate that could fit the above criteria . Barometer of cardiovascular risk, and endothelial dysfunction is the gateway to atherosclerotic cardiovascular diseases [3, 4]. Over the past 20 years, a number of noninvasive methods of assessing peripheral endothelial function have been introduced, including ultrasound imaging of brachial flow - mediated dilatation (fmd), fingertip arterial tonometry, fingertip photoplethysmography, and laser doppler flowmetry [512]. A new technique named digital thermal monitoring (dtm) has been developed to evaluate endothelial function by measuring vascular reactivity during a 5-minute arm - cuff reactive hyperemia test . Dtm is the newest addition to the field and monitors fingertip temperature changes to measure vascular reactivity . Dtm is a noninvasive, automated, and operator - independent test that can be performed both at physicians' offices and in patients' homes . We and other researchers have previously reported the relationships between dtm and cvd risk factors, coronary calcium score, myocardial perfusion defects, and coronary angiographic findings [1320]. Therefore, the present study was conducted on a large registry of 6,084 patients from 18 different clinics to better characterize dtm index of vascular reactivity (vri) in relation to patients' phenotypes . The methodology for measuring endothelial function and vascular reactivity using dtm has been previously described [2125]. All dtm tests were performed using a vendys 6000 portable system (endothelix, houston, tx), a pc - based system that fully automates the cuff reactive hyperemia protocol . The general test setup and a sample vendys test report blood pressure cuffs were placed on both of the subject's upper arms, and vendys skin temperature sensors were affixed to both of the subject's index fingers . The software - driven dtm test began with an automated measurement of blood pressure and heart rate obtained from the left arm cuff . Following a 5-minute period of patient and temperature stabilization, a 5-minute cuff occlusion (cuff inflated to 30 mmhg above systolic bp) of the right arm fingertip temperature in the right hand decreased because of the absence of warm circulating blood . When the cuff was released after the 5-minute occlusion, hyperemic blood flow to the forearm and hand was restored, and this resulted in a temperature rebound in the fingertip that is directly related to the subject's hyperemic blood flow response, endothelial function, and vascular reactivity [21, 22]. Using the recorded fingertip temperatures, the ambient temperature of the testing room, the observed slope of temperature decline, and a multivariate bioheat formula, the vendys software calculated and plotted a zero reactivity curve (zrc). The zrc served as an internal control and showed the expected temperature rebound curve, if zero vascular reactivity was present and the other variables remained the same . In other words, the zrc is the expected temperature curve, if no vasodilatation and subsequent reactive hyperemia had occurred . Vascular reactivity index (vri) was determined by taking the maximum difference between the observed temperature rebound curve and the zrc during the reactive hyperemia period . Vri ranged from 0.0 to 3.5 and was classified as being indicative of poor (0.0 to <1.0), intermediate (1.0 to <2.0), or good (2.0) vascular reactivity . The vendys dtm test registry includes age, sex, blood pressure, heart rate, vri, and fingertip temperature measurements recorded during dtm tests . This study includes a total of 6,084 patients from 18 clinics that volunteered to submit their data to the registry . The number of each type of medical practice is as follows: cardiology = 9, general / family practice = 4, antiaging = 3, and internal medicine = 2 . Vri scores in men and women were compared using unpaired student's t - test . Comparisons of categorical data (e.g., proportion of subjects with good vri in men versus women) were performed using fisher's exact test . Pairwise correlations were examined using pearson's correlation coefficient, and correlations between vri and multiple patient characteristics (i.e., age, sex, blood pressure, and heart rate) were evaluated using multiple linear regression analysis . P value <0.05 was considered significant . When performing statistical comparisons, tests with missing data cold finger flag was defined as the condition in which the right finger temperature at start of cuff occlusion (time 300 s) is 27c . Temperatures <27c often resulted in technically poor results . Sympathetic response flag was defined as the condition in which left finger temperature continuously declines (> 0.5c temperature drop over a 5-minute time period) after right arm - cuff occlusion . When evaluating vri, tests that exhibited cold finger flag in addition to monitoring temperature at the index finger of the right arm, we studied temperature changes at the index finger of the left (nonoccluded) arm and observed interesting signals that are currently under further investigations and not included in the results below . Overall, the study population had the typical age and sex distribution seen in internal medicine and cardiology clinics ., 54% men, 46% women, systolic blood pressure (sbp) 138 20 mmhg, diastolic blood pressure (dbp) 77 12 mmhg, and heart rate (hr) 70 13 bpm . The vri distribution with cumulative percentages overall, the vri values exhibited the appearance of a normal distribution, with the exception of a small clustering of vri values at or above zero . Thirteen percent of vri tests were categorized as poor vascular reactivity (vri <1.0), 70% as intermediate (1.0 vri <2.0), and 17% as good (vri 2.0). Vri was slightly higher in women than in men (1.56 0.58 versus 1.50 0.49; p = 0.0001). The distribution of poor, intermediate, and good vri in men and women is shown in figure 2(b). The percentage of good vri was higher in women than in men (21% versus 13%; p <0.0001). In contrast, men were slightly less likely to have poor vri than women (12% versus 14%; p = 0.03). Vri was mildly and inversely correlated with age (r = 0.21, p <0.01) as illustrated in figure 3 . As shown in figure 4(a), poor vri (<1.0) was most frequent in the oldest age group (> 70 yrs ., 18%) compared with middle age (5070 yrs ., 10%) and younger (<50 yrs ., 6% however, the distribution of poor, intermediate, and good vri values in this elderly age group (figure 4(b)) was similar to that of the overall study population (13% poor, 70% intermediate, and 17% good). Vri was not significantly correlated with sbp, dbp, pulse pressure (pp), or heart rate . A trend was seen of higher vri scores in subjects with higher diastolic blood pressure (r = 0.10; p = ns). However, none of the blood pressure variables were significantly correlated with vri . Multiple regression models were built using vri as the dependent variable and age, sex, sbp, dbp, and hr as independent variables . As shown in table 2, age, sex, and diastolic blood pressure were significant but weak predictors of vri . This is the largest report to date on any fingertip - based measurement of vascular reactivity and endothelial function [7, 26]. Our analyses showed that vri values derived from dtm followed a near - normal distribution and the reasonable distribution conformed to previously established cutoff values for categorizing vri scores as indicative of poor (0.0 to <1.0), intermediate (1.0 to <2.0), or good (2.0) vascular reactivity . Vri was weakly and inversely correlated with age . However, as shown in figure 4(a), the frequency of poor vri was three times higher in> 70 y versus <50 y. this finding was in line with the findings of framingham heart study reported by hamburg et al . . Nonetheless, as reported by schnabel et al . In a community based study of 5,000 individuals, classical risk factors only accounted for 15.4% of fmd and 13.9% of pat variability . This clearly indicates that endothelial function provides a new angle into the status of vascular risk . The distribution of weak association between vri and age is in sharp contrast to other vascular tests, including coronary artery calcium, carotid intimal - media thickness, and arterial stiffness, that are strongly and positively associated with age and, therefore, require age specific cutoffs . Although the highest prevalence of poor vri was found in patients older than 70 y, the distribution of vri values in this elderly population (figure 4(b)) clearly shows a sizable number of good and intermediate scores . These findings support the clinical utility of dtm as a test that can differentiate good vascular function from poor vascular function, regardless of patient's age . This is consistent with the sex differences of endothelial function measured by flow - mediated dilation in healthy adults . However, the magnitude of the sex difference for vri is not felt to be large enough to warrant establishing sex - specific cutoff values for good, intermediate, and poor vascular reactivity . We also observed a trend of higher vri values with higher diastolic bp but no association with systolic bp or pulse pressure . It is possible that the subjects with high bp would have been on multiple antihypertensive medications that could have increased their vri scores . The results of multivariable analyses showed that sbp and dbp were found to have minimal correlations with age . Because blood pressure is known to correlate strongly with age in untreated population, bp - lowering medications may have played a significant role in modifying (leveling) the relationships in our study population . Because our data set was limited by the unknown status of bp medication many investigators of peripheral vascular endothelial function refer to fmd as the method of choice and consider it to be a reference standard, but it has several physiological and technical issues, including operator - dependency, which may result in excessively high inter- and intraobserver variability, effect of the baseline diameter, low flow - mediated constriction, and reduced arterial wall compliance [3234]. The correlation between fmd and finger - based measurements has been less than strong [7, 26, 3538]. The weak or inconsistent correlations between fmd and the finger - based measurements have been explained by the notion that fmd mainly reflects macrovascular reactivity, whereas the finger - based measurements mostly reflect microvascular reactivity . Currently, there is no evidence regarding superiority of macrovascular over microvascular reactivity . More studies are needed to evaluate the predictive value of each for risk assessment and monitoring response to therapies . Previous studies showed a significant relationship between poor vri and high framingham risk score as well as high coronary calcium score [14, 18, 19]. Moreover, one study found that individuals with both poor vri and high framingham risk score had the highest coronary calcium scores . Although more work is needed to develop clear clinical guidelines to incorporate such physiologic measurements into patient care, there is no doubt that these physiologic data offer a new window to an individualized assessment . The fact is that risk factors are population - based factors and do not speak for individual's susceptibility to the risk factors, nor can they evaluate the current status or activity level of the disease . On the other hand, structural markers such as coronary calcium and carotid imt - plaque are good indicators of susceptibility to risk factors and show the effects of past exposure, but they do not show the current status or the activity level of the disease . In fact, calcification will not go away with treatments, making it not suitable for monitoring progression and regression . Measurement of endothelial function and vascular reactivity provides an instant status of the vascular physiology . Therefore, for a comprehensive assessment of vascular health, one must pay attention to risk factors, structural markers, and functional markers of the disease . Although almost all cvd patients receive medications and other therapeutic interventions, not all respond to the treatments or respond similarly . Identifying who responds well and who responds poorly is a major challenge and currently classified as residual risk . Budoff et al . Reported that vri was significantly higher in patients who received statins and aged garlic extract, compared with those who received statin alone, and that patients who showed a significant improvement in vri had less progression of coronary calcium . Showed an independent and significant predictive value for endothelial function measurement in patients at high risk for cardiovascular events . Similarly, rubinshtein et al . Showed that poor fingertip - based vascular reactivity measurement with pat significantly predicted poor outcomes . Together, these data clearly point to the clinical utility of endothelial function in primary and secondary prevention . A detailed comparison of fmd, pat, dtm, and other noninvasive cvd risk assessment methods is shown in table 3 . The primary limitation was that the vendys registry data do not include information about patients' clinical conditions or medication use . We also did not know when the dtm tests were performed in relation to each individual's medical history and use of medications that might have affected vascular reactivity . Strengths of our study include a large sample size and a mixed population of males and females, geographically dispersed and from various outpatient clinics . The present study using the largest database of finger - based assessment of endothelial function shows that digital thermal monitoring of vascular reactivity provides meaningful and reproducible physiological variables . It also suggests independent roles for vri as new indices of vascular reactivity and endothelial function . It is essentially a combination of a blood pressure and a thermometer empowered by intelligent software that can be used both at clinics and at home . However, further studies are needed to incorporate these functional measurements into clinical practice guidelines for primary and secondary prevention.
A sandwich or laminate technique is one of the methods proposed for composite resin restorations, which was introduced for the first time by mclean, et al . In 1985 . The basic idea behind this technique is to use two different restorative materials for a single restorative procedure so that the maximum physico - mechanical and esthetic properties of these two materials can be exploited simultaneously . Generally, the first component is a layer of conventional or resin - modified glass - ionomer cement which has drawn attention due to its capacity to form an inherent bond with tooth structures and the resultant better seal and decrease in microleakage (particularly in dentinal walls); it can also release fluoride and decrease the odds of carious lesions . The second component is a layer of composite materials (including composite resin, compomer, and ormocer), which is used to compensate for the limitations and disadvantages of glass - ionomer cements, including weak mechanical properties and inappropriate esthetic appearance . It has been reported that the combination of these two materials have different property results in the clinical success of restorations . The success of the laminate technique depends on the strength of the bond between the glass - ionomer and the resin composite materials in addition to the strength of the bond between the glass - ionomer cement and dentin . However, there is a relatively weak bond strength between conventional glass - ionomers and composite resin materials, mainly because of the lack of a chemical bond between these two materials and the low cohesive strength of glass - ionomer. [35] several studies have evaluated different surface preparation techniques for glass - ionomers, such as the use of different bonding systems and surface etching procedures in order to increase the bond strength between these two materials in the laminate technique . Etching the surface with phosphoric acid has yielded different results . In a study carried out by sheth, et al . Etching the surface of glass - ionomer had no effect on bond strength increase; however, an increase in bond strength after acid etching has been reported in another study . It has also been reported that premature etching of glass - ionomer cement (before its initial setting reaction) and failure to use an adhesive resin between the glass - ionomer cement and composite resin increases the odds of restoration failure . In another study, it was demonstrated that the use of a self - etch adhesive system on half - set glass - ionomer cement (before its initial setting) increases the bond strength between the glass - ionomer cement and composite resin more than that observed with the use of total - etch systems (its application after the initial setting of the cement). It has also been reported that the use of a glass - ionomer - based adhesive system applied after the cement's initial setting improves the bond strength between the glass - ionomer cement and composite resin compared to that with the use of total - etch adhesive systems under similar conditions . A new group of composite resin materials, giomers, have been introduced in less than a decade, which consist of reacted glass - ionomer fillers in a resin matrix; they are used in cavities in a manner similar to composite resins with the application of an adhesive system . In addition to appropriate esthetic results, easy polishing, fluoride recharging potential and strength, these materials release fluoride which may enhance their antibacterial effects . However, no studies to date have evaluated the bond strength between glass - ionomers and giomers; therefore, the aim of the present study was to evaluate the effect of three surface preparation methods on the shear bond strength of giomer to different surface treated conventional glass - ionomer . Sixty cylindrical specimens were used in the present in vitro study . In order to prepare the samples, a plastic mold (with an inner diameter of 6 mm and a height of 4 mm) was placed on a glass slab . Then conventional glass - ionomer (gc fuji ii, gc corporation, tokyo, japan) was packed into the plastic mold after mixing according to the manufacturer's instructions . Another glass slide was used on the other side of the mold to make the free surface of the conventional glass - ionomer smooth . Then the samples were randomly divided into three groups of 20 . According to the manufacturer, the initial setting of gc fuji ii conventional glass - ionomer lasts in 5 minutes and a half, and the net setting time is 2 minutes and a half . Three groups were compared; a total - etch adhesive resin or a self - etch giomer - based adhesive resin on set glass - ionomer; or the self - etch giomer - based adhesive resin on the unset glass - ionomer (before completion of the initial setting). In group 1 the surfaces of the specimens were etched with 37% phosphoric acid (3 m espe dental products, st . Paul, mn, usa) for 15 seconds after 5 minutes and 30 seconds from the mixing procedure; the initial setting reaction was confirmed with the use of a sharp dental explorer . It should be pointed out that a complete setting of conventional glass - ionomer takes 24 - 72 hours . After surface etching, a single bond total - etch adhesive system (3 m espe dental products, st . Paul, mn, usa) was applied according to the manufacturer's instructions and light cured [table 1]. A second transparent mold, with a diameter of 3 mm and a height of 2 mm, was placed on the conventional glass - ionomer specimen and a giomer restorative, beautifil ii a3-shade (shofu dental corporation, osaka, japan), was packed into the transparent mold and cured using a halogen light - curing unit (astralis 7; ivoclar vivadent, fl-9494 schaan, liechtenstein). The light - directing probe had a diameter of 8 mm and directed a light ray at an intensity of 700 mw / cm perpendicular to the surface, barely touching the surface, for 40 seconds . A light intensity of 700 mw / cm was confirmed using a radiometer before the start of each experimental session . After transparent mold removal, the specimens were cured for another 20 seconds from each direction . Then the samples were kept in humidity chamber at 37c for 1 hour before being immersed in distilled water at 37c for the next 23 hours . In the next stage, a 500-cycle thermocycling procedure was carried out at 5c/55c 5c with a dwell time of 30 seconds and a transfer time of 10 seconds . Chemical composition and application mode of adhesives used in group 2, the procedures were similar to those in group 1 except that fl - bond ii (shofu dental corporation, osaka, japan) self - etch adhesive resin was used on set glass - ionomer surface according to the manufacturer's instructions and light cured [table 1], without acid etching . In group 3, all the procedures were similar to those in group 2 except that fl - bond ii adhesive was applied according to the manufacturer's instructions right after the initial setting and before hardening of glass - ionomer (2 minutes and a half after the initiation of mixing, which is equal to the cement's net setting time). It should be pointed out that during that time the surface hardness of the cement was sufficient to place the second mold without damaging the cement . In order to measure the shear bond strength, the samples were mounted in cold - cured acrylic resin from the glass - ionomer side and the shear bond strength values of the samples were measured in newton using a universal testing machine (h5k - s model, hounsfield test equipment, surrey, uk) at a crosshead speed of 1 mm / min using a 0.5 mm - wide chisel . Then the shear bond strength values were calculated in mpa by dividing the force (in newton) by the surface area (mm) of the samples . Data were analyzed by one - way analysis of variance (anova) and pairwise comparisons were made by a tukey test using spss/ win.15 . The failure modes were determined under a stereomicroscope (smz1500, nikon, tokyo, japan) at 20 . The failure modes were classified as follows: adhesive failure: failure at giomer glass ionomer cement interface . In addition, to evaluate the interface between the conventional glass - ionomer and giomer in the groups under study, two additional specimens were prepared in each group and subsequent to longitudinal sectioning, they were evaluated under an scanning electron microscope [sem] (tescan, vega ii xmu, brno, czech republic) [figure 1]. Scanning electron micrographs of conventional glass - ionomer and giomer interface in the study groups (mag 500). Arrows indicate margins of adhesive resin between glass - ionomer and giomer . In the three scanning electron micrographs, the materials which are placed on the right and left sides of the adhesive resin indicate glass - ionomer and giomer, respectively shear bond strengths in mpa (means and standard deviations) for the study groups are represented in table 2 . There were statistically significant differences in shear bond strength values between the study groups (p <0.0005). Pairwise comparisons by a tukey test revealed that there were statistically significant differences in shear bond strengths between group 2 and the two other groups (p <0.0005), whereas the bond strength difference between groups 1 and 3 was not statistically significant (p = 0.609). Means and standard deviations (sd) of the shear bond strengths (mpa) measured in study groups moreover, all the cohesive failures were within glass - ionomer cement and there were no cohesive failures inside the giomer . Failure modes of the study groups sem photomicrographs of the glass - ionomer and giomer interface in the study groups are represented in figure 1 . In the sem photomicrograph in group 1 [figure 1a] the hybrid zone (the area of adhesive resin penetration into glass - ionomer) is almost homogeneous but has irregular borders on the glass - ionomer cement side . In the sem photomicrograph in group 2 [figure 1b] the hybrid zone is regular and homogenous and in the sem photomicrograph in group 3 [figure 1c] the hybrid zone is irregular and non - homogenous . Moreover, the use of self - etch adhesive resin (fl - bond ii) in groups 2 and 3 resulted in the thicker hybrid zone than total - etch adhesive resin (single bond) in group 1 . An appropriate bond between glass - ionomer and the superficial resin materials is very important for the success of the sandwich technique . In the present study shear bond strength of conventional glass - ionomer to giomer was evaluated using three different surface preparations for glass - ionomer (use of self - etch adhesive on glass - ionomer with or without complete initial setting reaction and use of total - etch adhesive on glass - ionomer after completion of the initial setting reaction). In designing the present study, the use of total - etch adhesive on glass - ionomer without the completion of the initial setting reaction was not considered, because in total - etch adhesives, rinsing after etching and contamination with moisture before completion of the initial setting reaction of glass - ionomer influences the surface integrity of the cement . The results of the present study showed that shear bond strength of glass - ionomer to giomer depends on surface preparation . In this context, in the group in which glass - ionomer was set and self - etch adhesive was used, the highest shear bond strength was recorded compared to two other groups, which is consistent with the results of a study carried out by gopikrishna, et al . On glass - ionomer - based adhesives; in the case of complete setting reaction the bond strength was higher than that in incomplete setting reaction . Contrary to the results of the present study, knight, et al . Reported no statistically significant differences in the bond strength before and after initial setting of glass - ionomer in the co - cure technique, where conventional glass - ionomer, resin - modified glass - ionomer (rmgi), and composite resin were placed in consecutive layers before light - curing procedure . The differences in the results of that study and the present study might be attributed to different etching times in the two studies . The etching time was 15 seconds in the present study, while in the study done by knight, et al . It appears that longer etching time paves the way for greater destruction of glass - ionomer surface by the acid and decreases the bond strength . In addition, a different technique was used in the above - mentioned study, i.e., a layer of rmgi was used over conventional glass - ionomer before placement of composite resin and the curing process was carried out for rmgi and composite resin simultaneously . It is well - known that the ph of glass ionomer cements is strongly acidic upon mixing, and it will increase with time, with the most rapid increase during the first 5 - 10 minutes of setting, regardless of the composition of the glass ionomer material . In comparison of groups 2 and 3, it appears that the acidic ph of unset glass - ionomer prevented complete polymerization of the giomer - based self - etch adhesive and therefore decrease the bond strength . In addition, this acidic ph might have an adverse effect on the polymerization of giomer itself . In a study carried out by mohamed - tahir, et al . Another study has shown that surface hardness of composite resin placed on polyalkenoate glass (set for 4 minutes) significantly decreased . Moreover, sem observation of the interface in group 3 revealed an inhomogeneous structure and occasionally breakdown of the glass - ionomer surface, which may have affected the bond strength . Polyacrylic acid prevents polymerization of composite resin and results in composite resin softening; apparently this effect was intensified in incompletely set glass - ionomer . In comparison of groups 1 and 2, it appears that etching the glass - ionomer surface immediately after the initial setting in group 1 in the total - etch system resulted in the destruction of cement surface, crack formation and decrease in bond strength . This speculation was confirmed by the sem micrographs of the interface . The irregular interface in group 1 may be an indication of damage and weakening of the glass ionomer surface rather than improved micromechanical interlocking, when compared to group 2 which was treated by a comparatively mild acid, i.e., the self - etching primer . Several studies have demonstrated a decrease in bond strength of glass - ionomer to composite resin as a result of etching the glass - ionomer surface . It has been reported that etching during the initial setting reaction of glass - ionomer leads to dissolution of weak calcium - polyacrylate rings, with the resultant deterioration of its physical properties . In the total - etch procedure however, another reason for a higher bond strength in the self - etch group compared to the total - etch group is the fact that the acidic monomers in the self - etch primer can chemically bond to the calcium in glass - ionomer and increase bond strength . In addition, a more appropriate compatibility of giomer with the giomer - based self - etch adhesive might be another reason for a higher bond strength in group 2; it has been suggested that the use of adhesives compatible with resin - based restorative materials can decrease deleterious chemical interferences . Moreover in the self - etch adhesive group, resin penetration occurs simultaneous with the etching process and it is probable that the discrepancy between these two processes is eliminated or minimized . Another factor that needs to be taken into account is the difference in composition and mechanical properties of the two adhesives; fl - bond ii is a two - step self - etching adhesive with filler particles while single bond is a mixture of hydrophilic monomers and solvents that contains no fillers . It has been suggested that the two - step self - etching adhesives that incorporate a hydrophobic resin as a separate bonding agent may have enhance mechanical properties compared to simplified adhesives . Moreover, apart from the composition of resin matrix, addition of filler particles enhances the mechanical strength of the bonding layer and contributes to bond strength . In the present study, no differences were observed in bond strength between groups 1 and 3, and bond strength in both groups was significantly less than that in group 2 . Regarding failure mode in the present study, the majority of failures were of the cohesive type in glass - ionomer, which is consistent with previous studies . This phenomenon might be attributed to lower mechanical properties of glass ionomer cements when compared to resin - based materials and the presence of numerous air inclusion bodies inside glass - ionomer, which act as stress concentration points and probably increase the odds of cohesive failure . A disadvantage of sandwich technique is the absence of a chemical bond between conventional glass - ionomer and superficial resin materials; therefore, researchers have focused on the establishment of a chemical bond between them . Considering the results of the present study, use of giomer - based self - etch systems not only decreases the time needed for the clinical application but also can result in the establishment of a chemical bond between giomer and conventional glass - ionomer . Taking into account the limitation of this in vitro study, etching the surface of set glass - ionomer with a total - etch system or placement of self - etch adhesive on the surface of glass - ionomer with incomplete initial setting compromised bonding of giomer to glass - ionomer.
Planning, evaluating, and budget allocation for prevention programs are contingent upon estimating the size of their target groups . Population size estimation of the target groups in some context, such as hiv / aids, always entail numerous challenges in countries where such diseases are concentrated in specific sub - populations with stigmatized behaviors & characteristics (e.g. : injecting drug users) (15). Traditional sampling methods that are used to estimate the size of these high risk populations, including multiplier, capture - recapture, etc ., are very complicated, if not impossible, since locating people with high risk behaviors is difficult, and approaching them directly can greatly reduce response reliability (510). Estimating social network size of a representative sample, through a general population survey, and asking participants questions about specific high - risk behaviors among their acquaintances (1113) is one of the best means of gathering information on the sizes of such populations, also called hidden or hard - to - count populations due to the fact that it is not possible to calculate their sizes through regular, direct methods (14) one such method that has held the interest of researchers for the past decade is network scale - up (nsu) (6). In this method, the average social network size of the respondents (shown by c) is used as a prerequisite for estimating the size of a high risk population in the society (shown by e) based on the mean number of persons with high risk behavior known by respondents (shown by m) (15). In the past two decades, several studies in different countries including the united states, ukraine, brazil, moldova, rwanda, japan, china, and thailand have used this method to determine social network sizes as a pre - requisite for estimating high risk population sizes . This difference points to the need for local studies to determine this value and its determinants (1421). In iran, the estimated social network size on a national scale is between 308 and 380 . However, tehran, as a megacity and the capital of iran, has unique demographic, cultural, and social features, special inter - individual relationship patterns, and different subpopulation proportions . In addition, due to the migration of different ethnic groups to this city, various ethnic networks have been formed (22). Therefore to observe these different characteristics and the technical considerations which are recommended in the nsu method, the present study was designed to examine the social network size of the tehran province residents and the demographic factors affecting it in order to prepare the grounds for estimating the size of hidden populations . The social network size was estimated using an indirect approach, that is, respondents were asked how many persons they knew in a certain sub - population within the society, and estimations were made based on the respondents answers . The term knowing a person has a specific definition in this study, and involves a certain time span and space (23, 24); therefore by saying a knows b, it is understood that a knows b by name and face; a can visit, call or email b whenever he / she wants, and vice versa . Moreover, a has contacted b by phone, email or in person at least once within the past 2 years, and b is a resident of tehran province (2527). For the total sample size 1029, we selected 829 persons from tehran and 200 from robat karim, the capital of robat karim county in tehran provincein 2012 . The city of tehran was divided into 5 geographical zones: north, south, east, west, and center and the sample size were divided proportional to the population size of these five zones . Sampling was done in crowded areas, such as streets and parks; individuals were selected through convenience sampling, and questions were asked in the form of street interviews . All participants were 18 or older, and had been residents of tehran province for the past five years . Upon entering the survey, participants were briefed on the study objectives, and their informed consent was obtained . In order to determine the social network size, participants were asked questions regarding the number of people in their personal networks using the indirect method, that is, they were asked how many people they each knew in specific subpopulations . After coordination with the ministry of health and the statistical center of iran, twenty - three known populations with clear and available provincial level statistics were selected to be used in this study . In order to improve estimation accuracy, and in view of the findings of similar studies (20, 28), several considerations were taken into account in preparing the final list of the known populations to be used in the present study; for instance, the size of all selected populations was between 0.1% and 4% of the total population of tehran province . Moreover, we excluded populations that could potentially induce a transmission error in the estimations for which there was no practical correction method . Popularity of names in the past three decades was observed in assigning names, and more popular names were used at an almost even distribution . Out of the twenty - three initial subpopulations, thirteen were eventually used in the study: first graders, high school graduates, university applicants, university students, married people, divorced people, those who had had normal vaginal deliveries (nvd), those who had had cesarean sections (c / s), primary school staff, people with the first names hamed, abulfazl, sara and marjan . In this study, social network size was estimated using the maximum likelihood estimation (mle) method and the equation below: c^i = j mijj ej.t where c^i is the social network size of the respondent i, mij is the number of people that i knows in the known population j, ej is the real size of the known population j, the statistical information for which is available through previous censuses or surveys, and t is the total size of the general population in the survey area (11, 13). To compute the 95% confidence intervals of the social network size, standard error c was calculated through the formula below: (29) se ci = tcijej this simple model will only work if the following strong assumptions exist (11, 24): all respondents have equal opportunity to know each member of the subpopulations under study.all respondents are fully informed about their own social network.all respondents can recall the number of their acquaintances in the subpopulations under study quickly and clearly . All respondents can recall the number of their acquaintances in the subpopulations under study quickly and clearly . Violation of each of these assumptions brings about errors in the results achieved through the network scale - up method . One thing that can violate assumption a is the barrier effect, which pertains to barriers causing some respondents to know the subpopulations in the study with stronger or weaker possibility . Transmission error, on the other hand, can violate assumption b, and that is when all people in a given person s network are similarly likely not to be aware of him / her belonging in a subpopulation . Estimation effect is another factor that can violate assumption c, and it is due to a lack of precise knowledge of certain details about the people in a high risk social network . In order to control various effects and errors that can bias estimations, the following methods were employed to investigate the sources for these potential errors: 1) back estimation of each of the known populations to determine the best groups for estimating the ultimate social network size, and 2) variable stratification of the study samples, carrying out all analyses independently in each subgroup, and comparing results with that for the total sample . Moreover, acquaintances who were among the respondents social network but were not residents of tehran province were eliminated from all estimations . In order to perform the first correction, a preliminary calculation of the social network size was done, the size of each known population was assumed unknown (e), and then the size of each subpopulation was estimated through the formula below: at this point, the estimate / real ratio (e / r ratio) for each population was calculated by dividing the estimated population sizes by the real sizes throughout the province . The next step was to eliminate the first known population in which this ratio was not between 0.5 and 2 . After removing the population in which this ratio was the farthest away from the above - mentioned range of 0.5 and 2, the whole process was repeated one more time . The procedure was repeated for each of the populations, starting with the farthest outlier, until none of the calculated ratios was outside of this range . The final social network size was computed from the average social network size calculated for people in this stage (ci) (14, 24, 30). In the end, the effect of various demographic and background factors on the social network size of the residents of tehran province was analyzed using a linear regression model . A total of 1029 people were interviewed in this study; 46.7% participants were male . The majority (42.3%) was in the 18 25 year age group; the last educational degree of most participants was high school graduate or bachelor s degree, and they were mostly university students (table 1). Demographics of study participants using the thirteen known populations, the social network size was estimated at 200.4 (ci95%: 188.3, 212.5), which was used for the back estimation of the known populations in this study . The pearson correlation coefficient between the real and estimated sizes of these known populations was 0.44 (p value = 0.12). The e / r ratio was approximately 1 in all but three of the subpopulations; exceptions were first graders, and nvd, c / s where e / r ratios were 0.40, 0.43, and 0.3 respectively, and therefore the social network size of tehran province was estimated by eliminating the subpopulations c / s, first graders and nvds in that order . Table 2 represents the estimated social network size after excluding each of the above subpopulations, as well as the e / r ratio for populations whose sizes have been calculated based on the estimated network sizes that continue to be out of the desired range . Having eliminated c / s, primary school and nvd groups, the estimated cs were 220.8, 243.4 and 259.1 respectively . In addition, the correlation between the real and estimated sizes of remaining groupwas improved significantly in every steps (r= 0.32 based on groups, 0.51, 0.72 and 0.82 by dropping c / s, primary school and nvd groups respectively). Estimate / real (e / r) ratio & estimate - real correlation changes after stepwise excluding the known populations with out of range e / r ratio table 3 demonstrates results of applying the back estimation method to subpopulations with estimated sizes within the acceptable range that were used in the final network size estimations . Back estimations and e / r ratios of all populations are presented in table 4 . Known populations, source of data, back estimation of their population sizes, and the e / r ratio e / r ratio in separate estimations of social network size for men and women (before and after excluding the three out of range e / r ratio known groups) figure 1 represents the scatter plot of the real against estimated sizes of the thirteen known populations, and the same measures after excluding the three abovementioned subpopulations . The final network size estimated by using the remaining ten subpopulations was 259.1 (ci95%: 242.2, 276). Real estimate scatter plot of known population sizes (before and after excluding the three out of range e / r ratio known groups) in the univariate analysis, social network size was significantly associated with gender (p=0.01), age (p<0.001), and occupation (p<0.001). Men had larger networks comparing to women (291.8 versus 230.4), and c in younger people was larger than that in older ones (328.5 versus 201.1). Multivariate analysis showed that variables of gender and age impacted social network size (table 5). Age was also proved to have a significant impact on the respondents knowing the studied subpopulations (p <0.001). Comparison of social network size in different sub groups based on different background variables the possibility of knowing a person who had graduated from high school, participated in the university entrance exam, or been admitted into university in the past year was higher in the younger age group (56.6%, 63.4% and 39.3% respectively) (table 6). Based on the findings of this study and by using the mle method, the social network size of the residents of tehran province was estimated at 259.1 which were calculated using 10 known populations with an e / r ratio between 0.5 and 2 . Age and gender were determinants of peoples network sizes . Estimated network sizes were different in male and female respondents, and appropriate known populations used for c estimation in these two groups were not equal . Our experience showed that all subpopulations with known size were not appropriate to be used in the estimation of c. we dropped three sub - populations to improve the internal validity of our size estimations, which also used in other comparable studies (11, 14, 20, 22). By eliminating these 3 subpopulations, the social network size the national study was primarily biased in a similar manner as well (22). Therefore, estimation of c based on the size of some known subpopulations is a stepwise technique and has to be applied with some considerations; otherwise the estimated c might have big bias . The estimated sizes for known subpopulations c / s, nvd, and first graders were less than half the real sizes, and for the subpopulation of people with the first name marjan the estimated size was more than twice the actual size . After all three subpopulations were eventually eliminated, the correlation coefficient was more than double (0.82 as opposed to 0.32), and became statistically significant . Moreover, the estimations for the subpopulation marjan a persian female first name- fit within the acceptable range, and was closer to 1 . This indicated that the social network size estimated by using the ten remaining known populations would yield a more reliable estimate of hidden subpopulations too . Similar studies confirm likewise that elimination of populations with estimations outside of the range 0.5 1.5increases the correlation coefficient between back estimations and real sizes . Conducted a research in ukraine to estimate the number of idu s fsw s and msm . Of the 22 known populations used in this study, 13 fell within the acceptable e / r ratio range, and were used in the final network scale - up calculations . The estimated sizes of known populations had a high correlation coefficient with the real sizes using the back estimation technique (r = 0.912), and this number reached 0.94 after nine of the known populations were eliminated (14). In another study conducted on 1554 individuals in the u.s . After elimination of two populations with a discrepancy between their real and estimated sizes, the correlation rose to 0.94 (11). In the present study, the average e / r ratio using thirteen known populations was calculated to be 1.17 . Removing each of the outliers brought this ratio closer to 1, and after eliminating the 3 sub - populations mentioned earlier, the e / r ratio reached 1.09 . This figure indicated an average overestimation of about 9% in the calculations . In the ukrainian study, the e / r ratio was 1.65, which denotes an overestimation of 65% in population size estimations (14). Overestimation seems to be one of the common limitations of the network scale - up method with small subpopulations (11, 30). In the present study, this problem occurred with the subpopulation of people with the first name marjan, which was the smallest subpopulation with only 0.12% of the total population of tehran province . Since nicknames are common in iran, this overestimation may be because the respondents network includes people called marjan who are registered in the census with a different name; this can be true with several names . After eliminating the c / s subpopulation, the e / r ratio for the subpopulation marjan fell within the acceptable range (e / r = 2), and after the two subpopulations nvd and first graders were removed, this ratio decreased even further (e / r = 1.7). Another common calculation error in the network scale - up method is underestimation of the size of large subpopulations (11, 30). The largest subpopulations used in this study were c / s, first graders, married people, and university applicants . The first two were underestimated as expected, while the other two had more accurate estimations, probably on account of a more satisfactory transmission and the respondents being more informed on these properties due to the significance that iranians attribute to marriage and university education . Study on se - roprevalence in the united states, it is difficult for respondents to estimate the number of acquaintances they have in large subpopulations (11). In addition to the estimation error in the c / s subpopulation, another explanation for this group having the lowest e / r ratio (0.34) and an e / r ratio lower than 0.5 for the nvd group is transmission error . The similar natures of these two subpopulations as well as their connection to gender suggested that respondents gender impacts their awareness of nvd or c / s occurring within their social networks . In order to assess the validity of this theory, network size estimations and back estimations for populations were performed based on the respondents gender . Based on our findings, the e / r ratios for known populations were different in male and female res pondents (table 4). The e / r ratios were out of range for the subpopulations c / s, nvd, and first graders when estimated through the networks of male respondents, but this limitation did not exist in case of female respondents . The difference seems to be understandable considering the nature of these subpopulations and the iranian culture: an iranian male respondent would be less likely to be aware of childbirth conditions or first graders in his social network compared to a female respondent in a similar situation . In the ukrainian study, similar circumstances were encountered when estimating the number of militiamen, since there was a higher likelihood for male respondents to know someone in this subpopulation on account of their cultural status and social relations compared to women (77% vs. 68%). Therefore, using the militiamen subpopulation to estimate the social network size leads to different results in male and female respondents (14). Barrier effect is another significant factor that can compromise the estimation of population sizes in the network scale - up method . One common barrier, which could be a concern in the present study, is the respondents age . Those in the 18 25 year group were more likely than others to know someone in the subpopulations high school graduates, university applicants, and university students, considering how these categories are age - related . Based on the results shown in table6 however, barrier effect did not affect the results of this study . This is probably because the 18 - 25 year old group is relatively larger in the general population, and our 18 - 25 year old group was proportionately larger too . In the ukrainian study, the two subpopulations polish and moldavian were removed due to the risk of barrier effect and consequent estimation errors . In the final stage of the present study, the remaining ten subpopulations were used to estimate the social network size at 259.1, and this was used as the base for estimating the known population sizes with the most suitable e / r ratio and the highest correlation with their true sizes . This number was smaller compared to similar study in the country, carried out by shokoohi et al . In kerman province in 2010 (c = 303). Their study was performed on 500 men between 18 and 45 years of age, and the data were collected through interviews . The difference between the social network sizes of the two provinces of tehran and kerman seems to be due to the lifestyle specific to metropolitan areas and capital cities that somehow limits social relationships; one other reason may be that the kerman study was restricted to male samples, who are expected to have more social contacts and consequently larger networks than females in a city like kerman (27). Two estimates were computed by entering 23 known groups in the study using regression - based (c=308) and ratio - based (c=380) methods . According to their results, the ratio - based method, which is also used in the present study, is the recommended approach because of higher internal validity and prediction validity (22). The ratio of the population size to the total tehran population was beyond the range of 0.1% to 4.0% for 10 of the 23 known groups in the national study; differences in population compositions and their effect on results can partly explain the different estimates in these two studies . Moreover, unique social, cultural, political, and economic processes in tehran have created a different pattern of social interactions that restricts inter - individual relationships and limits the social network size . Social science studies also confirm that in recent years, the nature of urban development in megaci - ties such as tehran has entailed loosening in social ties . This is due to concentration of population in metropolitan areas and absence of alternative social practices (31). In the ukrainian study, the social network size was estimated at 202 using a network scale - up approach and the mle method, which was also employed by the present study (27). In a 2012 study conducted in japan by ezoe et al . With the purpose of estimating the msm population, the network size was estimated to be 363.5 regardless of gender, with 174 being male . Out of the initial ten known populations used in this study, only three were eventually used to estimate the social network size in the pilot stage: male fire fighter, policemen, and military personnel . Of the seven eliminated populations, five were removed on account of estimation error, that is, their estimated sizes were not consistent with their real sizes, and two were removed due to transmission error (20). The social network size was estimated at approximately 291 in the united states, as shown in the 2001 study by mccarty et al ., using four separate national sets of samples . The study used the network scale - up method on 29 known populations, three of which were similar to the subpopulations in the present study and those were: first names, people who gave birth within the last year, and victims of car accidents (24). The social network size estimated by killworth et al . Was 286, which is larger than the present study, and this may be due to the numerous cultural and social differences between iran and the united states (11). Although in the kerman study, there was no significant relationship between the social network size and any of the demographic factors (age, education, marital status, and occupation) (27); the results of the present study showed that men comparing to women and younger people comparing older ones had a significantly larger social network, which seems understandable on account of cultural and social considerations . In the national study and the chinese study, the social network sizes of men and younger people was larger compared to those of women and other age groups, and this is due to men and young people having wider social circles (21, 22). Married people had smaller social networks compared to single people in the two studies mentioned above; this difference was found to exist in the present study as well, although the difference between these two groups was statistically not significant in tehran province (248.8 versus 270.1). In this study, there were limitations associated with the network scale - up method . Firstly, it is unrealistic to expect accurate and flawless estimations, because although there is a precise and specific definition for the term knowing a person, data collected on social networks is self - reported . In minimize this limitation, the present study attempted to use known populations that were easily recognizable by all respondents, and had clear and uniform definitions for all members of the society . Furthermore, the time span for the questions was the past year so that respondents could remember the details with fewer errors . Another issue, which is quite unavoidable, is lack of definite boundaries separating many subpopulations in the respondents points of view . Researchers are limited to subpopulations for which official statistics exist, and these subpopulations have been assigned specific definitions that are not necessarily consistent with those of various members of the society . We intended to select a representative sample of general population in order to minimize different types of selection and information biases . Although it was not a fully random sample of whole community and there are some methodological considerations, based on the existing experiences in iran and the result of a methodological study that was performed for comparing three popular sampling method in this type of studies (street - based, telephone - based and home - based interviews) in this regard, it seems street - based sampling from deferent geographical zones would be a feasible sampling scheme which was used in the national study as well . Based on the above explanation, it seems that the social network size of tehran s residents is different not only with similar studies in other countries but also with the results of national survey in iran, which might be mainly because of the special social and cultural pattern of communications among different communities . We also showed that the c varies considerably in males and females, in young and old people . Therefore, local estimations for c in different sub - populations are needed to improve the accuracy of nsu estimations . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or fal sification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
Benign prostatic hyperplasia (bph) is a highly prevalent disease affecting middle aged and elderly men (1). In the united states, bph is the most common benign tumor in men and is the most typically the disorder that reduces the quality of life (qol) in men, causing lower urinary tract symptoms (luts) (2). Bph could be accepted as one of the processes of aging, rather than a life threatening disease, however, and as korea is rapidly becoming an aging society, the qol becomes a major issue among koreans . It seems certain that, before long, bph will emerge as one of the main priorities of concern for health care service authorities, as well as the government . According to the report in the united states, approximately 4.5 million visits were made to physicians' offices for a primary diagnosis of bph, and almost 8 million visits were made with a primary or secondary diagnosis of bph in the year 2000 (3). The direct cost of bph treatment was estimated to be 1.1 billion usd, excluding outpatient pharmaceuticals and nutritional supplements or herbal medications . There have been some population surveys on the prevalence of bph in korea (4, 5, 6), but the scale of those studies was small, and the issue of cost for bph treatment was not investigated . Therefore, in the present study, the authors aimed to estimate the amount of health care utilization due to bph by surveying the records of patients who visited the designated medical institutions by the health insurance review and assessment service (hira) of korea . The hira monitors and analyzes reimbursement records from the korean national health insurance (nhi) and medical aid . Because almost the entire nation is required to join the nhi (approximately 96.6% of the population) and medical aid (approximately 3.4%), hira records cover all citizens (approximately 49 million people) in korea . We also aimed to find any seasonal or regional variation in the cost of health care utilization due to bph, as well as to examine economic burdens on the health insurance system and the pattern of practice in the management of bph . Lastly, this nationwide, large - scale survey was conducted to offer the most reliable and objective epidemiological data in order to provide fundamental information for authorities formulating health care policy to improve the national health - related qol . We evaluated data from the hira from a span of 5 yr (2004 to 2008). Data consisted of the patient's age, residence at diagnosis, treatment cost for bph (medical and surgical), time to surgery from medication, emergency visits, etc . The hira is a non - profit governmental organization established to review medical fees and to evaluate the appropriateness of health care benefits that beneficiaries receive . The hira database contains reimbursement records from all medical facilities (~5 - 6 million inpatient - visits per year in about 1,100 hospitals and 25,000 private clinics) in korea (7). The criteria to divide the residence at diagnosis into rural and urban depended on the locations of the clinics or hospitals which were visited by patients . In hira database, small and medium sized cities and farm villages are equivalent to the rural area, while large cities more than megalopolis correspond to the urban area (8). We used all claims records of outpatient visits or hospital admissions of patients aged 20 yr or older, diagnosed with bph (international classification of diseases [icd]-10 diagnostic code: n40) as the primary diagnosis . We then assessed the seasonal and annualpatterns of hospital visits and duration of treatment due to bph, as well as the changes in the amount of insurance payment for the diagnosis and treatment of bph, during the research period . Hospital visit (hv) meant the number of days that the patients visited the hospital due to bph and duration of treatment (dt) indicated the period of prescription if the patients received medications due to bph . Total amount of insurance payment (taip) gave the information of the total cost of national insurance payment for bph within one year, and per capitainsurance payment (pcip) signified calculated values using this total amount of insurance payment and national population data (9, 10). Age - specific number of hv and dt were presented, and differences over the years were analyzed with a poisson analysis and the relative risk (rr) was estimated . Rr was the calculated specific value which indicated the age - specific relative difference of hv, dt, and pcip based on the value of 1 . A time series analysis was performed to explore the seasonal and annual variation of the amount of hv, dt, taip, and pcip . The durbin - watson test was used to evaluate self - correlations of error . To remove the self - correlations of error a poisson regression analysis was done to estimate the rr of annual variation, age difference, number of hv, and dt for the pcip . Age - specific pcip was analyzed after age - standardization using data from the 2005 census (9, 10), obtained from the korean national statistical office . All hypotheses were evaluated in a 2-sided manner, and p value of <0.05 was considered significant . This study was exempted from review and evaluation by the institutional review board of the boramae medical center, seoul . This study was exempted from review and evaluation by the institutional review board of the boramae medical center, seoul . The total number of hv from 2004 to 2008 was 12,088,995 . The number of visits increased with time and reached the almost 1.7 fold in 2008 compared to 2004 (table 1). After a logarithmic transformation to remove an increasing tendency of the range of fluctuation, the linear pattern persisted . The total dt almost doubled from 3,463,520 days in 2004 to 6,598,787 days in 2008 (table 1). 1c). In the time series analysis using the stepwise autoregressive process, the amount of hvincreased every winter which demonstrated seasonality, repetition of a variation of patterns in a 12-month cycle (fig . 2a, p=0.005). Patients in the 20s showed a decrease in hv from year to year, those in the 30s showed an increase until 2006 and then a decrease, those in the 40s showed an increase throughout the study period . After a poisson regression analysis, we found that hv were different depending on the age groups, years, and type of visit (inpatient or outpatient) (p<0.001). The interaction between age groups and years was significant (p<0.001), which meant that the variation of hv by year was significantly different depending on the age groups . Estimated rr is presented in table 2 . For patients in the 20s and 30s, hv significantly decreased 0.78 and 0.96 times, respectively, compared with that of the previous year . On the other hand, in patients in the 40s and above, hv significantly increased 1.10, 1.13, 1.17, and 1.16 times compared to the previous year . There was 11.45 times more outpatient hv than inpatient hv in the same age group and year.dt markedly increased in patients in the 60s and 80s (fig . The variation of dt by years was significantly different according to the age groups . Per capita insurance payment (pcip) increased with increasing age and with times (table 3 and fig . The rate of increase was steeper in the age groups older than the 50s compared to the other age groups . In a significance test for the regression coefficient, we found that the pcip were different depending on the age groups and years (p<0.001). The interaction between age groups and years was significant (p<0.001), which implied that the variation of pcip by years was significantly different across the age groups . Estimated rr from the poisson regression analysis is presented in the table 3 . In patients in the 20s,, in patients in the 30s or older, pcip significantly increased 1.05, 1.20, 1.21, 1.21, and 1.20 times compared with the previous year . There was 2.93 times more outpatient pcip than inpatient pcip in the same age group and year . There was no regional difference between urban and rural areas in terms of hv count, dt, and taip due to bph . There is not a single developed country in which the importance of care due to bph is not growing . The main contributors of the rising prevalence of bph in korea are suspected to be the elevated standard of living, westernized diet with increased consumption of animal fat, and aging population (11). Although the fact that the prevalence of bph increases with age is widely accepted and presumed to apply to the korean society, the rate of increase in this study is noteworthy and greater than expected . In the us, the total rate of bph procedures increased significantly after 2002 and was driven by a marked increase of new minimally invasive surgical technologies (mist) (12, 13). Our data also shows a remarkable elevation in medical costs over a relatively short period of time, which is suspected to be due to not only a sharp upsurge of disease prevalence but also an increase in physicians' interests, along with the expanded release of new bph drugs and the increase in patients' treatment - seeking behaviors (13). In this study, we demonstrated that the demand for bph treatment nearly doubled throughout the 5 yr of study period . The dt was 3462273 days in 2004 and increased by 1.9-fold, to 6598787 days, in 2008 . The hv was 1827996 days in 2004 and increased by 1.7-fold, to 3057111 days, in 2008 . This rapid growth happened irrespective of regional differences such as whether the area is urban or rural, and regardless of practice patterns by urologists or non - urologists, whether inpatient or outpatient . That was the reason why potentially bph patients in the elderly were more diagnosed and treated after recent large - scale public advertisements and medical education about bph . In other words, in the past, elderly patients suffering from voiding problem due to bph did not know the cause of the problem and the solving methods . But these days, awareness of bph was wide spread and people could easily access the medical knowledge, elderly bph patients had more chance to receive the proper medical care (14). By analyzing the hospital visits, we found that the frequency of hospital visits started to increase in the autumn and peaked in december in a similar pattern every year from 2004 to 2008 . From february to april, when the temperature was warmer, the number of hospital visits was fewer . The difference between the number of hospital visits in the colder season and the warmer season reached 1.2 fold . In korea, the annual mean temperature ranges from 10 to 16 degrees celsius except in the high mountain areas and islands . The warmest month is august, whereas january is the coldest one . The monthly mean temperature ranges from 23 to 27 in august and from -6 to + 7 degrees celsius in january (15). A majority of urologists have experienced the seasonal variation and rising tendency of bph incidence in the winter, and such a phenomenon has been confirmed with solid evidence based on a large population data (16, 17). It is presumed that our body is too slow to adapt to the sudden change in temperature in the winter (18, 19). In addition, alcohol consumption rapidly increases at the end of the year in korea, deteriorating luts in bph patients and occasionally leading to the most serious complication of bph: acute urinary retention (aur) (20). Higher rates of cold medicine intake could be another explanation for worsening bph symptoms in the winter . Alpha - adrenergic agonists, which are a common component of over - the - counter cold medicines, may precipitate urinary retention by enhancing bladder outlet resistance (21, 22). The reports are inconsistent and controversy persists on the seasonal variation of testosterone, but in the largest cross - sectional study, that analyzed archival data from 4,462 us veterans aged 32 - 44 yr, there was a report of a seasonal peak of total testosterone in december (24). The amount of hvincreased every winter which demonstrated statically significant seasonality, but the dt and taip were not showed significant pattern.the reasons were suggested that hv was directly influenced and changed by seasonality, but dt and taip were not . For example, even though a patient visited hospital due to aggravating voiding symptoms in winter, the diagnostic procedures or medications were not changed because of season of winter, rather influenced by physician or medical costs . Until recently, studies on the health care costs of bph were reported mostly in western societies (25, 26). In the pharmacy and medical claims data obtained from 61 us healthcare plans, 77,040 patients aged over 45 yr were examined, and the overall average annual cost of diagnosis and management for bph was 31.4 million usd . Based on us census estimates (july 2003), the direct cost estimate was approximately 3 billion usd for the year after bph diagnosis . Through this study, we figured out that korean taip in 2008 was 66 million usd (1 usd=1,103.36 korean won [krw] in 2008) which were relatively small expenditure of bph costs compared to the united states . However, it is not possible to describe briefly the gap between the two countries, because the medical system of korea and the united states was totally different . To explain the discrepancy of medical costs between korea and other countries would be an interesting subject in future research . The present study has several limitations that require consideration because of the methodological modality using the insurance claim data, as was the case for several studies reported in similar manner (4, 5, 26, 27). The insurance claims records might have underestimated the entire bph population if many patients with bph were not diagnosed or treated in health care institutions . Additionally, only a single claim with a bph diagnosis was used to identify patients with the condition, so the incidence of this condition might be overestimated in the database because a single patient may have visited clinics several times a year . This study reflects data only for the 5 yr from 2004 to 2005, which is a relatively short period of time . In addition, we did not have detailed clinical information for each patient, including symptom severity, duration, prostate size, and other medical or surgical history . Using the hira data, we did not demonstrated cost of each treatment modalities . However, as was shown in the us (12), mist has gained enormous attention from the urologists and the number of mist performed is also increasing in korea . Additional researches are warranted . Despite these limitations, however, this study has important implications . This is the first nation - wide, population - based study demonstrating not only seasonal and age - specific variation in the incidence of bph, but also the amount of the economic costs for bph patients in korea . Therefore, our large - scale data could provide the most reliable information about the incidence of bph and its cost for researchers and authorities formulating health care policy . Health care utilization due to bph is rapidly increasing in korea and is more remarkable in the elderly population . Our study is the largest scale population study, as well as the most objective clinical data in korea, so it could provide fundamental epidemiological information on bph.
Primary retroperitoneal tumors (prts) of vascular origin are a diverse group of rare abdominal neoplasms, both benign and malignant . The most frequent malignant tumors are liposarcoma and leiomyosarcoma, while the most often found benign tumors are lipoma, leiomyoma and cavernous hemangioma [25]. Hemangiomas are a group of neoplasms originating from vascular tissue where benign tumors prevail . Among these capillary hemangioma, cavernous hemangiomas most frequently occur in the liver . Other described localizations are skin, muscles, bones, central nervous system and retroperitoneal organs (intestines, kidneys, adrenal glands, urinary bladder, uterus) [616]. An interventional staged therapy is becoming more popular with the aim of reducing the diameter of the main hemangioma, especially that surrounded with diffuse hemangiomatosis . Successful combination of transcatheter arterial embolization (tae) prior to the surgery of cavernous hemangioma of the liver was reported recently . Nevertheless, the treatment of choice for primary retroperitoneal tumors is still radical surgical resection that leads to recovery . Surgical techniques used for treatment of prts are: open procedures, laparoscopy, surgical endoscopy and percutaneous radiofrequency ablation [8, 19]. The present case is a patient with giant retroperitoneal cavernous hemangioma originating from the ilium with atypical clinical course who was referred for surgical treatment . A 71-year - old female patient was referred to the department of surgical oncology with a giant retroperitoneal tumor located in the left iliac fossa . The patient discovered the abdominal tumor 15 years earlier, but as it did not cause any problems she refused to seek medical help . Several months prior to admission to the department the first symptoms appeared: left lower limb edema, exertional dyspnea, abdominal distension and anemia with pallor and lowered hemoglobin level . Physical examination revealed a large, skin modeling, nonpulsatile mass in the left iliac fossa (fig . B computed tomography scan revealing a large, left - sided retroperitoneal mass when abdominal contrast - enhanced computed tomography (ct) was performed, a tumor 20 17 18 cm in diameter lying on the iliac ala was found (fig . An ultrasonography - guided fine needle biopsy was performed, revealing blood cells with necrotic masses and connective tissue which prevented precise diagnosis . Blood laboratory findings were: anemia (hb 8.8 g / dl), elevated white blood cell count (21.81 g / l) and high c - reactive protein level (100.8 mg / l). Because of uncertainties regarding the histological type of the tumor, escalation of abdominal pain and left lower limb edema in recent weeks and the patient s strong willingness to remove the tumor, the decision to perform laparotomy was made (figs . 2 a, b). A giant tumor with sigmoid colon tight on it . C the tumor after resection (arrow peduncle connecting the tumor to the ala) during the surgery a large mass on the ala was found . There were no signs of infiltration of neighboring organs, and the sigmoid colon was tight on the tumor . After separating the sigmoid and identification of the left ureter and iliac vessels massive damage to the internal surface of the ala was found in the place where the tumor grew . Pathologic examination showed a tumor 20 19 16 cm in diameter, weighing 3000 g (fig . Histochemically the cells lining the lacunae were stained positively by markers for cd34 (figs . 3 a, b). A microscopic image with h&e (enlargement 10). Diag . Staining with markers for cd34 confirm an endothelial origin of the cells lining the lacunae the postoperative follow - up is 3 years . Within this time limb edema and this is caused by its initially symptomless course and therefore delayed presentation to a physician . The most frequent symptoms of retroperitoneal tumors are non - specific abdominal pain (51.8%) and abdominal distension (18.7%). Less frequent symptoms include constipation (8%), fever (8%), dysuria (4.3%), lower limb edema (6.5%), weight loss and cachexia (5%). The time of these symptoms occurrence varies from several months for sarcomas to years for benign tumors . Patients usually visit a physician when they discover a pathological mass in the abdomen (60.4%). In the present case her first symptoms (abdominal distension and limb edema) occurred 15 years after discovering the tumor . On ct images retroperitoneal tumors present as heterogeneous pathological masses with hypoechogenic areas corresponding to necrotic zones in the tumor . We considered an interventional staged therapy with tae for its possible advantage of reduction of the diameter of the main tumor mass, and surrounding diffuse hemangiomatosis, which was reported in the case of cavernous hemangioma of the liver . The age of the patient with possible diffuse arteriosclerosis and the necessity to resect the symptomatic tumor were the arguments to abandon the percutaneous option . However, one can find publications on treatment of hepatic cavernous hemangioma with percutaneous radiofrequency ablation . In the present case the size and localization of the tumor and urgent necessity made the operation a high - risk procedure with possibility of resecting vital structures, such as the sigmoid colon or ureter . In the present case the long - term history of abdominal tumor indicated a benign tumor, while radiological and clinical findings suggested malignant disease . The literature review shows that in differential diagnosis of giant abdominal tumors, rare benign neoplasms should be considered in every case . Radical surgical resection resulted in full recovery in our patient, which corresponds to commonly found conclusions despite the huge diameters and the origin of retroperitoneal tumors [20, 21]. In the literature reports we found only 15 cases of retroperitoneal cavernous hemangiomas in kidneys, adrenal glands, urinary bladder, uterus and the retroperitoneal part of the rectum [615]. However, no description of cavernous hemangioma of the ilium was found; therefore our report seems to be a unique contribution to contemporary knowledge (tab . Because of their initially symptomless course, primary retroperitoneal tumors are usually diagnosed in an advanced stage of the disease, which is the reason for many uncertainties regarding safe surgical resection . Radical surgical resection remains the treatment of choice for primary retroperitoneal cavernous hemangiomas, although the decision of performing such operations should be taken after thorough analysis of indications (escalation of symptoms) and contraindications (risk of damaging vital retroperitoneal organs with massive bleeding).
The pathogenesis of gmd in pd patients is related to factors such as weight gain and insulin resistance evoked by peritoneal glucose load [13]. The periodical evaluation of pd patients for gmd is of clinical relevance and should be an element of the surveillance protocol . The gold standard method used for the diagnosis of gmd defined by the world health organization (who) in 1998 uses the level of 2-h post - challenge plasma glucose (2-hpg) in the oral glucose tolerance test (75-g ogtt). Criteria for the diagnosis are the following: fasting plasma glucose (fpg) 100 mg / dl (5.6 mmol / l) to 125 mg / dl (6.9 mmol / l) (impaired fasting glucose, ifg); 2-h pg in the 75-g ogtt 140 mg / dl (7.8 mmol / l) to 199 mg / dl (11.0 mmol / l) (impaired glucose tolerance, igt); 2-h pg in the 75-g ogtt or random 200 mg / dl (11.1 mmol / l) (dm). The utility of the recently recommended use of hba1c in terms of diabetes diagnosis (diagnostic threshold of 6.5%) still remains to be validated . The population at a particular risk of glucose metabolism disorders includes renal transplant recipients, pregnant women, and patients treated with peritoneal dialysis . For each of these groups, there is a lack of clear guidelines for the detection and diagnosis of gmd . Therefore, alternative methods for detecting all glucose metabolism disorders (ifg, igt, and dm) in the population of high risk of hyperglycemia have been investigated . The issue of glucose metabolism disorders (gmd) in pd patients has regained interest in recent years . This increase in clinical relevance was caused by new evidence that even mild hyperglycemia in the dialysis period can be harmful in the long term, being associated with worse survival and elevated risk of post - transplant diabetes mellitus [68]. Treatment with peritoneal dialysis is inherently associated with an additional load of glucose adsorbed from dialysis fluid . The effect of glucose deriving from the peritoneal cavity on the incidence of glucose intolerance still evokes some ambiguity, and published data are equivocal [13, 911]. The recent data suggest that high glucose exposure from dialysis solution may be a risk factor for vascular calcification in non - diabetic pd patients . There seem to be some analogies between the occurrence of de novo gmd in patients treated with pd and gestational diabetes (gdm), in which a combination of increased maternal adiposity and naturally occurring human placental hormones produces insulin resistance [13, 14]. In both cases, gestational diabetes mellitus is defined as any degree of glucose intolerance with onset or first recognition during pregnancy . The mechanisms that lead to chronic insulin resistance in gdm are varied as they are in the general population . Up to 2012 gdm was diagnosed by a two - step approach using a sequential model of universal screening with a 1-h 50-g glucose challenge test (50-g gct) followed by a diagnostic 75-g oral glucose tolerance test (75-g ogtt) for women with a positive screening test [threshold value 140 mg / dl (7.8 mmol / l)]. The gdm was recognized in 75-g ogtt when the plasma glucose value was 140 mg / dl . Ada recommendations for 2011 adopted new, stricter criteria for the diagnosis of gestational diabetes and confirmed them for 2012 . According to the current recommendations for all pregnant women between 24 and 28 weeks of pregnancy, gestational diabetes is diagnosed if the fasting plasma glucose is at least 92 mg / dl (5.1 mmol / l), after 1 h 180 mg / dl (10.0 mmol / l), and after 2 h 153 mg / dl (8.5 mmol / l). These criteria were based on the results of the hapo study and recommendations of the research group of the international association of the diabetes and pregnancy study groups (iadpsg). There is also a critical discussion concerning the methods and criteria for the new ada 2012 diagnosis of gestational diabetes [2023]. Currently, there are no clear recommendations for diagnosis and classification of glucose disturbances occurring de novo in a population of patients on pd . In our opinion, the who gold standard is not appropriate for pd patients because gmd differ from those in the general population, and other screening strategies should be explored . Considering the mentioned similarities, we aimed to examine the utility of the oral glucose tolerance screening test (50-g gct) for pd patients, which is used in a two - step approach to evaluate gestational diabetes . The first step the 50-g gct is performed at any time of the day (the fasting state is not required), using 50 g of glucose, and the plasma glucose was measured at 1 h after administration . In the current study, we aimed to evaluate the applicability of the 50-g gct for the detection of gmd in non - diabetic continuous ambulatory pd patients with normal fasting glucose levels . The study was performed in 20 prevalent patients without history of diabetes before pd treatment onset who had been on a pd program at our institution as their first dialysis modality . The median age of patients was 44.19 years [interquartile range (iqr) 34.1556.25], 9 being males and 11 being females, all caucasian with cause of end - stage renal disease (esrd) being glomerular disease in 12 patients (60%), hypertensive nephropathy in four patients (20%), interstitial nephropathy in three patients (15%), and polycystic kidney disease in one patient (5%). The median duration of pd treatment before inclusion in the study was 15.34 months (iqr 10.821.34). Patients were assessed at the study onset (on the day of the 50-g gct) and at the end of pd treatment (13 patients) or at end of the observation period (december 2012) for continuing the pd program (seven patients). At the study onset, all patients underwent 50-g gct with a glucose dose of 50 g. the test is performed at any time of the day (the fasting state is not required), using 50 g of glucose, and the glucose is measured at 1 h after the administration . Interpretation of our 50-g gct results was as follows: glucose <140 mg / dl normal value; 140199 mg / dl impaired glucose tolerance (igt), 200 mg / dl diabetes . In case of a fasting glucose value 100125 mg / dl, and normal value in 50-g gct impaired fasting glucose (ifg) was diagnosed . The 50-g gct was performed in patients with an empty abdomen after the night dwell draining . During the night, all patients used 1.36% glucose containing dialysis solution . The glucose was measured at 1 h after administration; the fasting state was not required . In addition, the following parameters of glucose metabolism were measured: c - peptide, fasting insulin serum concentration, and the glycated hemoglobin level (hba1c). The concentrations of c - peptide and insulin were evaluated in serum samples, and hba1c in whole blood using a chemiluminescent microparticle immunoassay (cmia) on the architect system (abbott, usa). Based on fasting insulin and glucose values, insulin resistance (ir) was determined according to the homeostasis model assessment insulin resistance (homa - ir). They encompassed blood pressure (bp), serum albumin, lipid profiles, hb, crp, liver tests, mean daily peritoneal glucose load, ultrafiltration volume, residual diuresis, weekly dialytic creatinine clearance (ccr), weekly dialytic kt / v, and other laboratory parameters (uric acid, pth, tsh, fe, tsat, and electrolytes). Systolic and diastolic bp, residual gfr, weekly dialytic ccr, and kt / v were measured by standard methods . The estimated peritoneal glucose load was calculated by the product of the volume and the glucose concentration of each exchange . The glucose load did not differ between the patients and was similar in all study patients during the follow - up . The patients were prospectively followed for a median time of 25.8 months (iqr 18.9933.57), and 50-g gct was repeated at the end of the observation period . The statistical analysis was performed with r for windows, version 2.15.1, and medcalc for windows, version 12.3.1.0 . Clinical characteristics at the study onset are shown in table 1.table 1clinical characteristics at the study onsetvariable n medianiqr (interquartile range)fasting glucose level (mg / dl)2091.583.596glucose level1 h after gct (mg / dl)20165137.5195hba1c (%) 205.55.45.7c - peptide (ng / ml)207.245.1210.95fasting insulin serum concentration (u / ml)2010.347.7916.05homa - ir202.131.573.53systolic bp (mmhg)20135120155.5diastolic bp (mmhg)2087.58090serum albumin (g / dl)203.83.653.95total cholesterol (mg / dl)20196179231hdl cholesterol (mg / dl)20433852ldl cholesterol (mg / dl)20128.5105.5143triglycerides (mg / dl)20164.5130226.5hb (g / dl)2010.610.111.85crp (mg / l)202.091.116.69aspat (iu / l)2017.51421alat (iu / l)20171225uric acid (mg / dl)206.35.557.3pth20817490.51,221.5tsh202.191.054.11fe207451.588tsat (%) 2025.41933.9ca (mmol / l)2098.259.2p (mg / dl)206.44.857.25mean daily peritoneal glucose load (g/24 h)20120120120ultrafiltration volume (ml/24 h)201,3007251,500residual diuresis (ml/24 h)201,1505001,500weekly dialytic ccr200.690.620.75weekly dialytic kt / v202.192.112.7bmi total (kg / m)2025.1423.8327.63 clinical characteristics at the study onset 50-g gct revealed gmd in 15 investigated patients (75%). The most frequent abnormality was igt (plasma glucose between 140 and 199 mg / dl), which occurred in 11 patients (55%). However, despite normal fasting glucose, in four patients (20%), the glucose concentrations at 1 h after oral load were above 200 mg / dl, suggesting a preliminary diabetes diagnosis . The other glucose metabolism indicators exhibited little clinical utility for the detection of abnormal glucose tolerance in pd patients . The median percentage of hba1c was in the normal range (5.5%), exceeding the upper limit only in two patients (10%). Median value of homa - ir was 2.13, being above 2.6 (the cutoff for ir) only in seven patients (35%). C - peptide concentrations were significantly higher than in non - diabetic healthy individuals (p = 0.03). A significant correlation was found between homa - ir and c - peptide measurements (p = 0.001, 0.677). Homa - ir and c - peptide determinations did not correlate with other investigated parameters, i.e., serum albumin, crp, lipid profile, glucose load in the dialysis fluid, dialysis dose, ultrafiltration, and residual diuresis . Patients with gmd were recommended a low - carbohydrate diet, lifestyle modification to promote weight loss, and increased physical activity . The adherence was checked at a monthly interval during patients visit to the pd clinic . Four patients, in whom diabetes was recognized after the first 50-g gct, additionally received short - acting sulphonylurea compounds (glipizide) for a few months (35), and then, a diet satisfactorily corrected the glucose value . The patients were prospectively observed, and after a median time of 25.8 months, the glucose metabolism evaluation was repeated . During the second 50-g gct, igt persisted in eight patients (40%), and of particular note, ifg (100125 mg / dl) occurred in four patients (20%) despite 50-g gct being in the normal range . All patients who exhibited the highest abnormalities suggesting diabetes in the first gct when retested at the end of the observation achieved a normal range . Glucose metabolism disorders at study onset and at the end of observation are shown in table 2.table 2glucose metabolism disorders at study onset and at the end of observationgct 50 ggmdstudy onsetend of observationifg0 pts4 ptsfasting glucose level (mg / dl) median / iqr124/112153glucose level1 h after gct (mg / dl) median / iqr176/152189igt11 pts8 ptsfasting glucose level (mg / dl) median / iqr93/839587/78.2590.25glucose level1 h after gct (mg / dl) median / iqr167/149184150/146167dm4 pts0 ptsfasting glucose level (mg / dl) median / iqr93/83.399.8glucose level1 h after gct (mg / dl) median / iq207/204236 glucose metabolism disorders at study onset and at the end of observation the occurrence of gmd in 75% of the study subjects representing a small single - center cohort of prevalent pd patients gives a good illustration of the epidemiological dimension of the problem . After the first oral glucose load of 50 g, igt was revealed in 11 subjects (55%), and a glucose rise suggesting diabetes appeared in four patients (20%). The 50-g gct was performed in prevalent continuous ambulatory peritoneal dialysis (capd) patients, who had been on dialysis for a median time of 15.34 months . Surprisingly, the literature on gmd in the pd population is very scanty . In two works published in the 1980s, lindholm et al . [25, 26] based on their own modification of ogtt (using 1 g glucose per kg body weight) carried out in 15 patients concluded that pd treatment up to 1 year does not deteriorate glucose metabolism . . Published results of ogtt diminished from standard 7550 g glucose load accomplished in six patients being on pd for at least 6 months . The test was applied exclusively to detect insulin resistance, and the data on increased glycemic and insulinemic responses were presented . More informative and extensive investigation was done by cheng et al . In 35 nondiabetic patients treated by pd for more than 1 year . They challenged patients by standard 75 ogtt and found igt in 31% . In a larger - scale epidemiological study, insulin resistance was significantly more frequent in pd patients than in hemodialysis and pre - dialysis subjects (47 vs. 21 and 26%, respectively). In a study by tatar et al ., insulin resistance was an independent risk factor for arterial stiffness in nondiabetic pd patients older than 50 years . In our present single - center study, we found homa - ir values indicating insulin resistance (> 2.6) in seven patients (35%). The c - peptide levels were significantly higher in the pd group than in healthy individuals and correlated closely with homa - ir . It should be mentioned that the elevated c - peptide concentrations in pd patients are mainly a consequence of the fact that 70% of this peptide is eliminated by the kidney route . However, the strong correlation with homa - ir can be treated as a sign of preserved excretory pancreatic cells capacity . Commenting on the results of our study, it is worth emphasizing that the study group encompasses low - risk, middle - aged, non - obese subjects, with normal fasting glucose, normal hba1c, and slightly elevated cholesterol level . The only more pronounced abnormality which is associated with glucose intolerance in epidemiological investigation was hypertriglyceridemia . Discovery of gmd in 75% of patients with such clinical characteristics highlights the clinical significance of this issue . We are conscious that 50-g gct was not validated in the pd population, but it seems to be well suited for a person on pd treatment due to its simplicity and convenience . A plasma glucose value 140 mg / dl, we gave up on performing the second step 75-g ogtt, because the aim of our study was not to recognize diabetes by who criteria, but reveal a group with special risk of hyperglycemia . We treated our test as a screening, not diagnostic method, also taking into account the cost benefit relationship . The 50-g gct allows quick verification of glucose disturbances in patients with an additional daily dose of glucose in the dialysis fluids . In contradistinction to standard 75-g ogtt, it does not require patients to keep coming to the pd clinic at different appointment hours without eating . It obviously does not provide a definitive diagnosis . In the next project following these preliminary data however, we believe that abnormalities revealed by 50-g gct are already of clinical value alerting the patient and physician . It provides a stimulus for preventive measures, which as shown by our experience can be effective, i.e., the normalization of the test in four patients with the worst results at the onset . The other positive aspect of the current study is supplying evidence that gmd are not inexorably progressive under pd treatment . The maintenance of normal glucose metabolism in pd patients is in the context of obtained results a feasible goal . Its achievement could bring benefits in terms of longer patient survival and lower risk of post - transplant diabetes development . The oral glucose challenge screening gct test appears to be a sensitive instrument for the detection of glucose metabolism disorders in pd patients with normal fasting glucose.
Proteomics has emerged as a valuable tool for the identification of biomarkers associated with human disease including those resulting from very subtle changes in normal cell functions and signaling pathways . Proteomic technology has advanced to a state where thousands of proteins can be identified within complex samples, yet disease - based studies using fresh or frozen tissues are limited by a lack of available specimens for longitudinal clinical investigations . In contrast, there are millions of archival formalin - fixed, paraffin - embedded (ffpe) tissues for which the clinical course of disease and response to therapy has been established . Ffpe tissue studies are affected greatly by sample collection, tissue processing, and archival time . Though these factors are difficult to control in archival samples, improvements in techniques such as mtraq have made relative quantitation of disease biomarkers in ffpe tissue possible . Improving protein extraction and detection of less abundant protein biomarkers is also of critical importance in proteomic analysis . Protein modifications by formaldehyde treatment and histological processing significantly limit the use ffpe tissues for proteomic analyses . This has prevented proteomic studies of the clinical course of diseases, such as prostate and breast cancer, that evolve slowly or where the time between treatment and recurrence is long . Coupling proteomic investigations with the retrospective pathology information available from archival ffpe tissues would produce a wealth of practical information on human diseases . Some are practical for slide - mounted ffpe tissue, such as quantitative fluorescence imaging analysis (qfia), which is reproducible and sensitive for specific standardized proteins, or maldi - imaging mass spectrometry (ms). Other encouraging mass spectrometry (ms)-based proteomic studies of ffpe tissues have appeared in the recent literature; however, these investigations have typically been restricted to minute tissue specimens, such as those obtained by laser capture microdissection . Further, some studies report high rates of false - positive protein identification and are limited to the analysis of tryptic digests of ffpe tissues by liquid chromatography ms (lc ms). Our laboratory has been studying the reactions of formaldehyde with proteins and ways to reverse these reactions . Using proteins in aqueous solution, we demonstrated that the majority of protein formaldehyde adducts and cross - links were consistently reversed with mild heating following the removal of excess formaldehyde by dialysis . We then developed a tissue surrogate, which consists of one or more proteins that form a gel - like plug when treated with formaldehyde at protein concentrations exceeding 75 mg / ml . These tissue surrogates have sufficient physical integrity to be processed using normal histological methods . A variety of extraction buffers and heating protocols were examined for their ability to recover proteins from tissue surrogates . Protein recovery was generally modest, and studies with multiprotein tissue surrogates revealed extraction bias, meaning that the composition of the solubilized proteins did not match that of the corresponding tissue surrogate . Subsequent studies showed that the ethanol dehydration step of histology caused most formaldehyde - treated proteins to adopt conformations enriched in -sheets, leading to the formation of protein aggregates where the -sheets form a dense network of intermolecular formaldehyde cross - links . We proposed that the difficulty of rehydrating these stabilized protein aggregates was the primary impediment to recovering proteins from ffpe tissue . Pressure promotes water penetration into the inner core of proteins, causing denaturation, whereas heat alone causes protein unfolding followed by aggregation . Consequently, we hypothesized that the combined effects of heat and elevated pressure would facilitate the rehydration of the highly cross - linked protein aggregates in ffpe tissues . The increased exposure to water should greatly improve protein solubilization while simultaneously promoting the reversal of protein formaldehyde adducts and cross - links . Initial physical studies on tissue surrogates supported this hypothesis and suggested that the effect of pressure was to reduce the size of protein aggregates through increased water penetration, rather than to increase the rate of reversal of protein formaldehyde adducts and cross - links directly . Encouraged by these results, we extracted ffpe mouse liver tissues with heat augmented by elevated hydrostatic pressure, with the goal of reducing extraction bias, improving the recovery of intact proteins, and obtaining tryptic digests that more closely resemble those from matched fresh - frozen tissue . Tissue tek oct compound was purchased from sakura, usa, amicon ultra 3k centrifugal filters were purchased from millipore, and 37% formaldehyde and pierce detergent removal columns were obtained from thermo fisher . Precast nupage bis - tris 412% gels, 2-(n - morpholino)ethanesulfonic acid sds running buffer, and the silverquest staining kit were purchased from life technologies . Tissue extracts were heated under a pressure of 40,000 psi (276 mpa) using both home - built and commercial instruments . The home - built instrument consisted of a 2-ml capacity ms-1 stainless steel reaction vessel coupled to a manually operated high pressure piston screw pump available from high pressure equipment company (erie, pa). The temperature of the pressure vessel was regulated by a eurotherm 2132 temperature controller (leesburg, va) connected to an aluminum heating collar surrounding the reaction vessel . The tissue extract (2 ml) was added directly to the reaction vessel using a syringe . The construction and operation of this pressure system has been described in detail previously . The commercial instrument was a model nep 2320 barocycler (pressure biosciences) modified by the manufacturer to hold isobaric pressure and to provide temperature control up to 95 c . The tissue extract (2 ml) was added to a ft500 sample tube, which was capped and placed in the pressure vessel of the barocycler . The liver from a female balb / c mouse was obtained under the secondary use provision from the department of laboratory animal medicine of the armed forces institute of pathology (usa). Half of the liver was immediately frozen in tissue - tek oct compound, divided into several equal - sized pieces, and stored at 80 c . The other half was fixed for 48 h at 4 c in 10% formalin . The fixed liver tissue was washed for 30 min with distilled water and dehydrated through a graded series of alcohols (70, 85, and 100% by volume) and two changes of xylene, 30 min each . Recovery experiments, 10 m sections of ffpe mouse liver were cleared of paraffin by incubating the sections through two changes of xylene for 10 min each . The sections were rehydrated through a series of graded alcohols for 10 min each2 changes each of 100% ethanol, 85% ethanol, and 70% ethanol and then incubated in distilled water for a minimum of 30 min, as described previously . Matched fresh - frozen and ffpe liver tissue sections were analyzed after 30 days, and again after 1 year, of storage . The ability of elevated hydrostatic pressure combined with heat to improve the recovery of proteins from ffpe mouse liver tissue was evaluated using two heat - based ffpe proteomic protocols recently reported in the literature . For each protocol, the experimental procedure was followed exactly as published, but with the heating step divided into two arms, or variations . In the first arm, the ffpe tissue extract was heated at the temperature and for the length of time reported in the original method . In the second experimental arm, the temperature and length of time was identical, but the experiment was performed under a pressure of 40,000 psi . The two experimental arms were then analyzed using identical gel electrophoresis and lc / ms conditions . The protein content of the tissue extracts was determined using a bca protein assay kit (pierce). Following deparaffinization and rehydration, the tissue was cut into small pieces and suspended in 36 ml of 50 mm tris - hcl, ph 7, 2% sds (extraction buffer 1, eb1) as described by shi et al . The tissue suspension was homogenized with three 5-s cycles of sonication on ice using a probe - tip sonicator, and the resulting homogenate was split into two equal fractions . One fraction (protocol-1a) was incubated at 100 c for 30 min followed by 80 c for 2 h at atmospheric pressure (14.7 psi) in a sand bath . The second fraction (protocol-1p) was incubated at 100 c for 30 min followed by 80 c for 2 h at 40,000 psi using our hand - built pressure instrument . A 750 m section (approximate thickness) of matched fresh - frozen liver was cut with a razor blade and homogenized in 22.5 ml of eb1 by sonication as described above . Proteins were extracted using two methods: incubation of the homogenate in an ice bath for 2.5 h (protocol-1fi) or incubation at 100 c for 30 min followed by 80 c for 2 h at atmospheric pressure using a sand bath (protocol-1fh). Following deparaffinization and rehydration, the tissue was cut into small pieces and suspended in 36 ml of 100 mm tris - hcl, ph 8, 100 mm dtt, 4% sds (extraction buffer 2, eb2) as described by ostasiewicz et al . And homogenized with three 5-s cycles of sonication on ice using a probe - tip sonicator . One fraction (protocol-2a) was incubated at 95 c for 1 h at atmospheric pressure in a sand bath . The second fraction (protocol-2p) was incubated at 95 c for 1 h at 40,000 psi using the barocycler instrument . A 750 m section of matched fresh - frozen liver was cut with a razor blade and homogenized in 22.5 ml of eb2 by sonication as described above . Proteins were extracted by incubating the homogenate at 95 c for 3 min at atmospheric pressure using a sand bath (protocol-2fh). All ffpe and matched fresh - frozen mouse liver tissue extracts (40 g each) were separated by sds - page on precast nupage bis - tris 412% gels using 2-(n - morpholino)ethanesulfonic acid the gels were stained using the silverquest silver staining kit and documented using an epson v500 photoscanner and annotated in adobe photoshop, version 7.1 . Each gel lane was then divided into 10 bands and placed into microcentrifuge tubes . In - gel tryptic digestion was carried out as previously described . Separation of the digested peptides was performed using nanocolumns prepared in - house (75 m i.d . Packed with jupiter c18 particles, 5 m, 300) connected to an agilent 1100 nanoflow lc system, which was used to deliver binary gradient solvents a (0.1% formic acid (fa) in water) and b (0.1% fa in acetonitrile). Reversed - phase chromatography was performed by solubilizing the lyophilized tryptic peptides in 10 l of 0.1% trifluoroacetic acid and injecting 7 l of sample per analysis . After sample injection, a 20-min wash with 98% mobile phase a was used to remove any remaining salts from the sample . Peptide elution was accomplished using a linear gradient of 2% solvent b to 42% solvent b over 45 min at a constant flow rate of 250 nl / min . The nanoflow reversed - phase lc column was coupled online to a linear ion trap mass spectrometer (ltq, thermoelectron) using the manufacturer s nanoelectrospray source with an applied electrospray potential of 1.75 kv and a capillary transfer tube temperature of 185 c . The ltq - ms was operated in a data - dependent mode where each full ms scan was followed by seven tandem ms scans in which the seven most abundant peptide molecular ions detected were dynamically selected for ms / ms analysis using a normalized cid energy of 35% . A dynamic exclusion of 60-s was applied to reduce redundant selection of peptides . The ms / ms spectra were analyzed using sequest (thermoelectron) against a combined uniprot nonredundant mouse proteome database containing 36,799 protein sequences . Only peptides with conventional tryptic termini (allowing for up to two internal missed cleavages) possessing delta - correlation scores (cn)> 0.08 and charge state - dependent cross - correlation (xcorr) criteria as follows were considered as legitimate identifications:> 1.9 for + 1 charged peptides,> 2.2 for + 2 charged peptides, and> 3.1 for + 3 charged peptides . A reverse - database search, performed using the respective databases, resulted in a calculated false - positive rate of <2% for all samples analyzed . Ffpe and matched fresh - frozen mouse liver tissue stored for 30 days were extracted using protocol-1 . The fresh liver tissue was completely solubilized in the extraction buffer (eb1) using extraction either on ice (protocol-1fi) or at elevated temperature (protocol-1fh). The quantity of protein solubilized in the buffer was designated as 100% protein recovery in table 1 . Ffpe mouse liver tissue extracted at atmospheric pressure (protocol-1a) resulted in a protein recovery of only 17%, and a large plug of remaining tissue was observed in the extraction vial . In contrast, when the extraction was performed at 40,000 psi (protocol-1p), the solubilized protein increased to 77% and only a small amount of tissue residue remained in the vial . Ffpe and matching fresh - frozen liver tissue stored for 1 year were extracted using protocol-2 . The fresh liver tissue was completely solubilized in the extraction buffer (eb2) when extracted at elevated temperature (protocol-2fh). The quantity of protein solubilized in the buffer was designated as 100% protein recovery in table 1 . The advantage of using elevated pressure was again evident, as 79% of the ffpe liver protein was solubilized at elevated hydrostatic pressure (protocol-2p) while only 18% was recovered at ambient pressure (protocol-2a). Ffpe mouse liver was homogenized in extraction buffer and heated with or without elevated pressure . Fresh - frozen tissue was extracted either at atmospheric pressure using the indicated extraction condition or on ice for 2.5 h. protocol used for protein extraction (see materials and methods). Tissue was heated at 100 c for 30 min; then the temperature was lowered to 80 c for 2 h. the amount of protein extracted from fresh frozen tissue was set to 100% . Previous studies using ffpe tissue surrogates containing several proteins indicated that failure to completely solubilize the tissue surrogate led to extraction bias, such that the composition of the solubilized protein solution differed significantly from that of the original surrogate . The extraction bias became less significant as the percentage of total protein solubilized from the tissue surrogate increased . Thus, the 4-fold improvement in protein solubilization realized when the extraction was performed at elevated pressure is likely to lead to a protein extract that more accurately represents the composition of the original ffpe tissue . Further, the increased amount of recovered protein allows a greater number of analytical techniques to be performed . While most published proteomic studies of ffpe tissue analyze only a few thousand cells from microdissected tissue, the use of elevated pressure has the advantage of improving protein extraction from whole tissue sections . This ability is particularly useful in instances where tissue microdissection is not practical or when a more global proteomic analysis is desired . Unbiased protein extraction and standardized protocols are particularly important with techniques such as reverse phase protein arrays (rppas), where the protein components of cell signaling pathways are quantified to direct clinical treatment of cancer . The 30-day - old ffpe mouse liver extracted at 40,000 psi (protocol-1p) exhibited a number of well resolved high and low molecular weight protein bands by sds - page, corresponding to 87% of those seen in the matched fresh - frozen tissue extracted on ice (figure 1, lanes 2 and 1, respectively). The ffpe samples extracted at ambient pressure (protocol-1a) contained relatively few well - resolved protein bands equivalent to 25% of those seen in frozen mouse liver (figure 1, lane 3). Similar results were seen with 1-year - old ffpe mouse liver extracted at 40,000 psi (protocol-2p) with well resolved high and low molecular weight protein bands corresponding to 74% of those seen in the matched fresh - frozen tissue (not shown). When the extraction was performed ambient pressure (protocol-2a) this value 1d sds - page of fresh - frozen and ffpe mouse liver extracts: lane 1, fresh - frozen tissue (protocol-1fi); lane m, molecular weight marker; lane 2, ffpe tissue extracted with heat at 40,000 psi (protocol-1p); lane 3, ffpe tissue extracted with heat alone (protocol-1a). As top - down ms sequencing technology improves, the ability to extract and analyze intact proteins from ffpe tissue will become more important . Top - down sequencing facilitates the measurement of combinations of modifications, such as phosphorylation and glycosylation, and the direct quantitation of specific protein isoforms and splice variants . Few of these measurements are directly obtainable using bottom - up proteomic approaches in which proteins are digested into peptides . The ability to extract intact proteins from the seemingly inexhaustible source of ffpe tissues will increase the diagnostic and prognostic efficacy of proteomic - based biomarker discovery by allowing biomarker validation using orthogonal methods such as western blotting, immunohistochemistry, immunoassays, and structural and interaction proteomics . In this context, the> 3-fold increase in the recovery of intact proteins from ffpe tissue achieved by using elevated pressure represents a significant breakthrough . Ffpe and matched fresh - frozen liver tissue stored for 30 days were extracted using protocol-1 . Ffpe tissue was extracted at ambient pressure (protocol-1a) or 40,000 psi (protocol-1p), while the matched fresh - frozen liver tissue was extracted using protocol-1fi and protocol-1fh . The solubilized proteins were separated by 1d - page, and each gel lane was excised, digested with trypsin, desalted, and analyzed by lc - ms / ms . The total unique peptide and protein identifications for each tissue type and extraction condition are shown in table 1 . Ffpe tissue extracted with heat alone resulted in the identification of 5565 unique peptides and 3449 unique proteins . The addition of elevated hydrostatic pressure significantly improved both the number of unique peptides (9621) and proteins (5192) identified . The number of proteins identified from the high pressure - extracted sample was comparable to the number of unique proteins identified from fresh - frozen tissue, which ranged from 4932 for tissue extracted on ice to 4451 for frozen tissue extracted with heat (table 1). The ms results for the 30-day - old ffpe mouse liver extracted under elevated pressure (protocol-1p) and the matched fresh - frozen tissue extracted on ice (protocol-1fi) were searched using gominer, a gene ontology program . The percentages of nuclear, membrane, intracellular, and extracellular proteins identified in fresh - frozen and ffpe liver were virtually identical (figure 2a), as were the results for classification by biological function (figure 2b). Gene ontology analysis of proteins identified by lc - ms / ms . Proteins identified using fresh - frozen mouse liver (protocol-1fi) or ffpe liver extracted with heat and elevated pressure (protocol-1p) were categorized by subcellular localization (a) or biological process (b), using gominer gene ontology software . To address the effect of long - term storage of the ffpe specimens, the mouse liver samples were investigated after an additional 11 months of storage (1-year - old sample). Ffpe tissue was extracted at ambient pressure (protocol-2a) or 40,000 psi (protocol-2p), while the matched fresh - frozen liver tissue was extracted at high temperature (protocol-2fh). The solubilized proteins were separated by 1d - page, and each gel lane was excised, digested with trypsin, desalted, and analyzed by lc - ms / ms . From the 1-d gel, we were able to identify 3492 nonredundant proteins in the 1-year - old ffpe liver extracted under elevated pressure, which was comparable to the 3415 nonredundant proteins identified in the matched fresh - frozen mouse liver extracted at high temperature . In contrast, only 107 unique proteins were identified in the ffpe tissue extracted at ambient pressure . Figure 3 shows venn diagrams of the unique and common (overlapping) proteins identified in mouse liver tissue extracts prepared by different methods . Figure 3a compares 30-day - old fresh - frozen liver tissue extracted on ice (protocol-1fi) versus 100 c for 30 min followed by 80 c for 2 h (protocol-1fh). Figure 3b compares 30-day - old ffpe liver tissue extracted under pressure (protocol-1p) figure 3c compares 1-year - old ffpe liver tissue extracted under pressure (protocol-2p) versus matched fresh - frozen liver extracted at elevated temperature (protocol-2fh). Notably, the common proteins, expressed as a percentage of either the ffpe or matched fresh - frozen mouse liver tissue, were 50% for all three tissue pairs . Venn diagrams showing the number of unique and common proteins identified using lc ms / ms analysis: panel a, fresh - frozen tissue extracted on ice (protocol-1fi) or with heat (protocol-1fh); panel b, fresh - frozen tissue extracted with heat (protocol-1fh) and ffpe mouse liver extracted with elevated pressure (protocol-1p); panel c, fresh - frozen tissue extracted with heat (protocol-2fh) and ffpe mouse liver extracted with elevated pressure (protocol-2p). Figure 4a is a pie chart showing the number of unique proteins identified by two or more fully tryptic peptides for 30-day - old ffpe mouse liver extracted under pressure (protocol-1p). The results reveal that 49% of the proteins were identified by two peptides, 51% were identified by three or more peptides, and 21% of the proteins were identified by five or more peptides . Figure 4b shows similar results for 1-year - old ffpe mouse liver extracted under pressure (protocol-2p), with 57% of the proteins identified by two peptides, 41% by three or more peptides, and 15% identified by five or more peptides . These results are similar to those for the matched fresh - frozen mouse liver tissue (not shown). The complete list of peptides identified in the fresh - frozen and high - pressure - recovered ffpe tissue, with their corresponding xcorr values, can be found online (supporting information table 1). Total number of unique proteins identified using lc - ms / ms by two or more unique, fully tryptic peptides in ffpe mouse tissue extracted with heat and elevated pressure (40,000 psi): a, 30-day - old ffpe mouse liver (protocol-1p); b, 1-year - old ffpe mouse liver (protocol-2p). Virtually all protocols reported in the literature for the extraction of proteins from ffpe tissue use a variation of the heat - induced antigen retrieval technique developed by shi and taylor for the recovery of antigenicity in immunohistochemical studies . This method involves exposing ffpe tissue sections to a buffer solution containing a detergent and/or protein denaturant and elevated temperatures of 90120 c for a period of 1030 min . Optimal antigen recovery varies with the host ffpe tissue, with each type requiring different buffers, ph values, buffer additives, and incubation temperatures . Although the ffpe proteomic literature is still quite limited, it is not unreasonable to propose that the same situation applies to the proteomic analysis of ffpe tissues . Elevated hydrostatic pressure is not a technique unto itself but rather an adjuvant method that can be applied to existing or future ffpe protein extraction protocols . While it remains to be shown that this method is useful with every tissue fixation and protein extraction protocol, elevated pressure acts through purely physical means and should be compatible with ffpe protein extraction buffers of any ph and containing any detergent, protein denaturant, or other additive . This should allow its integration into a wide range of protein extraction protocols for ms - based proteomics with little to no alteration to downstream sample preparation and analysis . This was demonstrated in this report by the successful application of elevated pressure to two very different published ffpe protein extraction protocols . An increase in pressure to 40,000 psi, to augment heat treatment, improved protein extraction efficiency from ffpe mouse liver tissue by approximately 4-fold and increased the number of unique proteins identified by up to 30-fold over the published methods used at ambient pressure . Further, the tryptic digests of these pressure - extracted tissues resulted in protein profiles that more closely resembled those from matched fresh - frozen tissue when analyzed by lc / ms than did those extracted with heat alone, while maintaining a false - identification rate of <2% . The ability of elevated pressure to significantly improve the recovery of intact proteins from ffpe tissues over the use of heat alone has great potential for broad application to top - down proteomic studies for the identification of disease biomarkers.
Type 2 diabetes mellitus (t2 dm) is considered a major epidemic of this century . It is estimated that its prevalence will increase worldwide from 371 million people in 2013 to 552 million people in 2030 . T2 dm is associated with accelerated progression of atherosclerosis, the major cause of vascular complications leading to increased morbidity and mortality . Chronic, low - grade inflammation has been demonstrated to be involved in the pathogenesis of atherosclerosis in subjects at high risk to develop cardiovascular disease [37]. Among immune cells infiltrating atherosclerotic lesions, polymorphonuclear neutrophil leukocytes with their products were reported to have an important role in the development and progression of atherosclerosis [811]. Marino and coworkers have recently reported that both circulating and intraplaque polymorphonuclear neutrophil leukocytes from subjects with carotid atherosclerosis are active producers of different inflammatory mediators including the vascular endothelial growth factor (vegf). Several environmental and genetic factors (i.e., hypoxia, hyperglycemia, oxidative stress, ischemia, and gene polymorphisms of vegf) influence plasma vegf levels [1216]. Among several polymorphisms of the vegf gene, the rs2010963 (634c / g polymorphism of the vegf gene) and few others were reported to affect serum vegf levels [1315]. Moreover, rs2010963 was demonstrated to be associated with several disorders, such as diabetic retinopathy, diabetic nephropathy, myocardial infarction, and impaired prognosis in patients with chronic heart failure [1315, 17]. Despite these findings, however, data about vegf polymorphisms and their possible association with carotid atherosclerosis in patients with diabetes mellitus are limited [1820]. Additionally, cimt is highly heritable and associated with stroke and myocardial infarction, making it a promising quantitative intermediate phenotype for genetic studies of vascular disease . The present study was thus designed to investigate the association between polymorphisms of the vegf gene (rs2010963) and the kdr gene (rs2071559) and markers of carotid atherosclerosis (such as carotid intima - media thickness (cimt), the number of affected segments of carotid arteries, and the sum of plaques thickness) in patients with t2 dm . The study protocol was approved by the slovene medical ethics committee in september 2010 (protocol number 128/09/2010). After an informed consent for the participation in the study this cross - sectional study included 595 subjects with t2 dm and 200 subjects without t2 dm (control group). They were selected among patients admitted to the diabetes outpatient clinics of the general hospitals murska sobota and slovenj gradec, slovenia . Subjects in the control group were not allowed to have t2 dm, and they were the staff of the general hospital murska sobota . Subjects with t2 dm and control subjects were excluded if they had homozygous familial hypercholesterolaemia or a previous cardiovascular event such as myocardial infarction or a cerebral stroke . All ultrasound examinations were performed by two experienced doctors blinded to the participants' diabetes status . The cimt, defined as the distance from the leading edge of the lumen - intima interface to the leading edge of the media - adventitia interface, was measured, as described previously . Plaques were defined as a focal intima - media thickening and divided into 5 types according to their echogenic / echolucent characteristics, as previously described . The interobserver reliability for carotid plaque characterization the genomic dna was extracted from 100 l of whole blood using a flexigene dna isolation kit, in accordance with the recommended protocol (qiagene gmbh, hilden, germany). For vegf rs2010963 polymorphism competitive allele specific pcr (kasp) was conducted on an abi step - one system (applied biosystems, foster city, ca). The reaction mixture (5 l) contained 2.5 l 2x kaspar reaction mix (v3), 0.07 l assay mix, 1.43 l of distilled water dnase / rnase - free (gibco, invitrogen life technologies), and 10 ng of extracted genomic dna (1 l). Thermal cycling employed the following conditions: hot - start enzyme activation (15 min at 94c), denaturation (20 sec at 94c) followed by 10 cycles of touchdown over 6557c for 60 sec (dropping 0.8c per cycle), and final 26 cycles (20 sec at 94c and 60 sec at annealing temperature 57c). For rs2071559 (kdr) everything was the same with the exception of thermal conditions . Hot - start enzyme activation (15 min at 94c) and denaturation (20 sec at 94c) were followed by 15 cycles of touchdown over 5565c for 60 sec (dropping 0.8c per cycle) and final 26 cycles (20 sec at 93c and 60 sec at annealing temperature 58c). In addition, the fasting serum vegf levels were analyzed in 70 subjects with t2 dm and in 33 subjects with t2 dm . For the determination of the fasting serum vegf concentration (isoform vegf 165), a solid phase sandwich elisa using two kinds of high specific antibodies (hvegf assay kit, ibl co., ltd . The respective cv (%) were between 3 and 5.5 for interassay measurements and between 2.6 and 5.3 for intra - assay measurements . Continuous clinical data were compared using unpaired student's t - test or analysis of variance (anova). A statistical analysis was performed using the spss program for windows version 21 (spss inc ., patients with t2 dm were older, had a greater waist circumference, and had higher fasting glucose and hba1c levels compared to controls, whereas there were no differences in bmi and systolic and diastolic blood pressure between patients with t2 dm and control subjects (table 1). Patients with t2 dm had lower total, hdl, and ldl cholesterol levels and a higher triglyceride level compared to controls (table 1). Plasma levels of inflammatory markers (i.e., hs - crp and fibrinogen) were higher in patients with t2 dm compared to controls (table 1). Additionally, there was higher percentage of men, statin therapy, and antihypertensive therapy and lower percentage of smokers in t2 dm group compared to control group (table 1). The genotype distributions in both patients with t2 dm and controls were in hardy - weinberg equilibrium for both vegf gene polymorphisms [rs2010963: t2 dm (genotype frequencies: cc genotype 8.7%, cg genotype 47.1%, and gg genotype 44.2%; = 3.48; p = 0.06) and controls (genotype frequencies: cc genotype 9%, cg genotype 48%, and gg genotype 43%; = 1.46; p = 0.22)]. The genotype distributions in both patients with t2 dm and controls were in hardy - weinberg equilibrium for the kdr gene polymorphism [rs2071559: t2 dm (genotype frequencies: cc genotype 22.0%, ct genotype 51.9%, and tt genotype 26.1%; = 0.97; p = 0.33) and controls (genotype frequencies: cc genotype 30.0%, ct genotype 48.0%, and tt genotype 22.0%; = 0.63; p = 0.23)]. No statistically significant differences in the vegf rs2010963 and kdr rs2071559 genotype distribution frequencies were observed between t2 dm patients and controls . The observed minor allele frequency (maf) distributions were mostly in agreement with the 1000 genomes project data in the european population . The c allele frequency of the vegf rs2010963 showed no significant difference (p = 0.79) between patients with t2 dm and controls (32.3% versus 33%). However, the c allele frequency of the kdr rs2071559 polymorphism was significantly lower (p = 0.04) in t2 dm subjects as compared to the controls (49% versus 54%). Higher vegf serum levels were demonstrated in subjects with t2 dm with the cc genotype (rs2010963) compared to those with other (cg + gg) genotypes (table 2). Moreover, higher vegf serum levels were found in subjects with the cc genotype (rs2071559) compared to those with other (ct + tt) genotypes (table 2). The comparison of atherosclerosis parameters was performed with regard to different genotypes of the vegf polymorphism (rs2010963) upon enrolment . In our study, we did not demonstrate any association between the rs2010963 and either cimt, the sum of plaque thickness, the number of involved segments, hscrp or the presence of carotid plaques, or the presence of unstable carotid plaques (tables 3 and 4). We did, however, demonstrate an association between the rs2071559 and either cimt or the sum of plaque thickness in subjects with t2 dm (table 3). In our study, we demonstrated an association between the rs2071559 of kdr and cimt in subjects with t2 dm, whereas we did not demonstrate an association between tested polymorphism of vegf (rs2010963) and cimt . Variations in the vegf gene were reported to be weakly associated with cimt . None of the single genotyped polymorphisms (2578a> c rs699947, 634c> g rs2010963, and + 936c> t rs3025039) were significantly associated with overall imt in the study reported by kangas - kontio and coworkers . The haplotype ccc, however, was associated with higher overall cimt in women and the haplotype cct with higher cimt in the internal carotid artery in men . Additionally, we also demonstrated an association between the rs2071559 of kdr and the sum of plaque thickness in subjects with t2 dm, whereas no association between tested polymorphism of vegf (rs2010963) and markers of carotid atherosclerosis was demonstrated . The rs2010963 polymorphism of the vegf gene was not demonstrated to exert a significant influence on the risk of subclinical atherosclerosis manifested by the presence of endothelial dysfunction by brachial artery reactivity and increased cimt in a series of patients with rheumatoid arthritis . Contrary, the importance of vegf and its receptor (vegfr1) was reported by russell and coworkers . In unstable plaques (cap rupture / thinning) increased vegf and receptor (vegfr1) staining as well as increased microvessel density was demonstrated in comparison with stable carotid plaques . Additionally, marino and coworkers have recently reported that both circulating and intraplaque polymorphonuclear neutrophils (pmn) from subjects with carotid atherosclerosis are active producers of vegf, il-8, and elastase . Moreover, an evidence is provided that these pmn have an increased ability to produce vegf (at mrna levels) in comparison to cells from healthy subjects . Additionally, increased vegf mrna occurs in both intraplaque and circulating pmn, at rest as well as after stimulation, suggesting that such functional changes are systemic and not limited to cells infiltrating the vascular wall . In contrast to these findings, we did not demonstrate an effect of vegf / kdr polymorphisms on the presence of either plaques or unstable plaques, since no difference in genotype distribution was present . In our study, the effect of either rs2071559 of kdr or rs2010963 on vegf serum levels was demonstrated . These findings are in accordance with our previous studies in which subjects with recent mi history (up to 9 months after mi) were enrolled [13, 16, 25]. Moreover, increased plasma vegf levels demonstrated in the stable phase after mi correlated with inflammation cytokines (il-8 and il-6), but not with atherosclerotic burden . In contrast to the minor effect of the rs2071559 of kdr and the absence of the rs2010963 of the vegf, an association of either rs2071559 or rs2010963 with mi has recently been reported in caucasians with t2 dm [13, 16, 24]. Our present findings and previous reports are additional evidence that markers of carotid atherosclerosis and atherothrombotic events (i.e., mi) are most probably not regulated via similar genetical / biological mechanisms . To conclude, in our study we demonstrated a minor effect of the rs2071559 of kdr on markers of carotid atherosclerosis (cimt, sum of plaque thickness) in subjects with t2 dm, whereas we failed to demonstrate an effect of tested polymorphism of the vegf gene (rs2010963) on markers of carotid atherosclerosis
Hidradenomas are benign cutaneous tumors of sweat gland origin, with the clear cell type constituting the most frequent histologic variety . Usually, they are diagnosed in the elderly population, the peak incidence being the fifth to sixth decade . We describe a young girl, in whom nodular hidradenoma developed at the age of 6 years . Hence, our case demonstrates that nodular hidradenoma is a rare differential diagnosis of skin tumors, even in the pediatric age group . A 10-year - old girl presented to us with a swelling on the left thigh, which had been progressively enlarging over the preceding 4 years . Cutaneous examination revealed a solitary erythematous dome - shaped, well - circumscribed tumor, measuring approximately 6 cm 4.5 cm . There was spontaneous dripping of straw - colored serous fluid at the rate of 2030 drops / min, the discharge accentuating on pressure . Biochemical analysis of the serous fluid revealed glucose 25 mg / dl, protein 4 g / dl, sodium 131 mmol / l, and potassium 4.3 mmol / l, almost similar to that of serum, the low concentration of glucose compelling us to think of something else . The mass was excised . The solid portion was largely composed of a cell type having finely granular, faintly eosinophilic cytoplasm with a dark - colored round to oval nucleus . The cyst was lined by a single layer of cuboidal epithelium without evidence of decapitation secretion [figure 5]. Solitary dome - shaped, well - circumscribed tumor over the left thigh photomicrograph showing a well - encapsulated mass composed of solid and cystic portions (h and e, 40) photomicrograph showing a well - encapsulated mass with large cystic spaces within it . Ductal luminal structures can be appreciated (h and e, 100) photomicrograph showing clear cells in the center along with cystic spaces (h and e, 400) note the large cystic cavity within the mass . Clear cell hidradenoma or eccrine acrospiroma of the skin was first described by liu, in 1949, as clear cell papillary carcinoma of the skin . It was reported under various designations such as nodular hidradenoma, eccrine acrospiroma, solid - cystic hidradenoma, clear cell acrospiroma, clear cell myoepithelioma, and eccrine sweat gland adenoma . Clinically, nodular hidradenoma presents as a slow - growing, red-, blue-, or brown - colored solitary, 530 mm in size, freely mobile and firm nodule, with an occasional cystic appearance . These are most commonly found on the scalp, face, thorax, abdomen, and gluteal region . This tumor is found mainly in adults and is excised more commonly in women than in men . Our patient was a young girl who presented with a gradually increasing swelling on the lower limb, a site that is unusual for the development of nodular hidradenoma . Literature search showed very few cases of nodular hidradenoma on the lower limb, that too in the pediatric age group . However, a case of nodular hidradenoma masquerading as umbilical polyp has been reported in a 1-year - old male child our patient complained of serous discharge from the lesion, for the preceding 3 months . Clinical differential diagnoses for our case were cutaneous lymphoma, dermatofibrosarcoma protuberans, epidermoid cyst, and sweat gland tumor . However, histology reliably excluded all the possibilities . It was predominantly composed of a cell type having finely granular, faintly eosinophilic cytoplasm with a dark - colored round to oval nucleus . The chronically discharging nature of the tumor in our patient was attributable to the fluid - filled cavity within the lesion . Biochemical analysis of the fluid was almost consistent with that of serum, however, the low concentration of glucose hinted that it might be normal sweat . Recently, nuclear grooving has been described as a useful morphological feature to aid in its diagnosis . Immunohistochemical staining of the tumor cells demonstrates positive staining with antibodies against ck - cam 5.2, ber - ep4, p63, epithelial membrane antigen, s-100 protein, smooth muscle actin, and vimentin . However, due to unavailability of resources and financial constraints, the immunohistochemical analysis could not be performed in our case . The high rate of local recurrence (10%) and potential for malignant transformation make surgical removal with wide margins as the widely accepted modality of treatment . The high recurrence is attributable to incomplete resection and to tumor tissue located between the dermis and subcutaneous tissue . These are characterized by increased mitotic activity, angiolymphatic invasion, local extension into deeper tissues, and a dispersed pattern of growth . Nodular hidradenoma in the pediatric age group is extremely rareit is usually located over the head, neck, and trunk . In our case, the lesion was present in the lower limbthe presence of an unusually large cystic cavity within the tumoral mass, leading to serous discharge, makes our case even more interesting . Nodular hidradenoma in the pediatric age group is extremely rare it is usually located over the head, neck, and trunk . In our case, the lesion was present in the lower limb the presence of an unusually large cystic cavity within the tumoral mass, leading to serous discharge, makes our case even more interesting . Nodular hidradenoma in the pediatric age group is extremely rareit is usually located over the head, neck, and trunk . In our case, the lesion was present in the lower limbthe presence of an unusually large cystic cavity within the tumoral mass, leading to serous discharge, makes our case even more interesting . Nodular hidradenoma in the pediatric age group is extremely rare it is usually located over the head, neck, and trunk . In our case, the lesion was present in the lower limb the presence of an unusually large cystic cavity within the tumoral mass, leading to serous discharge, makes our case even more interesting . Nodular hidradenoma in the pediatric age group is extremely rareit is usually located over the head, neck, and trunk . In our case, the lesion was present in the lower limbthe presence of an unusually large cystic cavity within the tumoral mass, leading to serous discharge, makes our case even more interesting . Nodular hidradenoma in the pediatric age group is extremely rare it is usually located over the head, neck, and trunk . In our case, the lesion was present in the lower limb the presence of an unusually large cystic cavity within the tumoral mass, leading to serous discharge, makes our case even more interesting.
The gothenburg osteoporosis and obesity determinants (good) study was initiated with the aim to determine both environmental and genetic factors involved in the regulation of fat mass as previously described (23). To be included in the good study, subjects had to be male, 18 to 20 years of age, and willing to participate in the study a total of 1,068 subjects, representative of the general young male population of gothenburg (23) (data not shown), were enrolled in the study . Of the 1,068 subjects, complete growth and weight charts for determination of bmi between 1 and 10 years of age were available for 612 subjects (growth chart subsample). Dual - energy x - ray absorptiometry analyses were performed on 610 subjects of the growth chart subsample, whereas abdominal ct scans were performed on 201 (the ct subsample) of the 612 study subjects in the growth chart subsample . The growth chart subsample is representative of the entire good cohort in terms of age (good 18.9 0.6 years, growth chart subsample 18.9 0.5 years, nonsignificant), weight (good 73.9 11.9 kg, growth chart subsample 73.3 11.5 kg, nonsignificant), height (good 181.4 6.8 cm, growth chart subsample 182.0 6.8 cm, nonsignificant), and bmi (good 22.4 3.2 kg / m, growth chart subsample 22.1 3.1 kg / m, nonsignificant). The ct subsample is representative of both the growth chart subsample and the entire good cohort in terms of weight, height, and bmi (ct subsample weight 72.7 11.2 kg, height 181.9 7.0 cm, bmi 21.9 3.0 kg / m, nonsignificant versus both the entire good cohort and the growth chart subsample). However, the subjects of the ct subsample were slightly younger (ct subsample 18.7 0.5 years) than both the subjects of the entire good cohort and the subjects of the growth chart subsample (p <0.05). The good study was approved by the local ethics committee at gothenburg university . Written and oral informed consent was obtained from all the study participants . Height was measured using a wall - mounted stadiometer and weight was measured to the nearest 0.1 kg as previously described (16,23). Total body fat mass, percentage body fat, total body lean mass, and fat mass of the trunk were assessed using the lunar prodigy dxa (ge lunar, madison, wi). A previously described ct technique was used to measure the cross - sectional adipose area of the abdomen (16,24,25). A single slice at the level of the fourth lumbar vertebra was acquired with a general electric high speed advantage ct system (version rp2; ge medical systems, milwaukee, wi). Subcutaneous and visceral adipose tissue areas were measured, and then the visceral adipose tissue area was divided into an intraperitoneal and a retroperitoneal adipose tissue area . Growth and weight charts were collected for the subjects of the good study and longitudinal growth was curve fitted according to the infancy - childhood puberty (icp) model (26) as previously described (16,27). The icp model represents a widely used model for fitting of human growth data to mathematical functions (26). The infancy part is represented by an exponential function, the childhood part by a quadratic function, and the pubertal part by a logistic function . The model also includes the transformations between the different phases . By using this model, we computed values of height at exact ages . Body composition, including bmi, is greatly influenced by pubertal stage and thereby pubertal timing (28). Complete growth charts with enough data to determine pubertal timing, requiring several height and weight measurements around the pubertal growth spurt, were not available for the complete growth chart subsample used in the present study . We have therefore chosen to use measurements of bmi before and after, but not during, puberty . Body weights between 1 and 10 years of age were estimated through fitting of the weight curve for each child using smooth splines (smooth.spline in the r package statistics, the r foundation for statistic computing, vienna, austria; http://www.r-project.org). Bmi values between 1 and 10 years of age were then calculated from the estimated values of weight and height . The z score, the standardization of a variable relative to the investigated population expressed in sds, was calculated using the software spss 15.0 (spss, chicago, il). For each subject (n = 612) in this cohort and for each age, the height was calculated using the icp model . These values were then used to calculate the z score for each subject at each age based on the variation (sd) in calculated height within the presently investigated population at that specific age . The variance of young adult body composition parameters (r) explained by bmi or bmi z score changes and the corresponding coefficients during childhood and adolescence was calculated using linear regression analyses with age - adjusted adult body composition variables as the dependent variable . Age adjustments were performed because the subjects differed somewhat in age at body composition analysis (1820 years of age, mean sd 18.9 0.5 years) and were performed between age at fat analysis and the body composition variables . All subsequent statistical calculations were performed using the age - adjusted body composition variables . For the calculations in fig . For all the statistical analyses, the software spss (version 15.0) was used . Height was measured using a wall - mounted stadiometer and weight was measured to the nearest 0.1 kg as previously described (16,23). Total body fat mass, percentage body fat, total body lean mass, and fat mass of the trunk were assessed using the lunar prodigy dxa (ge lunar, madison, wi). A previously described ct technique was used to measure the cross - sectional adipose area of the abdomen (16,24,25). A single slice at the level of the fourth lumbar vertebra was acquired with a general electric high speed advantage ct system (version rp2; ge medical systems, milwaukee, wi). Subcutaneous and visceral adipose tissue areas were measured, and then the visceral adipose tissue area was divided into an intraperitoneal and a retroperitoneal adipose tissue area . Growth and weight charts were collected for the subjects of the good study and longitudinal growth was curve fitted according to the infancy - childhood puberty (icp) model (26) as previously described (16,27). The icp model represents a widely used model for fitting of human growth data to mathematical functions (26). The infancy part is represented by an exponential function, the childhood part by a quadratic function, and the pubertal part by a logistic function . The model also includes the transformations between the different phases . By using this model, we computed values of height at exact ages . Body composition, including bmi, is greatly influenced by pubertal stage and thereby pubertal timing (28). Complete growth charts with enough data to determine pubertal timing, requiring several height and weight measurements around the pubertal growth spurt, were not available for the complete growth chart subsample used in the present study . We have therefore chosen to use measurements of bmi before and after, but not during, puberty . Body weights between 1 and 10 years of age were estimated through fitting of the weight curve for each child using smooth splines (smooth.spline in the r package statistics, the r foundation for statistic computing, vienna, austria; http://www.r-project.org). Bmi values between 1 and 10 years of age were then calculated from the estimated values of weight and height . The z score, the standardization of a variable relative to the investigated population expressed in sds, was calculated using the software spss 15.0 (spss, chicago, il). For each subject (n = 612) in this cohort and for each age these values were then used to calculate the z score for each subject at each age based on the variation (sd) in calculated height within the presently investigated population at that specific age . The variance of young adult body composition parameters (r) explained by bmi or bmi z score changes and the corresponding coefficients during childhood and adolescence was calculated using linear regression analyses with age - adjusted adult body composition variables as the dependent variable . Age adjustments were performed because the subjects differed somewhat in age at body composition analysis (1820 years of age, mean sd 18.9 0.5 years) and were performed between age at fat analysis and the body composition variables . All subsequent statistical calculations were performed using the age - adjusted body composition variables . For the calculations in fig . For all the statistical analyses, the software spss (version 15.0) was used . The present study represents a subsample (n = 612 [growth chart subsample]) of the original good cohort (n = 1,068) in which subjects with available detailed growth charts from 1 to 10 years of age were included . Anthropometrics and measurements of fat (dxa)/adipose tissue areas (abdominal ct) of the subjects participating in the present study are presented in table 1 . Average bmi in this cohort declined during early childhood years, and adiposity rebound (the lowest bmi) was reached slightly before 6 years of age, after which it began to increase (fig . 2) during both early (age 14 years) and late (age 410 years) childhood were, as expected, clear positive predictors of adult bmi . During adolescence, pubertal stage influences body composition (29). Because interindividual variations in pubertal onset will confound the calculations during adolescence, the predictive role of bmi for each individual year during adolescence for adult bmi and body composition is not shown . Instead, the coefficient for the correlation of the entire adolescence (age 1019 years) is shown in fig . 2, demonstrating that, as expected, bmi changes during adolescence also predicted adult bmi . Childhood bmi and variance in body composition and fat variables (bmi [a] and bmi change [b]) during early and late childhood . Association between childhood bmi between 1 and 10 years of age and young - adult body composition parameters is expressed as accumulated r (%, c and d) or coefficients (sd in adult body composition parameter per sd in bmi at that age, e and f). Variables of adult body composition and fat distribution have been age adjusted . At, adipose tissue; ip, intraperitoneal; sc, subcutaneous . Correlation between change in standardized bmi during different developmental time periods and adult body composition and fat distribution parameters (early childhood defined as 14 years, late childhood defined as 410 years, and adolescence defined as 10 years to young adult). Bars indicate coefficient (95% cis) expressed as sd in investigated adult body composition parameter per sd change in bmi during that growth period . Variables of adult body composition and fat distribution have been age adjusted . * * * p <0.01, * p <0.05 significant association between the developmental time period and the investigated body composition parameter . 95% cis are given for the coefficients, making it possible to evaluate the differences in relative contribution of the three time periods for each dependent parameter . At, adipose tissue; ip, intraperitoneal; ns, not significant; sc, subcutaneous . Bmi alterations during development reflect changes in fat mass, lean mass, or both . To study the role of childhood bmi and bmi changes for the prediction of different adult body compartments, the associations between bmi during development and age - adjusted adult body composition variables were analyzed . The variance (r) in adult total body lean mass explained by bmi as well as the corresponding coefficients for the correlations increased during early childhood, leveled off during late childhood, and increased again during adolescence (figs . The variance in adult bmi and the variance in adult lean mass explained by childhood bmi and the corresponding coefficients for the correlations were similar until 4 years of age, when they separated distinctly (fig . 1c and e). The coefficient for the correlation between change in bmi and adult lean mass was higher during adolescence than during late childhood (fig . 2). Thus, bmi changes during early childhood and adolescence but not during late childhood were major determinants of young adult lean mass . The prediction of young - adult total body fat mass from bmi and bmi changes during different developmental periods followed a different pattern from that of lean mass . The variances in total body fat mass and percentage total body fat explained by childhood bmi and the corresponding coefficients for the correlation were low before 4 years of age, but after 4 years of age, the plotted cumulated variance (r) and the corresponding coefficients for the correlation for young- adult total body fat mass and percentage body fat tightly followed the curve displaying the variance of adult bmi explained (fig . The predictive value of childhood bmi for young - adult percentage total body fat increased substantially during late childhood years, as demonstrated by the fact that the variance in percentage total body fat explained by bmi at 4 years of age was only 1.7%, whereas it was 20.8% at 10 years of age (fig . To analyze fat distribution in detail, we performed abdominal ct scans (on a subset of the present good sample [ct subsample], n = 201) for measurements of abdominal subcutaneous and visceral adipose tissue areas . The abdominal ct measurements revealed that the contribution of bmi during development for the explanation of the variance in young - adult subcutaneous adipose tissue area and the corresponding coefficients for the correlations followed a pattern similar to that of total body fat mass and percentage total body fat, with a distinct increase after 4 years of age (fig . 1d and f). For both young - adult percentage fat mass and subcutaneous adipose tissue area, the coefficients for the correlations were of similar magnitude during late childhood and adolescence but clearly higher than seen during early childhood (fig . Bmi changes during late childhood and adolescence, but not during early childhood, clearly predicted young - adult total fat mass and the amount of subcutaneous adipose tissue . The contribution of bmi during the different developmental periods for the explanation of the variance in amount of young - adult visceral adipose tissue (intraperitoneal + retroperitoneal adipose tissue areas) and the corresponding coefficients for the correlations followed a pattern different and clearly distinct from that of total body fat mass and subcutaneous adipose tissue area . Bmi and bmi changes during early and late childhood contributed only marginally to the explanation of the variance in intraperitoneal adipose tissue area, and the corresponding coefficient for the correlation between change in bmi and amount of young - adult intraperitoneal adipose tissue was low (figs . 1d and f and 2). Instead, adolescence was the developmental period when bmi changes started to contribute substantially to the explanation of the variance in amount of adult intraperitoneal adipose tissue, and the corresponding coefficients for the correlations between change in bmi and amount of young - adult intraperitoneal adipose tissue were then higher than seen during early and late childhood (fig . The results for retroperitoneal adipose tissue were similar as seen for intraperitoneal adipose tissue (data not shown). Analyses using weight for age during childhood and adolescence showed, in a manner similar to that seen for bmi for age, clear age - dependent associations with adult fat parameters (data not shown). In contrast, analyses of height for age did not show any obvious age - dependent association with fat parameters (data not shown). Changes in bmi during adolescence, but not during early or late childhood, predicted the amount of adult visceral adipose tissue . To further describe the association between developmental changes in bmi and adult fat mass / adipose tissue areas, subjects were divided into groups based on change in bmi z score (> 1 sd, less than 1 sd, and average bmi z score change) during the three different developmental time periods (fig . Subjects with more than 1 sd increase in bmi z score during late childhood and during adolescence had a clearly higher percentage total body fat mass (late childhood, + 44%, p <0.001; adolescence, + 60%, p <0.001, fig . 3a) and larger subcutaneous adipose tissue area (late childhood + 83%, p <3b) than subjects with average change in bmi . In contrast, subjects with more than 1 sd increase in bmi z score during late childhood had unaffected intraperitoneal adipose tissue area compared with subjects with average change in bmi (fig . 3c). However, for adolescence, subjects with more than 1 sd increase in bmi z score had larger intraperitoneal adipose tissue area (+ 91%, p <0.001) than subjects with unchanged bmi z score (fig . A specific association between high young - adult subcutaneous, but not visceral (intraperitoneal + retroperitoneal), adipose tissue area and increased bmi z score during late childhood is supported by the finding that young - adult visceral adipose tissue area adjusted for total adipose tissue area was clearly reduced in subjects with more than 1 sd increase in bmi z score during late childhood (fig . 3d). In contrast, an increase in bmi z score of more than 1 sd during adolescence was associated with an increased visceral adipose tissue area adjusted for total adipose tissue area (fig . 3d). Subjects who decreased their bmi with more than 1 sd did not differ from those with no change in bmi z score for any of the investigated fat parameters (fig . Thus, the amount of visceral adipose tissue was predicted by large increases in standardized bmi specifically during adolescence, whereas a high amount of subcutaneous adipose tissue area was predicted by increases in bmi during both late childhood and adolescence . The impact of developmental bmi changes for percentage total body fat (a), subcutaneous adipose tissue area (b), intraperitoneal adipose tissue area (c), and visceral (intraperitoneal + retroperitoneal) adipose tissue adjusted for total abdominal (visceral + subcutaneous) adipose tissue area (d). Subjects with more than 1 sd increase were compared with subjects with average change or less than 1 sd decrease in standardized bmi during early childhood (14 years of age), late childhood (410 years of age), and adolescence (1019 years of age). Variables of adult body composition and fat distribution have been age adjusted and are expressed as means sem and were analyzed using anova followed by tukey's post hoc analysis . * * * p <0.001 versus average, * * p <0.01 versus average, ###p <0.001 versus less than 1 sd decrease, and #p <0.05 versus less than 1 sd . A: early childhood less than 1 sd, n = 72, average n = 471; more than 1 sd, n = 67; late childhood less than 1 sd, n = 75, average n = 462; more than 1 sd, n = 73; adolescence less than 1 sd, n = 55, average n = 500; more than 1 sd, n = 55 . D: early childhood less than 1 sd, n = 21, average n = 160; more than 1 sd, n = 20; late childhood less than 1 sd, n = 22, average n = 154; more than 1 sd, n = 25; adolescence less than 1 sd, n = 22, average n = 164; more than 1 sd, n = 15 . We next investigated if bmi increases in subjects with low prepubertal bmi had a similar impact on the amount of adult visceral adipose tissue as seen in subjects with a high prepubertal bmi . Subjects were divided into tertiles according to prepubertal (10 years of age) bmi (low 15.2 0.8 kg / m, average 16.7 0.4 kg / m, and high 19.3 1.5 kg / m) and tertiles of bmi z score change (low 1.0 0.6 sd, average 0.1 0.2 sd, and high 0.7 0.6 sd) during adolescence (fig . Subjects with greater increase in adolescence bmi had significantly larger visceral adipose tissue areas (low prepubertal bmi + 56%, average prepubertal bmi + 53%, and high prepubertal bmi + 57%; p <0.05 for all) than subjects with average adolescence bmi increase (fig . Bmi increases during adolescence predicted the amount of adult visceral adipose tissue independently of prepubertal bmi . Bmi increases during adolescence are associated with high adult visceral fat mass in subjects with low, average, and high prepubertal bmi . Intraperitoneal fat area (y - axis) in subjects divided into tertiles according to (i) prepubertal bmi (x - axis; low, average, and high) and (ii) bmi - z score increase during adolescence (z - axis; low, average, and high). Data are expressed as means and were analyzed using anova followed by tukey's post hoc analysis . * p <0.05, * * p <0.01 versus average bmi z score change during adolescence (); ##p <0.01 versus low (). N for lowest bmi during adolescence () from low prepubertal bmi to high (left to right) 9, 19, and 39; for average bmi during adolescence () low prepubertal bmi to high (left to right) 26, 25, and 16; and for high bmi during adolescence () from low prepubertal bmi to high (left to right) 32, 23, and 12 . Average bmi in this cohort declined during early childhood years, and adiposity rebound (the lowest bmi) was reached slightly before 6 years of age, after which it began to increase (fig . 2) during both early (age 14 years) and late (age 410 years) childhood were, as expected, clear positive predictors of adult bmi . During adolescence, because interindividual variations in pubertal onset will confound the calculations during adolescence, the predictive role of bmi for each individual year during adolescence for adult bmi and body composition is not shown . Instead, the coefficient for the correlation of the entire adolescence (age 1019 years) is shown in fig . 2, demonstrating that, as expected, bmi changes during adolescence also predicted adult bmi . Childhood bmi and variance in body composition and fat variables (bmi [a] and bmi change [b]) during early and late childhood . Association between childhood bmi between 1 and 10 years of age and young - adult body composition parameters is expressed as accumulated r (%, c and d) or coefficients (sd in adult body composition parameter per sd in bmi at that age, e and f). Variables of adult body composition and fat distribution have been age adjusted . At, adipose tissue; ip, intraperitoneal; sc, subcutaneous . Correlation between change in standardized bmi during different developmental time periods and adult body composition and fat distribution parameters (early childhood defined as 14 years, late childhood defined as 410 years, and adolescence defined as 10 years to young adult). Bars indicate coefficient (95% cis) expressed as sd in investigated adult body composition parameter per sd change in bmi during that growth period . Variables of adult body composition and fat distribution have been age adjusted . * * * p <0.01, * p <0.05 significant association between the developmental time period and the investigated body composition parameter . 95% cis are given for the coefficients, making it possible to evaluate the differences in relative contribution of the three time periods for each dependent parameter . At, adipose tissue; ip, intraperitoneal; ns, not significant; sc, subcutaneous . Bmi alterations during development reflect changes in fat mass, lean mass, or both . To study the role of childhood bmi and bmi changes for the prediction of different adult body compartments, the associations between bmi during development and age - adjusted adult body composition variables were analyzed . The variance (r) in adult total body lean mass explained by bmi as well as the corresponding coefficients for the correlations increased during early childhood, leveled off during late childhood, and increased again during adolescence (figs . The variance in adult bmi and the variance in adult lean mass explained by childhood bmi and the corresponding coefficients for the correlations were similar until 4 years of age, when they separated distinctly (fig . The coefficient for the correlation between change in bmi and adult lean mass was higher during adolescence than during late childhood (fig ., bmi changes during early childhood and adolescence but not during late childhood were major determinants of young adult lean mass . The prediction of young - adult total body fat mass from bmi and bmi changes during different developmental periods followed a different pattern from that of lean mass . The variances in total body fat mass and percentage total body fat explained by childhood bmi and the corresponding coefficients for the correlation were low before 4 years of age, but after 4 years of age, the plotted cumulated variance (r) and the corresponding coefficients for the correlation for young- adult total body fat mass and percentage body fat tightly followed the curve displaying the variance of adult bmi explained (fig . The predictive value of childhood bmi for young - adult percentage total body fat increased substantially during late childhood years, as demonstrated by the fact that the variance in percentage total body fat explained by bmi at 4 years of age was only 1.7%, whereas it was 20.8% at 10 years of age (fig . To analyze fat distribution in detail, we performed abdominal ct scans (on a subset of the present good sample [ct subsample], n = 201) for measurements of abdominal subcutaneous and visceral adipose tissue areas . The abdominal ct measurements revealed that the contribution of bmi during development for the explanation of the variance in young - adult subcutaneous adipose tissue area and the corresponding coefficients for the correlations followed a pattern similar to that of total body fat mass and percentage total body fat, with a distinct increase after 4 years of age (fig . 1d and f). For both young - adult percentage fat mass and subcutaneous adipose tissue area, the coefficients for the correlations were of similar magnitude during late childhood and adolescence but clearly higher than seen during early childhood (fig . Bmi changes during late childhood and adolescence, but not during early childhood, clearly predicted young - adult total fat mass and the amount of subcutaneous adipose tissue . The contribution of bmi during the different developmental periods for the explanation of the variance in amount of young - adult visceral adipose tissue (intraperitoneal + retroperitoneal adipose tissue areas) and the corresponding coefficients for the correlations followed a pattern different and clearly distinct from that of total body fat mass and subcutaneous adipose tissue area . Bmi and bmi changes during early and late childhood contributed only marginally to the explanation of the variance in intraperitoneal adipose tissue area, and the corresponding coefficient for the correlation between change in bmi and amount of young - adult intraperitoneal adipose tissue was low (figs ., adolescence was the developmental period when bmi changes started to contribute substantially to the explanation of the variance in amount of adult intraperitoneal adipose tissue, and the corresponding coefficients for the correlations between change in bmi and amount of young - adult intraperitoneal adipose tissue were then higher than seen during early and late childhood (fig . The results for retroperitoneal adipose tissue were similar as seen for intraperitoneal adipose tissue (data not shown). Analyses using weight for age during childhood and adolescence showed, in a manner similar to that seen for bmi for age, clear age - dependent associations with adult fat parameters (data not shown). In contrast, analyses of height for age did not show any obvious age - dependent association with fat parameters (data not shown). Changes in bmi during adolescence, but not during early or late childhood, predicted the amount of adult visceral adipose tissue . To further describe the association between developmental changes in bmi and adult fat mass / adipose tissue areas, subjects were divided into groups based on change in bmi z score (> 1 sd, less than 1 sd, and average bmi z score change) during the three different developmental time periods (fig . Subjects with more than 1 sd increase in bmi z score during late childhood and during adolescence had a clearly higher percentage total body fat mass (late childhood, + 44%, p <0.001; adolescence, + 60%, p <0.001, fig . 3a) and larger subcutaneous adipose tissue area (late childhood + 83%, p <0.001; adolescence, + 138%, p <0.001, fig . 3b) than subjects with average change in bmi . In contrast, subjects with more than 1 sd increase in bmi z score during late childhood had unaffected intraperitoneal adipose tissue area compared with subjects with average change in bmi (fig . 3c). However, for adolescence, subjects with more than 1 sd increase in bmi z score had larger intraperitoneal adipose tissue area (+ 91%, p <0.001) than subjects with unchanged bmi z score (fig . A specific association between high young - adult subcutaneous, but not visceral (intraperitoneal + retroperitoneal), adipose tissue area and increased bmi z score during late childhood is supported by the finding that young - adult visceral adipose tissue area adjusted for total adipose tissue area was clearly reduced in subjects with more than 1 sd increase in bmi z score during late childhood (fig . 3d). In contrast, an increase in bmi z score of more than 1 sd during adolescence was associated with an increased visceral adipose tissue area adjusted for total adipose tissue area (fig . 3d). Subjects who decreased their bmi with more than 1 sd did not differ from those with no change in bmi z score for any of the investigated fat parameters (fig . Thus, the amount of visceral adipose tissue was predicted by large increases in standardized bmi specifically during adolescence, whereas a high amount of subcutaneous adipose tissue area was predicted by increases in bmi during both late childhood and adolescence . The impact of developmental bmi changes for percentage total body fat (a), subcutaneous adipose tissue area (b), intraperitoneal adipose tissue area (c), and visceral (intraperitoneal + retroperitoneal) adipose tissue adjusted for total abdominal (visceral + subcutaneous) adipose tissue area (d). Subjects with more than 1 sd increase were compared with subjects with average change or less than 1 sd decrease in standardized bmi during early childhood (14 years of age), late childhood (410 years of age), and adolescence (1019 years of age). Variables of adult body composition and fat distribution have been age adjusted and are expressed as means sem and were analyzed using anova followed by tukey's post hoc analysis . * * * p <0.001 versus average, * * p <0.01 versus average, ###p <0.001 versus less than 1 sd decrease, and #p <0.05 versus less than 1 sd . A: early childhood less than 1 sd, n = 72, average n = 471; more than 1 sd, n = 67; late childhood less than 1 sd, n = 75, average n = 462; more than 1 sd, n = 73; adolescence less than 1 sd, n = 55, average n = 500; more than 1 sd, n = 55 . D: early childhood less than 1 sd, n = 21, average n = 160; more than 1 sd, n = 20; late childhood less than 1 sd, n = 22, average n = 154; more than 1 sd, n = 25; adolescence less than 1 sd, n = 22, average n = 164; more than 1 sd, n = 15 . We next investigated if bmi increases in subjects with low prepubertal bmi had a similar impact on the amount of adult visceral adipose tissue as seen in subjects with a high prepubertal bmi . Subjects were divided into tertiles according to prepubertal (10 years of age) bmi (low 15.2 0.8 kg / m, average 16.7 0.4 kg / m, and high 19.3 1.5 kg / m) and tertiles of bmi z score change (low 1.0 0.6 sd, average 0.1 0.2 sd, and high 0.7 0.6 sd) during adolescence (fig . 4). For all three prepubertal bmi groups, subjects with greater increase in adolescence bmi had significantly larger visceral adipose tissue areas (low prepubertal bmi + 56%, average prepubertal bmi + 53%, and high prepubertal bmi + 57%; p <0.05 for all) than subjects with average adolescence bmi increase (fig . Bmi increases during adolescence predicted the amount of adult visceral adipose tissue independently of prepubertal bmi . Bmi increases during adolescence are associated with high adult visceral fat mass in subjects with low, average, and high prepubertal bmi . Intraperitoneal fat area (y - axis) in subjects divided into tertiles according to (i) prepubertal bmi (x - axis; low, average, and high) and (ii) bmi - z score increase during adolescence (z - axis; low, average, and high). Data are expressed as means and were analyzed using anova followed by tukey's post hoc analysis . * p <0.05, * * p <0.01 versus average bmi z score change during adolescence (); ##p <0.01 versus low (). N for lowest bmi during adolescence () from low prepubertal bmi to high (left to right) 9, 19, and 39; for average bmi during adolescence () low prepubertal bmi to high (left to right) 26, 25, and 16; and for high bmi during adolescence () from low prepubertal bmi to high (left to right) 32, 23, and 12 . Both bmi and obesity track strongly from childhood to adulthood (79,30,31), but the role for bmi changes during development as predictors of adult body composition and fat distribution is unclear . The main objective of the present study was to investigate the association between bmi changes during different developmental periods and young - adult fat distribution in a well - characterized cohort of young - adult men . We demonstrate that the amount of adult subcutaneous adipose tissue and visceral adipose tissue was associated with bmi changes during distinct developmental periods . We also identified the childhood age after which bmi increases had a clear impact on adult total body fat mass . Our main finding was that the amount of adult visceral adipose tissue was associated with bmi changes specifically during adolescence, whereas the amount of subcutaneous adipose tissue was associated with bmi changes during both late childhood and adolescence . Subjects with more than 1 sd increase in bmi z score during adolescence had> 90% greater visceral adipose tissue areas than subjects with average change in bmi z score . These data, hence, demonstrate that bmi increases during adolescence were associated with a larger amount of visceral adipose tissue at young adult age . A large amount of visceral fat is a well - known risk factor for cardiovascular disease . A recent study demonstrated that although the amount of subcutaneous adipose tissue is associated with the metabolic syndrome, the amount of visceral adipose tissue remains more strongly related and is therefore regarded as an independent risk factor (5). Increased understanding of how and when subcutaneous and visceral fat compartments are predicted might, therefore, add important knowledge for the prevention of cardiovascular disease . In the present study, bmi increases during adolescence in subjects with a low prepubertal bmi had a similar impact on the amount of adult visceral adipose tissue as in subjects with a high prepubertal bmi . Bmi increases during adolescence predicted the amount of adult visceral adipose tissue independently of prepubertal bmi . An increase by more than 1 sd in standardized bmi both during late childhood and during adolescence was, in the present study, associated with 50% more adult percentage total body fat . The new delhi birth cohort study also demonstrated that bmi changes during late childhood were associated with anthropometric measures of adult fat mass (13). The new delhi study represents a large longitudinally followed cohort, but indicators of fat mass and lean mass were only derived from anthropometric measurements and, consequently, the visceral fat could not be determined in that study . The differences both in height and weight for age and in nutritional status between the indian children in the new delhi birth cohort and children in the western world (13,3234) might also limit the interpretations of the data from the new delhi birth cohort into the western world . A major strength of the present study is that both the subcutaneous and the visceral adipose tissue areas were measured using abdominal ct scans, giving us the opportunity to determine the predictive value of developmental bmi changes for these two fat depots separately . In a danish study, including men born between 1930 and 1956, it was shown that subjects with both increases and decreases in bmi between 7 and 13 years of age had a higher risk of obesity in adulthood compared with those who maintained their bmi level (35). In contrast, in the present cohort of boys born between 1983 and 1985, increases but not decreases in bmi during growth were associated with increased adult fat mass and bmi . Because the subjects in the danish study were born between 1930 and 1956, it is possible that the decline in bmi during growth is related to environmental factors such as temporary undernourishment among certain subjects during this period (including world war ii). Although we in the present study have characterized the associations between childhood bmi and adult obesity, it is clear that a substantial part of adult obesity cannot be explained by childhood obesity (6). Bmi changes during early childhood and adolescence were, in the present study, predicting adult lean mass, whereas bmi changes during late childhood and adolescence were predicting adult total body fat mass . These findings are in accordance with the findings in the new delhi birth cohort study, demonstrating that bmi during early childhood predicts anthropometric measures of adult lean mass more strongly than anthropometric measures of adult fat mass in indian children (13). Both the present study and the new delhi birth cohort study thus support the notion that bmi changes during early childhood are indicators of adult lean mass, whereas bmi changes during late childhood and adolescence are indicators of adult total body fat mass . Our data demonstrate that 4 years of age was the threshold age for swedish boys after which bmi increases were clearly associated with increased adult total body fat mass . It should be emphasized that the present findings are based on association studies and, therefore, should be interpreted with caution . The present study demonstrates that the amount of young - adult subcutaneous adipose tissue was associated with bmi changes both during late childhood and adolescence, although young - adult visceral adipose tissue areas were associated with bmi changes specifically during adolescence . These findings suggest that avoiding substantial bmi increases during adolescence might, independent of prepubertal bmi, result in lower adult visceral fat mass.
It is estimated that around 50% of the population has one or more sites with 1 mm or more of such root exposure . This prevalence rate increases to> 88% in individuals who are 65 years or older . Key factors in the treatment of gingival recession are to prevent the progressive marginal tissue recession and to facilitate plaque control in the affected area . Various treatment modalities have been put forth for the correction of gingival recession . These include free gingival autograft, sub - epithelial connective tissue graft (sctg), coronally advanced flap (caf). It is seen that the incidence of adverse effects, such as discomfort with or without pain, was directly related to the donor sites of sctg . Hence despite sctg being the gold standard for root coverage research is always aimed at finding a suitable alternative to this procedure to reduce patient morbidity . This procedure has been modified by many others with an intention to improve the stability and predictability of this technique . In a recent 14 year follow - up study pini prato et al . Hence this procedure is now generally employed with adjuncts such as guided tissue regeneration membrane, emdogain, acellular dermal matrix and platelet rich plasma to enhance its long term stability . However, evidence regarding the beneficial impact of these procedures on the stability of root coverage is inconclusive . Hyaluronic acid (ha) is a linear polysaccharide found in extracellular matrices of skin . Hyaluronan has many structural and physiological functions within tissues, including extracellular and cellular interactions, growth factor interaction and the regulation of osmotic pressure and tissue lubrication, which helps in the maintenance of the structural and homeostatic integrity of tissues . One gram of ha can bind up to 6 l of water . As a physical background material, it has functions in space filling, lubrication, shock absorption, and protein exclusion . According to various clinical studies hyaluronan undergoes degradation in chronically inflamed gingival tissues, whereas the proteoglycan associated sulfated glycosaminoglycans, such as chondroitin 4-sulphate and dermatan sulfate, remain relatively intact . Ha is a potent anti - inflammatory agent and modulates wound healing due to its ability to scavenge the inflammatory cells - derived reactive oxygen species . This study is aimed at testing the efficacy of hyaluronan gel as an adjunct to caf in root coverage . This was a randomized clinical trial with split mouth study design, carried out in the postgraduate clinic of department of periodontics, coorg institute of dental sciences, virajpet . The study sample included 10 subjects of which seven are male, and three female (at least 20 sites) having miller's class i gingival recession on the canine and premolar region were recruited from department of periodontics, coorg institute of dental sciences . The sample size was calculated adjusting the minimum acceptable power of study at 80% and maximum allowable alpha error at 5% . The recession defects were designated as experimental and control sites randomly prior to surgery by spin of a coin . Experimental group includes hyaluronan gel (gengigel 0.2% gel which is 0.2% hyaluronan gel marketed by ricerfarma pharmaceuticals, milan, italy) with caf and control group with caf alone . This self - funded study was approved by institutional ethical committee, and the procedure and the procedure was explained to all the subjects who provided signed informed consent before participation . Medical and dental examination was obtained from all the individuals who were followed by complete periodontal examination . Patients with malaligned teeth, teeth in trauma from occlusion, cervical abrasion and restorations were also excluded . Subjects were included who are systemically healthy with two or more sites of miller's class i recession and those who can understand and follow oral hygiene instructions properly . At baseline group allocation and sampling site selection were performed by one examiner moogala srinivas (ms) with a unc 15 probe and rounded off to the nearest 0.5 mm . The rd was assessed at baseline, 1, 3, 6, 12 and 24 weeks, and the pd and cal were recorded at 12 and 24 weeks with the patients consent . The patients who were selected and gave their approval for the surgical intervention were educated and motivated with more emphasis on proper oral hygiene maintenance . All the patients underwent the initial phase of treatment of thorough scaling and root planning . The sites were randomly assigned to the control group or the test group using a flip coin technique immediately before surgery . The surgical area was prepared with adequate anesthesia using 2% lignocaine hcl containing 1:80,000 epinephrine . After local anesthesia and before the elevation of the flap, both the exposed root surfaces were gently planned with a sharp gracey no . This incision was horizontally extended to the adjacent papillae avoiding the gingival margin of the adjacent teeth . Two oblique releasing incisions were carried out from the mesial, and distal extremities of the horizontal incision beyond the mucogingival junction [figure 1a]. A trapezoidal full - thickness flap was raised with a periosteal elevator, until the mucogingival junction . Then a partial - thickness dissection was carried out apically leaving the underlying periosteum in place . In addition a mesiodistal and apical dissection parallel to the vestibular lining mucosa was performed with a blade to release residual muscle tension and to facilitate the passive coronal displacement of the flap . (a) horizontal and vertical incisions given in relation to 23; (b) hyaluronan gel applied on the root surface of experimental site; (c) suturing done . (d) postoperative 1-week in the control site; (e) postoperative 24 weeks in the experimental site; (f) postoperative 24 weeks in the control site in the experimental group, hyaluronan gel (gengigel 0.2%) applied on the root surface using a sterile instrument prior to flap advancement and suturing [figure 1b] whereas in the control group the flap was advanced coronally without application of ha gel . Suturing of oblique releasing incisions was performed, with 5 - 0 ethicon nonresorbable sutures, while the coronal mesial and distal extremities of the flap were secured by two single sutures placed in the interdental areas [figure 1c]. Additional interrupted sutures were applied, when necessary, to close the oblique releasing incisions in the alveolar mucosa . Immediately following surgery, use of ice packs was recommended for 3 h. all patients were instructed to discontinue tooth brushing, avoid trauma around the surgical site . In the event of pain, the use of ibuprophen + paracetamol (thrice daily) was recommended . A 0.2% chlorhexidine digluconate solution rinse was prescribed 2 times (60 s) daily for the first 10 days . The patients were instructed to clean the surgical sites with a cotton pellet soaked in a 0.2% chlorhexidine digluconate solution twice daily for 10 days . Three weeks after surgery, the patients were instructed to resume mechanical tooth cleaning of the treated areas using a soft toothbrush with a careful roll technique . Adverse effects such as inflammation, bleeding on probing, pain and abscess formation were assessed postsurgically by first examiner (ms). The patients were recalled for collection of data at 1, 3, 6, 12 and 24 weeks using prefabricated acrylic stent . Both experimental group and control group sites were evaluated postoperatively at 1, 3, 6, 12, and 24 weeks after surgery [figure 1e and f]. Stent made of acrylic was used to standardize the direction and position of the probe . On each visit, the area was checked for meticulous plaque control, but no subgingival instrumentation was performed until the 6 week . A total of 20 buccal gingival recession sites in 10 patients were considered for the study . The values obtained were tabulated and statistically analyzed using student's t - test and repeated measure anova tests . All the statistical methods were carried out through the statistical package for the social sciences (spss) for windows (version 16.0). The descriptive procedure displays univariate summary statistics for several variables in a single table and calculates standardized values (z scores). Using the general linear model procedure, null hypotheses about the effects of both within and between the subject factors in addition, the effects of constant covariates and covariate interactions between - subjects factors can be included . The patients who were selected and gave their approval for the surgical intervention were educated and motivated with more emphasis on proper oral hygiene maintenance . All the patients underwent the initial phase of treatment of thorough scaling and root planning . All the surgical procedures were carried out by one operator . The sites were randomly assigned to the control group or the test group using a flip coin technique immediately before surgery . The surgical area was prepared with adequate anesthesia using 2% lignocaine hcl containing 1:80,000 epinephrine . After local anesthesia and before the elevation of the flap, both the exposed root surfaces were gently planned with a sharp gracey no . This incision was horizontally extended to the adjacent papillae avoiding the gingival margin of the adjacent teeth . Two oblique releasing incisions were carried out from the mesial, and distal extremities of the horizontal incision beyond the mucogingival junction [figure 1a]. A trapezoidal full - thickness flap was raised with a periosteal elevator, until the mucogingival junction . Then a partial - thickness dissection was carried out apically leaving the underlying periosteum in place . In addition a mesiodistal and apical dissection parallel to the vestibular lining mucosa was performed with a blade to release residual muscle tension and to facilitate the passive coronal displacement of the flap . (a) horizontal and vertical incisions given in relation to 23; (b) hyaluronan gel applied on the root surface of experimental site; (c) suturing done . (d) postoperative 1-week in the control site; (e) postoperative 24 weeks in the experimental site; (f) postoperative 24 weeks in the control site in the experimental group, hyaluronan gel (gengigel 0.2%) applied on the root surface using a sterile instrument prior to flap advancement and suturing [figure 1b] whereas in the control group the flap was advanced coronally without application of ha gel . Suturing of oblique releasing incisions was performed, with 5 - 0 ethicon nonresorbable sutures, while the coronal mesial and distal extremities of the flap were secured by two single sutures placed in the interdental areas [figure 1c]. Additional interrupted sutures were applied, when necessary, to close the oblique releasing incisions in the alveolar mucosa . Immediately following surgery, use of ice packs was recommended for 3 h. all patients were instructed to discontinue tooth brushing, avoid trauma around the surgical site . In the event of pain, a 0.2% chlorhexidine digluconate solution rinse was prescribed 2 times (60 s) daily for the first 10 days . The patients were instructed to clean the surgical sites with a cotton pellet soaked in a 0.2% chlorhexidine digluconate solution twice daily for 10 days . Three weeks after surgery, the patients were instructed to resume mechanical tooth cleaning of the treated areas using a soft toothbrush with a careful roll technique . Adverse effects such as inflammation, bleeding on probing, pain and abscess formation were assessed postsurgically by first examiner (ms). The patients were recalled for collection of data at 1, 3, 6, 12 and 24 weeks using prefabricated acrylic stent . Both experimental group and control group sites were evaluated postoperatively at 1, 3, 6, 12, and 24 weeks after surgery [figure 1e and f]. Stent made of acrylic was used to standardize the direction and position of the probe . On each visit, the area was checked for meticulous plaque control, but no subgingival instrumentation was performed until the 6 week . A total of 20 buccal gingival recession sites in 10 patients were considered for the study . The values obtained were tabulated and statistically analyzed using student's t - test and repeated measure anova tests . All the statistical methods were carried out through the statistical package for the social sciences (spss) for windows (version 16.0). The descriptive procedure displays univariate summary statistics for several variables in a single table and calculates standardized values (z scores). Using the general linear model procedure, null hypotheses about the effects of both within and between the subject factors in addition, the effects of constant covariates and covariate interactions between - subjects factors can be included . Mean probing pocket depth (ppd) in experimental sites at baseline was 1.8 0.42 mm, and in control sites it was 2.0 0.47 mm . At the end of 24 weeks, mean pd was 1.7 mm 0.82 in experimental sites and 2.0 mm 0.81 mm in control sites [table 1 and figure 2]. The overall comparisons between the two groups were not statistically significant (p = 0.917) [table 2]. Descriptive analysis of two groups mean probing pocket depth values plotted against time for experimental and control groups results of repeated measure anova for ppd for between experimental and control groups clinical attachment level had a significant gain and stability, at 24 weeks follow - up both groups . Cal gain was significant for both groups, but no intergroup difference was reported at 12 months [table 3 and figure 3]. Comparison of mean clinical attachment level values between experimental and control groups student's t - test showing the cal difference between control and experimental groups on an average, experimental site showed initial rd of approximately 3.2 mm 0.78 mm and control sites 2.9 mm 0.73 mm . After 24 weeks, mean rd was 1.1 mm 0.99 mm in experimental sites and 1.0 mm 0.66 mm in control sites [table 4 and figure 4]. The percentage of root coverage for experimental and control group was 68.33% 28% and 61.67% 30.22%, respectively [table 5 and figure 5]. Descriptive analysis of two groups mean recession depth values plotted against time for experimental and control groups percentage of root coverage comparison of mean percentage of root coverage between control (c) and experimental (e) group at 24 weeks, the change in rd was statistically significant (p = 0.00) in both groups [tables 6 and 7]. Results of repeated measure anova for rd for experimental group results of repeated measure anova for rd for control group there are many factors that determine success of root coverage procedures namely, gingival biotype, amount of keratinized tissue, location of the tooth in the arch, prominence of the root, rd and width . Other than these local factors there are other factors like patient compliance, brushing technique, use of tobacco, etc ., that determine success and long term stability of root coverage procedures . It is a linear polysaccharide and one of the principle components of the extracellular matrix, which is biodegradable, biocompatible and nontoxic . Ha is a macromolecule of several million daltons, consisting of repeating units of d - glucoronic acid (1--3) n - acetyl d- glucosamine (1-4) n. exogenous application of hyaluronan has shown to have anti edema, anti - inflammatory and good wound healing properties . It has been used extensively in the field of dentistry for its various beneficial applications . In periodontics it has been used to treat gingivitis and periodontitis and more recently in the treatment of periodontal intra bony defects . The present study was conceived in an effort to merge two simple and cost effective techniques to achieve better root coverage . A split mouth study design was considered appropriate to minimize the bias that would arise due to variations in healing pattern among individuals . Complete root coverage was achieved immediately following the surgical procedures in all cases except one in the experimental group . During the study, after 24 weeks, 100% root coverage was seen in six sites out of which only two were control sites . That is, at the end of 24 weeks, 40% of experimental sites demonstrated 100% root coverage [figure 1e], whereas only 20% of the control sites showed complete root coverage [figure 1f]. This suggests that clinically the root coverage achieved with the use of hyaluronan gel is more predictable at the end of 24 weeks . Percentage of root coverage in the experimental sites was 68.3% and control sites were 61.6% . This is in accordance with the systematic review by chambrone et al . Which said that that the mean root coverage for caf alone was ranging from 55.9% to 86.7% . The biological properties of hyaluronan as reported by studies by ballini et al . Suggests that it promotes regeneration . The clinical stability of the root coverage achieved after 24 weeks in this study supports this aspect of previous studies . It has been suggested from previous animal studies that there is an increase in hard tissue component of the periodontium following treatment with hyaluronan . It promotes wound healing by cell migration and proliferation, facilitating white blood cell infiltration and improving tissue hydration . This could contribute to better stability of the root coverage procedures that is seen with the use of hyaluronan . Hyaluronan as previously mentioned has been extensively studied in the field of dentistry, but to the best of our knowledge, there is no published data on the usage of ha in the treatment of root coverage procedures . Hence, it is premature at this point to make a comparison of the results of this study with previous studies . A longer follow - up is required to know the long - term stability of the treatment procedures . It is entirely based on clinical parameters, where in the exact nature of periodontal regeneration achieved could be made only by histological evaluation, studies with large sample size and higher statistical power are needed in the future to explore and establish use of hyaluronan as an adjunct in periodontal surgeries . This study shows that hyaluronan affects treatment outcome when used as an adjunct to caf procedure . Although results are not statistically significant, clinically experimental group shows better results as compared to the control group . Though caf gives 100% coverage immediately following the surgery only 61 - 64% can be expected 24 weeks after surgery . Hyaluronan can be easily combined with caf procedure in compromised cases and situations where more stable results are desired.
Ulcerative colitis (uc) is characterized by chronic and relapsing inflammation of the intestines, resulting in diarrhea, abdominal pain, and a variety of other symptoms (1), and impacts negatively on the quality of life . Huangqing - tang decoction, described by zhang zhongjing (150 to 219 a.d ., in chinese eastern han dynasty), has been used for the treatment of uc disease for thousands of years . Radix scutellariae and radix paeoniae alba are the key ingredient herbs present in this decoction, the combination of radix scutellariae and radix paeoniae alba (3:2 g / g) renders its features, such as the heat - clearing, antiinflammatory, antidiarrheic and antinociceptive effects . Apparently, it is essential to study the synergistic interaction of radix scutellariae and radix paeoniae alba for elucidating the substantial foundation of huangqing - tang . Radix scutellariae has been widely used in traditional chinese medicine (tcm) for the treatment of inflammation, fever, hepatitis, allergic diseases and hypertension, and is comprised of the flavonoids, baicalin (bg), wogonoside (wg), baicalein (b) and wogonin (w) as the active ingredients (figure 1) (24). To date, the pharmacokinetic (pk) profiles of bg and wg in plasma, brain and eyes of rats and rabbits have been reported (511). It is generally assumed that baicalin is poorly absorbed from the gastrointestinal tract in its native form and must be hydrolyzed by microflora enzymes (bacterial - glucuronidase) in gut to its aglycone - baicalein, then reconverted back to baicalin . Similar to baicalin, wogonoside is also firstly metabolized by microflora enzymes and reconverted, and is subsequently excreted mainly in conjugated form following administration of radix scutellariae extract in rat and human . Baicalin and wogonoside demonstrated bimodal phenomenon in the plasma profile (12, 13). After oral administration of baicalein, levels of baicalein were negligible, whereas the glucuronides / sulfates conjugates of baicalein were predominant in the plasma (14, 15). Various case reports on herb drug interactions or herb herb interactions in - vivo have been published in recent years, in addition to some reports on the influence of disease condition on the pharmacokinetic characteristics of drug (1619). . A better understanding of the pharmacokinetics of herbal interactions and herbs in diseased rats would be helpful in formulating rational dosage regimens (20). However, to the best of our knowledge, there are no published studies reporting the pharmacokinetics of bg, wg, b, and w after oral administration of pure baicalin, radix scutellariae and scutellariae - paeoniae couple extracts to normal rats, let alone to uc rats . The syndrome of the trinitro - benzene - sulfonic acid)tnbs(-induced colonitis model is similar to the spontaneous uc . This animal model has been used extensively in studies of colonitis and its complications, including the altered drug pharmacokinetics under the colonitis conditions (2126). The aim of this study is to explore the pharmacokinetic differences of the four flavonoids after oral administration of pure baicalin, radix scutellariae extract and scutellariae - paeoniae couple extract to rats and to compare the pharmacokinetic parameters of uc rats with those of normal rats . Materials and chemicals radix scutellariae, radix paeoniae alba were purchased from bozhou medicine company (anhui, china) and authenticated by prof . Feng li from the college of pharmacy, university of traditional chinese medicine (liaoning, china). The voucher specimens (no.20081205, 20081211) have been deposited in liaoning university of tcm . Zhenqiu zhang (dept . Of chemistry in our institute, liaoning university of tcm). Baicalin and wogonin were purchased from the national institute for the control of pharmaceutical and biological products (beijing, china). The solvents used for chromatographic analysis were hplc grade and were purchased from fisher company inc . Deionized water was prepared in a mill - q academic water purification system (millipore, bedford, ma, usa). All the other reagents were of analytical grade and provided by kermel chemical co. (tianjin, china). Apparatus and chromatographic conditions the concentrations of the four flavonoids in plasma were assayed using reverse - phase high performance liquid chromatography (agilent 1100 series) equipped with a variable wave length uv detector and pump (agilent model g1314a vwd). Separation was accomplished on a eclipsel xdb - c18 column (250 mm 4.6 mm, 5 m particle size). The mobile phase was composed of acetonitrile (a): 0.1% phosphoric acid water (b) (0 10 min, 16: 84; 10 15 min, 22: 78; 15 25 min, 25: 75; 25 30 min, 34: 64; 30 50 min, 42: 58, v / v) at a flow rate of 1.0 ml / min with gradient elution . Preparation of radix scutellariae and scutellariae - paeoniae couple extracts radix scutellariae and radix paeoniae alba were mixed in the ratio of 1.5: 1 g / g and the total weight was 200 g. the mixture was decocted twice by refluxing with 70% ethanol (1: 10 and then 1: 8 w / v) for 1 h, and the solution obtained was concentrated to give an extract of 60.5 g. radix scutellariae (200 g) was treated as above to provide an extract of 43.3 g. the dried powder was stored at 4 c before use . For estimation of the administered dose, the concentrations of baicalin, wogonoside, baicalein and wogonin in the extracts and pure baicalin the extract powder (0.10 g) was ultrasound with 100 ml 60% methanol for 30 min . The contents of bg, b, wg and w were determined to be 17.3, 7.6, 2.4 and 1.7% in scutellariae - paeoniae couple extract and 43.6, 19.1, 6.2 and 4.5% in radix scutellariae extract, respectively . Male sprague dawley rats, weighing 250 - 280 g, were obtained from the experimental animal department of dalian university (dalian, china). Animal welfare and experimental procedures were strictly in accordance with the guide for the care and use of laboratory animals (us national research council, 1996) and the related ethics regulations of liaoning university of tcm . Rats were housed in an air - conditioned animal quarter at a temperature of 22 2 c and a relative humidity of 50 2% . The animals were acclimatized to the facilities for five days, and then fasted with free access to water for 24 h prior to each experiment . Colitis was induced in rats according to the model and method described by morris et al . Briefly, rats were lightly anesthetized with 10% chloral hydrate solution, and then a medical - grade polyurethane cannula for enteral feeding (external diameter 2 mm) was inserted into the anus and the tip was advanced to 8 cm proximal to the anal verge . Shanghai, china .) Dissolved in 100% ethanol was instilled into the colon through the cannula (at a dose 80 mg / kg). Following the instillation of the hapten, the rats were maintained in a head - down position for an additional 30 sec to prevent leakage of the intra colonic instillation . Successful replication of the model of uc was characterized by reduction in activities, apathy and occult blood in stool . Biosample collection the uc rats were divided into three subgroups randomly, the pure baicalin, radix scutellariae extract and scutellariae - paeoniae couple extract subgroup . Each group was respectively administrated an oral dose of 200 mg / kg baicalin (in the form of pure compound or co - administrated mixture, 0.21 g / kg pure baicalin, 0.46 g / kg radix scutellariae extract and 1.16 g / kg scutellariae - paeoniae couple extract), all of the compounds were suspended in water and homogenized using ultrasonic technology just prior to dosing . Blood samples (0.5 ml) were collected into a heparinized tube via the oculi chorioideae vein before drug administration and at 0.083, 0.25, 0.5, 0.75, 1.0, 2.0, 4.0, 8.0, 12.0 and 24.0 h after drug administration, and were centrifuged at 4000 rpm for 10 min for the separation of plasma from the red blood cells . The supernatant was decanted carefully and was stored at 40 c until analysis . Biosample preparation an aliquot of 15 l arctigenin (32.0 m in methanol) and 10 l hcl solution (0.1 mm) were added into 100 l plasma, and then spiked with methanol 75 l and acetonitrile 100 l by vortex mixing for 5 min . An aliquot of 50 l of the supernatant was injected into the hplc system . Known amounts of baicalin, baicalein wogonoside, wogonin and is were added into 100 l of blank plasma to prepare the following series of standards . The calibration curves showed good linearity in the range of 0.12331.6 m for baicalin, 0.28873.6 m for wogonoside, 0.1338.50 m for baicalein, 0.0627.9 m for wogonin . The extraction recoveries and matrix effects at three quality control (qc) concentrations were assayed in sets of six replicates . The cvs of the recoveries were less than 20% at low concentration, and less than 15% at medium and high concentrations . Accuracy and precision of the method were investigated by intra - day and inter - day data via comparing the mean of five replicates of each qc sample . The stabilities of baicalin, wogonoside, baicalein and wogonin were determined by analyzing qc samples at three concentrations exposed to encounter during sample storage . The corresponding relative errors were less than 6% for samples at three concentrations for each reference standard, respectively . Results of the stability test showed that under the experimental conditions the samples were stable throughout the testing process . The plasma concentration vs. time data of baicalin and wogonoside were analyzed by non - compartmental model using the nonlinear least squares regression program winnonlin (scientific consulting inc ., shanghai, china) were used to calculate the pharmacokinetic parameters, such as the area under curve (auc), the maximum plasma concentration (cmax) and the corresponding time (tmax), the half - life of absorption (t1/2), etc . Statistical analysis of pharmacokinetic parameter estimates was performed using a two - tailed nonparametric t - test . Chemical structures of arctigenin (a), baicalin (b), baicalein (c), wogonoside (d) and wogonin (e). The selectivity of the method was evaluated by analyzing blank plasma samples prior to administration . The chromatograms were free of interfering peaks at the retention times of is (34.5 min) and baicalin (20.6 min), wogonoside (25.9 min), baicalein (31.9 min) and wogonin (40.8 min). Figure 2 showed the representative chromatograms of blank plasma sample (a), blank plasma sample spiked with baicalin, wogonoside, baicalein, wogonin and is (b), blank plasma sample spiked with is (c), plasma sample (1.5 h) after oral administration of scutellariae - paeoniae couple extract (d). Under the established chromatographic condition, no interfering peaks were observed at the elution times of baicalin, wogonoside, baicalein, wogonin and the internal standard . Chromatograms of blank plasma sample (a), plasma sample spiked with baicalin, wogonoside, baicalein, wogonin and is (b), plasma sample spiked with is (c), plasma samples 1.5 h after oral administration of scutellariae - paeoniae couple extracts (d). Pharmacokinetics of baicalin and wogonoside after oral administration of pure baicalin, radix scutellariae and scutellariae - paeoniae couple extracts to rats . The mean plasma concentration - time profiles and standard deviation in normal rats and uc rats following the administration of pure baicalin, radix scutellariae or scutellariae - paeoniae couple extracts are depicted in figure 3 (a) and 3 (b). Pharmacokinetic parameters resulting from non - compartmental analysis are listed in tables 1 and 2 . The plasma concentration time profile of baicalin (bg) and wogonoside (wg) after oral administration of pure baicalin (0.21 g / kg), radix scutellariae extract (0.46 g / kg) and scutellariae - paeoniae couple extract (1.16 g / kg) to normal (a) and ulcerative colitis (uc) (b) rats pharmacokinetic differences of baicalin after oral administration of pure baicalin (0.21 g / kg), radix scutellariae extract (0.46 g / kg) and scutellariae - paeoniae couple extract (1.16 g / kg of baicalin) to normal and uc rats mean sd, n=10;p <0.05 vs. normal - rats pharmacokinetic differences of wogonoside after oral administration of pure baicalin (0.21 g / kg), radix scutellariae extract (0.46 g / kg) and scutellariae - paeoniae couple (1.16 g / kg) to normal and uc rats mean s.d ., n=10; p<0.05 vs. normal - rats following oral administration of pure baicalin (purity> 95.5%) to rats, wogonoside was detected in all rats plasma in addition to baicalin, the plasma concentration was almost equal to that of baicalin . The same result was observed after oral administration of radix scutellariae extract (200 mg / kg of baicalin, 28 mg / kg wogonoside) or scutellariae - paeoniae couple extract (200 mg / kg of baicalin, 27 mg / kg of wogonoside) to rats . The present result suggested that baicalin might convert to wogonoside in the rat body . Zhenyu zhu et al . (4) reported that they found a peak (named m) with a retention time of about 5 min at m / z 461 was similar to wogonoside (m / z 461) after oral administration of xiaochaihu tang and radix scutellariae extract to rats, which was possibly a methylated product of baicalin . Methylation generally existed during the drug metabolism in - vivo, and due to the multiple hydroxyl groups on the baicalin benzene ring, the combination of a methyl group with a hydroxyl group was easy . So, we tentatively concluded that absorbed baicalin could be methylated to wogonoside in - vivo . Following oral administration of radix scutellariae or scutellariae - paeoniae couple extracts to rats, baicalein and wogonin with very high concentrations were presented in rat tissues (28), however, in the present study, it was below the detection limit in all plasma samples collected for all rats . These results appeared to be consistent with previous reports (14, 15, 29, 30). As described in previous studies, baicalin firstly must be hydrolyzed to baicalein by -glucuronidase in - vivo, which was produced by both intestinal bacteria and intestinal epithelial cells (3134). Thus, baicalin can first enter the intestinal wall as baicalein and is then reconverted to baicalin within the intestinal mucosa and thereby is absorbed into the blood . Therefore, baicalin in plasma may be derived from both baicalin and baicalein in radix scutellariae or scutellariae - paeoniae . The doses of baicalin and baicalein in the extracts were summed to produce the sum dose of baicalin and baicalin which was used to calculate dose - normalized cmax and auc0-t . Based on the similar chemical structure between wogonoside and baicalin, it is proposed that the transformation between wogonoside and wogonin are similar to that between baicalin and baicalein in the intestinal wall, the sum dose of wogonoside and wogonin was calculated in the same way . Consequently, we could only detect baicalin and wogonoside, not baicalein and wogonin in plasma . As shown in figure 3 and table 1 - 2, the absorption speed of baicalin and wogonoside in the normal pure baicalin group was quicker than those in the normal radix scutellariae and scutellariae - paeoniae couple groups, tmax for baicalin were: (0.087 0.02) h, (0.27 0.03) h and (0.28 0.03) h; tmax for wogonoside were (0.11 0.02) h, (0.22 0.09) h, (0.21 0.08) h, respectively . But tmax of baicalin and wogonoside were little different among the three groups of uc rats . The pharmacokinetic profiles differences of baicalin and wogonoside were reflected in auc(0t) and cmax . Following oral adminstration scutellariae - paeoniae couple extract to rats, cmax and auc(0t) of baicalin and wogonoside were higher than the other two forms (p 0.05). Compared to the radix scutellariae groups, cmax and auc(0t) of baicalin and wogonoside in the pure baicalin groups were significantly lower (p 0.05). These chemical components might produce certain pharmacological effects and have impact on the pharmacokinetic profiles of baicalin and wogonoside . Under the guidance of the theory of tcm, radix paeoniae alba, used as messenger herb and hematinic herb, could guide the bioactive ingredients of radix scutellariae to the proper tissues and exert a harmonizing effect, including the increase of absorption and bioavailability . Radix paeoniae alba also could increase the absorption of baicalin and wogonoside through increasing the function of spleen and improving the patients digestive system vitality and immune system . Thus, compared to pure baicalin and radix scutellariae extract, the cmax and auc(0t) of baicalin and wogonoside increased remarkably (p <0.05) when radix scutellariae was mix - decocted with radix paeoniae alba, in contrast, the absorption of pure baicalin was the least . The present study demonstrated that herb extract could enhance the bioavailability of baicalin and wogonoside in rat plasma, a significant drug - drug interaction may occur and improve the absorption of baicalin and wogonoside when radix paeoniae alba is administered in combination with radix scutellariae (35). Either in uc or in normal rats, baicalin and wogonoside demonstrated bimodal phenomenon in rat plasma after oral administration of pure baicalin, radix scutellariae or scutellariae - paeoniae couple extracts (figure 3). The first absorption peaks occurred at about 0.15 - 0.27 h and the second was at about 8 12 h. the concentrations of the second peak (cmax) and the values of auc(0t) dose were lower than which of the first peak . The ability of rapid absorption of baicalin and wogonoside may result in the rapid appearance of the first peak . Baicalin and wogonoside had double - site absorption kinetics, and baicalin and wogonoside undergo enteric circulation and enterohepatic circulation in rats after oral dosing, which may be responsible for the second peak . But they were always detected and kept their concentration at a certain range in plasma . Free drug might bind with plasma protein when it reaches a certain concentration (19). Wang et al . (36) reported that the binding rate of free baicalin with plasma protein could reach 80% . It was not able to maintain a high concentration for a long time because the baicalin would enter into the plasma and then bind with plasma protein . When the concentration of free baicalin decreased to a certain concentration, the bound baicalin would dissociate . Comparative pharmacokinetics of baicalin and wogonoside after oral administration of pure baicalin, radix scutellariae and scutellariae - paeoniae couple extracts between uc and normal rats from figure 4 and table 1 - 2, it was noteworthy that uc rats showed better absorption than normal rats, regardless of oral administration of pure baicalin, radix scutellariae or scutellariae - paeoniae couple extracts . The absorption speeds of baicalin and wogonoside were very rapid, tmax were approximately 0.13 h. tmax showed no statistically significant difference among the three groups of uc rats . Cmax and auc(0t) of baicalin and wogonoside in uc rats were greatly higher than those in normal rats (p <0.05). After oral administration of pure baicalin, radix scutellariae or scutellariae - paeoniae couple extracts to rats, auc(0t) of baicalin were: (41.46 0.62), (59.12 6.42) and (104.87 0.86) (g / ml)h in uc groups vs (17.77 0.66), (28.04 4.06) and (49.01 4.61) (g / ml)h in normal groups; auc(0t) of wogonoside were: (40.86 5.31), (57.95 1.91) and (101.31 3.05) (g / ml)h in the uc groups vs (14.67 1.93), (22.89 3.17) and (40.35 4.96) g / ml / h in the normal groups, respectively . Plasma concentration - time profiles of baicalin (bg) (a) and wogonoside (wg) (b) after oral administration of scutellariae - paeoniae couple extract (1.16 g / kg) to ulcerative colitis (uc) and normal rats the significantly higher cmax and auc(0t) of baicalin and wogonoside in uc rats indicated that ulcerative colitis had an influence on the pharmacokinetic characteristics of baicalin and wogonoside in pure baicalin, radix scutellariae or scutellariae - paeoniae couple extracts . Several factors were likely to be involved in the alteration of the pharmacokinetic behavior of baicalin and wogonoside under the colitis condition, including -glucuronidase, udp - glucuronosyltransferase, mrp2, intestinal or hepatic metabolic enzymes and bile flow rate, etc . Trinitrobenzene sulfonic acid (tnbs)-induced uc condition might alter the formation of glucuronide, glutathione, and sulfate conjugates which played an important role in the metabolism of compounds in rats (40 - 43). These factors may result in a higher exposure of baicalin and wogonoside after oral doses . As known that intestinal flora plays an important role in the absorption and reabsorption of baicalin and wogonoside, we hypothesized that intestinal bacteria in uc rats would be very rich which lead to increased -glucuronidase activity . Thus, profound intestinal -glucuronidase activity due to the ulcerative colitis condition may have enabled the rapid conversion of baicalin and wogonoside to baicalein and wogonin which have the propensity to be absorbed more completely leading to higher baicalin and wogonoside exposure after oral administration relative to normal rats . The findings of this study demonstrated that the pharmacokinetic behaviors of baicalin and wogonoside were remarkably altered in uc rats . Scutellariae - paeoniae couple extract may exert more effectiveness than pure baicalin or radix scutellariae extract . It proves the rationality of using scutellariae - paeoniae couple for the treatment of ulcerative colonitis disease . In summary, the results of the present study highlighted that drug drug interactions, herb drug interactions and herb herb interactions always existed and affected the pharmacokinetic behavior of herbal ingredients . Statistically significant differences (p <0.05) in pharmacokinetic parameters of baicalin and wogonoside including cmax and auc(0t) were obtained among the rats orally administered pure baicalin, radix scutellariae or scutellariae - paeoniae couple extracts . The huge number of active ingredients in tcm made them suitable for multi - target actions . Baicalin and wogonoside had a better absorption effect, which would improve the therapeutic efficacy . We need to take caution when extrapolating pk and exposure data from healthy animals to diseased animals in designing pharmacological studies.
Weekly creatinine clearance (wccr) and kt / v are well - known parameters reflecting dialysis dose and adequacy, and are applied to adjustment of the dialysis menu in each patient who undergoes peritoneal dialysis (pd). However, the limitations of these parameters in predicting survival and morbidity have been reported . Moreover, the collection of urine and peritoneal effluent is cumbersome work not only for patients, but also for medical staff . Estimated ccr (eccr) was proposed as an alternative marker for measured total ccr (tccr), because it is less expensive and time - consuming . But it was also reported that eccr calculated by the cockcroft - gault formula substantially overestimated the effect of age on creatinine excretion in pd patients . Estimated glomerular filtration rate (egfr) is an alternative marker for measured gfr (mgfr), and it might be a possible indicator for prognosis in the general population without known cardiovascular disease, diabetes or kidney disease and in ckd patients included in the modification of diet in renal disease (mdrd) study . Moreover, these prognostic features of egfr might be partially independent of mgfr . We reported that egfr was well correlated with tccr in pd patients by cross - sectional analysis . Similar correlation of egfr with ccr was reported by khosla, et al ., although the analyzed patients were restricted to the population with a difference between two measurements of ccr of less than 25% . To clarify the actual utility of egfr in peritoneal dialysis practice, we retrospectively collected the data from 21 pd patients at ja toride medical center for the period of one year . Patients who underwent pd at ja toride medical center for one year or longer were enrolled in the study after their informed consent was obtained . Pd patients with a treatment period of less than a year, and patients who underwent combined pd and hemodialysis (hd) therapy were excluded . To measure renal ccr, urine was collected for 24 hours (from the second voiding of the day before visiting the hospital to the first voiding on the day of visiting the hospital). Pd effluent was also collected for 24 hours on the day before visiting the hospital to measure peritoneal ccr . The sum of the peritoneal and renal ccr was defined as the measured tccr . The serum, urine, and effluent cr were measured by the established enzyme method . The formula proposed by the japanese society of nephrology was applied for calculation of egfr as follows: egfr (ml / min/1.73 m) = 194 serum cr age (0.739 in females) protein catabolic rate (pcr) was calculated by the formula proposed by teehan as follows: pcr (g / day) = 6.25 (urinary urea excretion + peritoneal urea excretion + 1.39 + 0.15 + 0.031 body weight in kg). Pcr was normalized (divided) by the measured body weight (bw) and described as npcr (g / kg / day). According to the guidelines of the japanese ministry of health, labour, and welfare, informed consent of the patients the study protocol was approved by the ethics committee of ja toride medical center . The data are shown as means sd, unless otherwise specified . To observe the correlation of two sets of data, the pearson s correlation coefficients were calculated using excel 2007 (microsoft, redmond, wa, u.s.a . ). As table 1table 1characteristics of the studied patientsmen / women16 / 5age (years)66.6 12.6 (4695)capd / apd13 / 8cause of ckddm7cgn7ns4others3treatment period of pd in months45.1 32.4 (14118)samples in the data analysis1145.4 1.5 (27) per patient shows, 21 patients met the inclusion criteria and were included in this study . The patients comprised 15 men and 6 women with an average age of 66.6 12.6 years (4695 years old), and their average pd period was 45.1 32.4 months (14118 months). Their causes of ckd were diabetes mellitus (dm) in seven patients, chronic glomerulonephritis (cgn) in seven patients, nephrosclerosis (ns) in four patients, and others in three patients . Continuous ambulatory pd (capd) was undertaken in 13 patients, and the other eight patients received automated pd (apd). During the period of one year from november 2010 to october 2011, 114 data sets of egfr and tccr from the 21 patients were suitable for data analysis . According to the analysis, egfr and tccr were correlated (r. = 0.435 in figure 1figure 1egfr and tccr . The open circles in the plotted data were obtained from one patient who denied the habitual intake of creatine supplements, such as creatine monophosphate, but poorly complied with the diet therapy . ). However, their correlation was less than that of a previous cross - sectional study (r. = 0.836). Unexpectedly lower egfr levels were observed in one patient (shown as open circles in figure 1). Repeated counseling of the patient revealed that his diet fluctuated . As figure 2figure 2tccr - egfr difference and npcr (a) and total cr excretion and npcr (b) in one patient who showed fluctuating diet intake . More detailed data from the patient, exhibited as open circles in figure 1 are shown . Variations in the difference between egfr and tccr were correlated with both total cr excretion and npcr . Shows, tccr - egfr difference and total cr excretion were actually correlated with npcr in this patient . Similar correlations were observed for the difference between egfr and tccr with total cr excretion (r. = 0.821 in figure 3figure 3tccr - egfr difference and total cr excretion . Differences between egfr and tccr were well correlated with total cr excretion in total samples .) And npcr (r. = 0.636 in figure 4figure 4tccr - egfr and npcr . Differences between egfr and tccr were correlated with npcr in total samples .) In all the data . Total cr excretion and npcr were also correlated with each other (r. = 0.516 in figure 5figure 5total cr excretion and npcr . Total cr excretion and npcr were also correlated with each other in total samples . ). The open circles in the plotted data were obtained from one patient who denied the habitual intake of creatine supplements, such as creatine monophosphate, but poorly complied with the diet therapy . Tccr - egfr difference and npcr (a) and total cr excretion and npcr (b) in one patient who showed fluctuating diet intake . More detailed data from the patient, exhibited as open circles in figure 1 are shown . Variations in the difference between egfr and tccr were correlated with both total cr excretion and npcr . Tccr - egfr difference and total cr excretion . Differences between egfr and tccr were well correlated with total cr excretion in total samples . Total cr excretion and npcr were also correlated with each other in total samples . This retrospective study with the data collected for a year from 21 pd patients showed that the correlation of egfr with tccr was less than that of a previous cross - sectional study . The difference between tccr and egfr was mostly dependent on total cr excretion, as reported in pre - dialysis patients, but this has never been reported in pd patients . Moreover, total cr excretion fluctuated according to the npcr . Consequently, protein intake estimated by npcr may affect the difference between tccr and egfr . Because creatinine is homogeneously distributed in the body water, serum creatinine level is determined by the balance of several factors, such as oral intake, generation in the muscle, intrinsic degradation (metabolic clearance) and clearance by peritoneal dialysis and the kidney (figure 6figure 6considerable factors determining serum cr levels . Meats (per 100 g) generally contain 400460 mg of creatine and creatinine (see discussion for details).). The amount of creatinine obtained by oral intake is mainly dependent on the amount of meat, which generally contains 400450 mg of creatinine and creatine per 100 g, or more precisely, 1 mg of creatinine and 23 mg of creatine per 1 g of meat protein . Actually, total cr excretion was well correlated with npcr in this study (figure 5). Meanwhile, the cr generation rate in the muscle is relatively stable, because it is thought to be related to the muscle mass and activity . Mainly affects the variance in urinary creatinine excretion, especially in the case of preserved residual renal function, which has a wider ranging capacity for compensation . Consequently, the serum cr concentration and its calculation product, egfr, are supposed to be more stable parameters than ccr by diminishing the preserved capacity in small solutes clearance of the kidney . The increased difference between tccr and egfr in the higher pcr population could be explained by a similar reason, because pcr was positively correlated with total cr excretion . Hence, serum cr and its calculation product, egfr, may be superior to ccr because they are less dependent on diet, unlike ccr . (per 100 g) generally contain 400460 mg of creatine and creatinine (see discussion for details). Recently, it has been reported that egfr had a prognostic value for ckd - related complications, kidney failure, cardiovascular risk factors and mortality . It is possible that egfr has a similar independency and distinct feature as a predictive indicator even in pd patients . Hence, the obtained value can fluctuate as a result of several factors, such as patient condition, diet and drugs, which means that mgfr should not always be considered a representative value or gold standard of renal function, or rather the preserved capacity of the kidney to maintain the serum level of creatinine within a certain range under conditions of fluctuating intake may be a more reasonable index for actual kidney function . Although the peritoneal clearance of small solutes represented by creatinine should be taken into consideration in pd patients, egfr derived from serum creatinine, age and gender may diminish the compensatory fluctuation of small solute clearance in the kidney, and provide a more stable level in each pd patient . This feature may be valuable in routine clinical practice, and it is worth investigating the significance of egfr as a possible prognostic factor in pd patients, as reported in pre - dialysis patients, . This study has some limitations . Because the study design was a retrospective analysis at a single center, the patient characteristics were divergent with respect to pd modalities, exposure periods, residual renal function and adherence to diet therapy . In addition, the study population was small, and equal amounts of data were not collected for each patient . Therefore, differences between individual patients and the entire study population could not be distinguished from the obtained data . However, fluctuating cr excretion was certainly observed not only in data from individual patient but in all collected data, as shown in figures 2, 3, 4, 5 . This study revealed the practical profile of egfr, distinct from tccr, as a more stable marker for small solutes clearance by dialysis and the kidney . A more extended and longitudinal study will be needed to verify the actual value of egfr in pd practice.
Mesenchymal stem cells (mscs), also referred to as multipotent mesenchymal stromal cells, have been a focus of recent research, partially because they are an extraordinary model for investigating the biological mechanisms that allow a cellular population to generate diverse cell types and because they are a potential tool in cellular therapies for several clinical applications . Mscs can differentiate into mesenchymal lineages and secrete cytokines and growth factors with paracrine effects that favor the regeneration of damaged tissues [1, 2]. Several studies have demonstrated that mscs possess an immunoregulatory function in vitro and in vivo and that this property suggests clinical applications in the regulation of immunocompetent cell responses [2, 3]. This review addresses current knowledge of the biological aspects involved in msc immunoregulatory capacity and the clinical focus of these characteristics that allows these cells to be used in the treatment of several diseases with an immune component involved . This review culminates with a clinical description of the diseases treated with mscs as a component of cell therapy procedures . Mscs are adult stem cells that are initially isolated from bone marrow (bm) and can generate stromal bm components, such as adipocytes, reticular cells, and osteoblasts, whereas in conjunction with additional cellular components, mscs maintain hematopoiesis . Mscs proliferate in vitro as adherent, colony - forming cells with a high capacity for self - renewal and proliferation [4, 5]. Because there is no definite marker of mscs, the international society for cellular therapy has established minimum criteria that these in vitro cell populations must fulfill and certain characteristics to be considered mscs . The cells must be positive for cd105, cd73, and cd90, express low levels of mhc - i, and be negative for mhc - ii, cd11b, cd14, cd34, cd45, and cd31 . Additionally, these cells must be capable of differentiation into osteoblasts, adipocytes, and chondroblasts in vitro [5, 6]. Mscs have been isolated from multiple tissues: skeletal muscle, adipose tissue (at), synovial membranes, dental pulp, periodontal ligaments, cervical tissue, menstrual blood, wharton's jelly (wj), umbilical cord (uc), umbilical cord blood (ucb), amniotic fluid, placenta (pl), and fetal tissues such as blood, liver, and bm [710]. In most cases, isolated mscs are heterogeneous in proliferation and differentiation, although all express the characteristic msc marker profile . Mscs cultivated in vitro possess three biological properties that qualify them for use in cellular therapy: (a) broad potential of differentiation, (b) secretion of trophic factors that favor tissue remodeling, and (c) immunoregulatory properties . Furthermore, mscs differentiate into different mesodermal lineages (adipocytes, chondrocytes, osteocytes, fibroblasts, and myocytes). Because of this potential for differentiation, mscs were initially used in the treatment of imperfect osteogenesis and myocardial damage . The benefits observed in these initial cell therapy protocols were thought to be the result of osteogenic and myogenic differentiation . The current understanding is that, in addition to diverse mesodermal differentiation capacity, msc benefits arise primarily from the secretion of trophic factors and immunoregulatory capacity [13]. Mscs profoundly affect immune response through their interactions with the cellular components of the innate (natural killer cells (nk)) and adaptive (dendritic cells (dcs), b lymphocytes, and t lymphocytes) immune system . Msc immunoregulation can occur through cellular contact and/or the secretion of diverse factors [1317]. Because of these properties, mscs can prevent the inappropriate activation of t lymphocytes and generate a tolerogenic environment during wound repair or stop an immune response during healing, thus contributing to the maintenance of immune homeostasis [2, 3]. Below, we describe the immunoregulatory effects of mscs on specific immune cells with special emphasis on the effect of mscs on t lymphocytes because of their role as effector cells in many diseases with an immune component . The phases in which t cells are vulnerable to msc immunoregulation, recognizing from a biological perspective that there are no obvious limits between phases, are described below . T lymphocytes express and secrete molecules characteristic of this phase, such as cd25, cd69, cd38, cytotoxic t lymphocyte antigen-4 (ctla-4), and human leukocyte antigen - dr (hla - dr) and in addition the cytokines interferon- (ifn), tumor necrosis factor (tnf), and il-2, among others . Currently, there are contradictory results regarding the effect of mscs on t lymphocyte activation . Some studies have observed that bm - mscs prevent the expression of the early activation markers cd25 and cd69 in t cells stimulated with phytohemagglutinin (pha) [19, 20], whereas other studies describe no effect by bm - mscs on the expression of these molecules [16, 21]. Such contradictory results may be because of differences in the population of t lymphocytes studied . With this understanding, the activation of peripheral blood mononuclear cells (pbmc) with pha in the presence of bm - mscs results in lower numbers of cd4 and cd8 that express cd25, cd38, and cd69 . Employing the identical model, contradictory results report that the activation of pbmc with antibodies in the presence of bm - mscs does not modify the expression of cd25 or cd69 in cd4 and cd8 populations . Similarly, no change was reported in the expression of cd25, cd69, or ctla-4 in studies of populations enriched with cd4 and cd8 lymphocytes activated by alloantigens . However, a recent study using populations enriched with cd3 t lymphocytes activated with anti - cd2/cd3/cd28 in the presence of bm - mscs showed an increase in the expression of cd69 in cd4 and cd8 t lymphocyte populations . The effects of mscs on the secretion of cytokines by activated t lymphocytes are also described by contradictory results . Some studies have demonstrated that the presence of mscs diminishes [14, 21] or increases [23, 24] significantly the secretion of ifn by activated t lymphocytes . Nonetheless, it has been described that the effects of mscs on ifn secretion depend on the source of the lymphocyte population studied . In this study, the authors demonstrated that the activation of cd3 t lymphocytes with anti - cd3/cd28 in the presence of mscs from adipose tissue resulted in an increase in ifn, which was an effect that was not observed when pbmc were activated with the identical stimulus . Our laboratory recently demonstrated that the activation of cd3 t cells with antibodies in the presence of bm - mscs, ucb - mscs, and pl - mscs also resulted in an increase in ifn in cocultures . This observed effect might be related to the generation of ifn-producing t regulatory cells (tregs). The effect of mscs on the proliferation of t lymphocytes is independent of the activation method . The first studies to analyze the effects of bm - mscs on the proliferation of t lymphocytes used irradiated mscs that were cocultivated with alloantigen - stimulated pbmc . These studies reported that mscs inhibited t - cell proliferation in a dose - dependent fashion [13, 16, 17, 19]. However, in addition to inhibiting alloantigen - induced proliferation, mscs can inhibit proliferation induced by polyclonal activators such as pha [14, 26] or anti - cd3/cd28 [21, 23, 24]. The immunosuppressive effects of mscs have been analyzed using total populations of pbmc and populations enriched in cd3, cd4, or cd8 lymphocytes . Every case has demonstrated the capacity of mscs to diminish proliferation [13, 16, 17, 19, 21, 23, 24]. Immunoregulation has been shown to be independent of the induction of apoptosis [16, 27] and is performed through mechanisms dependent and independent of cellular contact . Among the secreted factors identified are transforming growth factor beta 1 (tgf1), hepatocyte growth factor (hgf), indoleamine-2,3-dioxygenase (ido), prostaglandin e2 (pge2), il-10, and hla - g5 [13, 17, 28], whereas programmed death - ligand 1 (pd - l1) and hla - g1 are involved in contact - dependent mechanisms (figure 1) [2830]. Whether direct contact between mscs and t lymphocytes is necessary for the inhibition of t - cell proliferation remains controversial . Some authors have suggested that mscs act via an immunosuppressive mechanism independent of cell - to - cell contact [31, 32], whereas others have indicated that contact is required for efficient immunoregulation [24, 2830, 33, 34]. However, the mechanism of msc immunoregulation appears to depend on cellular populations, mode of activation, and the presence or absence of cell - to - cell contact [23, 32]. (3) differentiation and effector function . Upon activation by the presence of pathogens or signs of damage, helper t cells cd4 (th0) differentiate into one of the following subtypes, depending on the t - cell microenvironment: th1, th2, th17, or tregs . Each population is characterized by the secretion of a set of cytokines whose function is essential to eliminate pathogens within the organism, resolve inflammation, and maintain immune homeostasis . Several studies have suggested that mscs modulate the differentiation, function, and balance of these subpopulations and foster the development of an anti - inflammatory immune response (figure 1) [14, 28, 35, 36]. The activation of nave t cells (cd45ra) in favorable conditions for the induction of th1 or th2 and in the presence of mscs results in the inhibition of ifn secretion by th1 cells and the increase of il-4 secretion by th2 cells . Furthermore, mscs inhibit the production of proinflammatory cytokines il-17, il-22, ifn, and tnf and the differentiation of nave cd4 lymphocytes to th17 . Additionally, mscs promote the secretion of il-10 and the expression of the foxp3 transcription factor, thus suggesting differentiation toward tregs (figure 1). Similarly, in a murine model, the presence of mscs in the th1 and th17 differentiation processes favors differentiation to cd4cd25foxp3 tregs . This effect was not observed when mscs were added to cultures of mature th1 or th17 populations . These results indicate that mscs affect the differentiation and function of inflammatory t lymphocyte populations in their capacity to produce proinflammatory cytokines and also in the induction of a tregs phenotype . Several studies have described the role of mscs in the induction of distinct tregs populations [14, 28, 3740]. In an initial study analyzing the participation of bm - mscs in the differentiation of tregs populations, maccario et al . Observed that the presence of allogeneic and autologous mscs, with respect to the responder t lymphocyte population in mixed lymphocyte culture (cml), induced a significant increase in the cd4cd25 t lymphocyte population . However, only allogeneic mscs favored an increase in cd4cd25ctla-4 populations . In the same year, a different study observed that pbmc activation by il-2 in the presence of mscs increased the proportion of cd4cd25 t lymphocytes . Subsequently, prevosto et al . Showed that pbmc in coculture with bm - mscs generated a population of cells that could inhibit t lymphocyte proliferation induced by alloantigens or polyclonal activators (anti - cd3 or pha), and this effect required cell - to - cell contact . The authors observed that the increase in foxp3 mrna expression occurred only in the tregs populations derived from cd4 lymphocytes . Mscs can induce and maintain the function and phenotype of tregs derived from cd3, cd3cd45ro, or cd3cd45ra t lymphocyte populations . Beginning with a cd3 population, the authors also demonstrated that the presence of bm - mscs maintained foxp3 expression in tregs . Furthermore, mscs can induce regulatory t type 1- (tr1-) like cells characterized by ifn and il-10 secretion . Through an in vivo transplant - induced arteriosclerosis model (obstructed arteries), jui et al . Demonstrated that the local administration of bm - mscs could prevent this pathology through a local increase in ifn and il-10 . In a subsequent in vitro study, the identical laboratory demonstrated that bm - mscs favored the generation of tr1 lymphocytes with an il-10ifncd4 phenotype mediated by pge2 and ido (figure 1). Msc participation in t lymphocyte subpopulation equilibrium has also been observed in human in vivo studies . Patients who have received mscs for the treatment of gvhd show subsequent increases of cd4cd25foxp3 and tr1 populations and decreases of th17 . Similarly, the administration of mscs to patients with systemic lupus erythematous induced an increase in cd4cd25foxp3 tregs in the peripheral blood . Increases in this tregs population have also been observed in kidney transplant patients, which were transplanted with autologous mscs . These cells are derived from bm - cd34 cells in vivo and from monocytes stimulated with il-4 and granulocyte macrophage colony - stimulating factor (gm - csf) in vitro . The primary function of dcs is to process and present antigens to virgin and memory t cells, although they also interact with other immune components such as b lymphocytes and nk cells . The individual dcs must mature to initiate an appropriate immune response, and during the maturation process, dcs increase the membrane expression of mhc - ii and t - cell costimulatory molecules cd80 and cd86 . Mscs can significantly reduce monocyte differentiation into dcs, affecting the upregulation of cd1a, cd40, cd80, cd86, and hla - dr (figure 2) [15, 37, 4648]. This reduction is performed through the secretion of factors [15, 46] and is a reversible process because these monocytes then differentiate normally at the removal of mscs . When immature dcs (idcs) derived from monocytes - msc cocultures were activated with lipopolysaccharide (lps) to induce their final differentiation, they expressed lower levels of the maturation marker cd83 and costimulatory molecules cd80 and cd86 . However, spaggiari et al . Showed that mscs do not affect direct lps - induced maturation of dcs in cocultures, because there was no change in cd80, cd83, and cd86 expression . These results suggest that mscs exert a strong inhibitory effect on the differentiation process from monocytes to idcs but not on the lps - induced maturation of idcs to mature dcs (mdcs). In addition, mdcs cocultured with mscs show a diminished expression of hla - dr, cd1a, cd80, and cd86, thus suggesting that mscs may push mdcs toward an immature state with a reduced stimulatory capacity (figure 2). Additionally, mscs affect the secretion of several cytokines that are key to dcs maturation . Aggarwal and pittenger observed that mscs inhibit the secretion of tnf by dcs activated by lps . The inhibition of tnf secretion by dcs inhibits their maturation, migration to the lymph nodes, and their capacity to stimulate alloreactive t lymphocytes, because of the alteration in the expression of several receptors that are necessary to capture and process antigens . Mscs also inhibit the dcs secretion of il-12 [15, 47, 48]. The insufficient production of il-12 is associated with the induction of t cell anergy and tolerance [15, 26, 47]. Human bm - mscs that act through notch can induce the differentiation of cd34 hematopoietic progenitors into a population of regulatory dcs with specific properties: (1) the expression of high levels of il-10 mrna and low expression of il-2 mrna; (2) the capacity to inhibit alloreactive t - cell proliferation and function; and (3) the capacity to induce tregs differentiation characterized by expression of foxp3 and tgf1 mrna (figure 2). Nk cells are important in innate immunity and participate in the body's defenses against infections and cancer . Nk cells perform their effector function through the secretion of cytokines, such as ifn, tnf, and gm - csf, and possess cytotoxic activity both spontaneous and antibody - dependent . Nk function is regulated by the equilibrium of signals transmitted by activator and inhibitor receptors that interact with specific hla molecules on target cells . Thus, hla - class i negative or hla - class i - mismatched cells represent potential targets of nk cells [27, 50]. Mscs affect the phenotype, proliferation, cytotoxic potential, and cytokine secretion of nk cells (figure 2). When activated by il-2, nk cells secrete ifn, but when activated in the presence of mscs, ifn secretion significantly decreases . Furthermore, nk cells activated by il-2 and alloantigens in the presence of mscs show diminished proliferation and lytic activity [16, 51]. Il-15 is another cytokine that promotes the proliferation, survival, and effector function of nk cells, but through factor secretion, mscs can inhibit il-15 induced proliferation . However, mscs and nk cell contact are necessary to inhibit nk cytotoxicity in tumor cell lineages . Few studies have analyzed the effects of mscs on b lymphocytes; however, mscs diminish b - cell proliferation by cell cycle arrest in the g0/g1 phase and not by inducing apoptosis . A recent study demonstrated that effect of msc on b lymphocytes proliferation with cpg is not direct and requires presence of cd3 t cells . Mscs can also affect b - cell differentiation because igm, igg, and iga production are diminished [5356]. Furthermore, mscs modify the chemotactic properties of b lymphocytes, because expression changes in their chemokine receptors including cxcr4, cxcr5, and ccr7 were induced by mscs . The first molecules described in the msc - mediated immunoregulation of alloantigen - activated t lymphocytes were tgf1 and hgf . Both cytokines can independently diminish alloantigen - activated t lymphocyte proliferation, although proliferation can be partially reestablished through blocking with antibodies [20, 31]. Tgf1 is involved in the msc - mediated generation of cd4cd25foxp3 tregs (figure 1) and in the decreased proliferation of nk cells . These results suggest that tgf1 and hgf, in addition to other mechanisms, participate in the suppression of msc - mediated proliferation in mixed lymphocyte culture (mlc). Ido is an enzyme that catalyzes the conversion of the amino acid tryptophan to kynurenine . The inhibition of t lymphocyte proliferation is because of the exhaustion of tryptophan or the build - up of kynurenine . Thus, the addition of exogenous tryptophan has been shown to reestablish alloantigen - activated t - cell proliferation in the presence of mscs . Similarly, the addition of kynurenine to mlc inhibits proliferation without mscs, however such inhibition is lower when compared with that observed in cultures in the presence of mscs . The use of competitive inhibitors of ido reduces msc immunosuppressive effects on alloantigen - activated cd4 t lymphocytes . Notably, the reestablished proliferation does not reach the levels observed in mlc without mscs, thus suggesting the presence and participation of additional mechanisms . The exhaustion of tryptophan by ido participates in the inhibition of th17 differentiation; however, this mechanism and the build - up of kynurenine are involved in the ido generation of foxp3 tregs . Furthermore, ido is involved in the decrease of proliferation and cytotoxic activity of nk cells activated by il-2 in the presence of mscs and also in the inhibition of maturation and functional activity of dcs (figure 2). Pge2 is a lipid mediator derived from the conversion of arachidonic acid to prostaglandin through cox1 and cox2 enzyme action . These enzymes, with pge2, are constitutively expressed by mscs, although their expression increases in an inflammatory environment [14, 17]. Pge2 has been shown to diminish proliferation, stimulate the secretion of il-4 and il-10, and promote cd4cd25foxp3 and il-10ifncd4 tregs differentiation (figure 1) [25, 59]. Several studies have shown that pge2 is a msc effector molecule; synthesis can be blocked with indomethacin or ns-398, and activated t - cell proliferation increases, but not similar to levels observed of t - cell proliferation in absence of mscs [14, 17, 32, 60]. Pge2 is involved in the decrease of differentiation of monocytes into dcs and the decrease of proliferation and cytotoxic activity of nk cells activated by il-2 in the presence of mscs (figure 2). It has been reported that il-10 is expressed by human and murine mscs and that tlr3 ligand increases the il-10 secretion by human mscs . However, other authors have showed that murine [16, 63] and human mscs do not express il-10 . Despite these conflicting results, some studies have reported a high concentration of il-10 in the supernatant from cocultures of fetal or adult mscs and immune cells and their participation in the immunosuppression by mscs in such cocultures have been well demonstrated . In that regard, some authors have showed that cell - to - cell contact between bm - mscs and t cells appears vital in the concentration increase of il-10 in the supernatant [24, 38, 64]. Participation of il-10 in bm - msc - mediated immunoregulation and in tregs generation has been demonstrated through the use of antibodies [17, 20]. Il-10 downregulates th1 cytokine expression and can stimulate the expression and secretion of hla - g5, which is another important molecule in mcs - mediated immunoregulation . A recent study reported an increase in immunosuppressive capacity of cd4cd25 tregs cocultured with bm - mscs, which is due to a high expression of pd-1 on tregs stimulated by il-10 present in the coculture supernatant (figure 1). Furthermore, il-10 is also involved in the decrease of maturation and function of dcs, inhibiting the ability of dcs to produce il-12 (figure 2). Hla - g molecules are nonclassic hla molecules characterized by a limited allelic polymorphism and a tissue - specific expression pattern . There are membrane - bound isoforms (hla - g1, g2, g3, and g4) and soluble isoforms (hla - g5, g6, and g7). Bm - mscs express the membrane - bound isoform hla - g1 and the soluble isoform hla - g5 [28, 30]; expression of both molecules is promoted by il-10 . Similarly, hla - g5 stimulates the secretion of il-10 in a positive feedback loop . The simultaneous use of antibodies against both molecules nearly reestablishes proliferation of alloantigen - activated pbmc in the presence of mscs [28, 67]. Direct contact between mscs and t cells is required to establish the positive feedback loop and subsequent generation of an immunosuppressive environment, which is further exacerbated by the generation of the cd4cd25foxp3 tregs induced by both molecules (figure 1). Galectins participate in the regulation of cellular homeostasis in both adaptive and innate immunity as immunostimulators or immunosuppressors . The silencing of galectin-1 expression using sirna or antibodies reestablishes proliferation of pbmc activated by mitogens or alloantigen, thus indicating that galectin-1 participates in msc immunoregulation . Similarly, mscs express galectin-3, a molecule known to regulate t - cell proliferation, adhesion, and migration . The inhibition of galectin-3 expression in mscs with sirna reduces immunosuppressive capacity on alloantigen - activated t lymphocytes . The authors observed that mscs express higher levels of galectin-9 in an inflammatory environment, and through the use of antibodies, the authors described the participation of galectin-9 in the msc - mediated proliferation reduction of stimulated t and b lymphocytes [73, 74]. The following membrane molecules participate in msc - mediated immunoregulation: the pd-1/pd - l1 pathway, hla - g1, jagged-1, and adhesion molecules, such as intercellular adhesion molecule 1 (icma - i) and vascular cell adhesion molecule 1 (vcam - i) (figure 1). Pd - l1 (b7-h1/cd274) and its receptor (pd-1/cd279) are components of a t lymphocyte costimulatory pathway that releases inhibitory and regulatory signals upon activation . The pd-1/pd - l1 pathway is activated in the event of a persistent antigenic stimulus, as occurs with self - antigens, chronic viral infection, or tumors . The activation of this pathway prevents autoimmunity and directly contributes to the immunosuppressive microenvironment observed in tumors through t - lymphocyte regulation . In murine models and human msc from pl, uc, and bm [34, 65, 77], it has been observed that ifn induce an increase of pd - l1 expression and has been demonstrated the participation of pd - l1 in msc - mediated immunosuppression of t cell proliferation through the use of monoclonal antibodies [29, 75, 76]. Future studies will be necessary to determine the participation of pd - l1 expressed on mscs in the expression of foxp-3 in t cells . Interestingly, an increase in the expression of pd - l1 receptor (pd-1) has been observed in activated cd4cd25 tregs cocultured with bm - mscs, which is associated with a high immunosuppressive capacity . The same increase in pd-1 was observed in cd4cd25 t cells, but in contrast with tregs, it is associated with apoptosis [65, 77]. Demonstrated that the reduced proliferation in anti - cd3/cd28-activated t lymphocytes in the presence of mscs derived from bm or fetal liver was primarily driven by cell - to - cell contact and that mscs expressed higher levels of hla - g1 in coculture . Furthermore, the use of antibodies specific to this molecule nearly reestablished t lymphocyte proliferation and reduced concentration of il-10 in cocultures, which shows the relevance of cell - to - cell contact . Similar studies have reported the importance of cell - to - cell contact between mscs and t cells in such mechanisms [24, 38, 64]. It appears that cell - to - cell contact in cocultures promotes expansion of cd4 t cells which produce il-10 and increase the expression of cd210 (il-10 receptor, subunit a) on cd4 t cells but not on cd8 t cells and mscs . These results suggest that through cell - to - cell contact between mscs and t cells a population of t cells whose secreted products contribute to the immunoregulatory environment generated by mscs is formed (figure 1). The participation of the adhesion molecules icam - i and vcam - i has been demonstrated using antibodies against both adhesion molecules, which are expressed by mscs during t - cell immunoregulation . When icam - i and vcam - i were blocked in a mouse model, anti - cd3-activated splenocyte proliferation was partially reestablished . Additionally, the expression of icam - i and vcam - i increased when mscs were exposed to ifn . These results suggest that mscs increase the capacity to recruit inflammatory t - lymphocyte populations and modulate its own function toward a regulatory phenotype as was demonstrated in the th17 population . Furthermore, adhesion molecules could be involved in t - cells immunoregulation through induction of ctla-4 expression on t cells, which has been previously demonstrated [79, 80]. Our laboratory recently demonstrated that cell - to - cell contact between activated cd3 lymphocytes and mscs from bm or ucb increased the expression of ctla-4 (figure 1). Through different mechanisms it has been demonstrated that interaction between ctla-4 with cd80/b7 - 1 and cd86/b7 - 2 expressed in dc induces ido upregulation by dc . It is likely that a similar mechanism is present in cd4ctla-4 t cells generated in cocultures with msc [24, 37, 38]. This idea is supported by several evidences; activated t cells express cd80 and cd86, in particular the presence of msc induces increased expression of cd86 on cd4 t cells, and it has been shown that the interaction of these molecules with ctla-4 induced ido expression in cd4 t cells . The cell - to - cell contact between mscs and cd3 t cells is important in the immunosuppresion of b cells by mscs . This evidence suggest that inhibition of b - cell proliferation observed in cocultures with msc is dependent of soluble factors produced during cell - to - cell contact between t cells and mscs . Another molecule involved in the inhibition of t lymphocyte proliferation is jagged-1, a notch ligand . Because jagged-1 is expressed in mscs suggests that notch signaling is involved in msc immunosuppressive functions . Showed that when jagged-1 was blocked by antibodies, the mscs inhibitory effects were decreased on a population of alloantigen - activated cd4 lymphocytes . Many studies suggest that mscs and immune cells have established two - way regulatory mechanisms; thus, the activation of msc immunoregulatory properties requires the presence of derived proinflammatory cytokines from immune cells . Similarly, as a result of this activation, factors secreted by mscs also regulate immune response . Broad evidence demonstrates that this activation requires the presence of proinflammatory cytokines derived from t lymphocytes, macrophages, and nk cells, thus indicating that there are bidirectional regulatory mechanisms between mscs and immune cells . Cytokines, such as ifn, are necessary in this process, either alone or in combination with tnf, il-1, il-1, or il-17 [14, 17, 85] (figure 2). The importance of an inflammatory environment for msc immunosuppressive capacity has been shown both in vitro and in vivo . The initial experiments indicated that when exposed to ifn, mscs induce the expression of ido [13, 17] and pd - l1 and increase the secretion of pge2 [14, 60]. Similarly, the conditioned medium of msc- and il-15-activated nk cell cocultures can inhibit nk - cell proliferation, which indicates that this coculture activates msc immunoregulatory properties . Other studies have shown that nk cells can produce ifn when they interact with mscs (autologous or allogeneic), and msc exposure to ifn increases the expression of hla - i in mscs, which reduces the secretion of cytokines and cytotoxic activity of nk cells (figure 2). This evidence suggests that bidirectional regulatory mechanisms drive the interaction between mscs and nk cells . Mscs express nk receptor ligands, such as pvr, nectin-2 (nam-1 ligands), and ulpbs and mica (nkg2d ligands). Because of these receptor - ligand profiles, it is likely that the interaction of nk cells and mscs (autologous or allogeneic) results in ifn production by nk cells, whereas this exposure of mscs to ifn increases hla-1 expression in mscs and other immunoregulatory molecules, thereby reducing the secretion of cytokines and nk cytotoxic activity . In addition to the abovementioned cytokines, a recent study reported that il-17 together with ifn and tnf increased inhibition of t - cell proliferation mediated by mscs, apparently through a synergic effect of the three cytokines, leading to a high expression of inducible nitric oxide synthase (inos). Recently suggested that mscs are not fully immunoprivileged because of their capacity to activate cells of the immune system (nk cells, macrophages, etc .) And may even be rejected by such immune cells . Thus, resting mscs are immunogenic and able to promote the secretion of inflammatory cytokines, which in turn induce msc to express and secret distinct immunoregulatory molecules, allowing them to evade the immune response . In this regard, it has been demonstrated that nave mscs or primed previously with inf plus tnf are able to decrease t - cells proliferation . However, nave mscs induce the secretion of inf and il-2 by activated t cells at two days of coculture and this is a cellular event prior to inhibition of proliferation . The authors suggested that unprimed msc transiently induce proinflammatory cytokines secretion, which promote the increase of their immunoregulatory capacity . In vivo studies in mouse models suggest that mscs are effective in the treatment, but not prevention of gvhd . The highest survival rates were obtained when mscs were administered when serum ifn concentrations peaked . The injection of mscs preactivated with high concentrations of ifn was effective in gvhd prevention and resulted in 100% survival . However, the injection of mscs with low concentrations of ifn did not increase survival . The administration of mscs to patients with steroid refractory gvhd significantly improved patient outcomes [89, 90]. However, when mscs were administered simultaneously with hematopoietic stem cells (hsc), there was no change in grade ii / iv gvhd incidence and a high incidence of relapse . Toll - like receptors (tlrs) are expressed by many immune cells, and their principal function is to detect pathogens . The activation of tlrs is essential to initiate an innate immune response and supports the adaptive immune response . Ten tlr types have been identified in humans and each recognize specific molecular patterns associated with bacterial, viral, or fungal pathogens . The signaling pathway common to all tlrs is the activation of nf-, which controls the expression of several inflammatory cytokines and the expression of maturation markers . Mscs express tlr-2, 3, 4, 5, 6, 7, and 9, which are all functional (except tlr-9) because its activation results in receptor internalization and the activation of the nf-, mapk, and akt pathways [62, 84, 94]. An in vitro population enriched with alloantigen - activated cd4 lymphocytes cultured in the presence of poly(i: c) or lps - treated mscs, activated tlr-3 and tlr-4 in the mscs, thus inhibiting their immunosuppressive capacity . Contradictory results by opitz et al . Showed an augmentation in immunosuppressive capacity after tlr-3 and tlr-4 activation in mscs, which continued to inhibit t - cell proliferation, even in low msc: t cells ratio in cocultures . These contradictory results can be explained with additional evidence from tomchuck et al . Who observed that tlr-3 activation in mscs supports the activation of the anti - inflammatory cytokines il-10 and il-12, whereas tlr-4 activation supports the secretion of proinflammatory cytokines . These results were corroborated by waterman et al . Who reported that tlr-3 supported msc immunosuppressive effects, whereas tlr-4 supported proinflammatory effects . These authors proposed that mscs could be polarized to one of two phenotypes: proinflammatory or anti - inflammatory . Each msc population may possess unique characteristics and differ in their secretion of cytokines, differentiation capacity, extracellular matrix deposits, tgf1-signaling pathways, and expression of jagged, ido, and pge2 . A recent study demonstrated the secretion of proinflammatory cytokines by mscs upon activation of tlr-3 or tlr-4 . Similarly, most literature describing the molecules that participate in immunoregulatory mechanisms are specific to bm - mscs [8, 13, 14, 16, 17, 20, 28, 31, 32, 38]. Few studies have used other sources such as pl [24, 76, 9799], ucb [24, 60, 98], uc [34, 98, 100102], at [8, 99, 101103], and wj [8, 98, 99, 101, 104] (table 1). Immune cell studies that have used mscs derived from pl, at, ucb, wj, placental villi, amnion, and chorion have focused principally on t lymphocytes, one of the most studied cell types in msc immunoregulation [8, 24, 76, 97, 101103, 105111] (table 2). The search for alternative sources is particularly important not only because obtaining bm is expensive and invasive, but also because of reports that msc differentiation capacity diminishes as the individual ages [112, 113]. Some reports have compared the immunoregulatory properties of mscs from different sources to determine which is the most viable for bm replacement . In this regard, our research group has demonstrated that mscs from bm and ucb, have identical immunoregulatory capacity . However we have shown, in the same way as other groups, that in contrast to bm - mscs, pl - derived mscs have a lower capacity [24, 107]. In fact, results relating to pl are contradictory between groups [76, 97, 99, 108]. In this regard, results of a preclinical study for treatment of 9 patients with grades iii - iv acute gvhd with pl - mscs showed complete and partial recovery in two and four patients, respectively . The inconsistency of the results observed in clinical application of pl - mscs could be related to the inconsistent results obtained in vitro by various groups . A different study comparing uc-, ucb-, pl-, and wj - derived mscs observed differences in the capacity to express hla - g or tgf1 after activation with ifn. There were no differences observed in ido secretion . Screening for immunosuppressive factors in wj- and bm - mscs activated with ifn or tnf has indicated differences in the postactivation secretion of ido, hgf, and pge2, which may influence immunoregulatory properties . It is important to pursue comparative studies to determine whether mscs from alternative sources operate with the identical immunoregulatory mechanisms as bm - mscs, which are used in cellular therapy . These studies will be vital in determining alternative sources of mscs for their potential implementation at the clinical level . The use of stem cells to replace cells and tissues damaged by congenital or degenerative disease or trauma is called stem cell therapy . In such procedures, we previously outlined that mscs have three biological properties that make them potential candidates for this use: high differentiation potential, trophic factor secretion, and immunoregulatory capacity . Mscs are potentially applicable to many diseases, such as gvhd, autoimmune diseases and bone, cartilage, and cardiovascular diseases . The beneficial effects of mscs administration regarding several of the aforementioned diseases have been analyzed in animal models and phases i, ii, and iii clinical studies have been initiated [115, 116]. In the following sections, we focus on the use of mscs in the treatment of immune - associated diseases with special emphasis on the treatment of gvhd . Because of their immunoregulatory properties, bm - mscs have been applied principally in hsc transplants because mscs are capable of treating and preventing gvhd [89, 117119]. After hsc transplant, gvhd presents when donor t lymphocytes recognize patient hla molecules (alloantigen) as nonself and mount an immune response (allogeneic immune response). Gvhd can be acute or chronic depending on the time of onset and intensity of tissue damage . Acute gvhd (agvhd) appears within the first 100 days of the transplant, whereas chronic gvhd (cgvhd) has a later onset . Although the exact pathophysiology is unknown, three phases are believed to describe agvhd onset: (1) the activation of host antigen presenting cells (apcs) by the transplant conditioning regimen (radiotherapy and/or chemotherapy); (2) the activation of t lymphocytes, which proliferate and differentiate in response to histoincompatible antigens presented by apcs; and (3) a cellular effector and inflammatory phase . The final phase is a combined effect of different sectors of the immune system (cytotoxic t lymphocytes and nk cells) and inflammatory cytokines (ifn, tnf, il-1, etc . ), which together promote inflammation and tissue damage in various organs and can cause death . The first clinical trial evaluating the safety and effectiveness of mscs in the treatment of gvhd was performed by frassoni et al . Who observed that the coinfusion of hsc and nonirradiated mscs from the identical donor reduced the incidence and severity of gvdh in recipients of an allograft from an hla - identical sibling . Subsequently, le blanc et al . Reported the case of a 9-year - old boy with steroid refractory agvhd grade iv who was treated with haploidentical mscs from his mother . Approximately 70 days after treatment, the child had renewed symptoms of diarrhea and high levels of bilirubin . The administration of a second dose of mscs significantly improved the patient's condition, and he remained stable throughout the following 100 days . After this case, the identical group reported another study with the administration of mscs to 8 steroids refractory gvhd grades iii - iv patients . No toxic effects were observed, and survival was significantly improved compared to the control . In a multicenter phase ii study of 55 steroid a response was observed in 39 patients treated with mscs, of which 30 recovered completely and 9 partially recovered . Survival was significantly improved in patients experiencing full recovery, and the mortality rate was significantly lower than that generally associated with the transplant . The authors suggest that the effect of the mscs was independent of the donor because mscs of hla - identical, haploidentical, and incompatible siblings had similar results . Von bonin et al . Treated 13 patients with steroid - refractory agvhd with different doses of mscs (15 applications) from unrelated donors that had been expanded in medium with platelet lysate . Only 5 patients responded to treatment and only 4 were alive after 257 days of treatment . Similarly, mller et al . Reported the treatment of 5 children with acute or cgvhd . Mscs doses were increased in accordance with cell availability from 0.4 10 to 3.0 10/kg . In addition, it has been suggested that the cotransplant of hsc and bm - mscs may prevent gvhd, but there is a high rate of relapse . However, a clinical trial with 37 children treated with multiple doses of bm - mscs for steroid - refractory grades iii - iv agvhd reported complete response in 24 children and partial response in 8 children . The contradictory results may be because of differences in the method of msc expansion, the number of cells administered, number of doses given, diagnosis of the recipient (chronic or agvhd), stage of gvhd development, and administration of mscs, among others . In attempts to eliminate some these variables, clinical studies have been performed with a universal bm - msc preparation, such as prochymal, which has rendered positive results in the treatment of gvhd . Additionally, the effects of using alternative sources of mscs, such as fetal membranes or uc, have been studied . Reported that, in steroid - refractory gvhd patients after msc infusion, a high frequency of cd4cd25cd127foxp3 and tr1 populations was detected . A decrease of th17 cells and no changes in the number of nk or b cells were observed . Furthermore, the authors suggest an induction and maintenance of tregs, because high levels of il-2 were detected . In another similar study an increment of cd8cd28 and cd5cd19 populations and decrease of cd8cd28 and cd5cd19 b cells after bm - msc infusion in the responsive group the first two populations of t and b cells are related with the maintaining of peripheral tolerance or the induction of differentiation of tregs . Similar results were obtained recently in 23 refractory cgvhd patients treated with mscs in which it was detected an increment in the population of cd19cd5il-10 b cells and a high plasma concentration of il-10 . It is important to mention that it has been suggested that changes in the immune microenviroment in patients may promote the risk of infections . In this regard, a retrospective cohort study showed that treatment of gvhd with msc is a risk factor for pneumonia related death . Furthermore, remberger and ringdn reported treatment with msc increment incidence of invasive fungal infections . Finally, randomized phase iii trials are necessary to determine the effectiveness of mscs in gvhd . Msc immunosuppressive capacity may be useful in the treatment of autoimmune diseases . In these pathologies, self - antigens are not tolerated, and the body mounts an immune response against its own tissues and organs . The resulting damage can be systemic (systemic lupus erythematosus) or targeted to a specific organ or tissue, such as the pancreas (type i diabetes), central nervous system (multiple sclerosis), or joints (rheumatoid arthritis) [131133]. Animal models have demonstrated that msc treatment is effective in some of these conditions, several of which have also been clinical trials, as described below [132, 133]. Systemic lupus erythematosus (sle) is a chronic autoimmune disease that affects connective tissue . Clinical studies using allogeneic bm - mscs and uc - mscs [135, 136] to treat this disease have described positive outcomes and no severe side effect . In a multicenter study, 40 sle patients were intravenously transplanted with uc - mscs and total or partial clinical response was observed in 60% of patients . The beneficial effect of uc - msc administration is not permanent, because 29.2% of patients relapsed . Although these results are interesting, it is important to mention that in the future a controlled and randomized study will be necessary to conclusively demonstrate the effectiveness of ucb - msc administration for sle treatment . Although the mechanism through which msc improves patient condition is unknown, li et al . Reported increase of cd4cd25foxp3 tregs in peripheral blood of refractory sle patients transplanted with uc - mscs, even after one month of treatment . Additionally, a significant decrease of th17 cells since the first week and up to twelve months after transplant was observed . Also, wang et al . Detected an increase in ido activity after administration of uc - mscs in sle patients, evidenced by kynurenine concentrations . These results suggest participation of immunoregulatory mechanism regarding beneficial effects of msc administration in such patients . On the other hand, some reports have shown that bm - msc administration in murine model of sle do not decrease the levels of autoantibodies or the mortality rates . Furthermore, using the same animal model, you d et al . Reported that administration of allogeneic bm - mscs to prevent or treat sle enhances autoantibody production and even exacerbates the disease in both experimental conditions . Also, a study carried out in two patients showed that administration of autologous bm - mscs increased peripheral blood cd4cd25foxp3 tregs cells, but no improvement was observed in patients . Today, there are no clinical trials in progress to assess efficacy of msc transplantation in the treatment of lupus erythematosus [http://www.clinicaltrials.gov/]. Type i diabetes is a chronic metabolic disease characterized by an autoimmune reaction against insulin - producing pancreatic cells . In vitro studies using cocktail of growth factors or genetic manipulation have shown that bm - mscs can differentiate into insulin - producing cells . However, such transdifferentiation capacity of bm - mscs into endocrine pancreas cells in animal models has yielded contradictory results and still remains elusive . Nevertheless, in animal models have been demonstrated that mscs can revert type i diabetes, enhances insulin secretion and sustain normoglycemia . It has been proposed that such beneficial effects are mainly due to trophic factors and immunoregulators secreted by mscs and not to their differentiation capacity . In a clinical trial, the administration of insulin - producing cells derived of mscs from adipose tissue in 11 patients reduced insulin requirements over the first 2 to 4 months after intraportal infusion . In another trail, wj - mscs were administrated to 15 patients and a decrease in insulin requirements and blood glucose levels was observed even after 24 months of follow - up . However, it is thought that msc immunoregulatory capacity prevents the destruction of the -pancreatic cells rather than their differentiation capacity to regenerate cells . In that regard, intravenous administration of bm - mscs in a murine model of type 1 diabetes reversed hyperglycemia and improved pancreatic regeneration, which is associated with an increase of cd4cd25foxp3 tregs cells in spleen and pancreatic lymph nodes . Similar results were obtained by intraperitoneal administration of mscs from at - mscs in mouse models, during early development of induced type i diabetes . Increased secretion of insulin and decreased glucose levels in peripheral blood were observed but also inflammatory infiltrate in pancreatic islets . Furthermore, a low frequency of cd4ifn and cd4tnf t - cells was observed in pancreatic lymph nodes (plns), and in contrast, a high frequency of cd4cd25foxp3 tregs, a decrease of ifn concentration and increase in tgf1 were observed in pancreatic tissue . Additionally, cotransplantation with bm - mscs improves engraftment of pancreatic islets in humanized diabetic mouse model . Normoglycemia was maintained during 4 weeks after transplant which show that mscs promote functionality of transplanted islets . The authors observed low infiltration by cd3 t cells in the transplanted tissue and increase of cd4cd25foxp3 tregs in peripheral blood . Future clinical trials will be required to determine if such immunological mechanisms also occur in humans . Currently, phases i, ii, and iii clinical trials are evaluating the efficacy of autologous bm - mscs [clinicaltrials.gov identifier: nct02057211, nct01068951, nct01157403] and uc - mscs in the treatment of type i diabetes [clinicaltrials.gov identifier: nct01374854]. Two autoimmune diseases affect the central nervous system (cns): multiple sclerosis (ms) and amyotrophic lateral sclerosis (als). Ms is a chronic inflammatory disease characterized by the loss of myelin and axon damage . Several studies have demonstrated in murine models that msc has positive effects for prevention and treatment of both pathologies, but it is not known what mechanisms are involved in such process . Although in vitro studies show that, in the appropriate culture medium, mscs differentiate into cell types with neuronal and glial characteristics, contribution of such mechanisms for in vivo tissue regeneration is controversial . In contrast, in vitro and in vivo studies have suggested that immunoregulation and trophic factor secretion are the main mechanisms used by mscs to improve the symptoms of ms and als [1, 147]. Studies in a murine model with experimental autoimmune encephalomyelitis (eae) as a model for multiple sclerosis have demonstrated that the intravenous administration of bm - mscs improved the symptoms of the disease by decreasing central nervous system inflammation and demyelination . Other studies have reported that, in eae mice that had received mscs, less infiltration by cd3 t cells and macrophages in csn was observed after pathological analysis . Also, it has been detected low levels of il-17 and tnf in serum . Observed that intravenous or intrathecal administration of bm - msc promotes generation of cd4foxp3 in cns and also an increase of il-17 mrna . Furthermore, after administration of huc - mscs in a murine eae model, the improvement of disease activity is accompanied by an increase of cd4cd25foxp3 tregs and decrease of th17 in spleen, while in the spinal cord increased il-4 and il-10 and decreased il-1 and il-6 levels were observed . Taken together, these results suggest that immunoregulation by mscs has a neuroprotector effect that reduces demyelization and axonal loss and therefore results in the improvement of eae symptoms . It is important to mention that in a recent study it was reported that bm - mscs transplanted in a murine eae model, cd8 t cell infiltrate was increased in cns, which exacerbated eae . The difference between these results could be due to disease mechanisms that underlie various models of eae . Similarly, allogeneic mscs administration in murine models of experimental als showed an improvement in survival and motor function, in the spinal cord from msc - treated mice . Intrathecal infusion of bm - mscs in a murine model of als delayed disease progression and prolonged survival . Activated microglia secrete inflammatory molecules including tnf and nitric oxide that play an important role in als and administration of hmscs decrease microglial activation (cd11b cells) and concentration of tnf in the spinal cord . Based on the positive results obtained in murine models, clinical trials have been carried out to determine safety and efficacy of mscs for the treatment of these pathologies . A clinical trial in which 34 ms and als patients received intrathecal or intravenous autologous mscs reported that msc administration was safe and had an immediate immunosuppressive effect that diminished inflammation . A study by mazzini et al . Studied the direct application of autologous mscs to the spinal cord in als patients and reported that msc administration generated no adverse side effects and was safe; however there was no significant improvement in patients . Currently, no study has shown an improvement in patient's condition by msc treatment; therefore, further clinical trials must be performed . Several of such studies, analyzing the efficacy and safety of autologous or allogeneic mscs for the treatment of ms and als, are in progress [http://www.clinicaltrials.gov/]. Rheumatoid arthritis (ra) is a chronic, systemic inflammatory disorder that primarily affects joints and results in bone and cartilage destruction . Collagen - induced arthritis (cia) initiated in susceptible strains of mice by immunization with native type ii collagen serves as a model of human rheumatoid arthritis . Several authors have used this animal model to analyze msc efficacy to improve the symptoms of this disease; however evidence remains equivocal as conflicting results have been reported . Results in this animal model suggest that inflammatory microenvironment present in ra could reverse the immunosuppressive capacity of mscs . Observed that msc administration does not improve the course of disease and in vitro experiments showed that tnf was responsible of reverse biological function of mscs . Additionally, it has been reported that the intravenous administration of mscs has no effect on the progression of the disease or make ra worse . Similar results were reported by papadopoulou et al . Who observed immunoregulatory capacity of mscs in vitro, but in vivo, they lost this capacity when they are administrated in the inflammatory ra environment . In a recent study similar immunosuppressive capacity by synovium - derived mesenchymal stem cells (s - msc) from ar both mscs are capable of decrease proliferation of pbmc activated with pha or alloantigens from healthy donors and also of autologous synovial t cells activated with pha . However, when cocultures are added with exogenous il-17 and/or tnf, s - mscs from ar patients or healthy donors, they lost their immunoregulatory capacity . In addition, it has been reported that infusion of allogeneic - related hla matched or partially matched mscs does not affect ra development, while mhc mismatched mscs exacerbate the disease activity . In contrast to these results, other studies have shown that administration of syngeneic, allogeneic, or xenogeneic mscs improves ra in mice models . Thus, gonzlez et al . Showed that intraperitoneal administration of human at - mscs in mice with cia reduced the incidence and severity of disease . Improvement of ra is accompanied by a decrease both in inflammation and proinflammatory cytokine secretion (il-1, il-12, il-17, tnf, ifn, etc .) And reduction in th1 and th17 numbers . In addition, in a ra murine model induced by antigens, intra - articular infusion of bm - mscs prevented cartilage damage reduced the inflammation and also decreased serum concentration of tnf . A few studies have been done to determine safety and efficacy of mscs administration to humans for the treatment of ra . A study carried out in four patients with refractory ra and treated with allogeneic mscs from bm (1 patient) or uc (3 patient) administered intravenously showed no adverse effects; however clinical remissions were not detected . In contrast, a clinical assay with 172 patients with active ra showed that uc - msc administration is safe and that the improvement in patients is accompanied by an increase of cd4cd25foxp3 tregs in peripheral blood and a decrease of tnf secretion . Two phases i and ii clinical trials are currently performed to evaluate the efficacy of uc - mscs [clinicaltrials.gov identifier: nct01547091 and nct01985464]. Bm - derived mscs have an immunoregulatory capacity because they can regulate the function of multiple immune system components . To fulfill this role, mscs must be activated by proinflammatory cytokines such as ifn. Mscs can inhibit dcs maturation and thus prevent the activation of t lymphocytes and even more and decrease the proliferation and cytotoxic activity of nk cells . As a result of these characteristics, mscs are a promising alternative treatment for immune - related diseases . Currently, mscs have been used in the treatment of autoimmune diseases, including gvhd, and have rendered positive results . Despite this encouraging debut in clinical application, it is necessary to perform more clinical trials that extend the current knowledge of the biology of msc immunoregulatory activity to optimize and control the patient's immune response for maximum benefits . These studies will be relevant to clinical decisions in the treatment of gvhd, autoimmune diseases, and other illnesses with an immune component, such as cancer, in which mscs play an important role in the tumor microenvironment that favors growth as our group has previously demonstrated.
Carpal instability is broad category consisting of various patterns of injury, with dissociative type more common . A 13 -year -old boy presented at 6 months following a fall with restriction of wrist movements . Patient had sustained a closed distal one -third both bones fracture forearm fixed with k -wire, and volar lunate instability was found during sequential follow -up . Posttraumatic carpal instability should be identified at the earliest to avoid poor hand function and morbidity associated with it . Carpal instability and its biomechanics have always been evolving due to the advancement in the field of radiology and arthroscopy . Lunate plays a pivotal role and acts like an intercalated segment in carpal stability, loss of anchorage of this key structure cause intercalated segment instability . Volar intercalated segment instability (visi) is a less common manifestation of dissociative carpal instability . A 13-year - boy had sustained distal one - third radius and ulna fracture after fall on an outstretched hand . Open reduction and k - wire fixation was performed for both bone fracture forearm (fig . 2). He noticed restriction of dorsiflexion of wrist, while other movements normal . Serial x - rays showed a loss of normal alignment of radio - lunate in comparison with the opposite (fig . 3, 4). Serial radiographs during follow - up showed a volar facing lunate with alteration of scapholunate and lunatocapitate angle and was diagnosed with a volar intercalated lunate instability (fig . The patient was put on strict rehabilitation protocol and the dorsiflexion improved from 0 - 10 to 0 - 40. at 1 year follow - up patient is still having restriction of dorsiflexion (fig . (a) post - operative radiograph of right wrist posterior - anterior and (b) lateral view showing reduced distal one - third radius and ulna fracture with implants in situ . (a) radiograph of wrist posterior - anterior and (b) lateral view at 2 months with uniting distal one - third radius and ulna fracture . (a) radiograph of both wrist posterior - anterior view left and (b) right showing union of distal one - third of radius and ulna . Loss of gilula arc with flexed scaphoid suggesting carpal instability at 6-month follow - up . (a) radiograph of both wrists lateral view left and (b) right at 6 month follow - up showing volar facing lunate with loss of carpal alignment . (a) radiograh of right wrist at 1 year follow - up, post - anterior view and (b and c) lateral views, (a) showing healed distal one - third radius and ulna fracture, signet ring sign of scaphoid and moon like appearance of lunate . (b) volar facing lunate with loss of alignment between radius, lunate and capitate . (c) reduction in the scapholunate angle (16) and increased capitolunate angle (40). (a) clinical photograph at 1 year follow - up showing reduction of dorsiflexion (0 - 40) and (b) normal palmar flexion (0 - 80) of wrist . Carpal instability should be considered as a differential in patients presenting with chronic wrist pain and restricted movements following trauma . Classified carpal instability into four categories and lunato - triquetral ligament is involved in stage three which leads to volar lunate instability . Visi is a condition in which there is pathologic volar flexion of the lunate, with or without a similar posture of the other proximal row carpal bones . Posttraumatic volar lunate instability is an entity that can be missed during the initial traumatic event because of its subtle nature . Posttraumatic carpal stability diagnosed at the earliest avoids advanced surgical procedures such as reconstruction and fusion of joint . Lunate instability in plain radiograph can be diagnosed with the alteration of various angles namely the loss of scapholunate angle, loss of alignment between the lunate, capitate and radius and increase in the capitolunate angle . Treatment options include from closed reduction and k - wire fixation, dorsal capsulodesis, tenodesis, arthroscopic or open repair with reconstruction and finally arthrodesis . This injury could be subtle in nature before reduction and fixation that led to delay in diagnosis or iatrogenic in nature after reduction of the fracture . Wrist function is a complex interaction of various biomechanics involving the carpal bones, ligaments, and the distal radio - ulnar complex . Awareness of carpal instability associated with fractures or injuries around the wrist is needed by the treating surgeon to avoid delay in diagnosis and treatment . To suspect visi following a wrist injury and also following reduction with k - wire fixation . Follow - up of patient at regular intervals to prevent morbidity due to this deformity.
Preeclampsia is a disorder affecting 5 to 10% of pregnancies and is clinically characterized by new - onset hypertension and proteinuria . Despite significant progress in our understanding of preeclampsia, there is a need for a reliable diagnostic biomarker for use in clinical practice . In the search for a biologically plausible biomarker, there have been attempts to reconcile clinical findings with pathologic changes in renal biopsies of preeclampsia . For example, renal pathology of preeclampsia in the kidney is classically described as endotheliosis, or swelling of endothelial cells in the glomerulus . The podocyte, a specialized visceral epithelial cell that lines and forms the slit diaphragm of the glomerular basement membrane, has traditionally been thought to be unaffected . However, more recent microscopic studies demonstrate that podocytes are structurally changed and harbor protein resorption droplets . Furthermore, there is evidence that selected podocyte - specific proteins such as nephrin, synaptopodin, and glepp-1 are downregulated in preeclampsia, while vegf and flt-1 are increased [2, 3]. Studied the use of podocytes in the urine (podocyturia) as diagnostic markers and found podocyturia to be highly sensitive and specific for preeclampsia . We sought to study the use of podocyturia to diagnose preeclampsia and differentiate it from other conditions that may have a similar presentation in a high risk pregnancy population . Furthermore, podocyturia was found frequently in other high risk pregnancy states such as chronic hypertension and gestational diabetes . We recruited two groups of patients all 18 years of age: uncomplicated pregnant subjects (control group) and women at risk for pregnancy complications (high - risk group) as described below from the obstetric inpatient service at jacobi medical center, bronx, ny, usa . Random urine samples inclusion criteria for high - risk group were diagnosis of preeclampsia, chronic hypertension (htn), gestational htn, type i and type ii diabetes mellitus (dm), gestational dm, mixed connective tissue disease, and pregnancies with fetal chromosomal abnormalities . Exclusion criteria were patients under the age of 18 and absence of the above - mentioned diagnosis . Inclusion criteria for the control group were uncomplicated pregnancies and deliveries and absence of the above - mentioned high risk pregnancy states . Exclusion criteria for the control group were <18 years of age, preexisting high risk pregnancy states or complicated deliveries . Diagnosis of preeclampsia fulfilled the criteria of new onset of htn with blood pressure of 140/90 mmhg after 20 weeks of gestation and proteinuria of> 300 mg of protein in a 24-hour urine specimen or 1 + protein on a urinalysis sample without evidence of another cause, such as urinary tract infection or inflammation . Chronic htn was defined as preexisting htn or blood pressure of 140/90 mmhg before 20 weeks of gestation . Gestational dm was defined as any degree of glucose intolerance with onset of first recognition during pregnancy . This study was approved by the internal review board of albert einstein college of medicine . Urinary protein was quantified either from a 24-hour urine sample collection or extrapolated from a random urine dipstick . For example, when only a dipstick urine protein was available, the value was extrapolated to a 24-hour value based on the following: negative protein corresponds to less than 150 mg/24 hours, trace protein corresponds to 150 mg/24 hours, 1 + corresponds to about 200500 mg/24 hours, 2 + to 0.51.5 g/24 hours, and 3 + to 25 g/24 hours . Twenty ml of freshly voided urine was centrifuged at 700 g for 5 min . The sediment pellet was carefully recovered by aspirating the supernatant, washed twice with pbs and resuspended in 1 ml of pbs . Aliquots of 100 l of the resuspended sediment were centrifuged onto slides using the shandon cytospin 4 cytocentrifuge (thermo electron corporation, asheville, nc), air - dried and fixed with 1: 1 acetone / methanol for 10 minutes . The slides were immersed with pbs/1% h2o2 for 15 minutes and washed with deionized water . Subsequently, antigen retrieval was achieved by steam - heating in a solution of citrate buffer, ph 6.0, for 15 minutes and blocked with 10% horse serum in pbs and 2% bsa . Slides were incubated overnight with monoclonal mouse antihuman synaptopodin antibody at 1: 1 dilution (gift of dr . Peter mundel, massachusetts general hospital, boston, ma) followed by horse anti - mouse igg at 1: 1000 dilution (dako inc . Sections were then incubated in avidin - biotin complex at 1: 25 dilution (vector labs, burlingame, ca) and developed using diaminobenzidine (dab) as chromogen . Difference in clinical variables between more than two groups was determined by kruskal - wallis method, differences between two groups were determined by mann whitney method . Analyses were performed with stata version 8.2 and graphpad prism version 5.02 for windows software, and results were considered statistically significant if p <0.05 . For test characteristics of podocyturia, sensitivity, specificity, positive predictive value, and negative predictive value were calculated for each high risk diagnosis . The diagnoses at time of urine collection were as follows: preeclampsia (n = 28), eclampsia (n = 1), chronic hypertension (n = 3), gestational hypertension (n = 6), type i dm (n = 1), type ii dm (n = 1), gestational dm (n = 4), connective tissue disorder (n = 1), marginal previa (n = 1), chromosomal anomaly (n = 1), and uncomplicated pregnancy (n = 9). The clinical characteristics of all subjects are described in table 1 . Podocyturia (figures 1(a) and 1(b)) was present in 11 out of 29 (38%) patients with preeclampsia / eclampsia, 3 out of 9 (33%) with chronic and gestational htn, and 3 out of 6 (50%) with gestational dm and type i / ii dm (table 2). Among patients categorized as, 2 (marginal previa and chromosomal anomaly) out of 3 patients exhibited podocyturia (66%). In contrast, 0 out of 9 patients (0%) with uncomplicated pregnancies demonstrated podocyturia . Based on these findings, we calculated the sensitivity and specificity of podocyturia for preeclampsia to be 38% and 70%, as compared to women of htn of any type, in whom it was 33% and 66%, respectively (table 3). The sensitivity and specificity for dm of any type were 50% and 68%, respectively . The positive predictive value was 57% for preeclampsia, as compared with 15% for both htn of any type and dm of any type . The negative predictive value, however, was poor for preeclampsia at 51%, as compared with 83% and 91% for htn of any type and dm of any type, respectively . Podocyturia is well described in many glomerular diseases such as type i dm, iga nephropathy, lupus nephritis, and membranous nephropathy [5, 6]. Though endothelial injury is thought to be the main lesion in preeclampsia, more recently, derangements of the podocyte with downregulation of selected podocyte - specific proteins in renal biopsies and presence of nephrin and podocalyxin (podocyte specific proteins) in the urine have been described [2, 7]. In this study, we sought to describe the presence of podocyturia in preeclampsia and other high risk pregnancy states using the podocyte marker synaptopodin for identification . Though the exact reason for this discrepancy is unclear, immunofluorescent staining of podocyte - specific proteins, in general, does not appear to be an accurate tool to identify podocytes, as these podocytes may be parietal in origin and may also be apoptotic . Thus, the utility of urinary podocytes to detect ongoing glomerular damage in women with preeclampsia as previously suggested is unclear . Furthermore, our study showed presence of podocyturia in other high - risk pregnancy states such as dm (gestational or type this finding is not unexpected since podocyturia and urinary podocyte mrna have been described in nonpregnant diabetic patients and in nonpregnant hypertensive patients respectively . Interestingly, the number of urinary podocytes has also shown a statistically significant correlation with blood pressure but not proteinuria in preeclampsia . Though podocyturia might help shed light on the pathophysiology of preeclampsia, we feel that its clinical utility is limited . Both cytospin methods (as was performed in this study) and cultivation of podocytes in culture are fraught with difficulties and are not cost - effective . It may not be easy to eliminate podocyte cell debris when counting podocytes from cytospin specimen of fresh sediment . Growing urinary podocytes in cell culture, on the other hand, are frequently limited by bacterial or fungal contamination as the urine may not have been collected under sterile conditions . Furthermore, these cells may proliferate, undergo apoptosis, or not attach to the culture dish, thereby falsely representing the true podocyte count . Interobserver bias poses yet another obstacle as it requires a highly trained cytologist to correctly identify these cells . Since clinical guidelines are available to diagnose preeclampsia, some have questioned whether the addition of a urinary marker is necessary . We feel that the utility of this marker becomes important when the diagnosis of preeclampsia is in question and when the clinical scenario is complicated by the presence of preexisting htn, dm, or other glomerular diseases such as lupus nephritis . In those cases, thus, a specific marker that is discovered through our understanding of the pathophysiology of preeclampsia remains crucial . Our goal was to confirm the previously shown high sensitivity and specificity of podocyturia in preeclampsia . Though a larger sample size would be ideal, we feel that of our total sample size of 56 with 29 patients diagnosed with preeclampsia / eclampsia, and 18 patients with other high - risk diagnoses, is an adequate sample size to demonstrate that podocyturia lacks sensitivity and specificity to be a diagnostic marker of preeclampsia . We discovered that podocyte loss is present not only in preeclampsia but in other high risk pregnancy states . In addition, podocyturia was not found in a majority of patients diagnosed with preeclampsia . However, our findings raise an important note of caution of relying on the limited findings in the literature regarding the predictive value of podocyturia in preeclampsia and encourage larger studies . Given our current knowledge of the complex pathophysiology of the disease such as the significant role of vascular endothelial growth factor (vegf) signaling in maintaining a healthy endothelium and cross talk between the podocyte and vascular endothelial cell, it is unlikely that any single test or cell type will be able to predict preeclampsia.
Illness is a challenge to our physical, psychological and spiritual wellbeing that has repercussions on our identity and our social context . In a pathogenetic approach, diagnostic tests are used to look for the underlying disease and treatments are aimed at removing it . A person is considered cured when the disease is no longer detectable and agreed parameters have normalised . However daily clinical practice is characterised by people who suffer from chronic illness where there is often a discrepancy between their biochemical results and the way they feel . Good or even normal parameters do not necessarily correlate with a good perceived state of health, and vice versa . Health is therefore a concept that goes beyond the absence of disease to include physical, mental and social wellbeing . Salutogenesis, developed by antonovsky in the 1970s, looks at what generates health by exploring the reasons why some people stay healthy in the face of hazardous influences whilst others, faced with the same hardship fall ill . Antonovsky s research shows how adverse events and stress can become the opportunity to generate health if certain personal characteristics are present . Resilience to difficult situations depends on a person s sense of coherence (soc), a global orientation towards life that is based on self - reliance in the face of challenges, self - confidence in one s ability to deal with demanding events and the trust that difficult events hold meaning for one s life [2, 3]. There is a growing body of research on all age groups [46], different socioeconomic backgrounds and across cultures that shows how a strong soc is related to better health, healthier ageing [812] and is a protective factor against alcohol addiction despite similar rates of recreational consumption in teenagers . Conversely, a weak soc is related to poorer health and lower mood [4, 5]. Although soc develops naturally in the first 30 years of life it is not a static orientation . It can be strengthened through personal activity and care [4, 14]. A dynamic, personally driven element that can change through activity and care it is not the absence of hardship or disease that determines health but our ability to deal with them positively and assign meaning to them . Health is not a steady state, effortlessly maintained once it has been achieved, but an active process of continuous adjustment, a subtle equilibrium between our physiological, psychological and spiritual integrity and the outer or inner influences that can strengthen or undermine this . The concept of health as a state of complete well - being advocated by the declaration of alma ata, becomes health as the ability to adjust and self - manage in the face of physical, emotional or personal challenges . A salutogenetic healthcare system needs to be oriented in such a way that illness is considered an adverse event that can become the foundation for better future health . Methods need to be adopted that allow the ill person to be treated in all their characteristics and in context . Each medical intervention should aim to strengthen soc and a person s physiological, psychological and spiritual resilience . The increasing prevalence of chronic diseases, the very different but constant environmental challenges faced by people in the developing and developed world alike, provide us with constant salutogenetic opportunities . Person - centred medicine (pcm) takes into account the physical, psychological and spiritual aspects of a person in health and illness in order to individualise health promotion practices, diagnosis and treatment . It broadens the technological advances of biomedicine with the epistemological approach, the relationship - based care and the salutogenetic treatments of non - conventional medicine . Complementary and alternative medicine (cam) and traditional medicine (tm) are grouped together as cam / tm or non - conventional medicine (ncm). The term includes a variety of different medical systems and healthcare methods whose roots lie in different philosophical backgrounds and cultural origins . Although very different from one another, they all share a holistic view of the human being as a physical, psychological and spiritual entity . They value the complexity of natural phenomena and study the relationship between the human being and nature in health and illness . Their treatment systems are based on knowledge, skills and practices that restore health and encourage the self - healing abilities of the human being . They advocate respect for the dignity of every person and promote responsibility for keeping healthy at individual and community levels . This holistic, person - centred, salutogenetic approach is the reason for the growing interest in all forms of ncm by patients and healthcare workers alike . Salutogenetic healthcare practices are personalised using the principles and methods of person - centred medicine . In salutogenetic healthcare the caregiver - person relationship each professional role needs to be developed to provide salutogenetic care from as early as undergraduate training . In order to have a person - centred approach, technological proficiency, solid grounding in evidence - based medicine (ebm) and knowledge of international protocols need to be complemented by knowledge of the epistemological systems and practical tools of ncm . Doctors and other healthcare workers are then encouraged to the use their clinical judgment as the final decision - making tool . Clinical judgment is central to the role of the doctor and their professionalism and can be strengthened and developed to become an accurate decision - making tool . This complements the application of ebm and protocols, which are based on large numbers and therefore not always applicable to particular cases . Following protocols ensures a basic standard of care that has lead to improvements in safety on a large scale . However following them automatically can lead to repetitive, monotonous practice which in turn can lead to errors as well as frustration and dissatisfaction both on the part of the healthcare worker, who feels like a generic cog in a smooth machine, and the patient who does not feel personally addressed . On the contrary, assessing and treating each person in their physical, psychological and spiritual uniqueness, encourages active personal involvement on the part of the both healthcare worker and the patient . The use of sound clinical judgment allows personalisation of guidelines and protocols to each case . Moreover, learning and teaching about salutogenetic practices may mean that healthcare workers adopt healthier lifestyles for themselves . Greater work satisfaction and active involvement strengthen a healthcare worker s resilience and soc, ultimately improving their health as well as that of their patients . With this person - centred method, any treatment is chosen as the result of an informed choice that takes all aspects of the person into consideration . For any therapeutic process to become a salutogenetic experience, physical as well as psychological, social and personal factors need to be addressed at the appropriate time with attentive care to the physical emotional and spiritual needs of the person . The patient needs to be able to rely on the doctor or the team who take responsibility for their treatment and recovery . During rehabilitation or at other times during the process there may be a chance to bring the experience to greater consciousness, to explore the reasons that led to the event and the things that could be changed in order to prevent similar episodes from happening again . All this works towards developing an awareness that overcoming this difficult experience was meaningful because it allowed the development of new life skills, new coping strategies, and new confidence in one s own healing abilities . This change needs to be sustained over time with appropriate follow - up as habits are difficult to change and may slip if they are not followed closely and encouraged over time . In order to evaluate the success of medical interventions broadened with a salutogenetic approach, parameters need to be developed and integrated into the current evaluation systems . They need to have a suitable epistemological basis, a methodological approach that considers the value of small numbers, individual cases and clinical judgement . Salutogenetic parameters such as the quality of life of patients and caregivers, sustainable change, treatment satisfaction, job satisfaction and prevention of burn - out need to be assessed as well as cost - effectiveness and technological excellence . Health education is both a therapeutic intervention and the key form of disease prevention in salutogenetic healthcare . It should take place at population levels, in primary care, in hospitals, as part of any rehabilitation process, in schools and families . Environmental obstacles that prevent people from adopting healthy lifestyles should be removed as far as possible . The ottawa charter advocates the implementation of eight conditions that should underlie any change in health . These are peace, shelter, education, food, income, a stable eco - system, sustainable resources, social justice, and equity . At the same time, individuals need to be encouraged to actively increase control over their health in order to improve it . To reach a state of complete physical, mental and social well - being, an individual or group must be able to identify and to realize aspirations, to satisfy needs, and to change or cope with the environment . Encouraging locally sourced, high quality foods, encouraging biodiversity and fair - trade, has positive effects on the sustainability of primary resources and the stability of the eco - system as well as people s health . In order to be adopted by individuals in their lifestyles, there should be variations between the diet of a child and that of an elderly person, of an office worker compared to that of a builder, the diet of someone who suffers from inflammatory illnesses compared to that of someone who suffers from cancer, the diet of the same person when they are well or ill . If diet were a better used resource in healthcare and people were taught its principles and practical applications, this may decrease the need to use medication in some cases . Altered sleeping patterns, eating rhythms and patterns of physical activity are both a measure and a cause of pathology and health . Variable shift workers have a higher degree of stress, of alcohol misuse and increased use of neuroleptic drugs compared to their colleagues with regular working patterns . Many others have altered eating rhythms as they skip meals, or constantly pick at food during the day . It is important for people to become aware of their own biorhythms, which alter with age, gender, state of health, personal and constitutional characteristics . With the help of education, improved environmental conditions and appropriate care during illness, people can adjust or at least compensate for altered biorhythms and therefore actively improve their health . Chronic stress can strengthen or weaken a person depending on how strong or weak their resilience and soc are . Chronic stress has been shown to be greater risk factor for developing ischaemic heart disease than hypertension or hypercholesterolaemia . Emotions can have adverse effects on the incidence of complication and prognosis during an acute event . Apart from reducing known risk factors and encouraging positive emotions, we can strengthen emotional resilience and soc through artistic activity in the form of painting, music, dance, drama, creative writing . A study carried out in sweden showed how music therapy improved quality of life and soc in a group of elderly people . Through artistic activities people learn new skills and their achievements have a positive effect on their self - esteem . This can be applied to overcome future challenges or unknown life - situations with strengthened soc . The initial steps towards a salutogenetic healthcare reform, are to broaden undergraduate training and to develop pilot projects in the fields of health promotion and salutogenetic rehabilitation . The person and the caregiver - person relationship needs to be placed at the centre of the therapeutic process through the principles of person - centred medicine both in education and in practice . Caregivers need to be given the tools to consider the person in all their aspects and characteristics through the adoption of the epistemological basis of ncm that broadens the technological advances of biomedicine . Medical interventions should not only be aimed at removing the disease but also at improving health by strengthening a person s soc and their resilience at physical, psychological and spiritual levels . Reasons for illness can be explored during rehabilitation . Through health promotion programmes, during rehabilitation, in education, people are taught how to take better care of themselves by adopting individually tailored, healthier lifestyles better suited to their own physiological, emotional and personal needs . Active involvement needs to be encouraged both on the part of the to patient and healthcare giver, the use of clinical judgment needs to be taught . Methods for the scientific investigation of effects on small numbers or single cases need to be included in the evaluation of a person - centred, salutogenetic healthcare system alongside ebm.
Macroautophagy (abbreviated as autophagy) is a genetically regulated and evolutionarily conserved pathway for the degradation of subcellular components [15]. This process involves the de novo formation of cytoplasmic double membrane - bound vacuoles termed autophagosomes, which sequester cytosolic cargo for delivery to the lysosomes [5, 6]. Autophagic cargoes may include various subcellular targets typified by ubiquitin - modified or long - lived proteins and major cytosolic organelles (e.g., mitochondria and peroxisomes) [79]. However, a number of other potential substrates have been identified, including lipids, nucleic acids, reticulocytes, and invading pathogens (e.g., intracellular bacteria, viruses, etc .) [7, 10]. The autophagic pathway proceeds through several defined steps: (i) the initiation phase involving the formation of an isolation membrane or phagophore, (ii) the elongation of the phagophore, (iii) the maturation of an autophagosome with assimilation of a cytosolic cargo, (iv) the fusion of the mature autophagosome to the lysosome, and finally (v) the degradation phase where the contents are digested by lysosomal proteases (e.g., cathepsins) and other hydrolytic enzymes [15] (figure 1). Autophagy has been recognized as an essential function for cell homeostasis and adaptation to environmental stress conditions including nutritional starvation, energy depletion, endoplasmic reticulum stress, oxidative stress, and hypoxia [1114]. Furthermore, autophagy plays a vital role in innate and adaptive immune mechanisms, including resistance to pathogen infections [10, 15, 16]. The role of autophagy in diseases is an emerging area of investigation, with recent studies indicating that autophagy may exert multifunctional roles in specific diseases, with the potential for both adaptive and maladaptive outcomes . Furthermore, deficiency or absence in autophagic function may also contribute to the pathogenesis of human diseases [2, 12, 1719]. The occurrence of autophagy in response to environmental stress, most notably starvation, is generally regarded as a cell survival mechanism [2022]. Due to the often coincident appearance of morphological and biochemical markers of autophagy in cells that are dying, the relationship between autophagy and cell death has been both extensively studied and speculated upon [2326]. Autophagic cell death to describe a form of caspase - independent necrosis - like cell death associated with accumulation of autophagosomes in cells . This classification is now controversial, and the casual relationship between autophagy and cell death remains unproven [25, 26]. Nevertheless, many studies have pointed to intimate relationships between autophagy and cellular death programs, which are not yet fully understood . Recent studies have also examined potential cross - talk between the signaling pathways that regulate autophagy and those that regulate distinct forms of regulated cell death such as apoptosis . The major types of cell death which have been studied most extensively in the context of autophagy research include apoptosis, necrosis, necroptosis, and pyroptosis, as briefly summarized here . Apoptosis denotes a regulated form of cell death that requires the coordinated action of proteases and nucleases within an intact plasma membrane . Morphological characteristics of apoptosis include dna fragmentation, plasma membrane blebbing, cell shrinkage, and cellular decomposition into membrane - bound apoptotic bodies which are removed by phagocytosis [3033]. The cardinal biochemical features of apoptosis include mitochondrial dysfunction, respiratory chain inhibition, loss of inner mitochondrial membrane potential (m), increased mitochondrial membrane permeability, and externalization of phosphatidylserine [3033]. Apoptosis has a crucial function in the maintenance of tissue homeostasis under physiological conditions and also serves as a component of developmental programs and furthermore may also contribute to disease pathogenesis . (mitochondria - dependent) apoptotic pathway represents a major mechanism by which exposure to harmful extracellular stimuli triggers apoptosis . This pathway is dependent on a proteolytic activation cascade for both regulation and execution (i.e., caspases) and subject to regulation by bcl-2 family proteins . The extrinsic apoptotic pathway, which shares common downstream features with the intrinsic pathway, is defined by its dependence on receptor - ligand (e.g., fas - fas ligand) interactions for initiation . Necrosis is a type of cell death that results from acute, accidental, or nonphysiological injury [3033]. This type of cell death is associated with cell lysis as the consequence of membrane damage and subsequent leakage of cell constituents into the extracellular space, which may lead to local inflammation and damage to the surrounding tissue . In certain cases, cell swelling or oncosis may precede necrosis . Necrosis and apoptosis differ in morphological features, though the two processes are not necessarily mutually exclusive . Both apoptosis and necrosis can occur in response to treatment with many injurious stimuli, usually in a dose - dependent fashion . Many agents that cause apoptosis at low to moderate doses may ultimately cause necrosis at relatively higher doses . A number of endogenous events can determine the balance between apoptotic and necrotic death . Cellular energy charge (i.e., atp levels) whereas atp is required for certain steps of caspase activation, rapid decline of cellular atp levels typically leads to necrotic cell death . The existence of necrotic cell death pathways regulated by an intrinsic death program distinct from that of apoptosis has also been proposed . Necroptosis, that resembles necrosis has been described [34, 35]. In this form of regulated necrosis, the ligand binding of death receptors such as the tumor necrosis factor receptor 1 (tnfr1) can promote the formation of a macromolecular complex (necrosome), involving the receptor - interacting protein (rip) kinase-1 and kinase-3 that initiate necrosis [36, 37]. Increasing evidence affirms the relevance of this mode of cell death in the pathogenesis of various diseases [3842]. Pyroptosis represents a form of cell death that is triggered by proinflammatory signals and which is associated with inflammation [32, 43, 44]. This type of cell death occurs primarily in inflammatory cells such as macrophages and may be triggered by bacterial or pathogen infections . Caspase-1 is responsible for the maturation of proinflammatory cytokines such as il-1 and il-18 through inflammasome - dependent pathways cell death occurs as a result of membranous pore formation and cytoplasmic swelling and leakage of cytosolic contents . Similar to apoptotic cells, pyroptotic cells may also display dna fragmentation and nuclear condensation . The molecular machinery of autophagic regulation is the subject of recent reviews [45, 46]. Subsequent to their identification in yeast, a number of critical autophagy - related genes (atg) have been identified whose gene products regulate distinct steps in the induction or progression of autophagy [45, 46]. In brief, the autophagy pathway responds to regulation by nutrient status, including nutrient deficiency (starvation) and loss of energy charge . Starvation induces autophagy through the inhibition of mammalian target of rapamycin (mtor), which resides in a multiprotein complex, mtorc1 . In response to stimulation by nutrients or growth factors, mtorc1 negatively regulates a macromolecular substrate complex that includes ulk1, atg13, atg101, and fip200 (rb1cc1), which results in autophagy suppression [4854]. Energy depletion, which stimulates autophagy, inhibits mtorc1, in part through activation of the amp - dependent protein kinase (ampk), leading to the activation of ulk1, an important initiating step in autophagy [47, 55, 56]. Autophagy is also coregulated by a multiprotein complex consisting of beclin 1 (homologue of yeast atg6), which associates with class iii phosphatidylinositol-3-kinase (vps34) and a number of additional stimulatory or inhibitory coregulatory proteins (e.g., atg14l, uvrag, ambra1, and rubicon). In response to proautophagic stimuli, the increased production of phosphatidylinositol-3-phosphate (pi3p) by this complex regulates autophagosome formation [57, 58]. The beclin 1 complex is subject to negative regulation by the pi3 k / akt pathway as well by binding interactions with antiapoptotic bcl-2 family proteins . Following phagophore formation, the elongation of the autophagosome membrane requires the action of two ubiquitin - like conjugation systems: the atg5-atg12 conjugation system and the microtubule - associated protein-1 light chain 3 (lc3, atg8) conjugation system [61, 62]. Atg4b converts the proform of lc3b to its cytosolic free form (lc3-i). In mammals, the conversion of lc3-i (and other atg8 homologues) to its phosphatidylethanolamine - conjugated and autophagosome - membrane associated form (i.e., lc3-ii) is an initiating step in autophagy [6366]. Once thought to be relatively nonspecific, it is now believed that autophagy is a highly selective process in which distinct cellular mechanisms are employed to identify and target cargo to autophagosomes . Such selective autophagy pathways have been identified for the turnover of mitochondria (mitophagy) and other organelles and the turnover of denatured protein (aggrephagy). During starvation (e.g., deprivation of glucose or growth factors or depletion of cellular energy charge) autophagy prolongs cell survival through the degradation and recycling of cellular macromolecules . Mice deficient in the autophagy protein atg5 are susceptible to the lethal effects of starvation . Inhibition of autophagy by beclin 1 or atg5 knockdown, or by chemical inhibitors such as 3-methyladenine, can promote apoptosis and caspase-3 activation in starved hela cells . These studies have suggested a role for autophagy as a means for prolonging cell survival during starvation . Autophagy performs a cardinal homeostatic function in the removal of damaged or dysfunctional mitochondria, in a selective process referred to as mitophagy . The increased turnover of mitochondria by mitophagy may occur as a result of chemical or physical stress (e.g., hypoxia). Nix localizes in the outer mitochondrial membrane and directly interacts with mammalian atg8 homologs through its lir motif . Damaged or dysfunctional mitochondria are recruited to the autophagosome for removal by mitophagy through a process regulated by the phosphatase and tensin homolog deleted in chromosome 10 (pten)-induced putative kinase 1 (pink1) and parkinson protein-2 (parkin) [9, 69, 70]. Mutations in the corresponding pink1 and park2 genes are associated with recessive familial forms of parkinson's disease . In mice, pink1 and park2 deletions loss of mitochondrial membrane potential and the increased production of mitochondrial reactive oxygen species (ros) may provide initiating signals for mitophagy . Pink1, a transmembrane protein, is stabilized on damaged or depolarized mitochondria . Following the decline of mitochondrial membrane potential, which can be caused by chemical stress, pink1 recruits cytosolic parkin, an e3 ubiquitin protein ligase, to the mitochondria [69, 70, 73]. Parkin ubiquitinates mitochondrial outer membrane proteins including porin, mitofusin, and miro [74, 75]. Ubiquitinated mitochondria are subsequently recognized and targeted to autophagosomes by the autophagic cargo adaptor protein p62 [9, 69, 70]. Autophagy can maintain cellular protein homeostasis (proteostasis) by providing a mechanism for the removal of ubiquitinated protein aggregates, in a selective process termed aggrephagy . Recent studies suggest that autophagy may provide an alternative pathway to proteolysis in addition to the ubiquitin proteasome system [7678]. Aggrephagy requires the selective autophagy cargo adaptor p62/sqstm1 (p62) which can interact with ubiquitinated proteins through a ubiquitin - associated (uba) domain . Furthermore, p62 can interact with lc3 through its lir (lc3-interacting region) motif and thereby facilitate the targeting of ubiquitinated proteins to autophagosomes . The selective autophagy adaptor, nbr1 (neighbor of brca1 gene 1), promotes the formation of ubiquitin - positive protein aggregates, facilitating their sequestration and removal by aggrephagy . This process involves the 400 kda, pi3p - binding autophagy - linked fyve domain protein (alfy), a p62-interacting protein . In addition to mitophagy, other forms of organelle - specific or substrate - specific autophagy have been identified and collectively may contribute to the maintenance of cellular integrity under stress . These include the selective autophagic degradation of peroxisomes, ribosomes, and endoplasmic reticulum fragments . In addition to protein, autophagic processes have been implicated in the degradation of diverse cellular biomolecules, including lipids and rna . Furthermore, autophagy can degrade exogenously derived substrates, most notably bacteria, virus particles, and other parasites, in a selective process termed xenophagy [10, 15, 16]. Although recent studies begin to unravel the role of mitochondrial selective autophagy in cell death pathways, the role of diverse selective autophagy pathways in the modulation of cell death programs remains largely uncharted territory . Despite a widely accepted role for autophagy in cellular survival, autophagy has also been associated with the regulation of various cell death pathways, most notably apoptosis . Thus, autophagy may represent a failed adaptive mechanism that may have prevented death under milder conditions . Hypothetically, excess activation of autophagy may contribute to apoptotic cell death through unchecked degradative processes . Cells undergoing autophagy display an increase in autophagic vesicles (i.e., autophagosomes and autophagolysosomes). The distinctions between autophagy and apoptosis remain incompletely delineated, as the two processes are not always mutually exclusive and may occur simultaneously in the same cell type . Recent studies suggest that factors well known to regulate apoptosis pathways also have the potential to exert regulatory activity on factors that regulate autophagy and vice - versa (figure 2). How these regulatory events, termed cross - talk, are integrated into a mechanism for the determination of cell fate yet remains incompletely understood . Antiapoptotic bcl-2 family proteins, which downregulate apoptosis (i.e., bcl-2) by antagonizing the activity of proapoptotic proteins, can downregulate autophagy . Binding of these bcl-2 family proteins to beclin 1 inhibits autophagy by preventing the association of beclin 1 with the class iii pi3k complex [57, 60]. Bnip3 is a bh3-only protein that can trigger apoptosis by sequestering antiapoptotic bcl-2 family proteins and promoting bax / bad dependent mitochondrial release of proapoptotic mediators . These interactions suggest that autophagy and apoptosis may be coordinately regulated by bcl-2 family proteins . Experimental evidence also suggests that, once activated, apoptosis effector molecules may suppress autophagy; for example, beclin 1 may be cleaved and inactivated by caspases during activation of apoptosis . Further studies suggest that certain atg proteins may play dual roles in autophagy / apoptosis regulation; for example, the autophagic protein atg5 may affect extrinsic apoptosis pathways through interactions with the fas - associated death domain (fadd) protein . Atg5 which regulates autophagy can be subject to calpain - dependent cleavage to generate a proapoptotic truncation product (tatg5). This cleavage product promotes apoptosis by binding to and inhibiting antiapoptotic proteins such as bcl - xl . Recent studies also implicate atg12, the binding partner for atg5 required for autophagosomal elongation, as an effector of the intrinsic apoptosis pathway . Atg12 may bind to and inactivate antiapoptotic bcl2 family proteins (e.g., bcl-2 and mcl-1), through an interaction involving a bh2 motif, and thereby act as a proapoptotic regulator . Recent advances have identified other regulatory targets for caspase regulation among autophagy related molecules; for example, atg4d, a member of the atg4 family of atg8 processing enzymes, has been identified as a substrate for proapoptotic caspase-3 . The autophagic protein atg3 has recently been identified as a caspase-8 substrate, which is cleaved during tnf-induced apoptosis . The antiapoptotic protein cellular flice - like inhibitory protein (c - flip) can act as a negative regulator of autophagy . The c - flip, an endogenous inhibitor of caspase-8 processing and the extrinsic apoptotic pathway, acts to prevent the binding of atg3 to lc3, which impairs lc3 processing . On the basis of what is known about the molecular cross - talk between autophagy and apoptosis it currently remains unclear whether autophagy and apoptosis are coregulated or mutually exclusive processes . Antiapoptotic (e.g., bcl-2) as well as proapoptotic (e.g., caspase-3) molecules can downregulate autophagy by interacting with beclin 1 . Furthermore, other caspase - dependent events have been implicated in anti - autophagy or proautophagy events . For example caspase processing of atg4d is proautophagy, whereas caspase processing of beclin 1 is antiautophagy . The definitive cellular mechanisms that control the decision to embark on each one or both of these pathways in response to specific stimuli remain unclear . Analysis of any single isolated regulatory component (using sirna knockdown for example) for its potential to cross - regulate autophagy and/or apoptosis will be unlikely to answer these questions . Thus, an integrative approach is needed to understand how the entire molecular machinery of apoptosis and autophagy are coordinated to influence cell fate decisions . The p53 tumor suppressor protein is a well studied regulator of cell cycle progression and apoptosis . P53 modulates the expression of bcl-2 family proteins (e.g., bax, bid) and other apoptosis - related gene targets (e.g., apaf1). The nuclear form of p53 targets the expression of dram (damage regulated autophagic modulator), which can stimulate both autophagy and apoptosis . Alternatively, p53 can induce autophagy through the upregulation of ampk, which downregulates the mtor pathway . Recent studies have shown that genetic or pharmacological inhibition of p53 can also activate autophagy and have led to the identification of the cytoplasmic form of p53 as an inhibitor of autophagy . Chemical stimuli known to induce autophagy can promote the proteasomal degradation of p53 . Cellular stimulation with interferon- (ifn-) induces the deacetylation of p53, leading to suppressed bmf expression, reduced complex formation between beclin 1 and bcl2, and enhanced autophagy . Taken together these studies suggest a complex role of p53 in the regulation of autophagy, with opposing roles for the cytosolic and nuclear forms of p53 [98, 99]. Several recent studies, supported by genetic manipulation of the autophagy program, have revealed that in select toxicological models, autophagy may be associated with the promotion of apoptosis . In our recent studies we have found that epithelial cells subjected to cigarette smoke extract (cse) exposure die by activation of the extrinsic apoptosis pathway [100, 101]. Cse - induced cell death involved activation of the fas - dependent death - inducing signaling complex (disc) and downstream activation of caspases (-8,-9,-3). Epithelial cells subjected to cse exposure concurrently responded with increased autophagosome formation and increased processing of lc3b - i to lc3b - ii in epithelial cells [100, 101]. Knockdown of autophagy proteins beclin 1 or lc3b inhibited apoptosis in response to cse exposure in vitro, suggesting that increased autophagy occurred in association with epithelial cell death [100, 101]. Further studies revealed that lc3b may act as a regulatory factor in extrinsic apoptosis in this model . Lc3b was found to engage a complex with fas, the key component of the disc, in a fashion dependent on the lipid raft protein caveolin-1 . Cse exposure caused the rapid dissociation of lc3b from fas, in association with the activation of apoptosis signaling . In conclusion, these results using genetic knockdown experiments have implicated a proapoptotic role for lc3b, in a specialized model of cse - induced toxicity, though the relative role of autophagic activity in promoting cell death in this model remains unclear [100, 101]. It should be noted that cse - induced autophagy may differ from starvation - induced autophagy in that it occurs in the presence of a complex mixture of foreign matter, which may potentially alter the functionality of the autophagy response . Thus, the concept of toxic autophagy may involve altered function, which may be dependent not only on whether its activation is physiological or excessive, but also on the nature of foreign substrates (e.g., complex xenobiotics such as tar or virus particles) and their interactions with autophagosomes . Further examples of coincident autophagy and apoptosis include p53-dependent autophagy through upregulation of dram, which is coincidental with upregulation of apoptosis . Deletion of atg5 was also shown to protect cells from prodeath environmental stimuli; however, the authors attributed this resistance to compensatory activation of chaperone - dependent autophagy, rather than inhibition of macroautophagy per se . These studies raise an important issue in that genetic knockdown of one specific autophagy - related factor cannot establish whether autophagy was protective or not in any context, as downregulation of the target may potentially affect signaling pathways that are independent of autophagy, or alternatively, promote compensatory mechanisms, such as alternate forms of autophagy . The terms autophagic cell death or type ii programmed cell death have been previously used to refer to cell death distinct from apoptosis that occurs in association with increases in autophagosome formation and independently of caspases . Many studies that have implicated autophagy as a cell death effector have been performed on apoptosis - compromised or caspase - deficient cells; for example, cells treated with z - vad - fmk, a general inhibitor of caspases, or with caspase-8 and calpain inhibitors, die essentially by a nonapoptotic pathway characterized by dramatic accumulations of autophagic vacuoles [104107]. Genetic knockdown experiments (e.g., beclin 1) suggest that autophagy contributes to cytotoxicity in these models; however, contrasting studies, also using knockdown of autophagy proteins, have also suggested that autophagy can also protect in the context of nonapoptotic cell death induced by caspase inhibition . In baxbak mouse embryonic fibroblasts (mefs), which cannot activate intrinsic apoptosis, treatment with chemotherapeutic agents results in nonapoptotic necrosis - like cell death accompanied by excessive autophagosome formation . Currently it remains unclear whether the process of autophagy acts as an effector or bystander of caspase - independent necrosis - like cell death, though autophagic proteins likely play an accessory role [25, 26]. Experiments in tumor cells have suggested the possibility of cross - talk between autophagy and necrosis in cells . Autophagy provides a protective function to limit tumor necrosis and inflammation in response to metabolic stress . While autophagy acts to buffer metabolic stress, the combined impairment of apoptosis and autophagy promotes necrotic cell death in vitro and in vivo . Although it remains to be determined what triggers necrosis in tumor cells, it is likely that insufficient atp production to maintain plasma - membrane integrity results in metabolic catastrophe and cell lysis [110, 112]. Autophagy integrates a metabolic feedback system to allow sufficient atp generation to maintain cell viability . Enhanced autophagy by spermidine, a natural polyamine, inhibits loss of membrane integrity and release of chromatin protein high mobility group b1 (hmgb1), a biomarker of necrosis . However, recent consensus agrees that specific genes can regulate necrosis, which is termed necroptosis . The kinases receptor - interacting protein 1 (rip1) and rip3 are key signaling molecules in necroptosis . Published studies have suggested that the treatment with zvad, a caspase inhibitor with broad specificity, induced autophagy and the death of l929 cells; and this death process required rip1, suggesting that autophagy is involved in necroptosis . In several models, autophagy has been shown to regulate necroptosis [116, 117]. In endothelial cells, inhibition of autophagy rescues palmitic acid - induced necroptosis . On the other hand, a recent study has demonstrated that necrostatin-1 (nec-1), a specific necroptosis inhibitor, suppressed not only necrosis but also autophagy . These observations suggest that autophagy may be induced by necroptosis, raising the possibility that cellular stress during cell death may lead to the induction of autophagy . It is tempting to speculate that so - called autophagic cell death may involve elements of necroptosis, though further research will be needed to clarify this relationship, as well as the signaling pathways linking autophagy to necroptosis . Recent observations have revealed a relationship between autophagic proteins and inflammasome - associated proinflammatory cytokine maturation in macrophages [122124]. Inflammasomes are cytosolic multiprotein complexes that constitute a novel inflammatory signaling mechanism and which govern the maturation and secretion of distinct proinflammatory cytokines, such as il-1, il-18, and il-33 . Cytosolic receptors of the nod - like receptor (nlr) family (i.e., nlrp3, nlrp1) interact with accessory proteins to form inflammasome complexes . Nlrp3 interacts with an adaptor protein [apoptosis - associated speck like protein containing card (asc)], which recruits and activates the procaspase-1 by proteolytic cleavage . Proinflammatory cytokine secretion (il-1 and il-18) was enhanced in atg16l1 or atg7 deleted macrophages in response to lps . In contrast, atg16l1 or atg7 deficiency did not affect tnf and ifn- production or nf-b pathway activation in macrophages stimulated with lps . Furthermore, atg16l1 deleted mice displayed increased susceptibility to a murine model of colitis, which could be ameliorated by anti - il-18 therapy . Increased activation of il-1 and il-18 has also been observed in macrophages and monocytes isolated from mice genetically deficient in beclin 1 and lc3b . Cytokine activation in response to lps and atp in wild - type macrophages, as well as the amplification observed in lc3b or beclin 1 deficient macrophages, required the nlrp3 inflammasome pathway [123, 124]. The mechanism by which autophagy deficiency enhanced nlrp3 inflammasome pathway activation involved mitochondrial dysfunction, including the enhanced production of mitochondrial ros and increased mitochondrial membrane permeability transition [122, 123]. The pathway to caspase-1 dependent il-18 secretion in macrophages was inhibited by mitochondrial targeting antioxidants . These experiments suggest that autophagic proteins dampen inflammasome pathway activation by stabilizing mitochondria and/or maintaining mitochondrial quality control through autophagy . In contrast to negative regulation of autophagy by the inflammasome, a recent study demonstrates that autophagy induction by starvation enhances caspase-1 activation and secretion of il-1 and il-18 . It is possible that a distinct type of autophagy induction might differentially regulate the inflammasome pathway . Taken together these studies suggest an important role for autophagic proteins in the dampening of proinflammatory responses, which warrants further investigation in models of inflammatory disease . In addition to confirmed negative regulatory roles of autophagy in inflammasome activation, it has been shown that stimulation of inflammasome pathways can promote autophagosome formation through activation of the gtpase ralb . Furthermore, p62-dependent selective autophagy processes may regulate the turnover and degradation of ubiquitinated inflammasome complexes . Further studies suggest that stimulation of plasminogen activator inhibitor-2 by toll like receptor activation suppresses nlrp3-dependent cytokines activation by promoting the autophagic degradation of nlrp3 . An important and unanswered question is related to whether inflammasome activation and the generation of inflammasome - associated cytokines exert downstream consequences on autophagic processing . Pyroptosis is triggered in inflammatory cells in response to excessive inflammation by caspase-1-dependent processes, leading to release of proinflammatory cytokines (e.g., il-1, il-18, and il-33) from dying cells . Recent studies suggest that macrophages activate autophagy in parallel with inflammasome activation, as a means to delay the onset of pyroptosis . Chemical inhibition of autophagy using 3-methyladenine or inhibition of the atg4 protease resulted in increased incidence of pyroptotic cell death in activated macrophages . The impact of autophagy modulation on the regulation of pyroptosis, and the relevance of these interactions in in vivo models of inflammatory disease and sepsis, warrants further exploration . Autophagy is generally defined as a cellular program that ensures survival under conditions of stress . The ability of autophagy to clear damaged or denatured subcellular constituents such as aggregated protein (i.e., aggrephagy) as well as to maintain mitochondrial homeostasis (i.e., mitophagy) appears to play important roles in the cytoprotective and homeostatic functions of autophagy . Despite the homeostatic roles, autophagy is now recognized to play complex and incompletely understood roles in cell death programs (figure 3). Furthermore, there is considerable cross - talk between the molecular regulation of autophagy and other regulated forms of cell death [2326]. The role of autophagy in diseases is an emerging area of investigation, with recent studies indicating that autophagy may exert multifunctional roles in specific diseases, with the potential for both adaptive and harmful outcomes . Furthermore, deficiency or absence in autophagic function may play a pathogenic role in select human diseases [2, 1719]. Additional studies are needed to define the dynamic equilibrium between autophagy, apoptosis, regulated necrosis, and other modes of cell death in the context of human disease pathogenesis . Furthermore, additional studies are needed to determine the relevance of autophagic regulation of pyroptosis in inflammatory diseases . An increased understanding of these relationships would be essential in the development of therapeutics targeting the autophagy pathway for the treatment of disease.
Koreich in 1981 first reported the case of a 22 year old man diagnosed as hodgkin lymphoma (hl) who developed hypothermia and hypotension during the course of his admission, which resolved only after initiation of chemotherapy . Systemic symptoms are present in a third of patients at presentation and among them fever is the most common followed by night sweats and weight loss . On review of literature, we found 18 case reports with similar finding of hypotension and hypothermia associated with hl . Most of the patients in these case reports developed hypotension and hypothermia after initiation of chemotherapy . Only 3 out of these 18 patients were found to have hypotension at the time of presentation prior to diagnosis . We report the case of a patient who presented with hypotension and hypothermia and was diagnosed initially with septic shock . He was found to have ill - defined liver lesions on the computed tomography (ct) scan which were new on comparison with a recent ct abdomen done for evaluation of nephrolithiasis . The pathophysiology of development of hypotension and hypothermia in patients during chemotherapy or prior to diagnosis remains unexplained . A complex interaction between cytokines, tumor and blood vessels has been proposed as the genesis of such a presentation . A 61 year old man presented to emergency room with history of flank pain on right side, dysuria, urgency and frequency with occasional hematuria for 3 days associated with fever, chills and rigors . 3 weeks before this presentation he was admitted for renal colic and was found to have a new staghorn calculus in the kidney which was managed conservatively with 7 days of oral antibiotics . Review of systems noted a history of 40 pounds weight loss over 3 months, drenching night sweats and occasional low grade fevers for last 3 months . Past medical history was significant for multiple episodes of renal colic secondary to nephrolithiasis treated with lithotripsy several years ago . Social history was significant for 30 pack year history of smoking, occasional alcohol consumption and no substance abuse or high risk behavior . Was noted to be hypotensive with a blood pressure (bp) of 78/49 mmhg and mean arterial pressure (map) of 59 mmhg . The hypotension was new compared with recent admission 3 weeks prior, where the bp readings were consistently above a map of 80 . The hypotension did not correct with bolus of 3 liters of 0.9% normal saline (ns) and in view of his history of dysuria and intermittent hematuria and recent diagnosis of staghorn calculus he was diagnosed with urinary tract infection (uti) leading to urosepsis and septic shock . He was admitted to medical intensive care unit (micu) where he was started on pressor support with norepinephrine and broad spectrum antibiotic coverage with vancomycin and piperacillin - tazobactam . Vitals recorded at presentation were temperature of 97.3f, bp of 78/49 mmhg, map of 59 mmhg, heart rate 80/min, respiratory rate 18/min, spo2 of 98 - 99% on room air . General exam was significant for an averaged sized man in mild distress with mild pallor, no icterus, cyanosis or edema . Labs were significant for hemoglobin (hb) of 9.2 g / dl, mean corpuscular volume (mcv) of 77.6 fl and leukocyte count (wbc) of 5.1 k/l with differential of 77% neutrophils . Liver enzymes showed alkaline phosphatase of 212 u / l, alanine transaminase (alt) 80 u / l, aspartate tranaminase (ast) 96 u / l, total protein 3.6 g / dl and albumin 1.5 g / dl . Urine dipstick was positive for blood (1 +), proteins (30) and glucose (50) and urine microscopy showed 109 rbc and 12 wbc . Two sets of blood culture and urine culture were done prior to starting antibiotics which showed no growth after 5 days of incubation . Ct scan abdomen done at presentation showed numerous ill defined lesions in the liver which were new from the ct scan done 3 weeks before for evaluation of renal colic (figure 1). The study redemonstrated the staghorn calculus with no evidence of obstruction, no radiographic evidence of pyelonephritis or renal abscess . Patient received 2 days of pressor support with norepinephrine drip, following which his blood pressure improved to a map over 70 mmhg, however he continued to have intermittent episodes of hypotension which were managed with frequent boluses of 1000 to 500 ml of 0.9% ns . Interestingly, on day 5 of admission, patient developed increased shortness of breath and became hypoxic . Trans - thoracic echocardiogram done at bedside showed normal ejection fraction and normal inferior vena cava . Patient was diagnosed with fluid overload secondary to frequent fluid boluses and was given one dose of 20 mg i.v . Lasix which led to resolution of shortness of breath . During this entire stay, he continued to have intermittent episodes of hypotension with mean arterial pressure dropping to low 60 s . Colonoscopy and esophago - gastro - duo - denoscopy (egd) done as part of malignancy workup, showed 2 polyps which were diagnosed as tubular adenoma and thick gastric folds with chronic gastritis on histopathology respectively . A liver biopsy was planned after improvement in his overall condition however on day 9 of the hospitalization patient declined the procedure and requested a break from the hospital . Liver biopsy was deferred for a later date and patient was discharged in a stable condition . During this admission 4 blood cultures and 3 urine cultures did not show any growth after 5 days of incubation . He was discharged with oral levofloxacin to complete a course of 14 days of antibiotics for complicated uti . Three days after being discharged from hospital, patient returned to emergency room with similar complaints of acute onset weakness and fatigue and a single episode of fever for which he received a single dose of ibuprofen at home . Vitals at presentation showed rectal temperature of 94.1f, bp of 84/49 mmhg, mean arterial pressure of 60 mmhg, breathing at rate of 18/min, heart rate 59/min and saturating 97% on room air . Patient was readmitted to micu with a provisional diagnosis of urosepsis and was given vancomycin and piperacillin - tazobactam . Blood culture and urine culture done at this time again showed no growth which could support the diagnosis of sepsis . Biopsy of the liver lesions showed extensive lymphocytic and histiocytic infiltrates with abnormally large cells and positive stains for cd15 and cd30 . Bone marrow biopsy also showed areas of residual trilineage hematopoesis with 40% cellularity alongwith several para - trabecular infiltrates composed of large atypical cells including reed - sternberg (rs) cells, in a mixed inflammatory background consisting of small lymphocytes, histiocytes, eosinophils and plasma cells (figure 2). The immuno - histochemical stains were positive for cd15 and cd30 and negative for cd45, cd3 and cd20 . A 100 cell count showed granulocytes (56%), monocytes (1%), eosinophils (6%), erythroid precursors (34%), lymphocytes (2%) and plasma cells (1%). The presence of the characteristic rs cell in a mixed inflammatory background pointed towards a diagnosis of hl . The diagnosis was further confirmed by positive immune - histo - chemical (ihc) stain for cd15 and cd30 along - with negative ihc stain for cd45, cd3 and cd20 . Since no pan - t antigens were missing, the possibility of a t - cell lymphoma was very low . A ct chest for staging did not show any hilar lymphadenopathy . Soon after the diagnosis patient was started on chemotherapy with doxorubicin, dacarbazine, vinblastine . Bleomycin was initially withheld due to unknown pulmonary function in view of patient been active smoker and was added later after pulmonary function test turned out to be normal . After completion of the 1 cycle of chemotherapy the blood pressure started improving to a map of more than 80 mmhg (figure 3). At 6 month follow up the patient continues to be free of any episode of hypotension or hypothermia . Reported the first patient with hl who developed hypothermia and hypotension during the course of admission, prior to initiation of chemotherapy . Since then 18 more cases have been reported with hypothermia as presenting feature and in 8 out of 18 patients, hypotension has also been recorded (table 2). Fifteen out of 18 patients reported in literature had developed these symptoms after initiation of chemotherapy with only 3 patients presenting with hypotension prior to diagnosis . Interestingly, most of the patients described with hypothermia and hypotension have been reported to have liver metastases . To date, the mechanism behind hypotension and hypothermia as isolated manifestations of hl remains unexplained . In our patient though the presentation of the patient was highly suggestive of urosepsis, numerous blood and urine cultures did not grow any microbe which could have explained the cause of sepsis . Moreover treatment with vancomycin and piperacillintazobactam did not lead to improvement in the condition of the patient, essentially ruling out infectious cause and sepsis as the primary cause of hypotension . An increased random and morning cortisol level and tsh / free t4 level ruled out adrenal insufficiency and thyroid involvement respectively . A normal transthoracic echocardiogram demonstrated a normal cardiac anatomy and clinically there were no signs of heart failure . Though orthostatic maneuver was not done in our patient because of his general condition, the absence of correction of hypotension with volume repletion and fluid boluses makes hypovolemia less likely . Blood pressure control is governed by a complex interaction between cardiac, renal, endocrine and nervous systems . Hypotension in cancer patients has long being believed to be secondary to cytokine release from increased macrophage function . The cytokines implicated in causing hypotension are interleukin (il)-1 and il-2, tumor necrosis factor- (tnf-) and interferon- (if-). Although the exact mechanism of tnf- causing hypotension is not clear, it is well known that administration of tnf- leads to production of nitric oxide (no) which is a potent vasodilator and could lead to hypotension . In addition to this, cytokines also cause endothelial damage, a mechanism which is very well defined in patients with sepsis and septic shock . In patients with sepsis infection another important association implicated in this patient is the effect of psycho - neuroendocrine hormones in mediation of no, like melatonin, which has been shown to have counter - regulatory effect on action of free radicals, especially no . We postulate from the above, that the probable cause of hypotension in this patient could be release of cytokines from the tumor especially from liver metastasis, which is an extremely vascular organ . Autonomic dysfunction is a know paraneoplastic syndrome associated with hl which raises the possibility of direct infiltration of hypothalamus or pineal gland by the tumor leading to alteration in neuroendocrine hormones . The loss of inhibition of counter - regulatory effects of these hormones on cytokine regulation could result in macrophage activation and no production resulting in hypotension . Our patient never took any salicylates for his fever which rules this out as a possible cause . Moreover, not all patients reported were taking nsaids before presentation, making this explanation less likely . In conclusion although, further studies are needed in support of this association, we can conclude from this case that the condition responds dramatically to aggressive chemotherapy.
Most conclusive evidences indicate that periodontal disease (pd) is not a conventional bacterial infection but is an inflammatory disease initiated by immune response against a group of microorganisms in susceptible hosts . The consequent uncontrolled inflammation causes destruction of attachment structures, being the most significant reason of tooth loss in adults from different populations . In affected tissues cytokines and chemokines lead to the migration of leukocytes to the periodontal tissues where these cells play an important role in pathogen destruction by releasing mediators in a local inflammatory response [4, 5]. Therefore, these and other mediators have been detected at elevated levels in the gingival crevicular fluid, saliva, and blood, thus being considered acceptable biomarkers for some aspects of pd [3, 6, 7]. Particularly, proinflammatory cytokines such as interleukin-1 beta (il-1) and tumor necrosis factor - alpha (tnf-) have been associated with pd progression and decline after periodontal treatment . These cytokines are released by macrophages after bacterial infection or tissue injury and, in high concentration, stimulate the production and release of other inflammatory mediators . Similarly, il-17 is a proinflammatory cytokine produced by activated th17 cells that induce a distinct profile of effector cytokines which may exacerbate inflammation and tissue damage . In fact, th17 cells were found in human pd as well as il-17 expression in the alveolar bone of these subjects, suggesting a causal link between inflammation and bone destruction . Thus, while proinflammatory cytokines are potent inducers of bone resorption and inhibitors of bone formation, immunoregulatory mediators inhibit such proinflammatory signals and suppress the activation of metalloproteinases (mmps) that mediate tissue destruction in pd . These enzymes are classified according to their catalytic domains or substrate specificity and several studies have associated mmps regulation with pd progression, once the control of synthesis and degradation of extracellular matrix defines levels of periodontal attachment . Moreover, since mmps production is potentiated in inflammatory conditions and these enzymes are related to pd susceptibility, the determination of the levels of inflammatory mediators in gingiva or biologic fluids became good indicators of the patient's periodontal disease status and activity [18, 19]. However, although how the inflammation develops in the gingival tissue of pd patients is largely described, little is known about the progression of this response to the alveolar bone underneath gingiva and how pd affects cytokine and mmps expression in this tissue around the extensive periodontal pocket . Accordingly, the present study focused on the detection of the ongoing inflammatory changes in the bone and neighboring tissues directly affected by the destructive disease in pd patients . Seventeen (17) subjects with no periodontal or systemic diseases (controls) and 18 patients with advanced periodontal disease (pd) from the periodontal clinic of uberaba university at uberaba, minas gerais, brazil, were selected for periodontal evaluation and sample collection . The subjects were submitted to anamnesis, clinical and periodontal exams, as proposed by the periodontal american association . All the clinical profile such as probing deep and clinical attachment was recorded for subjects classification into pd patients or controls (table 1). Informed consents approved by the local ethics committee on human research (protocol number 1230) were obtained from all the volunteers and the study was performed according to the declaration of helsinki, 1964 . Bone biopsies were extracted from patients with advanced pd in which alveoloplasty was necessary before gingival suture, in cases of extraction of teeth with previous extensive periodontal damage . Therefore, the samples were obtained after maxillary or mandibular alveolar ridge regularization, with removal of minimal bone spicule from areas adjacent to the large bone resorption regions of the previously extracted teeth . Biopsies from control group were obtained during extraction of third molars that required osteotomy (n = 17). All samples used for gene expression analysis were first collected in rpmi medium supplemented with 10% of bovine fetal serum for transportation followed by washing in cold saline solution and storage into liquid nitrogen . Samples destined for histopathology study were washed in cold saline solution and fixed in pbs - formaldehyde 10% . Tartrate - resistant acid phosphatase (trap) activity was detected using a leukocyte - specific acid phosphatase kit (sigma aldrich, st . Briefly, samples were decalcified and embedded in paraffin and serial sections of 5 m were placed in glass slides . The sections were stained with trap solution for 1 hour at 37c and counterstained with mayer's hematoxylin . Cells stained dark red to purple with more than three nuclei on the bone surfaces were considered trap and were counted per mm of tissue . Quantitative polymerase chain reaction analysis (rt - pcr) of tnf-, ifn-, il-10, il-4, and the metalloproteinases mmps 1, 2, 3, and 9 mrna expression was performed in the bone tissue samples . Primer sequences were designed using the software oligoperfect designer (invitrogen, carlsbad, ca, usa). Rna was extracted according to the manufacturer's guidelines of rna sv total rna isolation system kit (promega, madison, wi, usa) and the cdna confection was performed with oligodt (promega), dntps, reverse transcriptase enzyme m - mlv rt, and m - mlv buffer (promega) in a pcr thermocycler ptc-100 (mj research, waltham, ma, usa). The sequences of cdna products were amplified in real - time pcr machine geneamp 7000 (applied biosystems, foster city, ca, usa) using the reagent faststart universal sybr green master (rox) (roche, madison, wi, usa) and specific forward / reverse primers at 0.1 g/l . The default pcr condition was 2 minutes at 50c, 10 minutes at 95c and fifty cycles of 15 seconds at 95c, 30 seconds at 58c, and 30 seconds at 72c . Sequence detection software version 1.3 (applied biosystems) was used to analyze data after amplification . Results were obtained as cycle threshold (ct) values, which were normalized using the expression of the constitutive gene -actin, following the equation 2, according to the applied user's bulletin #2, p / n 4303859 (applied biosystems). Biopsies were fixed with pbs - formaldehyde of 10% for 48 h and decalcified in pbs - edta of 0.5 m, during 30 days . Sections (5 m) were stained with hematoxylin and eosin (he) and analyzed by light microscopy . All images were captured with the digital video camera evolution mp 5 (media cybernetics, rockville, md, usa) mounted on a light microscopy eclipse 50i (nikon, melville, ny, usa) using the software image - pro plus (media cybernetics). Morphometric analysis of fibrosis was performed using the imagej software (national institutes of health, bethesda, md). Fibrous connective tissues were stained with picrosirius red and the images were captured at 400 (24 fields / sample) that measured 3705.82 m . A grid with 100 points, each one representing 37.06 m, divided each field . For each sample, 2400 points were analyzed totalizing 90192 m . To calculate the percentage of collagen area, points coincident with stained area were counted . Points were checked by the formula of hally, as described before . For immunohistochemistry, deparaffinized sections were treated with 3% hydrogen peroxide in methanol for 10 min and incubated for 30 min at 90c for antigen recovery . The blocking of the sections was performed using 2% bovine serum albumin incubated for 30 min at room temperature . Afterwards, they were individually incubated with anti - cytokine monoclonal antibodies specific for tgf- (1: 100) (r&d, hopewell, nj, usa) and il-17 (1: 20) (r&d). All antibodies were diluted in 2% bsa prior to use and incubated with the samples for 2 hours at 37c . A secondary step was performed using biotinylated anti - mouse ig, anti - rabbit ig, and anti - goat ig from link system 002488 (dako, carpinteria, ca, usa) for 30 min at 37c . After being washed, the sections were incubated with streptavidin - peroxidase conjugated (dako) for 30 min . The number of positive cells for each cytokine was counted in 20 fields at a magnification of 400, in a predetermined area of 0.091575 mm . Graph pad instat and prism statistical programs were used for analysis (graphpad, san diego, ca, usa). In case of normal distribution, the independent t - test was used while the nonparametric mann - whitney test was used in non - gaussian sample distribution . First, we performed a clinical periodontal examination and an analysis of the status of the volunteers enrolled in the study to better classify the individuals into pd or control group and to verify if these findings could be related to the next evaluations . Data showed that both groups were balanced for gender and were different for age distribution, since chronic periodontitis was more prevalent in older individuals . Regarding tobacco use, 4 patients from pd group were smokers, a habit known to be directly related to pd progression . The probing depth was not different between control and pd group (p> 0.05) since there was extensive clinical attachment loss with gingival recession in pd patients, thus accounting to their classification into the advanced pd group (table 1). Next, to verify if the periodontal and especially the bone tissue adjacent to the areas of extensive bone resorption in advanced pd presented any sign of inflammation, we performed histopathological evaluation of the he stained biopsies . Results showed that control subjects presented a normal aspect of bone tissue with osteocytes and osteoblasts at the edge of bone matrix with no signs of alteration (figure 1(a)). In contrast, samples from pd group presented a focally distributed and mild inflammatory process composed predominantly by mononuclear cells with the presence of lymphocytes and plasma cells, besides a few neutrophils . The bone tissue did not present any significant alteration (figure 1(b)). Then, since osteoclast - mediated bone resorption may be driven by local inflammation, we next aimed to verify if it could be an indicative of ongoing bone damage . In fact, we found increased numbers of trap - positive cells in samples from pd group when compared to controls (figure 1(c)), indicating that the inflammatory process was able to trigger osteoclast differentiation in periodontitis patients . Previous studies from our group showed that advanced pd is characterized by elevated levels of tgf- and il-17 mrna, which may be related to disease progression [13, 21]. Then, in the present study, immunohistochemical analysis revealed that both groups produced tgf- and il-17 cytokines (at protein level) in the periodontium biopsies . Pd subjects presented a slight augment in the density of tgf- positive cells (figure 1(d)) and a significant increase was observed in the number of il-17 positive cells in comparison to the control group (figure 1(e)). Furthermore, since the collagen matrix in the bone and connective tissue of the periodontium are one of main targets in periodontitis destruction, we determined the collagen percentage in the biopsies stained by picrosirius red . Surprisingly, although pd subjects presented microscopic inflammation and osteoclast accumulation suggestive of tissue damage, a higher collagen deposition was found in this group, as observed in figure 1(f). Once bone resorption is a result of the balance between anti- and proinflammatory mediators that may activate tissue destructive enzymes, we assessed the expression of cytokines and metalloproteinases (mmps) in the bone tissue of pd and control samples . The real - time pcr assays revealed that the levels of ifn-, il-10, and il-4 mrna were not altered in the samples of subjects relative to controls (figures 2(b)2(d)). However, there was a strikingly elevated expression of tnf- mrna in subjects with pd compared to control group (figure 2(a)). Importantly, this increase in the inflammatory cytokine tnf- was accompanied by augmented expression of mmp-2 mrna (figure 3(b)) and there was a tendency towards elevated expression of mmp-1 and mmp-9 in pd patients (figures 3(a) and 3(d)). Mmp-3 was not different between the studied groups (figure 3(c), p> 0.05). Furthermore, a positive and significant correlation was observed between tnf- and mmp-2 mrna expression when all the subjects of the study were evaluated together (figure 4, p = 0.0036; rs = 0.6190). Altogether, these data suggested that the local immune alterations that culminate in tooth loss are not restricted to gingiva . The periodontal or bone tissue next to the extensive areas of resorption presents relevant inflammatory findings indicative of periodontitis destruction and progression in susceptible individuals . The data presented in this study obtained from examination of sites close to areas with extensive periodontal damage showed that, as expected, inflammation in advanced pd is not restricted to gingiva . Otherwise, tissues like alveolar bone that is clinically undergoing a resorption process present relevant findings that could be considered inflammatory biomarkers for disease development in susceptible patients . Although predictable, this is the first study that showed the immune response related to periodontitis evolution directly in the damaged bone and neighboring area . Interestingly, our patients with advanced pd presented a number of features characteristics of local inflammation and some of them were smokers, a habit known to be classically involved in pd progression . In spite of this, it did not seem to interfere in the disease spreading to bone tissue, since the inflammation markers analyzed were not differentially expressed by these individuals . As a next approach, we examined whether pd could result in histological changes in the bone resorbing areas close to the large periodontal pocket . Also, this mild inflammation associated with trap cells could be an indicative of microbial presence and an active process of tissue damage, though not at the same extent yet as that observed in the large periodontal pocket, that led to the tooth loss . Corroborating our data, previous studies showed that pathogenic microorganisms might colonize different sites and then spread local inflammation in case of uncontrolled pathogen burden [22, 23]. The integrity of bone tissue depends on the balance between bone formation by osteoblasts and bone resorption by osteoclasts [24, 25]. In this scenario, several proinflammatory cytokines were identified as key molecules contributing to the destruction of periodontal tissue, including il-1, tnf-, ifn-, and il-6 besides rankl [26, 27]. Thus, in view of our results, it is possible that the higher tnf- mrna found in our patients may have acted as an important osteoclastogenic factor by inducing the local osteoclast differentiation that could culminate in bone resorption . We also revealed that the number of il-17 cells was higher in pd regions than in control healthy tissues . Such cells could be cd4, cd8,, neutrophils, natural killer cells, or others [2832]. A previous study demonstrated that patients with chronic periodontitis have th17 cells as well as il-17 expression in inflamed periodontal tissue, indicating the possible involvement of this cytokine in periodontal disease . Indeed, th17 cells could exacerbate inflammatory periodontal disease by inducing metalloproteases or inflammatory mediators by gingival fibroblasts . In this context, our results suggested the involvement of th17 cells in the inflammatory events triggered in the periodontal disease affected areas . Besides, il-17 could be capable of inducing rankl, the main stimulatory factor for the differentiation and activation of osteoclasts in bone inflammatory diseases like rheumatoid arthritis and pd [34, 35]. Then, the higher number of osteoclasts in the areas evaluated could also be related to the presence of il-17 cells . The inflammatory process in pd leads to the degradation of extracellular matrix, mainly collagen, by mmps overproduction that may be induced by cytokines released from resident and inflammatory cells [36, 37]. However, during the healing process that follows inflammation, collagen is also newly produced for extracellular matrix remodeling . Therefore, the increased collagen deposition observed in our patients could result from a repair response to the initial inflammation triggered nearby the extensive bone resorption areas . In fact, the number of tgf- cells was slightly higher in pd group compared to controls . Nevertheless, this cytokine could play a dual role in pd, by controlling inflammation or inducing the differentiation of th17 response [13, 21]. Most strikingly, as discussed before, levels of tnf- were significantly augmented in bone tissue from pd group . As tnf- is important for osteoclastogenesis, it is possible that this factor initiates osteoclast differentiation in subclinical inflammatory process . Also, tnf- is produced in response to periodontopathogens, inducing the microbicidal activity of phagocytic cells, and, in the absence of the subunit p55 of tnf- receptor, mice infected with aggregatibacter actinomycetemcomitans presented less bone resorption and inflammatory response, besides increased number of bacteria . Therefore, the higher levels of tnf- in our pd group could indicate the presence of pathogens in periodontal environment, besides accounting for the higher number of osteoclasts in these patients [40, 41]. During active periodontitis, degradation of gingival connective tissues, mainly collagen, is due to the expression of mmps in situ by inflammatory and resident cells such as fibroblasts and epithelial or endothelial cells [33, 37]. However, the evaluation of mmps directly in the bone resorbing areas adjacent to the large periodontal pocket, as well as their role in the disease outcome, is unclear . Our subjects with pd presented a mild inflammatory infiltration of cells and the expression of mmp-2 mrna was almost five times higher in samples from this group . This local infiltrate could be able to produce mmp-2, based on previous results indicating that tnf- stimulates the secretion of active mmp-2 [42, 43], thus resulting in degradation of collagen types i, ii, and iii . Mmp-2 expression in biopsies of subjects with pd could suggest a possible biological alteration in the turnover of connective tissue and a consequent active ongoing process of bone resorption . Also, the degradation of collagen by mmp-2 could produce peptides important for recruitment of mononuclear and polymorphonuclear cells that could later amplify the inflammatory process . In our study, although we did not evaluate mmp-2 activity in situ, we might hypothesize that the production of tnf- could upregulate membrane type metalloproteinase-1 (mt1-mmp), which is able to activate the latent form of mmp-2, thus breaking collagen in pd sites . Such phenomenon could be confirmed by higher percentage of collagen areas, indicating a remodeling process that follows collagen degradation . Indeed, repeated exposure to low or moderate lps concentration induced augmented cardiac fibrosis along with elevated mmps expression (including mmp-2) in mice heart, thus indicating that a subclinical inflammatory response may be able to trigger tissue collagen response and alter mmps balance . Tissues neighboring large periodontal pockets present inflammatory markers such as il-17, tnf-, mmp-2, and osteoclasts accumulation, which could be predictors of local bone resorption and disease spreading . These results support the importance of a more detailed evaluation of these regions other than gingiva, since the local immune response may represent sentinel factors relevant for disease outcome.
Modafinil, a novel wake - promoting drug has gained immense popularity among psychiatrists in recent times . Now a days, its use is not limited to treat narcolepsy and other sleep wake disorders, but also in chronic fatigue syndrome, treatment resistant depression, attention deficit hyperactivity disorder and cocaine dependency.1) reportedly it has a much lower abuse potential but some have also suggested it to be having a definite potential for dependence.2) here we report a rare case of modafinil dependence who presented with hypersexuality behavior . Till date, only one such similar case have been reported.3) a 35 years male patient was diagnosed with bipolar affective disorder (international classification of diseases [icd]-10 criteria), since last 7 years with four episodes of depression (characterized by low mood, decreased energy, anxiety throughout the day, depressive cognitions, decreased sleep and appetite along with occasional wish to die) and two episodes of mania (characterized by cheerful mood, increased activity levels, decreased sleep to only 3 hours / day, increased appetite, grandiose ideas, over - talkativeness and increased expenditure) along with benzodiazepine dependence (currently abstinent). He presented to our centre seeking treatment for excessive sexual desire and to limit excessive use of modafinil . He was on lithium (600 mg / day), carbamazepine (800 mg / day), venlafaxine (150 mg / day), and lamotrigine (200 mg / day) during this period . Exploration of the history revealed that, he was started on modafinil 200 mg / day (100 mg at morning and afternoon) by a private practitioner four years earlier to improve his fluctuating sadness of mood and early morning lethargy . He would feel active, fresh, and would be able to work better after taking modafinil . Over the next 3 years (2010 to 2012) he started to use modafinil whenever he used to feel low and escalated the dose to 400600 mg / day . Whenever he would not take, he had strong craving for the same, felt low, lethargic, tired, aches and pains in body, decreased confidence and concentration at work . In mid of 2014, inspite of good compliance to above medications, without any apparent stressors, he again started to have persistent sadness, lack of energy and easy fatigability . Because of this, he increased dose of modafinil to 400 mg / day on his own in early morning . After taking modafinil so, over the next few weeks, he increased the dose to 8001,000 mg / day in divided doses . Though there was no improvement in his mood, there was change in his sexual behavior . On seeing any women nearby, he started to have spontaneous erection and feel excited . His frequency of masturbation increased to 1012 times / day, but he would not feel satisfied unlike his premorbid self . In addition to these symptoms, he started interacting with commercial sex workers (csws) on phone, would get aroused by mere talking with them . He would be preoccupied with sexual fantasies and would not be able to concentrate at his work . He tried meditation, increased his frequency of religious activities to get rid of his sexual urges but in vain . Despite being happily married for last 16 years with adequate sexual adjustment he would have increased desire for intercourse with females other than his wife which would further instigate guilt in his mind . His sleep was disturbed with restlessness and anxiety at night and he would feel fatigue throughout the day despite taking high doses of modafinil . His mood remained sad for most part of the day, would not enjoy the day to day activities like before and continued to harbor depressive cognitions . There was no associated history of cheerfulness, grandiosity, hyperactivity, overplanning, increased appetite and decreased need for sleep during this time . Throughout this period there was neither any change in his compliance with medications nor any change in dosage of other medications . And he had been on venlafaxine 150 mg / day since last 2 years under the cover of three mood stabilizers, i.e., lithium, carbamazepine, and lamotrigine with adequate dosages and normal therapeutic lithium level of 0.76 mmol / l . None of previous mood episodes (both depression and mania) had any symptoms suggestive of hypersexual behavior . His sexual behavior during the intake of high doses of modafinil was also not in keeping with his premorbid sexual desire and sexual activity . Detailed evaluation of history did not suggest presence of any head injury in the recent past and presence of any associated impulsivity, obsessive compulsive behavior, substance abuse, hyperorality, cognitive decline, sleep attacks, use of aphrodisiacs and use of any other medications which could increase the sexual desire . With the above available information, a diagnosis of bipolar affective disorder with current episode mild depression (as per icd-10 criteria) along with an additional diagnosis of modafinil dependence and modafinil induced hypersexuality . Physical examination, routine hematological and biochemistry investigations and electrocardiogram were within normal limits . At 8001,000 mg / day of modafinil, he had side effects as assessed by uku scale in areas of psychic (score 9), autonomic (score 3), other (score 9) and global assessment of interference (score 3). He was also rated on hypersexual behavior inventory-19 (hbi-19)4) where he scored 48 . Management included a gradual and slow reduction in dosage of modafinil at the rate of 100 mg every 2 days under the cover of benzodiazepines (clonazepam 2 mg / day) to manage withdrawal symptoms . Mood charting was done to assess development of any mood symptoms . Over 3 weeks period, all the above mentioned symptoms decreased significantly (uku total score 0; hbi-19 total score 19) and he was discharged after being counseled with structured relapse prevention programme on lithium (600 mg / day), lamotrigine (200 mg / day) and venlafaxine (150 mg / day). In literature, we could find only two case reports on modafinil dependence at higher doses.2,5) as seen in the index case, modafinil seems to have some abuse potential . Our case escalated the dose of modafinil so as to overcome fatigue, increase energy and improve concentration . Later on, to overcome the fear of relapsing into depression he increased to a supratherapeutic dosage of 1,000 mg / day and started having symptoms which fulfilled the criteria of hypersexuality disorder (as per kafka s criteria).6) these symptoms were temporally correlated with increment in dose of modafinil and subsided on decreasing the dose of the same in a controlled environment . Hence, as neither any other drug used in the index case could be linked with such kind of behavior nor was there any switch to mania / hypomania / mixed episode which could explain such change in behavior, we concluded that the symptoms of hypersexual behavior was induced by modafinil . Hypersexual behavior during a hypomanic / manic or mixed episode has characteristics of sexual disinhibition, severely compromised self - control, lack of guilt and shame feelings and is generally without any insight . In contrast, index case had guilt associated with his increased sexual desire which is very well reported in individuals with hypersexual behaviour.7,8) modafinil has been found to act by binding on dopamine receptors and affects dopamine uptake by dopamine transporters in the neurons . Modafinil dependence can be explained by its dopamine uptake blockade leading to increase in dopamine concentration in the brain areas linked with reward pathways.9) on the other hand, a hyperdopaminergic state have been implicated in hypersexuality . Upsurge of dopamine in the mesolimbic pathway due to use of supratherapeutic dosage of modafinil might explain for the development of hypersexuality in the index case . Overdose of modafinil can cause insomnia, agitation, tachycardia, rise in blood pressure etc ., but in case of dependence it is more likely to cause physical withdrawal symptoms like lethargy, tremors of hands, anxiety and erratic sleep hours5) or only severe psychological withdrawal symptoms.10) modafinil has been listed under schedule iv drug in united states for regulation of its sale . However, in india, it is available over the counter and being regularly prescribed by many psychiatrists . Inspite of reportedly low abuse potential, we report a case of modafinil dependence and modafinil induced hypersexuality so as to increase awareness regarding this rare side effect of modafinil and for the need of regulation on its sale.
Childhood constipation is a common complaint accounting for 3% of visits to pediatricians and 10 - 25% of visits to pediatric gastroenterologist[13]. Commonly there is no underlying organic cause and the constipation is indentified as functional or idiopathic[4, 5]. Functional constipation is identified by rome iii criteria in children over 4 years old and adolescents having two months of at least 2 or more of the following conditions: 2 defecations in the toilet per week, 1 episode of fecal incontinence per week, history of retentive posturing or excessive volitional stool retention, history of painful or hard bowel movements, presence of a large fecal mass in the rectum, history of large diameter stools that may obstruct the toilet . Children usually are treated with a combination of toilet training, running a bowel diary, and oral laxatives such as paraffin oil . In many patients there are many articles on the efficacy of probiotics in organic and functional gastrointestinal disorders . Probiotics are live microbial food ingredients which are reported to be effective in the treatment of many forms of gastrointestinal disorders[812]. Prebiotic is a selectively fermented ingredient that changes the composition and/or activity of the intestinal microflora and has shown beneficial effects in host's health ., we aimed to determine the therapeutic effect of synbiotics (combination of probiotics containing strains of l. casei, l. rhamnosus, s. thermophilus, b. breve, l. acidophilus, b. infantis, and fructooligo - saccharide as prebiotic) on childhood constipation . The study was performed at children's medical center in tehran, iran, from january to december 2009 . Children with constipation were referred to the pediatric gastroenterology clinic for evaluation and treatment of constipation . One - hundred two children aged 412 years with chronic functional constipation enrolled in this study, were divided into 3 groups by simple randomization method . Exclusion criteria were organic causes for constipation such as hirschsprung's disease, spina bifida occulta, hypothyroidism, cystic fibrosis, neurologic abnormalities and intestinal pseudo - obstruction . These patients were excluded from the study by history and physical examination and rome iii criteria of childhood constipation . The research protocol was approved by the medical ethics committee of tehran university of medical sciences . Label of drugs was replaced by a new label indicating drug a or b. contents of sachets or bottles were not known to the physicians or nurses involved in the study . Group a received 1.5 ml / kg / day oral liquid paraffin plus placebo, group b received 1 sachet synbiotic per day (restore 1x10 cfu/1 sachet, protexin co, uk). Synbiotic combination consisted of probiotic strains containing l. casei, l. rhamnosus, s. thermophilus, b. breve, l. acidophilus, b. infantis, fructooligosaccharide as prebiotic, and placebo . Group c received 1.5 ml / kg / day oral liquid paraffin and 1 sachet synbiotic per day . All patients in the 3 groups received drugs in bottles and sachets with similar shape, taste and color . Frequency of bms, stool consistency, number of fecal incontinence, episodes of abdominal pain, painful defecation per week and side effects were determined in each patient before and after treatment . Success treatment was defined as 3 bms per week, 2 incontinence per month and no abdominal pain . Study design: from seven days prior to study and during the treatment period all children were requested to record frequency of bms, number of fecal incontinence episodes, stool consistency, abdominal pain, painful defecation and effects such as vomiting, diarrhea and oil seepage in a bowel diary . Before starting treatment, all children were examined and patients with fecal impaction received rectal enema (paraffin oil 1530ml / year) once daily for three days in order to accomplish rectal disimpaction . Toilet training consisted of sitting on the toilet 3 times per day for 5 minutes after each meal . Patients were not allowed to use any other kind of medication for constipation during the study period . Clinical efficacy was recorded, patients were seen at the end of 4 weeks, and their charts were reviewed . Outcome measures: primary outcome measures were frequency of bms per week, stool consistency, fecal incontinence episodes per week, presence of abdominal pain, and painful defecation; secondary outcomes were success treatment and incidence of adverse effects such as vomiting, diarrhea and seepage . Stool consistency was rated by the patients as hard, normal or watery . Statistical analysis: data of baseline information were analyzed with the spss (ver . Continuous variables were expressed as mean (sd), and categorical data were shown as frequency and percent . Number of bms and fecal incontinence episodes in baseline information were analyzed by kruskal - wallis test . Change of frequency of bms and fecal incontinence episodes were analyzed by non - parametric paired wilcoxon test . For assessment changes of stool consistency and abdominal pain between baseline and after treatment, the mcnemar test was used . Totally, 102 children (aged 412 years) with chronic functional constipation enrolled in this study and were divided into 3 groups . Five patients were lost to follow - up and remaining 97 patients consisted of 47.4% males and 52.6% females with a mean age of 6.32.1 years . As shown in table 1, no significant differences were found with respect to demographic data and recorded baseline characteristics between the three treatment groups . Characteristics of the patients and the main outcomes are summarized in table 1 and 2 . As shown in table 2, the frequency of bms per week increased in all groups, the highest rise occurring in group c (p=0.03). Improvement in stool consistency and decrease in number of fecal incontinence episodes happened in all groups (p=0.2, p=0.3 respectively) without any statistically significant difference . Also, abdominal pain and painful defecation per week decreased (p=0.6, p=0.9 respectively) similarly and there was no statistically significant difference between groups . No side effects were reported in group b but in group a 18 patients and in group c 21 patients had seepage (p<0.001). Treatment success in group a was 24/29 (82.8%), in group b 22/31 (71.0%) and in group c 28/37 (75.7%) without statistically significant difference between them (p=0.6). New investigations have shown that gut bacterial colonization has an important role in health and disease . There are several hypotheses about the effectiveness of this microbial flora in treatment of constipation . According to some investigations gut microbial flora in chronic constipation is different from that in healthy persons[17, 18]. Short chain fatty acids produced by probiotics reduce colon ph and by this mechanism enhance colon motility and finally transit time will decrease . There are a few rcts about probiotics in the treatment of constipation in children . In rcts study by banaszkiewicz and szajewska it was concluded that l. rhamnosus gg was not an effective adjunct to lactulose in treating constipation in children . Bu et al evaluated the effect of l. casei rhamnosus lcr35 compared to magnesium oxide(mg0).comparisons of the frequency of defecation, consistency of stool and the use of lactulose or enema during the period of treatment were made among the groups . The patients who received mgo or probiotics had a higher defecation frequency, percentage of treatment success (defined as 3 spontaneous defecations per week with no episodes of fecal soiling) and less hard stool . There is no statistically significant difference in efficacy between mgo and lcr35, but less abdominal pain occurred when using lcr35 . In a study by coccorullo et al the beneficial effects of l. reuteri (dsm 17938) in infants with functional chronic constipation was evaluated . Administration of l. reuteri had a positive effect on bowel frequency, even when there was no improvement in stool consistency and episodes of inconsolable crying episodes . For example, in children with constipation defined according to the rome iii criteria, administration of bifidobacteria (b. bifidum, b. infantis, b. longum) and lactobacilli (l. casei, l. plantarum, l. rhamnosus) to 20 children aged 416 years resulted in an increased frequency of bowel movements, a decreased number of fecal incontinence episodes, and reduced abdominal pain, although there was no change in stool consistency . It seems that our study is the first rct study which investigates the synbiotics effects in childhood constipation . According to our study, mixtures of different strains of probiotics and their specialized prebiotics are more effective than each of them alone and this combination augments their efficacy in all parameters of study, but in previous researches improvement had been seen only in some of symptoms and signs . Also adjunctive therapy of synbiotic and liquid paraffin could be more effective to improve bms than any of them alone . According to this rct, synbiotic have got beneficial effects on symptoms of childhood constipation similar to liquid paraffin without any side effects and synbiotic is an effective adjunct to liquid paraffin to improve bms.
Recently, the use of magnetic nanoparticles (mnps) in medical applications (e.g. Magnetic fluid hyperthermia (mfh), magnetic drug delivery, magneto - mechanical actuation of cell surface receptors, magnetic gene transfection, and magnetic resonance imaging (mri) contrast improvement) has had an upward trend . The principle of this technique is to destroy cancer cells by heating them up without lethal effects on normal tissues . In comparison with other treatment techniques, this technique is a physical therapy with few side effects and it can be accompanied by other therapies like radiotherapy and chemotherapy to sensitize resistant malignant cells to these therapies . Effectiveness of the treatment is dependent on the tumor size and its location in the body . Mnps, used as heating mediators, are magnetic materials consisting of one or more inorganic crystals . When they undergo external magnetic field, thermal energy the heating power of mnps depends on the particle size, size distribution, domain state, magnetic anisotropy, the viscosity of the dispersion medium and parameters of the magnetic field, including field strength (h) and frequency (f). Survival of the malignant cells declines when their temperature reaches 41 to 46 c . In this technique, it is therefore necessary to reach temperatures above 41 c by mnps as the heat sources . Tumor cells are more sensitive to heat in comparison to normal cells and consequently these temperatures do not disturb the viability of normal cells . Dispersing mnps in a liquid, as a carrier, leads to the production of magnetic fluids . . When fe is substituted by mn, co and zn in m1-xznxfe2o4 ferrites with superior magnetic properties can be produced . Several methods are available for synthesizing mnps, but the most popular methods are coprecipitation, thermal decomposition, hydrothermal synthesis, and laser pyrolysis . In this study, we synthesized fe0.5zn0.5fe2o4 ferrite with dextrin coating by the aqueous precipitation method . The samples were characterized by transmission electron microscopy (tem) to investigate the size distribution and morphology of the nanostructure . Magnetic properties and hysteresis loop of the mnps were studied by vibrating sample magnetometer (vsm). Fourier transform infrared (ft - ir) was also applied to characterize the structure and purity of the compound . Afterwards, we injected these particles intratumorally in mice bearing implanted melanoma cancer to investigate their hyperthermia effect under amf . Ferrite nanoparticles (nps) were synthesized by the aqueous precipitation route . Briefly, individual metal chloride or sulfate, in an appropriate stoichiometric proportions, was dissolved in a dilute nitric acid (0.1 mol / l hcl) solution and heated to 80 c . Sodium hydroxide solution (4 mol / l) was prepared separately and heated to 80 c . The hot nitrate precursor solution was then rapidly mixed with magnetic stirring (final ph of 12.0). Then, the solution was cooled and the precipitate was collected by a permanent magnet and washed several times with distilled water to neutralize the supernatant . Tem (zeiss, em10c, 80 kv, germany) was performed to obtain the morphology and size of the nanostructure . Magnetic properties of ferrofluid were determined by drying the fluid and using a vsm (meghnatis kavir co., kashan, iran) at room temperature . Surface structure of the sample was identified by using a ft - ir spectroscope (burker tensor 27). The ft - ir spectrum was acquired in the wavenumber range of 500 - 4000 cm . B16/f10 melanoma cells were purchased from the pasteur institute (iran) and cultured in dmem (dulbecco s modified eagle medium) medium with 10% fbs (fetal bovine serum) and 1% penicillin in a humidified 37c incubator . Four- to six - week - old inbred balb / c mice were purchased from the center of comparative and experimental medicine, shiraz university of medical sciences, shiraz, iran . All animals were housed in the laboratory of the center of comparative and experimental medicine under identical conditions . The animals were housed in special cages at a controlled temperature (242 c) with weekly floor exchange . A 12:12 hour light - dark cycle was followed in the above - mentioned animal house center . All animals received care in compliance with the standard animal ethics of iran . To implant solid tumor, 1510 b16/f10 melanoma cells in pbs after approximately one week, the tumors appeared and the mice were followed until their tumors reached an appropriate size . To measure the tumor volume, a caliper was used and the volume was computed using the following formula . Where a and b are the largest and smallest diameter of tumor, respectively . After reaching an appropriate tumor size (about 1 cm), hypethermia study was started . In order to generate alternating magnetic field (amf), a horizontal solenoid coil vibrating 100 g at 515 khz (sine wave pattern) was used (shiraz university, school of engineering). The solenoid had an inner diameter of 5 cm, a length of 15 cm and 14 turns . It consisted of a water - cooling system to avoid heat induction because of the impedance . A resonant h - bridge zcs inverter with a capacitor bank of 75 nf was employed to derive the coil and inject ac current . Capacitor bank was in series with the solenoid coil, which constitutes the resonant tank . The inverter changed dc input voltage to a square wave alternating voltage and was applied to the resonant tank . Sinusoidal current flowed through the coil while the frequency of the square wave voltage was adjusted to the resonant frequency of the resonant tank . The injected ac current generated amf whose amplitude was calculated according to the coil characteristics and the magnitude of ac current . Where, n: number of turns, l: coil length, 0: equal to 410 and is the magnetic permeability in vacuum, bm: peak value of amf, and i m: peak value of ac current . The peak value of the current was adjusted to 85 a, which was measured using gds-1072 oscilloscope . The maximum input power of the system was 650 w. mice bearing implanted solid tumor in proper conditions were selected and divided into four groups consisting of two mice per group . It included a control group (group a) without any treatment administration and a sham treatment group (group b) to investigate the effect of magnetic field on the malignant cells . The mice in group b were located in the solenoid coil for 30 min without mnps injection . For evaluating the lethal effects of the fnps on cancerous cells, the mice in group c received only intratumoral injection of fnps . Finally, group d was chosen for treatment administration by intratumoral injection of mnps (200 l magnetic fluid containing 2 mg fe) undergoing amf for 30 min . Before administrating the experimental treatment, each mouse was anesthetized with intramuscular injection of ketamin / xylazine mix . For histological findings, all treated and non - treated tumors and tissues of the spleen, kidney, and liver were removed 24 hours after the treatment . For this purpose, after dissection, the tissues were removed and each specimen was collected and fixed by immersion in 10% buffered formalin and routinely processed into paraffin . Afterwards, sections were cut at 5 m and put in an oven for 45 minutes to remove the extra paraffin from the tissue . After staining with hematoxylin and eosin (h&e), perl s iron staining was carried out to obtain the iron content in groups c and d. finally, each prepared slide was observed under a microscope to distinguish necrosis and inflammation areas and the distribution of mnps through the track of iron . For this purpose, the necrotic surface area was estimated by using graticule (olympus, japan) on tumor slides . Ferrite nanoparticles (nps) were synthesized by the aqueous precipitation route . Briefly, individual metal chloride or sulfate, in an appropriate stoichiometric proportions, was dissolved in a dilute nitric acid (0.1 mol / l hcl) solution and heated to 80 c . Sodium hydroxide solution (4 mol / l) was prepared separately and heated to 80 c . The hot nitrate precursor solution was then rapidly mixed with magnetic stirring (final ph of 12.0). Then, the solution was cooled and the precipitate was collected by a permanent magnet and washed several times with distilled water to neutralize the supernatant . Tem (zeiss, em10c, 80 kv, germany) was performed to obtain the morphology and size of the nanostructure . Magnetic properties of ferrofluid were determined by drying the fluid and using a vsm (meghnatis kavir co., kashan, iran) at room temperature . Surface structure of the sample was identified by using a ft - ir spectroscope (burker tensor 27). The ft - ir spectrum was acquired in the wavenumber range of 500 - 4000 cm . B16/f10 melanoma cells were purchased from the pasteur institute (iran) and cultured in dmem (dulbecco s modified eagle medium) medium with 10% fbs (fetal bovine serum) and 1% penicillin in a humidified 37c incubator . Four- to six - week - old inbred balb / c mice were purchased from the center of comparative and experimental medicine, shiraz university of medical sciences, shiraz, iran . All animals were housed in the laboratory of the center of comparative and experimental medicine under identical conditions . The animals were housed in special cages at a controlled temperature (242 c) with weekly floor exchange . A 12:12 hour light - dark cycle was followed in the above - mentioned animal house center . All animals received care in compliance with the standard animal ethics of iran . To implant solid tumor, 1510 b16/f10 melanoma cells in pbs were injected subcutaneously into the back of the neck of each mouse . After approximately one week, the tumors appeared and the mice were followed until their tumors reached an appropriate size . To measure the tumor volume, a caliper was used and the volume was computed using the following formula . Where a and b are the largest and smallest diameter of tumor, respectively . After reaching an appropriate tumor size (about 1 cm), hypethermia study was started . In order to generate alternating magnetic field (amf), a horizontal solenoid coil vibrating 100 g at 515 khz (sine wave pattern) was used (shiraz university, school of engineering). The solenoid had an inner diameter of 5 cm, a length of 15 cm and 14 turns . It consisted of a water - cooling system to avoid heat induction because of the impedance . A resonant h - bridge zcs inverter with a capacitor bank of 75 nf was employed to derive the coil and inject ac current . Capacitor bank was in series with the solenoid coil, which constitutes the resonant tank . The inverter changed dc input voltage to a square wave alternating voltage and was applied to the resonant tank . Sinusoidal current flowed through the coil while the frequency of the square wave voltage was adjusted to the resonant frequency of the resonant tank . The injected ac current generated amf whose amplitude was calculated according to the coil characteristics and the magnitude of ac current . Where, n: number of turns, l: coil length, 0: equal to 410 and is the magnetic permeability in vacuum, bm: peak value of amf, and i m: peak value of ac current . The peak value of the current was adjusted to 85 a, which was measured using gds-1072 oscilloscope . Mice bearing implanted solid tumor in proper conditions were selected and divided into four groups consisting of two mice per group . It included a control group (group a) without any treatment administration and a sham treatment group (group b) to investigate the effect of magnetic field on the malignant cells . The mice in group b were located in the solenoid coil for 30 min without mnps injection . For evaluating the lethal effects of the fnps on cancerous cells, the mice in group c received only intratumoral injection of fnps . Finally, group d was chosen for treatment administration by intratumoral injection of mnps (200 l magnetic fluid containing 2 mg fe) undergoing amf for 30 min . Before administrating the experimental treatment, each mouse was anesthetized with intramuscular injection of ketamin / xylazine mix . For histological findings, all treated and non - treated tumors and tissues of the spleen, kidney, and liver were removed 24 hours after the treatment . For this purpose, after dissection, the tissues were removed and each specimen was collected and fixed by immersion in 10% buffered formalin and routinely processed into paraffin . Afterwards, sections were cut at 5 m and put in an oven for 45 minutes to remove the extra paraffin from the tissue . After staining with hematoxylin and eosin (h&e), perl s iron staining was carried out to obtain the iron content in groups c and d. finally, each prepared slide was observed under a microscope to distinguish necrosis and inflammation areas and the distribution of mnps through the track of iron . For this purpose, the necrotic surface area was estimated by using graticule (olympus, japan) on tumor slides . Magnetic properties of nps were determined by vibrating sample magnetometer (vsm) at room temperature . Figure 1 depicts the m versus h curve of the dry fe0.5zn0.5fe2o4 ferrite nps with applied field between -8500 oe and 8500 oe at room temperature . As shown in this figure, the particle size, morphology, and agglomeration of mnps can be determined by tem images . M versus h curve of fe0.5zn0.5fe2o4 ferrite (at room temperature) indicates the single domain superparamagnetic properties of mnps . Tem image of fe0.5zn0.5fe2o4 ferrite shows that the diameter of nanoparticles is around 9 nm . In order to confirm that dextrin was successfully coated on the surface of nps ft - ir spectra of fe0.5zn0.5fe2o4 ferrite shows nps were successfully covered with dextrin . For the in vivo study, the tumor was induced in balb / c mice via the injection of b16/f10 melanoma cells in pbs into the back of the neck of the mice . After approximately one week, the tumors appeared in the animals and the size of tumors was measured with a caliper (figure 4). Figure 5 shows that the mice in groups b and d were located in the center of the solenoid and subjected to amf with 50 a / div current (figure 6) for 30 minutes . Mouse bearing implanted tumor was placed in a solenoid (f=515 khz, h=100 g). Sinusoidal current flow through the coil could be seen by oscilloscope (50 a / div). After 24 hours, all mice were sacrificed and each specimen of the tumors was collected and prepared for histological analyses . Figure 7 shows stained slides of tumors in four groups . In order to document the presence of fnps between the cells and to investigate their effects on the surrounding medium, perl s iron staining was done.12,13 as shown in figure 7c, iron particles were present in malignant cells . A: group a (blue arrows show malignant cells); b: group b; c: iron stained slide of mouse tumor in group c (yellow arrow shows the presence of fe nanoparticles in malignant cells); d: h&e stained slide of mouse tumor in group d. no significant difference in the necrosis extent was observed (h&e 400). No trace of fnps was detected in the spleen, kidney, and liver tissues and they had normal tissues, figure 8 . No trace of mnps was observed in the tissues of the liver (a), spleen (b), and kidney (c) (h&e 400). Magnetic properties of nps were determined by vibrating sample magnetometer (vsm) at room temperature . Figure 1 depicts the m versus h curve of the dry fe0.5zn0.5fe2o4 ferrite nps with applied field between -8500 oe and 8500 oe at room temperature . As shown in this figure, the particle size, morphology, and agglomeration of mnps can be determined by tem images . M versus h curve of fe0.5zn0.5fe2o4 ferrite (at room temperature) indicates the single domain superparamagnetic properties of mnps . Tem image of fe0.5zn0.5fe2o4 ferrite shows that the diameter of nanoparticles is around 9 nm . In order to confirm that dextrin was successfully coated on the surface of nps for the in vivo study, the tumor was induced in balb / c mice via the injection of b16/f10 melanoma cells in pbs into the back of the neck of the mice . After approximately one week, the tumors appeared in the animals and the size of tumors was measured with a caliper (figure 4). Figure 5 shows that the mice in groups b and d were located in the center of the solenoid and subjected to amf with 50 a / div current (figure 6) for 30 minutes . Mouse bearing implanted tumor was placed in a solenoid (f=515 khz, h=100 g). Sinusoidal current flow through the coil could be seen by oscilloscope (50 a / div). After 24 hours, all mice were sacrificed and each specimen of the tumors was collected and prepared for histological analyses . Figure 7 shows stained slides of tumors in four groups . In order to document the presence of fnps between the cells and to investigate their effects on the surrounding medium, perl s iron staining was done.12,13 as shown in figure 7c, iron particles were present in malignant cells . A: group a (blue arrows show malignant cells); b: group b; c: iron stained slide of mouse tumor in group c (yellow arrow shows the presence of fe nanoparticles in malignant cells); d: h&e stained slide of mouse tumor in group d. no significant difference in the necrosis extent was observed (h&e 400). No trace of fnps was detected in the spleen, kidney, and liver tissues and they had normal tissues, figure 8 . No trace of mnps was observed in the tissues of the liver (a), spleen (b), and kidney (c) (h&e 400). Due to many side effects of common strategies for cancer therapy, these strategies are not considered useful for all kinds and stages of tumors . Consequently, researchers are looking for a comprehensive treatment method . Parameters that contribute to the induction of heat in this technique are the diameter of nps, anisotropy constant, fluid viscosity, and frequency and amplitude of the magnetic field . In this study, for the characterization of fnps, ft - ir, vsm, tem were done . The absence of hysteresis loop in this curve and non - saturated magnetization at the applied magnetic field, indicated the single domain superparamagnetic properties of mnps . Where, m is the molecular weight of the composition (in gram), ms is saturation magnetization, and 5585 is the magnetic factor . By estimating the saturation magnetization through extrapolation (30.16 emu / gr), nb was calculated to be 1.27 . According to tem image for in vivo study, it is necessary to coat the nps with a polymer . In this study, we used dextrin as a coating for biocompatibility of nps . Ft - ir analysis was used to confirm that dextrin was successfully coated on the surface of mnps . In ft - ir spectrum, the peak at 570 cm refers to the characteristic absorption of fe - o bond of magnetic particles . The peaks at 1634.6 cm and 2920.5 cm corresponded to c = o bond and vibration of -ch2- groups, respectively . Thus, according to previous studies, fnps were successfully covered with dextrin . In this study, microscopic changes in tumoral cells were investigated 24 hours after treatment among the four mice groups . For this purpose, the degree of necrosis and inflammation (400) was verified on tumor slides . According to the pathology results, in the tumoral tissue, necrotic cells were easily seen in the central part of all tumors . On tumor slides belonging group c, there was no necrosis cells around nps . Thus, it is expected that if fnps are transferred to other organs in intravenous administration, they do not make lethal effects on the normal cells . However, a previous study showed iron / iron oxide core / shell nps with porphyrin coating caused cell damage due to the generation of free radicals and magnetic hyperthermia under the influence of magnetic field . Different degrees of necrotic cells could be seen in all specimens, but no significant difference in necrosis extent was observed among the four groups; thus, this treatment was not powerful enough to remove the cancer cells, which may contribute to particle size . Three mechanisms contribute to heat loss in mnps, namely, hysteresis losses, neel and brownian relaxations . Bakoglidis et al . Investigated the magnetic hyperthermia response of iron oxide nps in the size range of 5 - 18 nm . They divided these nps into three categories; the superparamagnetic (spm) region (as large as 10 nm) where heating is mainly because of neel relaxation, the spm - ferromagnetic region (10 - 13 nm), and the ferromagnetic region (> 13 nm) where hysteresis loss mechanism is dominate in heat dissipation . They reported that ferromagnetic materials release heat that is more significant and hysteresis mechanism is more efficient for hyperthermia applications . In addition, jeun et al . Reported that the heat efficiency of fe3o4 particles below 9.8 nm under 110 khz magnetic field frequency was insufficient for hyperthermia applications, and the value of specific loss power (slp) had an upward trend with an increase in the particle size from 11.5 to 22.5 nm under the same magnetic field . Therefore, heat efficiency of fnps with an average diameter of 9 nm under the influence of amf (515 khz) is insufficient for hyperthermia applications . Although, ultra - small nps have a lot of potential for use in biomedical applications, it was confirmed that this np could not induce efficient heat for hyperthermia . However, studies show the mnp aggregate to larger cluster after systematic administration and therefore the effective hydrodynamic size of the mnp in the body is different from the initial size of nps . Additionally, theoretical study on proton relaxation indicates that the magnetic properties of nps increase significantly upon the enhancement of the particle and the crystallite size . Ultra - small nps can be functionalized and guided by an external magnetic field for in vivo studies and after removing the emf, dipoles return to random orientations because of the spm behavior of these nps . Unlike ferromagnetic nps however, for the hyperthermia study, spm nps show lower heating efficiency than single domain ferromagnetic nps due to the absence or negligible amounts of hysteresis loss . We also surveyed the presence of nps in other organs such as the spleen, kidney, and liver . No trace of fnps was detected in the spleen, kidney, and liver tissues . Thus, mnps remained in the tumor and did not transfer to other organs after intratumoral injection . In systemic administration, large particles (> 50 nm) are taken up by the liver cells, but smaller ones generally circulate for a longer period . Longer residence time in the blood stream may enhance (enhanced permeation and retention) epr effect . Therefore, it is expected that in systemic administration, fnps with a diameter of 9 nm are not captured by the liver and accumulated by tumor . A limitation of this investigation was the use of a solenoid coil with one frequency and field strength . The major findings reported here illustrate that fnp ferrofluid coated with dextrin is a good candidate for in vivo approaches without any side effects on body organs . While fe particles were seen in malignant tumor cells, there was no trace of them in other organs . Different amounts of necrosis were seen in the tumor tissues of all groups, but no significant difference in the necrosis extent was observed among the groups . Therefore, although this np is a good agent for other biomedical applications, like contrast enhancement in mri, it did not induce efficient heat under external magnetic field.
It behaves highly aggressive and spreads widely throughout the skin, recurs locally, and metastasizes early . Standard treatment with resection and adjuvant radiotherapy results in local control in approximately 50% of patients at 1 year and median survival is approximately 8 months . Considerable evidence has implicated matrix metalloproteinases (mmp) in the degradation of the extracellular matrix (ecm) during the metastatic process . Murakami et al . Reported the expression of mmp-2 on subcutaneous angiosarcoma in canine . In human, however, there is no english report suggesting the expression of mmp-9 on human angiosarcoma of the skin . In this report, we describe a case of angiosarcoma in which complete remission was archived with low dose docetaxel and bisphosphonate after the standard treatment of angiosarcoma . A 78-year - old woman consulted us with a 6-month history of an asymptomatic nodule on her scalp . Her nodule has been surgically resected at a private clinic 3 months before her visit . Two weeks after the resection, skin nodules had suddenly enlarged . On her first visit, physical examination revealed a skin - colored nodule with a surgery scar, teleangiectasia and purpura on her scalp (fig . Histologically, irregular anastomosing vascular channels lined by single layers of enlarged endothelial cells existed between collagen bundles with dense infiltration of lymphocytes (fig . Immunohistochemical staining revealed that these enlarged endothelial - like cells were strongly positive for cd31 and vimentin, and positive for factor viii and thrombomodulin, and negative for cd34, s-100, ck, sma, and desmin . Moreover, these enlarged endothelial - like cells and tumor stromas were positive for mmp-9 (fig . We used rabbit polyclonal anti - human mmp-9 antibody (abcam, tokyo, japan) at a dilution of 1:100 . In addition, we employed immunohistochemical staining for 9 cases of angiosarcomas that were histologically diagnosed in our institution, and about 78% (7/9) cases of angiosarcomas were positive for mmp9 . From these results, we diagnosed this patient as mmp-9-expressing angiosarcoma . Positron emission tomography (pet) scans showed no evidence of metastases . Then, we administered docetaxel monthly at 40 mg / m body surface area intravenously and weekly with oral administration of 17.5 mg sodium risedronate hydrate . One and a half years after the surgical treatment, there was no evidence of local recurrence or metastasis . In our present case, we describe a case of mmp-9-expressing angiosarcoma treated with low - dose docetaxel and bisphosphonate . Like paclitaxel, docetaxel promotes microtubule assembly and inhibits the depolymerization of tubulin, thus stabilizing microtubules, but docetaxel has a higher potency [4, 7, 8]. However, in studies conducted in europe, docetaxel monotherapy was rather ineffective for soft - tissue sarcoma, including angiosarcoma, and could not be recommended for further use . Mmp-9 is a stromal factor that regulates the mobilization of hematopoietic stem cells from the bone marrow niche by solubilizing the membrane - bound form of c - kitl . Because it remodels the extracellular matrix and promotes the sprouting and growth of new blood vessels by making vegf available to the vegfr-2/flk receptor on endothelial cells, mmp-9 is a linchpin in tumor progression . Moreover, recently, several reports revealed the expression of mmp-9 on tumor correlated with the progression or prognosis of several skin tumors such as malignant melanoma, squamous cell carcinoma, basal cell carcinoma, and mycosis fungoides . In addition, koontz et al . Reported two cases of successful treatment of angiosarcoma with the administration of the anti - vegf antibody bevacizumab along with radiotherapy prior to surgery . More recently, it was reported that pharmacological inhibition of mmp-9 by amino - bisphosphonate decreased pro - mmp-9 and vegf in the serum and abrogated the induction of immunosuppressive macrophages, myeloid - derived suppressor cells (mdscs), in the tumor microenvironment [15, 16]. In aggregate, inhibition of mmp-9 by bisphosphonate could be one of the optimal supportive therapies for the treatment of angiosarcoma by inhibiting tumor - induced angiogenesis and by the induction of anti - tumor immunity . In conclusion, the combination of docetaxel with bisphosphonate was effective for mmp-9-expressing angiosarcoma and resulted in complete remission after the standard therapy for angiosarcoma.
Their contribution has gone beyond academic research the team of researchers in the national institute of mental health and neurosciences (nimhans), bengaluru, karnataka, india, has developed indigenous ect devices that have stood the test of time in terms of their use in clinical practice as well as in their contribution to research . It delivered bidirectional stimuli, and facilities for measuring various parameters of electrical dose had been incorporated in the device . With the demonstration of cognitive superiority and comparable efficacy of brief - pulse ect, the national workshop on ect (1988) recommended the development of state - of - the - art ect devices with brief - pulse waveform to be available indigenously . A committee including the member of the bengaluru chapter of the national institution for quality and reliability, a psychiatrist (bng), and a biomedical engineer (vsc) took up the task of developing a brief - pulse ect device indigenously . After several laboratory tests, the machine was finally found suitable for safe use in 1992 . The focus on the simplest of the models was the ease of use by psychiatrists . This was possible by a simple microcontroller unit that transmits a brief - pulse (1.5 ms as width) of bipolar nature (at a frequency of 125 pulses / s) and constant current (800 ma). Ten steps of stimulus dose was made available by adjusting the total duration of stimulus from 0.2 s to 3.6 s and keeping current, pulse width, and pulse frequency constant . The first two stimulus steps were 30 mc and 60 mc; the next eight steps were in multiples of 60 mc up to 540 mc . The stimulus was delivered by pressing the switch provided on the hand - held electrode . The duration of stimulus was preprogrammed based on the total charge chosen and would be shorter if the switch was released earlier . The same switch also started a seconds counter to help time the observed motor seizures . The treating physician should keep the switch pressed to let that seconds counter on; release of switch at the termination of seizure stops the counter and indicates the duration (in seconds) of the motor seizure . Release of the switch earlier than 20 s (failing to see the convulsion of duration longer than 20 s) automatically would increase the stimulus dose setting to next level for re - stimulation if the doctor chooses to do so . Features such as internal trigger to disconnect the electroencephalograph (eeg) electrodes from external amplifiers during stimulus helped using standby eeg / electrocardiograph (ecg) monitoring free of artifacts . This allowed changing the settings of other electrical parameters such as pulse width and frequency if required while keeping the default setting same as the earlier microcontroller - programmed steps . However, it gave liberty to set either 10 steps of increment as in the basic model or 20 steps increase of 15 mc as 15, 30, 45, 60, up to 540 mc . Automatic upgradation of the stimulus dose, if the observed seizure was <20 s, was preserved . By 1994, the computer monitor would display the eeg in two, four, or eight channels along with ecg . After eeg recording is terminated, a 10-s calibration signal of 100 v was recorded . There was also option of choosing different eeg settings, including number of channels, and display size (zoom). This refined eeg and computerized model is in use in nimhans since 1993 . In 19981999, the option of automatic setting of threshold stimulus dose in mc, by feeding data on age, sex, and inion - nasion distance (ind), was developed . The research related to measurement of impedance and stimulus threshold of ect in nimhans contributed to it . Around the same time, feature to store ect seizure and ecg for offline analysis was made available . With popularity of bifrontal ect (bfect), special concave stimulus electrodes were added . Most recent development includes facility of administering ultra - brief - pulse (<0.5 ms) ect that is expected to cause lesser cognitive dysfunction . The latest integrated ect machine, with four - channel eeg / ecg, has intelligent features to independently operate without interfacing with a computer system . Eeg / ecg is displayed on 5.7 " color graphic lcd screen, and it also has sd card memory and printer interface . A separate portable eeg amplifier independent of ect can remain attached to the patient and the signals can be seen on any hand - held device that has bluetooth . All ect machines at nimhans are periodically calibrated for pulse width, frequency, amplitude, and stimulus duration stages . The frequency and duration, this device has been used to administer ect to about 700800 patients annually . With each patient receiving about 67 ects on an average through his / her course, the precision and flexibility of electrical parameters provided by this ect machine have fostered quality research on ect at nimhans . We have selected for review those studies from nimhans which have utilized specific features of this device . Stimulus relative to seizure threshold is more critical than the absolute stimulus . A few techniques of threshold estimation included the half - age method and dose titration method but have limitations . The former was dependent on the model of the device while the latter might expose the patient to inadequate stimuli . The study at nimhans in this regard on 100 consecutive patients receiving bilateral ect (blect) revealed that age was the most important predictor of threshold stimulus accounting for 23% variance in multivariate analysis . The other significant but less robust factors were ind and severity of illness that accounted for 5% and 4% of variance in threshold, respectively . The psychotropic medications and head circumference were not noted to influence the threshold . A formula as mentioned below for determining stimulus threshold was devised using forward stepwise linear regression model based on age alone and was prospectively tested at the 1 and 6 ect sessions . T1 = 1.67 (age) + 48.7 t6 = 1.8 (age) + 71.9 t1 = threshold at 1 session, t6 = threshold at 6 session . The computerized version of stimulus setting allows use of this regression equation with ease . With the computerized version, ect sessions of each patient a similar effort was made to find the seizure threshold for unilateral ect (ulect). Here, age was the only significant predictor of seizure threshold (15% of variance). A formula based on regression analysis was developed which is as follows: threshold (mc) = exp (age [0.015412] + 3.667387), where unit of age is years . Then, in an independent sample (n = 30) of patients receiving ulect, the threshold was estimated (but not administered) using the above formula . The value obtained was rounded off to the nearest higher level on the ect device . This estimated threshold was then compared with the actual threshold stimulus which was determined by using the titration method . The results showed that 22 (73%) patients would have developed adequate seizure with the first stimulus estimated by the formula method, but it overestimated threshold stimulus by 3060 mc in majority of them . Moreover, it underestimated the threshold in 8 (27%) patients . Hence, the formula method may not be suitable for threshold estimation in ulect . However, if the ect administrator wishes to use it, he or she should do so with the stimulus set at one or two levels lower than the formula - estimated threshold estimation, and further titration may be done as needed . Although stimulus at 26 times the threshold intensity is associated with greater clinical efficacy in ulect, the guidelines were less clear about this in blect . From 2006, there was change in practice in nimahns and unless otherwise requested from the referring psychiatrist, all blects are administered at 1.5 times the threshold stimulus charge . Before 2006, the threshold stimulus was administered for blect . Hence, a retrospective data analysis was done to see whether new practice has better outcome . The data of 100 consecutive inpatients who received blect at threshold level before the change in practice implemented were compared with that of 101 who received blect at 1.5 times threshold level after the change implemented . The outcome measures were the number of ects administered and the number of inpatient days after the start of ect . However, the change to suprathreshold blect conferred advantage in the treatment of mania: those receiving suprathreshold ect achieved clinical improvement with, on an average, 2 ects less and their inpatient days reduced by 10 days . Ect guidelines mandate the need for seizure monitoring during ect . Initially, feasibility, reliability, and validity of eeg seizure measurement were studied at nimhans using a separate paper eeg machine . Subsequently, a paperless eeg amplifier, which was attached to a computer monitor displaying the eeg, was designed at nimhans . Display of both eeg and the digital counter showing time duration was triggered by the ect stimulus switch (currently, eeg monitoring is available in a display in the ect machine obviating the need for a computer attached to the ect machine). This paperless eeg was validated against a paper eeg measurement which showed high correlation in terms of seizure duration (intraclass correlation, r = 0.99, p <0.001). In later studies using this paperless eeg machine, unequivocal absence of epileptiform transients for five or more seconds on both channels the use of this paperless eeg simplified eeg monitoring by reducing mechanical problems associated with paper eeg and simplified the storing process . (1998) monitored 158 consecutive patients referred for ect on their first ect for both motor and eeg seizures . Around 40% of patients with prolonged eeg seizures had a seizure duration> 180 s, necessitating termination . Motor seizure of 90 s failed to predict prolonged eeg seizures (120 s or more) in 60% of occasions . A sizable minority (8%) failed to obtain adequate motor seizure on the cuffed forearm although their eeg seizures were considered adequate by the study criteria (25 s). A similar study was conducted by mayur et al . With 232 consecutive patients posted for either blect (54%) or ulect (46%). In this study, 16% had prolonged eeg seizures, 39% of which was missed by motor monitoring, and 7% of adequate eeg seizures were classified as inadequate by motor seizure monitoring . Around 1% of sessions with ulect and 11% with blect were considered inadequate by motor seizure monitoring despite adequate eeg seizures . Motor seizure correlated well with eeg seizure when the latter was adequate but not when prolonged . These findings were again replicated in a further larger study with 485 consecutive patients receiving either blect or ulect . In the later study, two patients classified as having inadequate motor seizures (<15 s) had prolonged eeg seizures (> 120 s). Patients with prolonged seizures were younger, had lower seizure threshold, were more likely to receive a diagnosis of mania, and were treated with lithium . The above studies emphasize the need for eeg monitoring during ect to prevent unnecessary re - stimulation when motor seizures monitoring incorrectly label the treatment as inadequate and also to detect and abort the prolonged seizures, which appears to be common in indian setting . A study was conducted on 287 consecutive consenting patients receiving either blect or ulect to explore the factors influencing ratio of motor and eeg seizure duration (me ratio). Patients were classified into low (0.8; n = 146) and high (> 0.8, n = 141) me - ratio groups . Significantly, more patients in the low me - ratio group received blect, had prolonged eeg seizure, and were on concurrent lithium compared with the high me - ratio group . This study underscores the importance for eeg monitoring at least inpatients receiving lithium and blect . Recent international guidelines have recognized the limitations of seizure duration as a marker of adequacy of treatment and emphasize the pattern of eeg seizure . A study was conducted to compare the old definition of seizure adequacy (based on seizure duration) with the new definition (a seizure with polyspikes and a 3-hz activity) in 102 computerized eeg recordings . This suggested that seizures meeting newer criteria almost invariably last for at least 25 s; in the indian context, the change in the criteria would make little change in the day - to - day practice of ect . Numerous ictal eeg markers have been elucidated to predict treatment response of ect including postictal suppression, postictal coherence and amplitude, amount of slowing and time to onset of slowing, global eeg power, largest lyapunov exponent, and strength symmetry index (ssi). Ssi was computed from the early- and mid - seizure eeg epochs using the fractal dimension (fd). The seizures of ulect were characterized by significantly smaller ssi in both phases, despite having seizure duration comparable to blect . It was suggested that ssi may be a potential measure of seizure adequacy . In another study, ssi was computed in 40 patients receiving either high - dose or low - dose bitemporal ect (btect). Ssi of the early seizure was higher in the high dose than in the low dose ect group . Another method of analyzing eeg is to measure the components of the eeg such as its frequencies across several nonoverlapping frequency bands: delta, theta, alpha, and beta through fast fourier transform . The delta band of eeg is said to be relevant to the therapeutic properties of ect . Eeg of 25 patients receiving either blect or ulect was subjected fast fourier transform, and the spectral power of the delta (14 hz) band was computed . Blect resulted in symmetrical seizure spectral power; ulect seizures had significantly lower spectral power in the delta band on the unstimulated side . Fd was computed for early-, mid-, and post - seizure phases of the first ect . Fd is a geometrical method of analysis of eeg, which was calculated based on the principles described by katz . It is a measure of complexity of the eeg wave in the terms of amplitude and frequency . Smaller postseizure fd after the 1 ect was associated with remission status at 2 weeks . Smaller postictal fd was considered a marker for postictal suppression suggesting that postictal suppression may be a marker for early antidepressant response for ect . A similar study was conducted in 51 right - handed, drug - free patients with major depressive disorder receiving right ulects at 2.5 times their seizure threshold . Spectral power (db) for 26 hz band and fd of postseizure eeg were estimated . Smaller fd and spectral power (i.e. Greater postseizure eeg suppression) were seen in early responders compared to the late responders . Ictal eeg fd was calculated from 26 eeg records of patients receiving either bfect or btect for schizophrenia . Maximum fd at the 2 or 3 ect had an inverse correlation with psychosis severity after 6 ects as well as with the number of ects provided . Hence, maximum fd during the early part of the ect course in schizophrenia patients is predictive of greater benefit in short - term psychopathology . In another analysis of data from the sample, it was seen that maximum fd does not change over six ects despite decline in seizure duration over ect . Thus, eeg morphology of blect induced seizures show little variation over the course of treatment which is in keeping with other studies . Bispectral index (bis) measures the level of hypnosis (sedation) during anesthesia . Bis values of awaked individuals with schizophrenia were studied through a course of bitemporal brief - pulse ect . It was recorded using a bis monitor (a-2000, aspect medical systems inc ., newton, massachusetts, usa), with sensor applied to the forehead on the right side . It was found that after six ects, 60% of patients had their resting bis values in the anesthetized / sedated range even when they are awake . Thus, bis may not provide accurate estimation of the depth of anesthesia during ect after the initial ect sessions . Bfect is found to be as efficacious as btect for depression but associated with fewer cognitive adverse effects . However, its efficacy in other indications had not been well studied and hence, it was planned in nimhans . Assessing bfect in acute mania in double - blind randomized controlled trial showed faster decline in ymrs scores and earlier attainment of response compared to btect without differences in adverse effects . A double - blind, randomized controlled trial demonstrated the superior clinical as well as cognitive effects of bfect over btect in - patients with schizophrenia . Seizure duration significantly reduced only with bfect and not with btect over the course of ect . This provided the indirect support to possible better anticonvulsant mechanism of action of bfect in schizophrenia . These studies used electrodes with inner concave surface specifically for bfect and later, we have been using these electrodes in clinical practice for bfect in nimhans . The effect of electrical stimulus parameters of ect on prolactin response was studied . Stimulus dose, frequency of ect, and seizure variables such as seizure duration, seizure strength, pattern, and symmetry did not predict chance in prolactin level . Similarly, none of the clinical variables including baseline severity of illness, presence of psychotic symptoms, drug - naive status, and degree of clinical improvement predicted the prolactin response . The prolactin response however, was significantly more in female participants which may be due to their lower seizure threshold and inherent biological predisposition . A study comparing low- and high - stimulus doses in a double - blind, randomized controlled design revealed that eeg seizure was of comparable duration in the two stimulus groups . Another study with a cross - over design looking into the effect of different stimulus frequency found that lower pulse frequency (50 pps) stimulus had lower seizure threshold and produced fewer subconvulsive stimulations compared with high - frequency stimulus (200 pps) without altering seizure durations or the cardiovascular responses . The low - frequency stimulus produced similar clinical benefits as that of high frequency in subsequent study . Thus, lowering down the frequency of pulses may be a viable option when seizure threshold is high due to various reasons . The lower stimulus frequency leads to longer stimulus train duration and hence, had lower rate (mc / s) of stimulus dissipation . The cardiovascular system (cvs) effects of ect were also studied with the features of automated cardiac monitor and ambulatory ecg system in eeg machine . To study the effect of atropine on cvs response to ect, 30 patients were randomly allocated before the third ect to receive atropine or no premedication and found that atropine contributed to 32% of the variance in rate pressure product (rpp) with lower values in those who did not receive atropine . However this study hence indicated that avoiding atropine as premedication can control rpp and thus can improve cardiac stability during ect without affecting other aspects . In a large sample of 124 patients, it was found that postictal rpp was significantly higher after blect than ulect even after eliminating the effect of possible confounding variables such as subconvulsions and concurrent medications . The difference of 10% postictal rpp increments between the right ulect and blect groups found in this study is of clinical relevance in elderly or patients at risk of cardiac complications . The postictal rpp may be considered as a peripheral marker of the degree of seizure generalization . In addition, if the hypothesis of seizure generalization to hypothalamus as a prerequisite for clinical efficacy is given consideration, then lower rpp of threshold ulect compared to blect can explain lower clinical efficacy of ulect and may reflect the less than optimal hypothalamic stimulation . The correlation of rpp with clinical efficacy was further supported by the lower postictal rpp with unilateral threshold ect compared to that with unilateral suprathreshold ect . However, atropine could mask the differential cardiovascular responses of the effective and ineffective seizures . In another study, the effect of anesthetic modification of motor seizure on rpp was also explored . 1 mg / kg dose of succinylcholine improved the number of patients with successful modification compared to 0.5 mg / kg but did not influence ictal or postictal rpp . It thus ruled out the significant cvs alteration due to depolarizing effect of succinylcholine and 1 mg / kg dose may be used routinely without fear of exaggerated cvs response . It confirmed the above findings that rpp response correlates with the cerebral seizure instead of motor component of seizure . Ictal rpp did not differ between groups with or without adequate motor seizure if eeg seizure was adequate . However, the group with inadequate eeg seizure had the least ictal rpp . Hemodynamic response with btect and bfect were examined at five - time points starting from before anesthesia induction to 2 min after the seizure . The maximum values of systolic blood pressure, heart rate, and rpp were similar in both groups, suggesting that cardiovascular load is similar in bfect and btect . It also indicates that differential frontal lobe stimulation rather than seizure generalization may be playing a role in better efficacy of bfect over btect in schizophrenia . Lithium given concurrently with ect can have serious interactions with various aspects of the procedure . At the same time, not combining ect and lithium in certain patients may have adverse clinical consequences . In the absence of systematically collected data on adverse effects of lithium co - prescribed with ect, patients on lithium (n=27) and those not on lithium (n=28) were compared while they received ect . The sympathetic cardiovascular response was lower in those who were on lithium and the time to post - ect recovery directly correlated with serum lithium level . Safety of lithium during ect was satisfactory particularly when serum lithium was at a lower therapeutic range in young patients without significant cardiovascular risk factors . To conclude, the indigenously developed brief - pulse ect - eeg device has been used to treat thousands of patients in the past two decades . Summary of the findings of research conducted utilizing the specific features of the indigenously developed brief - pulse ect device * many more issues related to ect need exploration in future; these include altering amplitude of electrical stimulus, ultra - brief ect in indications other than depression, novel techniques of different electrode's sizes, and placements to reduce the cognitive adverse effects without compromising the clinical efficacy . The last author, mr . Ltd ., bengaluru, karnataka, india, which manufactures the brief - pulse ect device mentioned in this review article . Candade is the director of the company, niviqure meditech pvt . Ltd ., bengaluru, karnataka, india, which manufactures the brief - pulse ect device mentioned in this review article.
The many genetic studies performed in recent years showed that genes such as interleukin 23 receptor (il23r) and il12b and tumor necrosis factor alpha (tnf) are closely associated with psoriasis and related diseases such as rheumatoid arthritis, psoriatic arthritis, and crohn's disease . Human leukocyte antigen c (hla - c)0602 is the allele most closely associated with this disease . The age at onset of psoriasis follows a bimodal distribution: type i psoriasis appears before the age of 40 years (early - onset), with a peak at 1622 years; type ii psoriasis appears after the age of 40 years (late - onset), with a peak at 5760 years . Type i psoriasis has been associated with several single - nucleotide polymorphisms (snps) in genes associated with the immune response (table 1). For example, hla - c0602 is more strongly associated with type i psoriasis than with type ii psoriasis . Although several association studies have already been performed in psoriasis in both populations (type i or type ii psoriasis patients), knowledge of age at onset remains limited and controversial (table 1). Therefore, we performed a candidate gene study, where we evaluated genetic susceptibility to type i or type ii psoriasis in patients with moderate - to - severe chronic plaque psoriasis . This approach may help us to identify snps previously associated with psoriasis or other autoimmune diseases that are specific to type i or type ii psoriasis . Furthermore, our genetic study could improve our understanding of psoriasis and of its etiology and pathogenesis . We recruited 198 caucasian patients with moderate - to - severe plaque type psoriasis (psoriasis area and severity index> 10) who attended the department of dermatology in four university hospitals in madrid between 16/10/2007 and 17/12/2012 . Five samples did not fulfill the quality criteria of the human genotyping unit - cegen (cegen, spanish national cancer research centre, madrid, spain), and 2 samples had insufficient volume . We also included 197 healthy volunteers (controls) recruited between 10/01/2011 and 14/12/2012 from the clinical pharmacology service (hospital universitario de la princesa, madrid, spain). All the volunteers were caucasian and had no personal or family history of psoriasis (at least 2 generations). The protocol fulfilled spanish law on biomedical research and was approved by the ethics committee for clinical investigation of hospital universitario de la princesa . All controls and patients gave their written informed consent to donate a sample for investigation . We preselected 320 snps based on an extensive review of 449 articles describing the association between polymorphisms and psoriasis and response to biological drugs and psoriasis and related inflammatory diseases (rheumatoid arthritis, psoriatic arthritis, and crohn's disease). We finally selected 192 snps based on minor allele frequency (0.05) and on the results of studies performed in caucasians and psoriatic patients . Information on the 173 snps analyzed can be found in supplementary table s1, which is published in . Dna was obtained from samples using an automatic dna extractor (magna pure system, roche applied science, usa) and its concentration was quantified in nanodrop nd-1000 spectrophotometer (wilmington, usa). The extracted dna was stored at 80c in the clinical pharmacology service until use . A total of 196 samples from patients (2 samples of 198 cases had insufficient volume) and 197 samples from controls were sent to the human genotyping unit - cegen to genotype 192 snps . The analysis was performed using the illumina veracode genotyping platform . If fluorescence was low or the genotype clusters were undifferentiated, the snps were removed . In addition, if the call rate was less than 95% of the average of the 192 snps analyzed, the samples were removed . Since cegen quality criteria were not met in 19 snps and 5 patients, we finally analyzed 173 snps in 191 patients and 197 controls . The statistical analysis was performed to compare the following stratified populations: patients with type i psoriasis (n = 155) or type ii psoriasis (n = 36) versus controls (n = 197) and patients with type i psoriasis versus cases with type ii psoriasis . Hardy - weinberg equilibrium was tested for all the snps analyzed using the snpstats program . Snps that were not in hardy - weinberg equilibrium in controls were removed from the subsequent analysis . We constructed various logistic regression models depending on the main types of inheritance (codominant, dominant, recessive, and additive). In the additive model, the presence of 2 mutant alleles confers double the risk of 1 mutant allele . The results were adjusted for rs12191877 (snp that is strongly associated with the hla - c0602 allele and is highly prevalent in our population) [3, 35]. Subsequently, snps with p <0.1 in the univariate analysis (adjusted for rs12191877) were included in a multivariate logistic regression model to adjust for relevant confounding factors (spss 15.0). The results of the univariate analysis were adjusted for rs12191877, except when we compared patients with type i psoriasis and patients with type ii psoriasis (the influence of rs12191877 was not very relevant). We expressed the results as the odds ratio (or), 95% confidence interval, and p value . The study population included 155 patients with moderate - to - severe chronic plaque type i psoriasis (92 men and 63 women), 36 patients with type ii psoriasis (19 men and 17 women), and 197 controls (98 men and 99 women). The mean age was 46.01 13.11 years in patients with type i psoriasis (45.72 11.69 in men and 46.43 15.04 in women), 67.72 11.85 years in patients with type ii psoriasis (65.95 11.18 in men and 69.71 12.59 in women), and 24.51 4.29 years in the controls (25.07 4.94 in men and 23.95 3.46 in women). The mean age at onset of psoriasis was 23.31 8.52 in patients with type i psoriasis and 52.58 10.45 in patients with type ii psoriasis . A total of 192 snps were analyzed (see supplementary table s1 published in). One snp was monomorphic (rs165161 in the junb gene) and was excluded from the statistical analysis . All the minor allele frequencies were in hardy - weinberg equilibrium except 9 snps in the controls and 12 snps in the patients (see supplementary table s1 published in). The 9 snps which were not in hardy - weinberg equilibrium in controls were removed from the statistical analysis . Our findings showed an association between type i psoriasis and 10 snps (n = 155 versus n = 197 controls): rs1634517 (ccl4l), rs1975974 (c17orf51), rs12720356 (tyk2), rs1800925 (il13), and rs6908425 (cdkal1) decreased the risk of psoriasis 2.94-fold, 2.08-fold, 10-fold, 100-fold, and 2.44-fold, respectively; and rs2282276 (clmn), rs10782001 (fbxl19), rs3792876 (slc22a4), rs12191877 (hla - c), and rs13437088 (hla - b / mica) increased the risk of psoriasis 3.90-fold, 2.10-fold, 3.75-fold, 30.54-fold, and 2.52-fold, respectively (table 2). However, comparison of 36 patients with type ii psoriasis and 197 controls revealed no significant association (results not shown). Four snps were associated with significant decreases in the risk of type i psoriasis (n = 155) compared with type ii psoriasis (n = 36), namely, rs191190 (tnfr1; 126.08-fold), rs361525 (tnf-; 190.76-fold), and rs10499194 and rs6920220 (tnfaip3; 155.02-fold and 19.14-fold, resp . ). We also found 5 snps that were associated with a significant increase in the risk of type i psoriasis, namely, rs1801274 (fcgr2a; 5.26-fold), rs763361 (cd226; 33.3-fold), rs12459358 (psors6; 11.11-fold), rs12191877 (hla - c; 12.5-fold), and rs1576 (cchcr1; 166.66-fold) (table 3). About 75% of patients with chronic plaque psoriasis have type i psoriasis before age 40, whereas a lower number of patients develop psoriasis at around 5060 years . Our results are consistent with these findings, since 79.06% of our patients developed psoriasis before the age of 40 . When we compared patients with type i psoriasis and controls, we found 10 significant snps in clmn, fbxl19, ccl4l, c17orf51, tyk2, il13, slc22a4, cdkal1, hla - c, and hla - b / mica . The hla - c0602 allele is a risk factor for psoriasis and has been associated with both type i [69] and type ii psoriasis . In one study, 85.3% of patients with type i psoriasis had this allele, whereas only 14.7% of patients with type ii psoriasis were carriers . Other authors found an association between rs10484554 (hla - c) and type i psoriasis compared with type ii psoriasis (or = 3.24 in type i). The hla - c gene was associated with type i psoriasis (p = 2.97e 18 for rs1265181, p = 2.58e 15 for rs12191877, p = 1.84e 15 for rs4406273, and p = 1.10e 07 for rs2395029), but not with type ii psoriasis after application of the bonferroni correction . In addition, our results showed significant differences in rs12191877 (hla - c) in patients with type i psoriasis (p = 2.50e 19). However, we did not find this association in patients with type ii psoriasis, probably owing to the small sample size in this group (n = 36). Found an association between rs1295685 in the il13 gene and type i psoriasis (p = 2.47e 03). Our results showed an association between another snp in il13 (rs1800925) and type i psoriasis (p = 0.034). In addition, munir et al . Did not obtain significant results when they compared controls with type ii psoriasis or type i psoriasis with type ii psoriasis . Both snps in il13 have been associated with predisposition to psoriasis [36, 37]. Our comparison of patients with type i psoriasis and controls is the first to obtain significant results for a series of snps in type i psoriasis, although the snps have already been associated with the risk of psoriasis . Rs10782001 in fbxl19, rs1975974 in c17orf51, rs12720356 in tyk2 [3, 39], rs3792876 in slc22a4, rs6908425 in cdkal1, and rs13437088 in hla - b / mica have previously been associated with psoriasis, but not with type i psoriasis . Furthermore, snps in clmn (rs2282276) and ccl4l (rs1634517) have not been associated with psoriasis or age at onset . We found no significant differences between patients with type ii psoriasis and controls owing to the small sample size (n = 36). Comparison between patients with type i psoriasis and patients with type ii psoriasis revealed significant associations for the following genes: fcgr2a, tnfr1, cd226, psors6, tnfaip3, hla - c, tnf-, and cchcr1 . Polymorphisms in cchcr1 (386 and 404, cchcr1ww allele) have been associated with type i psoriasis [9, 31]. We found significant differences between rs1576 in cchcr1 and age at onset . In a study comparing controls (54.8%) and patients with psoriasis type ii (66.0%), allen et al analyzed rs763361 in cd226 in patients with early - onset psoriasis and patients with late - onset psoriasis, although they found no associations . Rs12459358 in psors6 has been associated with type i psoriasis (g risk allele, or = 1.47 and p = 0.005). In contrast, our data showed an association between the t allele and type i psoriasis (or = 11.11; p = 0.026). Rs361525 (238) in the tnf gene has been associated with susceptibility to psoriasis, and the a allele was more frequent in male patients with type i psoriasis (p = 2e 07) [15, 22]. We found significant results in rs361525 (tnf-) when we compared patients with type i psoriasis and patients with type ii psoriasis, although we found no gender differences . Other authors confirmed our association with type i psoriasis in caucasian [20, 23] and mongolian patients . Baran et al . Found no significant differences between rs1800629 in the 308 promoter (tnf) and type i or type ii psoriasis . Likewise, rs12191877 in hla - c has been associated with increased risk of psoriasis . Compared patients with type i psoriasis and patients with type ii psoriasis and obtained significant results for rs1265181, rs4406273, and rs12191877 in hla - c . We replicated these results in rs12191877 (t allele risk; p = 0.045). Rs191190 in tnfr1 and rs10499194 in tnfaip3 have been associated with psoriasis, but not with age of onset . Moreover, rs1801274 in fcgr2a and rs6920220 in tnfaip3 have not been studied in patients with psoriasis according to age of onset . Given the small sample size in the group with type ii psoriasis in our study, our results should be interpreted with caution . Our results highlight the role of the immune system in psoriasis and enhance our understanding of pathogenic mechanisms . Second, the sample size was limited by the number of study patients treated in the dermatology department, thus making it difficult to detect snps with a low probability of causing psoriasis . Third, since the snps were selected based on a literature review, several major snps may not yet have been investigated . In conclusion, our study confirmed an association between rs12191877 (hla - c) and type i psoriasis and between type i and type ii psoriasis patients . Ours is the first study to show an association between clmn, fbxl19, ccl4l, c17orf51, tyk2, il13, slc22a4, cdkal1, and hla - b / mica and type i psoriasis . In addition, psors6 and tnf have been described as more prevalent genes in type i psoriasis and we showed a significant association when we compared type i psoriasis and type ii psoriasis . Ours is the first study to identify an association between fcgr2a, tnfr1, cd226, tnfaip3, and cchcr1 and age at onset of psoriasis.
A case showing sustained structural and functional responses 2 years after a single treatment with iluvien (0.2 g / day fluocinolone acetonide, fac) despite suboptimal responses to ranibizumab . A 68-year - old female patient with diabetic macular oedema (dme) from type 2 diabetes mellitus was first diagnosed in october 2010 and had a baseline visual acuity (va) of 46 early treatment diabetic retinopathy study (etdrs) letters in the left eye . The patient was treated with 11 intravitreal injections of ranibizumab (5 in combination with a small - interfering rna agent), and by march 2014, va and cft were largely unchanged (55 etdrs letters and 774 microns). The patient was treated with iluvien as she had a pseudophakic lens and a clearly suboptimal response to the prior therapy with ranibizumab . An implant releasing fac at a dosage of 0.2 g / day was administered in march 2014, and the optical coherence tomography indicated that the macula was dry after 7 days (cft was below 300 microns). Va improved by 5 letters within 7 days and by 15 letters within 14 days, and this was maintained after 24 months . Throughout the duration of this study, the intraocular pressure was 22 mm hg, and no glaucoma medication was administered . In real - life uk practice, this dme patient showed a suboptimal response to multiple intravitreal injections of ranibizumab . When subsequently treated with a single injection of iluvien, there were large and rapid improvements in va and cft that were maintained for the following 2 years . Worldwide diabetic macular edema (dme) is reported to have a prevalence of 6.8% and results in vision loss . Dme management can be difficult, with only around 15% of the patients achieving significant vision recovery with laser, the current standard of care . A number of pharmacotherapies are now licensed for the treatment of dme in europe, including anti - vascular endothelial growth factor agents and corticosteroid therapies, which are used to target vascular endothelial growth pathways and inflammatory pathways, respectively . In diabetes, leukocytes release free radicals and enzymes that cause direct damage to endothelial cells, increasing blood retinal barrier leakage . They also release cytokines, including vascular endothelial growth factor, tumor necrosis factor-, and interleukin-6, which act through various signaling pathways to increase vascular permeability . The release of cytokines with a corticosteroid such as dexamethasone, triamcinolone or fluocinolone has been shown to reduce dme and rehabilitate vision in several pivotal clinical studies . Iluvien contains the corticosteroid fluocinolone acetonide (fac) and uses microdosingtm technology to release fac at a daily rate of 0.2 g for up to 3 years . This differs significantly from both the dexamethasone delivery system and that of triamcinolone, which are reported to have a duration of action of only up to 3 and 4 months, respectively . The effectiveness of iluvien was demonstrated in the fame trials (nct00344968) in which patients with dme who had previously shown an insufficient response to laser were treated with either a 0.2 g / day (iluvien) or 0.5 g / day fac implant and were compared against a sham - control treated population . Both fame trials independently met their primary endpoint and showed that significantly more patients with chronic dme treated with the 0.2 g / day fac implant experienced a 15-letter improvement in visual acuity (va) at month 24 than sham - control patients (pooled data; 34.4 vs. 13.4%; p <0.001) and that this benefit was sustained to month 36 . Functional improvements were accompanied by rapid and sustained improvements in central foveal thickness (cft). In europe, iluvien is indicated for the treatment of vision impairment associated with chronic diabetic macular oedema considered insufficiently responsive to available therapies . Since then miss clare bailey presented the real world outcomes from a uk audit of patients treated with iluvien at the annual meeting of the royal college of ophthalmologists in birmingham, uk, between june 24 and 26, 2016 . This unpublished interim analysis showed that the majority of treated eyes (69.4% of 290 eyes) maintained or improved va . To date, however, relatively limited data with a longer - term follow - up of the functional and structural responses following treatment with iluvien have been reported . The case described herein provides data for both va and cft over a 24-month follow - up period . A 68-year - old caucasian female with type 2 diabetes mellitus had diffuse dme diagnosed in her left eye in october 2010 . The treatment history is summarised in table 1 and was previously reported when only 6 months of follow - up were available . At diagnosis, va was 46 early treatment diabetic retinopathy study (etdrs) letters, converted from snellen va using the equation 85 + 50 x log (snellen fraction), cft was 712 microns, and intraocular pressure (iop) was 22 mm hg . The patient had phacoemulsification plus intraocular lens insertion in the left eye in february 2012 . Intravitreal triamcinolone acetonide was also administered to treat the persistent dme postoperatively . At the first postoperative visit, va was 70 etdrs letters, cft was 278 microns, and iop was 20 mm hg . Over the next 5 months, va (50 etdrs letters) and cft (805 microns) progressively worsened, and the patient was admitted into the matisse trial in september 2012 to test the effects of ranibizumab plus a small - interfering rna agent . Between october 2012 and march 2014, the patient received 5 injections of ranibizumab plus the small - interfering rna agent and then subsequently listed for 2 further courses of 3 intravitreal injections of ranibizumab . By the end of this stage of treatment, by 1 month after the final injection of ranibizumab, the dme had recurred, va was 55 etdrs letters, cft was 774 microns, and iop was 17 mm hg . The patient's dme was now chronic (over 18 months of duration), relapsing, and her crt had fluctuated wildly through the different treatment phases, which is believed to have a deleterious effect on the function of the retina and, more specifically, on the visual function due to the presence of submacular fluid . It was at this stage that the patient was treated with iluvien according to nice ta301 (please see http://www.nice.org.uk/guidance/ta301/chapter/1-guidance). Figure 1 shows the response of va and cft after a single iluvien implant without any further treatment to this eye over the next 2 years . Within 7 days, va had increased to 61 etdrs letters and cft had decreased to 267 microns . Within 2 weeks, va had improved further to 70 etdrs letters, which is the legal requirement to hold a driving license in the uk . These early improvements were then largely maintained throughout the next 24 months without further intervention, as shown in figure 1 . Figure 2 shows optical coherence tomography scans before and after iluvien implantation, illustrating the structural improvement that occurred alongside the functional improvement in vision . Over the course of the 2-year period, iop remained below 21 mm hg, and no iop - lowering medication was required . This is the first case that the authors are aware of, which shows that a single injection of the 0.2 g / day fac implant leads to rapid improvements (within 7 days) in va and cft that are maintained over 2 years of follow - up . This was despite 11 previous injections of ranibizumab, which failed to control the dme prior to treatment with iluvien . The functional and structural responses presented herein are consistent with those reported in the fame trials, with rapid and marked responses observed early and being sustained in the long term . This patient will continue to be monitored to see if the responses reported in controlled clinical trials are replicated with a single injection in real - life uk practice over a 36-month period . This article does not contain any new studies with human or animal subjects performed by any of the authors . F. quhill has attended advisory boards and speaker engagements and has been remunerated for these by alimera sciences.
Patients were recruited from the epilepsy clinic at austin health, from the practices of investigators, and by referral for epilepsy genetics research from around australia and internationally . Informed consent was obtained from the patient or his or her parent or legal guardian . The study was approved by the institutional review boards of austin health and the university of washington . We used molecular inversion probes to capture all exons and 5 base pairs of flanking intronic depdc5 sequence; next - generation sequencing and data analysis were performed as described previously in 130 patients with epileptic spasms of unknown etiology . Known epileptic encephalopathy genes had been excluded in many cases (unpublished data, carvill et al ., january 2015). We considered only nonsynonymous, splice site, or frameshift variants that were present at an allele frequency <1% in 61,000 exomes of the exome aggregation consortium (exac) data set (to exclude single nucleotide polymorphisms) (http://exac.broadinstitute.org/) for further analysis and performed segregation analysis for these rare variants in available family members . We considered truncating variants to be pathogenic and missense variants that were either inherited from an affected parent or arose de novo to be possibly pathogenic . Maternity / paternity was confirmed using the powerplex s5 system (promega, madison, wi). We included an additional novel depdc5 case, identified through commercial genetic testing (d: ii:1), and additional phenotypic data on cousins from our earlier report (family e). Patients were recruited from the epilepsy clinic at austin health, from the practices of investigators, and by referral for epilepsy genetics research from around australia and internationally . Informed consent was obtained from the patient or his or her parent or legal guardian . The study was approved by the institutional review boards of austin health and the university of washington . We used molecular inversion probes to capture all exons and 5 base pairs of flanking intronic depdc5 sequence; next - generation sequencing and data analysis were performed as described previously in 130 patients with epileptic spasms of unknown etiology . Known epileptic encephalopathy genes had been excluded in many cases (unpublished data, carvill et al ., january 2015). We considered only nonsynonymous, splice site, or frameshift variants that were present at an allele frequency <1% in 61,000 exomes of the exome aggregation consortium (exac) data set (to exclude single nucleotide polymorphisms) (http://exac.broadinstitute.org/) for further analysis and performed segregation analysis for these rare variants in available family members . We considered truncating variants to be pathogenic and missense variants that were either inherited from an affected parent or arose de novo to be possibly pathogenic . Maternity / paternity was confirmed using the powerplex s5 system (promega, madison, wi). We included an additional novel depdc5 case, identified through commercial genetic testing (d: ii:1), and additional phenotypic data on cousins from our earlier report (family e). We sequenced all depdc5 target base pairs to a depth of 50 at a median of 90% across all samples . We identified likely pathogenic variants in 3 of 130 (2.3%) patients with epileptic spasms of unknown etiology (table 1, figures 1 and 2). A total of 92 of 130 patients had west syndrome, while 38 had epileptic spasms in association with other epileptic encephalopathies . In 2 cases (families a and c), the depdc5 variants occurred de novo . Patient b: iii:2 inherited a truncating mutation not seen in controls from a father with frontal lobe epilepsy . Patient c: iii:3, who was of chinese descent, had a de novo missense variant that disrupted a highly conserved nucleotide, which was predicted to be damaging by 2 of 3 in silico tools (table 1). This variant occurred in 71 individuals in exac, including 66 of 8,732 individuals of east asian descent (minor allele frequency [maf] 0.7%). Clinical and molecular features in patients with depdc5 variants and epileptic spasms we describe 6 patients in 5 families with depdc5 variants and spasms . Variants arose de novo in 2 cases (families a and c) and were inherited in 3 (families b, d, and e). Upper panel of the schematic shows all previously reported truncating mutations (black) and those described in this study (red). Lower panel shows all missense mutations in previous studies (black) and those described in this study (red), numbers in parentheses show the highest population maf from the exac data set, and black lines show the missense variants present in exac and variable frequencies . Many of the missense mutations described in patients are present at appreciable frequencies in controls, and there are many missense variants across the gene . It will be vital to perform functional experiments to test the functional effect of these variants, to understand whether and how they cause disease, and to understand the incomplete penetrance that is a common feature of this disorder . We describe 2 additional families with inherited depdc5 variants in whom 1 or more affected family members presented with spasms (table 1, figure 1). Family d, ascertained through commercial testing, had a tyr281phe variant, which is highly conserved and predicted to be damaging by 2 of 3 tools (table 1). This variant was present in 5 of 67,552 (maf 0.0007%) individuals of non - finnish european descent . Family e carries a splice site mutation, and we describe 2 patients with infantile spasms from this previously reported family . Spasms were the presenting seizure type in each case, with onset at 612 weeks in 5 cases and late onset at 2 years, 8 months in 1 . Two had easily controlled spasms, both with offset at 6 months . In 4 cases, spasms had focal electroclinical features . Eeg features included multifocal epileptiform abnormalities, generalized paroxysmal fast activity, and slow spike waves (figure e-1 at neurology.org/ng). Three cases had later focal seizures with impaired awareness and onset from 9 months to 13 years; all were refractory . One patient, e: iv:2, had normal intellect and no developmental regression with spasm onset; at 34 years, she was a professional . Brain mri revealed temporal focal cortical dysplasia (fcd) in a: iii:2 and frontal fcd in d: ii:1 (figure e-2). D: ii:1 had a histologically confirmed left frontal fcd type iia (figure e-3). After anatomic left frontal lobectomy, the patient was seizure - free for 6 months and then had return of head drops and tonic seizures . We sequenced all depdc5 target base pairs to a depth of 50 at a median of 90% across all samples . We identified likely pathogenic variants in 3 of 130 (2.3%) patients with epileptic spasms of unknown etiology (table 1, figures 1 and 2). A total of 92 of 130 patients had west syndrome, while 38 had epileptic spasms in association with other epileptic encephalopathies . In 2 cases (families a and c), the depdc5 variants occurred de novo . Patient b: iii:2 inherited a truncating mutation not seen in controls from a father with frontal lobe epilepsy . Patient c: iii:3, who was of chinese descent, had a de novo missense variant that disrupted a highly conserved nucleotide, which was predicted to be damaging by 2 of 3 in silico tools (table 1). This variant occurred in 71 individuals in exac, including 66 of 8,732 individuals of east asian descent (minor allele frequency [maf] 0.7%). Clinical and molecular features in patients with depdc5 variants and epileptic spasms we describe 6 patients in 5 families with depdc5 variants and spasms . Variants arose de novo in 2 cases (families a and c) and were inherited in 3 (families b, d, and e). Upper panel of the schematic shows all previously reported truncating mutations (black) and those described in this study (red). Lower panel shows all missense mutations in previous studies (black) and those described in this study (red), numbers in parentheses show the highest population maf from the exac data set, and black lines show the missense variants present in exac and variable frequencies . Many of the missense mutations described in patients are present at appreciable frequencies in controls, and there are many missense variants across the gene . It will be vital to perform functional experiments to test the functional effect of these variants, to understand whether and how they cause disease, and to understand the incomplete penetrance that is a common feature of this disorder . We describe 2 additional families with inherited depdc5 variants in whom 1 or more affected family members presented with spasms (table 1, figure 1). Family d, ascertained through commercial testing, had a tyr281phe variant, which is highly conserved and predicted to be damaging by 2 of 3 tools (table 1). This variant was present in 5 of 67,552 (maf 0.0007%) individuals of non - finnish european descent . Family e carries a splice site mutation, and we describe 2 patients with infantile spasms from this previously reported family . Spasms were the presenting seizure type in each case, with onset at 612 weeks in 5 cases and late onset at 2 years, 8 months in 1 . Two had easily controlled spasms, both with offset at 6 months . In 4 cases, spasms had focal electroclinical features . Eeg features included multifocal epileptiform abnormalities, generalized paroxysmal fast activity, and slow spike waves (figure e-1 at neurology.org/ng). Three cases had later focal seizures with impaired awareness and onset from 9 months to 13 years; all were refractory . One patient, e: iv:2, had normal intellect and no developmental regression with spasm onset; at 34 years, she was a professional . Brain mri revealed temporal focal cortical dysplasia (fcd) in a: iii:2 and frontal fcd in d: ii:1 (figure e-2). D: ii:1 had a histologically confirmed left frontal fcd type iia (figure e-3). After anatomic left frontal lobectomy, the patient was seizure - free for 6 months and then had return of head drops and tonic seizures . We first identified depdc5 in familial focal epilepsy, and here we show its relevance to epileptic spasms, illustrating the convergence of phenotypes in genetic mutations of the mtor pathway . Our findings suggest that greater significance should be attributed to a family history of focal seizures in patients with epileptic spasms . Affected family members had focal epilepsies emanating from different cortical regions, consistent with the pattern of ffevf . Infantile spasms have an identifiable etiology in 60% cases and may include hypoxic - ischemic or metabolic encephalopathies, malformations, infection, and chromosomal anomalies . A family history of spasms is rare but has been described in conditions such as tsc and specific genetic diseases such as arx . The importance of de novo mutations has recently been emphasized, with a pathogenic mutation attributed to a single gene identified in 5%16% of cases (n = 268 from 3 studies using next - generation sequencing technologies) (table e-1). The most frequently mutated genes were stxbp1 (n = 6), cdkl5 (n = 2), kcnq2 (n = 2), and alg13 (n = 2). Our finding of a depdc5 variant in up to 2.3% of patients in our cohort suggests that this gene may be one of the more frequent genes associated with epileptic spasms, taking into account that this cohort had been previously screened for many of the known genes . As only 1 patient showed classic hypsarrhythmia, the cohort may have some fundamental differences from other studies of infantile spasms in which hypsarrhythmia is essential for inclusion . We identified 3 truncating mutations: 1 occurred de novo and the remaining 2 were inherited . This is in keeping with previous reports in which the overwhelming majority of pathogenic depdc5 mutations resulted in premature truncation of the protein (figure 2), suggesting that depdc5 mutations cause disease by haploinsufficiency of the protein . This is further supported by the presence of only 15 truncating variants in the 61,000 exomes in exac . However, we report 2 missense variants, pro1031his (maf 0.7%) and tyr281phe (maf 0.007%), and there are more than 400 missense variants in exac . Tyr281phe is exceedingly rare, and incomplete penetrance of depdc5 mutations may explain the presence of these variants in the population . However, the 0.7% maf of pro1031his (arose de novo in family c) seems too high in this population to be explained solely by incomplete penetrance, and this result needs to be interpreted with caution . This may also be true for several reported missense mutations also present in controls at low frequencies (figure 2). It will be important to develop robust functional experiments to assess the pathogenicity of these missense variants in the future . We have combined a targeted resequencing approach in 130 patients and results from clinical diagnostics and extended phenotyping in a known mutation - positive family to determine several notable features that highlight the variability of onset and outcome of depdc5-associated spasms . Our findings expand the depdc5 phenotypic spectrum to include more severe epilepsies presenting with spasms . First, the outcome may be excellent with normal intellect, although most of our patients had intellectual disability with or without autistic features . Third, 1 patient had later onset of spasms in the third year with further cognitive decline in adolescence . Fourth, 2 patients had malformations with fcd; in 1, surgery resulted in seizure improvement . Surprisingly, only 1 patient showed hypsarrhythmia on eeg; however, all had highly abnormal eegs with abundant epileptiform activity, which can be associated with epileptic spasms . The absence of classic hypsarrhythmia means that these patients differ from those with west syndrome, which has been the focus of many recent genomic studies . Of note, spasms were present in patients with fcd (2 patients) and those without fcd (3 patients) after careful scrutiny of the mri . Because many patients with focal epilepsies and depdc5 mutations have normal mri, the presence of detectable lesions is not necessary for the development of seizures . Rather, loss - of - function mutations in depdc5, an inhibitor of the mtor pathway, presumably lead to excessive signaling of this pathway, which has many functions that could conceivably contribute to hyperexcitability . This scenario would be analogous to tsc, in which a second mutation in the mtor regulators tsc1 and tsc2 is reported in some tumors of patients with tsc . In patients with depdc5 mutations, second hit could occur either on the other allele or on another gene involved in the mtor pathway . Alternatively, an acquired cause, such as a human papillomavirus, has been conjectured to be a deep targeted or even whole - exome sequencing should be performed on resected tissue to explore this hypothesis . Given the incomplete penetrance of depdc5 mutations and the discovery of both inherited and de novo mutations, molecular approaches for epileptic spasms should interrogate both inheritance patterns . The detection of inherited mutations has important reproductive counseling implications for families of children with spasms, which needs to incorporate increased risk for comorbidities such as intellectual disability and autism spectrum disorders . The recognition of spasms in depdc5 epilepsies parallels other mtoropathies such as tsc and ste20-related kinase adaptor alpha syndrome . Although many depdc5 epilepsies are milder, the convergence of the phenotypic spectrum and molecular pathways suggests that targeted mtor therapies may benefit patients with the more severe depdc5 disorders . G.l.c . : drafted / revised the manuscript, study design, acquisition of data, and data analysis . D.e.c . : drafted / revised the manuscript, acquisition of data, and data analysis . B.m.r . :, s.f.b ., and j. sullivan: acquisition of data and data analysis . I.e.s . And h.c.m . : drafted / revised the manuscript, study design, acquisition of data, and data analysis . This work was supported by funding from the nih (ninds 5r01ns069605) to h.c.m . Is supported by a postdoctoral fellowship from the epilepsy foundation and the lennox and lombroso fund and the nih (ninds 1k99ns089858). I.e.s ., s.f.b ., and l.d . Are supported by a national health and medical research council of australia (nhmrc) program grant . Is supported by an nhmrc practitioner fellowship and l.d . Is supported by an nhmrc career development fellowship (1032603). The work was also supported by the university of washington intellectual and developmental disabilities research center genetics core (nih u54hd083091). Dr . Carvill is a member of the scientific advisory board of ambry genetics and has received grants from the nih / national institute of neurological disorders and stroke, the epilepsy foundation and lennox and lombroso trust, and citizens united for research in epilepsy . Crompton has received research support from the national health and medical research council of australia . Mcmahon has received research support from the national health and medical research council of australia . Howell has received research support from the national health and medical research council gustav nossal postgraduate scholarship and her husband holds stock options for general electric (medical imaging equipment). Mandelstam has been an employee of the royal children's hospital, the melbourne brain centre, and the university of melbourne . Dr . Leventer has received honoraria for travel from the asia oceania congress of child neurology and has received research support from the national health and medical research council project grant 1068278, the national health and medical research council project grant 1059666, and campbell edwards trust research support . Mullen has been an employee of the florey institute of neuroscience and mental health, the university of melbourne, australia austin health, and australia eastern health; has received travel funding from the american epilepsy society young investigator award; and has received research support from the nhmrc early career fellowship and nhmrc project grant . Berkovic has served on the scientific advisory board of ucb pharma; has served on the editorial boards of brain, epileptic disorders, and lancet neurology; has received research support from the national health and medical research council of australia; has received honoraria from ucb; has a patent for pcdh19 testing planned and is one of the inventors listed on a patent held by bionomics inc . On diagnostic testing of using the scn1a gene; has received payment for development of educational presentations from ucb pharma, novartis pharmaceuticals, sanofi - aventis, and janssen - cilag; and has been a consultant to bionomics and athena diagnostics . Dr . Sullivan has been the chair of sab for nonprofit entity pcdh19 alliance; has received honoraria from zogenix; and has received research support from marinus pharmaceuticals . Scheffer has served on scientific advisory boards for ucb and janssen - cilag emea; has served on the editorial boards of the annals of neurology, neurology, epilepsy currents, progress in epileptic disorders series, virtual neuro centre, and epileptic disorders; holds patents for methods of treatment and diagnosis of epilepsy by detecting mutations in the scn1a gene, a diagnostic method for epilepsy, mutations in ion channels, diagnostic and treatment methods relating to autosomal dominant nocturnal frontal lobe epilepsy (pending), gene and mutations thereof associated with seizure disorders, a gene and mutations thereof associated with seizure and movement disorders, and diagnostic and therapeutic methods for efmr; may accrue future revenue on pending patent wo61/010176 (filed: 2008): therapeutic compound; has received speaker honoraria from glaxosmithkline, athena diagnostics, ucb, biocodex, and janssen - cilag emea; has received funding for travel from athena diagnostics, ucb, biocodex, glaxosmithkline, janssen - cilag emea, aoccn taiwan, weizmann institute, the american academy of neurology, irccs oasi maria ss, sanofi china, qbi university of queensland, international league against epilepsy, australian academy of science, commonwealth department of industry, westmead hospital, perpetual, university of california, matthew's friends, sbs, pts for nfle conference, turkish child neurology association, european congress on epileptology, international child neurology association, ucb, movement disorder society, international epilepsy congress, university of auckland, world congress of neurology, epileptic disorders, eisai, aoccn, sanofi, and transgenomic; and has received research support from the national health and medical research council of australia, nih, australian research council, health research council of new zealand, cure, american epilepsy society, us department of defense autism spectrum disorder research program, the jack brockhoff foundation, the shepherd foundation, perpetual charitable trustees, the university of melbourne, the epilepsy association of tasmania, melbourne neurosciences institute, weizmann institute, cure sudep award, and perpetual philanthropic services . Dr . Mefford has received research support from the nih / national institute of neurological disorders and stroke, the burroughs wellcome fund, the american thoracic society foundation partner award, and simon's foundation for autism research; has served on the editorial board of science translational medicine, is a consultant for sera prognostics and the simons foundation (sfari gene advisory board); and has served on the scientific advisory boards of the lennox gastaut foundation and supporting families with koolen - de vries syndrome.
Previous studies have shown a close relationship between bone density and success of implant treatment [27]. Bone quality is determined by cortical bone thickness, the amount of trabeculae and mineralization and can be evaluated by bone density assessment . Several methods have been proposed for bone quality assessment; among which, volumetric imaging techniques are the most feasible . These techniques enable the clinicians to assess bone density without any superimposition, which is a major limitation of plain radiography . Computed tomography (ct) is a useful method for bone density assessment prior to dental implant surgery and has been accepted as the gold standard for such evaluations . Cone - beam computed tomography (cbct) has become a widely used imaging modality for pre - implant assessment in the recent years . Compared with ct scan, cbct images provide superior resolution and lower patient radiation dose . Despite the wide application of cbct in implant dentistry, some studies advocate it as a reliable substitute for ct in this respect and confirm its validity [1,2,6,7,1316] while others have brought it into question . Hounsfield unit (hu) is the standard scheme for scaling the reconstructed attenuation coefficient in medical ct systems . In cbct systems, the gray values are used to represent the reconstructed values, although it has not yet been proposed as a standard system . In the present study, the correlation between the gray values obtained from cbct and the hus in ct images was evaluated and the effect of the type of tissue, tissue thickness, acquisition parameters and location was assessed in this regard . In this in vitro diagnostic study, we compared the tissue density values on cbct and ct images in four different tissue phantoms with two different thicknesses, two different acquisition settings and in three locations in the phantoms . The phantoms used in this study simulated different densities namely hard tissue, soft tissue, water and air . Hard tissue equivalent phantom was made of bovine bone powder mixed with epoxy resin with the proportion of 0.55:1 in the laboratory of nuclear engineering department of shahid beheshti university . Soft tissue equivalent phantom consisted of a 1 cm - thick plexiglas slab, suggested by the medical engineering and medical physics department of shahid beheshti university . They were fixed over each other and placed in a clear plastic cylindrical container (biokips, komax industrial co. ltd ., the phantoms were positioned at the center of the field of view (fov). For easy repeatability, the phantoms were scanned three times to increase precision using ge bright speed 16 slice multi detector ct scan system (general electric, schenectady, new york, usa) with two different exposure settings . It was also scanned three times with two different acquisition settings using three different cbct units namely scanora 3d (soredex, helsinki, finland), newtom vg (afp, verona, italy) and pro - max 3d (planmeca, helsinki, finland). Exposure parameters for different units in the first phase, six different series of scans were obtained by each unit, three with high and three with low acquisition settings, all in full thickness . In the second phase, the new series of scans were obtained by the same units and the same acquisition parameters but with half thickness . In order to overcome the effect of various computer programs, all ct and cbct images were imported into a single computer program (workstation 2.1 merge emed, the ct number of ct images and the voxel value in cbct images were evaluated . Three definite locations were selected on each image: at the middle (m; 270 mm from the periphery), on the periphery (p), and an intermediate point between these two (int; 140 mm from the periphery) on the radius of phantom with a constant region of interest (roi; fig . These points were selected on a slice and distributed to all using a software option to evaluate the same location in all slices and scans . The same was done for the half thickness images . An oral and maxillofacial radiologist observed and recorded the values in all images . Evaluation of hus in hard tissue phantom with merge e - film software in three times of scanning in full thickness phantom . The relationship between ct numbers on ct scans and the gray values of cbct images was studied by anova (p<0.05). The effects of the type of material, acquisition parameters, phantoms thickness and location of the assessed point on the phantoms were also studied . The relationship between ct numbers on ct scans and the gray values of cbct images was studied by anova (p<0.05). The effects of the type of material, acquisition parameters, phantoms thickness and location of the assessed point on the phantoms were also studied . In the first evaluation, the interaction effect of the variables was found to be significant using results were not the same in different conditions and each variable had to be examined separately . The results of anova used to compare the cbct and ct data are shown in tables 2 and 3 . Comparison of voxel values in cbct systems with hounsfield units in ct in full thickness phantoms ns: non - significant s: significant comparison of voxel values in cbct systems with hounsfield units in ct in half thickness phantoms ns: non - significant s: significant bone quality and quantity assessment is critical for pre - implant surgeries; thus, reliable and precise radiographic evaluations are essential . However, despite wide use of cbct in different fields of dentistry, it is still not a valid method for bone quality assessment [4,1416,1921]. Object location in cbct systems, object volume, acquisition parameters and some other factors have been evaluated in previous studies and controversial results have been reported [7,8,10,11,1316]. In this study, the diagnostic accuracy of three cbct systems was compared with that of ct as the gold standard, and the effect of four factors including different tissue phantoms, object volume size, acquisition parameters and location of the objects was assessed . As the results showed, none of the cbct systems revealed the precise bone density as the gold standard . In this study, different tissue phantoms were used to evaluate diagnostic accuracy of cbct systems in different density ranges . Review of the literature revealed that only mah et al, used standard phantoms . Heterogeneity of the hard tissue and air phantoms was a limitation of our study and was due to the production process . They were handmade in a laboratory and even in the best conditions, porosities were seen . However, in the clinical setting, the tissues are not homogenous; thus, this factor may not be a real limitation for generalization of results to the clinical setting . However, in this study, the results showed no significant effect of this restriction by comparing the data of the four phantoms . The effect of tissue thickness is one of the main subjects for researchers to asses in density studies . In the first phase, the complete thickness and in the second phase, half - thickness samples were evaluated, which showed no considerable effect on assessment of the tissue density . The results were different in the two phases and there was a significant difference in results compared with ct system . Katsumata et al, showed that the thicker the tissues, the more precise the values of tissue density . They discussed that beam characteristics may be a more important factor than the tissue thickness, which is because of the 360-degree rotation of the system and changes in the intensity of the x - ray beam while passing through different parts of an object, which causes maximum and minimum x - ray intensities . Considering the importance of this factor, we used different acquisition parameters to evaluate the importance of the effect of intensity of x - ray beam on tissue density . In our study, despite the changes in the values, no significant difference was shown between the various image acquisition parameters of cbct systems and all values were different from the ct numbers . Parsa et al, found a significant difference between ct and cbct values and showed changes in cbct values with changes in acquisition parameters . Gray values increased with increase in size of fov in accuitomo system but this increase was obtained with an increase in volume in newtom system . This discrepancy between the behaviors of the two systems could be attributed to the variability in reconstruction and post - processing methods applied by the two manufacturers . However, one theory suggests that the tissue density of an object is more effective than the beam intensity and characteristics in showing the actual tissue density . To evaluate and interpret the cbct and ct images, we used only one software which can show the same level of tissue density in both systems, the point which was confirmed by ghasemi et al . By doing so mah et al, who used 11 types of cbct systems also used only one software program (on demand 3d) to match the observing conditions and roi in all sections . This fact is important in density assessment studies and can affect the results . Because of the variable geometric characteristics of different systems, the density values and the selected roi are variable in different software programs provided by the systems . Katsumata et al, emphasized that the selected roi should be the same in all sections with at least 3% error . In their study, ct images were also examined by the same software program to achieve the same situation in all conditions . Nevertheless, mah et al, believed that human error is inevitable in selecting the roi . However, no specific method for precise selection of an area in different conditions has been suggested in studies except in a study by naitoh et al, who emphasized on selection of equal points via observation . By choosing three different points in an object, we wanted to evaluate the effect of object location in the fov on tissue density . Legravere et al, did not report any significant difference in different locations in the tube field in their study, which was in contrast to the results of oliveira et al, who noticed that the correlation between the object density and ct number in cbct systems was not uniform through the dental arch . We found no significant difference between different locations in the diversity between the voxel values and hus . Hua et al, found that some artifacts and scatter radiation are responsible for inefficacy of cbct for density assessment, which are inevitable because of the design of cbct systems and their detectors . Considering the inefficacy of cbct for density evaluation, the x - ray beam heterogeneity in cbct can affect hu values, and lead to absence of a clear relationship between voxel value in cbct and bone mineral density provided by dual x - ray absorptiometry . The artifacts such as beam hardening or heel effect can decrease the validity of these values . Several studies mentioned the difference between the cbct values and the ct values and in most cases, the reported cbct values were higher than the ct values . Parsa et al, mentioned higher gray value in their study and believed that it may be due to the increased noise level, scattering and artefacts specific to the scanning technology . Scarf and farman proposed that although a sort of association was seen between the provided hus by ct and voxel value in cbct, the variability in measurements by cbct was higher than that by ct . However, legraver et al, found a linear relationship in r (coefficient of relationship between two variables) between the values in cbct and ct, and indicated that the cbct values were generally higher . In our study, the provided values by cbct were higher than the ct values in one of the systems (newtom vg 3d), which is similar to the results of legrave et al, who used the same system for the same purpose . According to this point of view, the difference between the values in our study can be the result of different levels of energy in the three systems; because the systems with a lower power result in lower intensity of x - ray beam and subsequently less tissue penetration depth . In order to create parallel conditions between the experimental phases and the clinical setting, the suitable acquisition parameters for each system were determined by an expert operator . Thus, the levels of kvp and mas were specific and different in the three systems . Haristory et al, studied the effect of different exposure parameters on the voxel value of cbct and found a strong relationship between cbct and ct using r value . However, because of different results in cbct, they suggested that the use of calibration phantom is necessary before imaging to ensure accurate bone density values . Despite the afore - mentioned results, some studies showed inefficacy of this system in providing accurate values of bone density and found a linear relationship; thus, a high correlation between the results of cbct and ct was achieved . A study confirming the optimal efficacy of cbct systems to estimate bone density introduced a conversion coefficient . Nomura et al, reported a relationship between two systems in evaluating bone mineral density and voxel value, but because of the nonlinear regression obtained in their study, further studies were suggested . However, a linear relationship and high correlation coefficient between these values have been shown in several studies . By applying the attenuation coefficient in an equation, mah et al, obtained the hu values of tested materials from the voxel values with only a small difference from the actual hu values . Considering all the above, we can say that our methodology, which is one reason for the uniqueness of this study, affected the results, and our results do not completely reflect the efficacy of the systems tested . As recently stated by pauwels et al, it is logical to postulate that although attempts have been made to correct the gray level variability, quantitative use of values provided by cbct should be generally avoided at this time . According to the results, the cbct systems were not able to show the accurate value of tissue density and the factors such as type of tissue (hard, soft, water, air), thickness (full against half), image acquisition conditions (high settings against low settings) and object location (middle, peripheral and intermediate) did not affect density evaluation by cbct systems.
Damage of the cell membrane system, especially the plasma membrane, is one of the primary events in heavy metal toxic action in plants . Disruption of membrane integrity is thought to be an effect of a complex interaction between heavy metals and functional groups of membranes . It is well known that metal ions are easily bound to both the sulphhydryl groups of proteins and the hydroxyl part of phospholipids (devi and prasad, 1999). They can also replace the calcium ions at essential sites on the cell membranes (breckle and kahle, 1991). All those events result in an increase of a non - specific membrane permeability and the parallel decrease of specific transporting activities which disrupt the ionic homeostasis and, subsequently, the activities of many enzymes crucial for basic cell metabolism . The atp - dependent proton pump of the plasma membrane has a central function in the regulation of ion homeostasis in the cytosol . This enzyme is encoded by a multigene family (portillo, 2000; arango et al ., 2003) and the expression of at least some isogenes is differentially regulated according to tissue type and developmental stage (oufattole et al ., 2000). Many studies have also shown changes in the gene expression of the plasma membrane h - atpase in response to a variety of environmental factors, including salt stress (binzel, 1995), dehydration (surowy and boyer, 1991), light conditions (harms et al ., 1994), mechanical stress (oufattole et al ., 2000), and externally applied hormones (fras et al ., 1996). Increasing evidence indicates that, besides the genetic regulation of the proton pump, its activity might be fast modulated post - translationally at the protein level, mainly through reversible phosphorylation (schaller and sussman, 1988; portillo, 2000). This important role in the regulation of the plasma membrane h - atpase has its autoinhibitory domain in the c - terminal region of the enzyme (jahn et al ., 1997; oecking et al ., 1997; baunsgaard et al ., 1998; the c - terminal tail interacts with the catalytic region of the enzyme, limiting its activity (portillo, 2000). Many data have suggested that the activation of the plant plasma membrane h - atpase is mediated through phosphorylation of the thr-948 in the enzyme, which allows the binding of 14 - 3 - 3 protein (svennelid et al ., 1999). This causes displacement of the c - terminal tail and activates the pm h - atpase (palmgren, 2001; arango et al ., 2003). Dephosphorylation of the enzyme protein, mediated by the specific phosphatases belonging to the pp2 and followed by the release of 14 - 3 - 3 protein from the complex, inactivates h - atpase . To date, data concerning heavy metal action on the plasma membrane h - atpase are very limited . Only a few observations have indicated that enzyme activity was decreased under heavy metal stresses (kennedy and gonsalves, 1989; fodor et al ., 1995). However, no attempts were undertaken to elucidate the mechanisms involved in this inhibition . In this work, to explain the mechanism of metal action on the plasma membrane proton pump, the hydrolytic and transporting activities of h - atpase were measured simultaneously with the expression of genes encoding the enzyme . Moreover, the effect of cantharidin, a specific inhibitor of phosphatases, on the inhibitory action of metals on the h - atpase was determined . Since the activity of the plasma membrane proton pump depends on atp, the changes in its level were measured in plants treated with metals . Finally, the accumulation of cadmium, copper, and nickel in cucumber roots was asseyed to estimate to what degree the efficiency of metal absorption may affect the h - atpase activity . Krak), germinated in darkness at 25 c for 48 h, were transferred to a nutrient medium for 6 d. the nutrient solution contained 1 mm k2so4, 0.2 mm ca(h2po4)2.h2o; 1.5 mm caso4.0.5h2o, 0.3 mm mgso4.7h2o, and microelements 75 m ferric citrate, 10 m mnso4.5h2o, 5 m h3bo4, 1 m cuso4.5 h2o, 0.01 m znso4.7h2o, 0.05 m na2moo4.2h2o . After this the plants were exposed for 2 h to the 0.33 mm mes - naoh (ph 5.5) solution without (control) or with 10 m cd, cu or ni and 100 m cd, cu or ni . The plants were grown hydroponically with a 16 h photoperiod (180 mol m s) at 25 c during the day and 22 c during the night . Plasma membrane (pm) vesicles were isolated from cucumber root microsomes by phase partitioning according to the procedure by larsson (1985) and modified by kobus (1995). A 16 g phase system containing 6.2% (w / w) dextran t500, 6.2% (w / w) polyethylene glycol 3350, 330 mm sorbitol, 5 mm kcl, 5 mm btp - mes (ph 7.5) was used . The plasma membranes obtained by this procedure were mainly composed of right - side - out vesicles and were used to determine the hydrolytic atpase activity . Part of the vesicles was turned to the inside - out oriented form by the method of johansson et al . (1995) and used for the measurements of atp - dependent h transport in plasma membranes . The hydrolytic activity of the vanadate - sensitive atpase (pm - h - atpase) was determined according to the procedure of gallagher and leonard (1982), as modified by sze (1985). The reaction mixture contained 50 g of protein (plasma membrane), 33 mm tris - mes (ph 7.5), 3 mm atp, 2.5 mm mgso4, 50 mm kcl, 1 mm nan3, 0.1 mm na2moo4, 50 mm nano3, 200 m na3vo4, and 0.02% triton x-100 . Pm h - atpase activity was expressed as the difference between the activity measured in the absence and in the presence of na3vo4 . The pi released during the reaction was determined according to ames (1966) with 0.2% (w / v) sodium dodecyl sulphate included to prevent precipitation (dulley, 1975). H transport activity was measured spectrophotometrically as the change in acridine orange absorbance at 495 nm (a495) according to kobus and buczek (1995). The assay medium contained: pm vesicles (about 50 g of protein), 25 mm btp - mes (ph 7.5), 330 mm sorbitol, 50 mm kcl, 0.1% bsa, 10 m acridine orange, and 0.05% brij 58 . Proton transport was initiated by the addition of 3 mm mg - atp . For every combination, passive proton movement through the membrane protein was measured according to bradford (1976) in the presence of 0.02% triton x-100 with bovine serum albumin as the standard . Determination of adenosine triphosphate (atp) was made according to glaab and kaiser (1999). The fresh root material (1 g) was ground in liquid nitrogen and 5 cm of 4.5% perchloric acid was added and mixed until it thawed . The mixture was then supplemented with 0.125 cm 2 mm tris and centrifuged for 5 min at 5000 g. the ph of the supernatant was adjusted to 7.4 with 5 mol dm k2co3, and recentrifuged . Firefly luciferin - luciferase assay using a td-20/20 luminometer (turner designs, usa). Total and symplastic metal levels were determined spectrophotometrically (perkin - elmer 3300) in fresh root tissues digested with concentrated hno3 in a microwave . Prior to the determination of the symplastic metal pool after 2 h exposure to cu, cd or ni, the roots were washed with 5 mm pbcl2 at 0 c for 30 min, in order to remove the extracellular bound ions (harrison et al ., 1979). The apoplastic pool was calculated from the differences between the total and the symplastic metal level . Total rna was isolated from 50 mg of roots using tri reagent (sigma). To evaluate the expression of the pm - h - atpase gene (csha3), semi - quantitative rt - pcr analysis with specific primers for each gene was performed (titan one tube rt - pcr system, roche, germany). As an internal standard the following specific primers were designed for the pm - h - atpase gene (cucumber root h - atpase csha3, accession number ef375892) 5-aagtttgtggggttcatgtggaat-3 (forward primer); 5-gtaagaggaagtgactctccagtc-3 (reverse primer), and for actin the primers were 5-ccgttctgtccctctacgctagtg-3 (forward primer); 5-ggaactgctctttgcagtctcgag-3 (reverse primer). For the cdna reaction 18 cycles were run (uno ii thermoblock, biometra, germany), which corresponded to the exponential phase for the pm - h - atpase and actin genes . Each cycle was composed of a 30 s denaturation at 94 c, 30 s of annealing at 59 c, a 2 min 40 s extension at 68 c followed by 7 min of prolonged extension at 68 c . The gel images were digitally captured with a sony xc - st50ce camera and analysed using the biocapt version 99 program . For western blot analysis, 20 g of plasma membrane proteins were incubated in sds buffer containing 2% (w / v) sds, 80 mm dtt, 40% (w / v) glycerol, 5 mm pmsf, 10 mm tris, 1 mm edta, and 0.05% (w / v) bromophenol blue for 30 min at room temperature and separated on 7.5% sds - polyacrylamide gels (laemmli, 1970). After 1 h of electrophoresis at room temperature (25 ma) proteins were electrotransferred at room temperature (60 v, 200 ma) for 1.5 h to nitrocellulose using a sigma - aldrich sv10-eb10 blotting apparatus . Transfer buffer contained 25 mm tris, 150 mm gly, and 10% (v / v) methanol . To identify the plasma membrane h - atpase, the blots were incubated overnight at 8 c with monoclonal antibody against plasma membrane h - atpase, (46e5b11d) kindly provided by w michalke (universitt freiburg, germany). After repeated washing the nitrocellulose membrane was incubated at room temperature for 1 h with 1:4000 diluted secondary antibody (anti - mouse, conjugated to horseradish peroxidase, sigma - aldrich) and visualized by staining with dab . Phosphorylation of plasma membrane h - atpase was detected with the antibody against phosphothreonine (rabbit polyclonal to phosphothreonine, abcam) used at a concentration of 2 g ml after overnight incubation at 8 c . The membranes were rinsed and incubated for 1 h at room temperature with 5000-fold secondary antibody conjugated to horseradish peroxidase (goat polyclonal to rabbit igg, abcam). Data reported in the figures are the results from at least three experiments performed on independent preparation . Data reported in the figures are the results from at least three experiments performed on independent preparation . Treatment of the cucumber seedlings with heavy metals (cd, cu and ni) changed the hydrolytic and transporting activities of the plasma membrane h - atpase (figs 1, 2). The effect of 10 m cd and cu was similar, and both metals decreased hydrolytic activity by about 30% (fig . 1, white bars), whereas 10 m ni increased the hydrolysis of atp in plasma membrane vesicles by about 30% (fig . Higher concentrations of every metal (100 m) in nutrient solution caused the distinct inhibition of h - atpase activity (fig . The greatest inhibition of atp hydrolysis was observed in plasma membranes isolated from cucumber roots treated with cd (about 60%), while in the case of cu and ni it was 45% and 20%, respectively . All metals at both concentrations affected the transporting activity of the plasma membrane proton pump in a similar manner (fig . Effect of cd, cu and ni on the hydrolytic activity of h - atpase in plasma membrane vesicles . The plasma membrane was isolated from the control roots (control), and roots treated for 2 h with 10 m metals (white bars) or with 100 m metals (grey bars). Hydrolytic activity of h - atpase was measured as described in the materials and methods . Effect of cd, cu and ni on the proton transport activities measured in the plasma membrane vesicles . The plasma membranes (50 g of protein) were isolated from control roots (control), roots treated for 2 h with 10 m (a, open symbols) or with 100 m (b, closed symbols) of cd, cu or ni . After equilibration of membranes with the reaction medium (at least for 5 min), vesicle acidification was initiated by the addition of mg - atp to give a final concentration of 3 mm . The formation of ph gradient in the vesicles was monitored as the changes in acridine orange absorbance (a495). The values presented are representative for the results obtained in three independent experiments with each experiment done in triplicate . The results in the inner diagrams (the steady - state of h - transport) are means sd from those three independent experiments . The effect of metals on the plasma membrane proton pump could comprise the expression levels of a gene (mrna) as well as the enzyme protein level . To verify whether an alteration of enzyme activity under heavy metals was caused by changes in gene expression, the level of specific transcript of cucumis sativus plasma membrane atpase (genbank accession number ef375892) was determined using rt - pcr approaches . The transcript level of the constitutively expressed actin gene was used as the internal standard . 3a, c) and as a ratio of the pm - h - atpase gene signal in the selected line compared with the actin gene signal (fig . Transcript levels of the csha3 gene in roots treated with 10 m cd, cu and ni were similar to the control, indicating that the metal effect on plasma membrane h - atpase in our short - term experiments did not involve the gene level (fig . Also, higher concentrations (100 m) of cu and ni did not affect the expression of the csha3 gene, whereas in roots treated with 100 m cd the level of the transcript markedly declined (fig . Expression of the pm - h - atpase gene in cucumber roots treated with 10 m cd, cu or ni (a, b) and 100 m cd, cu or ni (c, d). Total rna was isolated from cucumber roots untreated (control, white bar) or treated for 2 h with 10 or 100 m heavy metals (grey bars). To evaluate the expression of pm - h - atpase and actin (internal standard) genes, semi - quantitative rt - pcr (titan one tube rt - pcr system, roche) with specific primers for each gene was performed . Ethidium bromide - stained bands for the atpase transcripts were quantified with respect to the band of actin . Rt - pcr results are presented as the gel image (a, c) and as a ratio of pm - h - atpase gene signal in the selected line to the actin gene signal (b, d). All experiments were repeated three times independently with comparable results (sd). Since the activity of h - atpase can also be rapidly changed through reversible protein phosphorylation, it was tested if cantharidin, the specific inhibitor of protein phospatases (pp2a, pp1), could affect the inhibitory effect of metals on the enzyme activity . When cucumber plants were exposed to 100 m cd, cu and ni in the presence of cantharidin the metal - dependent inhibition was partially diminished (fig . 4) suggesting that the effect of metals could involve dephosphorylation of h - atpase protein . Effect of metals and cantharidin on the hydrolytic activity of h - atpase in plasma membranes of cucumber roots . The plasma membranes were isolated from the control roots (control), from roots treated for 2 h with 100 m cd, cu and ni, (white bars) or from roots treated for 2 h with metals and 50 m cantharidin (grey bars). Hydrolytic activity of h - atpase was measured as described in the materials and methods . Data are expressed as a percentage of the enzyme activity determined in plasma membranes of control roots . The differences in phosphorylation of plasma membrane h - atpase after metal treatment of plants (2 h with 100 m cd, cu and ni) were also confirmed with the antibody against phosphothreonine (fig . 5b). To verify the specificity of the antibody against phosphoamino acids, a control with antibody against plasma membrane h - atpase, 46e5b11d, was used (fig . Figure 5b shows that the phosphorylation of plasma membrane atpase decreased in plants treated with heavy metals compared with the control . This result strongly indicates that, under heavy metal stress, dephosphorylation of plasma membrane h - atpase occurs . Western blot of plasma membrane protein (obtained from control plants or plants treated with 100 m cd, cu, ni) with antibodies raised against plasma membrane h - atpase -46e5b11d (a), and phosphothreonine (b). Therefore the amount of atp in tissues could be one of the factors limiting an active phospho - enzyme level . For that reason, atp levels in cucumber roots treated for 2 h with heavy metals were also measured . In general, atp contents in roots of plants stressed with every metal were lower than in the control (fig . 6). Plants were exposed for 2 h to the mes - naoh solution without (control, white bar) or with 10 m cd, cu or ni (grey bars) and 100 m cd, cu or ni (black bars). The data represent an average (sd) of three experiments; each assay was performed three times . Plasma membrane functions are rapidly altered by heavy metals present in the environment at high concentrations . The first diagnostic symptom of membrane damage by heavy metals is an increase in its permeability (fodor et al ., 1995) with a subsequent disturbance in the ionic balance of the cell . It is mainly caused by metal - induced changes in the composition of the membrane lipids and the saturation of fatty acids (de vos et al ., 1993). However, the action of metals is much more complex and comprise various events including the oxidation and cross - linking of protein thiols resulting in an inhibition of the key membrane proteins (harms et al ., 1994). One of the membrane enzymes which is altered in plants stressed with metals seems to be the h - atpase, the only proton pump operating in plasma membranes and playing a central role in the regulation of ion homeostasis . It was shown that the hydrolytic activity of h - atpase in roots of different plants was inhibited by cd (kennedy and gonsalves, 1989; fodor et al ., 1995) as well as cu (burzyski and kolano, 2003). The short - term treatment of cucumber with cd or cu reduced the hydrolysis of atp in the plasma membranes of root cells (fig . Moreover, the atp - dependent proton transport in membranes isolated from roots stressed with metals was also inhibited in a similar manner (fig . The effect of metals on both hydrolytic and transporting activities was dependent on their concentrations in the nutrient solution and correlated well with an accumulation in the symplast of the cells (table 1). A similar effect was observed in roots treated with higher concentration of ni (100 m), whereas lower concentrations of the metal slightly elevated both activities of the plasma membrane proton pump . Comparable observations were made earlier by burzyski and buczek (1994) and by ros et al . (1992) for the plasma membrane atpase in cucumber and rice grown with nickel . Interestingly, the action of nickel on the proton pumps was parallel to its effect on plant growth: low concentration of ni stimulated the growth of various crop species, while higher concentrations of the metal inhibited the growth of plants (brown et al . Since one of the main function of plasma membrane h - atpase is the regulation of growth (rayle and cleland, 1992), it could be suggested that the enhanced growth of plants subjected to low concentrations of ni and the lowered growth in the presence of higher concentrations of ni is, at least partially, a result of the modification of plasma membrane h - atpase activity by nickel . (2005) also observed the increase of plasma membrane h - atpase activity when plants were subjected to another metal aluminium . Results from real - time rt - pcr and immunodetection analysis indicated that the stimulation of the plasma membrane proton pump activity by al, in soybean roots, is caused by transcriptional and translational regulation . Total, symplastic and apoplastic metal levels in root tissues after 2 h of cucumber exposition to cd, cu or ni 10 seedlings were incubated in 50 cm of 10 or 100 mol dm of metal chloride solutions (ph 5.5). Cd, cu or ni levels were determined as described in the materials and methods . As mentioned above, the effect of metals on the plasma membrane proton pump was correlated with their concentration in the nutrient solution . However, possible reasons for the differential action of the metals on enzyme activity, in spite of similarities in their uptake, is not clear . The strongest inhibition of h - atpase was obtained after treatment of plants with cadmium . There is no correlation between enzyme protein inhibition and lewis acidity of metal ions or when the inhibition by metals is compared with the various ligands (hydroxyl, carboxyl, phosphoryl, amino, sulphydryl) present in cells (filippis, 1979). Heavy metal toxicity can be due to membrane distortion as shown earlier by the altered lipid content (burzyski and kolano, 2003). 1995) have indicated that saturation of fatty acid in the membrane of plants growing with metals increased, whereas the level of sterols significantly decreased . Since lipid composition and membrane fluidity are considered as significant factors regulating the plasma membrane h - atpase (hernandez et al ., 2002), an inactivation of the proton pump could be the result of the metal - induced changes in the plasma membrane . Inhibition of the plasma membrane proton pump in root cells under heavy metal stress could also result from alteration at the transcriptional as well as the post - transcriptional level . The plasma membrane h - atpase is encoded by a multigene family and it is generally accepted that the expression of at least some of them is differentially regulated in response to a variety of environmental stresses . Thus it could be assumed that heavy metals also affect the activity of the proton pump through an alteration of specific gene expression . However, using genetic approaches, it has been proved that, among the metals used in these experiments, only cadmium markedly decreased the level of csha3 mrna . Those observations are in agreement with other findings that show that cd is a very effective modulator (up- and down - regulation) of plant gene expression (fusco et al ., 2005; kovalchuk et al ., (2005) analysed the global genome expression in plants exposed to cd and have shown that there are at least 65 up - regulated and 338 down - regulated genes . Also in brassica juncea l., known as a hyperaccumulator plant, 73 transcript - derived fragments were identified as cd - responsive (fusco et al ., 2005). Among them 52 genes have been identified as encoding proteins with varied physiological functions (transcriptional factors, expression regulators, stress - responsive proteins, and proteins involved in general metabolism). Such results indicate that the response of plants to cd stress at the genetic level is very broad . The other metals used in our experiments (cu and ni) did not change the level of plasma membrane h - atpase transcripts in cucumber roots (fig . Thus the alteration of the plasma membrane proton pump activity in cucumber roots stressed with those metals seem not to involve the gene expression level . However, h - atpase is encoded by a gene family and only one isoform was analysed at the transcript level . Evidence has been presented that the plasma membrane h - atpase activity is rapidly modulated through the phosphorylation / dephosphorylation mechanism (schaller and sussman, 1988; kobus and janicka - russak, 2004, janicka - russak and kobus, 2006). The activation of the enzyme is due to its phosphorylation followed by binding of 14 - 3 - 3 protein, whereas the dephosphorylation of h - atpase by specific phosphatases belonging to the pp2, and the release of the 14 - 3 - 3 protein from the complex, inactivates the enzyme . To determine if the metal - induced inhibition of the plasma membrane proton pump in cucumber roots was attributed to its post - translational modification, the effect on the membrane proton pump of cantharidin, a specific inhibitor of protein phosphatases, as shown, cantharidin applied together with 100 m cd, cu and ni distinctly diminished the inhibitory effect of the metals (fig . 4), suggesting that the metals altered the proton pump activity mainly via dephosphorylation of its protein . The level of h - atpase phosporylation was distinctly lower in plasma membranes from cucumber roots treated with cd, cu or ni (fig . 5) demonstrating that alteration of the plasma membrane proton pump under heavy metals is due to dephosphorylation of the enzyme protein . Considering that our plants (control plants and those treated with heavy metals) were exposed for 2 h to mes - naoh without ca in solution, a set of supplementary experiments with plants exposed to metals in mes - naoh with or without 200 m ca (caso4) nevertheless no differences were found in both the hydrolytic and the transporting activity of the h - atpase . Also western blot analysis of plasma membranes with the antibody against phosphothreonine showed that the presence of calcium in the solution did not affect the metal action on h - atpase phosphorylation in the short - term experiments presented in this paper (data not shown). As protein phosphorylation depends on the energetic status of the cell, the level of endogenous atp was measured . Each metal treatment decreased the amount of the adenosine triphosphate in root tissues, suggesting that, besides the dephosphorylation intensity of the proton pump, the atp level is also an important factor in enzyme deactivation under heavy metals stresses . It is known that the main source of atp in root tissues is mitochondrial respiration . Until now, the effect of heavy metals on respiration and atp content in plant cells has not been sufficiently studied . However, it was revealed that cd treatment of plants significantly reduced the oxygen consumption by roots (reese and roberts, 1985) as well as disordering the electron transport chain (kessler and brand, 1994). Thus it is suspected that altered respiration could enhance the inhibition of plasma membrane proton pump activity in plants treated with metals . There is the possible action of heavy metals on atpase activity through decreasing the energy charge of the tissue . Such a correlation is indicated since the endogenous amount of atp, the substrate for plasma membrane h - atpase, decreased under heavy metal stress . In addition, it is well known that endogenous atp influences atpase activity, not only as the substrate but also through its function as an activator . Since protein phosphorylation depends on the endogenous atp level, its reduction upon the addition of heavy metals is in line with our hypothesis . Data of experiments with cantharidin and western blot with antibodies against phosphothreonine support this supposition . We think that some changes in plant cells initiated under heavy metals lead to an increase in the activity of specific phosphatases, responsible for the dephosphorylation of h - atpase protein . Taken together, the data presented suggest that alterations of the plasma membrane proton pump under heavy metal stresses are mainly due to the post - translational modification of its protein . Only in the case of cadmium action,
It is well known that they provide structural and metabolic support for neuronal networks, but a growing body of evidence indicates that they also play an active role in modulating neuronal activity . Astrocytes make close contact with perisynaptic regions, forming a functional structure called the " tripartite synapse, " together with presynaptic and postsynaptic nerve terminals . Indeed, one astrocyte in the hippocampus makes contact with tens of thousands of synapses . It is well established that astrocytes clear away excessive neurotransmitters and ions released from synaptic clefts through uptake via specific transporters and channels . For example, astrocytes remove excess extracellular glutamate using sodium - dependent glutamate transporters, such as the glutamate aspartate transporter and glutamate type 1 transporter . Excessive glutamate is cytotoxic to neurons, causing an influx of calcium that far exceeds physiological levels and triggering the activation of enzymes and signaling proteins that are detrimental to neurons . Evidence from a number of studies indicates that astrocytes release signaling molecules, the so - called " gliotransmitters, " such as glutamate, gaba, d - serine, and atp, into the extracellular milieu in response to extracellular stimuli (fig . Gliotransmitter release often results from the activation of g protein - coupled receptors (gpcrs) that trigger downstream signaling cascades in astrocytes, including phospholipase c, adenylate cyclase, inositol 1,4,5-trisphosphate (ip3), and cause an intracellular calcium increase . Gliotransmitters facilitate or inhibit the excitability and synaptic transmission of neighboring neurons, and the outcome of their release is dependent on the site of action and types of activated receptors . Through the use of volume - sensitive organic anion channels, gap junction hemichannels, p2x7, bestrophin-1, and reverse - orientation plasma membrane glutamate transporters, diverse mechanisms for gliotransmitter release have been identified in astrocytes, including calcium - dependent exocytotic vesicular release as well as non - exocytotic mechanisms . Although accumulating evidence suggests a coupling between various intracellular changes in astrocytes, such as intracellular calcium increase and gliotransmitter release, there is also evidence against this view; thus, the mechanisms underlying astrocyte - neuronal communication are still debated . In this review, we present recent studies that have using optogenetic and chemogenetic approaches to explore the function of astrocytes and gliotransmitters . Optogenetics is a novel biological technique based on a variety of light - sensitive proteins called opsins, which include microbial ion channels and ion pumps as well as engineered gpcrs (fig . 1). Following absorption of a specific wavelength of light, an opsin undergoes a conformational change that triggers diverse cellular changes in opsin - expressing cells . Some of the opsins induce the translocation of ions, and others activate intracellular signaling cascades, such as g protein - mediated signaling . Since most of these opsins do not exist in experimental - model organisms, and photostimulation itself has a negligible effect on cells and tissues, optogenetics has instead been used as a powerful experimental tool to manipulate specific populations of cells both in vitro and in vivo by means of a combinatorial approach of cell type - specific promoters and additional genetic tricks . This technique has also enabled the manipulation of cellular activity with millisecond - scale temporal precision . The time - resolved stimulation has made possible the revelation of causal relationships between manipulated cellular activity and functional outcomes, particularly in the study of neuronal circuits mediating specific behaviors . Opsins have been modified to generate mutants and chimeric proteins with diverse features, including their intracellular effects, optimal wavelengths of light for activation, and temporal dynamics in activation and inactivation; thus, they offer great flexibility in designing experiments and conducting more refined manipulations . Channelrhodopsin-2 (chr2), originally identified in green algae, is a cation channel that becomes permeable to positively charged ions such as proton and sodium when it is stimulated with blue light . When it is expressed in neurons, photostimulation elicits an influx of cations, which causes depolarization and the firing of action potentials in the stimulated cells . An influx of protons though chr2 can also acidify the cytosolic compartment of photostimulated cells . In the study of neurons, the frequency and duration of neuronal spiking can be easily controlled using variants of chr2, such as chr2(h134r), chr2(c128s), cheta, and step function opsin (sfo). For example, cheta can drive ultrafast spiking up to 200 hz, and sfo can elicit prolonged, bi - stable, sub - threshold depolarization of membranes . Some light - gated cation channels, such as calcium - translocating channelrhodopsin (catch) and liglur, are more permeable to calcium than chr2, and therefore they have been preferentially used in studies exploring the role of intracellular calcium . Liglur is a mutated ionotropic glutamate receptor 6 containing its ligand attached to an optically switchable tether called maleimide - azobenzene - glutamate . Halorhodopsin is an opsin identified from archaea which, when stimulated with yellow light, pumps chloride ions into cells . When halorhodopsin is expressed in neurons, photostimulation promotes an influx of chloride ions that results in hyperpolarization and the inhibition of the firing of action potentials in the stimulated cells . Archaerhodopsins, such as arch and archt, are light - driven outward proton pumps that inhibit the firing of action potentials during photostimulation when they are expressed in neurons; the efflux of protons can also cause alkalization of the cytosol . Finally, optoxrs, such as opto1ar and opto2ar, are chimeric gpcrs in which the intracellular loops of rhodopsin are replaced with those of other gpcrs, such as adrenergic receptors and dopamine receptors . Photostimulation can initiate diverse intracellular signaling cascades in target cells, depending on the type of g protein replacing the intracellular loops of rhodopsin . Thus, these opsins enable the acute activation of different gpcr signaling pathways in cultured cells and animals . Chemogenetics is based on engineered proteins, such as gpcrs and ligand - gated ion channels, that are no longer responsive or only very weakly responsive to their endogenous ligands but strongly respond to synthetic chemical ligands that are otherwise biologically inert . For example, hm3dq, one of the designer receptors exclusively activated by designer drugs (dreadds), is generated by multiple cycles of randomized mutagenesis of the human m3 muscarinic receptor, which is linked to the gq protein . It is neither sensitive to the endogenous muscarinic acetylcholine receptor ligand acetylcholine nor is it constitutively active, but it is strongly activated in response to a synthetic ligand, clozapine - n - oxide (cno), with nanomolar potency . In response to cno, hm3dq can induce an enhancement of neuronal excitability that can lead to burst - like firing . Thus, it is one of the most frequently used chemogenetic tools to activate neurons . Another dreadd molecule, hm4di, is a mutant of the gi - coupled human m4 muscarinic receptor that responds to cno . Upon an application of the chemical agonist, hm4di activates the g subunit of the gi protein, which then stimulates g protein inwardly rectifying potassium channels (girk), causing an efflux of potassium and a resulting robust hyperpolarization when it is expressed in neurons . Thus, hm4di has been used to silence spontaneous and depolarization - evoked neuronal firing . This goal is often attained by injecting a virus (e.g., adeno - associated virus (aav) or lentivirus) that encodes an effector into a target region in the brain or other tissue . Alternatively, the effector can be expressed as a transgene in a genetically engineered mouse line . By using cell type - specific promoters, such as the astrocyte - specific glial fibrillary acid protein (gfap) promoter, the effector's expression can be restricted to a specific population (or more than one population) of cells . An intersectional strategy based on a combination of specific promoters and genetic tools, such as cre- and flippase - mediated recombination, can further restrict the effector expression to specific subpopulations . In addition, other genetic tricks, such as the use of tetracycline - dependent transcriptional regulation, have been used to achieve temporal control as well as amplification of effector expression . Optogenetics can deliver photostimulation directly to target cells and manipulate cellular activity acutely and reversibly . In contrast, chemogenetics is ideal for a prolonged manipulation of cellular activity in the range of minutes to days, depending on the route of ligand delivery and the pharmacokinetic properties of the synthetic ligand(s) used . Optogenetics is excellent in generating spiking patterns that mimic the endogenous firing responses of neurons by using a pulse generator that produces lights with different frequencies and pulse durations . In addition, photostimulation can be delivered to different subcellular locations such as the soma and nerve terminals, a useful feature for studying neuronal circuits in the brain . On the other hand, chemogenetics is less invasive in experimental animals and hampers animal behaviors only marginally, if at all, because it requires neither the installation of a fiber - optic cable within the brain nor a connection of the cable to a light source, such as a laser or a light - emitting diode (led). Furthermore, some synthetic ligands for chemogenetics, such as cno, can be delivered via the animal's water and/or food as well as by systemic injection, permitting the delivery of the ligand with minimal disturbance of the animals, particularly in the case of chronic manipulation . Optogenetic and chemogenetic techniques have been most frequently used to investigate neuronal circuits, but they also have been used to study non - neuronal cells in the brain and peripheral tissues . In the following section, we will summarize the approaches and findings of recent studies that have employed these techniques to reveal the function of astrocytes (table 1 and 2). Studies using primary astrocytes and immortal astrocyte cell lines have shown that optogenetic stimulation can elicit an elevation of intracellular calcium and subsequent release of gliotransmitters that can activate adjacent astrocytes as well as neurons . Have reported that photostimulation of chr2-expressing primary astrocytes using a led can elicit an intracellular calcium increase and electrophysiological responses not only in the stimulated cells but also in co - cultured astrocytes and neurons that do not express chr2 . The calcium response in chr2-negative cells is suppressed by the application of antagonists of n - methyl - d - aspartate (nmda) and -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) receptors in the bath solution, suggesting that the response in chr2-negative cells is mediated by glutamate released from chr2-expressing astrocytes . Similar results have been obtained in another study, in which the coupling has been demonstrated between an intracellular calcium increase in astrocytes and glutamate release . Have performed fluorescent calcium imaging in primary cultures of mouse cortical astrocytes and shown that photostimulation of astrocytes expressing liglur can elicit calcium transients not only in stimulated liglur - expressing cells but also in neighboring astrocytes that do not express the opsin . The calcium response in liglur - negative astrocytes is affected by antagonists of glutamate receptors, but not by a gap junction blocker or an antagonist of extracellular atp signaling, suggesting the involvement of glutamate in the communication between astrocytes . Further experiments have shown that the calcium transients in liglur - negative astrocytes are inhibited by an anion channel blocker but are unaffected by an inhibitor of v - atpase, which blocks exocytosis, suggesting that liglur - evoked glutamate release is mediated by anion channels . In an attempt to investigate whether intracellular ionic alteration in astrocytes triggers gliotransmitter release, ono and coworkers have co - cultured an astrocytic cell line and a neuronal cell line; in response to photostimulation, the chr2-expressing astrocytes exhibited diverse cellular changes, including an increase in intracellular sodium and calcium, intracellular acidification, glutamate release, and inhibition of proliferation . A short period of photostimulation (for minutes) elicited calcium transients in the co - cultured chr2-negative neurons, whereas a long period of stimulation for several days resulted in apoptotic responses in the neurons . Thus, this study has demonstrated that activation of astrocytes releases glutamate which, in turn, provokes an intracellular calcium increase and cytotoxic cell death . To mimic gpcr - mediated signaling events occurring in astrocytes in response to extracellular neurotransmitters and neuromodulators, figueiredo et al . Have expressed gpcr - based opsins, such as opto1ar and opto2ar, in astrocytes to activate gq- and gs - mediated signaling cascades, respectively . Photostimulation elicited an intracellular calcium increase in astrocytes expressing either opsin, which was blocked by apyrase, an enzyme hydrolyzing extracellular atp, as well as by pharmacological blockers for the corresponding intracellular signaling cascade, such as inhibitors of phospholipase c and adenylate cyclase; these data indicate that a large portion of the calcium rise that was evoked by the activation of either opsin was a result of the autocrine action of extracellular atp . This study has demonstrated that gpcr - based opsins can be effectively used in the study of astrocytic gpcr - mediated signaling . Tetracycline - dependent expression, using the so - called tet - off system, has been employed in several studies to generate transgenic mouse models expressing an opsin . In the tet - off system, the tetracycline - controlled transcriptional activator (tta) binds to a tta - responsive promoter sequence (teto) to induce the expression of a downstream gene . When bound to the tetracycline derivative doxycycline, tta undergoes a conformational change that prevents tta from binding to teto, inhibiting the transcription of a target gene . Thus, this system enables a reversible control of gene expression produced by treatment with doxycycline . Tanaka and coworkers have generated a mouse line by knocking in a transgene cassette encoding teto - driven chr2(c128s) downstream of a housekeeping gene, -actin, to obtain a high level expression . The knockin mice have been crossed to tta driver lines in which tta is driven by cell type - specific promoters, the mlc1, plp, and iba-1 promoters, to induce chr2(c128s) expression in astrocytes, oligodendrocytes, and microglia, respectively . The double - transgenic mice containing mlc1-driven tta and teto - driven chr2(c128s) have been used to reveal the role of bergman glia (bg), a specialized subtype of astrocytes in the cerebellum, in modulating the activity of purkinje neurons . First, photostimulation of acute brain slices prepared from the transgenic mice was found to elicit current responses from chr2-expressing bg, suggesting that chr2 is expressed in glial cells to a level sufficient for electrophysiological responses . Second, photostimulation of the cerebellum using a fiber - optic cable installed above the skull, to avoid the generation of injury - induced reactive gliosis, was found to be sufficient to evoke an induction of a surrogate marker for cellular activation, c - fos, in chr2-expressing bg . Third, photostimulation of chr2-expressing bg in acute cerebellar slices was shown to be sufficient to trigger glutamate release and firing of nearby purkinje cells (pcs), resulting in long - term plasticity between parallel fibers and pcs . Finally, in vivo photostimulation of glia cells using fiber - optic cable inserted into the cerebellar flocculus was found to cause pupil dilation as well as perturbation of smooth eye pursuit of visual stimuli in head - fixed mice . Have recently demonstrated using the same mouse line that neuronal damage in the mouse model of ischemia can be exacerbated by optogenetically induced acidosis and attenuated by alkalization of the cytosolic compartment of astrocytes . Under ischemic conditions, such as deprivation of oxygen and glucose, cerebellar bg exhibited intracellular acidosis and glutamate release, followed by an inward excitatory current in the surrounding pcs . The response in pcs was inhibited by a cocktail of glutamate receptor and transporter blockers, suggesting the involvement of glutamate in the interaction between bg and pcs . Acidosis induced in bg by optogenetic stimulation of chr2(c128s) was sufficient to evoke an inward excitatory current in the adjacent pcs . The response in pcs was inhibited by a non - competitive ampa and kainate receptor antagonist, confirming the involvement of glutamate in the signaling between bg and pc . In contrast, an efflux of proton from bg produced by optogenetic stimulation of a light - gated outward proton pump, archt, led to a reduction in the inward currents in the pcs elicited by the deprivation of oxygen and glucose . Furthermore, in vivo photostimulation of archt - expressing bg caused a substantial reduction in cerebellar infarction following a local thrombosis - caused ischemic stroke, whereas control mice without archt activation exhibited severe neuronal death under the same conditions . Taken together, the results of this study have demonstrated that ischemic injury causes glial acidosis, which, in turn, releases glutamate into the extracellular space and causes ischemic neuronal death . Have demonstrated that in vivo optogenetic stimulation of cortical astrocytes elicits a rapid, robust, and widespread increase in cerebral blood flow (cbf). The increased cbf was abolished by an application of the inward rectifier potassium channel blocker, bacl2, on the exposed cortex, indicating the importance of potassium signaling in astrocytic modulation of cbf . In contrast, the study found that neither astrocytic intracellular calcium signaling nor glutamate release was involved in the increase in cbf . A number of studies have employed virally mediated expression of opsins to manipulate astrocytes, despite the possibility of inducing reactive gliosis as a result of viral infection . For example, an aav encoding gfap promoter - driven chr2 has been used to reveal a causal relationship between the activity of astrocytes and visual processing in the primary visual cortex (v1). Although a previous study had shown that astrocytes in the visual cortex respond to visual sensory stimuli, their roles had not been clearly determined because of the difficulty in selectively manipulating astrocytes among the heterogeneous populations of cells in the region . Perea et al . Reported that in vivo optogenetic stimulation of astrocytes in the v1 enhanced the spontaneous firing of a population of inhibitory neurons expressing parvalbumin, and this firing was suppressed by treatment with an antagonist of type 1a metabotropic glutamate receptors, suggesting the involvement of glutamate in astrocyte - mediated visual processing . In contrast, optical stimulation of astrocytes had mixed effects in terms of activation and inhibition on excitatory neurons and another population of inhibitory neurons expressing somatostatin . Finally, in vivo optogenetic stimulation of astrocytes in the v1 strongly affected the responses of neuronal populations to visual stimuli . Optogenetic manipulations have revealed the involvement of other signaling molecules released by astrocytes, such as extracellular atp and l - lactate, in modulating the activity of neurons in the brainstem . Have reported that astrocytes in the ventral surface of the medulla oblongata (vs) are exquisitely ph - sensitive . In response to a decrease in ph in anesthetized rats, astrocytes residing near the vs exhibited an intracellular calcium increase . Furthermore, a decrease in ph in brainstem slices elicited a sustained atp release in the vs region, as well as extracellular atp - dependent calcium responses in vs astrocytes . To mimic ph - elicited calcium excitation in astrocytes, an aav encoding enhanced gfap promoter - driven chr2(h134r) was injected into the brainstem . In organotypic brainstem slices, photostimulation elicited not only calcium transients in chr2-expressing astrocytes but also long - lasting depolarization in adjacent chemo - sensitive neurons in the retrotrapezoid nucleus (rtn). Rtn neurons have been found to play an important role in monitoring glucose concentrations, ph, and partial pressure of co2 . Either apyrase or an antagonist of extracellular atp receptor blocked the response of the rtn neurons, suggesting that extracellular atp mediates the interaction between astrocytes and adjacent neurons . Finally, in vivo unilateral optogenetic stimulation of astrocytes in anesthetized, vagotomized, and artificially ventilated rats elicited a robust respiratory activity from hypocapnic apnea and an increase in phrenic nerve amplitude, which was suppressed by an antagonist of the extracellular atp receptor; these results indicate that astrocytes are critical components of the central respiratory and chemosensory functions, and extracellular atp is a key molecule in the signaling between astrocytes and neighboring neurons in the rtn . The same group of researchers has investigated the astrocytic modulation of norepinephrine (ne) release in the locus coeruleus (lc) using an aav encoding gfap promoter - driven chr2(h134r). Evidence existed to suggest that l - lactate is involved in the process, but the exact mechanism was unclear . Photostimulation of chr2-expressing astrocytes in organotypic cultured brain slices elicited delayed depolarization and increased firing rates in norepinephrine (ne)-ergic neurons . Pharmacological interventions that reduce the level of l - lactate suppressed light - induced depolarization of neergic neurons, suggesting that astrocytes activate neergic neurons via l - lactate . Indeed, the application of l - lactate to brain slices provoked similar electrophysiological responses in neergic neurons and caused ne release from the activated neurons . Finally, optogenetic activation of astrocytes using either opto2ar or chr2(h134r) was sufficient to trigger ne release . Thus, this study clearly demonstrated that activated astrocytes in the lc release l - lactate, which then triggers ne release from neergic neurons . A similar viral approach was used by gradinaru et al . To examine whether local astrocytes contribute to the therapeutic effect of deep - brain stimulation (dbs) delivered to the subthalamic nucleus (stn) to relieve tremor in parkinson's disease . To deliver photostimulation and measure neuronal activity from a parkinsonian rodent model, optrode recordings were performed in anesthetized rats, in which 6-hydroxydopamine (6-ohda) had been unilaterally injected into the right medial forebrain bundle to cause a loss of nigral dopaminergic cells . 6-ohda - treated animals displayed rotations ipsilateral to the lesion as a result of specific deficits in contralateral limb function, which became more obvious when amphetamine was administered to the subjects to increase locomotion . This study revealed that photostimulation of chr2-expressing astrocytes in the stn can reversibly inhibit firing of stn neurons in 6-ohda - treated animals; this treatment, however, failed to cause any changes in pathological motor behavior in parkinsonian rats, suggesting that astrocytes are unlikely to be critical players in the dbs - elicited effects . Optogenetic manipulation has been used in two recent studies to examine the role of astrocytes in sleep . Have reported that optogenetic activation of the posterior hypothalamus using chr2(h134r) promotes both rapid and non - rapid eye movement sleep . On the other hand, yamashita et al . Have reported that in vivo optogenetic stimulation of chr2-expressing astrocytes in the anterior cingulate cortex results in a significant increase in wakefulness as well as disturbance of non - rapid eye movement sleep . In a very recent study reported by poskanzer and yuste, the role of neocortical astrocytes in the control of cortical circuit functions was examined using in vivo two - photon calcium imaging based on the genetic calcium indicator gcamp6s, together with electrophysiological recording from cortical neurons . To examine the causal relationship between the calcium signaling in astrocytes and neuronal activity in the v1, an aav encoding cre - dependent arch was injected into the v1 of transgenic mice expressing gfap promoter - driven cre, which resulted in astrocyte - specific expression of the opsin . When expressed in neurons, arch hyperpolarizes membrane potentials and inhibits neuronal firing by pumping protons out of neurons in response to yellow - light photostimulation . Surprisingly, photostimulation of arch in the astrocytes triggered calcium transients that were specifically localized to the processes of astrocytes and largely undetected in the soma . In contrast, neighboring arch - negative cells failed to exhibit a calcium response during photostimulation . A previous study has reported that arch - mediated stimulation of cerebellar bg increases the intracellular ph as the result of an efflux of protons out of cells under oxygen - glucose - deprived conditions . In contrast, poskanzer and yuste found no significant changes in ph in stimulated astrocytes as well as in surrounding cells in the v1 . It is not clear whether this discrepancy is a byproduct of cell - type specificity . Finally, local field potential recordings have revealed that in vivo optogenetic stimulation of astrocytes in the v1 results in calcium transients, followed by a brief increase in extracellular glutamate and a shift in neuronal firing patterns in v1 from a desynchronized state to the synchronized slow oscillation - dominated state . Among diverse chemogenetic effectors, dreadds, such as hm3dq, have been used most frequently in studies focusing on astrocytes . As in optogenetic approaches, astrocyte - specific expression of chemogenetic proteins has been achieved by using viral and transgenic delivery in combination with astrocyte - specific promoters such as the gfap and mlc1 promoters . To manipulate gq - coupled receptor signaling in astrocytes, fiacco et al . Generated a bi - transgenic mouse line encoding gfap promoter - driven tta and teto promoter - driven mas - related g protein - coupled receptor a1 (mrgpra1) to express gpcr selectively in astrocytes . Mrgpra1 can be activated by rf amides, such as a peptide phe - leu - arg - phe amide (flrf). Since endogenous mrgpra1 is specifically expressed in dorsal root ganglion neurons but not in the brain, this protein is a useful molecular tool for manipulating neurons and glia in the brain when it is exogenously expressed in these cells . An infusion of flrf into acute hippocampal slices prepared from the transgenic mice elicited a robust calcium increase in widespread astrocytes, suggesting that mrgpra1 is able to activate the gq - coupled intracellular signaling pathway . It is particularly interesting that such a widespread calcium rise in astrocytes failed to affect neuronal activity in the same slices . This finding is at odds with other studies, questioning the hypothesis that an astrocytic calcium increase causes the release of gliotransmitters which, in turn, activate nearby neurons . In a follow - up study using margpra1 mice together with mice lacking inositol 1,4,5-trisphosphate receptor 2 (ip3 r2), the astrocyte - specific ip3 receptor isoform, the same group of researchers further confirmed that activation of gq protein - coupled signaling affects neither spontaneous excitatory postsynaptic currents nor the induction and maintenance of long - term potentiation in ca1 hippocampal neurons . In another study performed by the same group of researchers, bonder and mccarthy reported that hm3dq can be selectively expressed in astrocytes by injecting aav incorporating cre - dependent hm3dq into the visual cortex of transgenic mice encoding gfap promoter - driven cre, and they have used this system to investigate whether the astrocytic calcium elevation triggers vasodilation and a change in local blood flow in the cortex . Activation of hm3dq with cno was sufficient to increase the intracellular calcium level in astrocytes but not to alter the basal blood flow in the visual cortex . The study also reported the absence of a temporal correlation between the astrocytic calcium increase and the change in cortical blood flow following either visual stimulation or a startle - evoking air puff . Furthermore, genetic deletion of ip3 r2 did not affect neurovascular coupling, suggesting that gq signaling and ip3-dependent calcium elevation in astrocytes do not mediate vasodilation in the visual cortex . The gfap - driven mrgpra1 mouse line was used in a more recent study of cao and coworkers to investigate the role of astrocytic atp release in depression - like behaviors . Application of the mrgpra1 agonist flrf elicited not only a robust increase in intracellular calcium in mrgpra1-expressing primary astrocytes but also a 2.5-fold increase in the atp concentration in the culture medium . Furthermore, mrgpra1 mice infused with flrf into the cerebral ventricle exhibited a substantial reduction in depression - like behavior elicited in the murine paradigm of chronic social - defeat stress . Together with other results reported in the study, these findings suggest that endogenous atp released from astrocytes can induce antidepressant - like behavior . Whether intracellular calcium increases in astrocytes can affect the activity of neighboring neurons was untested in the study . For instance, sweger et al . Developed a mouse line expressing an engineered k - opioid receptor (ro1) in gfap - expressing astrocytes by crossing transgenic mice encoding gfap promoter - driven tta mice with another line encoding teto promoter - driven ro1 on the background of a genetic deletion of the endogenous k - opioid receptor (kor). Ro1 is a gi - coupled gpcr that is insensitive to endogenous ligands of kor, such as dynorphin, but highly sensitive to a synthetic ligand of the k - opioid receptor, spiradoline . Ro1-expressing transgenic mice developed hydrocephalus and accumulation of cerebrospinal fluid in the ventricular system, even in the absence of a synthetic ligand, suggesting that ro1 is constitutively active in this mouse model; unfortunately, this constitutive activity negates one of main features of chemogenetics, its temporal controllability, and limits the use of this model . The same group of researchers has described another transgenic mouse line expressing gfap promoter - driven hm3dq . Systemic treatment of these mice with cno elicited a number of physiological changes that are controlled by the autonomic nervous system, including cardiovascular function, saliva formation, and homeostasis of body temperature . Furthermore, hm3dq - expressing mice receiving cno exhibited substantial changes in activity - related behaviors and motor coordination . Thus, these findings indicate the critical role of astrocytes in a broad range of basic physiological functions . Interestingly, the physiological and behavioral changes were unaffected by genetic deletion of ip3 r2, suggesting that astrocytic ip3-mediated calcium increase is dispensable for hm3dq - elicited responses . The gfap promoter - driven hm3dq mice have been used to study glial cells outside of the brain . Examined the potential role of the enteric glia, which are astrocyte - like peripheral glial cells surrounding enteric neurons in the gut . An application of cno to the ileal and colonic myenteric plexus prepared from transgenic mice not only elicited and intracellular calcium increase in astrocytes but also triggered contraction of the ileum and colon to a degree similar to that elicited by direct stimulation of smooth muscle or electrical stimulation of enteric neurons . The contraction was abolished by the application of tetradotoxin, indicating the involvement of neuronal activation in the process . These findings have demonstrated that astrocytes in the gut play a critical role in the contractions of intestinal smooth muscle . The mechanism by which activation of gq - coupled receptor in astrocytes leads to activation of enteric neurons remains unknown . Have reported two new transgenic mouse lines expressing hm3dq, depending on cre and flippase - mediated recombination . When crossed to cre or flp driver lines, the new mouse lines permit the selective expression of hm3dq in a population of cells that express either cre or flippase . In addition, the intersectional strategy involving both cre- and flippas - edependent recombination further restricts hm3dq expression in a specific subpopulation . This group reported that a systemic application of cno to mice expressing hm3dq in gfap - expressing cells elicits hypothermia, confirming the efficacy of the new mouse line by reproducing the previous finding . Finally, the chemogenetic approach has also been applied to reveal the function of gs - coupled signaling in longterm memory in normal animals and the alzheimer animal model . For example, double - transgenic mice encoding gfap promoter - driven tta and teto - driven rs1 have been generated to acutely modulate gs - coupled receptor activity . Rs1 is the human gs - coupled 5-ht4b serotonin receptor with a point mutation that renders this receptor insensitive to serotonin but highly sensitive to a synthetic ligand, gr-125487 . Activation of gs signaling by systemic delivery of gr-125487 impairs the performance of transgenic mice in the morris water maze as well as a novel object - recognition task . Orr et al . Found that rs1 is constitutively active in this mouse model, driving the gs signaling pathway even in the absence of the synthetic ligand . Thus far, only a small number of studies focusing on glia have used a virally mediated method to achieve the expression of chemogenetic proteins . For example, an aav encoding gfap promoter - driven hm3dq or hm4di has been stereotactically injected into the arcuate nucleus of the mouse brain to investigate the potential role of medial basal hypothalamic astrocytes in regulating food intake . In the feeding assay, hm3dq - expressing mice receiving cno exhibited a significant reduction in both baseline feeding and ghrelin - elicited hyperphagia, whereas hm4di - expressing mice receiving cno showed substantially enhanced and prolonged ghrelin - evoked feeding . In contrast, following the cno treatment, leptin - induced anorexia was facilitated in hm3dq - expressing mice but suppressed in hm4di - expressing mice . Thus, this study employing two different chemogenetic actuators that recruit different downstream signaling molecules clearly demonstrated that astrocytes in the arcuate nucleus exert bi - directional regulation of food consumption . An aav virus expressing gfap promoter - driven hm3dq was injected into the rat nucleus accumbens core (nacore) in two recent studies in order to investigate the contribution of glial cells and extracellular glutamate to substance abuse and motivation . Reported that an application of cno elicited an elevation of the intracellular calcium level in hm3dq - expressing primary astrocytes and a decrease in motivation for self - administration of ethanol after 3 weeks of abstinence . Showed that intracranial or systemic administration of cno triggered an increase in extracellular glutamate in the nacore . Furthermore, hm3dq - expressing rats receiving intraperitoneal cno exhibited a significant reduction in the cueinduced reinstatement of cocaine seeking . Neurons have always been a main focus of brain research, and non - neuronal cells that make up the majority of brain cells, such as glial cells, have not received much attention until recently . Studies of glia have revealed that they do not merely provide food and support to neurons; rather, they play an important role in brain function . In order to understand astrocytic function, it is critical to be able to control their intracellular activity in a native context . Since glia are intermingled with neurons in the brain and they express receptors and ion channels that are also expressed in neurons, it is difficult to perform such manipulation selectively in glial cells, while leaving neighboring neurons unaffected . Optogenetics and chemogenetics are novel manipulation techniques based on genetically encoded effector molecules, such as specific ion channels and gpcrs, that respond to exogenously delivered light stimuli or synthetic ligands, but are unresponsive to endogenous molecules . In combination with cell type - specific promoters and other genetic tools, expression of effector molecules can be restricted to specific cell types . Thus, the features of spatial and temporal control make it possible to perform a time - resolved functional manipulation in a specific population of cells . Optogenetics and chemogenetics have been used most extensively in the study of neuronal circuits and behavior, but they have also been employed in a number of studies focusing on glial cells, mainly astrocytes . Such studies have demonstrated that astrocytes play a critical role not only in a variety of basic physiological responses, including visual processing, norepinephrine release, breathing, cerebral blood flow, feeding, memory, and sleep, but also in pathological conditions, including drug addition, depression, and ischemia . Those studies have further revealed the importance of gliotransmitters, such as extracellular glutamate, atp, and l - lactate, that modulate excitability and synaptic transmission in neighboring neurons . However, it is still debatable whether astrocytic release of gliotransmitters is a calcium - dependent process . In addition, the exact molecular mechanisms governing gliotransmitter release from astrocytes remains to be revealed . A combinatorial approach of advanced functional manipulation techniques such as optogenetics and chemogenetics, together with pharmacological and molecular genetic methods, can further our understanding of glial function in health and disease, including neurodevelopment, neurodegenerative disorders, and neuroinflammatory conditions.
The online version of this article (doi:10.1007/s10953 - 014 - 0276-y) contains supplementary material, which is available to authorized users . In recent years, the deep desulfurization of diesel fuel has become the most studied process with different techniques (extraction, liquid liquid separation, oxidative desulfurization, adsorption). The emission of sulfur from petrol and diesel oils, which is linked to acid rain, plays a crucial role in pollution problems of large conglomerates . Thus, the usa and european countries have issued regulations regarding sulfur content in fuels [1, 2]. Due to this situation, the european union approved a new directive stating that the content of total sulfur in european gasoline and diesel fuels from 2010 onwards must be at a maximum concentration level of 10 ppm . Ionic liquids (ils) have the ability to extract aromatic sulfur - containing compounds at ambient conditions . Additionally, ils are immiscible with the fuel, are non - volatile and can be regenerated and recycled by solvent washing . Oxidative desulfurization in future years probably will bring better results than simple liquid liquid separation, however, first the best ils must be chosen . At present, the hydrodesulfurization (hds) processes is the established method used in some industrial technologies to remove organic sulfur from fuels . However, to achieve low sulfur targets with current hds technology, higher temperatures, higher pressures, larger reactor volumes, and more active catalysts are needed . The hds process does not purify fuels of polycyclic organic sulfides such as thiophene, benzothiophene, methyldibenzothiophenes, 4,6-dibenzothiophenethiols, thioethers, and disulfides . Extraction desulfurization, which has begun to be popular, especially with ils, has the potential for being an alternative and future complementary technology for deep desulfurization [410]. In order to solve this problem, extractive liquid liquid equilibrium (lle) desulfurization with ils has been proposed [7, 1018]. The 1-alkylpiperidinium - based, or pyrrolidinium - based ils with different anions, or 1-alkylcyanopyridinium - based ils, have been recently studied in our laboratory in ternary lle {il + thiophene, or benzothiophene + heptane) with high selectivities . Attractive extraction parameters were presented as well for 1-ethyl-3-methylimidazolium bis{(trifluoromethyl)sulfonyl}imide, [emim][ntf2] (, and references cited therein), 1-ethyl-3-methylimidazolium acetate, [emim][oac], 1-ethyl-3-methylimidazolium thiocyanate, [emim][scn], and 1,3-dimethylimidazolium methylphosphonate [dmim][mp]. This work is a continuation of our systematic studies on the physicochemical properties and the extraction abilities of piperidinium - based ils (and references cited therein). Proposed by us are new interaction parameters for the group contribution method modified unifac for the piperidnium - based ils, predicted attractive infinite dilution selectivity, and capacity of piperidinium - based ils (alkane chain, n = 36) in the thiophene / heptane separation problem at t = 328.15 k. to our best knowledge, the phosphonium - based il (tributyl - methylphosphonium methylsulfate, [p1,4,4,4][ch3so4]) was measured in ternary lle for the separation of thiophene from cyclohexane at t = 298.15 k with very low selectivities in a range of 1.5 to 5.4 . Better results were obtained with deep eutectic solvents, des, containing phosphonium - based ils with ethylene glycol . Des is composed of methyltripentylphosphonium bromide, [p1,5,5,5][br], and ethylene glycol (as a hydrogen bond donor) showed selectivities of about s = 60100 for ternary lle at t = 318 k for benzene / hexane separation . Poorer results were estimated with des composed of tetrabutylphosphonium bromide, [p4,4,4,4][br], and ethylene glycol for the separation of toluene / heptane . Usually, the results of separation processes for aliphatic / aromatic hydrocarbons provide good information for the separation of aliphatic / aromatic sulfur compounds . We can expect similar or even better results for the chosen il . On the other side, there are very good results obtained with methylphosphonate and diethylphosphate anions of ils in ternary lle (il + thiophene + heptane) mixtures . In this work we report experimental ternary lle data for one additional piperidinium - based il, {1-pentyl-1-methylpiperidinium bis{(trifluoromethyl)sylfonyl}imide [c5mpip][ntf2], for comparison with measured earlier 1-propyl, or 1-butyl-, or 1-hexyl-1-methylpiperidinium bis{(trifluoromethyl)sylfonyl}imide . Moreover, tributylethylphosphonium diethylphosphate, [p2,4,4,4][dep] was chosen to check the influence of the anion . The [dep] anion in [emim][dep] shows interesting results for thiophene extraction from hexane at t = 298.15 k . The solvents heptane, thiophene, and benzothiophene used in this work are model compounds for fuel and sulfur organic hydrocarbons, respectively . The ternary systems {il (1) + thiophene, or benzothiophene (2) + heptane (3)} were investigated at t = 308.15 k and p = 101.33 kpa . The experimental tie - lines for four ternary mixtures the solute distribution ratio and the extractive selectivity were determined from the experimental data, and are compared to the literature data . The ils studied, [c1c5pip][ntf2] and [p2,4,4,4][dep], were purchased from iolitec . The names, abbreviations, structures, measured densities and mass fraction of ils are listed in table 1 . The names, cas numbers, sources, mass fraction purities, purification method, water content, and measured and literature densities of all chemicals used are shown in table 1s in the supplementary material information . The samples of ils were dried for 24 h at 300 k under reduced pressure to remove volatile impurities and trace amounts of water . Thiophene and benzothiophene were stored over freshly activated molecular sieves of type 4 (union carbide). The densities for all substances were measured at t = 298.15 and 101.33 kpa . The method and uncertainties have been described previously .table 1list of investigated ionic liquids: structure, name, abbreviation of name, molar mass (m) and densitycationanionname, abbreviationm/(gmol)exp . Density /gcm (298.15 k; 101.33 kpa) 1-pentyl-1-methylpiperidinium bis{(trifluoromethyl) sulfonyl}imide [c1c5pip][ntf2]450.461.35016 tributylethylphosphonium diethylphosphate, [p2,4,4,4][dep]384.471.0089 list of investigated ionic liquids: structure, name, abbreviation of name, molar mass (m) and density the water content was analyzed by the karl - fischer titration (method titroline kf). The sample of il, or solvent, was dissolved in methanol and titrated in steps of 0.0025 cm . The error in the water content is 10 10 in mass fraction for the 3 cm of injected il . The water content in solvents used was less than 350 10 in mass fraction . To obtain the experimental lle tie - lines, mixtures with compositions inside the immiscible region of the systems the vessel was tightly closed to avoid losses by evaporation or pickup of moisture from the atmosphere . The jackets were connected to a thermostatic water bath (lauda alpha) to maintain a constant temperature of t = 308.15 k (0.05). The mixtures were stirred for 6 h to reach thermodynamic equilibrium and after a minimum of 12 h were analyzed . After the phase separation, samples of about (0.10.3) 10 cm were taken from both phases using glass syringes with coupled stainless steel needles . A sample of the phase was placed in an ampoule with a capacity of 2 10 cm . Next, acetone (1.0 cm) was added to the samples to avoid phase splitting and to maintain a homogeneous mixture . Because of the low vapor pressure, the ils used in this work cannot be analyzed by gc . Thus, only thiophene or benzothiophene and heptane were analyzed; the mass fraction of the third component, the il, was determined by subtracting the mole fractions of the two other components from unity . The compositions were analyzed by gas chromatography (perkinelmer clarus 580 gc equipped with auto sampler and fid and tcd detectors). The capillary column of the chromatograph was protected with a pre - column to avoid the non - volatile ionic liquid reaching the column in the case of a leak from the glass wool in the liner . The totalchrom workstation software was used to obtain the chromatographic areas for the thiophene, or benzothiophene, heptane and the internal standard propan-1-ol . Details of the operational conditions of the apparatus are reported in table 2s in the supplementary material . The estimated uncertainty in the determination of mole fraction compositions is 0.003 for compositions of the hydrocarbon - rich phase and 0.005 for compositions of the il - rich phase . The equilibrium compositions of the experimental tie - line ends in ternary systems of four mixtures {il (1) + thiophene or benzothiophene (2) + heptane (3)}, at t = 308.15 k and p = 101.33 kpa are reported in table 2 . Experimental solubilities for [c1c5pip][ntf2] and [p2,4,4,4][dep] in heptane at t = 308.15 k are totally different from each other . In the binary {il (1) + heptane (3)} system complete liquid miscibility (solubility of heptane in the il) is up to mole fraction of heptane \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{3}^{\text{il}} $$\end{document}x3il = 0.089 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{3}^{\text{il}} $$\end{document}x3il = 0.456 for [c1c5pip][ntf2] and [p2,4,4,4][dep], respectively . The solubility of heptane is much larger in [p2,4,4,4][dep] than that in [c1c5pip][ntf2]. The piperidinium - based il shows much lower solubility of heptane in the il . In comparison with piperidinium - based il measured by us earlier, heptane shows higher solubility in [c1c5pip][ntf2] than in [c1c3pip][ntf2] (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{3}^{\text{il}} $$\end{document}x3il = 0.051, at t = 308.15 k). This effect is due to an increase in the van der waals interactions between the hydrocarbon chain of the cation and heptane.table 2compositions of experimental tie lines, solute distribution ratios,, and selectivity, s, for ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1) + thiophene or benzothiophene (2) + heptane (3)} at t = 308.15 k, p = 101.33 kpahydrocarbon - rich phaseil - rich phase s \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{1}^{\text{i}} $$\end{document}x1i \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{\text{i}} $$\end{document}x2i \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{1}^{\text{ii}} $$\end{document}x1ii \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{\text{ii}} $$\end{document}x2ii [c1c5pip][ntf2] + thiophene + heptane 0.0000.0000.9110.000 0.0000.0570.7700.1422.4926.7 0.0000.1110.6630.2502.2523.0 0.0000.1910.5640.3521.8417.7 0.0000.2300.5230.3921.7015.4 0.0000.3530.4240.4901.3910.4 0.0000.4470.3760.5421.218.2 0.0000.5300.3370.5821.106.4 0.0000.6960.2810.6500.934.1 0.0000.8000.2410.7020.883.1 0.0000.8910.2130.7500.842.5 0.0001.0000.1860.8140.81[c1c5pip][ntf2] + benzothiophene + heptane 0.0000.0000.9110.000 0.0000.0250.8030.1094.3648.3 0.0000.0520.7050.2104.0445.0 0.0000.0920.5890.3263.5437.9 0.0000.1610.4440.4722.9329.3 0.0000.2430.3830.5312.1919.2 0.0000.3460.2990.6111.7712.8 0.0000.4600.2360.6741.478.8 0.0000.5530.2080.6961.265.9 0.0000.7660.1440.7580.992.4 0.0000.8530.0960.8190.961.7 0.0000.9150.0600.8730.951.2[p2,4,4,4][dep] + thiophene + heptane 0.0020.0000.5440.000 0.0020.0160.5150.0432.696.0 0.0040.0430.4430.1042.425.1 0.0050.0790.3760.1702.154.3 0.0080.1120.3230.2141.913.6 0.0090.1480.2740.2571.743.1 0.0080.1720.2440.2801.632.8 0.0100.1990.2010.3011.512.4 0.0130.2120.1870.3091.462.2 0.0130.2390.1600.3261.362.0[p2,4,4,4][dep] + benzothiophene + heptane 0.0020.0000.5480.000 0.0060.0150.4950.0624.139.1 0.0070.0440.4180.1633.708.4 0.0090.0680.3690.2243.297.5 0.0060.0920.3270.2773.016.9 0.0110.1200.2870.3232.696.0 0.0060.1670.2180.3802.284.7 0.0140.2410.1710.4221.753.2 0.0140.2710.1470.4351.612.7 0.0150.3110.1150.4531.462.3standard uncertainties are: u(x) <0.003, u(t) = 0.05 k compositions of experimental tie lines, solute distribution ratios,, and selectivity, s, for ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1) + thiophene or benzothiophene (2) + heptane (3)} at t = 308.15 k, p = 101.33 kpa standard uncertainties are: u(x) <0.003, u(t) = 0.05 k the solubility of thiophene at t = 308.15 k is equal to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{\text{il}} $$\end{document}x2il = 0.814 for [c1c5pip][ntf2] (x2il = 0.797 for [c1c3pip][ntf2] at t = 298.15 k, the influence of temperature is minimal; the largest solubility of thiophene in the piperidinium - based il was observed for c1c6pip][ntf2]). Complete miscibility with thiophene was observed for [p2,4,4,4][dep]. In the binary system with benzothiophene, the solubility of benzothiophene in [c1c5pip][ntf2] at t = 308.15 k is equal to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{\text{il}} $$\end{document}x2il = 0.873 (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{\text{il}} $$\end{document}x2il = 0.945 for [c1c3pip][ntf2] at t = 308.15 k . Immiscibility is observed in the {thiophene, or benzothiophene (2) + heptane (3)} binary mixture, as was reported previously . The determined experimental tie - lines for the ternary lle systems are plotted in figs . 1, 2, 3, 4 for thiophene and benzothiophene, respectively . Figures 1, 2, 3, 4 show that the two - phase region is much larger for [c1c5pip][ntf2] than that for [p2,4,4,4][dep].fig . 1plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1) + thiophene (2) + heptane (3)} at t = 308.15 kfig . 2plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1) + benzothiophene (2) + heptane (3)} at t = 308.15 kfig . 3plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1) + thiophene (2) + heptane (3)} at t = 308.15 kfig . 4plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1) + benzothiophene (2) + heptane (3)} at t = 308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1) + thiophene (2) + heptane (3)} at t = 308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1) + benzothiophene (2) + heptane (3)} at t = 308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1) + thiophene (2) + heptane (3)} at t = 308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1) + benzothiophene (2) + heptane (3)} at t = 308.15 k the results obtained in this work show that the more suitable il for the separation of thiophene, or benzothiophene from heptane, is [c1c5pip][ntf2] because of its much larger selectivity (s) and the comparable solute distribution ratio (). These parameters are defined as follows:1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta = \frac{{x _ {2}^{\text{ii}}}} {{x _ {2}^{\text{i}}}} $$\end{document}=x2iix2i2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s = \frac{{x _ {2}^{\text{ii}} \cdot x _ {3}^{\text{i}}}} {{x _ {2}^{\text{i}} \cdot x _ {3}^{\text{ii}}}} $$\end{document}s = x2iix3ix2ix3iiwhere x is the mole fraction; superscripts i and ii refer to the heptane - rich phase and the il - rich phase, respectively . The values of and s are listed in table 2 for thiophene and benzothiophene . Figures 5 and 6 present measured values of and s for ils for thiophene and benzothiophene.fig . 5plot of the selectivity (s) as a function of the mole fraction of solute in the hydrocarbon - rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1) + thiophene (2) + heptane (3)}, filled square {[c1c5pip][ntf2] (1) + benzothiophene (2) + heptane (3)}, open circle {[p2,4,4,4][dep] (1) + thiophene (2) + heptane (3)}, and open square {[p2,4,4,4][dep] (1) + benzothiophene (2) + heptane (3)}, at t = 308.15 kfig . 6plot of the solute distribution ratio () as a function of the mole fraction of solute in the hydrocarbon - rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1) + thiophene (2) + heptane (3)} filled square {[c1c5pip][ntf2] (1) + benzothiophene (2) + heptane (3)} open circle {[p2,4,4,4][dep] (1) + thiophene (2) + heptane (3)}, and open square {[p2,4,4,4][dep] (1) + benzothiophene (2) + heptane (3)}, at t = 308.15 k plot of the selectivity (s) as a function of the mole fraction of solute in the hydrocarbon - rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1) + thiophene (2) + heptane (3)}, filled square {[c1c5pip][ntf2] (1) + benzothiophene (2) + heptane (3)}, open circle {[p2,4,4,4][dep] (1) + thiophene (2) + heptane (3)}, and open square {[p2,4,4,4][dep] (1) + benzothiophene (2) + heptane (3)}, at t = 308.15 k plot of the solute distribution ratio () as a function of the mole fraction of solute in the hydrocarbon - rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1) + thiophene (2) + heptane (3)} filled square {[c1c5pip][ntf2] (1) + benzothiophene (2) + heptane (3)} open circle {[p2,4,4,4][dep] (1) + thiophene (2) + heptane (3)}, and open square {[p2,4,4,4][dep] (1) + benzothiophene (2) + heptane (3)}, at t = 308.15 k the values presented in table 2 show that the distribution ratio coefficient are in the range of 0.812.41, 0.954.36, 1.362.69 and 1.464.13 for [c1c5pip][ntf2]/thiophene, [c1c5pip][ntf2]/benzothiophene, [p2,4,4,4][dep]/thiophene and [p2,4,4,4][dep]/benzothiophene, respectively . The selectivities of the separation in the system thiophene or benzothiophene / heptane is quite high for [c1c5pip][ntf2] and very low for [p2,4,4,4][dep]. The values listed in table 2 for the best tie - lines are: 26.7, 48.3, 6.0 and 9.1 for [c1c5pip][ntf2]/thiophene, [c1c5pip][ntf2]/benzothiophene, [p2,4,4,4][dep]/thiophene and [p2,4,4,4][dep]/benzothiophene, respectively . In this work the effect of the alkane chain length on the cation of the piperidinium - based il was examined for comparison with previously measured data for [c1c3pip][ntf2]/thiophene, [c1c4pip][ntf2]/thiophene, and [c1c6pip][ntf2]/thiophene at t = 298.15 k, and of [c1c3pip][ntf2]/benzothiophene at t = 308.15 k (the influence of temperature is not large). The characteristic extraction parameters obtained in this work are compared to the few previously described in the open literature in table 3 . Unfortunately, the selectivity for [c1c5pip][ntf2] obtained in this work is slightly worse than that for [c1c3pip][ntf2] measured by us earlier . The values of selectivity presented for 1-alkylcyanopyridinium - based ils at t = 308.15 k measured in our earlier work are also larger than those for piperidinium - based ils (see table 3).table 3comparison of solute distribution ratio () and selectivity (s) for sulfur compounds extractionillle system t / k max s max ref. [c1c5pip][ntf2]il + thiophene + heptane3082.4926.7this work[c1c5pip][ntf2]il + benzothiophene + heptane3084.3648.3this work[c1c3pip][ntf2]il + thiophene + heptane2982.5060.3[c1c3pip][ntf2]il + benzothiophene + heptane3085.3693.0[coc2mpip][ntf2] il + thiophene + heptane2982.6462.9[coc2mpip][fap] il + thiophene + heptane2984.0056.8[bcnpy][ntf2] il + thiophene + heptane3081.9362.2[bcnpy][ntf2] il + benzothiophene + heptane3083.50117.1[p2,4,4,4][dep]il + thiophene + heptane3082.696.0this work[p2,4,4,4][dep]il + benzothiophene + heptane3084.139.1this work[emim][dep] il + thiophene + hexane2982.8848.8[p1,4,4,4][ch3so4]il + thiophene + cyclohexane2981.385.38[dmim][mp] il + thiophene + heptane2980.421,756 1-(2-methoxyethyl)-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide 1-(2-methoxyethyl)-1-methylpiperidinium trifluorotris(perfluoroethyl)phosphate 1-butyl-4-cyanopyridinium bis{(trifluoromethyl)sulfonyl}imide 1-ethyl-3-methylimidazolium diethylphosphate 1,3-dimethylimidazolium methylphosphonate comparison of solute distribution ratio () and selectivity (s) for sulfur compounds extraction 1-(2-methoxyethyl)-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide 1-(2-methoxyethyl)-1-methylpiperidinium trifluorotris(perfluoroethyl)phosphate 1-butyl-4-cyanopyridinium bis{(trifluoromethyl)sulfonyl}imide 1-ethyl-3-methylimidazolium diethylphosphate 1,3-dimethylimidazolium methylphosphonate the selectivities for [c1c3pip][ntf2] are comparable to those for 4-(2-methoxyethyl)-4-methylpiperidinium trifluorotris(perfluoroethyl)phosphate [coc2mpip][fap] ils at t = 298.15 k, or to 4-(2-methoxyethyl)-4-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide [coc2mpip][ntf2]. The extraction results for [p2,4,4,4][dep] are very low and similar to [p1,4,4,4][ch3so4]. It can be definitely concluded that phosphonium - based cations are not suitable for these separation processes . However, for the diethylphosphate anion [dep] and imidazolium - based cation [emim], the results are comparable to those obtained in this work with [c1c5pip][ntf2] but with a lower value (see table 3). It can be also seen from figs . 5 and 6 that and s decrease as the solute mole fraction (thiophene, or benzothiophene) in the heptane phase increases, for all systems, when going through the tie - line end compositions . The ternary lle data measured in this study were correlated (the tie - line correlation) using the well known non - random liquid equation, nrtl . The equations and algorithms used for the calculation of the compositions in both phases follow the method described by walas . The objective function f(p) was used to minimize the difference between the experimental and calculated compositions:3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f(p) = \sum\limits_{i = 1}^{n} {\left [{x_{2}^{{{\text{i,}}exp}} - x _ {2}^{\text{i, calc}} \left ({pt} \right)} \right]^{2} + \left [{x_{3}^{{{\text{i,}}exp}} - x_{3}^{\text{i, calc}} \left ({pt} \right)} \right]}^{2} + \left [{x_{2}^{{{\text{ii,}}exp}} - x _ {2}^{\text{ii, calc}} \left ({pt} \right)} \right]^{2} + \left [{x_{3}^{{{\text{ii,}}exp}} - x _ {3}^{\text{ii, calc}} \left ({pt} \right)} \right]^{2} $$\end{document}f(p)=i=1nx2i, exp - x2i, calcpt2+x3i, exp - x3i, calcpt2+x2ii, exp - x2ii, calcpt2+x3ii, exp - x3ii, calcpt2where p is the set of parameters vector, n is the number of experimental points, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{{{\text{i}},exp}} $$\end{document}x2i, exp, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{3}^{{{\text{i}},exp}} $$\end{document}x3i, exp and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x _ {2i}^{{{\text{i}},{\text{calc}}}} \left ({pt} \right) $$\end{document}x2ii, calcpt, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{3}^{\text{i, calc}} \left ({pt} \right) $$\end{document}x3i, calcpt are the experimental and calculated mole fractions of one phase, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{2}^{{{\text{ii}},exp}} $$\end{document}x2ii, exp, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x_{3}^{{{\text{ii,}}exp}} $$\end{document}x3ii, exp\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x _ {2}^{\text{ii, calc}} \left ({pt} \right) $$\end{document}x2ii, calcpt, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x _ {3}^{\text{ii, calc}} \left ({pt} \right) $$\end{document}x3ii, calcpt are the experimental and calculated mole fractions of the second phase . The binary parameters of each constituent were regressed by minimizing the sum of the squares of the differences between the experimental and calculated mole fractions of each component of both liquid phases for each ternary system . The value of the non - randomness parameter, ij, was optimized in order to obtain the best model fit . The correlated parameters are given in table 4 along with the root mean square deviations (rmsd). The rmsd values, which are a measure of the precision of the correlation, were calculated according the equation:4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{rmsd}} = \left ({\sum\limits_{i} {\sum\limits_{l} {\sum\limits_{m} {\left [{x_{ilm}^{exp} - x_{ilm}^{\text{calc}}} \right]^{2} /6k}}}} \right)^{1/2} $$\end{document}rmsd=ilmxilmexp - xilmcalc2/6k1/2where x is the mole fraction and the subscripts i, l, and m designate the component, phase, and tie - line, respectively . The experimental and calculated lle data agreed relatively well.table 4binary interaction parameters, parameter ij and root mean square deviation (x) for the nrtl equation for the ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1) + thiophene or benzothiophene (2) + heptane (3)} at t = 308.15 k, p = 101.33 kpa ij g 12/(jmol)g 21/(jmol) ij rmsd x [c1c5pip][ntf2] + thiophene + heptane 128261.1123225.940.20.007 132536.4315361.68 23460.97475.45[c1c5pip][ntf2] + benzothiophene + heptane 125698.7312608.560.20.007 135142.9534672.57 232498.842232.66[p2,4,4,4][dep] + thiophene + heptane 125566.067459.650.20.003 132785.5519670.14 233351.226008.81[p2,4,4,4][dep] + benzothiophene + heptane 129265.5911427.530.20.004 132823.0616531.68 231048.012808.72 binary interaction parameters, parameter ij and root mean square deviation (x) for the nrtl equation for the ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1) + thiophene or benzothiophene (2) + heptane (3)} at t = 308.15 k, p = 101.33 kpa liquid phase equilibrium data were measured in this study for the extraction of thiophene or benzothiophene from heptane using two ils . Four ternary systems {il + thiophene or benzothiophene + heptane} were analytically determined using gc for the composition analysis at temperature t = 308.15 k at ambient pressure . It has been demonstrated that the 1-pentyl-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide il is much more effective than the phosphonium - based il for extraction of thiophene or benzothiophene from alkanes . Sulfur compounds can be extracted easily by piperidinium - based ils, leading to low sulfur content in fuels . Our earlier experimental results revealed that the solubility of sulfur compounds in the il increases as the alkyl chain length increases . The capacity of extraction, described in terms of the selectivity and the solute distribution ratio coefficients, was calculated for all ternary systems and compared to the published data used in similar extraction problems . Based on the values obtained, [c1c5pip][ntf2] was found to be useful for the extraction of sulfur compounds from alkanes; however, it is not as good as [c1c3pip][ntf2] measured previously . The selectivity and the solute distribution ratio decrease as the mole fraction of thiophene or benzothiophene in the heptane - rich phase increases . The best selectivity (s) is observed for very low mole fractions of s - compounds in the hydrocarbon - rich phase \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$(x_{2}^{\text{hc}} \, = \,0.0 5) $$\end{document}(x2hc=0.05) (see fig . 5), which may be compared with the results of the hds method for the removal of the s - compounds . The experimental data in this work the non - randomness parameter was also determined through the reduction of the experimental data . The model exhibited an excellent fit to the data with the average rmsd values between 0.003 and 0.007.
Higher carriage rates are seen in diabetics, intravenous drug users (ivdu), hiv and dialysis patients . All patients with s. aureus bacteremia should undergo transthoracic echocardiography (tte), since s. aureus bacteremia is associated with heart valve involvement in 25% of the cases . Nevertheless, tee has been shown to be superior to tte for the diagnosis of infective endocarditis (ie), identifying small vegetations and abscesses . All infective foci must be identified and removed as soon as possible; however, foci are not always obvious and long - term antimicrobial therapy might be necessary . Nafcillin is a well - established agent for serious systemic non methicillin - resistant s. aureus (mrsa) infections and has been reported as superior over vancomycin . We present a very interesting case of a rapidly progressive methicillin - sensitive staphylococcus aureus infection, for which empirical treatment with vancomycin and initial treatment with nafcillin did not stop further dissemination despite adequate mic, taking longer than usual to respond to adequate treatment . A 64-year - old male patient with a past medical history of hypertension, hiatal hernia and osteoarthritis presented to the emergency department with a chief complaint of acute worsening of his chronic lower back pain for two weeks and progressive weakness in lower extremities . He used to ambulate with a cane and later used a walker for several days, but recently he felt non - ambulant . Cardiac examination showed a regular rate and rhythm with normal s1 and s2 and no murmurs . On further review of systems he reported having chronic bilateral knee pain related with osteoarthritis and a congenital deformation of his right knee . He was a smoker of 40 pack - years, occasional user of alcohol and marijuana, but denied ever using intravenous drugs and toxicology was positive only for oxycodone, which he used for chronic lumbar pain for several years . Laboratory exams displayed a leukocytosis of 25,500 with 89% neutrophils, no bands, sedimentation rate of 44, lactic acid 1.6, anion gap 18 . Thoracic and lumbar spine computed tomography (ct) scan showed multilevel central canal and bilateral neural foraminal compromise, but did not show evidence of abscess . Partially visualized lungs showed a cavitary lesion in the superior segment of the left lower lobe, measuring 1.4 cm with circumferential thick wall, suggestive of septic emboli versus tuberculosis, and left inferior renal pole abnormalities suggestive of multiple infarctions . The patient was started empirically on vancomycin 15 mg / kg iv q 12h, while waiting for sensitivities . The tte performed after bacteremia diagnosis showed an ejection fraction of 65% with normal valves and no vegetations . On day two of hospitalization the clinical picture worsened as the patient suddenly developed an altered mental status and nuchal rigidity . Lumbar puncture confirmed meningitis with a cerebrospinal fluid leukocytosis of 1157 (neutrophil 95%) and culture positive for s. aureus . Testing for hiv, herpes simplex virus (hsv) and tuberculin skin test (ppd) were all negative . Spine magnetic resonance imaging (mri) showed osteomyelitis at t12-l1 and previously seen (in ct scan) renal infarcts . The patient continued to be febrile despite pathogen susceptible to vancomycin with mic <2 mg / ml, trough previous to 4 dose 11, repeated trough 18.4, repeat blood cultures at 48 and 96 hours remained negative . Six days later he had clinical deterioration with tachypnea, hypoxia, new systolic 2/6 murmur, louder over cardiac apex area, and bilateral respiratory crackles . At this point, the patient was switched to nafcillin 2 g iv q 4h when blood culture results confirmed methicillin susceptibility on day 3 of admission . Head mri showed multiple infarcts in a non - vascular pattern secondary to septic embolisms (figure 1). The tee showed severe mitral and tricuspid regurgitations, with 1.5 cm mobile vegetation on the posterior leaflet of the mitral valve . The patient was transferred to the intensive care unit due to the complicated picture of mssa bacteremia, ie, osteomyelitis, meningitis, ischemic stroke, renal and pulmonary infarcts secondary to septic emboli . There were indications for emergent mitral valve replacement, however given his recent finding of embolic stroke; this was not feasible due to high mortality risk . Follow up tte showed worsening mitral and tricuspid valve involvement, therefore mitral and tricuspid valve replacements were performed, four weeks from ie diagnosis . He completed 8 weeks of nafcillin (given his vertebral involvement and unknown source). After 2 months of hospitalization, patient was discharged home with a dual - chamber pacemaker due to persistent 3rd degree atrio - ventricular block, post surgery . Staphylococcus aureus is one of the leading agents of infection among adult patients . When s. aureus invades deep structures it often metastasize hematogenously to other areas and organs with significant morbidity . Infection caused by community acquired mssa strains are characterized by severe clinical course with increased incidence of endocarditis and organ failure . Two important questions should be asked to the patient with the intention to identify focal source and consider additional necessary diagnostic test . Ivdu related infection can manifest as an initially insidious presentation that later complicates to be an aggressive metastatic disease . We presented a unique case since our patient was not an ivdu nor an initial focus of infection was identified . Additionally, the progression from negative to positive echocardiogram findings of valvular vegetations highlights the high virulence of this community - acquired pathogen, since severe valvular regurgitation or insufficiency should be equally observed on both types of echocardiograms . Altered mental status in such patients a mri is crucial to confirm the diagnosis with the visualization of a non - vascular pattern . Mssa meningitis is a serious infection, which can occurs in patients without risk factors or immunosuppression . Like meningitis, stroke secondary ca - mssa is rarely seen, regardless of the severity of infection . High level of clinical suspicion is needed in such patients, as back pain could be the only reliable predictor of an added spine infection . When treating for gram - positive cocci bacteremia, empirical antibiotic therapy should provide coverage against staphylococci, usually with vancomycin to cover mrsa . Nafcillin / oxacillin remains the antibiotic of choice for treating infections caused by mssa once culture and sensitivity results confirm it, because nafcillin is superior to vancomycin in preventing persistent or relapsing mssa bacteremia . In the case of endocarditis, studies have demonstrated that vancomycin (versus nafcillin) is significantly associated with relapse given its slow bactericidal activity . For our case, the reasons why empirical treatment with vancomycin and initial treatment with nafcillin, did not stop further dissemination remained unknown . Nevertheless, continued treatment with nafcillin eventually did resolve the infection . We have to consider that, even though the mic remains the only satisfactory in vitro measurement of the intrinsic activity of antimicrobials, the test has always been open for criticism since it is performed with the use of artificial media and fixed concentrations, under conditions that may be very different from those in the actual site of infection . There is evidence that support the concept of the principal determinant of efficacy of beta lactams to be the time for which the drug levels exceed the mic at the site of infection, not just and mic <2 mg / ml by itself . Also, bacterial strains have been detected to have a mbc (minimum bactericidal concentration) many times higher than the mic, (known as phenotypic tolerance), isolated in vitro gram - positive bacteria causing slower clinical response . The inoculum effect may be clinically relevant since the number of bacteria at the site of infection may much higher that the traditionally used for susceptibility testing . Although the benefit of such concentration is questionable since our patient s infection was multifocal . Our laboratory was not able to analyze serum nafcillin concentrations; hence, samples would have to send to a referral laboratory . A community acquired pathogen, even when part of the normal flora could be virulent enough to cause end organ damage from head to toe . The use of head mri as a pre evaluation tool for ie - related urgent valve surgery is imperative, to investigate whether such preoperative findings affect postoperative outcomes . The presence of characteristic cranial mri lesions may prompt early diagnosis of infective source and lead to the adequate management . Beyond the mic, the time the drug level exceeds the mic, the phenotypic tolerance and the inoculum effects may be reasons why empirical treatment with vancomycin and initial treatment with nafcillin did not stop further dissemination, but, eventually, clearing the infection.
The use of nanomaterials in medicine involves the applications of nanoparticles and manufactured nanosystems to provide regeneration at the cellular and tissue levels . They encapsulate therapeutic agents and typically carry multiple targeting motifs such as hemostasis [1, 2]. For instance, ellis - behnke and coworkers introduced a unique nanomedicinal method to stop bleeding using a self - assembling peptide that establishes a nanofiber barrier and incorporates it into the surrounding tissue to form an extracellular matrix [1, 2]. Biomaterials used as tissue engineering scaffolds have specific physical properties and might form fibrous networks similar to collagenous extracellular matrix . They also can be programmed to carry chemical and physical cues to provide bioactivity for cell - materials interactions . In the search for more improved bioactive materials for tissue engineering purposes, peptide amphiphile (pa) molecules are good candidates to bring scaffold properties and bioactivity together [3, 4]. Hydrophobic region of the pa is composed of fatty acids, which are packed against aqueous medium inducing self - assembly of the molecule to form cylindrical nanofibers . Charged amino acids on hydrophilic peptide region of the pa molecules are responsible for triggering self - assembly upon isolation of charges . Neutralization of charge density on amino acids causes aggregation of pa molecules and formation of nanofibrous networks at microscale . Encapsulation of water by these nanofiber networks results in constitution of self - supporting gel at macroscale . Peptide part of the pa molecules can be synthesized in a way to include bioactive epitopes or biofunctional chemical groups, which are eventually presented to cells on nanofibers . Pa gels carrying these types of functionalities have been studied thoroughly and proven to be active in terms of inducing angiogenesis, neuronal regeneration, and cartilage and bone tissue formation [710]. Charge neutralization mechanism also allows us to use bioactive molecules with high negative or positive charge density, such as heparin, dna, or oligonucleotides for inducing gel formation, while exploiting their bioactivity [6, 11, 12]. The use of medicinal plants as remedies for numerous disorders has formed the basis of current medicinal approach . Various plants are used ethnomedicinally for prevention of excessive bleeding and as wound dressing to staunch blood flow . Ankaferd hemostat, a topical hemostatic agent of plant origin, has recently been registered for the management of clinical hemorrhages when the conventional methods to control bleeding by ligature and/or hemostatic measures are ineffective [1416]. Ankaferd blood stopper (abs) includes standardized preparation of the plants thymus vulgaris, glycyrrhiza glabra, vitis vinifera, alpinia officinarum, and urtica dioica [17, 18]. Abs provides vital erythroid aggregation covering the entire physiological hemostatic process via a unique protein network depending primarily on the interactions between abs and blood proteins, particularly with fibrinogen gamma and prothrombin [16, 1922]. Vital erythroid aggregation takes place with the spectrin and ankyrin receptors on the surface of red blood cells (rbcs). Those rbc proteins and the required atp bioenergy are included in the abs protein library [23, 24]. On the other hand, controlled clinical trials indicated the safety and efficacy of topical ankaferd hemostat in distinct clinical backgrounds [19, 2531]. In this work, we present a chimeric hemostatic agent, abs nanohemostat, via combining a self - assembling pa molecule with the traditional ankaferd hemostat . The first step of our research was the synthesis of the specific self - assembling peptide molecules capable of being a part of the combined abs nanohemostat compound . The second step was the assembly of the peptide nanofibers and abs to generate the abs nanohemostat . The third step of our study was testing the in vivo hemostatic effects of abs nanohemostat in comparison with the traditional ankaferd in a previously established and published controlled surgical experimental trial in kidney tissue . The ultimate aim of the present study is, therefore, to test the efficacy of abs nanohemostat formed by combination of a self - assembling pa molecule and ankaferd hemostat for controlling surgical bleeding due to renal injury during partial nephrectomy (pn) and to compare its hemostatic effects to the traditional surgical and ankaferd hemostat groups . 9-fluorenylmethoxycarbonyl (fmoc), ter . Butoxycarbonyl (boc) protected amino acids, rink amide mbha resin, and 2-(1h - benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (hbtu) were purchased from novabiochem or abcr . The other chemicals were purchased from fisher, merck, alfa aesar, or aldrich and used as provided . Amino acid couplings were done with 2 equivalents of fmoc protected amino acid, 1.95 equivalents hbtu, and 3 equivalents of n, n - diisopropylethylamine (diea) for 2 hours . Fmoc removal was performed with 20% piperidine / dimethylformamide (dmf) solution for 20 min . Cleavage of the peptides from the resin was carried out with a mixture of tfa: tis: h2o in ratio of 95: 2.5: 2.5 for 2 h. excess tfa was removed by rotary evaporation . The remaining viscous peptide solution was triturated with ice - cold ether, and the resulting white product was dried under vacuum . Pa molecules were characterized by liquid chromatography - mass spectrometry (lc - ms) (figure 1). Mass spectrum was obtained with agilent lc - ms equipped with agilent zorbax extend - c18 2.1 50 mm column . A gradient of (a) water (0.1% formic acid) and (b) acetonitrile (0.1% formic acid) was used . It is composed of a lauryl (c12) group, hydrophobic region of the pa, and a peptide sequence . Vvag peptide sequence is used as -sheet inducer that causes nanofiber formation, while the lysine (k) residue is protonated at physiological ph and increases solvation of pa molecule in aqueous solution at ph 7 . Figure 2 shows both the chemical structure of the pa (lauryl - vvagk - am) and the schematic representation and abs nanohemostat formation . 1 10 m peptide solutions were measured from 300 nm to 190 nm, data interval and data pitch being 0.1 nm and scanning speed being 100 nm / min, all measurements with three accumulations . Digital integration time (dit) was selected as 1 sec, band width as 1 nm, and the sensitivity was standard . Oscillatory rheology measurements were performed with anton paar physica rm301 rheometer operating with a 25 mm parallel plate configuration at 25c . Each sample of 100 l total volume with a final peptide concentration of 1 wt% was carefully loaded on the center of the lower plate and incubated for 15 min before measuring . After equilibration, the upper plate was lowered to a gap distance of 0.5 mm . Storage moduli (g) and loss moduli (g) values were scanned from 100 rad / s to 0.1 rad / s of angular frequency, with a 0.5% shear strain . Sem experiments were performed with fei nova nanosem 230, using the etd detector at low vacuum mode with 30 kev beam energy . Small amounts of gels with a final peptide concentration of 1% were put on a metal mesh, dried at critical point (1072 psi, 31c) with tousimis autosamdri-815 b series c critical point dryer and coated with 6 nm au - pd . Figure 3 shows sem images of pa gel with and without ankaferd at ph 10 . An amount of 250 l of pa was mixed with 250 l abs solution on glass slide and incubated at room temperature for 30 min for self - supporting gel formation . Due to anionic molecules in ankaferd solution, all animal experimentations described in this paper were carried out in accordance with national guidelines for the use and care of laboratory animals and were approved by the local animal review and ethics committee . All procedures were in full compliance with turkish law 6343/2, veterinary medicine deontology regulation 6.7.26, and with the helsinki declaration of world medical association recommendations on animal studies . The animals were obtained from the center of medical experimental research of ankara training and research hospital . The rats were housed in stainless steel cages in an animal room maintained at a temperature of 2224c with 12-hour light / dark periods . All were fed with the same amount of laboratory pellet diet and with water supplied ad libitum for a minimum of 5 days before procedure . A total of 24 wistar rats weighing 200 to 300 g were divided into 4 groups of 6 each and underwent pn . All operations were performed under total anesthesia with injection of 50 mg / kg intramuscular ketamine hydrochloride . The lower third of the left kidney was resected in guillotine fashion with a single stroke of an amputating knife . (i) group 1 (g1) is the left pn with hilar vascular control including intracorporeal suturing of the renal parenchyma and collecting duct (control group). (ii) group 2 (g2) is the conventional pn with only 0.5 ml traditional ankaferd hemostat (abs) application without suturing . (iii) group 3 (g3) is the conventional pn with abs (0.25 ml) + peptide (0.25 ml) gel (abs nanohemostat) mixture application with no suturing . (iv) group 4 (g4) is the conventional pn with only 0.5 ml peptide solution application . (i) group 1 (g1) is the left pn with hilar vascular control including intracorporeal suturing of the renal parenchyma and collecting duct (control group). (ii) group 2 (g2) is the conventional pn with only 0.5 ml traditional ankaferd hemostat (abs) application without suturing . (iii) group 3 (g3) is the conventional pn with abs (0.25 ml) + peptide (0.25 ml) gel (abs nanohemostat) mixture application with no suturing . (iv) group 4 (g4) is the conventional pn with only 0.5 ml peptide solution application . Two objective parameters were recorded during the surgical procedure: warm ischemia time (wit) and amount of bleeding (aob). Second, while the aob was measured with the bleeding area (cm) onto the sponges . All the rats were allowed to feed and drink water for the following 4 weeks . After that, each rat was sacrificed, and total nephrectomy was performed for histopathological examination . Wi started with clamping the renal artery and vein and finished with taking the clamp out . In g1, traditional hemostasis method was used as compression onto the renal excised area and suturing the renal vessels and collecting duct with absorbable sutures (figures 4(a) and 4(b)). In g2, 2 ml of abs was dropped to the amputated renal margin steadily until bleeding stopped (figures 4(c) and 4(d)). In g3, abs (2 ml) + nanopeptide gel mixture (abs nanohemostat) other hemostatic methods including sponges, surgicel, electrocautery, and any other sources were not used to control bleeding in the present study . Coronal 1 to 2 mm thick slices of the kidney were fixed in 4% formaldehyde and embedded in paraffin, and 3 to 4 m thick tissue sections were stained with hematoxylin and eosin . Sections were examined for several parameters including erythroid aggregation, fibrosis, calcification, inflammatory cells, and siderophages . For each case, a global estimation of parenchymal damage was done and semiquantitatively graded on a scale in which 0 was no abnormality, and 1 +, 2 +, and 3 + represented mild, moderate, and severe abnormalities, respectively . Data analysis was performed using ibm statistical package for the social sciences (spss) statistics software . Comparisons of numerical variables among four groups were initially performed using the kruskal - wallis test and mann - whitney u - test with the bonferroni correction used for post hoc analysis to compare the groups separately . A p value of <0.0083 (0.05/6) was deemed statistically significant in multiple comparisons . The percentages of histopathological features between study groups were compared using the chi - squared test . A p value of <0.05 was considered as statistically significant . In this work, we synthesized a positively charged pa molecule as shown in figure 2 . Storage and loss moduli measurement by oscillatory rheometry was performed in order to characterize the mechanical properties of the gel . Storage moduli, showing stiffness of gel, were found to be several folds higher than loss moduli, indicating a self - supporting gel formation (figure 5). Moreover, storage modulus value was comparable to control gel formed by elevating ph of pa solution . Circular dichroism spectroscopy was used to investigate the secondary structure of the pa and ankaferd mixture . Characteristic -sheet formation was observed in pa - ankaferd solution, which was similar to pa solution at high ph . Morphology of the gel was examined by using sem which showed nanofibrous network structure similar to pa gels reported before and pa samples at high ph . The ph 10 solutions for pa molecule were studied to analyze the peptide gels alone . The pa molecules were dissolved at ph 7, and they self - assembled into nanofibers forming gels upon addition of ankaferd solution or by increasing the ph to 10 . Left lower pole pn was surgically performed successfully to each rat in all groups . The kidney size and the same surgical equipments were used, and rommel clamps succeeded the warm ischemia during all surgical procedures . Mean sd wits were 232.8 56.3, 65.6 11.4, 75.5 17.2, and 58.1 17.6 seconds in g1 to g4, respectively . A significant difference was detected between g1 and g2, 3, and 4, while no difference was observed among the three groups; g1, g2, and g3 (table 1). In g1, renal parenchyma injury that caused the longer wit and repaired with primary suture was present in one rat . In g4, more amount of nanopeptide agent was used to stop the bleeding in one rat following the warm ischemia . Apart from these two cases, no complication was observed during the operations . Fibrosis was not different among the groups (p> 0.05), while inflammation was detected to be significantly different in g3 and g4 (p = 0.04). Erythrocyte aggregation, especially in glomerular field (figure 7), was confirmed to be significantly higher in g3 (abs nanohemostat) compared with the other groups (p = 0.03). Hemosiderin was also detected in g3; however, no significant difference was detected among the groups . In g4, bleeding and congestion without erythrocyte aggregation were confirmed with significant calcification (p <0.001) (figure 8). We confirmed the significant demonstrative aggregation of red blood cells in abs nanohemostat group as shown in abs group . Giant cell reaction, thyroidization, fibroblast activation, and microvascular proliferation were not detected . In this study, we revealed that pa - ankaferd gel mixture (abs nanohemostat) is effective as traditional ankaferd hemostat . Moreover, this unique nanomedicine proves itself as an effective and easily applicable alternative hemostatic method which can successfully be used even in complicated hemorrhagic situations such as aggressive surgical tissue bleeding due to pn . Several hemostatic agents are preferred to control external and internal bleedings; yet, commercially available products are not sufficiently effective or fast acting to achieve hemostasis in extreme occasions . Ankaferd hemostat is a topical hemostatic agent of plant origin, including molecules with high density of negative and positive charges, and is proven to work as an efficient hemostatic agent [1416]. Controlled clinical trials indicated the safety and efficacy of topical ankaferd hemostat in distinct clinical backgrounds [19, 2531]. In this work, we aimed to assemble a nanostructured scaffold material with hemostatic activity in the pa and ankaferd gel formed upon mixing soluble pa molecule with ankaferd solution (abs nanohemostat). Thus, we hypothesized that, while reducing blood loss, nanofiber network will serve as a scaffold for infiltrating cells to wound area, and eventually tissue regeneration rate will be enhanced . Sustaining hemostasis in clinical hemorrhages is a challenging task and requires extensive effort to stabilize traumatic and surgical injuries . Our experimental animal model is therefore clinically relevant since bleeding is one of the most important major complications leading to the morbidity and even mortality during pn for renal masses . Providing hemostasis following the renal mass excision is the most important step of pn, and various hemostatic agents were used to stop bleeding during this operation [3335]. Although the complication rates including bleeding are slightly higher than those of open radical nephrectomy, the advantage of renal preservation is more evident . Likewise, laparoscopic pn, including hilar control, suture repair of the collecting system, suture ligation of blood vessels, and capsular closure, is also a valuable urological intervention . Bleeding and ischemic renal damage due to warm ischemia period are the most important complications following surgery . In order to decrease wit and pnt several agents have been investigated for their hemostatic potential in managing vascular injury and many have also been evaluated for their efficacy on repairing the collecting system injury . In our results, abs and abs nanohemostat applications onto the transected kidney area provided active hemostasis in pn with significant decrease in wits and pnts, comparable with suture group . With more application number of abs products, however, the absence of urinoma in the groups applied with abs may reveal the effect of abs on collecting system repair following one month . These favorable findings lead to the active hemostasis and regular healing of transected kidney without adherence and urinoma around the kidney . In our studies, we demonstrated foreign material reaction in conventional pn model but not observed in the abs groups . However, it could be speculated that the topical abs administration onto the sutured line might prevent foreign biological reactions (fbrs) against the suture by the way of affecting biological pathways . The anti - infective effects [3638] of abs represent a putative biological mode of action on the hypothetical fbr . The hemostatic effect of local abs application in a patient who underwent an open pn has already been shown . Abs was successfully applied to stop bleeding without suturing the renal parenchyma, which provided active hemostasis in pn on the transected kidney area . The surgical and histopathological findings about pn in the present trial and our previous research suggested similar results regarding the renal tissue effects of abs . Moreover, nanotechnologically generated chimeric abs nanohemostat was observed to increase the duration of the contact of ankaferd hemostatic agent with the bleeding area during pn via the controlled targeted release of the topical hemostatic agent to the tissue . Controlled clinical studiesconducted to evaluate the effectiveness of abs in distinct states of bleeding disorders documented the safety and efficacy of traditional ankaferd hemostat in comparison to conventional antihemorrhagic medications . The first randomized controlled clinical study was reported by teker et al . In 49 patients with anterior epistaxis . In this study, patients were randomly grouped to receive the hemostasis technique by means of either abs wet tampon or phenylephrine impregnated gauze tampon for anterior epistaxis control . Abs successfully treated all bleeding intensity with one application (for 5 m). Abs patients experienced fewer rebleeding rates within 7 days compared to phenylephrine patients (8.3 versus 20%, p <0.05). In patients to whom abs was applied, significant differences in effective control of anterior epistaxis similarly, another clinical trial has also demonstrated the effectiveness of abs in children undergoing tonsillectomy . In this prospective controlled study, the success of abs and the traditional knot - tie approach to reach hemostasis for patients undergoing tonsillectomy was evaluated . Forty - seven consecutive patients undergoing cold knife dissection tonsillectomy were studied, in all of whom abs wet tampon was used for right side tonsil hemorrhage and knot - tie technique for left side tonsil hemorrhage . The abs side was reported to have shorter hemostasis time after tonsil removal than the knot - tie side (3.19 0.74 min versus 7.29 2.33 min, p <0.01) and less blood loss (1.57 2.26 ml versus 14.04 7.23 ml, p <0.01). The author concluded that abs is not only safe and efficient, but also it decreases intraoperative bleeding and reduces operating time compared to the traditional hemostasis methods after cold knife dissection tonsillectomy . The effectiveness of abs in cancer patients was also reported in a study by al et al . . Sixty - nine cancer patients that were admitted for port insertion to a university hospital were randomized either to take a wet compress form of abs or regular dry sterile sponges to stop the bleeding that occurs during the clinically indicated vascular port insertion . The average time needed to stop the bleeding was 32.97 29.9 s for abs group and 123.75 47.5 s for dry sponge group . Abs was proven to stop local bleeding in a shorter time, with a lower recurrence rate in comparison with the sterile sponge . Additional clinical studies about antihemorrhagic efficacy of abs on the bleeding due to adenoidectomy, [28, 40] the surgical bleeding of thyroidectomy, gastrointestinal bleedings [14, 29], and dental bleedings were performed with similar beneficial outcomes . Our promising experimental results about abs nanohemostat in this study cast novel studies to search clinically measurable end - points regarding the hemostatic efficiency of this unique chimeric nanomedicine . The findings of our present study represent a starting point to investigate clinical antihemorrhagic effects of abs nanohemostat . The ability of abs to induce formation of a protein network not only makes it an effective hemostatic agent, but also confers anti - infective, antineoplastic, and healing modulator properties to the extract [1416]. Those pleiotropic effects were ascribed to the abs - induced alterations in apoptosis, angiogenesis, cellular proliferation, and cellular dynamics [46]. In previous investigations, histopathological examination of the damaged vascular structures revealed abs - induced red blood cell aggregates supporting the hypothesis that abs - induced formation of the protein network with vital erythroid aggregation covers the entire physiological hemostatic process [42, 43]. We have observed the same structures in the kidney tissue in the present study . In the current study, abs nanohemostat has led to a more pronounced erythroid aggregation at the tissue level in comparison to the traditional ankaferd hemostat . However, clinical antihemorrhagic efficiency of ankaferd solution seems to be superior to the chimeric ankaferd nanohemostat . In summary, abs nanohemostat has comparable hemostatic efficacy to the traditional ankaferd hemostat in the pn experimental model . These observations prompt the design of future experimental and clinical studies focusing on the antibleeding and vascular repair effects of this novel hemostatic nanomedicine . The production of abs nanohemostat in gel formation is also important for using the hemostatic material during the laparoscopic urologic surgery . The steady scaffold onto the resected area with abs nanohemostat predicts the intracorporeal use of abs hemostat as a promising agent . Likewise, future controlled studies are needed to shed further light on the expanding spectrum of the effects of abs compounds in hemostasis and related areas.
Falls are one of the leading injury - related accidents involving older adults whose muscular strength, proprioceptive sense, and bodily coordination are compromised with aging1 . The elderly lack obstacle negotiation capacity and are prone to trip over commonly encountered environmental barriers such as door sills, pavement blocks, and safety bumps2 . In a local community, 33% of elderly people were reported to experience falls, of which 42.4% suffered falls3 . Individuals with a history of falls have fears of repeated falls, depression, and anxiety, all of which lead to decreased physical activities4 . These negative experiences result in reduced physical capacity in terms of muscular strength, bodily flexibility, and coordination, rendering the affected elderly even more susceptible to falls in a vicious cycle5 . Notably, elderly women are more at risk of secondary injury such as severe fractures after falling than elderly men because of their low bone density after menopause6 . Interventions for fall prevention include exercise, education, environmental improvements, and medication7,8,9, of which exercise has been used in fall prevention programs in many ways, as it takes less time and money to implement and programs are easy to set up . Carter et al.10 reported in a bibliographical study on exercise intervention that exercise improved leg strength 44.4% and balance ability 37.5% in older adults and that as weakness of muscle strength in the trunk was more important than that in the lower extremities, strengthening of lumbar function can improve functional stability, leading to increased balance ability, gait ability, and prevention of falling11, 12 . Core stabilization exercise (cse) can improve balance control ability by reinforcing intersegmental muscles in the multifidus, transversus abdominis, and rotators13 and physicopsychological functions in a harmonious way by stimulating proprioception powerfully when it is accompanied by swiss ball exercises, improving balance sense, and maintenance ability14 . Previous studies on falling in elderly adults involving cse have been limited to balance ability or gait ability15, 16, and there have been only a few studies on obstacles as an environmental factor or psychological factors . Therefore, this study evaluated changes in the physicopsychological functions of elderly women with a fear of falling in negotiating obstacles such as a doorstep (5.2 cm) of a bathroom, where falling occurs frequently, through a performance - oriented mobility assessment (poma) in order to understand whether cse is valid as an efficient exercise to prevent and control falling in consideration of the physicopsychological functions of elderly women . The subjects of the study were 20 elderly women above the age of 65 who were able to walk independently, did not have experience participating in regular balance training more than twice a week within the past 6 months, had a score higher than 24 on the mini - mental status examination - korea (mmse - k), had no limits on exercise performance due to visual or musculoskeletal disorders and no previous experience of falling, and scored lower than 19 on the tinetti poma17 . The purpose and methods of this study were explained to all the participants, who read and signed an informed consent from that revealed all the details of the study protocol, which were approved by the ethics committee of kangwon national university (no . The subjects selected were divided into an experimental group and a control group by drawing lots, and the average age, height, and weight in the experimental group were 73.203.46 years, 152.154.29 cm, and 57.787.95 kg, while those in the control group were 71.003.50 years, 149.836.45 cm, and 53.8011.04 kg . There were no significant differences among the groups with regard to age, height, or weight (p>0.05). The core stabilization exercise program proposed by jeffrey18 and hesari et al.19 was applied to the experimental group and cse was composed of three steps . Level 1 consisted of abdominal hollowing in a supine position, abdominal hollowing in a prone position, abdominal hollowing in a quadruped position, abdominal hollowing in a supine position while curling the feet, abdominal hollowing in a prone position while curling the feet, and modified side bridging . Level 2 consisted of bridging with abdominal hollowing, pelvic bridging, the dying bug with abdominal hollowing, and abdominal hollowing while seated on a swiss ball . Level 3 consisted of pelvic bridging with a swiss ball, bird dog exercise, twists on a swiss ball, and bird dog exercises on a swiss ball . The experimental group performed a core stabilization program consisting of three levels for 30 min, three times per week on alternate days, for 6 weeks . This program consisted of three levels, and the subjects began at exercise level 1 and proceeded to the next level according to the protocol for the day . Level 1 included static holds in a stable environment, level 2 included dynamic movements in a stable environment, and level 3 included dynamic movements in an unstable environment, such as on a swiss ball, and resisted dynamic movements in an unstable environment . Before the program and 6 weeks after the program, the tinetti poma, crossing velocity (cv), maximum vertical heel clearance (mvhc) and knee flexion angle, which are related to physical functions, were measured, and with respect to psychological functions, depression and fear of falling were measured . The tinetti poma is an instrument used to decide the degree of fear of falling and balance and mobility in elderly adults consisting of items scored on a 3-point scale . The maximum score is 28, with 16 points for balance and 12 points for gait . If a subject scores below 19, fear of falling is high, and scores of 19 to 24 indicate an intermediate degree for fear of falling; scores of 25 to 28 indicate no fear of falling . For the crossing velocity (cv), the horizontal distance from the point at which the leading limb leaves the ground to the point at which the heel returns to the ground again is divided by the time taken20 . For the maximum vertical heel clearance (mvhc), the vertical distance from the height of the obstacle before obstacle negotiation to the ball of the leading limb was measured21 . The obstacle was 60 cm long, 10 cm wide, and 5.2 cm high . The subjects began their gait 5 m from the obstacle and continued on 3 m after obstacle negotiation . Cv and mvhc were measured with the use of dartfish software (dartfish, fribourg, switzerland)23, and the results were output in a data table . To analyze depression, the ces - d (center for epidemiological studies - depression scale) was used . It is scored on a 4-point scale (03), and includes a total of 20 questions . The higher the score, the higher the depression24 . For fear of falling, the fofq (fear of falling questionnaire) was used . It is scored on a 4-point scale (14) and includes a total of 11 questions . The higher the score, the higher the fear of falling25 . For statistical analysis of the results, spss 18.0 was used . To explain the differences in measurement variables according to the measurement period between exercise groups, a 2-way anova with repeated measure was used, and the level of statistical significance was =0.05 . Repeated measure anova to analyze changes in the poma, cv, mvhc, kf, depression, and fof according to the measurement periods showed that there was a statistically significant difference in the interaction between time and the groups and that the changes in poma, cv, mvhc, kf, depression, and fof according to time differed (p<0.001) (table 1table 1.changes in physical and psychological function variablesgroupbeforeafterpoma (score)eg (n=10)17.601.3419.301.57*cg (n=10)17.801.4017.601.43cv (m / sec)eg (n=10)1.560.211.600.21cg (n=10)1.560.101.550.09mvhc (cm)eg (n=10)7.421.387.021.33cg (n=10)7.361.627.311.74kf (angle)eg (n=10)111.003.16108.604.06cg (n=10)110.803.77110.303.16depression (score)eg (n=10)27.103.6724.503.34*cg (n=10)26.002.5825.203.00fear of falling (score)eg (n=10)22.501.4319.801.69cg (n=10)22.603.2721.903.54meansd . Eg, experimental group; cg, control group; poma, performance - oriented mobility assessment; cv, crossing velocity; mvhc, maximum vertical heel clearance; kf, knee flexion . Eg, experimental group; cg, control group; poma, performance - oriented mobility assessment; cv, crossing velocity; mvhc, maximum vertical heel clearance; kf, knee flexion . * p<0.05; * * p<0.01 older adults have low balance and stability due to physiological and functional decreases that occur with ageing26, and to compensate for balance and stability in gait, cadence and stride length decrease27 . In the case of obstacle negotiation, when the leading foot encounters obstacles, the center of the body moves forward and fear of falling increases28 . In this case, the mvhc, joint angle, and cv are important measures to assess the ability of elderly adults to safely cross obstacles during gait5, 29, 30 . Although falling is not always accompanied by physical injury, fear of falling again can be used to predict falling in elderly adults5 . Fear of falling leads to a decrease in activity and low self - esteem for independent behavior4 and has direct negative effects that result in decreased balance and gait disorder31, 32 . Cse is training to improve the stability of the trunk by inducing a correcting reaction and an equilibrium reaction through balance training of the flexors and extensors, and as it has been judged to have an effect on physicopsychological functions in obstacle negotiation, a clinical study was conducted . The results of the present study showed that the tinetti poma, cv, mvhc, and knee flexion angle were significantly improved . Esculier et al.33 provided lumbar stability training through a wii fit program for parkinson s patients for 6 weeks and administered the tinetti poma . Chou et al.20 reported that the cv was slow for elderly adults with lower balance ability . Weerdesteyn et al.21 provided balance, gait, and coordination training for elderly adults and reported that foot clearance decreased, which matched with the results of the present study . Park and lee22 reported that the maximum knee flexion angle of normal adults with lumbar stability was significantly lower in comparison with that of elderly adults with lumbar instability, which partially matched with the results of the present study . The study by lee et al.34, who reported that a falling prevention program decreased the gds (geriatric depression scale) significantly, was in agreement with the study by duque et al.35, who reported that fear of falling by elderly adults who experienced falling significantly decreased as a result of balance training using a virtual reality system . Such results indicate that stability of the trunk was secured, as cse decreased the sway area of the center of mass . Through harmonious exercise of the limbs based on physical stability, the subjects could negotiate obstacles precisely and easily, had higher self - esteem and had less fear of falling and depression . It is suggested that the 6-week cse decreased excessive obstacle gait with physical instability in elderly women and improved their physicopsychological functions involving obstacle gait.
A stroke is defined by the who as rapidly developing clinical signs of a focal (or global) disturbance of cerebral function, with symptoms lasting 24 h or longer or leading to death, with no apparent cause other than of vascular origin . Taking into consideration the cause, the mechanism and the character of morphological lesions, there are two types of stroke: ischemic and haemorrhagic [2, 3]. Eighty percent of strokes are of ischemic origin [2, 4], and their most common cause is thrombosis of the atherosclerotic internal carotid artery (ica) and/or cerebral arteries (ca)20% . A stroke, including an ischemic one, is of particular interest to the forensic pathologist aiming on establishing the cause of death and its mechanism, rather than for giving an opinion in cases of suspected medical malpractice . Neck and/or head trauma may very rarely constitute a cause of thrombosis of the ica and ca without any pre - existing pathology [58]. It most commonly results from direct, penetrating or non - penetrating (blunt) neck trauma in the region of large cervical vessels; less frequently it is attributed to indirect head trauma . In such cases the autopsy result and available clinical information has to allow the forensic pathologist to prove the existence of neck and/or head trauma and establish its causal connection with ica thrombosis and exclude other, known, non - traumatic causes of the latter . We present two cases of ica thrombosis with concomitant middle cerebral artery (mca) thrombosis secondary to the thrombus present in the ica lumen, in which the postmortem examination, the medical records regarding hospitalization and records of investigation indicated trauma as the cause of thrombosis . A 57-year old male carpenter sustained an injury in an occupational accident in the carpenter s warehouse . He was struck very hard in the face, in the region of his left cheek by an irregular - shaped wood fragment which looked like a big splinter (measuring about 26 cm in length, and with the greatest cross - sectional dimensions of 3.5 1.5 cm) that broke off from the board being processed on the carpenter s machine (fig . 1). First aid was provided in the emergency department in the local hospital, where the presence of a large, wooden fragment that thrust deep into the left cheek and penetrated through the parapharyngeal space into the neck was diagnosed . On admission he was then transferred to the otolaryngological ward, where a physical examination, including an evaluation of his neurological status revealed: maintained consciousness, narrow and symmetric pupils, circulatory and respiratory sufficiency and bp of 180/80 mmhg . The ct examination revealed the presence of a foreign body penetrating the left maxillary sinus with a comminuted fracture of the anterior and inferior wall below the external surface of the base of the skull, and a left occipital condyle fracture with concomitant breaking and impression into the posterior cranial fossa and soft tissues of the neck . No cerebral lesions, including traumatic, or features of raised intracranial pressure were observed (fig . 2). The ct angiography allowed the diagnosis of an occlusion of the ica by a thrombus localised at the level of the bifurcation of the common carotid artery (cca) and at the level of c1, adjacent to the foreign body . The laboratory findings were as follows: d - dimer 20921.25 g / l (n <500); pt and aptt within normal limits . Once the diagnostic procedures were finished, a surgical intervention was performed on the day of admission . The preparation of the internal jugular vein revealed the medial translocation and compression of the carotid vessels . The foreign body was removed . Post - interventional ct revealed the thrombotic occlusion of the left ica and mca and a hypodense area supplied by the mca and the concomitant left hemisphere oedema of the brain . The patient died on the 6th post - operative day exhibiting symptoms of intracranial hypertension and a brain oedema.fig . 2case 1: localisation of the foreign body (ct) case 1: wooden splinter removed during the surgical procedure case 1: localisation of the foreign body (ct) the findings of the medico - legal autopsy were as follows: a thrombus occluding the left ica and the proximal segment of the left mca, a large infarction area in the temporal lobe and adjacent parts of the frontal and occipital lobes of the left hemisphere of the brain, a large brain oedema with features of subfalcine herniation and transtentorian herniation, a comminuted fracture of the left maxilla and an occipital bone fracture in the region of the occipital condyle with the fragment impression . The histopathological examination revealed the occlusion of the left ica by the thrombus (h + e (fig . 3), masson, gomori, verhoeff and ptah), focal intimal haemorrhages and features of a mechanical injury the rupture of the artery wall in the form of an irregular fissure in the tunica media (fig . 4). The samples of the macroscopically changed left cerebral hemisphere revealed ischemic necrosis with polymorphonuclear leukocytes reaction, oedema and hyperaemia, while secondary, focal, non - reactive perivascular haemorrhages were found in the brainstem . Other organs showed no significant histopathological lesions, apart from morphological indices of circulatory disturbances.fig . 3case 1: the internal carotid artery wall with the adjacent thrombus (h + e)fig . 4case 1: damaged tunica media, damaged and dissected intima, as well as fragments of the thrombus within the internal carotid artery (a h + e and b verhoeff) case 1: the internal carotid artery wall with the adjacent thrombus (h + e) case 1: damaged tunica media, damaged and dissected intima, as well as fragments of the thrombus within the internal carotid artery (a h + e and b verhoeff) a 32-year old female patient was brought to the hospital after being battered what resulted in police intervention . On admission the patient was conscious, complaining about a left upper extremity contracture that started 2 weeks prior to admission . She was generally healthy, with no chronic diseases, taking no medication, apart from being a smoker . For the previous month she had been repeatedly battered by her partner (about twice a week) with a fist and open hand to the face, neck and back, as well as pulled by the hair . The last battery that took place 1 day prior to admission resulted in a short - term loss of consciousness . On admission the following body injuries were described in her medical record: resorbing bruises on the face, including a wound of the lower lip mucosa, and the upper extremities, . On admission the patient was sleepy with left - sided hemiparesis with symptoms concerning mainly the upper extremity, blood pressure was 110/80 mmhg, a fundus examination revealed no pathological lesions . D - dimer 1 200 ng / ml (n <500), aptt slightly shortened 25.69 s (n: 2836), aptt ratio and pt within normal limits . Ct revealed the presence of a hypodense area in the right hemisphere region supplied by the mca, whereas mri scan confirmed the presence of an ischemic brain damage . Thrombotic occlusion of the ica and mca was visible in mri (fig . 5) and angioct (fig ., the patient died on the 12th day after admission presenting symptoms of raised intracranial pressure with a concomitant brainstem injury secondary to a brain oedema.fig . 5case 2: occlusion of the right internal carotid and middle cerebral artery marked with an arrow (mri)fig . 6case 2: occlusion of the right internal carotid artery marked with an arrow (angioct) case 2: occlusion of the right internal carotid and middle cerebral artery marked with an arrow (mri) case 2: occlusion of the right internal carotid artery marked with an arrow (angioct) the findings of the medico - legal autopsy were as follows: a thrombus occluding the right ica and the mca, thrombosis of the internal jugular veins, as well as the superior sagittal sinus and transverse sinus, an extensive infarction area in the right hemisphere region supplied by the mca; a brain oedema with features of right - sided subfalcine herniation and transtentorian herniation, carotid and basal ca with no atherosclerotic lesions . A histopathological examination revealed an occlusion of the right ica by the thrombus (h + e, masson, gomori, verhoeff and ptah)a muscular type artery with normal wall structure, the lumen filled with thrombus fragments, mechanical injury of the arterial wall rupture of the intima and tunica media (fig . 7). Internal jugular veins normal wall structure, occluded by thrombi . There were dominating circulatory disturbances in the brain in the form of very significant capillary - venous hyperaemia resulting from an impaired cerebral venous return secondary to jugular vein and dural sinuses thrombosis.fig . 7case 2: damaged tunica media and intima of the internal carotid artery with intact adventitia (a h + e and b verhoeff) case 2: damaged tunica media and intima of the internal carotid artery with intact adventitia (a h + e and b verhoeff) observed in both cases, focal ischemic brain injury was secondary to the thrombosis of the ica and mca . Cerebral vascular lesions may be causally associated with the sustained head and/or neck trauma with concomitant ica thrombosis and ischemic brain damage [5, 713]. They can, however, accompany head and/or neck trauma, yet be independent of trauma and have other morbid origins [2, 4]. In both cases we considered the most common, known, possible non - traumatic causes for ica thrombosis, including atherosclerosis, which is the most common cause for ica and ca thrombosis . The endothelium and the connective tissue cap injury expose the blood coagulation activating factors, which induce thrombus formation . The endothelium injury itself with exposure of the basal membrane may predispose to thrombus formation as well . The presence of stable atherosclerotic plaque may be complicated by arterial thrombosis, and this refers to cerebral vessels as well . However, vessel stenosis has to be significant, i.e. The blood flow transforms from being laminar into post - stenotic turbulent [1417] both the in vivo neuroradiologic diagnostic imaging modalities, including ct angiography, and the postmortem examination with a histopathological assessment did not reveal the atherosclerosis of ica or mca in any of the discussed cases . Other factors favouring carotid arteries thrombosis include: hypertension, diabetes, hypercholesterolaemia, obesity and smoking [2, 4, 18]. Such factors accelerate the course of atherosclerosis, of which a common complication is thrombosis . The analysis of both patients medical records, including the laboratory findings obtained during hospitalisation allowed diabetes and lipid metabolism disorders to be ruled out . The woman did not manifest features of hypertension, whereas unstable aterial pressure values, i.e. Labile hypertension, was observed in the male patient . No lesions in the small - sized cerebral vessels that could have been responsible for the ischemic stroke were found during the postmortem examination, including the neuropathologic examination, within the ischemic, as well as in the non - ischemic areas . No arteritis, amyloid angiopathy, vascular malformations nor lesions observed in the course of hypertensive encephalopathy were found . The presence of a thrombus inside the ica and/or ca, and secondary focal ischemic brain damage may result from embolism [2, 4, 18, 19]. The most common source of such embolic material are thrombi localised in the left side of the heart (auricle of the left atrium in patients with atrial fibrillation), parietal thrombi in the left ventricle whose formation is associated with myocardial infarction or more frequently aneurysm of the heart in the area of an extensive post - infarction scar or left ventricle dilatation, e.g. In the course of dilated cardiomyopathy or endocarditis, especially of bacterial origin the embolism in the ica and ca may then develop in patients with atrial septal defect and deep vein thrombosis . The postmortem examination did not, however, reveal any of these conditions in the discussed patients . A significantly less common cause of stroke are haematological disorders, which are responsible for about 1% of all strokes and occur slightly more frequently in young subjects . The laboratory findings performed during hospitalisation and autopsies allowed haematological disorders to be ruled out as factors predisposing to thrombosis . The elevation of d - dimer level was the sole abnormal parameter observed on the coagulation profile and was associated with present ica and mca thrombosis in both cases . Oral contraceptives (oc) should be considered as a possible cause for thrombosis in the female patient . Oc are described in neurology as one of the ethological factors of ica and ca thrombosis . In the presented case the anamnesis collected on the patient s admission to the hospital indicated that she did not take any medication, most probably including oc . However, should she have taken oc, they did not significantly influence the development of ica thrombosis . Arterial thrombosis in such cases is very rare in women below 35 years of age [21, 22]. The annual incidence of ischemic stroke in women in this age group is 13 cases/100 000 women . The following risk factors are considered to increase the risk of developing thrombosis in subjects using oc: hypertension, diabetes, hyperlipidemia and smoking [2025]. Oc predispose more strongly to the development of venous, rather then arterial thrombosis, which results from the haemodynamic properties of blood flow in these two types of vessels . Other risk factors for venous thrombosis are slowed blood flow and thrombophilia, whereas vessel wall injury (endothelium), including the atherosclerotic plaque are characteristic risk factors for arterial thrombosis . Despite doubts concerning her taking oc, the patient s age (32 years old) and lack of other, above - mentioned risk factors and also atherosclerosis allow oc to be ruled out as a possible cause of ica and mca thrombosis . The above - mentioned exclusions and the circumstances preceding the disease established in the course of the investigation indicate the traumatic background of the ica thrombosis in both cases . The ct and ct angiography performed in the first patient revealed the presence of a foreign body adjacent to the left ica on the level of c1, whereas medial translocation and compression of carotid vessels caused by the foreign body were found during the surgical procedure . The histopathological examination revealed features of mechanical arterial injury, namely the rupture of the tunica media with focal haemorrhages into the intima and tunica media . The above - mentioned conditions indicate direct trauma as the cause of thrombosis . Apart from the arterial occlusion by the thrombus found in the histopathological sections obtained from the second patient, the mechanical injury to the arterial wall in the form of the intima and tunica media rupture were also noted . Such findings and the information obtained during investigation indicate indirect trauma as the cause of arterial thrombosis . Post - traumatic ica thrombosis may result from a penetrating (e.g. Knife, bullet or other foreign body splinter, as in case 1) or non - penetrating (blunt) trauma . There are two types of the latter, namely direct ones concerning the neck in the region of the carotid artery, and indirect concerning distant regions, e.g. Head . Penetrating neck trauma caused by the above - mentioned tools, leads to arterial wall injury in the form of contusion or vessel wall dissection with the formation of intramural haematoma, outer arterial layer damage (adventitia) and the formation of pseudoaneurysm or segmental vessel spasm . Suppurative inflammation may also develop in the periarterial space, should the patient survive long enough after the trauma . The above - mentioned primary vessel wall injuries, associated with an injury limited to at least endothelium and intima, predispose to the development of thrombosis with subsequent vessel occlusion and ischemic stroke . The ica segment localised a few centimetres over the cca bifurcation is the vessel segment most commonly injured in the course of non - penetrating (blunt) ica traumas, both direct and indirect . They result in the rupture of the intima and/or tunica media, with the possible formation of intramural haematoma, i.e. A condition called dissecting aneurysm . The thrombotic occlusion of the vessel lumen occurs a few hours or even days or weeks after the trauma [5, 27, 28]. Six to ten percent of patients manifest such symptoms within the first hour after trauma, another 50% after 10 h and in 5773% of cases the asymptomatic period lasts more than 24 h. only 1735% of such patients develop ischemic symptoms after such a period . The above - mentioned facts indicate that in some cases of traumatic ica thrombosis there is a variably long asymptomatic period between the trauma and the manifestation of neurological symptoms of ischemic brain damage . Some authors compare it to intervallum lucidum occurring in patients with epi- and/or subdural haematoma . It results from thrombus propagation within the damaged vessel and may hamper the process of establishing the causal connection between the trauma and the ica thrombosis, especially, as according to some authors, the process itself may last up to several years [8, 9, 27], which in our opinion is hardly probable . According to unterharnscheidt traumatic ica thrombosis may result from: (1) direct neck trauma (e.g. Boxers); (2) direct head trauma (including insignificant) with force transfer to the neck region; (3) oral cavity trauma; (4) fractures of the neuro- and splanchnocranium bones; (5) whiplash injuries; (6) strangling or other manual procedures in the carotid artery region (e.g. Massage) and (7) compression by seatbelt in the course of road traffic accidents . Non - penetrating ica injuries result from blunt head and/or neck trauma . A head trauma with a violent and powerful head rotation and hyperextension of the cervical spine results in some topographic alterations, including the ica course . It may lead to ica compression by the transverse processes of c3 or c1c2 vertebral bodies and predisposes to thrombosis due to the secondary rupture of intima and tunica media by an intact adventitia . Ica thrombosis may result from neck trauma, as well . By certain head positions, in which the artery is covered only with skin and fascia, it would be pressed against the c1 and c2 or transverse processes of c3c5 with secondary damage to intima, and even tunica media . In both of the discussed cases the thrombosis could have been caused by a segmental artery spasm on the injury site, which is impossible to establish during a postmortem examination . In 1974 crissey and bernstein identified four basic mechanisms of ica injuries, and thus four types of damage . Type i damage results from a direct blow to the neck and most commonly concerns older patients, frequently having advanced ica atherosclerosis . A similar mechanism occurs by a sudden powerful hyperflexion of the cervical spine with a compression of the ica between the mandible and spine . Type ii ica damage is caused by the hyperextension of the cervical spine with a head and neck rotation in the opposite direction . Such a mechanism results in injury to the ica segment that is overstretched over the lateral masses of the first two cervical vertebrae . The discussed mechanisms of ica injuries, apart from a direct blow to its region, are most commonly observed in motorcyclists participating in road traffic accidents . Type iii ica damage is most commonly observed in children and accompanies the intraoral trauma caused by a foreign body e.g. By falling on a hand - held or more frequently mouth - held object, e.g. Pencil . The establishment of the causal connection between neck and/or head trauma and ica thrombosis and its cerebral consequences requires the exclusion of non - traumatic factors in the first line disease - associated, being the most common cause of thrombosis . This is very important as such trauma is most frequently a result of a criminal offence and brings the perpetrator to criminal and civil liability . The establishment of a causal connection may be problematic or even impossible in victims who apart from traumatic injuries suffer from diseases or factors predisposing to thrombosis.
Erythromelalgia (em) is a rare disease characterized by painful swelling and erythema on the extremities [1, 2, 3]. The symptoms are often triggered by minor trauma, exercise, increased skin temperature, or heat exposure and often alleviated by cooling and elevation of the involved extremity . There are three distinct types: primary em, secondary em and em with thrombocythemia . Primary em is observed most commonly in patients aged less than 30 years without underlying disorders . Secondary em is associated with several autoimmune disorders [e.g. Systemic lupus erythematosus (sle), insulin - dependent diabetes mellitus]. In contrast, em with thrombocythemia is usually treated with aspirin, since the burning pain is relatively easy to control . In this report, we describe a case of adult - onset em successfully controlled with steroid pulse and pregabalin . A 68-year - old japanese woman presented at our outpatient clinic with a 10-year history of painful, recurrent erythema on her bilateral hands . There was no erythema on her feet . She had been diagnosed with idiopathic em and treated with oral intake of vitamin e 150 mg / day, transamin capsules 750 mg / day, prostaglandin e1 15 g / day and aspirin 100 mg / day, without any improvement . On her initial visit, physical examination revealed dark erythematous swelling on her bilateral hands (fig . The biochemical profile revealed normal levels of antinuclear antibodies (40) and a slightly decreased igg level (702 mg / dl). No specific autoantibodies (e.g. Dsdna, ssdna, ss - a, ss - b) were detected . Prothrombin time, activated partial thromboplastin time, serum fibrinogen, and platelet count were within normal ranges . The patient was found to be euthyroid by a measurement of the basal tsh and free t4 levels as well as by trh provocative test . Internal malignancy was excluded at the internal department . From the above findings, we diagnosed the patient as having adult - onset em of unknown origin . We administered methylprednisolone sodium succinate 1,000 mg / day intravenously for 3 days, and after that we treated her with oral prednisolone 60, 40 and 20 mg / day for 2 days each . Two days after the administration of methylprednisolone sodium succinate, eruption and pain had improved (fig . 1b). The visual analog scale (vas) score improved from 10 to 2 (fig . However, 6 days after therapy start, her pain gradually developed again (vas score 2 to 5). The vas score improved again, and the patient has been able to control her pain for half a year, although slight erythema could still be observed . Em is a rare condition characterized by episodic bouts of burning pain, erythema, and edema, most commonly involving the extremities . Symptoms are often triggered by minor trauma, exercise, or heat exposure and often alleviated by cooling and elevation of the involved extremity . Several reports have suggested successful treatments for em [2, 3, 4, 5], but the optimal therapy is still under discussion . In this report, we describe a case of adult - onset em successfully controlled with steroid pulse and pregabalin as evaluated by vas . Previous reports suggested an association between secondary forms of em and autoimmune disorders [3, 6, 7]. Indeed, there is evidence that secondary em might be associated with an autoimmune condition in which there are autoantibodies directed against the sodium channel encoded for by the scn9a gene . In addition, jackson and oates reported a case of autoimmune - related em; however, these autoantibodies were not suggested to be directly associated with em like sle . On the contrary, the primary form of em is associated with a mutation in the sodium channel nav1.7, which is selectively expressed within the dorsal root ganglion and sympathetic ganglia and encoded by the scn9a gene [3, 8]. Once diagnosis is established, potential secondary causes must be excluded [6, 9]. Other causes associated with em include sle, raynaud's disease, pernicious anemia, thrombotic thrombocytopenic purpura, infectious mononucleosis, metabolic, endocrine, and vascular origin and diabetic neuropathy [6, 7, 9]. Although there was no evidence for autoimmune - associated em in our present case, late onset of em might indicate the possible involvement of autoantibodies . In addition, suh et al . Reported that adult - onset idiopathic em could be successfully treated with corticosteroids and pentazocine . Furthermore, pfund et al . For the above reasons, we decided to administer steroid pulse and pregabalin, and monitored the patient's pain with vas . Vas is a simple assessment tool consisting of a 10-cm line with 0 on one end, representing no pain, and 10 on the other end, representing the worst pain ever experienced, which a patient marks to indicate the severity of his or her pain (fig ., the vas score and erythema on the hands immediately improved after administration of high - dose methylprednisolone sodium succinate and were maintained by oral pregabalin . Although we describe a single case and the observation is limited, our case might suggest a possible, optimal therapy for adult - onset em.
Discharging patient from intensive care unit (icu) is a difficult and complex process because icu nurses need to provide a lot of critical information to patients and delegate many heavy responsibilities to medical - surgical nurses . Moreover, more than one third of patients who are discharged form icu, develop serious complications and are readmitted to icu . Studies have shown that approximately 10% of patients who are discharged from icu are readmitted to this unit before discharging from the hospital . Moreover, despite great technological advances in healthcare provision, icu readmission rate has increased during the past two decades . The netherlands intensive care evaluation committee 2011 reported that a total of 75000 patients have been admitted to icus so far . Considering a mean hospital stay of patients in one day, about 1.6 million euros can be saved yearly by decreasing the icu readmission rate by only one percent . Moreover; icu readmissions are associated with increased length of hospital stay (3547 vs. 1621 days), elevated mortality rate, and increased risk for developing nosocomial infections . On the other hand, given the growing demand for advanced medical technologies, the increasing number of elderly people with complicated health problems, and the limited number of icu beds, prioritizing icu hospitalizations and using icu equipments in an optimal way are crucial . Accordingly, special attention has been paid in the last decade to developing strategies for improving patient outcomes once getting discharged from icu . An innovative strategy for these purposes was the introduction of a new nursing role entitled liaison nurse . Liaison nurse strategy was originally designed in 2001 in several hospitals located in australia . The primary goal of this strategy is the facilitating of post - icu care provision, minimizing post - icu complications, identifying severely - ill patients who need intensive care, and reducing icu readmission and hospital mortality rates . Liaison nurses are expected to manage post - icu care, provide scientific and educational support to other nurses, establish relationship between icu and ward nurses, and provide intensive nursing care to patients who are in medical - surgical wards . Accordingly, they can maintain the continuity and the quality of care which finally improve patient outcomes . Given the novelty of the nurse liaison strategy, few studies have investigated its effects on patient outcomes . Moreover, there are still controversies about the effectiveness of this strategy for improving patient outcomes . The aim of the study was to investigate the effect of liaison nurse on patient outcomes after icu discharge . This was a single blinded randomized controlled trial that the patients did nt know to selecting for which groups of control and intervention . The study population consisted of all patients who had been recently transferred from icus to medical - surgical wards of two teaching hospitals located in tehran, iran . Sample size was calculated using the altman s nomogram and the results of a study conducted by chaboyer et al . Accordingly, with considering of 0.05, of 0.1, and a power of 0.9, the sample size was determined to be 40 patients in each group . Participants were recruited by the convenience sampling and were randomly allocated to either the control or the experimental groups regardless of the hospitals (figure 1). Flow diagram of subject progress through the phases of randomized trial the inclusion criteria were having an age of 1885 years, having no cardiac dysrhythmia, and having no immune disorders, leucopenia, or cancer . If patients developed conditions that the liaison nurse could not or was not privileged to manage, they were excluded from the study . Accordingly, the exclusion criteria were experiencing cardiac arrest and need for resuscitation, developing hemodynamic instability, being transferred to other clinical settings, and discharging from hospital with personal consent . Patients in the experimental group received the study intervention by researcher for three consecutive days: when patient was transferred from icu to medical - surgical wards, the liaison nurse of the study introduced herself to patient and his or her family members . Then, she started collecting data about patients condition through reading their medical records . Moreover, the liaison nurse as researcher monitored patients baseline vital signs and informed them about the characteristics of medical - surgical wards and nurses, how to access nurses in these wards, differences between these wards and icus, and the reason for transferring patients from icu to these wards . In addition, the liaison nurse taught them about the dietary regimen, the importance of daily self - care activities, and how to cope with new conditions . The liaison nurse also answered patients questions and helped them to perform their self - care activities . Patients vital signs and clinical conditions were monitored and documented twice a day for three days by a checklist . Medical - surgical nurses were also informed about patients conditions, their care plan, and their educational needs . After the intervention, patients vital signs, level of consciousness, length of hospital stay, need for re - hospitalization in icu, and satisfaction with care were measured and documented by the checklist . The liaison nurse was collected study data by using three tools; a) a checklist, b) the early warning score, and c) the patient satisfaction instrument . The patient assessment tool consisted of items on the functions of: the cardiovascular system: heart rate, blood pressure, edema, and capillary filling time; the nervous system: the history of cerebrovascular accident and the level of consciousness was determined by glasgow coma scale; the respiratory system: percutaneous oxygen saturation, body temperature, cough, the color and the volume of sputum; the digestive system: route of nutrition, appetite, pattern of elimination, and weight; the urinary system: the color and the volume of urine and the serum levels of electrolytes, urea, creatinine, albumin, and also fasting and postprandial glucose; the musculoskeletal system: mobility, joint mobility and range of motion, independence in doing daily activities, and muscular strength ., for the early diagnosis of life - threatening conditions and significant alterations in patients state of health . Ews assesses patient s clinical condition based on items such as respiratory rate, heart rate, level of consciousness, body temperature, and systolic blood pressure . Each item is scored on a four - point scale from zero to three (figure 2). The total score of the instrument is interpreted as follows: scores 02: the nurse continues providing routine care and monitors vital signs every twelve hours; score 3: the nurse immediately modifies the vital sign monitoring schedule from every twelve hours to every two hours . If the problem persists after three rounds of vital signs monitoring, the nurse needs to monitor patient and provide intensive care; score 4: the nurse reports patient s condition to physician performs the continues monitoring of vital signs, and measures intake and output (i / o) every two hours; score 5: the nurse monitors patient s vital signs and blood oxygen saturation hourly and reports patient s condition to the resuscitation team . If the patient acquires a score of 5 at three subsequent rounds of monitoring, the nurse reports the condition to physician to decide on transferring patient to icu; score 6: the nurse reports patient s condition to both physician and resuscitation team when the patient is transferred to icu . This figure shows early warning score the researcher used the 25-item patient satisfaction instrument (psi) for measuring patient satisfaction with care ., this instrument consists of three domains including nurses professional practice (seven items), patients confidence in nurses (eleven items), and nurses patient education services (seven items). Items are scored on a five - point likert scale ranging from 1 (completely disagree) to 5 (completely agree). We invited ten icu nurses who had the work experience of more than fifteen years to evaluate the content validity of the checklist . The reliability of the ews had been previously determined using the guttman split - half method which yielded a correlation coefficient of 0.868 . Hajinezhad et al ., evaluated the reliability of the psi and reported a coronbach s alpha of 0.90 for the instrument . The normality of the variables were assessed by using the kolmogrov - smirnov test . The chi - square, the independent - samples t - test, and the repeated measures analysis of variance (anova) tests were used for comparing the study groups in terms of the demographic characteristics, the length of hospital stay, ews, and patient satisfaction . This study was approved by the ethics committee of baqiyatallah university of medical sciences, tehran, iran . The age of participants ranged from 22 to 82 years with a mean of 59.5 (14.24) years . The results of the chi - square test revealed that the intervention and control groups did not differ significantly in terms of demographic characteristics such as gender, education, employment, reason for hospitalization, and history of previous hospitalization in icu (p> 0.05) (table 1). The results of the independent - samples t - test showed that there were no significant differences between the two groups regarding heart rate, respiratory rate, systolic blood pressure, post - icu level of consciousness, satisfaction with care, and the length of hospitalization in medical - surgical wards (p>0.05). Results of variables associated with hospitalization of patients are shows in table2 . Moreover, the results of the independent - samples t and the repeated measures anova tests indicated that the study groups did not differ significantly regarding the post - icu ews scores (p>0.05)(table 3). However, the results of the independent - samples t - test showed that the difference between control and intervention groups in terms of body temperature was statistically significant (p<0.05). This study was conducted to investigate the effect of liaison nurse on post - icu patient outcomes . The findings revealed that liaison nurse had no significant effect on icu re - hospitalization rate and the length of post - icu hospital stay . In line with this study, doric et al ., reported that liaison nurse s services did not significantly affect the rate of icu re - hospitalization and the length of hospitalization stay mean (sd), f = repeated measures anova however, green and edmonds found that a five - year care plan provided by liaison nurses significantly reduced the rate of icu re - hospitalization from 2.3% to 0.5% ., also reported that liaison nurse strategy reduced the rate of pediatric icu re - hospitalization from 5.4% to 4.8% . According to chaboyer et al ., contradictions in terms of the effect of liaison nurse strategy on patient outcomes can be attributed to factors such as differences in patients clinical conditions, complexity and diversity of post - icu care, differences in the length and the types of liaison nurses interventions, and differences in the types, scale, and the management systems of the settings of the studies, noted that liaison nurses can produce more significant effects on patient outcomes in large - scale hospitals that have several icus and higher icu admission and discharge rates . The findings of our study revealed that liaison nurse strategy had no significant effect on patient satisfaction . Chaboyer et al ., also reported the similar findings . However, coffin et al ., found that 99% of their participants were satisfied with liaison nurses care services . This contradiction is probably related to the differences in liaison nurses clinical competence and communication skills . We also found that the care services provided by liaison nurse only decreased patients body temperature and had no significant effects on heart rate, respiratory rate, blood pressure, and level of consciousness . Doric et al ., noted that liaison nurses can positively affect patients survival and empowerment . To the best of our knowledge, none of the previous studies investigated the effects of liaison nurse strategy on patients vital signs and level of consciousness . This study had also limited budget and also was required to be completed in a short period of time . Accordingly, designing and conducting long - term and large - scale studies may produce different results and more persuasive evidence . Study findings suggest that care services provided by an icu liaison nurse has limited effects on patient outcomes . However, according the contradiction among the studies, further studies are needed for exploring factors that improve care quality and patient outcomes as well as for providing clear evidence about the effectiveness of liaison nurses.
By the turn of the century, it was clear that the vertical transmission of hiv to children could effectively be prevented with the appropriate use of short courses of antiretroviral therapy (art). In their landmark paper on the issue, de cock et al . Noted that few other aspects of hiv had, by that time, demonstrated results as dramatic as perinatal prevention . They argued that prevention of infection among children requires hiv and aids to be addressed as a disease of the family and the community and leads to consideration of other interventions, such as reproductive health care for women and support for children orphaned by the epidemic [1, p. 1181, the critical policy and programme issues needing to be addressed were highlighted as: increased hiv counselling and testing, expanded use of the most effective drug regimens and the prevention of transmission through breastfeeding . Since then, all three issues have been resolved to the point of creating conditions feasible for the virtual prevention of hiv transmission from parent to child through pregnancy, delivery and infant feeding . More effective drugs are available, there is more integration among services and the drug regimens recommended are more comprehensive and better targeted . Hiv counseling and testing (hct) no longer depends only on individuals stepping out of the line to be tested and risking gossip and stigmatization for doing so . In 2007, the world health organization (who) recommended provider - initiated testing and counselling (pitc) to streamline and normalize the process . Pitc also helps to increase the uptake of prevention of mother - to - child transmission services (pmtct), more appropriately called prevention of vertical transmission (pvt), in order not to place blame unintentionally on women . Home - based testing similarly expands services and provides for families to be tested together, as does couples testing, guidelines for which have recently been published by who . Up until recently, pmtct programmes predominantly focussed on the prevention of hiv transmission to infants . However, successfully enrolling eligible pregnant women into treatment and retaining them on treatment is proving to be the most effective approach to protecting mothers, their children as well as their partners . The 2012 who pmtct technical update recommends a single universal regimen both to treat pregnant women living with hiv and to prevent transmission to her baby (so - called option b). This approach simplifies service delivery, aligns and links with art programmes enabling women to more easily transition between services and specifically targets the prevention of maternal mortality and vertical transmission both of which are disproportionately attributable to the poor health of pregnant women in need of treatment . Extended prophylaxis given to infants or the continued treatment of their mothers also renders breastfeeding safer . Given the dramatically increased vulnerability of young children whose mothers die or who suffer serious ill - health, treatment for women not only protects women's wellbeing but also safeguards their children . Moreover, providing early treatment reduces hiv transmission between serodifferent couples . Scientific and technical knowledge and programme evaluations of pvt have increased dramatically, as indicated by an overview of published literature on the topic between 1990 and 2010 (figure 1). Average number of clinical, public health and programmatic papers on pvt published every five years from 1990 to 2009 . Despite pitc, some 10% to 20% of women refuse testing and another 20% or so either directly or indirectly avoid pvt prescriptions, procedures and follow - up . When women are not fully informed of the benefits, they may perceive pitc to be coercive . The need or perceived requirement to get their partners consent and the cost of transport and out - of - pocket expenses are some of the reasons women give for declining pvt prescriptions and procedures . A recent review highlights the loss of women between vertically provided pregnancy- and hiv - related services and stresses the need for both integration and family - focussed care . Together with health service characteristics such as the availability of test kits and drugs and the negative attitudes of some healthcare providers towards women living with hiv, progress to prevent hiv infections among young children and to ensure the wellbeing of their mothers is slower than was hoped . We believe that what is needed, in addition to developments already highlighted, is to implement recommendation by de cock et al . That hiv and aids be addressed as a disease of the family and the community and that hiv interventions be integrated across the lifecycle of women, families and children . Assessments of progress towards the millennium development goals show that the effects of hiv and aids are especially severe for the survival and wellbeing of mothers and young children . In addition, pvt is central to global hiv prevention efforts and remains the one area of prevention in which resounding success can be achieved . However, given current knowledge and technology to prevent almost all parent to child transmission of hiv, scale up of pvt and universal access to prevention and treatment has been slow, with especial concern for women and children's health in the worst affected countries . Support for a concerted global effort to prevent hiv transmission from parent to child has been growing [2023]. At the 2011 united nations general assembly high level meeting on aids, world leaders committed to work together to achieve this goal . The aims of countdown to zero: global plan towards the elimination of new hiv infections among children by 2015 and keeping their mothers alive are to achieve a 90% reduction in the number of new hiv infections among children and a 50% reduction in aids - related deaths among pregnant women . This is the boldest plan to date to protect children from hiv and to safeguard their families, and it offers unprecedented opportunities to change the way the health sector, donors, governments and others work with affected people and communities to change the course of the epidemic . However, a modelling exercise, published before the launch of the plan, laid out how high a mountain had to be climbed to reach the targets . Based on data from 25 countries with the highest numbers of pregnant women living with hiv, mahy et al . Estimated that even if: (1) more effective drug regimens were implemented, (2) the current unmet need for family planning among women living with hiv was wholly met and (3) breastfeeding was limited to 12 months to curb hiv transmission, the number of new child infections averted (reckoned to be 79%) would still fall short of the target . What is critical, they argued, was for high coverage to be reached on all aspects of the pvt programme (with far fewer women lost to follow - up at each stage of what is called the pmtct cascade), safer feeding practices adopted and implementation of a comprehensive approach . Such a comprehensive approach must include meeting the family planning needs of couples affected by hiv and reducing new hiv infections among women of reproductive age . That is, giving effect to all four prongs of pvt . These are (1) primary prevention of hiv among women of reproductive age; (2) reducing the unmet need for family planning among women living with hiv; (3) scaling up more efficacious arv regimens for women living with hiv and hiv - exposed infants and (4) expanding treatment and care for women, children and their families . The challenges to expanding comprehensive approaches, even in the highest burden regions, differ by country and by area within countries . Ninety - one percent of pregnant women living with hiv in 2009 are in 22 countries, all but one in africa . However, huge differences exist between these 22 countries, with some classified as middle - income (such as india and south africa) and others low - income (malawi and mozambique); some stable states (for example, cameroon and ethiopia) and others with fragile political regimes (democratic republic of congo and zimbabwe). There are also differences in health service access (at least one antenatal visit: 97% in botswana, 39% in chad), hiv incidence (1.68 in south africa, 0.02 in india), unmet need for family planning (41% in uganda, 7% in namibia), coverage with any arv regimen (95% in botswana, 6% in the democratic republic of congo) and median duration of breastfeeding in the general population (34 months in rwanda, 16 in south africa). Unicef has developed fact sheets on the status of national pvt responses in these 22 countries as at 2010 . From the assembled data, it is clear that some countries, such as angola, must increase pvt services in antenatal care, especially in rural areas . Others, such as nigeria, must expand the low reach of and access to antenatal services most of which are relatively well provisioned for pvt programmes especially amongst poor and rural women . South africa must bolster the prevention of new hiv infections among young women and improve the quality of pvt services, including the retention of women across the range of vertical prevention services . In all countries, big gaps, inefficiencies and poor quality services must be addressed . As has been recognized for some time, though, to reach the targets requires actions, not only within and by health services but also by affected women, their partners, within families and communities and in the wider society . In turn, this engagement is only possible under enabling political, legal, material and social conditions . The choices of women are affected, and their options limited, by their husbands and partners, their families and what they perceive other people think about them and how their neighbours and friends treat them . In turn, social norms are influenced by laws and policies, cultural beliefs, economic conditions and the range, quality and helpfulness of the services they have at their disposal . The same concentric circles of influence have been noted in other areas of health intervention, with the following quotation taken from cardiovascular disease: just as we have learned that it is difficult to change the behavior of individuals without changing the communities in which they live, we may be learning that it is difficult to change the behavior of whole communities without changing their broader social environment as well [27, p. 1391 scale - up emphasizes the importance of supporting community - based programmes and achieving integration with family planning, as well as other aspects of sexual and reproductive health and tuberculosis services, in order to create or enable facilitative conditions for individual and social actions (demand) to complement health service provision (supply). These programmes include the following: developing policy and legal frameworks, guidelines, tools and competencies to link services to community - based providers;defining standard packages of services to improve maternal, neonatal and child survival and health, at both health facility and at the community level;building capacity with technical and financial support to community - based organizations to deliver pvt and hiv services at facilities and in communities;promoting the active engagement of people living with hiv in advocacy and planning and delivering services;promoting male - friendly models of delivering hiv services and the participation of men in pvt and in hiv care for children; anddeveloping and implementing policies and programmes to reduce hiv - related violence, stigma and discrimination in the context of pvt and hiv care for children, including supporting women to disclose their hiv status to partners and family members [19, p. 2223]. Developing policy and legal frameworks, guidelines, tools and competencies to link services to community - based providers; defining standard packages of services to improve maternal, neonatal and child survival and health, at both health facility and at the community level; building capacity with technical and financial support to community - based organizations to deliver pvt and hiv services at facilities and in communities; promoting the active engagement of people living with hiv in advocacy and planning and delivering services; promoting male - friendly models of delivering hiv services and the participation of men in pvt and in hiv care for children; and developing and implementing policies and programmes to reduce hiv - related violence, stigma and discrimination in the context of pvt and hiv care for children, including supporting women to disclose their hiv status to partners and family members [19, p. 2223]. There has been no assessment of country responses to these guidance points or progress in achieving greater women, family and community involvement in pvt . It is troubling that recommendations for community action are considerably diluted in countdown to zero . They include less specific strategies, such as developing community charters, ensuring participation of all stakeholders, maximizing community assets and identifying solutions to stigma . There is an emerging consensus that many hiv prevention programmes do not succeed specifically because they do not engage communities . Instead, they are conceived by external experts and imposed on communities in top - down ways . As a result, they fail to resonate with the worldviews and perceived needs and interests of their target groupings, or to take adequate account of the complex social relations into which programmes are inserted [28, p. 1570 . Too often, suggest campbell and cornish, target communities are seen as passive recipients, as objects of intervention . But community engagement and participation is essential for several reasons: (1) because it is the most effective way to deliver acceptable messages and services to hard - to - reach groups; (2) because it is one of the main ways of engendering a sense of agency with which to build individual and collective health promotion; and (3) because the overall shortage of health workers means that community volunteers and workers are needed to help deliver hiv prevention, treatment and care to those who need it . The avahan experience in india, the largest prevention programme ever undertaken, demonstrates the value of involving communities, including the private sector, an oft - forgotten constituency in the public domain . At a broader societal level, laws and policies within which health services are funded and delivered emanate from social values and are subject to public opinion which, in turn influences and is influenced by all forms of media . Given the importance of engaging women, families and communities to achieve an end to hiv transmission from parent to child, this special issue takes stock of current knowledge and good practice in community action to create an enabling environment, expand access and improve care of women and children in pvt programmes, as well as to reach men . The papers review and organize what is known to date, document examples of community mobilization, and the reach and effectiveness of community workers linked to health facilities . They draw attention to gender inequalities, the ways in which affected groups and their networks can expand services and the importance of their experiences and voices to unsettle complacency and compel changes in attitudes and behaviour . Several things stand out from these papers: firstly, how determined community groups are to be part of the response to hiv and how energetic and innovative are their practices . Secondly, how large - scale some community activities are: for example, in uganda, 750 groups of people living with hiv, working in larger coalitions, assisted 1.3 million people to access hiv - related health services (gitau - mburu, this issue); mothers2mothers reports having more than 250,000 patient encounters per month, seeing nearly 24,000 new hiv - positive women per month in 714 sites . Thirdly, how comprehensive community - based services try to be as they integrate their activities to meet individual needs and family concerns (see kim et al . And patel et al . This issue), and fourth, the urgent need that community actors have for financial, policy, programme and personal support for their work (see dhlamini et al . However, what is also evident, especially from the review papers, is how little published research there is and, as a result, how limited our knowledge and use of community processes in increasing demand and supply of services and their role in the creation of an enabling environment . In addition to the papers, including the reviews and helpful conceptual frameworks offered by, amongst others, buzsa et al . Firstly, the joint initiators of the global plan, dr michel sidibe, executive director or unaids, and dr eric goosby, global aids coordinator responsible for the implementation of pepfar, have provided a foreword . By doing so, they emphasize the importance of community engagement and action, and their commitment, within the global plan, to achieve it . It is a massive expression of support for community action, and it manifests the seriousness of their determination . The second unique feature is that, in addition to academic peer - reviewers, nine women living with hiv, recommended for their professional expertise and personal experiences by the international community of women with hiv / aids (icw) and the global network of people living with aids (gnp+) were invited to review terminology . Their perspectives demonstrated the ways in which language can distort understanding, fuel discrimination and deeply hurt those who are directly affected by hiv . Although the comments of this group of reviewers were discretionary unless independently endorsed by the journal's standard editorial process, all authors responded seriously to the issues raised . This is the first time, of which we are aware, that a scientific journal has engaged the people at the receiving end of science, policy and service in a mutual effort to find common ground and move forward together . In this sense, the special issue embraces the commitment to include community even though the common ground between science and experience is uneven, a consequence of both low use and potential misunderstanding . The special issue closes with an account of the experiences of people living with hiv, male and female recipients of our services, and an annotation by women living with hiv and their networks on language, identity and hiv . Almost all the papers take as their starting point the role of community engagement in the following areas: expanded reach and supply of services, increased uptake, enhanced adherence to treatment and care regimes, improved retention in programmes and better psychosocial wellbeing of women, children and their families within an enabling environment . Reviews of published research and of best practice experience endorse the need for community action in pvt . Community action strategies can expand the reach of services to women and their families, increase access, boost adherence and retention, and support affected children and ensure they receive treatment . By and large, the mechanisms for community action involve the engagement, enrolment and collaboration of a diverse range of community - based volunteers, workers, counselors and social actors through independent and integrated community- and facility - based programmes . Stand - out examples from the papers themselves and the work they cite are couples and home - based testing and prevention programmes [3133], mentor and peer counselors; support groups and community forums and community - based financing mechanisms that address barriers due to transport and other costs . More and more effort is being made, with success, to involve men, a strategy strongly endorsed by affected women (anderson et al . Less apparent, although model studies and programmes can be found, are efforts to substantially change the social and policy environment through legal reform, mass media, community activism and demands for and implementation of mechanisms to increase accountability at the local and international levels . In a recent review of community accountability mechanisms, molyneux et al . Identify three basic approaches: committees and groups, report cards and patient charters . While some impressive findings are reported for committees and groups, patient charters are less promising, offering only guidelines rather than consequences for abuses of patient rights and poor quality of health services . One of the most impressive effects of the use of report cards to improve healthcare is given by bjrkman and svensson from a randomized field experiment in fifty communities in nine districts in uganda . Local organizations facilitated agreements between community members and private and government health providers on which submitted reports were based . A pre- and post - survey of 5000 households after one year suggested that the accountability mechanism was highly effective . Health workers were rated as making more effort, there were large increases in utilization and health outcomes, including in child growth and a reduction of under - five mortality by 33% . It is clear that research in this area needs to be done and project and programme evaluations must be improved to pass the scrutiny of peers and be published . While there are many promising practices of the effectiveness of community action, the evidence base is still very limited . In this special issue, several different conceptual frameworks are used to review and or describe community approaches . (this issue) employ a social ecological framework that links the individual with peers and family, community and the broader social, cultural and economic environment in overlapping concentric circles . As they indicate, such conceptual frameworks are useful for illustrating the relationships between determinants that are proximal (downstream) or distal (upstream) to the person as previously described by latkin and knowlton . Gulaid and kiragu (this issue) use the distinction made by rosato et al . Between participation, mobilization and empowerment in an analysis of their roles in maternal, newborn and child health . See community empowerment being built up through layers of personal and collective action, starting from the individual, to small mutual groups, community organizations, partnerships and coalitions and social and political action . However, they conclude with several fundamental questions, unanswered also with respect to pvt . Is community participation an essential prerequisite for better health outcomes or simply a useful but non - essential companion to the delivery of treatments and preventive health education? If essential, then is it only a transitional strategy for the poorest and most deprived populations but largely irrelevant once healthcare systems are established; or is it the critical missing component and the reason we are failing to achieve (in this case) the millennium development goals 4 and 5 regarding maternal and child mortality? Community means many different things and we speak simultaneously of the international or donor community and a particular local community; we refer to community - based, community - oriented and services delivered in, for and by community (as opposed to health facility). Refer to four categories of implicit constructions of community in health projects: community as setting (usually geographic), community as target (groups as compared to individuals), community as resource (frequently in terms of participation and support) and community as agent (meeting day - to - day needs). Writing in 1968 of his attempts to develop a unitary approach to community intervention, jack rothman notes it was as if i had packed a large and assorted pile of conceptual clothing into a cognitive suitcase and found there was a sock or the end of a tie sticking out after i had pressed it closed [45, p. 27]. Criticized for ignoring culture as a factor in determining the shape of community responses, rothman's conception remains a cornerstone for understanding community action . In short the first aims to improve service delivery through community development, bringing people together to solve local problems on a cooperative self - help basis . In this approach, participation, inclusion and consensus are critical . The second is a rationalistic approach used in policy and planning as evidenced, for example, in task shifting arguments for the role of community action . The third approach, social action, aims to aid the oppressed, promote social justice, and change society adopted, for instance, as the foundation of many aids activist groups [45, p. 27]. In practice, the three approaches may be interwoven and differentially phased, with one approach giving way to another . The treatment action campaign, gnp+ and physicians for social justice, as examples, combine assumptions, goals and processes of all three approaches, in different ways and at different times . These approaches, argues rothman, can all be applied in a way to pursue social change and human betterment in fact, they have to draw from one another because each has inherent limitations for which the others can compensate . Campbell and cornish also argue for alignment of different approaches to community action but draw attention to the contexts in which such action can flourish . Funding, though needed, may impose expectations and constraints that undermine the participatory ethos that is necessary for community action . Similarly, mass media approaches frequently represent the views of western agencies, for example, of gender or sex work, and may miss opportunities for affected groups to challenge stigma and establish their symbolic legitimacy . Lastly, community action depends also on a relational context, in which marginalized groups must have opportunities to interact with powerful local actors in their efforts to protect their health and receive services . Campbell and cornish advocate what they call fourth generation social mobilization, mobilization for supportive conditions for community action at local, national and international levels . Here there is a role for donors, development agencies and governments to consider how their policies and actions support or sabotage community action . In addition, they suggest, this will require that researchers also shift their attention upwards to examine, explicate and hold accountable the international community, as well as focussing downwards on the successes and failures of marginalized local communities [28, p. 1578 what is clear is that community engagement and action is necessary for the global plan to succeed . Communities, holding hands with health services, are needed to contribute to creating demand for services, to help supply services and to assist in establishing an enabling environment for both to occur with maximal effectiveness.
The regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli . Social insects such as honey bees represent good models to study the relationship between brain gene expression (i.e. Neurogenomics) and behavioral modulations,, . Insect societies are composed of reproductive females (queens), males and non - reproductive workers that each display a remarkably distinct behavioral repertoire . Workers in particular exhibit striking patterns of division of labor and behavioral maturation that are crucial for colony survival and growth, which generally consist of a sequence of behaviors known as temporal polyethism, from nursing and nest construction to nest guarding and food foraging . Several external factors may modify this behavioral sequence, such as food availability and colony demography . Pathogen infections also accelerate maturation towards early foraging, a change in behavior that is considered to function as a form of social immunity in insect societies . Pathogens such as microsporidian and viruses have been shown to accelerate temporal polyethism in honey bee colonies,, as well as dramatically altering brain gene expression, including genes involved in neural function and foraging behavior . Among the multiple pathogens infecting honey bees, the gut parasite nosema ceranae, a microsporidia which recently switched from its original host, the eastern honey bee apis cerana, to the western honey bee a. mellifera, is one of the most prevalent parasite of honey bees in europe . Honey bees are also infected by several rna viruses, and one of the most prevalent is the positive single strand rna virus, black queen cell virus (bqcv). In a previous study, we showed that bqcv and n. ceranae interact synergistically to increase worker bee mortality . Using samples from the same experiment, we sequenced the brain transcriptome of worker bees infected by the two pathogens, alone or in combination, and compared it to control bees . Here, we explore the genome - wide response of worker bee brains to experimental infection . Workers honey bees apis mellifera carnica originated from colonies located in halle (saale), germany . Colonies had been treated to control varroa mites with varidol (amitraz; tolnagro, hungary) the previous fall, six months before the experiment . Two day - old worker honey bees were experimentally infected individually with 10 n. ceranae spores and 1.4 10 genome equivalents of bqcv per os, alone or in combination (see details in). Bees were kept 13 days post - infection in metal cages (10 10 6 cm) comprising 30 individuals from the same colonies and treatment, with an 8 cm piece of organic beeswax . Cages were held in incubators at 30 c 1 and 50% rh and bees were fed 50% sucrose solution ad libitum following standardized guidelines . Three replicates using three different honey bee colonies were used within a treatment, and the same colonies were used across treatments . At the end of the experiment, rna was extracted from a pool of four brains (from all four treatments and three replicates except co - infection, for which only two replicates could be analyzed) using trizol and the rneasy mini kit (qiagen). Sample preparation was performed using the dge dpnii sample preparation kit (illumina, inc ., san diego, ca, usa) with 2 g rna . Library preparation of mrna was perform following the truseq stranded mrna sample preparation kit from illumina . Image analysis and base calling were performed using the hiseq control software and real - time analysis component . The quality of the data was assessed using fastqc from the babraham institute and the illumina software sav (sequence analysis viewer). Reads were mapped to the apis mellifera genome (amel_4.5) using the eland_rna module of casava 1.8.2 . Ncbi annotation file (seq_gene.md.gz; 2012 - 12 - 17) was used to generate splice junctions automatically . Reads were also aligned to a set of contaminants, including the ribosomal rnas, the phix genome (illumina control) and the illumina adapters . Gene counting was performed with htseq count (union mode). As the sequencing was strand - specific, the reads were mapped to the opposite strand of the gene . Before any statistical analysis, genes with <15 reads summed across all the analyzed samples were filtered out . Differentially expressed genes were identified using the bioconductor r package edger 2.6.2 and the upper quartile normalization method . Genes with adjusted p - value <5% (according to the benjamini - hochberg fdr method) were declared differentially expressed . Functional analysis based on overlap tests with previously published brain transcriptomes upon parasitism with varroa mites and n. ceranae were performed using a hypergeometric test . Workers honey bees apis mellifera carnica originated from colonies located in halle (saale), germany . Colonies had been treated to control varroa mites with varidol (amitraz; tolnagro, hungary) the previous fall, six months before the experiment . Two day - old worker honey bees were experimentally infected individually with 10 n. ceranae spores and 1.4 10 genome equivalents of bqcv per os, alone or in combination (see details in). Bees were kept 13 days post - infection in metal cages (10 10 6 cm) comprising 30 individuals from the same colonies and treatment, with an 8 cm piece of organic beeswax . Cages were held in incubators at 30 c 1 and 50% rh and bees were fed 50% sucrose solution ad libitum following standardized guidelines . Three replicates using three different honey bee colonies were used within a treatment, and the same colonies were used across treatments . At the end of the experiment, bees were flash frozen in liquid nitrogen and brains dissected on dry ice . Rna was extracted from a pool of four brains (from all four treatments and three replicates except co - infection, for which only two replicates could be analyzed) using trizol and the rneasy mini kit (qiagen). Sample preparation was performed using the dge dpnii sample preparation kit (illumina, inc ., san diego, ca, usa) with 2 g rna . Library preparation of mrna was perform following the truseq stranded mrna sample preparation kit from illumina . Image analysis and base calling were performed using the hiseq control software and real - time analysis component . The quality of the data was assessed using fastqc from the babraham institute and the illumina software sav (sequence analysis viewer). Reads were mapped to the apis mellifera genome (amel_4.5) using the eland_rna module of casava 1.8.2 . Ncbi annotation file (seq_gene.md.gz; 2012 - 12 - 17) was used to generate splice junctions automatically . Reads were also aligned to a set of contaminants, including the ribosomal rnas, the phix genome (illumina control) and the illumina adapters . Gene counting was performed with htseq count (union mode). As the sequencing was strand - specific, the reads were mapped to the opposite strand of the gene . Before any statistical analysis, genes with <15 reads summed across all the analyzed samples were filtered out . Differentially expressed genes were identified using the bioconductor r package edger 2.6.2 and the upper quartile normalization method . Genes with adjusted p - value <5% (according to the benjamini - hochberg fdr method) were declared differentially expressed . Functional analysis based on overlap tests with previously published brain transcriptomes upon parasitism with varroa mites and n. ceranae were performed using a hypergeometric test . A total of 875,319,378 reads were generated, with an average of 79,574,489 per replicate (5,023,017 sem). After quality control and alignment to the a. mellifera genome, 397,450,508 reads (average per replicate: 36,131,864 3,629,065 reads) were uniquely assigned to exons and used for statistical analysis of the host response to the experimental inoculation treatments (details in supplementary table 1). The number of genes showing significant changes in expression level upon infection was markedly different between treatments . While 144 genes where differentially expressed in brains of workers infected by bqcv, only 13 genes had a different level of expression in brains of bees infected by n. ceranae (fig . Co - infection with the two pathogens induced the differential expression of 67 genes, including 29 genes that were also differentially expressed in brain of worker bees infected by bqcv, and 6 genes also differentially expressed in brain of bees infected by n. ceranae; 31 genes were differentially expressed in co - infected bees only . Among the latter, three cytochrome oxidase p450 genes (loc408453, cyp4g11 and loc412209) and two genes coding for odorant binding proteins (obp4 and obp18) conversely, the gene coding for the protein yellow - x1 (loc724293) was significantly up - regulated in co - infected bees . Finally, one gene coding for a heat shock protein (loc724488) was consistently down - regulated after all pathogen treatments, including co - infection . The functional analysis of genes differentially regulated showed no significantly overrepresented go terms in workers bees infected with n. ceranae or co - infected with both pathogens . However, we found a significant overrepresentation of genes involved in immune functions that were differentially expressed in brains of bees infected with bqcv (benjamini - hochberg corrected p = 0.039). Several genes from the toll and imd pathways were up - regulated, such as the antimicrobial peptides abaecin (loc406144), apidaecin (apid1 and apid73) and hymenoptaecin (loc406142), but also rel, lys-2, the drosophila homolog of pirk (loc100578156), and the gene coding for the pathogen recognition protein pgrp - s2 . More importantly, two genes from the rnai antiviral pathway, ago2 and dicer (loc726766), were found up - regulated in both treatments including bqcv . Although no functional group associated to brain and neuronal activities were overrepresented in the list of differentially expressed genes, we found the chemosensory protein csp6, a light sensitive protein (lop2), the heat shock cognate protein hsc70 - 4 and a neuropeptide cchamide-1 receptor - like (loc411632) to decrease in expression upon infection by bqcv . Infection by n. ceranae induced lower expression of the chemosensory protein csp1 but increased expression of the neurotransmitter nt-4 . A complete list of genes exhibiting significant differential expression between treatments and control is available in supplementary table 2 . Comparison with a previous study investigating effect of the varroa mite and n. ceranae on honey bee worker brain gene expression revealed significant overlaps, with 27 and 2 genes found in response to varroa / bqcv and both n. ceranae studies, respectively, in independent experiments (supplementary table 3). This study reports the transcriptome responses of the honey bee brain to two different pathogens, an rna virus and a gut microsporidia . We found that bqcv induces a more dramatic change in gene expression than the microsporidia n. ceranae in brains . The main reason is likely the capacity of the virus to reach and infect the central nervous system of its host, while n. ceranae is strictly restricted to the gut of honey bees . Such a difference of impact was also observed in a previous study comparing the effect of the varroa mite when transmitting another rna virus, deformed wing virus (dwv), and the same microsporidia n. ceranae . Interestingly, we found that genes from the antibacterial / antifungal pathways toll and imd, including several amps, where not triggered upon infection with n. ceranae, but rather involved in the response to bqcv . Although observed in other model insect species, the involvement of these pathways in the antiviral response remains to be elucidated . More importantly, we confirmed experimentally the role of the rnai genes dicer and ago2 in the antiviral response of honey bees, as previously observed in response to another virus . An important aspect of our transcriptome study is that the response of the host to co - infection with two pathogens was also analyzed . Bqcv and n. ceranae have been shown to interact synergistically in honey bee workers, with co - infection significantly decreasing host survival . With these transcriptome sequences we identify candidate genes involved in pathogen interactions . For instance, genes involved in the behavior and responses to external stimuli such as yellow - x1 and odorant binding proteins were found significantly differentially expressed in co - infected bees only . We believe that such data will provide important resource for research on honey bee diseases, and more generally on insect host - pathogen and pathogen - pathogen interactions . The following are the supplementary data related to this article.supplementary table 1summary of our illumina sequencing results of brain transcripts of honey bees experimentally inoculated with bqcv, nosema ceranae, both or neither.supplementary table 1supplementary table 2list of genes differentially expressed in worker honey bee brains upon experimental infection by bqcv, n. ceranae or both in comparison to controls . Fdr indicate the corrected p - value associated with the differential expression level in each pathogen treatment against controls . Bold values show significant differential expression (fdr <0.05).supplementary table 2supplementary table 3overlap of differentially regulated genes with a similar study . Our list of genes differentially expressed in brains after bqcv infection was compared with the list of genes differentially expressed in brains after varroa mite parasitism in mcdonnell et al ., while our list of genes differentially expressed in brains after n. ceranae infection was compared with the list of genes differentially expressed in brains also after n. ceranae infection in mcdonnell et al . . * indicate significantly more overlap than expected by chance (hypergeometric test; p <0.002 at most). Reference of the study: mcdonnell cm, alaux c, parrinello h, desvignes j - p, crauser d, durbesson e, beslay d and le conte y ecto- and endoparasite induce similar chemical and brain neurogenomic responses in the honey bee (apis mellifera). Bmc ecology, 13: 25 . Doi: 10.1186/1472 - 6785 - 13 - 25.supplementary table 3 summary of our illumina sequencing results of brain transcripts of honey bees experimentally inoculated with bqcv, nosema ceranae, both or neither . List of genes differentially expressed in worker honey bee brains upon experimental infection by bqcv, n. ceranae or both in comparison to controls . Fdr indicate the corrected p - value associated with the differential expression level in each pathogen treatment against controls . Our list of genes differentially expressed in brains after bqcv infection was compared with the list of genes differentially expressed in brains after varroa mite parasitism in mcdonnell et al ., while our list of genes differentially expressed in brains after n. ceranae infection was compared with the list of genes differentially expressed in brains also after n. ceranae infection in mcdonnell et al . . * indicate significantly more overlap than expected by chance (hypergeometric test; p <0.002 at most). Reference of the study: mcdonnell cm, alaux c, parrinello h, desvignes j - p, crauser d, durbesson e, beslay d and le conte y ecto- and endoparasite induce similar chemical and brain neurogenomic responses in the honey bee (apis mellifera). Bmc ecology, 13: 25.
It is well known that genes can be silenced by antisense rna oligonucleotides called small interfering rna (sirna) (1,2). In order to design an efficient sirna sequence, empirical rules based on the features of the sirna sequence have been discovered, including, for example, low g / c content, lack of self - structure, preference of a at position 3, absence of g or c at position 19 and asymmetry in the stability of the terminal base pairs (310). The self - structure of the target and oligonucleotide is also an important consideration for the effective binding (1115). It is desirable to select an oligonucleotide having high accessibility to the target - binding site and low duplex stability . Here, the oligowalk server, which predicts efficient sirna sequences using an accessibility calculation with a convenient web interface, is described . Overall, the positive predictive value of the server is 0.786, meaning that 78.6% of the sirnas selected by the server will be efficient at silencing (16). The positive predictive value was determined by testing against a database of sirna experiments conducted under diverse experimental conditions (17). In the calculation of the oligowalk server, unimolecular and bimolecular self - structures for the sirna are considered along with unimolecular self - structure in the target at the oligonucleotide binding region (16). Oligowalk predicts the free energy changes (g) involved in these equilibrium states (18). The predicted thermodynamics (g), plus the oligonucleotide sequence features (19), are then utilized to predict sirna efficacy for candidate sirna sequences (16), which are generally 19 nucleotide duplexes with 3 dinucleotide dangling ends (7). A support vector machine (svm) program (20) is embedded in the server to take the thermodynamic and sequence features as input . The svm classification model used in the server has been proven to be able to predict efficient sirna (greater than 70% inhibition of the target mrna expression) with high accuracy (16). The svm was trained on a sirna database that contains 2431 experimental results conducted in human cells at 37c (10). The output of the oligowalk server is a table of sirna candidates, showing the sirna sequences and the probabilities of being efficient (having silencing efficacy larger than 70%). Each of the free energy change terms for each candidate is also listed in a separate table . The oligowalk server uses the cgi (common gateway interface) module of perl for taking user input and submitting calculations from the homepage . The input of oligowalk server is the rna sequence of the target gene . Only a, u, t, g and c are the acceptable types of nucleotides in the sequence (the server will replace the nucleotide t with u for calculations), and the maximum sequence length is 10 000 nucleotides . An email address is required because the server sends an email to the user when the calculation is completed . Submit query, the server generates a list of efficient sirna candidates for the target gene . Jobs are submitted by the server to a cluster of seven nodes with 3.2 or 3.4 ghz pentium 4 processors running fedora linux (http://fedoraproject.org/), managed by sun grid engine (http://gridengine.sunsource.net/). When the calculation is complete, an html (hypertext markup language) page is generated with links to tables containing predicted sirna efficacy data and thermodynamic binding data . In the sirna efficacy table (figure 1), the sequences of sirna candidates are ranked in the output list by their probabilities of being efficient sirna . The probabilities are predicted by a svm embedded in the web server for selecting efficient sirna . The classification model (16) used in the svm was trained with a publically available database (10), using thermodynamic and sequence features of sirna candidates . The position number of each sirna candidate is also listed in the table as the index of the 5 most base in the target - binding region . The sequences of sirna are ranked from top to end by their probabilities of being efficient (antisense efficacy larger than 70%). A table of sirna candidates generated by oligowalk server . The sequences of sirna are ranked from top to end by their probabilities of being efficient (antisense efficacy larger than 70%). In addition, the predicted equilibrium thermodynamics table is generated as a reference for advanced users . In the table overall (in kcal / mol) is the overall free energy change of oligonucleotide - target binding, when all contributions are considered, including breaking target and oligonucleotide self - structures (18). Duplex (in kcal / mol) is the free energy change of hybridized duplex between oligonucleotide and target (antisense sense duplex), . The value is independent of oligonucleotide concentration because it is a standard free energy change . Tm - dup (in c) is the melting temperature in degrees for the duplex formation of oligonucleotide and target . Break - targ. (in kcal / mol) is the free energy cost to open the intramolecular target base pairs for oligonucleotide binding, . A more negative number indicates higher free energy cost, which is unfavorable for oligonucleotide - target binding . Intraoligo (in kcal / mol) is the free energy change of intramolecular oligonucleotide structure, . It usually has a negative value or, if there is no favor - able intramolecular structure, it is zero . Interoligo (in kcal / mol) is the free energy change of intermolecular oligonucleotide structure, . Antisense bimolecular structure, which decreases the oligonucleotide - target (antisense sense) binding affinity . End_diff. (in kcal / mol) is the free energy difference between the 5 and 3 end of the antisense strand of sirna, with windows of two base pairs . Functional sirna prefer to have an unstable 5 end (3), which means a positive end_diff . Prefilter_score is the score calculated with a method based on the empirical rules by reynolds et al . (7). (7), except for the melting temperature of intramolecular oligonucleotide self - structure because the free energy (21) and enthalpy parameters (22) used by oligowalk are more recent . When calculating the prefilter score, 57c is used as the cutoff of the intramolecular oligonucleotide melting temperature, as suggested in another study (23). As an example, the prediction of the webserver is compared with experimental results in figure 2 . In the experiment (3), sirna were tested for efficacy against the target mrna, human cyclophilin (genbank i d: m60857), at 37c . The inhibition efficacy of each sirna is defined as 100% minus the percentage of mrna level after sirna application as compared to matched control . The prediction result is the probability of being efficient (having inhibition efficacy larger than 70%), which is calculated with the server . In figure 2, most of the sirna with high inhibition efficacy are predicted to have high probability of being efficient . Figure 2.a comparison between the prediction and experimental result . In blue is the experimental result (inhibition efficacy) for an mrna target, human cyclophilin (genbank i d: m60857), at 37c (3). The inhibition efficacy is defined as 100% minus the percent level of mrna expression after sirna application as compared to a control . In red is the probability (ranging from 01) of being efficient (having inhibition efficacy larger than 70%), as predicted by oligowalk . A comparison between the prediction and experimental result . In blue is the experimental result (inhibition efficacy) for an mrna target, human cyclophilin (genbank i d: m60857), at 37c (3). The inhibition efficacy is defined as 100% minus the percent level of mrna expression after sirna application as compared to a control . In red is the probability (ranging from 01) of being efficient (having inhibition efficacy larger than 70%), as predicted by oligowalk . Advanced options (figure 3) are available for users who understand the underlying calculations and would like to test novel hypotheses . The option form is written in html, embedded with javascript controlling the options so that they are context - aware . The oligonucleotide concentration does not affect the result of sirna sequence design, because the inputs to the svm are standard free energy changes, g . Concentration changes do, however, alter the overall free energy change (), which is provided to the user with the thermodynamic details table . The sense antisense duplex free energy changes are calculated without considering the self - structures of the target . This mode is not recommended for an accurate sirna prediction . It is more rigorous to consider the accessibility of the target and oligonucleotide self - structures because binding affinity is lost to open existing base pairs in the target and oligonucleotide . The second mode is to break local structure . In this case, the structure of target is fixed and only the base pairs on the binding site will be broken without refolding the global structure of target . The final and most rigorous mode is to refold the target rna . In this mode, the rna target is folded before oligonucleotide binding and refolded afterwards for each possible oligonucleotide to consider complete equilibration . The default setting of sirna design is shown in the figure . If the target rna secondary structure is considered, three different prediction methods are available to calculate the free energy change of target self - structure . The first method is optimal structure prediction, where only the optimal structure (lowest free energy structure) of the target is considered to calculate the free energy cost of opening the base pairs of binding region . The second method considers a set of suboptimal structures to determine the free energy cost . Each structure's free energy cost is weighted according to the free energy change of the structure to arrive at the ensemble cost . For this option, at most 1000 suboptimal structures (within 10% free energy difference from the optimal structure) are generated with a heuristic method (24). The number of suboptimal structures will be listed in the output table if the target is folded with suboptimal structure prediction method . Constrained target structure is the refolded structure where the binding region is forced to be single - stranded, so that the oligonucleotide can bind to it . This is the most rigorous method because it considers every possible secondary structure in the folding ensemble, with boltzmann weight . The structure prediction only folds a certain total number (folding size) of nucleotides centered at the binding region . The user can define this number, but the largest folding size is 1000 nucleotides for the webserver in order to save compute time . Users can define longer folding sizes by downloading and installing the oligowalk program to a local machine . (7) can be used to rule out nonefficient sirna candidates before folding the target sequence, i.e. The sirna sequences having score less than six points will not be considered for the folding step . It is suggested to turn on the prefilter option to save considerable computation time (table 1). Furthermore, the scan region can be redefined if the user is interested only in a specific region of the target . Table 1.calculation size and time of oligowalk server for different target sequencestarget mrna (genbank id)sequence length (nucleotide)time (h: min: sec)memory (mb)nm_0205487300:57:1793m608578513:55:53110nm_00287012116:09:25112nm_00246721896:36:42113aj27221234606:53:05117the benchmarks were performed with the default options: the oligonucleotide was a 19 base rna; the folding size of the target was 800 nucleotides centering on the binding site (full length if the whole target has less than 800 nt); the partition function calculation was conducted; the entire mrna was scanned; and the prefilter was on . The time cost changes little for long sequence because the prefilter (7) is on and number of candidates being folded is limited to about the same number for each sequence.the calculations were submitted and benchmarked on the oligowalk web server (http://rna.urmc.rochester.edu/servers/oligowalk). Each node has a 3.2 or 3.4 ghz pentium 4 processor running fedora linux.the calculation for sequences less than 800 nucleotides is relatively fast because the dynamic programming arrays are reused for calculations of short sequences (16). Calculation size and time of oligowalk server for different target sequences the benchmarks were performed with the default options: the oligonucleotide was a 19 base rna; the folding size of the target was 800 nucleotides centering on the binding site (full length if the whole target has less than 800 nt); the partition function calculation was conducted; the entire mrna was scanned; and the prefilter was on . The time cost changes little for long sequence because the prefilter (7) is on and number of candidates being folded is limited to about the same number for each sequence . The calculation for sequences less than 800 nucleotides is relatively fast because the dynamic programming arrays are reused for calculations of short sequences (16). The oligowalk web server predicts the hybridization thermodynamics of an oligonucleotide binding to a complementary target rna using the most recent rna folding parameters (21, 22). It predicts efficient sirna with high accuracy using a transparent implementation of an svm (16), which considers both sequence and thermodynamic features . The calculation time and memory size of oligowalk are shown in table 1 for a sample of mrna sequences . The prefilter (7) that uses local sequence information to narrow down the list of sirna candidates before calculating the equilibrium affinity is used by default . For example, the server takes 3 h and 43 min for a complete scan of all possible sirnas on an mrna having 730 nucleotides using the partition function calculation . For the same sequence, the algorithm time scales o(mn) and the memory use scales o(n) (table 1), m is the number of candidates and n is the value of folding size . The time and memory costs change little with sequence because the same folding size (e.g. 800 nucleotides) is used and the prefilter (7) is turned on, which limits the number of candidates to be folded in a way that is apparently independent of target length . There is currently significant interest in using sirna for both basic science and medical research . The fact that not all sirna duplexes will function in silencing means that there is a significant cost in trial and error for sirna design.
Stroke is a disease that causes sudden local neurological deficit symptoms due to a cerebrovascular accident1 . Stroke may decrease postural control and balance ability due to sensory disability, motor disturbance, muscular weakness, and asymmetric postures resulting from central nervous system damage2 . Reduced postural control and balance ability decreases overall physical function, making independent activities of daily living difficult for stroke patients, and increases the risk of falls . Therefore, improving stroke patients balance ability is an important therapeutic objective3 . With regard to this issue, a recent cross - sectional study revealed that stroke patients trunk control ability was correlated with balance, gait, and functional abilities4 . Exercises intended to improve stroke patients trunk control have been extensively studied in recent years . Verheyden et al.2 reported that a group of stroke patients that performed trunk exercises on plinths showed better improvement in trunk control than a group that received only conventional physical therapy . Pereira et al.5 conducted trunk flexion and extension, and compared trunk muscle activities measured by semg on the affected and unaffected sides of stroke patients . Karthikbabu et al.6 studied the effect of exercise using swiss balls on the improvement of trunk muscles . Although many exercise programs for trunk control have been implemented, there are few programs that can improve subjects balance while maintaining their interest . After the first horse riding studies were performed with patients with neurological damage, hippotherapy was used only to treat children with neurological disorders, mainly cerebral palsy, to improve their postural control and promote their normal development and functional recovery7, 8 . The horse s gait is repetitive and rhythmic, and causes the center of gravity to move in anterior - posterior, lateral, and upward - downward directions . Since the patterns of these movements are similar to those of the movements of the trunk and pelvis during human gait, such exercise is expected to make the subjects feel as if they were walking9 . Hippotherapy is effective in terms of psychological motivation because it arouses subjects interest in participating in the therapy9, 10, and helps in the recovery of many physical functions . Hippotherapy increases the range of joint motion, strengthens muscles, and improves muscle tone, postural control, and balance and equilibrium ability . Improvements in postural control and balance ability are achieved through stimulation of the upper motor neurons through proprioceptive sensory stimulation inputs11, 12 . Despite these therapeutic effects, no studies have been conducted on the changes in muscles related to stroke patients stability and balance after hippotherapy . In this study, the improvement in stroke patients trunk control and changes in abdominal muscle thicknesses after horse riding simulation training were examined . The purpose of this study was explained to patients diagnosed with stroke at d general hospital in busan, south korea . Patients willing to participate in the study were recruited, and those who satisfied the selection criteria were randomly assigned to a control or experimental group (15 patients per group). Subject selection criteria were as follows: patients with hemiplegia and no previous experience with hippotherapy who could follow verbal instructions, sit and walk independently (regardless of the use of walking aids), and had no restriction in the range of joint motion . Then, the experimental group performed horse riding simulation training, while the control group performed trunk exercises using swiss balls . Training was performed for 30 min per session, three sessions per week for a total of eight weeks10 . Subjects general characteristic (n = 30)groupcontrol group(n = 15)experimental group(n = 15)age (years)56.57.555.16.1height (cm)163.38.2165.18.5weight (kg)63.58.565.49.8sex (male / female)8 / 77 / 8cause of brain damage(cerebral hemorrhage /cerebral infarction)8 / 76 / 9affected side (right / left)9 / 610 / 5data are mean sd . All subjects agreed in writing to participate in this study after receiving a detailed explanation of the experimental procedure, and possible side effects of the intervention . The experiment was conducted after receiving approval from the human subjects research ethics committee of dong - eui medical center (demcirb-2013 - 1001). The horse riding simulator (eu6441 core muscle trainer; panasonic, japan) used is designed to simulate the effects of horse riding exercises in an indoor environment using three - directional movements (anterior - posterior, lateral, upward - downward), and has three different programs and nine levels of exercise intensity . A therapist and an assistant monitored each subject during horse riding training . A balance ability measuring and training system (an analysis system with biofeedback, ap1153; biorescue, france) was used to evaluate subjects balance ability . Static balance ability (center of pressure [cop] path length and cop travel speed) was measured while subjects stood for 60 s with their eyes open . The subjects were prevented from seeing the monitor to avoid visual feedback, and the position of the feet was maintained during repeated measurements to eliminate errors resulting from changes in foot positions . All tests were performed three times, and average values were calculated . Ultrasonic imaging equipment (sonoace x4; medison, korea) subjects were instructed to bend their knees to 90 and to maintain a comfortable posture in a supine position . Linear probes were positioned on both sides, midway between the bottom of the rib cage and the top of the iliac crest . The thicknesses of the external oblique, internal oblique, and transversus abdominis muscles were measured three times and their average values were calculated . The paired t - test was conducted to compare the results before and after the intervention within each group and the independent t - test was used to compare the exercise and control groups before and after the experiment . The experimental but not the control group showed statistically significant differences (p<0.01) between the cop path lengths of before and after the intervention . The differences between the two groups were not significant before the experiment, but were statistically significant (p<0.05) after the intervention (table 2table 2 . Changes in static balance following horse riding simulation traininggrouppre - testpost- testcenter of pressure path length (cm)control14.55.914.45.8experimental15.95.112.24.3 center of pressure travel speed (mm / s)control0.70.30.70.2experimental0.70.30.60.2 different superscripts within the same columns indicate significant differences (p<0.05)). Different superscripts within the same columns indicate significant differences (p<0.05) the experimental, but not the control group, showed statistically significant differences (p<0.05) between the speeds of the cop travel of before and after the intervention . There was no significant difference between the control and the experimental group before the experiment, but the speed of cop travel decreased more in the experimental group than in the control group after the experiment, and this difference was statistically significant (p<0.05; table 2). Changes in abdominal muscle thicknesses after training were observed in the experimental group . Before training, tra and io did not show any significant differences between the affected and unaffected sides . In contrast, eo showed significant differences: 5.71.6 mm on the unaffected side and 4.71.4 mm on the affected side (p<0.05). After eight weeks of training, tra, io, and eo on the unaffected side did not show any changes compared to before the training . Tra and io on the affected side did not show any changes after training, but the eo thickness significantly increased from 4.71.4 mm to 5.21.6 mm . Total abdominal muscle thickness differed significantly before training between the affected and unaffected sides (13.52.7 mm and 14.33.0 mm, respectively). After eight weeks of training, both sides showed slight increases, with final values of 14.12.9 mm on the affected side and 14.35.8 mm on the unaffected side, but these differences were not statistically significant (p>0.05; table 3table 3 . Changes in abdominal muscle thickness following horse riding simulation training (experimental group; n = 15)sidepre - testpost - testtraa2.50.82.70.9na2.50.62.60.6ioa6.30.156.31.6na6.00.166.11.8eoa4.71.4 5.21.6na5.71.65.71.4totala13.52.7 14.12.9na14.33.014.35.8a, affected side; na, non - affected side; abdominal muscle thicknesses unit: mm . Different superscripts within the same columns indicate significant differences (p<0.05)). A, affected side; na, non - affected side; abdominal muscle thicknesses unit: mm . This study examined the effects of horse riding simulation training on the improvement of balance ability (which is an important issue for stroke patients), and the changes in abdominal muscle thicknesses of stroke patients . The distance and speed of center of gravity movements were measured using a biorescue system, and changes in abdominal muscle thicknesses were observed by ultrasonography . The cop path lengths of before and after the intervention were similar in the control group (p>0.05), but significantly decreased in the experimental group after horse riding training . The changes in the speed of cop travel showed that body sway remarkably decreased in the experimental group after training in comparison with the control group . These changes presumably occurred because the trunks of the subjects became more stable as a result of horse riding simulation training, reducing body sway and shaking . Regarding abdominal muscle thicknesses, eo was thinner before training on the affected side than on the unaffected side, resulting in a difference in total abdominal muscle thickness on the affected and unaffected sides . This is consistent with the results of the study by english et al.14, which measured the abdominal muscles of stroke patients (65 years old or older) at rest . Although the mean age of the subjects in our present study was somewhat lower (55.16.1 years), similar results were obtained . Even though eo is mainly mobilized during trunk rotation movements, pereria et al.5 reported that eo was activated when stroke patients performed exercises that involved lifting of both legs, and this reportedly occurred to compensate for the inactivity of the rectus abdominis . Similarly, in our present study the eo muscle may have activated more to compensate for the weakness of the rectus abdominal muscles on the affected side of the stroke patients . Another reason for higher eo activation on the affected side could be that it is located closer to the surface layer than tra and io, which would affect thickness changes because horse riding simulation exercises induce multi - directional movements . Although diverse balance training programs for stroke patients have been reported, therapeutic approaches using horse riding have rarely been studied with stroke patients as subjects . Some studies have been conducted with persons with neurological disorders, in particular children with cerebral palsy7, 8 . Therefore, comparison of our present results with those of previous studies was difficult . Future studies of horse riding simulation may lead to an improvement in stroke patients balance ability . Horse riding simulation training can be fun and interesting for patients, which may increase their motivation to actively participate in exercise program and thus enhance the improvement of neurologic functions9, 10 . Second, ultrasonic measurement was conducted in a steady state in a supine position . Third, since the damaged sites and symptoms differed among subjects, standard subjects could not be selected . Therefore, in future studies, the effects of hippotherapy on stroke patients should be examined with a more efficient control and the selection of a wide range of subjects . Additional information should be provided by comparison (during ultrasonic measurement) of the degrees of contraction on the affected and unaffected sides . In conclusion, horse riding simulation training may reduce the distance and speed of the center of gravity movements of stroke patients and reduce the asymmetry of the abdominal muscles . To improve stroke patients balance ability, diverse uses of horse riding simulation training should be considered.
A number of gases are produced endogenously in humans and have roles in the pathology of various diseases . Among these gases, nitric oxide (no) and carbon monoxide (co) have vital roles in the physiology of the body . Since the last decade, hydrogen sulfide (h2s) has captured the interest of scientists because of its significant role in different systems of the body . H2s has been known as a toxic gas with rotten egg smell for more than 300 years . As a toxicant, some studies have also reported the toxic effects of h2s on the central nervous system (cns) and respiratory system . H2s is endogenously produced from two sulfur - containing amino acids l - cysteine and l - methionine by the two enzymes cystathionine lyse (cse) and cystathionine synthase (cbs) as shown in figure 1a and b. recently, a third enzyme, namely, 3-mercaptopyruvate sulfur transferase (3mst), along with cysteine aminotransferase (cat), which is similar to aspartate amino transferase, has been shown to produce h2s in brain . 3mst is produced by schematic chain reaction from 3-mercaptopyruvate which is also produced by cat from cysteine and -ketoglutarate[figure 1]. (a - c) the schematic presentation of h2s production in the mammalians body by involving three different pathways both the enzymes cse and cbs are present in mammalian cells and tissues . Previously, cse has been reported to be responsible for the production of h2s in the cardiovascular system (cvs) and kidneys, whereas cbs performs the same function in cns . Few studies have supported that cse is dominant in cvs, whereas cbs is dominant in cns . Both cbs and cse have been reported to be present in the kidneys, predominantly in predominantly cortical thymoma . However, the mechanism of its production still remains unclear; whether or not the production of h2s is induced by cse or cbs . Expression of both enzymes in the kidneys can lead us to conclude about the production of h2s by both enzymes . The third enzyme, 3mst, is responsible for h2s production and has also been reported to be present in endothelial cells in the thoracic aorta . Recent studies have shown that greater than 90% of the total h2s is produced in the brain by 3mst . Based on the literature, different enzymes are involved in the production of h2s in different parts of body; for example, h2s is predominantly produced in the heart by cse, both cbs and cse in the kidneys, and 3mst in the brain by . Dl - propargylglycine (dl - pag) is an inhibitor of cse, whereas aminooxyacetic acid is an inhibitor of cbs . Both inhibitors are nonselective and may be responsible for the inhibition of other enzymes . Some selective inhibitors can elaborate the mechanisms of h2s . Some mechanisms for long - term control production of h2s are coming to light . Long - term regulation of h2s seems to be dependent on s - adenosyl - l methionine, which activates cbs and ultimately leads to the production of h2s[figure 1c]. The endogenous concentration of circulating h2s is 50160 m in rats, bovines, and humans . H2s hyperpolarizes the membranes of localized cells, modulates the neuronal excitability, relaxes the smooth muscles, and controls cell apoptosis or proliferation . In one study, normal concentration of h2s in wistar kyoto (wky) rats was measured at 10 m; however, other studies have demonstrated that the plasma level of h2s is 50 m . The tissue level of h2s has been thought to be higher than its plasma level . For example, the physiological concentration of h2s in the brain has been documented at 50160 m . The h2s level decreased below the normal level in the body if coronary heart disease spontaneously hypertensive rats (shrs); however, the level increased in diabetes and circulatory shock . In carrageenan - induced inflammation model, concentration is increased . Increase in the concentration of h2s has also been observed in acute pancreatitis, hemorrhagic shock, and in endotoxin shock . The vasorelaxant effect of h2s has been proven, which shows that h2s relaxes the isolated aorta at a concentration as low as 18 m and 60 m if pretreated with 20 mm kcl or phe . A number of gases are produced endogenously in humans and have roles in the pathology of various diseases . Among these gases, nitric oxide (no) and carbon monoxide (co) have vital roles in the physiology of the body . Since the last decade, hydrogen sulfide (h2s) has captured the interest of scientists because of its significant role in different systems of the body . H2s has been known as a toxic gas with rotten egg smell for more than 300 years . As a toxicant, some studies have also reported the toxic effects of h2s on the central nervous system (cns) and respiratory system . H2s is endogenously produced from two sulfur - containing amino acids l - cysteine and l - methionine by the two enzymes cystathionine lyse (cse) and cystathionine synthase (cbs) as shown in figure 1a and b. recently, a third enzyme, namely, 3-mercaptopyruvate sulfur transferase (3mst), along with cysteine aminotransferase (cat), which is similar to aspartate amino transferase, has been shown to produce h2s in brain . 3mst is produced by schematic chain reaction from 3-mercaptopyruvate which is also produced by cat from cysteine and -ketoglutarate[figure 1]. (a - c) the schematic presentation of h2s production in the mammalians body by involving three different pathways both the enzymes cse and cbs are present in mammalian cells and tissues . Previously, cse has been reported to be responsible for the production of h2s in the cardiovascular system (cvs) and kidneys, whereas cbs performs the same function in cns . Few studies have supported that cse is dominant in cvs, whereas cbs is dominant in cns . Both cbs and cse have been reported to be present in the kidneys, predominantly in predominantly cortical thymoma . However, the mechanism of its production still remains unclear; whether or not the production of h2s is induced by cse or cbs . Expression of both enzymes in the kidneys can lead us to conclude about the production of h2s by both enzymes . The third enzyme, 3mst, is responsible for h2s production and has also been reported to be present in endothelial cells in the thoracic aorta . Recent studies have shown that greater than 90% of the total h2s is produced in the brain by 3mst . Based on the literature, different enzymes are involved in the production of h2s in different parts of body; for example, h2s is predominantly produced in the heart by cse, both cbs and cse in the kidneys, and 3mst in the brain by . Dl - propargylglycine (dl - pag) is an inhibitor of cse, whereas aminooxyacetic acid is an inhibitor of cbs . Both inhibitors are nonselective and may be responsible for the inhibition of other enzymes . Some selective inhibitors can elaborate the mechanisms of h2s . Some mechanisms for long - term control production of h2s are coming to light . Long - term regulation of h2s seems to be dependent on s - adenosyl - l methionine, which activates cbs and ultimately leads to the production of h2s[figure 1c]. The endogenous concentration of circulating h2s is 50160 m in rats, bovines, and humans . H2s hyperpolarizes the membranes of localized cells, modulates the neuronal excitability, relaxes the smooth muscles, and controls cell apoptosis or proliferation . In one study, normal concentration of h2s in wistar kyoto (wky) rats was measured at 10 m; however, other studies have demonstrated that the plasma level of h2s is 50 m . The tissue level of h2s has been thought to be higher than its plasma level . For example, the physiological concentration of h2s in the brain has been documented at 50160 m . The h2s level decreased below the normal level in the body if coronary heart disease spontaneously hypertensive rats (shrs); however, the level increased in diabetes and circulatory shock . In carrageenan - induced inflammation model, concentration is increased . Increase in the concentration of h2s has also been observed in acute pancreatitis, hemorrhagic shock, and in endotoxin shock . The vasorelaxant effect of h2s has been proven, which shows that h2s relaxes the isolated aorta at a concentration as low as 18 m and 60 m if pretreated with 20 mm kcl or phe . The role of h2s seems to be partially solved by evaluating different mechanisms; however, researchers have shifted their interest to other gaseous transmitters, such as no and carbon monoxide . Studying the role of h2s in hypertension chronologically, we were first informed that h2s produces vasorelaxation on rat aortic tissue in vitro . In succeeding research, the vasorelaxant effect of h2s has been attributed to the opening of the atp - sensitive potassium (katp) channel; this effect was mimicked by pinacidil (a katp channel agonist) and antagonized by glibenclamide (a katp channel antagonist). Blood pressure reduction by intravenous (iv) bolus injection of h2s was 1230 mm of hg . The study under discussion revealed that aortic rings were relaxed by 63% 2.2% at a dose of 180 m, if pretreated with phe . The vasorelaxation of h2s was partially dependent on endothelium and mostly through direct effects on the smooth muscle cells . To further exclude the involvement of no, the vasorelaxant effects of h2s are not blocked by 1h-(1,2,4)oxadiazolo[4,3-a] quinoxalin-1-one (odq) (an inhibitor of guanylyl cyclase). The katp channel mechanism was confirmed by inducing contractions in the aortic tissue through treating the tissue with low k (20 mm) and high k (100 mm); vasorelaxation produced by h2s on aortic tissues was observed when pretreated with low k (20 mm) and high k (100 mm). The maximum vasorelaxation produced by h2s was 90% 8.2% and 19% 3.9% when pretreated with low k (20 mm) and high k (100 mm), respectively . Hydrogen sulfide produces more relaxation with low k (20 mm) because of k conductance . The k channel opener effect was further verified using 10 mm tetraethylammonium and 100 nm of charybdotoxin or 100 nm iberiotoxin (specific inhibitors of kca channel), completely inhibiting h2s - induced relaxation . In upcoming years, the vasorelaxation produced by h2s was proven to be through a different mechanism than that of no and co. furthermore, the vasorelaxation effect on the vascular tissue by no is reduced when pretreated with h2s . This study also suggests that an additive response can be achieved using no and h2s . A study elaborated that the cardioprotective action of h2s mediated by katp channel opening is caused by the physiological production of h2s in the heart . This study has proven the negative inotropic effects of h2s both in vivo and in vitro, and concluded that h2s can effectively prevent hypertension in rats when induced by l - n - nitro arginine methyl ester . Nitric oxide and deficiency in no and co has been proven to contribute to the pathogenesis of hypertension . H2s has also been reported to play the same role in hypertension because of similar biological activities . In subsequent studies, the level of h2s in the plasma and its production rate in seriously hypertensive rats (shr) was lower than that in wky rats . Therefore, cse is a specific enzyme for h2s production in the thoracic aorta and its decreased activity in hypertension may lead to less production of h2s, resulting in decreased circulating level of h2s . The above - mentioned theory proposes that less activity and decreased transcription of cse results in decreased circulating aortic h2s level and that vasoconstriction is a dominant phenomenon over vasorelaxant one . Sodium hydrogen sulfide (nahs) has been selected as an exogenous source ofh2s because of to four reasons . (1) na dissociates from hs in a nahs solution, then hs associates with h and produces h2s, regardless if the h2s solution was prepared by bubbling h2s gas or dissolving nahs . In physiological saline, about one - third of h2s exists in the undissociated form (h2s), and the remaining two - thirds is hs - at equilibrium with h2s . (2) nahs enables a more accurate and reproducible measurement of h2s concentrations in a solution than by bubbling h2s gas . (3) the influence of 1 mm or less sodium ion on the physiological experiments is negligible . (4) nahs at concentrations used in the current study does not change the ph of the medium . The results of one study suggest that upregulation of h2s results in the reduction of sbp in the shr + nahs group (158.13 12.52 mm vs. 183.57 11.8 mm of hg). A study demonstrated that an iv bolus injection of h2s at 2.8 mol / kg and 14 mol / kg body weight results in a decrease in the mean arterial blood pressure of rats by 12.5 2.1 mmhg and 29.8 7.6 mmhg, respectively . Therefore, the physiological concentration of h2s is responsible for maintaining the mean arterial blood pressure . However, the expression of cse activity decreases with the onset of disease . Based on the findings, the finding that the physiological concentration of h2s is responsible for the normal function of cvs is a matter of great interest . Diseases like hypertension occur when the concentration of h2s decreases; however, the opposite occurs in hemorrhagic shock . In a study, induction of hemorrhagic shock results in a prolonged decrease in the mean arterial pressure (map) and heart rate (hr). However, data suggest that vasoconstriction is responsible for a hemorrhagic shock because of vasopressin, noradrenaline, and angiotensin ii . A reasonable number of previous studies have shown that excessive formation of inducible nitric oxide synthase (inos) in hypotension is responsible for hemorrhagic shock; thus, the concentration of h2s increases in the induction of hemorrhagic shock . Treatment with inhibitors of h2s - producing enzymes cse and dl - pag, a suicidal inhibitor, resulted in the rapid and partial restoration of map and hr . Previously, glibenclamide (a k channel blocker) has been proven to perform the same partial but equally effective function after hemorrhagic shock in a rat . A comparative study was conducted to compare the effect of h2s with pag and -cyano - l - alanine, a reversible inhibitor of cse, on the blood pressure of rats subjected to hemorrhagic shock . After many years of earning good repute among researchers, h2s research started to intermingle with each other . Two different schools of thought exist between interchangeable production of h2s and no . In 1997, a study has proven that a low concentration of h2s increases the relaxation of smooth muscles by 13-folds . This study also explained that low concentration (30 m) of h2s enhances the vasodilator effect of no . Therefore, a synergistic response between h2s and no can be the therapeutic outcome in hypertension . This study further elaborated that no - induced vasorelaxation is specifically for h2s, but no cannot potentiate the vasorelaxant effect of h2s . Another study has proven that no is responsible for the upregulated production of h2s in rats in a dose - dependent manner (1100 m), as shown in the following figure . This study claims that production of h2s by no is narrated by two mechanisms: (1) no increases cse activity, which ultimately leads to the production of h2s, and (2) no increases the activity of protein kinase, which is dependent on cyclic guanosine monophosphate, thereby increasing cse protein . A growing body of evidence has proven that h2s as a cofactor is responsible for the generation of no from nitrite . In his previous studies in 2002, documented the interaction between hydrogen sulfide and no resulting in the formation of the intermediate compound nitrosothiol, which releases no through hemolysis . In his next experimentation, proposed the mechanism of no production from sodium nitroprusside . In 2006, has proven that the interaction between two gasotransmitters results in the formation of nitrosothiol and the release of only a small portion of no unless an antioxidant is involved . These findings contradict those of other studies, which demonstrate that the interaction between no and h2s enhances vasodilatation . In the battle of the interchangeable production of h2s and no, another finding cropped up, supporting the claim that h2s is responsible for the direct inhibition of endothelial nitric oxide synthase (enos). This theory is born out of the result of the first school of thought, which proposed that no can potentiate the response of h2s, but no can do this . Has elaborated that h2s is responsible for the inhibition of enos, as well as inos and nnos . They further strengthened the results of their study by explaining that h2s and tetrahydrobiopterin (bh4) reverse the h2s inhibition of enos and nnos, but not inos . A study in 2006 elaborated that the intermediate complex formed from the interaction between h2s and no has no vasorelaxant effect; h2s was responsible for the regulation of no . This study concluded that h2s inhibits the vasorelaxant effect of no . A decrease in h2s concentration results in over stimulation of adrenoreceptor . The h2s has also been reported to inhibit the l - type ca channels in cardiomyocyte, which leads to a decrease in contractility, thereby revealing the ca channel - blocking mechanism of h2s . In the same year, h2s has been found to have the ability to block the angiotensin - converting enzyme and responsible for additive vasorelaxant response leading to the inhibition of angiotensin ii production, ultimately resulting in reduced degradation of bradykinin . In a related study in 2010, reported that enos and neuronal nitric oxide synthase (nos) activation is important to produce a cardioprotective response . The cardioprotective response of the nos family mentioned in is contrary to the results by . Another area of interest is the formation of the intermediate complex nitrosothiol, which is responsible for the vasorelaxant effect in the blood vessels through interaction between two gasotransmitters, h2s and no . The presence of this intermediate molecule, nitrosothiol, has not been fully confirmed and has been considered as a possible molecule for the said action . A previously mentioned study has stated that the intermediate molecule is nitrosothiol but has no vasorelaxant effect in vivo and in vitro . Another school of thought has reported that the interaction between no and h2s leads to the formation of the nitroxyl group; nitroxyl has been reported to be involved in positive inotropic and vasodilation activities . These results support the evidence that hno / no produce positive inotropic and lusitropic effects (independent of -adrenergic stimulation) in a failing heart . Most recently, a group of researchers studied the role of h2s in hypertension along with diabetes and emphasized that h2s improves the renal blood flow by reducing renal vasculature resistance through vasodilation . The same group of researchers extended their study to investigate the role of h2s in cardiac protection in dihydroxycortisone acetate - induced hypertension and shr combined with diabetes . In view of the above - mentioned literature review, many things remain to be explored and many questions still to be answered . Future studies must verify whether the intermediate molecule formed as a result of interaction between no and h2s is nitroxyl or nitrosthiol or both . If both molecules are present; then, which one is responsible for the vasorelaxant effect?concentration of h2s decreased in hypertension . Is it a cause or consequence of the disease?h2s acts by vasodilatation, so blocking effect can be investigatedbh4 and h2s effects in hypertension can be studiedthe molecular mechanism of h2s can be studied using reverse transcription polymerase chain reactionsome selective inhibitors can be introduced to avoid inhibition of unwanted enzymesreleasers of h2s introduced as present releasers are inconsistent and have sustained - release property . Future studies must verify whether the intermediate molecule formed as a result of interaction between no and h2s is nitroxyl or nitrosthiol or both . If both molecules are present; then, which one is responsible for the vasorelaxant effect? H2s acts by vasodilatation, so blocking effect can be investigated bh4 and h2s effects in hypertension can be studied the molecular mechanism of h2s can be studied using reverse transcription polymerase chain reaction some selective inhibitors can be introduced to avoid inhibition of unwanted enzymes releasers of h2s introduced as present releasers are inconsistent and have sustained - release property . In view of the above - mentioned literature review, many things remain to be explored and many questions still to be answered . Future studies must verify whether the intermediate molecule formed as a result of interaction between no and h2s is nitroxyl or nitrosthiol or both . If both molecules are present; then, which one is responsible for the vasorelaxant effect?concentration of h2s decreased in hypertension . Is it a cause or consequence of the disease?h2s acts by vasodilatation, so blocking effect can be investigatedbh4 and h2s effects in hypertension can be studiedthe molecular mechanism of h2s can be studied using reverse transcription polymerase chain reactionsome selective inhibitors can be introduced to avoid inhibition of unwanted enzymesreleasers of h2s introduced as present releasers are inconsistent and have sustained - release property . Future studies must verify whether the intermediate molecule formed as a result of interaction between no and h2s is nitroxyl or nitrosthiol or both . If both molecules are present; then, which one is responsible for the vasorelaxant effect? H2s acts by vasodilatation, so blocking effect can be investigated bh4 and h2s effects in hypertension can be studied the molecular mechanism of h2s can be studied using reverse transcription polymerase chain reaction some selective inhibitors can be introduced to avoid inhibition of unwanted enzymes releasers of h2s introduced as present releasers are inconsistent and have sustained - release property . In view of the above - mentioned literature review, many things remain to be explored and many questions still to be answered . Future studies must verify whether the intermediate molecule formed as a result of interaction between no and h2s is nitroxyl or nitrosthiol or both . If both molecules are present; then, which one is responsible for the vasorelaxant effect?concentration of h2s decreased in hypertension . Is it a cause or consequence of the disease?h2s acts by vasodilatation, so blocking effect can be investigatedbh4 and h2s effects in hypertension can be studiedthe molecular mechanism of h2s can be studied using reverse transcription polymerase chain reactionsome selective inhibitors can be introduced to avoid inhibition of unwanted enzymesreleasers of h2s introduced as present releasers are inconsistent and have sustained - release property . Future studies must verify whether the intermediate molecule formed as a result of interaction between no and h2s is nitroxyl or nitrosthiol or both . If both molecules are present; then, which one is responsible for the vasorelaxant effect? H2s acts by vasodilatation, so blocking effect can be investigated bh4 and h2s effects in hypertension can be studied the molecular mechanism of h2s can be studied using reverse transcription polymerase chain reaction some selective inhibitors can be introduced to avoid inhibition of unwanted enzymes releasers of h2s introduced as present releasers are inconsistent and have sustained - release property.
Ischemic heart disease is rare during pregnancy, occurring in approximately one in 10,000 live births . The risk of myocardial infarction (mi) in pregnancy is reported from one per 37,500 to 6.2 per 100,000 deliveries.13 the diagnosis is by clinical findings, electrocardiogram (ecg), and measurement of the serum level of the cardiac specific contractile protein, troponin 1.4, 5 the most common forms of angina are stable and unstable angina, which are usually due to atherosclerosis . But coronary spasm, coronary dissection, and thrombus have been reported as other causes.6, 7 prinzmetal s angina (variant angina) is rare and it accounts for only 2 out of every 100 cases of angina . We report a pregnant woman who presented with signs and symptoms of acute mi and whose ecg findings and troponin 1 level were compatible with mi, leading to the final diagnosis of prinzmetal s angina . A 35-year - old woman, gravid 3 (with a history of two cesarean section operations), developed acute mi at the 30 week of gestation . She was a non - smoker and had no history of drug abuse or systemic disease . She referred to the emergency ward due to a sudden, severe pain in the neck and between the two scapulas that had started during sleep at 5 am, with cold sweat and nausea . Her blood pressure was 200/150 mm hg; she had a history of increased blood pressure of two weeks duration . The patient also had tachycardia, rales in the bases of the lungs, signs of anteroseptal mi in the ecg (figure 1), and increased troponin 1 blood level . We performed a cesarean section operation because of severe preeclampsia, repeat cesarean section, and transverse lie . Four days after delivery, the patient s blood pressure was 140/80 mmhg and coronary angiography showed total occlusion of the second obtuse marginal artery (om2) in addition to diffuse spasm of the left circumflex coronary artery (lcx) (figure 2). At the seventh day after delivery in the ward, the patient had chest pain and st - segment elevation in the inferior leads (figure 3) as well as signs of pulmonary edema . The ecg changes reversed after intravenous trinitroglycerin (figure 4). Based on the ecg, the diagnosis was inferior wall ischemia . We performed angiography for a second time and surprisingly the lcx and om2 coronary arteries were normal and there was narrowing in the rca (figure 5). We conclude that this discrepancy between the first and second ecgs and angiographic findings were due to prinzmetal s angina . A few days later, the patient was discharged (blood pressure = 130/80 mmhg) on diltiazem, atorvastatin, captopril, nitrocontin, furosemide, and clopidogrel while the ecg showed previous anteroseptal mi (figure 6). An ecg three months after discharge showed the same findings too (figure 7). Mi in pregnancy is rare but can produce significant maternal and neonatal morbidity . Prompt diagnosis and immediate therapy are necessary to lower the high likelihood of the mortality of mother and fetus . The highest incidence of mi seems to occur in the third trimester and in multigravidas older than 33 years old . Acute mi in pregnancy is commonly located in the anterior wall, and acute maternal death rate is reported to be 1930%.13, 8 complications of pregnancy that are significantly associated with acute mi are preeclampsia, postpartum hemorrhage, postpartum infection, and fluid and electrolyte imbalance.1, 9 shock from postpartum hemorrhage,10 ergonovine,11 and prostaglandin e1 (pge1)12 is reported as a risk factors for mi in pregnancy . Our patient was a 35-year - old, obese, multiparous, pregnant woman with preeclampsia, and her symptoms of mi appeared at rest in the early hours of morning . Prinzmetal s angina usually occurs at rest and happens between the midnight and early morning . People with prinzmetal s angina are often younger than those with the other forms of angina . The gold standard for diagnosis is coronary angiography with injection of provocative agents (like ergonovine) into the coronary arteries . . Also administration of intracoronary nitroglycerin in cases of vasospasm can cause marked diffuse vasodilatation.13 treatment with calcium - channel blockers or nitrates eliminates spasm in most of these patients . In our patient, the discrepancy between the first and second angiographic findings was the confirmatory evidence that she had prinzmetal s angina . This conclusion was derived from the fact that the first angiographic examination showed that the lad coronary artery was normal despite the definite occurrence of an mi in its territory, thus suggesting transient spasm . Furthermore, a subsequent bout of inferior wall ischemia with confirmation of transient spasm by angiography was another piece of confirmatory evidence . Last but not least, asymptomatic rca spasm, detected in the last angiography, was another clue to the propensity of the coronary arteries to vasospasm, which is the sine qua non of prinzmetal s angina.
Moderate or severe mitral regurgitation (mr) is the most frequent valve disease in the usa and the second most common form of valvular heart disease needing surgery in europe . Degenerative mitral valve disease (mvd) is the leading cause of organic mr in western countries . Its mechanism is primarily characterized by mitral valve prolapse (mvp) due to excessive leaflet movement (2 mm abnormal systolic movement beyond the saddle - shaped annular level), as defined by carpentier (type ii). The anatomic lesions associated with the degenerative mr etiology encompass a wide pathological spectrum, from fibroelastic deficiency (fed) to extensive myxomatous disease . Carpentier described fed as a condition associated with a fibrillin deficiency that often leads to the rupture of one or more thinned and elongated chordae . This process usually, but not exclusively, involves the middle scallop of the posterior leaflet with the myxomatous degeneration limited to the prolapsing segment . In contrast to fed, myxomatous disease, often called barlow disease (bd), is characterized by diffuse excess tissue, with large valves comprising multiple degenerated segments presenting as thick, mostly with elongated chordae; severe mitral annulus (ma) dilatation associated with different degrees of annular calcification is a frequent finding in patients with bd, and subvalvular fibrosis and calcification of the papillary muscles, usually the anterior, may also occur . Myxomatous degeneration is defined by the accumulation of mucopolysaccharides responsible for the thickening and proliferative aspect of valvular tissue . Even if molecular disorders and pathophysiologic pathways may not be uniform, there is a continuum between the different anatomic aspects of degenerative mr . Surgery is the treatment of choice in degenerative mr, improving symptoms and preventing heart failure . Since the 1970s, mitral valve (mv) repair has emerged as the optimal treatment, preferred to traditional valve replacement, as it improves outcome and reduces mortality of patients with severe organic mr by about 70% . Recent studies and guidelines have underlined the importance of early surgical intervention to preserve long - term left ventricular (lv) function in severe mr . Indeed, the best short- and long - term results are obtained in asymptomatic patients operated in advanced repair centers with low operative mortality (<1%) and high repair rates (80 - 90%). These results emphasize the importance of early detection and detailed assessment of valve morphology and mr . Moreover, in the recent years there has been an increasing interest towards non - surgical solutions to severe mr, with the percutaneous mitraclip system, mimicking the surgical alfieri stitch by placing a clip on the beating heart, being the most well established, with results not inferior to surgical correction in selected patients . Patient selection is a crucial step of the mitraclip procedure and several anatomic criteria should be fulfilled to ensure the suitability of the device to mv anatomy . In this complex scenario, echocardiography is the method of choice to evaluate patients with degenerative mr; it allows the accurate assessment of mr severity, etiology, mechanisms and anatomic lesions, lv and left atrial remodeling, and consequently defines the indication and the probability of successful mv repair . Three - dimensional (3d) echocardiographic imaging has represented a major innovation in cardiovascular ultrasound . Recent guidelines stated that real - time three - dimensional (rt3d) imaging modalities are useful in the presentation of realistic views of heart valves and are ideal for interrogating the anatomy and function of each of the individual components of the mv apparatus, including annulus, leaflets, chordae and papillary muscles . Both qualitative and quantitative evaluations of degenerative mvd all publications considered for this review were identified accessing the medline database via pubmed . The search strategy employed a number of free - text keywords and controlled vocabulary terms including, but not limited to, the following concepts: 3d echocardiography; mitral valve; degenerative mitral valve disease; mitral valve repair; percutaneous mitral valve repair . Fields of search were limited to the title and abstract and restricted to the english language . All the retrieved studies were screened for inclusion using a hierarchical approach assessing title, abstract and manuscript . Additional searches were conducted after screening the references of all selected studies . As a direct consequence of a series of technological breakthrough, such as the introduction of the 3d matrix technology with its improved spatial resolution compared to previously available sparse array transducers, rt3d echocardiography demonstrated feasibility and accuracy in mv assessment . The enhanced visualization of morphologic and pathologic aspects of the mv apparatus in degenerative mr has contributed to our knowledge of mv pathology, with unquestionable benefits compared to traditional two - dimensional (2d) echocardiography . Qualitative morphological evaluation of the mvp may be accurately assessed both by 3d transthoracic echocardiography (tte) and transesophageal echocardiography (tee) and the recent data showed that rt3d, either tte or tee, is superior to the corresponding 2d techniques in the description of mv pathology [figure 1]. Example of head - to - head comparison between 3d tte (left) and 3d tee (right) datasets in two cases of a2 prolapse (above) and p2 prolapse (below), imaged from the surgical view (left atrium) 3d evaluation may be easily integrated into a standard 2d examination in the assessment of qualitative morphology of the mv . Indeed, the possibility of visualizing mv leaflets, commissures, annulus calcifications and subvalvular structures in different and unique planes, both from the atrium or ventricle, with access to en face views, enhances the understanding of this complex apparatus . Diagnostic accuracy of rt3d tte vs surgical inspection in the identification of prolapsing segments has been investigated by tamborini et al . The overall accuracy of the method was high (sensitivity 92.5%, specificity 96%, accuracy 95%); sensitivity was slightly lower for antero - lateral commissure, p1 and a1, while specificity was very high in all the segments . Even focusing on the differences in rt3d tte accuracy in the setting of simple (isolated p2 prolapse or p2 associated with p1 or p3) and complex cases (lesions involving the entire posterior leaflet, lesions of the anterior leaflet, bileaflet prolapse, and commissural involvement), the accuracy was very high, 98% and 93% respectively, even if slightly lower in complex lesions . All these data were in accordance with previous findings . As it concerns rt3d tee, there is a substantial body of literature demonstrating the additional value of 3d over 2d in the evaluation of patients with mvp . The majority of these studies showed that 3d echocardiographic findings correlate closely to surgical findings, achieving an exact anatomic description in approximately 90% to 95% of segments, whereas 2d echocardiography is less accurate ., underlined that in agreement with previous works, the incremental value of 3d modality over conventional 2d can be better appreciated in complex disease involving both leaflets or the anterior leaflet alone . La canna et al ., demonstrated that rt3d tee provided more accurate mapping of mv prolapse than 2d tee and rt3d tte imaging, adding quantitative recognition of dominant and secondary lesions and mv anatomy details in 222 patients undergoing surgical repair for mr secondary to prolapse . Recently, hien et al ., investigated whether the known benefit of rt3d tte over 2d tee imaging for the evaluation of mvp would be valuable among novice echocardiographers . They demonstrated that both expert and novice echocardiographers were able to provide more accurate descriptions of the mv prolapse with rt3d than with 2d tee images, and this benefit was three times more important for inexperienced operators . With the advances of rt3d echocardiography together with the development of dedicated rt3d software capable of providing several parameters (annular diameters and area, annular height and planarity, saddle - shaped morphology, leaflet size, coaptation geometry), high - resolution, full - volume imaging and quantification of morphology of the entire mitral apparatus have become feasible [figure 2]. Several studies demonstrated that the use of rt3d allows improving the evaluation of the mv apparatus both qualitatively, as previously illustrated, but also quantitatively . In fact, the mv has a complex 3d morphology and attempts to use 2d images to comprehend a complex 3d structure have provided an incomplete picture . In particular, the normal ma is characterized by a nonplanar saddle shape that has been suggested to be important for alleviating the mechanical stress on mitral leaflets and chordae tendinae imposed by lv pressure . Moreover, the geometry of leaflet surface and coaptation, magnitude of leaflet billowing, and deformation of subvalvular structures are important morphological features in mvp and they can be only partially assessed with 2d imaging . Chandra et al ., hypothesized that rt3de - derived measurements of valvular anatomy could be used to characterize mvd in an objective way . Morphological analysis in the mvd group revealed a progressive increase in multiple parameters from normal subjects to fed to bd, allowing an accurate diagnosis of these entities . Three - dimensional billowing height with a cutoff value of 1.0 mm differentiated mvd from normal subjects, and billowing volume with a cutoff value of 1.15 ml differentiated between fed and bd . These findings could support the adoption of preoperative automated clinical decision - making strategies based on reliable quantitative parameters, with important surgical implications . Example of 3d tee and corresponding reconstruction of mitral annulus and leaflets in a patient with fibroelastic deficiency (left) and in two patients with barlow disease (right). In the first case, the two barlow cases with the same method are characterized by multiple scallop involvement of both leaflets identified by the red surfaces moreover, grewal et al ., investigated mitral annular size, shape, and motion 6 times over the cardiac cycle using rt3de in patients with degenerative mvd compared with normal subjects and patients with ischemic mr and demonstrated that degenerative mvd annulus is still a dynamic structure but behaves considerably different from normal patients with loss of early - systolic area contraction and saddle - shape deepening . Maffessanti et al ., characterized the mv 3d morphology using rt3d tee in the presence of severe mr associated with fed or bd, immediately before and after mv repair, in comparison with a control group . They found that the annular enlargement after mr is not isotropic, being more pronounced in the anteroposterior and intercommissural directions rather than along the mitral height, resulting in flattening of the mv in both fed and bd groups with higher values in the bd group . Postoperatively, annular diameters and mv area were significantly smaller compared with preoperative values; similar changes were found in the exposed areas of both leaflets . More recently, lee et al ., demonstrated that patients with mvp - related mr had more dilated mitral annulus, a flattening of annular saddle shape, redundant leaflet surfaces, greater leaflet billow volume and billow height, longer lengths from papillary muscles to coaptation and more frequent chordal rupture compared to normal subjects and non - prolapse mr patients . Interestingly, the association between annular flattening and the increased frequency of chordal rupture suggests that the loss of the annular saddle shape may predispose to chordal elongation and rupture as a result of excessive chordal tension . As a direct consequence of a series of technological breakthrough, such as the introduction of the 3d matrix technology with its improved spatial resolution compared to previously available sparse array transducers, rt3d echocardiography demonstrated feasibility and accuracy in mv assessment . The enhanced visualization of morphologic and pathologic aspects of the mv apparatus in degenerative mr has contributed to our knowledge of mv pathology, with unquestionable benefits compared to traditional two - dimensional (2d) echocardiography . Qualitative morphological evaluation of the mvp may be accurately assessed both by 3d transthoracic echocardiography (tte) and transesophageal echocardiography (tee) and the recent data showed that rt3d, either tte or tee, is superior to the corresponding 2d techniques in the description of mv pathology [figure 1]. Example of head - to - head comparison between 3d tte (left) and 3d tee (right) datasets in two cases of a2 prolapse (above) and p2 prolapse (below), imaged from the surgical view (left atrium) 3d evaluation may be easily integrated into a standard 2d examination in the assessment of qualitative morphology of the mv . Indeed, the possibility of visualizing mv leaflets, commissures, annulus calcifications and subvalvular structures in different and unique planes, both from the atrium or ventricle, with access to en face views, enhances the understanding of this complex apparatus . Diagnostic accuracy of rt3d tte vs surgical inspection in the identification of prolapsing segments has been investigated by tamborini et al . The overall accuracy of the method was high (sensitivity 92.5%, specificity 96%, accuracy 95%); sensitivity was slightly lower for antero - lateral commissure, p1 and a1, while specificity was very high in all the segments . Even focusing on the differences in rt3d tte accuracy in the setting of simple (isolated p2 prolapse or p2 associated with p1 or p3) and complex cases (lesions involving the entire posterior leaflet, lesions of the anterior leaflet, bileaflet prolapse, and commissural involvement), the accuracy was very high, 98% and 93% respectively, even if slightly lower in complex lesions . All these data were in accordance with previous findings . As it concerns rt3d tee, there is a substantial body of literature demonstrating the additional value of 3d over 2d in the evaluation of patients with mvp . The majority of these studies showed that 3d echocardiographic findings correlate closely to surgical findings, achieving an exact anatomic description in approximately 90% to 95% of segments, whereas 2d echocardiography is less accurate ., underlined that in agreement with previous works, the incremental value of 3d modality over conventional 2d can be better appreciated in complex disease involving both leaflets or the anterior leaflet alone . La canna et al ., demonstrated that rt3d tee provided more accurate mapping of mv prolapse than 2d tee and rt3d tte imaging, adding quantitative recognition of dominant and secondary lesions and mv anatomy details in 222 patients undergoing surgical repair for mr secondary to prolapse . Recently, hien et al ., investigated whether the known benefit of rt3d tte over 2d tee imaging for the evaluation of mvp would be valuable among novice echocardiographers . They demonstrated that both expert and novice echocardiographers were able to provide more accurate descriptions of the mv prolapse with rt3d than with 2d tee images, and this benefit was three times more important for inexperienced operators . With the advances of rt3d echocardiography together with the development of dedicated rt3d software capable of providing several parameters (annular diameters and area, annular height and planarity, saddle - shaped morphology, leaflet size, coaptation geometry), high - resolution, full - volume imaging and quantification of morphology of the entire mitral apparatus have become feasible [figure 2]. Several studies demonstrated that the use of rt3d allows improving the evaluation of the mv apparatus both qualitatively, as previously illustrated, but also quantitatively . In fact, the mv has a complex 3d morphology and attempts to use 2d images to comprehend a complex 3d structure have provided an incomplete picture . In particular, the normal ma is characterized by a nonplanar saddle shape that has been suggested to be important for alleviating the mechanical stress on mitral leaflets and chordae tendinae imposed by lv pressure . Moreover, the geometry of leaflet surface and coaptation, magnitude of leaflet billowing, and deformation of subvalvular structures are important morphological features in mvp and they can be only partially assessed with 2d imaging . Chandra et al ., hypothesized that rt3de - derived measurements of valvular anatomy could be used to characterize mvd in an objective way . Morphological analysis in the mvd group revealed a progressive increase in multiple parameters from normal subjects to fed to bd, allowing an accurate diagnosis of these entities . Three - dimensional billowing height with a cutoff value of 1.0 mm differentiated mvd from normal subjects, and billowing volume with a cutoff value of 1.15 ml differentiated between fed and bd . These findings could support the adoption of preoperative automated clinical decision - making strategies based on reliable quantitative parameters, with important surgical implications . Example of 3d tee and corresponding reconstruction of mitral annulus and leaflets in a patient with fibroelastic deficiency (left) and in two patients with barlow disease (right). In the first case, the two barlow cases with the same method are characterized by multiple scallop involvement of both leaflets identified by the red surfaces moreover, grewal et al ., investigated mitral annular size, shape, and motion 6 times over the cardiac cycle using rt3de in patients with degenerative mvd compared with normal subjects and patients with ischemic mr and demonstrated that degenerative mvd annulus is still a dynamic structure but behaves considerably different from normal patients with loss of early - systolic area contraction and saddle - shape deepening . Maffessanti et al ., characterized the mv 3d morphology using rt3d tee in the presence of severe mr associated with fed or bd, immediately before and after mv repair, in comparison with a control group . They found that the annular enlargement after mr is not isotropic, being more pronounced in the anteroposterior and intercommissural directions rather than along the mitral height, resulting in flattening of the mv in both fed and bd groups with higher values in the bd group . Postoperatively, annular diameters and mv area were significantly smaller compared with preoperative values; similar changes were found in the exposed areas of both leaflets . More recently, lee et al ., demonstrated that patients with mvp - related mr had more dilated mitral annulus, a flattening of annular saddle shape, redundant leaflet surfaces, greater leaflet billow volume and billow height, longer lengths from papillary muscles to coaptation and more frequent chordal rupture compared to normal subjects and non - prolapse mr patients . Interestingly, the association between annular flattening and the increased frequency of chordal rupture suggests that the loss of the annular saddle shape may predispose to chordal elongation and rupture as a result of excessive chordal tension . The prognosis and the best timing for surgical treatment in degenerative mvd strongly depend on the accurate quantification of mr severity, which claims for accurate, feasible and reproducible techniques . Despite these premises, recent technological development has made rt3d echocardiography the ideal technique for the evaluation of mr severity, in particular, in all those cases where the hypotheses at the basis of 2d estimate are not met . Mr grading can be obtained, in accordance with standard 2d echocardiography, by means of vena contracta area (vca), effective regurgitant orifice area (eroa) using 3d proximal isovelocity surface area (pisa) or mr volume measurement [figure 3]. Detailed and comprehensive discussions on mr quantitative evaluation two examples of the complementary use of 3d color doppler in two different patients with a more common and typical patterns (left case p2 prolapse) and an uncommon case with multiple scallop involvement . 3d tte color doppler dataset (left) clearly facilitates the identification of the origin of the jet (p2) and its measurement while in the complex case (right) tee identifies multiple regurgitant jets 3d vca can be easily obtained, without any a priori shape assumption, acquiring a 3d color doppler dataset, and then cutting the volumetric dataset till the best en face view of the regurgitant jet is obtained; vca is measured as the mr jet planimetry . Several studies have shown vca estimated by rt3d echocardiography to be more accurate and reproducible than 2d echocardiography - derived vca, when compared with other techniques such as cardiovascular magnetic resonance . Moreover, 3d - vca measurements appear accurate even in asymmetric regurgitant orifices and unaffected by the etiology or eccentricity of mr . A cutoff of 0.41 cm using 3d - vca showed 82% sensitivity and 97% specificity in differentiating moderate from severe mr . Further, using the planimetric 3d - vca and sampling the regurgitant jet with the continuous wave doppler, mr volume can be obtained multiplying the anatomical regurgitant orifice area and the velocity time integral, similarly to what is done routinely using 2d echocardiography . The major limitation affecting the 3d - vca technique is related to the limited temporal and spatial resolutions, which may prevent the accurate measurement of vca . The anatomic severity of mr can be assessed by 3d color doppler using the pisa technique . The theoretical benefit of the 3d pisa technique is the ability to measure the 3d surface of the proximal flow convergence region (pfcr) or to obtain the largest radius of the pfcr using 3d navigation, possibly increasing the accuracy of the eroa calculation . Although the use of 3d data may improve the accuracy of the eroa calculation, it still requires assumptions about the shape of the pfcr . Two studies attempted to obtain a 3d surface area, one using measurement of multiple radial planes of the pfcr in an in vitro model to reconstruct subsequently the total surface area, and the second using multiple linear measurements to reconstruct the 3d surface area . Recently, a completely 3d - based method for mr quantification has been proposed and validated against cardiovascular magnetic resonance . The mr volume is obtained subtracting the left ventricular (lv) outflow from the mv inflow; both flows are calculated based on 3d color - doppler acquisitions, using advanced algorithm for the estimate of the flow rate in planes close to the mv or lv outflow tract . This can be more accurate and reproducible than 2d pulsed - wave doppler - based methods . Despite several studies have clearly shown the benefit of rt3d echocardiography, both tee and tte, for the mr quantification when compared to standard 2d echocardiographic methods, the lack of extensive, independent and ideally multicentric validation studies, limits the widespread use of the above mentioned techniques . Guidelines on management of valvular heart diseases underlined that mv repair should be considered even in asymptomatic patients when the likelihood of a successful repair is high and in presence of a low operative risk . It is clear that the likelihood of a durable and safe mv repair strongly depends on the anatomy and morphology of the mv, and similarly the complexity of the surgical procedure is related to the complexity of the mv lesions . In a paper by tamborini et al ., the relationship between the extent of mv lesions and the complexity of the surgical procedures has been investigated . The results clearly demonstrated that simple lesions, as assessed by rt3d echo, are very likely to be treated with simple techniques; while in almost half of the patients with complex lesion, complex surgical repair was performed by the surgeon . Moreover, biaggi et al ., showed that quantitative mv characteristics, as assessed by rt3d tee rather than 2d tee, determined the complexity of mv repair, being involvement of the anterior leaflet, bileaflet prolapse, severe annular calcification, increased annular dimensions and leaflet height anatomic predictors of a lower likelihood of successful repair . Thus, an accurate pre - operative rt3d tte evaluation, eventually using ad hoc post - processing software, may facilitate surgical planning allowing a tailored approach to each case . Several publications have underlined the importance of mv annuloplasty during repair of degenerative mvd to optimize repair durability . Using rt3d tee, demonstrated the presence of an enlarged posterior ma in patients with significant mr due to degenerative mvd, while there was no evidence that the intertrigonal distance is abnormal in these patients leading to the conclusion that posterior annular reduction with a flexible device at the time of mv repair is important, and that altering the anterior intertrigonal portion of the ma is unnecessary . Caiani et al ., investigated, by rt3d tte, the changes in ma dynamics and the long - term effects induced by annuloplasty in mv organic prolapse undergoing repair using either an incomplete flexible band or a complete semi - rigid ring . Both rings showed similar dynamic changes and, at 6 months, the ma area change during the cardiac cycle was depressed compared to control groups, independently of the implanted prosthetic ring . They concluded that the main factor affecting ma function is the undersizing due to the ring, which restricts ma geometry and limits the natural ma motion . Most of the investigation focused on the mv and based rt3d echocardiography aimed at evaluating mv morphology as an isolated structure . However, veronesi et al ., investigated, using custom software, the relationship between mv and the aortic annulus . They demonstrated that in patients with mr, the dynamic mitral - aortic coupling was preserved despite the altered morphology and function of the mv . In these patients, mv repair with annuloplasty led to smaller and less pulsatile ma, with altered spatial displacement of the mv - aortic annulus complex . Despite surgical correction of mr has demonstrated optimal outcomes in terms of efficiency, safety and residual mr, it is often not feasible in high - risk patients . According to the results of the euroheart survey, approximately half of the symptomatic patients with severe mr of functional or degenerative origin are denied surgery, and the likelihood of surgery denial increases with lv dysfunction, age and presence of comorbidities . Chiam et al ., classified the proposed technologies into those targeting the chordae, the leaflets or the ma, both indirectly via the coronary sinus or directly true an edge - to - edge repair . Among the latter, the mitraclip system is the more diffused and studied, and is currently under ce mark in europe and investigational use in the usa and parts of asia . The mitraclip system mimics the surgical mv repair procedure introduced by alfieri, who treated a patient with an anterior prolapse by placing a pledgeted stitch to approximate the middle portions of the mv leaflets, creating a double orifice mv and successfully reducing the mr . The everest trials (i and ii) and the pivotal studies established the feasibility, safety and hemodynamic improvements in the large majority of patients, despite less effective at reducing mr than conventional surgery and thus with a higher rate of reintervention and/or surgical operation . Currently, catheter - based mv clip repair is guided by standard, 2d tee . However, 2d tee is limited in the direct visualization of major mv pathology, the assessment of the 3d location of the catheter - clip system during the procedure, and the effect of the procedure on 3d mv morphology . Rt3d tee was found helpful in several catheter - based procedure such as closure of atrial septal defects and transcatheter aortic valve implantation and, providing a unique en face visualization of mv anatomy and mr orifice, that is demonstrated to facilitate the transcatheter closure of mitral prosthesis paravalvular leaks . Biner et al ., hypothesized that the combined use of 2d and 3d tee would also have additional value over 2d imaging in evaluating mr for catheter - based mv clip repair and guidance of the procedure . They demonstrated that combined 2d and 3d tee imaging was associated with a shorter time to first clip deployment and with a general reduction in the total procedure time when compared to traditional 2d tee guidance . They also stressed that rt3d tee is valuable in determining the precise orientation of the clip arms guiding the interventional cardiologist till the clip is positioned perpendicularly between the two central scallops, without the need for multiple verifications and cross - checks of 2d planes . Moreover, the use of 3d color doppler could allow a better identification of the site of origin and the degree of any residual mr ., identified thickened anterior mitral leaflet and more severe mr to be the echocardiographic predictors associated with a higher likelihood of a dual clips procedure . Recently, faletra et al ., showed side - by - side images obtained by fluoroscopy, 2d tee, and rt 3d tee . While essential data during the procedure were provided by the use of the 2d standard imaging techniques and the capture of mitral leaflets was always guided by 2d tee, they demonstrated that in almost every step of the mitralclip procedure, rt 3d tee may provide new additional useful data: the more precise anatomic information, the fine details of the devices and the precise relationship of catheters / clip with surrounding anatomic structures, may enhance the confidence of imaging interpretation and eventually improve the efficiency of the procedure . A crucial step during the percutaneous edge - to - edge repair of the mv is the assessment of clip attachment to the mv leaflets, which may be challenging using the 2d tee . In the everest i trial, single leaflet clip detachment occurred in 9% of the patients, demonstrating the need for new techniques that allow a more reliable assessment of clip attachment . Braun et al ., developed a novel method for the assessment of clip attachment using intraprocedural 3d tee . They tried to quantify exactly the portion of mv leaflets fixed into the clip by measuring the distance between the lowermost part of the leaflet and the top edge of the clip . They found that the frequency of clip complications (partial clip detachment or displacement) was higher in patients imaged by 2d tee compared to patients imaged by 3d tee . Hence, 3d imaging using volumetric analysis in addition to standard techniques may help to confirm a secure clip attachment during the mv clipping procedure . Rt3d tee data of 55 patients (14 patients with degenerative mvd) acquired during the mitraclip procedure immediately before and after clip placement have been recently published with the aim of assessing changes in annulus diameter and area . The results demonstrated that mitraclip can produce immediate reductions in ma size and tenting in functional mr . In contrast, similar changes were not observed in organic mr, and this different remodeling between the two etiologies of mr may be important to improve procedural strategies . Scandura et al ., demonstrated that the mitraclip system led to left cardiac chamber reverse remodeling, with significant improvement in lv size and function, similarly to what observed in surgical restoration, both in patients with prolapsed - related mr and functional mr . All these results support the importance of 3d imaging for pre - procedural patient selection and prediction of procedural effectiveness . Three - dimensional echocardiography represents a major technological breakthrough in the field of cardiovascular imaging, as it allows visualizing cardiac structures in their morphological complexity without the need for multiple acquisitions and mental reconstruction . During the past ten years a substantial body of literature has proven the potentials of 3d tee and tee in the evaluation of mv prolapse . Moreover, this imaging modality has not been limited to investigational studies, but several evidences have enlightened the benefits that 3d echocardiography can add to the daily clinical practice . Furthermore, 3d echocardiography plays a pivotal role in understanding the pathophysiology of mv disease, better defining surgical strategy, guiding percutaneous procedure and improving the communication inside the heart team.
Surgical resections such as unilateral temporal lobectomy and amygdalo - hippo - campectomy have an established place in the management of carefully selected patients with refractory localisation - related epilepsy . Adverse cognitive sequelae of epilepsy surgery have been well - recognised since the seminal report of scoville and milner in 1957 documenting the dense anterograde amnesia in patient h.m . Such amnesia has been observed on occasion following unilateral surgery, reflecting preoperative damage in the unoperated, contralateral, temporal lobe, a finding which mandates careful preoperative assessment of the non - operated hemisphere, for example using sodium amytal (wada) testing and/or functional neuroimaging, to try to ensure cognitive function is preserved post - operatively . We present a patient with refractory epilepsy who, following initially apparently successful unilateral temporal lobectomy, developed recurrent seizures and profound amnesia, and in whom subsequent investigations unexpectedly suggested an autoimmune aetiology . A 36-year - old right - handed female was referred to our centre for assessment of epileptic seizures and cognitive impairment . At the age of 33, she had undergone a right (non - dominant) temporal lobectomy for refractory complex partial seizures, performed at another neuroscience centre with an established epilepsy surgery programme . The patient's seizures began at the age of 15 years; there was no history of childhood febrile convulsions . Seizures were characterised by dj vu, absence, and automatisms, and were thought to arise in the right temporal lobe . Mr imaging appearances were equivocal, with right temporal lobe changes thought to represent either sclerosis or a possible dysplastic lesion . Because of the refractory nature of the seizures, pre - operative workup was undertaken, including fdg - pet which showed reduced uptake of tracer in the right temporal lobe . Intracranial eeg (subtemporal strips) confirmed complex partial seizures arising from the lateral right temporal cortex, but there also seemed to be subclinical events arising from the left side . A sodium amytal test performed prior to surgery confirmed that the patient was left - hemisphere dominant for language and that both hemispheres supported memory function . However, 34 months post - operatively the patient deteriorated with further frequent complex partial seizures . Additionally, she was noted to have symptoms suggestive of both anterograde and retrograde amnesia . By this time cognitive assessment included administration of cognitive screening instruments which showed impaired performance: on the mini - mental state examination (mmse), she scored 23/30; on the addenbrooke's cognitive examination - revised (ace - r), she scored 74/100, with 12/26 on the memory components; and on the montreal cognitive assessment, she scored 23/30 (normal 26/30). On the repeatable battery for the assessment of neuropsychological status (rbans), her delayed memory scores fell within the extremely low range . This impairment was for both verbal and visual material, with a subtle indication of slightly higher levels of delayed recall with visual information (list recall total score = 0; story recall total score = 1; figure recall total score = 2). Other domains assessed by the rbans showed the immediate memory to be in the borderline range, attention was low average, whilst language and visuospatial / constructional abilities were relatively preserved (table 1; left - hand column). In addition to the evidence of right temporal lobectomy, this also showed a high signal change in the left temporal lobe involving the hippocampus (fig . Serological testing revealed a very high titre of antibodies directed against glutamic acid decarboxylase (gad). In sum, these investigations suggested a diagnosis of anti - gad limbic encephalitis (le). Over the next 2 years, the patient was empirically treated with various immunomodulatory interventions including intravenous methylprednisolone, plasma exchange, and two infusions of rituximab, all without obvious clinical improvement in either seizures or cognitive function . Three years after surgery, prior to embarking on a treatment trial of intravenous immunoglobulin at our centre, the patient was still receiving polytherapy for epileptic seizures (levetiracetam, pregabalin, clonazepam, and lacosamide). On cognitive testing, she now scored 17/30 on the mmse and 63/100 on the ace - r with 8/26 on the memory components . Repeating the rbans, the cognitive profile was little changed, with the delayed memory score still being extremely low (table 1; right - hand column), again affecting both verbal and visual material, with the latter still at slightly higher levels (list recall total score = 2; story recall total score = 2; figure recall total score = 8). Behaviourally, she used external memory aids to record daily events since she had no recall of these after only a brief period of time . Antibodies to gad have been associated with various neurological syndromes, including stiff person syndrome, cerebellar ataxia, epilepsy, paraneoplastic syndromes (encephalomyelitis, cerebellar ataxia, and le), idiopathic le, and myasthenia gravis . From the epilepsy perspective, in a cohort of 253 epilepsy patients, liimatainen et al . Detected anti - gad antibodies in 15 patients (5.9 vs. 1.5% in 200 controls), most of them (90%) with temporal lobe epilepsy . In a study of patients with adult - onset (> 30 years) temporal lobe epilepsy, anti - gad antibodies were found in 5 out of 42, with evidence for pharmacoresistant epilepsy with associated memory impairment and other autoimmune diseases . Temporal lobe epilepsy with anti - gad antibodies may not therefore be a rare condition, especially amongst the treatment - refractory patients referred for surgical evaluation . The precise pathogenic sequence of events in our patient remains uncertain; a number of potential explanations exist . It is possible that she had two separate problems, namely mesial temporal sclerosis followed by adult - onset anti - gad antibody le . If this is so, it might be speculated whether her temporal lobectomy surgery might have unmasked epitopes which initiated an autoimmune response that produced anti - gad antibodies and hence le . Another possibility is that the entire syndrome was due to anti - gad le, albeit very long - lived . Defined non - paraneoplastic anti - gad le as a chronic non - remitting disorder, with antibody titres remaining high after intravenous methylprednisolone . Moreover, none of their patients became seizure free despite intense anti - epileptic drug therapy, unlike the situation in le associated with voltage - gated potassium channel (vgkc / lgi1) antibodies [10, 11]. Furthermore, cognitive impairments did not improve after treatment in anti - gad le . In this context, it is of note that the neuropathological examination of our patient's temporal lobectomy specimen found evidence of chronic inflammatory change consisting almost exclusively of t cells with associated microglial activation, suggesting a chronic encephalitic process in addition to hippocampal sclerosis . To date there is little information on the efficacy of intravenous immunoglobulin in anti - gad le . Response has been reported in new - onset focal epilepsy, but the chances of success must be doubtful in chronic epilepsy, as in our patient . This case may illustrate that autoimmune processes, rather than surgery, may cause bilateral hippocampal pathology resulting in profound amnesia, behaviourally akin to that seen in the classic amnesic patient h.m . [14, 15]. Following bilateral anterior temporal lobectomy for intractable seizures with partial hippocampal removal, h.m . Developed a profound anterograde amnesia for episodic autobiographical material but with preserved general intelligence, attention, working memory, language and perceptual skills . In contrast, the neuropsychological outcome following unilateral non - dominant hemisphere temporal lobectomy, as undergone by our patient, is usually confined to material - specific (i.e. Visual rather than verbal) memory impairments . We recommend that the possibility of anti - gad le needs to be considered in all patients with refractory epilepsy of presumed temporal lobe origin, including those being considered for epilepsy surgery, especially those whose clinical course is not typical for mesial temporal sclerosis.
However, cardiac metastasis is diagnosed in less than 1% of patients with malignant melanoma because less than 10% of these patients present with cardiac symptoms.1 - 3) identification of cardiac metastasis from melanoma usually means that the patient is suffering systemic metastasis . Unlike typical cardiac metastasized patients, we report a first case of a patient with a metastatic malignant melanoma in the heart without an identifiable primary source or additional metastasis in korea . A 59-year - old woman was admitted for cough and pleuritic chest pain with no history of malignancy or heart disease . Her initial blood pressure was 110/70 mm hg, pulse rate 70 beats / min, respiratory rate 20/min, and body temperature was 36.1. jugular veins were not distended . Laboratory studies, including a complete blood count, liver, and chemical profiles were in normal ranges . Chest computed tomography showed a large amount of pericardial effusion and a mass in the right atrium (ra) (fig . Transthoracic echocardiography showed a large mass measuring 4231 mm in the ra, which did not obstruct tricuspid valve flow . Effusion analysis showed a red blood cell count of 1.910/mm and a white blood cell count of 3300/mm (lymphocytes, 55%; neutrophils, 14%). Cardiac mri also revealed a large mass surrounding ascending aorta spread into transverse sinus and around pulmonary trunk (fig . Considering the risk of open heart surgery and poor prognosis of extensive cardiac metastasis, pericardial window operation and epicardial mass biopsy were performed to relieve symptoms and confirm the pathological diagnosis . Pathological analysis including immunohistochemistry revealed the final diagnosis to be malignant melanoma (fig . Positron emission tomography revealed no other distant organ metastasis except for heart and mediastinal lymph nodes . Malignant melanoma has aggressive biological behavior and the greatest tendency for metastasis to the heart.1) although autopsy studies reported an incidence of 50% to 71%, cardiac metastasis is diagnosed in less than 1% of patients with malignant melanoma because less than 10% of these patients present with cardiac symptoms.2) such metastases most frequently occur after multifocal hematological dissemination and may develop anywhere in the heart.3) melanotic metastases can invade the wall of any of the 4 cardiac chambers, and the ra is involved most frequently.4) the clinical signs and symptoms of cardiac metastasis are unclear and non - specific, although when present, the clinical signs and symptoms include fatigue, weakness, pericardial effusion, congestive heart failure, cardiac arrhythmia, superior vena cava syndrome, right ventricular outflow and inflow obstruction, and transient ischemic attack.5) however, patients with malignant melanoma who have cardiac metastases may present symptoms only caused by tumors in other organ systems . Although cardiac involvement occurs during the course of the disease, it is rare that the initial manifestation is cardiac metastasis . A tumor's anatomic location and extent of invasion determine the feasibility of surgical intervention, which should optimally be performed during the early stages of the disease.6) a complete resection of an intracardiac melanoma prevents potential morbidities that are associated with progressive intracardiac growth, such as superior vena cava syndrome, right ventricular outflow and inflow obstruction, dysrhythmia, cardiac tamponade, and heart failure.6) even when total resection is not possible, conservative surgery can relieve symptoms and prevent imminent cardiac failure . Conservative surgery improves the quality of a patient's life, as in our patient's case . Although more than 90% of melanomas have a cutaneous origin,7) melanomas may sometimes present metastatically in the absence of a primary lesion, termed melanomas of unknown primary origin . Most authors estimate that 2 - 6% of patients are diagnosed with metastatic melanoma of unknown primary site . In particular, such a metastatic melanoma in the heart such as in this patient without a known primary cutaneous origin is a rare presentation and chiefly an anecdotal finding of metastatic melanoma . Several reported cases can be found in the literature about cardiac involvement with cutaneous primary malignant melanoma and multiple metastasis in korea, as well as worldwide.8)9) as far as we know, malignant cardiac melanoma without a primary origin has not yet been reported in korea . The survival of patients with unknown primary melanoma was demonstrated to be similar to that of patients with known primary tumors when corresponding stages were compared.10 - 12) those patients with metastases to any other visceral sites are described to have a 1 year survival rate of 41% and a median survival of approximately 6 months.11)13)14) accordingly, we expected that the outcome of this patient might be very unfavorable . Although total resection was not possible because of extensive cardiac metastasis, a pericardial window operation could resolve her symptoms . After surgery, chemotherapy was planned, including cisplatin, dacarbazine, casmustine, and tamoxifen . However, the patient refused further chemotherapy after completion of two sessions . As only few reports about cardiac metastasis of malignant melanoma without cutaneous origin have been published, we are uncertain if conservative surgery is associated with prolonged survival and if the role of surgery for survival is worth further investigation.
Vitamin d deficiency (vdd) is defined as serum 25-hydroxy vitamin d (25ohd) levels <20 ng / ml . Vdd has been documented in more than 90% across all age groups and both sexes from india . Classical manifestations of vdd is described as rickets / osteomalacia, which manifest as bony deformity / pain, decreased bone mineral density (bmd), increased risk of fracture and is associated with raised alkaline phosphatase and parathormone (pth). However, secondary hyperparathyroidism (shpt) is observed in <50% of subjects in indian and us population . Subjects with same levels of serum 25ohd have varied clinical and biochemical abnormalities including some showing no abnormalities . This raises logical question do all subjects with vdd have clinical disease according to this definition? The main physiological function of vitamin d is maintenance of calcium homeostasis by its effect on calcium absorption and bone health in association with parathyroid gland . Calcium is absorbed actively in the duodenum through transcellular (active transport-80%) process, which is vitamin d dependent, whereas passive absorption is a paracellular (passive diffusion-20%) process, which occurs throughout intestine independent of vitamin d and is dependent on concentration of calcium in the intestinal tract . Total fraction of calcium absorbed from total intake can vary from 20 to 80% . In the event of decreased calcium availability from intake, calcium is released from bone under the effect of vitamin d - pth system to maintain its homeostasis . As per the recent institute of medicine (iom) statement the data currently suggest that fractional calcium absorption (fca) reaches a maximum between 12 and 20 ng / ml in both children and adults . In most of the studies reviewed by iom, the baseline serum 25ohd was> 10 ng / ml and there was no correlation of serum 25ohd levels with calcium absorption . When we have plotted mean basal serum 25ohd levels in various studies and mean fca, there was a significant inverse correlation (r = 0.75, p = 0.001). There is only one study among elderly that has assessed the relation of calcium absorption and base line serum 25ohd levels ranging from 4 to 20 ng / ml . This study has clearly shown that calcium absorption decreases in the ranges from 4 to 8 ng / ml and not> 8 ng / ml . Similarly, in the most studies related to vitamin d supplementation, basal serum 25ohd levels were> 8 ng / ml . Only one study carried out in subjects with 25ohd level of 4 ng / ml showed an increase of 21% with change in 25ohd level to 24 ng / ml, whereas in those with the increase in 25ohd level from 8 to 28 ng / ml only 3% increase of calcium absorption occurred . There is no correlation of mean change in fca (increase or decrease) with either mean basal serum 25ohd levels (r = 0.122, p = 0.754) or increment in serum 25ohd levels . These data clearly shows that the maximum calcium absorption capacity is reached when serum 25ohd levels are> 8 ng / ml . Logically to maintain calcium homeostasis in the face of vdd, the first body will try to absorb maximum available calcium, rather than affecting bone . Hence, calcium absorption is the first most important adaptive mechanism in patients with vdd . High fca (54 - 63%) has been reported from the region of china with low calcium intake (<500 mg) compared with 25 - 34% in us children with high intake of calcium (> 900 mg). This suggests that the body tries to adapt to the calcium availability to bodies requirement by adjusting fca . The conventional explanation of homeostasis is by systemic adaptation, in which decreased calcium intake results in decreased calcium absorption, which leads to increase in pth levels . The pth up regulates the 1- hydroxylase enzyme, leading to increase generation of 1,25-dihydroxyvitamin d (1,25(oh) 2d) levels and increased calcium absorption and bone resorption . However, as deduced from the above discussion, the body has a tremendous reserve to increase the fca in the face of decrease in calcium intake . This suggests that calcium absorption can be kept static over a wide range of calcium intake and serum 25ohd levels by local intestinal adaptation . We hypothesize that the first adaptive mechanism in calcium homeostasis is local rather than systemic . It consists of calcium sensing receptor (casr) on intestinal brush border, which senses calcium in intestinal cells and negatively affect vitamin d system in intestinal cells to decrease active transcellular calcium transport . It also facilitates passive paracellular diffusion of calcium in the intestine, which is less efficient process . On the contrary, when there is decreased calcium intake, this feedback inhibition is removed and vitamin d dependent active calcium absorption will increase, maintaining calcium homeostasis . Furthermore, there may be some genetic or epigenetic alteration in genes of 1- hydroxylase enzyme, which decreases efficiency of active vitamin d generation or vitamin d receptor (vdr) genotype affecting calcium absorption . In subjects with efficient vdr genotype for calcium absorption, local adaptation will be maintained at lower levels of serum 25ohd and vice versa will also be true . The interaction between casr and vitamin d system in intestinal cells (intestinal calcistat) will decide the level of serum 25ohd at which calcium absorption can be maintained according to the need of the body or becomes suboptimal in a given individual indicating failure of local adaptation . Firstly, decrease in calcium intake <250 mg, which cannot be overcome by increasing fca . This will manifest as calcium deficiency rickets on the face of normal vitamin d levels . Secondly, mutation in casr, if activating, may lead to decreased calcium absorption and if inactivating, increased calcium absorption . Thirdly, decreased supply of substrate below critical levels (serum 25ohd <8 ng / ml) will lead to vdd rickets . However, this level can vary according to interaction between casr and vitamin d system in an individual-intestinal calcistat . Finally, genetic mutation in 1- hydroxylase [vitamin d resistant rickets - i (vdrr - i)] or vdr (vdrr - ii) will also lead to failure of local adaptive response . This will also explain the observation in vdrr - i and ii, where high intake of calcium can overcome most of the clinical manifestation of the disease . With very high intake, casrs will get saturated and will enhance passive (paracellular) calcium absorption, which will be able to fulfill the requirement of body . With increasing severity of vdd, there will be decrease in calcium absorption . The calcium levels will now be maintained by bone resorption, rather than increasing calcium absorption, which is currently believed . Hence, generally held belief that increase in pth will increase calcium absorption through generation of active vitamin d metabolites, is wrong . This puts pth as a marker for systemic vdd or failure of local adaptation by the intestinal calcistat . The above hypothesis of the intestinal calcistat explains the vide variation observed in literature about relation between serum 25ohd, pth, calcium absorption and bmd . According to this hypothesis, subjects with low serum 25ohd who have normal intestinal calcistat will absorb required amount of calcium and will not mount systemic adaptive response in the form of increase in pth and 1,25(oh) 2d levels, hence will have lower 1,25(oh) 2d levels than those with failure of adaptation and bmd will not be affected . Subjects with adaptive failure will have higher 1,25(oh) 2d levels and will have lower bmd . This is further supported by observation that patients with similar low serum 25ohd levels (<10 ng / ml), bmd was lower in subjects with shpt . This will also explain the observation that about 50% of subjects with vdd do nt mount pth response because they have adequate local adaptation in intestinal calcistat . This will also explains that why there is no substantial increase in calcium absorption in with vitamin d supplementation because basal level of serum 25ohd is sufficient to supple enough substrate for generation of active vitamin d metabolites . This brings us to question that should we define vdd with a value of serum 25ohd in isolation? It is obvious from the above discussion that there are adaptive mechanisms to overcome low vitamin d levels, which can be operative over a wide range of serum 25ohd levels . Failure of adaptive mechanism will lead to clinical and biochemical evidence of vdd . Among them hence, the subjects with vdd defined by low vitamin d levels (<20 ng / ml or <30 ng / ml) according to the current definition with normal pth and bmd will not have any clinical and biochemical consequence of low vitamin d levels and vice versa subjects with similar levels of serum 25ohd with raised pth or low bmd are likely to be vdd . What should we call subjects with low serum 25ohd levels without evidence of shpt or low bmd? Should we call them subclinical vdd, compensated vdd, asymptomatic vdd or not call them vdd at all . Further studies are required to define adverse biological consequences of vdd in this group and effects of vitamin d supplementation and comparing them with the population who already had adverse biological effects of vdd.
The penn diabetes heart study (pdhs) is an ongoing, cross - sectional study of individuals with type 2 diabetes (aged 3575 years) without clinical evidence of cvd (myocardial infarction, coronary revascularization or angiographic disease, positive stress test, clinical peripheral arterial disease or peripheral arterial revascularization, stroke, or transient ischemic attack). The university of pennsylvania institutional review board approved the study protocol, and all subjects gave written informed consent (4). The ankle - brachial index (abi) was calculated by dividing the average of the ankle pressures by the highest brachial pressure . Participants with an abi> 1.4 (n = 13) reflecting noncompressible arteries were excluded (5). Each subject had the estimated glomerular filtration rate (egfr) calculated based on the abbreviated modification of diet in renal disease study equation (6). Plasma levels of fetuin - a (4.3 and 10.2%, respectively, intra - assay and inter - assay coefficient of variation) were measured by enzyme - linked immunosorbent assay (biovendor laboratory medicine, modrice, czech republic). High - sensitivity c - reactive protein (hscrp) was measured by immunoturbidimetric assay (wako, osaka, japan). Student's t test was used for normal continuous variables and the kruskal - wallis for nonnormal distributed variables . The association between a 1-sd change in fetuin - a and pad was examined using unadjusted and multivariable adjusted logistic regression models as described in table 1 . Analyses were performed on stata 10.0 software (stata, college station, tx). Association between fetuin - a and pad data are odds ratios (95% ci) and were obtained by logistic regression model . Model 2: model 1 + smoking, hypertension, hypercholesterolemia, metabolic syndrome, a1c, framingham risk score (%), and medications (ace inhibitors, aspirin, statins, insulin, metformin, sulfonylureas, and thiazolidinediones). The ankle - brachial index (abi) was calculated by dividing the average of the ankle pressures by the highest brachial pressure . Participants with an abi> 1.4 (n = 13) reflecting noncompressible arteries were excluded (5). Each subject had the estimated glomerular filtration rate (egfr) calculated based on the abbreviated modification of diet in renal disease study equation (6). Plasma levels of fetuin - a (4.3 and 10.2%, respectively, intra - assay and inter - assay coefficient of variation) were measured by enzyme - linked immunosorbent assay (biovendor laboratory medicine, modrice, czech republic). High - sensitivity c - reactive protein (hscrp) student's t test was used for normal continuous variables and the kruskal - wallis for nonnormal distributed variables . The association between a 1-sd change in fetuin - a and pad was examined using unadjusted and multivariable adjusted logistic regression models as described in table 1 . Analyses were performed on stata 10.0 software (stata, college station, tx). Association between fetuin - a and pad data are odds ratios (95% ci) and were obtained by logistic regression model . Model 2: model 1 + smoking, hypertension, hypercholesterolemia, metabolic syndrome, a1c, framingham risk score (%), and medications (ace inhibitors, aspirin, statins, insulin, metformin, sulfonylureas, and thiazolidinediones). Among 738 subjects in the study sample, pad prevalence was 5.1%, the mean age was 58.7 9.3 years, 37.1% were female, 63.2% were caucasians, and 32.1% were african americans . The median fetuin - a level was 292.4 ng / ml (interquartile range 115.5). Individuals with pad had a significantly lower fetuin - a level compared with individuals without pad (269.3 vs. 293.4, p <0.001). No significant differences were noted in other cardiovascular risk factors, metabolic syndrome, kidney function, inflammation, bmi, serum albumin (the only surrogate marker of liver function collected on the pdhs), or medication use . Fetuin - a levels decreased consistently (p for trend <0.02) across abi clinically relevant cut points (<0.7, 0.70.9, 0.91.1, and 1.11.4) (7) (see supplemental fig . 1 in the online appendix [available at http://care.diabetesjournals.org/cgi/content/full/dc09-1541/dc1]). The odds of pad were significantly increased for each sd decrease in fetuin - a (odds ratio 1.6 [95% ci 1.12.3], p = 0.001) and the association persisted in incremental models that adjusted fully for age, sex, race, kidney function, cardiovascular risk factors, medication use, and hscrp (1.6 [1.0582.5], p = 0.03) (table 1). A similar trend was noted among subjects with egfr> 80 ml min 1.73 m (1.9 [1.03.4], p = 0.05), suggesting that our findings were not confounded by the presence of moderate kidney disease . Finally, in a fully adjusted subgroup analysis, participants with hscrp levels <3 mg / dl (n = 460) had higher odds of pad (2.6 [1.45.0], p = 0.002), whereas subjects with high hscrp levels (3 mg / dl; n = 234) did not (0.82 [0.41.6], p = 0.59). Low levels of fetuin - a have been linked to medial arterial calcification and flow limiting aortic stenosis in humans (8,9). In this study, we demonstrate that lower levels of fetuin - a are associated with pad in subjects with type 2 diabetes . To our knowledge, this is the first study to report such a relationship in the absence of advanced kidney disease or prevalent cvd . Notably, in analysis stratified by the centers for disease control and prevention / american heart association defined hscrp risk strata (10), fetuin - a conferred increased odds of pad in subjects with hscrp <3 mg / dl and also in participants with interleukin (il)-6 levels below the median (data not shown). This is consistent with studies reporting an increased cvd risk mortality with fetuin - a deficiency independent of hscrp and il-6 (11) and points to a unique role for this negative acute - phase protein as a biomarker of pad beyond traditional and novel cardiovascular risk factors . Remarkably, animal models appear to track with our clinical observations . In mice lacking the fetuin - a gene, the aorta was found to be spared of calcification and fibrosis, whereas peripheral vessels in the skin and kidney showed evidence of extensive calcification (2), and the small artery involvement preceded the renal impairment (3). However, in the absence of direct imaging data, we are unable to define the type of vascular phenotype (intimal calcification or medial calcification) that account for the observed association . An abi of <0.9 is 95% sensitive and 99% specific for a stenotic lesion (> 50%) (12). Therefore, we assume that some degree of eccentric atherosclerotic calcification contributes to the association observed while acknowledging that multiple types of vascular calcification may coexist in type 2 diabetes (13). Nonalcoholic liver disease and other phenotypes related to insulin resistance, including type 2 diabetes (14), are associated with higher levels of fetuin - a (15). We controlled for most potential confounding factors and found no attenuation of the inverse association of fetuin - a with pad . In particular, because of this inverse relationship, a significant confounding effect was not expected by any condition associated with high fetuin - a levels . Finally, our study is limited by cross - sectional design, which limits causal inferences . In summary, low plasma fetuin - a levels are associated with pad in type 2 diabetes independent of traditional and contemporary risk factors . Our findings suggest a unique role for fetuin - a deficiency as a biomarker of pad in the setting of type 2 diabetes.
Collecting duct carcinoma (cdc) of the kidney is an unusual variant of renal cell carcinoma (rcc), accountings for less than 1% of all renal cancers . Cdc arises precisely from the principal cells lining distal collecting ducts of epithelium and distal renal tubules that originates from mesonephros . Considering that urothelial carcinoma originating from the ureter, pelvis, or calices also arises from the mesonephros, cdc might be similar to urothelial carcinoma and its radiologic and pathologic findings differ from those of other rccs . Recent publications have pointed out the histological heterogeneity of this neoplasm and its extensive histological overlapping with high grade papillary tumors and urothelial carcinoma . Accurate diagnosis is important for proper management . In diagnosis of cdc, it is important to distinguish between invasive papillary rcc and urothelial carcinoma . Positive immunohistochemical staining for distal tubules and collecting duct markers is helpful indiscrimination of cdc from the more commonly diagnosed clear cell rcc of proximal nephron origin . Cdc generally expresses broad spectrum keratins and high molecular weight (hmw) cytokeratin, which is expressed in the lower nephron and the urothelium . It also shows positive staining with e - cadherin, epithelial membrane antigen, cke12, and ck19 . However, cd10, c - kit, and a - methylacylcoa racemase (amacr) show no staining . In contrast, papillary rcc showed positive results for cd10 and amacr, and it appears to be different from cdc . However, this immunohistochemistry is not specific and may be seen in medullary carcinomas and in urothelial carcinoma, including those arising in the renal pelvis . Although the gross and microscopic features of the tumor are well established, diagnostic confusion can still occur . 40% of patients have already developed metastatic lesions, including lymphnodes, lungs, or adrenal glands . Clinical outcome is poor, with 66% of patients dying of the disease within two years after diagnosis . Various treatments have been proposed, including radiation therapy, immunotherapy, and some combinations of chemotherapy, however, results have been unsatisfactory . To date, no standard therapy for cdc has been established . The aim of this study is to conduct an investigation of the clinicopathologic findings of cdc and to determine their correlation with the disease status and prognosis . We retrospectively reviewed 35 patients diagnosed with cdc at eight korean medical centers from 1996 to 2009 . Data on gender, age, initial symptoms, and laboratory findings, including complete blood count profile, calcium, and urine analysis, pathological features, treatment, and patient outcome were obtained from patient medical records . Diagnosis of cdc was made by examination of a nephrectomy specimen in 27 cases and by renal biopsy in eight . Tumors were staged according to the 2002 american joint committee on cancer (ajcc) tnm stage classification . This study was approved by the institutional review board (irb) from each participating institution . Tumor response after treatment was re - evaluated using the response evaluation criteria in solid tumors (recist ver . Progression free survival (pfs) was estimated from the date treatment began to the date when disease progression was recognized, or the date of the last follow - up visit, or the date of death . Overall survival (os) was estimated from the date of diagnosis to the date of death from any cause or the last follow - up visit . The cox regression model was used for multivariate analysis with factors that had been used in univariate (log rank) analysis of os and pfs . P - values less than 0.05 were considered statistically significant and all p - values correspond to two - sided significance tests . The median age of patients was 56 years (range, 29 to 82 years) and 74% of the patients were male . Of 32 symptomatic patients, 16 and 11 experienced pain and gross hematuria . Other presenting symptoms included weight loss, microscopic hematuria, and a palpable mass . Seventeen patients had a tumor size of 7 cm or less, and 10 patients had a tumor size of 7 cm or greater . The median level of hemoglobin and calcium was 12.5 g / dl (range, 8.9 to 18.3 g / dl) and 9.30 g / dl (range, 7.9 to 11.1 g / dl), respectively . According to the immunohistochemistry finding, cdc expressed cytokeratin in nine patients (26%), hmw - cytokeratin in 14 (40%), low molecular weight - cytokeratin in three (8.6%), and cke12f in one (2.9%). It also expressed cd10 in five (14.3%) and vimentin in 11 (31.4%). At diagnosis, nine, two, four, and 19 patients had tnm stage i, ii, iii, and iv, respectively . Eight patients had two or more metastatic sites of the bone (44%), lungs (39%), liver (16%), and lymph nodes (11%) as the most common sites . With a median follow - up period of 15.8 months (range, 0.6 to 88.4 months), 14 (40%) deaths were reported . During the median follow - up period of 15.8 months, 14 patients died, while nine patients (25.7%) were lost in the follow - up . Twenty seven of the 35 patients underwent nephrectomy for initial treatment (curative surgery in 17, and palliative in 10), three patients received chemotherapy, and four patients did not receive any treatment (fig . Palliative chemotherapy was administered for 22 persons, who were composed of eight of 14 relapsed patients, eight of 10 patients who were in stage iv and underwent palliative surgery, and four patients who did not undergo an operation (fig . Median pfs and os for all patients were 5.8 months (95% confidence interval [ci], 3.5 to 9.2 months) and 54.4 months (95% ci, 0 to 109.2 months), respectively (figs . 2 and 3a). The os of the patients with stages i - iii was 69.9 months (95% ci, 54.0 to 85.8 months), while that of patients with stage iv was 8.6 months, which showed a statistical significant difference (p=0.01) (fig . 3b). In addition, among patients with stage iv, the os of patients who received a palliative treatment (immunotherapy, chemotherapy, or targeted therapy) was 18.4 months, which was higher than the os of patients without treatment of 4.5 months . The pfs of patients with stages i - iii was 6.9 months (95% ci, 1.3 to 12.4 months). Recurrence occurred in 14 patients, 82% of the 17 patients who underwent a curative surgery, and their average recurrence period was 5.9 months, with a short pfs and a high relapse rate . Using the log - rank method, no relationship was demonstrated between survival end points (pfs and os) and explanatory covariates, including patients' age, gender, and initial calcium level, except for hemoglobin (p=0.005 and p=0.193, respectively) and initial tnm stage (p=0.022 and p=0.002, respectively). Results of multivariate regression analysis using a cox's proportional hazards model showed that tnm stage (i - iii vs. iv; hazard ratio, 4.58; 95% ci, 1.301 to 16.135; p=0.018) was an independent prognostic factor for survival of cdc (table 3). The frequency of cdc is within 1% of the entire rcc and its radiologic and pathologic findings differ from those of other rccs . In 1976, mancilla - jimenez et al . Reported on 34 cases of papillary rcc and postulated a collecting duct origin for three of these tumors based on the findings of atypical hyperplastic changes in adjacent collecting tubules . This is the first report on cdc based on medical records from eight institutions in korea . In japan, a retrospective survey was conducted in order to analyze the nature of cdc . In the study, the central pathologists confirmed cdc in 81 of 120 cases diagnosed as cdc at 66 institutions . It was a large - scale nationwide survey with an advantage of a multi - institutional central review . On the other hand, in this study, 35 patients were selected from eight different organizations nationwide in korea . Although a pathological central review was not performed, there was significant detailed information on each case with the pattern of cases and treatment outcomes . Thus, based on such information, the results were evaluated with regard to the types of post operational treatment and the drugs used as palliative treatment and the responses . Our results are in agreement with those of previous reports showing that the median age was 56 years (range, 29 to 82 years) and that males comprised 74% of the patient population . In our study, cdc expressed cytokeratin, hmw - cytokeratin, and cke12 in many cases, however, it also expressed cd10 and vimentin, which is generally expressed in the upper nephron, and not in the lower nephron . Ninety - one percent of patients had symptoms and the most common presenting symptoms were pain, hematuria, and weight loss . At diagnosis, 19 (54%) patients were tnm stage iv, and the median os period of patients with stage iv was 9.29 months (95% ci, 0.0 to 26.78 months). A summary of the clinical data on cdc gathered from published series and case reports is shown in table 4 . Due to the rarity of its occurrence, optimal treatment for cdc has not been established . Despite past reports on striking responses to cytokines, currently, immunotherapy only has an historical role . Cdc might be distinct from conventional rcc and share embryological origins and biological features with urothelial carcinoma . Therefore, even if trials comparing immunotherapy with chemotherapy have not been conducted, chemotherapy currently represents the most used therapeutic approach . However, it remains unclear whether this carcinoma should be managed with a treatment similar to that for urothelial cell carcinoma or rcc . Multiple chemotherapeutic and/or immunotherapeutic regimens have been tried for treatment of cdc (table 4). These data appear to suggest that chemotherapy and immunotherapy may offer only limited benefits to a selected group of patients . In our study, surgical treatment was performed as the initial treatment in 77% of patients . However, recurrence occurred in most patients who underwent surgery and a palliative treatment was administered in 75% of patients . Most patients with advanced or recurrent disease were treated with immunotherapy, chemotherapy, radiation therapy, or targeted therapy . The most commonly used agents included interferon, gemcitabine, cisplatin / carboplatin, and sunitinib . It seems that patients with stages i - iii had a high relapse rate with a short pfs of 6.9 months, while seven patients (58%) with stages i - iii survived for a long time with patients in the no evidence of disease state, contributing to the increase of the os, so that there was a discrepancy between the pfs and the os . Most of the long - term survivors were in stages i - iii and those who received palliative treatment after a relapse, and the treatments administered to these patients included target therapy as well as immunotherapy and chemotherapy . Due to the small number of patients, the correlation between the prognosis and the treatment could not be known . However, it can be assumed that palliative treatment takes the role of extending survival . In paticular, the current standard therapy against rcc is the targeted therapy, and though it is recognized as a different disease from rcc, there were some cdc patients who were treated with sunitinib, temsirolimus, or other targeted agents, different from the past . According to an analysis of clinical aspects, treatment and prognosis in the records of seven cdc patients diagnosed with rcc in procopio's study and included in patients treated with the target therapy, five persons showed survival of four months while two patients showed long - term survival of 49 months and 19 months, respectively . In this study of the patients who were recently diagnosed and received a target therapy, one patient for whom sunitinib was used finally died, but showed a partial response during treatment . Cdc is an aggressive disease with poor prognosis, however, like some patients in this study who survived for a long period of time, a study on predictive markers by which the outcomes of prognosis and therapy, especially target therapy as well as their clinical features can be predicted is needed . Pfs and os were short, however, there were some long - term survivors, therefore, additional research on the predictive markers of several clinical, pathological differences and their treatments will be needed.
After approval by the institutional review board of the federal university of so paulo, brazil, 500 patients with dm from the diabetic foot outpatient clinic of orthopaedic department of the federal university of so paulo were enrolled in a prospective study to evaluate the results of minimally invasive surgery to treat forefoot ulcerations . Patients were included for surgery in the study if they had a history of dm type 2 for at least 5 years duration, decreased plantar sensation (detected with 10 g semmes weinstein monofilament), dorsiflexion range of motion of the ankle equal to or less than 10 measured via goniometer (fig . 1), palpable distal pulse, and history of forefoot ulceration healed with proper treatment (10, 11). Patients were excluded from surgery if they had an infected ulceration, dorsiflexion of the ankle greater than 10, and absent distal pulse on clinical examination . Fifty - two patients met the study criteria and the average age was 66.4 years . A modification of white's surgical technique was performed to address the equinus contracture with three hemisections of the achilles tendon, with specific configuration according to the clinical presentation of the hindfoot and ankle (10). The proximal and distal hemisections were made at the same side of the achilles tendon, and the intermediate cut was performed at the opposite side . A valgus hindfoot received proximal and distal hemisections at the lateral side of the tendon, whereas a varus hindfoot was addressed with medial side hemisections (fig . 2). The postoperative care included plaster short - leg cast immobilization to maintain maximal dorsiflexion . After 1 week, a total contact cast with full weight bearing as tolerated was applied for 6 weeks . Physical therapy was then initiated to maintain ankle position, calf strengthening, proprioceptive improvement, and gait training in an accommodative walking boot for an additional 6 weeks (8, 12). Fig, 2 . A modification of white's surgical technique was performed to address the equinus contracture with three hemisections of the achilles tendon, with specific configuration according to the clinical presentation of the hindfoot and ankle (10). The proximal and distal hemisections were made at the same side of the achilles tendon, and the intermediate cut was performed at the opposite side . A valgus hindfoot received proximal and distal hemisections at the lateral side of the tendon, whereas a varus hindfoot was addressed with medial side hemisections (fig . 2). The postoperative care included plaster short - leg cast immobilization to maintain maximal dorsiflexion . After 1 week, a total contact cast with full weight bearing as tolerated was applied for 6 weeks . Physical therapy was then initiated to maintain ankle position, calf strengthening, proprioceptive improvement, and gait training in an accommodative walking boot for an additional 6 weeks (8, 12). Fifty - two patients in the study underwent surgical treatment consisting of percutaneous achilles tendon lengthening through a modified white's technique to treat forefoot ulcerations . Forty - eight patients (92%) had no recurrence of ulcerations during the follow - up and demonstrated improved foot function . Follow - up was performed through a multidisciplinary team to maintain metabolic and glycemic control, provide education strategies to prevent recurrence of lesions, and also physical therapy for adequate function and protection . Patients with recurrent forefoot ulcerations (n=4 feet), which occurred in the same location as the original ulcer, also underwent a percutaneous distal metatarsal osteotomy (fig . 3) of the associated metatarsal and were permitted full weight bearing in a total contact cast for 4 weeks . Thereafter, walking boots and custom shoes were prescribed . During the study, none of the patients presented with infection, pain, or necrosis . Diabetes mellitus is a chronic disease with potential complications that are responsible for high rates of morbidity and mortality . The presence of plantar foot ulcerations in these patients increases the risk of infection, sepsis, and amputation . Early detection, multidisciplinary treatment, and education are critical for preventing any related lower extremity amputations . Our study demonstrated success in 92% of patients for prevention of recurrent forefoot ulceration in patients with ankle equinus, suggesting the usefulness of a minimally invasive approach for percutaneous lengthening of the achilles tendon in these patients . Dm can affect all components of the nervous system, including light touch sensation, motor control, pain recognition, proprioception, and autonomic function . Absence of protective sensation and the presence of foot deformities are the clinical factors with the highest correlation for the development of foot ulcerations and eventual lower extremity amputation (8, 1315). In fact, 85% of lower limb amputations are preceded by plantar ulcerations (16). Prevention and early treatment of these lesions can maintain satisfactory biomechanical and functional longevity of the lower extremity . Longer duration of dm is associated with the development of calf shortening due to structural changes, glycated collagen of tendon fibers, and the presence of peripheral sensory neuropathy, contributing strong risk factors for forefoot ulceration . Clinical and imaging assays demonstrate that these patients often present with heterogeneous patterns of tendon fibers and sometimes contain internal calcifications . Anatomic physiologic patterns show significant modification within the calcaneal tendon that becomes a solid tendon (12, 1719). As a consequence, patients present with limited range of motion of the ankle, physiologic loss of collagen elasticity, gait alterations, and inability of the foot to act as an energy absorber leading to elevated forefoot pressures (9, 18, 19). Diabetic prophylactic foot surgery plays an important role in establishing optimal biomechanical function as well as preventing and treating foot ulcerations (8, 11, 12, 17). Our study illustrates that percutaneous achilles tendon lengthening with a modification of white's original technique constitutes an important mechanism to restore appropriate range of motion to the ankle, improving gait quality, and preventing recurrent forefoot ulcerations . When necessary in cases of ulcer recurrence after achilles tendon lengthening, the percutaneous distal metatarsal osteotomy has been recommended (9). We believed that the ulcer recurrences were associated with anatomic disturbance of the involved metatarsal such as elongation and plantar flexion (9). This study also highlights successful treatment of forefoot ulcerations and prevention of recurrence during a follow - up period in a large cohort of subjects via a multidisciplinary team approach . Prophylactic surgery of the diabetic foot is a viable option in advanced treatment clinics to avoid foot complications and treat forefoot ulceration in diabetic patients . In an effort to reduce forefoot pressures and subsequently prevent ulcer recurrence, our study demonstrates an effective, reproducible surgical technique for percutaneous achilles tendon lengthening with good tolerance by patients, and minimal complications . The authors have not received any funding or benefits from industry to conduct this study.
A 40-year - old woman, 169 cm, 57 kg, underwent laparoscopic right adrenalectomy due to an adrenal pheochromocytoma . A 7.5 fr 3-lumen catheter was inserted under ultrasonographic guidance (linear probe: ust-5546, 5 - 10 mhz, machine: prosound ssd-4400, aloka medical, co., ltd ., tokyo, japan) into the right internal jugular vein, and lung sliding was confirmed in both thoraces . Next, the patient was placed into the left lateral decubitus position . Before incision, etco2, pmax, and peripheral oxygen saturation (spo2) pneumoperitoneum was established using co2, intraabdominal pressure was maintained <15 mmhg, and pmax was 23 cmh2o at the time . Thirty minutes after inducing pneumoperitoneum, the etco2 and pmax levels gradually increased to 43 mmhg and 30 cmh2o, respectively . However, the right side of the chest demonstrated no sounds . Immediately, the fraction of inspired oxygen (fio2) increased from 0.5 to 0.8, and the endotracheal tube was withdrawn back to 2 cm in order to rule out endobronchial intubation . Because the depth of the endotracheal tube was 18 cm at the incisor teeth and confirmed the depth of endotracheal tube by cuff palpation at the sternal notch, we supposed that it was enough to rule out one - lung intubation without using bronchoscope . Spo2 was maintained at between 98 - 100%, though the right thorax was still silent . 1a), however there was no sliding with barcode sign in the right lung (fig . 1b). Although the surgeon simultaneously inspected the diaphragm in detail, no apparent injuries or defects were found . Because the vital signs were stable and spo2 and etco2 were normal, as indicated by an increased fio2 and respiratory rate, the operation was laparoscopically completed . When the operation was concluded, a positive end - expiratory pressure (peep) of 5 cmh2o was applied to inflate the collapsed lung . The patient was examined using ultrasonography whilst in the supine position, and at the same time, portable chest radiography was called to assess a pneumothroax . The ultrasonographic probe was placed on the right lower lateral chest wall between anterior and mid axillary line (fig . 2), and we identified the " lung point " sign, which can be used to diagnose pneumothorax . Also, chest radiography indicated a <30% collapse of the right lung (fig . Auscultation of the right lung improved, as well as the appearance of lung sliding sign and the disappearance of the lung point sign in whole right hemithorax within about 30 minutes after the end of the operation . No hemodynamic instability was noted, and spo2 was maintained at 100% using only medical air . Hence, pneumthorax was considered to be capnothorax, and the patient was extubated without the insertion of a chest tube . The patient was transferred to the postanesthetic care unit (pacu) and did not complain about any respiratory disturbance . A 39-year - old man, 165 cm, 63 kg, was scheduled for living right donor nephrectomy via hand - assisted laparoscopic surgery (hals). The induction of anesthesia with thiopental sodium, fentanyl, vecuronium and desflurane was uneventful . After co2-pneumoperitoneum was induced, the intraabdominal pressure was maintained <14 mmhg, and etco2, pmax, and spo2 were 33 mmhg, 23 cmh2o and 100%, respectively . When the upper pole of the kidney was approached, the diaphragm was injured by the dissector, which was immediately repaired . The surgeon inquired about the status of the right lung because the right hemidiaphragm was bulging . The lung sounds in the right chest were decreased on auscultation, and etco2 and pmax were increased to 42 mmhg and 30 cmh2o, respectively ., we evaluated the right thorax using ultrasonography (linear probe: l25x, 6 - 12 mhz, machine: m - turbo system, sonosite inc ., bothell, wa, usa) in the operative field, and the " lung point " sign was found at the right lower anterior axillary line (fig ., a small amount of pneumothorax was expected . However, because the hemodynamic parameters were maintained in a normal range, the operation was continued via hals and a peep of 5 cmh2o was applied . At the end of the surgery, the surgeon requested a portable chest radiography and we concurrently examined the patient using ultrasonography in the supine position . 3b), and the range of the pneumothorax which was indicated by the lung point sign was gradually diminished . Because signs of cardiopulmonary instability were not found and spo2 was maintained without an increase in fio2, the insertion of a chest tube was not necessary and we safely extubated the endotracheal tube . The patient was transferred to the pacu and did not complain of any respiratory discomfort . A 40-year - old woman, 169 cm, 57 kg, underwent laparoscopic right adrenalectomy due to an adrenal pheochromocytoma . A 7.5 fr 3-lumen catheter was inserted under ultrasonographic guidance (linear probe: ust-5546, 5 - 10 mhz, machine: prosound ssd-4400, aloka medical, co., ltd ., tokyo, japan) into the right internal jugular vein, and lung sliding was confirmed in both thoraces . Next, the patient was placed into the left lateral decubitus position . Before incision, etco2, pmax, and peripheral oxygen saturation (spo2) pneumoperitoneum was established using co2, intraabdominal pressure was maintained <15 mmhg, and pmax was 23 cmh2o at the time . Thirty minutes after inducing pneumoperitoneum, the etco2 and pmax levels gradually increased to 43 mmhg and 30 cmh2o, respectively . However, the right side of the chest demonstrated no sounds . Immediately, the fraction of inspired oxygen (fio2) increased from 0.5 to 0.8, and the endotracheal tube was withdrawn back to 2 cm in order to rule out endobronchial intubation . Because the depth of the endotracheal tube was 18 cm at the incisor teeth and confirmed the depth of endotracheal tube by cuff palpation at the sternal notch, we supposed that it was enough to rule out one - lung intubation without using bronchoscope . Spo2 was maintained at between 98 - 100%, though the right thorax was still silent . 1a), however there was no sliding with barcode sign in the right lung (fig . 1b). Although the surgeon simultaneously inspected the diaphragm in detail, no apparent injuries or defects were found . Because the vital signs were stable and spo2 and etco2 were normal, as indicated by an increased fio2 and respiratory rate, the operation was laparoscopically completed . When the operation was concluded, a positive end - expiratory pressure (peep) of 5 cmh2o was applied to inflate the collapsed lung . The patient was examined using ultrasonography whilst in the supine position, and at the same time, portable chest radiography was called to assess a pneumothroax . The ultrasonographic probe was placed on the right lower lateral chest wall between anterior and mid axillary line (fig . 2), and we identified the " lung point " sign, which can be used to diagnose pneumothorax . Also, chest radiography indicated a <30% collapse of the right lung (fig . Auscultation of the right lung improved, as well as the appearance of lung sliding sign and the disappearance of the lung point sign in whole right hemithorax within about 30 minutes after the end of the operation . No hemodynamic instability was noted, and spo2 was maintained at 100% using only medical air . Hence, pneumthorax was considered to be capnothorax, and the patient was extubated without the insertion of a chest tube . The patient was transferred to the postanesthetic care unit (pacu) and did not complain about any respiratory disturbance . A 39-year - old man, 165 cm, 63 kg, was scheduled for living right donor nephrectomy via hand - assisted laparoscopic surgery (hals). The induction of anesthesia with thiopental sodium, fentanyl, vecuronium and desflurane was uneventful . After co2-pneumoperitoneum was induced, the intraabdominal pressure was maintained <14 mmhg, and etco2, pmax, and spo2 were 33 mmhg, 23 cmh2o and 100%, respectively . When the upper pole of the kidney was approached, the diaphragm was injured by the dissector, which was immediately repaired . The surgeon inquired about the status of the right lung because the right hemidiaphragm was bulging . The lung sounds in the right chest were decreased on auscultation, and etco2 and pmax were increased to 42 mmhg and 30 cmh2o, respectively ., we evaluated the right thorax using ultrasonography (linear probe: l25x, 6 - 12 mhz, machine: m - turbo system, sonosite inc ., bothell, wa, usa) in the operative field, and the " lung point " sign was found at the right lower anterior axillary line (fig . However, because the hemodynamic parameters were maintained in a normal range, the operation was continued via hals and a peep of 5 cmh2o was applied . At the end of the surgery, the surgeon requested a portable chest radiography and we concurrently examined the patient using ultrasonography in the supine position . 3b), and the range of the pneumothorax which was indicated by the lung point sign was gradually diminished . Because signs of cardiopulmonary instability were not found and spo2 was maintained without an increase in fio2, the insertion of a chest tube was not necessary and we safely extubated the endotracheal tube . The patient was transferred to the pacu and did not complain of any respiratory discomfort . Patients under general anesthesia may develop pneumothorax due to a variety of reasons, such as barotraumas, rupture of the lung bullae or needle insertion into the pleural cavity . Capnothorax due to co2 during laparoscopic surgery is rare, but, it has been described as a complication of almost every type of laparoscopic surgery [1 - 3,6 - 8]. It has been speculated that an abnormal diaphragm caused by congenital failure of fusion (e.g., sternal, costal, and lumbar portions), weak point (e.g., around the aorta, vena cava, and esophagus), congenital defects or iatrogenic injuries by the instrument can lead to capnothorax [1 - 3,6]. Because the creation of pneumoperitoneum and positional changes can demonstrate several potential physiological alterations, the accurate diagnosis of pneumothorax is more difficult during laparoscopic surgery than other surgical procedure . When pneumothorax is suspected, it is traditionally diagnosed by portable chest radiography in the operating room . However, chest radiography may take a considerable amount of time and demonstrates a sensitivity of 31.8 - 75.5% for the diagnosis of pneumothorax [10 - 12]. In many different fields, lung ultrasonography is often used to diagnose pathological conditions of the lung . In particular, ultrasonography has received attention as a very effective method for confirming pneumothorax at the bedside in the operating room . In numerous studies, ultrasonography has been reported as superior to conventional portable chest radiography for the detection of pneumothorax [4,10 - 13]. The presence or absence of characteristic ultrasonographic signs are key to a correct diagnosis, i.e., lung sliding, lung pulse, comet - tail artifact, barcode sign (stratosphere sign), seashore sign and lung point sign . Among these signs, however, the absence of lung sliding does not always indicate pneumothorax due to several mechanical factors (e.g., poor technique, inappropriate ultrasound probe frequency, the presence of dynamic noise filters) and the patient's affliction (e.g., main bronchial intubation, emphysema, atelectasis, pleural calcification, pleural adhesion, lung fibrosis). For these reasons, more specific ultrasonographic methods are needed to confirm pneumothorax . In a particular area of the thorax, the ultrasonographic patterns of pneumothorax and the normal lung alternatively appear depending on the respiratory cycle . This can be explained by a slight increase in pulmonary volume during inspiration and can be observed in two ultrasonographic modes: real - time (b - mode) and time - motion (m - mode). In b - mode, the lung point sign can be found by observing lung - sliding and absent of lung - sliding alternately at a same pleural line . Analogous patterns also can be found in m - mode . Seashore sign and barcode sign can be observed in turn, and these signs demonstrate the specificity of 100% for the diagnosis of pneumothorax . Furthermore, by serially observing the location of the sign, the extension of pneumothorax may be identified . Despite this wide spread practice, there are few studies about the relationship between the lung point sign and the extension of pneumothorax . When it moves to the lower lateral chest wall, the volume of pneumothorax expands and the patient may need to have a chest tube immediately inserted . On the other hand, movement of the sign from the lower lateral chest to the anterior chest indicates an improvement in pneumothorax (fig . 3). If capnothorax is highly suspected and cardiopulmonary instability is not severe, alteration of the " lung point " sign can be used to identify improvements in pneumothorax . In addition, for faster recovery of capnothorax, application of peep is supportive method to absorb co2 more readily from the pleural cavity . Therefore, a chest tube insertion, which can cause injury to other structures in the thorax, may not be necessary in these cases . In conclusion, the lung point sign may predict the range and amount of pneumothorax during laparoscopic surgery . Ultrasonography cannot only help to diagnose pneumothorax, but can also be used to decide treatment of pneumothorax . Most notably, in the case of capnothorax which resolves spontaneously as time goes on, the unnecessary insertion of a chest tube may be avoided by observing alterations in the lung point sign.
Imbalance of muscles around the knee can cause changes in the alignment of the knee joint1 . Therefore, to prevent knee injuries in females, improved muscle balance around the knee during dynamic motions such as landing and balanced strengthening of lower limb muscles are necessary . Kim et al.1 found kinematic differences in landing motions between male and female college students and reported that the valgus angles of females were more increased than those of males during a vertical landing motion . The decline squat exercise moves the line of gravity backwards and increases external momentum during extension in knee joints2; thus, the squat exercise on a decline board has had great effectiveness in reducing knee pain due to the selective strengthening of lower extremity muscles3 . This study investigated the effect of the single - leg, lateral oblique, decline squat exercise on sacroiliac (si) joint pain with knee pain . A 39-year - old female had severe pain in the right medial buttock and right anterior knee . She complained of continuous low back pain for 8 months, and examination revealed that her pelvis was tilted posteriorly . The patient was unable to sleep in the side - lying position due to the pain . The purpose and methods of the study were explained to the participant before her inclusion in the study, and she provided informed consent according to the principles of the declaration of helsinki . The pelvic inclination was measured with a palpation meter (palm; performance attainment associates, st . Paul, mn, usa) by one examiner . At the initial assessment, the anterior pelvic tilt angles were 3.5 and 6.5 on the right and left sides (normal range, 11 4), respectively . On palpation of the right medial buttock and right anterior patella, the visual analog scale (vas) scores were 7/10 and 6/10, respectively . The si joint pain provocation tests used in this study were the gaenslen test and patrick test . The single - leg, lateral oblique, decline squat exercise is performed with descent to 90 knee flexion, followed by ascent to the initial position at the individual s natural speed . This study assessed the anterior pelvic tilt angle and the response to pain provocation tests before and after 4 weeks of performing the exercise . Following the course of exercise, the anterior pelvic tilt angles were 8 and 10 on the right and left sides, respectively, and were higher than the initial values (3.5 and 6.5). On palpation of the right medial buttock and right knee, the initial vas scores of 7/10 and 6/10 decreased to 2/10 for both regions . The decline squat exercise induces anterior pelvic tilt as the trunk is pushed backward to compensate for the feeling of the trunk tilting forward2, 3 . The subject in the current study also experienced considerable reduction in lateral knee pain, due to decreased tension in the tensor fasciae latae or iliotibial band of the lateral knee . In particular, the pain in the si joint also subsided after the course of exercise . The decline board used for the single - leg, lateral oblique, decline squat exercise induced foot supination, which promoted ideal alignment of the hip and pelvis, preventing knee valgus . In addition, the single - leg position can activate muscles that provide pelvic stability more effectively than the two - leg position4 . Manual pelvic compression was demonstrated to be a compensatory strategy to enhance the force closure mechanism and thus normalize the altered motor responses5 . The stability of the si joint through form and/or force closure mechanisms was proposed to facilitate load transfer to the pelvis5 . Therefore, the single - leg, lateral oblique, decline squat exercise can be effective for treating si joint pain with knee pain caused by an abnormal quadriceps angle in females.
Stemming from the seminal work by cannon and selye, stress is defined as " an alteration in the body's hormonal and neuronal secretions caused by the central nervous system in response to a perceived threat " and a stressor is defined as " a change in an organism's internal or external environment which is perceived by the organism as threatening " [1 - 3]. Within this context, psychosocial stressors like social conflict, social isolation the most profound change that occurs with individual housing is an increase in aggression of males seen in both mice and rats following even relatively brief periods of individual housing . For example, in one study it was found that group size per se had limited long - term effects on pathophysiological measures of social stress, although it had a significant influence on many aspects of behavior when rats were first introduced into their groups . Over weeks 18, single housed rats continued to spend much more time apparently attempting to escape (sniffing and chewing at the bars and suddenly dashing around their cage) while those housed in groups spent more time sleeping and feeding . The objective of the present study was to examine whether social isolation in growing male rats affected 24-h variations of activity of the hypophysial gonadal axis . Indeed, stressors have been shown to modify gonadotropin and testosterone secretion, acute stressors activating and chronic stressors suppressing the activity of the hypophysial gonadal axis . It must be noted that, except for some exceptions, studies on the subject were performed at single time - points, generally in the morning, a serious drawback in view of the circadian nature of hormone release for most of the hormones considered . In this study we measured the daily pattern of plasma prolactin, luteinizing hormone (lh), follicle - stimulating hormone (fsh) and testosterone levels at 6 different time points within a 24-h cycle in growing male rats kept in isolation or group - caged for 30 days . Thirty five day - old male wistar rats were kept under standard conditions of controlled light (12:12 h light / dark schedule; lights on at 0800 h) and temperature (22 2c). Rats were either put in individual cages (isolated group) or left in cages of 45 animals each . All animals had free access to food and water for the 30 days of the study . The experiments were conducted in accordance with the guidelines of the international council for laboratory animal science (iclas). Groups of 68 rats were killed by decapitation under conditions of minimal stress, at six different time intervals every 4 h throughout a 24-h cycle starting at 0900 h. blood was collected from the trunk wound in heparinized tubes and was centrifuged at 1500 g for 15 min . The plasma was collected and stored at -20c until further analysis . Plasma prolactin, fsh and lh levels were measured by a homologous specific double antibody ria, using materials kindly supplied by the niddk's national hormone and pituitary program . Sensitivities of the rias were 45, 9 and 45 pg / ml for prolactin, fsh and lh using the niddk rat prolactin rp-3, rat fsh - rp-2 and rat lh - rp-3, respectively . Results were expressed as ng / ml for prolactin and as pg / ml for fsh and lh . Plasma testosterone levels were measured by using a commercial kit (icn pharmaceuticals, inc . Sensitivity of the assay was 0.2 ng / ml and the intraassay coefficient of variation was 5%, as previously described; results were expressed as ng testosterone / ml . Statistical analysis of results was performed by a two - way factorial analysis of variance (anova). Generally, the analysis included assessment of the group effect (i.e. The occurrence of differences in mean values between isolated and control rats), of time - of - day effects (the occurrence of daily changes) and of the interaction between the two factors (manipulation and time, from which inference about differences in timing and amplitude could be obtained). Post - hoc tukey - kramer's multiple comparisons tests were then employed to show which time points were significantly different within each experimental group to define existence of peaks . Figure 1 shows the levels of prolactin throughout the day in isolated and control rats . A factorial anova for main effects indicated a significant 74% decrease of circulating prolactin in isolated rats (f1,75= 75.9, p <0.00001) and the occurrence of significant time of day changes (f5,75= 18.8, p <0.00001). The maximum seen in control animals at the beginning of the activity span was no longer detected in isolated rats (fig . 1), as indicated both by a significant interaction between time of day and the experimental procedure in the factorial anova (f5,75= 9.23, p <0.00001) and by post - hoc tukey - kramer's tests (fig . 1). Effect of isolation on 24-h changes of plasma prolactin concentration in young male rats . Groups of 68 rats were killed by decapitation at 6 different time intervals throughout a 24 h cycle . Letters indicate the existence of significant differences between time points within each group after a tukey - kramer's multiple comparisons test, as follows: p <0.01 vs. 0900, 1300, 0100 and 0500 h. for further statistical analysis, see text . Globally, this manoeuvre augmented fsh levels by 64% (f1,79= 8.31, p <0.005, factorial anova) with absence of significant changes as a function of time of day (f= 1.95, p> 0.9). As shown in fig . 3, this pattern differed in the case of plasma lh levels, i.e. Isolation decreased circulating lh to 51% of controls (f1,78= 4.99, p <0.03, factorial anova) without any significant effect of time of day (f= 1.41, p> 0.2) (fig . No significant correlation between fsh and concentration values was found, high fsh and lh levels being distributed randomly among animals (results not shown). Groups of 68 rats were killed by decapitation at 6 different time intervals throughout a 24 h cycle . Groups of 68 rats were killed by decapitation at 6 different time intervals throughout a 24 h cycle . Isolation brought about a 34% decrease of plasma testosterone (factorial anova, f1,77= 58.8, p <0.00001). Significant effects of time of day (f5,77= 8.71, p <0.00001) and a significant interaction " time of day treatment " occurred (f5,77= 21.9, p <0.00001), i.e., the maximum in circulating testosterone took place at 1700 h in controls and at 2100 h in isolated rats and the decrease of plasma testosterone in isolated rats was seen only during the light phase of daily photoperiod (fig . 4). Effect of isolation on 24-h changes of plasma testosterone concentration in young male rats . Groups of 68 rats were killed by decapitation at 6 different time intervals throughout a 24 h cycle . Letters indicate the existence of significant differences between time points within each group after a tukey - kramer's multiple comparisons test, as follows: p <0.01 vs. all time points . For further statistical analysis, our results indicate that social isolation of young male rats for 30 days brings about changes in the 24-h variation of pituitary - testicular function . Overall, the secretion of prolactin, lh and testosterone decreased whereas that of fsh augmented in isolated rats . The maximum in prolactin seen in group - caged rats at the beginning of the activity span was not observed in isolated rats . In addition, the maximum in circulating testosterone taking place at the second part of rest span in controls was phase - delayed to light - dark transition in isolated rats . A decrease of plasma testosterone in isolated rats was seen only during the light phase of daily photoperiod . Solitary housing of usually social animals such as rats and mice causes complex neurobiological changes . Socially isolated animals exhibit a decrease in the electrical activity of neurons within the hypothalamus and have lower basal plasma corticosterone levels than do animals raised in social conditions . Although this could be interpreted as indicating less psychosocial stress in isolation, individual housing of animals is associated with an increase in aggression of males, hyperresponsiveness to several stressors and an increase in time spent attempting to escape and decrease in time spent sleeping and feeding . Decreases in plasma levels of prolactin were found in subordinate hamsters after exposure to social conflict and in isolated male hamsters as compared to hamsters with a family . Therefore, the decrease levels of plasma prolactin herein described after a 1-month isolation of growing male rats agrees with the reported modifications of prolactin seen in isolated hamsters . Prolactin is a versatile compound that has a dual function as a circulating hormone and as a cytokine . The prolactin receptor is a member of the cytokine receptor superfamily, linked to activation of signaling pathways that promote cell growth and survival . Through these mechanisms prolactin regulates diverse physiological functions via its effects on cellular processes such as proliferation, differentiation, and cell survival . In addition, prolactin may represent a peripheral regulatory factor for reproductive function in males, and/or a feedback mechanism that signals cns centers controlling sexual arousal and behavior . For example, studies on sexual hormonal response in males demonstrated that plasma prolactin concentrations are substantially increased for over 1 h following orgasm in men but unchanged following sexual arousal without orgasm . Evidence exists for a brain prolactin receptor - mediated anxiolytic action and for inhibitory actions on the reactivity of the hypothalamic - pituitary - adrenal axis and the neurohypophysial oxytocin system . Hyperprolactinemia in males induces hypogonadism by inhibiting gonadotropin - releasing hormone pulsatile secretion and, consequently, fsh, lh and testosterone release . This leads to spermatogenic arrest, impaired motility, and sperm quality and results in morphologic alterations of the testes similar to those observed in prepubertal testes . The present results on decreased prolactin levels in isolated male rats disagree with the previously reported increase in prolactin levels in a similar psychosocial stress paradigm . Some conditions of the experiments, like the age of rats, i.e., growing rats in this study vs. adult rats in the study by gambardella and colleagues, could explain this discrepancy . The changes in gonadotropin secretion found in isolated rats include a decrease of plasma lh and an increase of plasma fsh levels . The reduction in circulating lh was accompanied by a concomitant reduction of testosterone . Since fsh levels augmented in isolated rats, the possible decrease of testicular inhibin should be considered . Temporal organization is an important feature of biological systems and its main function is to facilitate adaptation of the organism to the environment . The daily variation of biological variables arises from an internal time - keeping system, and the major action of the environment is to synchronize this internal clock to a period of exactly 24 h. the light - dark cycle, food, ambient temperature, scents and social cues have been identified as environmental synchronizers or " zeitgebers " in rats . Stress is also capable of perturbing temporal organization by affecting the shape and amplitude of a rhythm or by modifying the intrinsic oscillatory mechanism itself . In particular, social stress in rodents has been found to cause disruptions of the body temperature, heart rate and locomotor activity rhythms [31 - 33]. Further experiments are needed to assess whether the changes in amplitude as well in timing of 24-h rhythms of prolactin and testosterone secretion seen in socially isolated rats can be attributed to an effect on the endogenous clock that modulates the circadian variation of pituitary testicular hormones or to a masking effect on some output(s) of the clock . Likewise, to what extent the differences between group- and single - housed rats in the plasma levels of the various hormones can affect reproduction or the immune response should be further explored . Our results concerning fsh plasma levels indicate that the increase in secretion induced by isolation is several fold larger than the daily variation in group - housed animals (fig . 2), which suggests that measurements of fsh secretion in isolated animals may misrepresent natural pituitary function in this species . Secretion of prolactin, lh and testosterone decreases, and secretion of fsh increases, in isolated rats . The maximum in prolactin seen in group - caged rats at the beginning of the activity span is not observed in isolated rats . The maximum in circulating testosterone taking place at the second part of the rest span in controls is phase - delayed to the light - dark transition in isolated rats . This work was supported by grants from dges, spain, fundacin rodrguez - pascual, spain, agencia nacional de promocin cientfica y tecnolgica, argentina (pict 6153), fundacin bunge y born, argentina and fundacin antorchas, argentina . The gift of the reagents to measure prolactin, lh and fsh levels by the niddk's national hormone and pituitary program and dr.
Punctate inner choroidopathy (pic) is an idiopathic disorder representing one point on a spectrum of the multifocal choroiditides . The visual outcome is good unless complicated by submacular choroidal neovascularization (cnv), which may occur bilaterally . Treatment options of cnv in pic include argon laser photocoagulation, local or systemic corticosteroids or other immunosuppressant agents, intravitreal anti - vegf agents, photodynamic therapy (pdt), and submacular surgery . In cnv cases with subfoveal involvement, argon laser photocoagulation has been associated with poor visual outcome . Before the introduction of anti - vascular endothelial growth factor (vegf) agents, surgical excision was the therapeutic option of last resort and only employed after conventional management with corticosteroids or pdt had failed . Various angiogenic factors have been implicated in the pathogenesis of cnv, with vegf putatively the key player . The advent of targeted pharmacologic inhibition of vegf has been a major advance in the management of cnv secondary to age - related macular degeneration (amd). There are no randomized clinical trials providing evidence for the efficacy of intravitreal anti - vegf agents in the treatment of cnv in conditions other than amd . Nevertheless, given their excellent safety profile, these agents are widely used in all subfoveal cnv cases regardless of etiology, including pic [2, 3]. It remains unclear why cnv responds in different ways to anti - vegf treatment . A multifactorial etiology of ocular angiogenesis, including inflammation and mediators other than vegf, as well as the different levels of vascular maturation of the neovascular complex, has been proposed . To date, there is no report of the surgical management and ultrastructural study of cnv secondary to choroiditis following intravitreal anti - vegf treatment . We report herein on the clinical outcome of bilateral surgical excisions of cnv in a pic case which failed anti - vegf treatment . Electron microscopic evaluation was performed on the excised specimens in an attempt to elucidate the pathogenesis of the condition and the possible mechanisms of treatment failure . The cnv regressed following one intravitreal bevacizumab injection with an improvement in vision to 20/25 . It recurred 17 months later with a decrease in vision to 20/40, and a second injection was administered with no response . Dilated fundus examination revealed small punctate yellowish chorioretinal lesions bilaterally consistent with choroiditis (fig . 1b, c). Optical coherence tomography (oct) revealed that the lesion was associated with adjacent intraretinal cystic spaces (fig . 2a, top).fig . A preoperative color photograph demonstrates multiple, small, yellowish punctate lesions at the level of the choroid . C late phase of the angiogram shows leakage from the cnv along with multiple punctate hyperfluorescent lesions in the peripapillary area and the periphery . D fundus photograph 1 month after surgical excision of cnv showing rpe atrophyfig . A (top) oct before surgical excision of cnv showing hyperreflective area at the level of the rpe corresponding to the cnv . C (bottom) oct 15 months after surgical excision of cnv right eye . A preoperative color photograph demonstrates multiple, small, yellowish punctate lesions at the level of the choroid . C late phase of the angiogram shows leakage from the cnv along with multiple punctate hyperfluorescent lesions in the peripapillary area and the periphery . D fundus photograph 1 month after surgical excision of cnv showing rpe atrophy right eye . A (top) oct before surgical excision of cnv showing hyperreflective area at the level of the rpe corresponding to the cnv . C (bottom) oct 15 months after surgical excision of cnv surgical removal of the cnv 3 months after the second injection led to improvement in vision to 20/20 - 1 with resolution of metamorphopsia (figs . There has been no recurrence at 23 months of follow - up after surgery . Cnv developed in the left eye 2 years after failed pharmacotherapy in the right eye . 3d) led to resolution of metamorphopsia and improvement of vision to 20/20 at a 3-month follow - up . Six months following surgery, visual acuity decreased to 20/63 - 2 secondary to recurrence . Informed consent was obtained from the patient regarding evaluating the surgical specimens obtained by light and electron microscopy.fig . A color fundus photograph 3 months after second injection of bevacizumab shows a grayish subfoveal cnv membrane . B early phase of the fluorescein angiogram reveals hyperfluorescence corresponding to the cnv lesion with hypofluorescent borders corresponding to the pigmented borders of the lesion . A color fundus photograph 3 months after second injection of bevacizumab shows a grayish subfoveal cnv membrane . B early phase of the fluorescein angiogram reveals hyperfluorescence corresponding to the cnv lesion with hypofluorescent borders corresponding to the pigmented borders of the lesion . The specimens obtained were evaluated by light microscopy in 1-m plastic sections stained with toluidine blue and by transmission electron microscopic examination of ultrathin sections prepared according to standard techniques (a mixture of 2.5% glutaraldehyde and 2% formaldehyde fixation buffered in 0.1 m cacodylate followed by 2% osmium fixation in an aqueous solution). The first specimen was obtained from the right eye 20 months after the introduction of anti - vegf therapy, 3 months after the most recent intravitreal bevacizumab injection . The light microscopic evaluation of epon sections revealed a hypocellular membrane featuring multiple widely separated capillaries in the midst of a fibrillar matrix without apparent inflammatory cells (fig . Some of the vessels contained erythrocytes, which were not detected in the extracellular space . At one edge of the membrane, 4a right submacular surgical specimen consists of collagen with many capillary channels (arrows), some of which have erythrocytes in their lumens (crossed arrows). Scattered pigment granules are observed, with a concentration of pigment epithelial cells (pe) toward the bottom left (toluidine blue, 200). B a nonfunctioning capillary exhibits attenuation and fragmentation of the endothelial (en) cell layer in the absence of pericytes . Note the persistence of erythrocytes (er) within the lumen, which is filled with microfilaments (f). H histiocyte, pe retinal pigment epithelial cell process, ma extracellular fibrocollagenous matrix (em 2,600). C a viable neovascular unit displays endothelium (e) with focal fenestrations (f) and elongated lumen (l). Both the endothelial cells and surrounding pericytes (p) are clothed by a basement membrane . The matrix (ma) is looser in this region and contains a macrophage (m) with complex phagolysosomes (v) and surface villi (vi). (em 5,800). D multilaminar membrane (m) from the left eye has formed above bruch s membrane (bm) and contains small neovascular units (arrows). (toluidine blue, 200) a right submacular surgical specimen consists of collagen with many capillary channels (arrows), some of which have erythrocytes in their lumens (crossed arrows). Scattered pigment granules are observed, with a concentration of pigment epithelial cells (pe) toward the bottom left (toluidine blue, 200). B a nonfunctioning capillary exhibits attenuation and fragmentation of the endothelial (en) cell layer in the absence of pericytes . Note the persistence of erythrocytes (er) within the lumen, which is filled with microfilaments (f). H histiocyte, pe retinal pigment epithelial cell process, ma extracellular fibrocollagenous matrix (em 2,600). C a viable neovascular unit displays endothelium (e) with focal fenestrations (f) and elongated lumen (l). Both the endothelial cells and surrounding pericytes (p) are clothed by a basement membrane . The matrix (ma) is looser in this region and contains a macrophage (m) with complex phagolysosomes (v) and surface villi (vi). D multilaminar membrane (m) from the left eye has formed above bruch s membrane (bm) and contains small neovascular units (arrows). (toluidine blue, 200) at the ultrastructural level, no photoreceptors or other retinal elements were detected . The predominant one contained occasional intraluminal erythrocytes but was for the most part occluded with microfibrils (fig . The second less common type of capillary had a well - defined pericytic layer; only one such capillary was identified in the specimen (fig . The pigment epithelial cell cluster exhibited a peculiar fine clumping of the nuclear chromatin and disruption of the plasmalemmas, presumably degenerative phenomena, causing the extracellular release of melanin granules . The membranous tissue excised from the left eye 5 months after initiation of therapy and 3 months after most recent intravitreal injection comprised the inner choroid with its choriocapillaris, bruch s membrane, and a vascularized subretinal multilaminar cellular membrane with many capillary - type units (fig . Epon - embedded, light microscopic sections, no break was detected in bruch s membrane that demonstrated a vascular channel connecting the choriocapillaris with the subretinal neovascular units . The inner choroid harbored a distinct focus of chronic inflammatory cells without follicular organization . By transmission electron microscopy, the pigment epithelium consisted of one or two layers at the center of the membrane with neovascular channels distributed among them in the absence of inflammation (fig . The rpe cells and neovascular channels in the middle of the lesion also interfaced with broad processes of mueller cells without the interposition of photoreceptors or their degenerative remains (fig . The mueller cells were characterized by multiform mitochondria, abundant profiles of smooth surfaced endoplasmic reticulum, and the absence of pigment granules . Poorly pigmented displaced rpe cells contained rare pigment granules, profiles of rough surfaced endoplasmic reticulum and manifested segments of basement membrane material and disorganized surface villi . Extravasated erythrocytes, macrophages, lymphocytes, and conspicuous extracellular matrix material were not found in the membrane, except for the last which was limited to the pericapillary zone . The viable neoformed intramembranous capillaries displayed patent lumens with endothelial cell fenestrae and uniformly enveloping pericytes, both ensheathed by basement membranes (fig . 5a in the left eye, above bruch s membrane (bm) with its elastic layer and subjacent choriocapillaris (ch), are two to three layers of pigment epithelial cells (pe) with loss of polarity . The pe cells interface with broad processes of mueller cells (mc) in the upper half of the field with myriad mitochondria . Inset: fenestrations (arrows) of the endothelial cells of the neoformed capillary and a thick surrounding basement membrane (bm) (em 1,950). C at the edge of the membrane, pigment epithelial cells (pe) with basement membrane (bm) are positioned on bruch s membrane (bm). Within the cytoplasm of the central pe cell is a degenerated compact whorled membranous body (arrow), another of which is also shown toward the right in the cytoplasm of an indeterminate cell (crossed arrow). The underlying choriocapillaris (cc) with its endothelial cells (e) is patent . A large melanophage (m) contains complex phagolysosomes (crossed arrows) of engulfed uveal melanin . E extravasated erythrocyte (em 1,450) a in the left eye, above bruch s membrane (bm) with its elastic layer and subjacent choriocapillaris (ch), are two to three layers of pigment epithelial cells (pe) with loss of polarity . The pe cells interface with broad processes of mueller cells (mc) in the upper half of the field with myriad mitochondria . Inset: fenestrations (arrows) of the endothelial cells of the neoformed capillary and a thick surrounding basement membrane (bm) (em 1,950). C at the edge of the membrane, pigment epithelial cells (pe) with basement membrane (bm) are positioned on bruch s membrane (bm). Within the cytoplasm of the central pe cell is a degenerated compact whorled membranous body (arrow), another of which is also shown toward the right in the cytoplasm of an indeterminate cell (crossed arrow). The underlying choriocapillaris (cc) with its endothelial cells (e) is patent . A large melanophage (m) contains complex phagolysosomes (crossed arrows) of engulfed uveal melanin . E extravasated erythrocyte (em 1,450) at the edge of the membrane, a single layer of dyspolar pigment epithelial cells without apical villi was surrounded by whorled membranous bodies of various sizes, some of which were engulfed by the rpe cells and others by macrophages (fig . The focus of inner choroidal inflammatory cells was composed of mature small lymphocytes with clumped chromatin and scant cytoplasm without intermixed histiocytes and plasma cells (fig . The choroidal melanocytes were focally damaged and had released their small pigment granules extracellularly, which had attracted melanophages (fig . This report documents for the first time the healing response following anti - vegf treatment of cnvs and highlights possible causes of treatment failure . We also analyzed the clinical and anatomical implications of surgical removal of cnvs following treatment failure of anti - vegf agents . There is one other report in the literature of excision of a cnv membrane following intravitreal injection of the anti - vegf agent bevacizumab, in which only avascular fibrous tissue was described pathologically . The submacular membranes removed from both eyes in our case had significantly different light and electron microscopic features . That from the right eye, which had been followed and treated over a span of 20 months prior to surgical excision (in comparison with 5 months for the left eye), was remarkably hypocellular and mainly composed of abundant fibrillocollagenous material . Apart from the presence of rare elongated processes of degenerating pigment epithelial cells or an occasional macrophage, lymphocytes and plasma cells were absent . A cluster of polygonal pigment epithelial cells at the membrane s base near bruch s membrane displayed disrupted plasmalemmas and a disturbed nuclear chromatin pattern of fine clumping compatible with incipient dissolution . The ability of the rpe cells to undergo fibrous and even osseous metaplasia is well recognized . The vascular endothelial cells of the membrane s capillaries were attenuated and fragmented, and their lumens were filled with microfibrils . Only one capillary appeared functional with healthier looking constituent cells that included fenestrated endothelial cells and well - preserved pericytes . In this zone, the surrounding extracellular matrix was looser, suggesting that such vessels were of more recent origin than the others and probably related to the recurrence . In contrast, the submacular membrane that was removed from the left eye 5 months after initiation of treatment displayed virtually no extracellular fibrillar matrix material . The obviously viable and intact vascular endothelial cells displayed fenestrae and were consistently surrounded by pericytes . The fenestrae support an origin of the neovascular units from the choriocapillaris, which normally possesses this feature . There was no evidence of a lymphohistiocytic inflammatory component accompanying the subretinal neovascularization throughout most of the membrane, as also described in a previous immunohistochemical study of cnv in pic ., however, reported moderate to prominent lymphocytic infiltration in four out of the six cnv specimens studied . The pigment epithelial cells in the left membrane remained for the most part confined to one or two layers at the base of the membrane and were in direct apposition to broad processes of mueller cells without the interposition of photoreceptors or their degenerative remnants . The latter were discovered at the borders of the membrane in the form of whorled lamellated membranous bodies probably representing degenerative products of outer segments . This finding suggests a primary degenerative mechanism rather than an infarction, which would have produced a more complete and broader effacement of cellular detail with a prominent inflammatory cell infiltrate . Finally, the fortuitous discovery of lymphocytes at the level of the inner choroid with sparing of the choriocapillaris lends, for the fist time, ultrastructural electron microscopic support to the hypothesis that pic is an inflammatory disease, with the inflammation originating in the choroid . There are no other em studies of tissue excised from a pic case that include choroid manifesting inflammatory infiltration . Thus, there was a striking difference in the response of the two submacular membranes to bevacizumab treatment . While different durations of the two membranes before their removal created concomitant differences in the amount of collagen deposition, the chief ultrastructural differential feature was the pronounced regression of the neoformed vessels in the right eye that lacked pericytes (in comparison with those in the left eye that possessed them). This phenomenon could be a primary feature of the neovascular units themselves or reflect a preferential secondary loss during the membrane s evolution or treatment . The well - preserved architecture of the endothelial - lined vascular channels with a normal accompaniment of pericytes in the left eye intimates that anti - vegf treatment had no effect on them . The finding of one capillary in the right specimen with fenestrated endothelial cells and well - preserved pericytes, while all other capillaries which were occluded manifested fragmented endothelial cells and lacked pericytes, may signify that it represented cnv nonresponsiveness to the most recent anti - vegf treatment 3 months prior to surgery . This is further supported by the fact that in this zone the surrounding extracellular matrix was looser, suggesting more recent origin and less deposition of collagen as explained above . The capillaries with fragmented endothelial cells most likely represent the regressed cnv treated with anti - vegf agents 20 months prior to surgery . Pericyte - poor neovascular units have been shown to be more susceptible to anti - vegf agents than pericyte - rich ones . We therefore hypothesize that failure to respond to anti - vegf treatment in the left eye of our patient may be associated with the uniform presence of a pericytic component in the neovascular channels . These observations indicate that the presence of pericytes may act as a survival factor for endothelial cells and therefore increase resistance to anti - vegf therapy . Context, dual vegf and platelet - derived growth factor - targeted therapy has been shown to be more effective in inhibiting in vivo tumor growth than either agent alone . Choroidal lymphocytic infiltration was found in the left subretinal excision which included a segment of choriocapillaris and surrounding inner choroidal tissue . This finding should not be totally unexpected despite the absence of overt clinical intraocular inflammation . None of the eyes had undergone prior surgery or photodynamic therapy that could have triggered inflammation . The presence of a focus of choroidal inflammation is also suggestive of the possibility that anti - vegf treatment of cnvs may fail because of underlying persistent inflammation . This provides another basis for considering a combination of therapeutic modalities in addition to anti - vegf factors to improve the efficacy of treatment in cnvs secondary to pic . This is the first report showing persistent choroidal inflammation after anti - vegf treatment that could possibly provoke recurrent cnvs, in contradistinction to inflammation in the membrane itself . Available data on treatment of cnv associated to pic are derived from small nonrandomized case series . Local and systemic treatment with steroids has not been proven effective in the treatment of cnv associated with pic, even when administered at high doses for many months [6, 10]. More recent small prospective studies of pdt in combination with either systemic steroids or 4 mg intravitreal triamcinolone of five and four eyes, respectively, showed decreased activity of cnv lesions [11, 12]. Three out of the four patients who received intravitreal triamcinolone experienced improvement of two or more lines of vision and one patient lost two or more lines at 1-year follow - up . We should, however, take into account the high rate of side effects of systemic or local corticosteroid treatment . Regarding the surgical management outcome of this case, prior anti - vegf treatment did not appear to complicate surgical excision . In our series of three submacular surgeries in two eyes, there were no adverse events peri- or postoperatively, but the number is too small for any definite conclusions . This high rate of recurrence in our series is in accord with the results of the submacular surgery trial (sst) trial in which recurrent cnv developed in 58% of surgically treated eyes by the 24-month examination . Recurrences occurred in four of six eyes with cnv associated with pic following surgical excision in the series reported by olsen et al . . Following reports from the sst trial for cnv that showed no benefit in preventing visual loss and a high rate of adverse events, submacular surgery has been virtually abandoned . Sst reported on both type i membranes, which grow below the rpe and are typically secondary to amd, and type ii membranes, which grow subretinally . Pic is one of the conditions, along with an idiopathic category, myopia, and presumed ocular histoplasmosis syndrome, that are complicated by type ii cnvs . The sst trial showed that surgical excision of cnv in pohs and idiopathic cases probably has a more favorable visual outcome in the subgroup of eyes with initial visual acuity 20/100 or worse . A successful outcome was defined as a visual acuity better, or no more than one line worse, than at baseline . As a result, a smaller benefit of surgery, such as reduction of risk of loss of three lines of vision, which many trials have been designed to detect, could not be confirmed . Also, 25% of patients were 60 years or older; results may be more favorable in a younger cohort of patients, as large case series have suggested . Still, submacular surgery carries significant risks and should be considered only in selected cases nonresponsive or nontolerant to other treatment modalities . In conclusion, this report provides evidence that inhibition of vegf alone cannot be relied upon to induce stable and lasting regression of subretinal neovascularization in pic . This is the first pathological study employing human tissue that points to pericytes as a potential critical target with the aggravating influence of inner choroidal chronic inflammation . This article is distributed under the terms of the creative commons attribution license which permits any use, distribution and reproduction in any medium, provided the original author(s) and source are credited.
Hemolysis, elevated liver enzymes, and low platelet count (hellp) syndrome is a severe manifestation of a hypertensive disorder of pregnancy called pre - eclampsia . It affects about 10% to 20% of patients with severe pre - eclampsia (0.5% to 0.9% of all pregnancies) and causes significant mortality and morbidity, which increases in accordance with the severity of this syndrome . This syndrome is associated with increased maternal risk of developing morbidities, including cerebrovascular complications, hemorrhage, pulmonary edema, retinal detachment, hematoma / hepatic rupture, acute renal failure, liver failure, intravascular coagulopathy, placental abruption, and sepsis [35]. Perinatal / infant morbidity and mortality rates are higher in pregnant women with hellp syndrome . The preterm delivery rate is about 70% in hellp syndrome patients with about 15% of cases requiring parturition before the 27 week of gestation . Sufferers may refrain from further pregnancies and need psychological support, and those who attempt further pregnancies have higher risk of gestational hypertension . Previously, immediate delivery was indicated for patients diagnosed with hellp syndrome, which often resulted in significant maternal and neonatal morbidity and/or mortality . Later it was recognized that antepartum administration of high - dose corticosteroids can stabilize the disease indicators and prolong the gestation . Although many studies have demonstrated that cort use helps raise the platelet count and reduce elevated liver enzymes, results are not consistent across all studies . Moreover, evidence regarding the role of corticosteroids in improving maternal morbidity and mortality is not clear . The present study, therefore, carried out a systematic review of the relevant studies and performed a meta - analysis of all related parameters for the sake of evaluating the efficacy of cort therapy observed in studies with controlled designs . Important features of the method used for the present study are summarized in table 1 . Several electronic databases were searched for the acquisition of required study reports by using the most relevant mesh and keywords in different logical combinations and phrases . The inclusion criterion was the studies examining the efficacy of cort therapy to treat hellp patients either in a prospective or retrospective controlled design. Some studies were, however, excluded by the following exclusion criteria (table 1). Important information including outcome measures and outcomes, dosage and mode of administration of cort, and obstetric and demographic characteristics were obtained from identified papers and organized on datasheets . Meta - analyses of mean difference and odds ratio were carried out under the random - effects model . Fifteen studies [1226] fulfilled were eligible and were included in the meta - analysis . Of the included studies, 8 were randomized controlled trials and 7 were retrospective analyses . The overall population of this meta - analysis is 675 cort treated and 787 control hellp patients . Age of the cort treated and control patients as mean sd (range) was 26.945.8 (23.2633.54) years and 26.355.7 (23.1630.93.3) years, respectively . Gestation duration was 32.273.7 (29.13.535.12.9) weeks in cort treated and 32.423.8 (27.63.335.52.6) weeks in control hellp patients . In the cort treated group, least asymmetry was visible from the visual inspection of the funnel plots, indicative of almost no publication bias in this area of research (figure 2). The mean difference [95% confidence interval] in the change from baseline between cort treated patients and controls was 38.08 [15.71, 60.45]10/l; p=0.0009 (figure 3). On the other hand, the mean differences in the changes from baseline between cort treated and controls were 0.44 [0.76, 0.12] iu / ml; p=0.007 for ldh (figure 4) and 143.34 [278.69, 7.99] iu / l; p=0.04 for alt . However, the decrease in ast levels was not statistically significant in cort - treated patients in comparison with controls (48.50 [114.32, 17.32] iu / l; p=0.15; table 2). Blood transfusion rate was significantly lower in cort - treated patients (odds ratio [95% ci]: 0.42 [0.24, 0.76]; p=0.004 . Hospital / icu stay was also significantly lower in cort - treated patients (mean difference: 1.79 [3.54, 0.05]; p=0.04). There was no significant difference between cort - treated and control patients in the incidence of cesarean deliveries (odds ratio [95% ci]: 1.25 [0.95, 1.63]; p=0.11), prevalence of infections (0.78 [0.19, 3.15]; p=0.73; table 2), birth weight (mean difference: 0.09 [0.11, 0.28]; p=0.38), infant respiratory distress incidence (odds ratio: 1.13 [0.50, 2.53]; p=0.78) and maternal mortality (odds ratio: 1.27 [0.45, 3.60]; p=0.65) (table 2). Among the included studies, infant mortality was 23% in cort - treated patients and 8.3% in controls and 4% in cort - treated patients and 0% in controls . Perinatal death was 0% in cort - treated patients and 3% in controls . Despite lower frequency of morbid conditions in hellp patients treated with cort (318 vs. 418), there was no significant difference in the incidence of overall morbidity between the groups (odds ratio: 0.79 [0.58, 1.08]; p=0.14). Morbid complications observed in 1 or more studies included pulmonary edema (3.6%), intraventricular hemorrhage (18%, disseminated intravascular coagulation (15%), endomyometritis (9%), ascites (13.3%), hematoma (3.3%), acute renal failure and other renal pathologies (14%, necrotizing colitis (12%, bronchopulmonary dysplasia (80%), intraventricular hematoma (20%), infant thrombocytopenia (13%), apgar score less than 7 (18%), and other hematological (36%), neurological (12%), and cardiopulmonary complications (33%). This meta - analysis of the studies with variable research designs revealed that in comparison with controls, cort therapy significantly improved the platelet count, ldh, and alt, as well as reducing ast levels non - significantly in patients with hellp syndrome . Moreover, blood transfusion rate and hospital / icu stay were significantly lower in cort - treated patients . However, there was no significant difference in the maternal mortality, overall morbidity, birth weight, or infant respiratory distress between cort - treated and control patients . Platelet count and serum ldh levels are reliable indicators of hellp severity, and recovery and longer recovery time is required for more severe cases . Corticosteroids are thought to prevent platelet consumption and erythrocyte destruction by stabilizing the vascular endothelium and effectually reducing blood product administration requirements . The recovery of platelets is reported to start as earlier as 12 hours after cort administration . The hellp syndrome, especially in the postpartum period, is associated with high maternal morbidity . Class 1 hellp syndrome patients are at higher risk of maternal mortality, and delay in the diagnosis worsens prognosis . Despite improvements in biological parameters of hellp syndrome, most of the studies reported that cort treatment does not reduce maternal morbidity . The present study also found no significant difference between cort - treated and control hellp patients in the incidence of overall morbidity in a meta - analysis of 8 studies presenting 15 morbid conditions . The morbid conditions observed in the present study were also reported by many studies not included in this meta - analysis . The morbidities not reported herein include abruptio placentae, retinal detachment, adult respiratory distress syndrome, and hypoxic ischemic encephalopathy . It is believed that an imbalance between proangiogenic and antiangiogenic factors and increased proinflammatory cytokines play an important role in women with preeclampsia and hellp syndrome . Higher circulating levels of anti - angiogenic proteins secreted by the placenta, such as soluble fms - like tyrosine kinase 1 (sflt1) and soluble endoglin, are found in preeclampsia patients . Dexamethasone has been demonstrated to significantly decrease sflt-1, soluble endoglin, il-6, and tnf- after 24 hours of treatment in hellp patients . These soluble factors are known to stimulate angiotensin ii receptor (at1-aa) production and increase endothelin 1, which are known to play a pathophysiological role in gestational hypertension . These findings suggest that targeting immunomodulators of hellp syndrome pathology may be a novel therapeutic research strategy . Management of hellp syndrome requires earlier diagnosis, mother - fetus status examination, stabilization of the indicators and symptoms, delivery at optimal time, and postpartum care in order to reduce maternal morbidity and mortality . A rather longer postpartum recovery period may be required for patients with progressively worsening hellp syndrome . Corticosteroid therapy is a cost - effective medication that can be administered via different routes and reduces the length of hospitalization as compared to other treatments, such as platelet transfusion . In the present study, on average, cort therapy reduced hospital / icu stay by about 3 days in comparison with controls and this difference was statistically significant in the meta - analysis of 7 studies . Thus, corticosteroids can be beneficial in carefully selected hellp patients without apparent adverse effects to mother or fetus / neonate . Firstly, studies with varying designs were included because none of a particular design could make sufficient data available . Secondly, clinical and methodological heterogeneity of the sample population in the form of factors such as the severity of hellp syndrome, time of cort administration, and dosage and duration of cort administration in recruited patients may have affected overall outcomes . Although, the random - effects model was used to interpret the results, but multi - center randomized controlled trials will be required for clarification of these results . Thirdly, the effect of some statistical procedures used to impute missing data may also have had a slight impact, as not all studies provided measures of dispersal values of the effect size of change in indicators following cort / placebo treatments . Corticosteroid administration to hellp patients improves platelet count and the serum levels of ldh, besides reducing hospital / icu stay and blood transfusion rate . However, these indices are not significantly associated with maternal mortality and overall morbidity prevalence.
During the last few years, dual - source high - pitch imaging has become increasingly important in the daily routine of radiology departments . In dual - source computed tomography (ct) imaging two sources means that two x - ray tubes are in use at an angle of approximately 90 degrees to each other . After introduction of the second generation dual - source ct, about four years ago, increasing pitch (pitch = table mm / n * t mm, where n = no . Of slices and t = slice thickness mm) values above the former traditional technical limit of 1.5 in a single - source ct, became possible . When high - pitch imaging is performed, one of the major advantages, compared to conventional single source normal pitch imaging, is the image acquisition time . In high - pitch imaging this makes high - pitch imaging the technique of choice, especially when regions of the body that are normally subject to motion artifacts have to be examined . Therefore, in clinical practice there are some major regions of interest where high - pitch imaging can demonstrate its advantages, such as, in imaging of the heart, the great thoracic vessels, and the lungs, in patients who have problems holding their breath . As our clinical experience in high - pitched imaging shows especially in non - electrocardiogram (ekg)-gated high - pitch imaging the amount of energy that can be applied may be limited by patient habitus . In high - pitch imaging of the lung, these energy factors are not relevant, but in imaging of the upper abdominal tract the maximum applicable energy may cause problems, leading to diagnostic issues . Therefore, the aim of this study was to examine the maximum current levels that can be used in dual - source high - pitch ct during imaging of the upper abdominal tract . An upper - abdominal phantom was placed on the ct table and no alterations were made to this experimental setup during all the ct examinations [figure 1]. This was followed by a series of high - pitch examinations, beginning with a pitch of 3.2 [table 1]. This value was reduced in steps of 0.2, with each successive test, ending at a pitch of 1.6 in the final examination [tables 2 and 3]. All investigations were carried out in the same scan range, once with a tube voltage of 120 kv, and once with 100 kv (modes 1 and 2, table 1). The tube charge in mas (= ma multiplied by the rotation time) was always adjusted to the maximum that the ct machine could perform at, without using the dose modulation software (care dose 4d), so that the exact tube maximum could be reached . To achieve the maximum current, the mas value one step downward from the level producing an error - message was chosen for the examinations, and this was taken as the maximum current that the ct machine was able to apply . Examination protocols high - pitch examinations at 100 kv high - pitch examinations at 120 kv the images obtained were reconstructed in a conventional filtered back - projection recon kernel b30, as frequently used for imaging soft tissue . The images were assessed in slices / increments of 5 mm/5 mm as transversal cross - sectional images . For further evaluation coronal and sagittal images in slices / increments of 2 mm/2 mm were reconstructed in the same manner . As objective measures of image quality of the examination series, several region - of - interest (roi) measurements, using the circle tool and a picture archiving and communication system (pacs) workstation (centricity 4.2, general electric healthcare, dornstadt, germany), were performed by a radiologist, who had four years of experience in ct . The mean attenuation values and standard deviation were recorded and displayed in hounsfield units (hu). The background noise (bn) was determined as the standard deviation of air measured in front of the phantom . The attenuation at different locations in the phantom were measured (liver parenchyma, liver metastases (hyper- and hypo - dense examples), muscle tissue, cutaneous fat tissue, cutaneous metastases (hyper- and hypodense examples), as also the air in front of the phantom). The roi measurements were drawn as large as possible, to include as much of the corresponding area of interest as feasible . To minimize bias from single measurements, we calculated the average of four measurements for each roi . On the basis of these measurements, the signal - to - noise ratio (snr) was determined according to the following equation: snr = attenuation / bn . To calculate the contrast - to - noise ratio (cnr)- value, we measured the attenuation and the hu and sd of attenuation of the surrounding muscle tissue (roi muscle) compared with the attenuation of the hyperdense subcutaneous lesions [figures 2 and 3]. Cnr was calculated as cnr = ((roi subclesion - roi muscle)/image noise). Images at different pitch values (100 kv, a = pitch 3.2; b = pitch 2.8, c = pitch 2.2; b30 kernel). Images at different pitch values (120 kv, a = pitch 3.2; b = pitch 2.8, c = pitch 2.2). Subjective image quality rating was conducted in a blind fashion by two independent radiologists, with three and four years of experience, respectively, in general ct imaging . The rating was done according to a five - point scale as follows: 1 = excellent / no artifacts, 2 = good / hardly any artifacts, 3 = moderate / few artifacts, 4 = fair / many artifacts, 5 = unacceptable . Exemplary: attenuation values, snr, cnr, subjective image quality score, dlp (dose length product) and ctdivol (computed tomography dose index). Analyses were performed using a dedicated software (bias 9.14, epsilon verlag, germany). A cohen's kappa analysis was performed to determine the interobserver agreement for subjective image quality scoring . As objective measures of image quality of the examination series, several region - of - interest (roi) measurements, using the circle tool and a picture archiving and communication system (pacs) workstation (centricity 4.2, general electric healthcare, dornstadt, germany), were performed by a radiologist, who had four years of experience in ct . The mean attenuation values and standard deviation were recorded and displayed in hounsfield units (hu). The background noise (bn) was determined as the standard deviation of air measured in front of the phantom . The attenuation at different locations in the phantom were measured (liver parenchyma, liver metastases (hyper- and hypo - dense examples), muscle tissue, cutaneous fat tissue, cutaneous metastases (hyper- and hypodense examples), as also the air in front of the phantom). The roi measurements were drawn as large as possible, to include as much of the corresponding area of interest as feasible . To minimize bias from single measurements on the basis of these measurements, the signal - to - noise ratio (snr) was determined according to the following equation: snr = attenuation / bn . To calculate the contrast - to - noise ratio (cnr)- value, we measured the attenuation and the hu and sd of attenuation of the surrounding muscle tissue (roi muscle) compared with the attenuation of the hyperdense subcutaneous lesions [figures 2 and 3]. . Images at different pitch values (100 kv, a = pitch 3.2; b = pitch 2.8, c = pitch 2.2; b30 kernel). Images at different pitch values (120 kv, a = pitch 3.2; b = pitch 2.8, c = pitch 2.2). Subjective image quality rating was conducted in a blind fashion by two independent radiologists, with three and four years of experience, respectively, in general ct imaging . The rating was done according to a five - point scale as follows: 1 = excellent / no artifacts, 2 = good / hardly any artifacts, 3 = moderate / few artifacts, 4 = fair / many artifacts, 5 = unacceptable . Exemplary: attenuation values, snr, cnr, subjective image quality score, dlp (dose length product) and ctdivol (computed tomography dose index). Analyses were performed using a dedicated software (bias 9.14, epsilon verlag, germany). For statistical comparison a cohen's kappa analysis was performed to determine the interobserver agreement for subjective image quality scoring . It became apparent that the maximum applicable energy, especially at increasing pitch levels, was limited . At a pitch factor of 3.2 it was possible to apply a maximum of 142 mas at 120 kv and 114 mas at 100 kv . All measurements were performed without the use of a dose modulating software (care dose 4d, siemens, forchheim, germany) to obtain a value for the maximum energy that the ct machine was able to deliver . As the applicable energy decreased, while increasing the pitch factor, the image noise increased . The snr and cnr values decreased, while the pitch factors increased [figures 4 and 5]. When discussing the increasing imaging noise, we should consider the reduction in image quality . As expected, in the subjective image analysis, we saw a near linear correlation between the increase in pitch factor and a corresponding decrease in the applicable energy, to decreasing image quality). The linear correlation did display a dip in the curve, and this dip occurred at a pitch factor of 2.8 [figure 6]. Therefore, performing examinations at a pitch factor of 2.8 resulted in a better image quality compared to the pitch values nearby . Thus, this remained an interesting point for future investigations, although we could not immediately envisage why at that particular pitch value the image quality was rated to be better compared to the other values . Therefore, there might be an advantage in conducting a study exploiting a more overlapping dataset . To reduce the image noise seen in high - pitch imaging, it had already been proved that iterative reconstruction algorithms had positive effects on image quality . In our study, we reconstructed the images in the b30 kernel (medium - smooth kernel), which were often used for abdominal imaging . With regard to the image noise, we calculated the snr, cnr, and additionally evaluated the image quality in grades from one to five, as explained above [figures 46]. The interobserver agreement was good, with a value of cohen's kappa of 0.8 . Subjective image quality at different pitch factors (quality rating scale from 1 to 5 = y - axis: 1 = excellent image quality, 5 = worst image quality). The red line represents the 100 kv group, the blue line represents the 120 kv group . The main result of our study was that the energy in dual source high - pitch mode was definitely limited . As shown in tables 2 and 3, the maximum applicable current that could be supplied by the machine, especially beyond a pitch of 3.0, had to be kept in mind when imaging at those pitch values . The scanner studied here was often working at its absolute limits; these limits were a result of the accelerated rotation time combined with fast table movement . Together, the time during which radiation was applied to the patient, and consequently the image acquisition time during which the detector was absorbing the x - rays, remained so brief that the tubes were often working at a current above 1000 ma . Therefore, when we tried to go beyond these limits, the scanner produced a malfunction message . Thus, this represented one major cause for the dose savings described in the recent literature . In a conventional single - source mode, a ct machine was able to deliver as much energy as was needed, and so gained a constant noise - level, and this could be adjusted using the dose - modulation software (such as care dose 4d). In high - pitch mode, the machine, at some point during examination of the patient, was not able to deliver the energy that was necessary and so a malfunction message was displayed, and as a result the examination had to be performed with under radiation in some areas of the body, resulting in less total radiation exposure . In our examination, we wanted to rule out the limits of the scanner, so we performed all our scans without the use of the dose - modulating software . The use of this software would have meant that we would have been unable to produce valid results and it would not have been possible to draw conclusions that would have been relevant to clinical practice from our results . This was on account of various patient features, especially the body mass index, as this was the major influential factor of the dose - modulation software, which adjusted the energy levels to keep the noise levels stable . When the dose - modulating software is used, the tube or the scanner can be adjusted to higher mas values, as we observed, and this is in agreement with the recent publications in the field of high - pitch imaging . However, even in the field of high - pitch imaging, when using the dose - modulating software, the energy is still limited . Naturally, determining these values by using the dose - modulation software is more complicated, because other influential factors have to be kept in mind (e.g., patient size, weight, and the region that will be examined). Overall, for the evaluation of the maximum applicable energy when using dose modulating software, further studies have to be performed, but in our view the study here may represent a first step . With respect to the image quality rating, looking at figure 6, there is a dip in the curve at pitch values between 2.6 and 2.8 . We cannot explain why at exactly these pitch values the image quality is rated better compared to the other values . Thus, it may be advantageous to conduct a study utilizing a more overlapping dataset . Performing examinations at a pitch factor between 2.6 and 2.8 resulted in an image quality nearly equal to a pitch factor of 2.2 . In recent times, many studies concerning high - pitched imaging have been published . Most of them focus on imaging of the heart and the vessels of the thorax . In some studies, the limitation of energy is described and the scanner is adjusted to values that the machine is able to perform, however, a controlled study for the maximum applicable energy has not yet been published . In our study we wanted to determine the limits of high - pitch imaging and the consequences for image quality . As the ongoing progress in a multi - slice ct enables us to use a more sophisticated ct scanner technology, one of the recent technologies uses wide detector arrays, up to 16 cm, to cover a wide area of the body with one rotation . However, this is a different approach when compared to a dual - source ct, because this remains a one - tube detector system, whereas, in a dual - source ct there are two tube - detector systems in use, at about 90-degree angles to each other . One limitation of our study was that we did not compare the use of the dose - modulating software with the dose modulating software mode when it was not used . However, our main goal was to show how much energy could be applied in a stable setting, and therefore, we performed our examinations without the dose modulation software . Of course, the energy levels when using the dose modulating software would be limited too . Another limitation of the ct scanner is the width of the second detector, which only covers 33 cm . Another limitation we show in our study is the maximum energy that can be applied to the patient . In a conventional single source mode, the maximum applicable energy is not generally a concern, because the scanner, depending on the rotation time, is normally able to deliver as much energy as is needed to examine the patient, irrespective of their height and weight . In high - pitch imaging one limitation of our study was that we did not compare the use of the dose - modulating software with the dose modulating software mode when it was not used . However, our main goal was to show how much energy could be applied in a stable setting, and therefore, we performed our examinations without the dose modulation software . Of course, the energy levels when using the dose modulating software would be limited too . Another limitation of the ct scanner is the width of the second detector, which only covers 33 cm . Another limitation we show in our study is the maximum energy that can be applied to the patient . In a conventional single source mode, the maximum applicable energy is not generally a concern, because the scanner, depending on the rotation time, is normally able to deliver as much energy as is needed to examine the patient, irrespective of their height and weight . In high - pitch imaging high - pitch imaging, in departments where a ct machine that is able to work in this mode is available, is already a standard examination tool for selected clinical indications . As the high - pitch mode is used more routinely, it becomes increasingly important to examine the limitations of high - pitch imaging . Therefore, in some cases, high - pitch imaging is a good solution for imaging patients, but in other cases, especially in abdominal imaging, it may be desirable to apply more energy than the ct is able to deliver . Altogether, not every clinical question can be answered in a way that it could be in conventional single source mode ct . The limited energy, as well as the detector width, have to be kept in mind when examining at high - pitch.
Inherited breast cancers are (pleiotropic) expressions of mutations in a number of distinct genes causing other cancers as well . To some extent, the biological function of the different genes is known, and to some extent the ways breast cancers are produced when this function is lacking, have been described . The cancers associated with different genetic syndromes occur at different ages, they may differ with respect to tumour characteristics, they have different prognosis, and they respond differently to prophylactic and treatment modalities . Following the clinical genetic work - up to provide health care to a woman possibly at risk for inherited breast cancer, there is a multistep approach . If she is demonstrated to be at risk, the preventive / treatment modalities she needs are a consequence of which subgroup of the inherited breast cancers she is at risk with . In most european countries, it is the understanding to discuss health care as what is to be offered to any woman who needs it . Thus, the question is not what might be done or what money possibly can buy - it is about what is reasonable and affordable . It is also about tradition and culture - what is possible in the current socio - ethical context . The first detailed scientific description of inherited breast - ovarian cancer was given by paul broca in 1866 . He demonstrated the transmission of the assumed underlying genetic defect, its expressions, the age - related and sex - limited penetrance, and the possibilities of modifying environmental and genetic factors . Not until 10 years ago, we learned that the syndrome is produced by brca1 mutations . Brca2 mutations produce breast cancers in a similar prevalence and at a similar age, but with completely different tumour characteristics and with a different set of associated cancers . A number of additional genes cause multiorgan cancer syndromes when mutated, including mutations in tp53, pten, atm and chek2 . Heterozygous state for atm mutation as a predisposition to breast cancer is debated, and the chek2 syndrome needs further evaluation . Some assume that there have to be more dominantly inherited breast cancer genes, others disagree and conclude that they may be recessive, low penetrant or multifactorially interacting, but not dominantly inherited with high penetrance . All cancer genetic clinics are aware that " inherited breast cancer " outside demonstrated brca mutation carrying syndromes may be a fiction, nevertheless all such clinics have defined a large volume of " inherited breast cancer " cases defined by family history but lacking demonstrated dna mutations and referred them to follow - up examinations . We have demonstrated a brca mutation in but a small fraction of our at - risk families, and we have excluded brca mutations in a number of large dominantly inherited breast cancer pedigrees . None of the models for probability calculations for recurrence risk of breast cancer in breast cancer kindreds are valid after a brca mutation have been excluded - they all assume that the patient is selected from an untested population . However, many cancer genetic centres continue to estimate the probability that a given woman is a mutation carrier, after she has been tested and found not to be so . This makes sense if you - as we do - believe there are more genes . Whatever we may believe, the calculations are wrong, because they cannot be interpreted without correcting the probability estimates for the testing performed prior to the calculations . Moreover, our activity of nesting up all the large mutation - carrying families will remove a substantial part of the mutation carriers from the population before the remaining familial clusters are referred to genetic counselling: for each passing day, the next familial cluster of breast cancer referred is less likely to harbour one of our founder brca1 mutations . . This may in principle be due to four factors: (1) selection biases, (2) improper algorithms to calculate penetrances, (3) true differences between the mutations examined and/or (4) environmental or genetic modifiers of penetrance . Because the first series obviously had selection biases and because many of the families were not tested (carrier status for relatives was assumed, calculated upon and thereafter presented as results), the methodological problems may have been major . Studies based upon testing rather than assuming carrier status, and studies employing sophisticated statistics to eliminate methodological problems, now agree that penetrance for breast cancer is high for all brca1 or brca2 truncating mutations . Breast and ovarian cancers are competitive causes of death in a brca1/2 mutation carrier, and both are caused by the same mutation . Estimating the penetrance of breast cancer (or ovarian cancer) implies the methodological problem of informed censoring: whatever you do is methodologically wrong, because you censor the data with an argument dependent on what you are examining . Because there is no universally " correct " method, the solution is to formulate explicit questions specifying the assumptions to the answers . If a figure for probability for a healthy mutation carrier to contract ovarian cancer is looked for, one must censor out all mutation carriers when they contract another (breast) cancer . Doing so, lifetime penetrance for ovarian cancer is high in brca1 mutation carriers, possibly as high as for breast cancer . Two of the reasons for the low penetrance for ovarian cancer in some studies may be the combined effect that the families were selected for by the presence of breast cancer, and the fact that you may not contract ovarian cancer after having died of breast cancer . In addition, there may be biological differences between different mutations in the same genes . The exercise of pooling a number of small families without excluding the index cases used to ascertain the families, with different mutations, without actually testing the relatives but assuming their carrier status, without specifying the questions addressed and how the data are censored to answer that question, may give results of low practical value . A statistical flaw has made some mistakenly conclude that brca1-associated cancers have prognosis similar to other breast cancers . The flaw is that according to oncological standards for randomized trials to evaluate effects of treatment modalities, the brca1 cancers have been compared to controls selected for similar prognostic tumour characteristics (oestrogen receptor, histopathological grade, etc . ). In this way, brca1 cancers have been matched with a subset of patients demonstrated to have bad prognostic signs (over - parameterization). The question of whether brca1 mutation carriers have even worse prognosis is debated, but all studies agree that brca1 cancers have worse prognosis than age - matched controls . Because a germline mutation is always prior to the tumour it causes possibly, the mathematical models are pertinent, but the way the results are presented may seduce the readers to conceptional misunderstandings . Brca1-associated breast cancers are, as a group, different from all other defined groups of breast cancers [6 - 8]. The picture is so clear that all exceptions may be sporadic cancers caused by different mechanisms in brca1 mutations carriers (age - related sporadic breast cancer may occur in brca1 mutation carriers as well). The brca1-associated breast cancers are hormone receptor negative, of histopathological high grade, and they are close to never appear as precancers (dcis) when diagnosed clinically or by mammography . Attempts of early diagnosis to achieve early treatment was initially considered successful: the tumours diagnosed were small and often without spread . It turned out, however, that the prognosis was not as good as hoped for according to the stage at diagnosis: retrospective series before any attempt on early diagnosis and treatment demonstrated 5-year survival of 63% for invasive brca1 cancers . The results of the biomed2 prospective series included a 5-year survival of 63% for invasive brca1 cancers, point estimate was no effect at all . Prophylactic mastectomy is an alternative, but with severe implications both on personal and professional ethical levels, and it is resource demanding . A new attempt on secondary prophylaxis has been implemented in most centres: mri obviously has the capability of demonstrating tumours invisible in mammography . We do not, however, at present know whether or not mri may diagnose the tumours before they have biologically achieved their bad prognostic propensities . We ask for time - out to retrieve this figure before we consider the alternatives . Early diagnosis and treatment to improve prognosis for inherited ovarian cancer was undertaken by ultrasound and cea125 in many centres . It did not work - no report claims substantial improvement in survival . Actually, there are few reports on survival, most reports mention cancer with spread at diagnosis but give no survival data . However, it became clear that brca1-associated ovarian cancer seldom occurs before the age of 40 . Combined with the finding that oophorectomy at that age reduced not only ovarian cancer risk by more than 90%, but also reduced breast cancer risk in brca1 mutation carriers - even in those using hormone replacement therapy - most centres advocate prophylactic oophorectomy past childbearing ages . In contrast to prophylactic mastectomy where uptake is low, the majority of postmenopausal brca1 carriers seem to choose oophorectomy . If a mean to early diagnosis and cure for ovarian cancer appears, we may soon have no brca1 carriers left to evaluate the effects, because there may not be many ovaries left in the mutation carriers aged over 40 years . Moreover, the disease is so lethal and prophylactic oophorectomy past childbearing ages seems to be so well tolerated, that it would be hard to suggest a trial . In contrast to the differences in breast cancer phenotype, ovarian cancer caused by brca2 seems similar to that caused by brca1, besides that the penetrance may be lower and disease onset later in brca2 carriers . One report concluded that oophorectomy in brca1 carriers contracting cancer improved the prognosis of the breast cancer . This observation needs to be supported by an independent series, but it is in keeping with the beneficial effect of prophylactic oophorectomy to breast cancer risk in the same group . Breast cancers in inherited / familial non - brca1/2 carriers have good prognosis (about 90% 5-year survival) inside early detection programmes applying annual clinical mammography . Moreover, a number of cases are demonstrated as precancers (dcis), and they have reportedly 100% event - free 5-year survival . Few studies have been presented on prospective survival in brca2-associated breast cancers, but these cancers seem to be comparable to sporadic breast cancers beside the young age of onset . There is no indication that the prognosis should be worse than that of non - brca1/2-associated breast cancers . Because all non - brca1 carriers (including the brca2 carriers) predominantly contract hormone receptor - positive breast cancers, they should theoretically benefit from receptor blocking agents (like tamoxifen) and oestrogen production blocking agents (aromatase inhibitors). Most agree that by now it would be reasonable to suggest such chemoprevention to these groups, but there is no agreement on which compound and exactly which group to address . It is advocated to give various regimens of such treatment under strict control to evaluate the effects . That is where we are today: trials and discussions, but no consensus on applying chemoprevention as standard health care . It may be expected that because as a group they have receptor - negative cancers, they should not respond either to oestrogen blockers or to oestrogen ., oophorectomy prevents breast cancer, tamoxifen prevents contralateral breast cancer, and oral contraceptives induce breast cancer . It seems, however, irrational to suggest oestrogen blockers to prevent oestrogen receptor - negative tumours . In oncology, the scientific standard is a randomized trial . As is evident from the reports (beside chemoprevention) mentioned above, we have no randomized trials . You cannot randomize a woman to mastectomy, and you cannot deprive a mutation - carrying woman from any potential life - saving health care available . We are faced with the challenge of doing science without randomized trials, and we cannot (as the mammographic screening of older women) go and get the families we want for research . This leaves us with series subjected to a number of ascertainment biases, and we should interpret the results with caution . Because we are outside the framework of randomized trials, we may be better off not discussing exact figures in single reports, but rather focus on the main results, methods employed and whether or not the empirical facts are in keeping with the current paradigms for understanding . In this perspective, it may seem that we need to reconsider our paradigms for brca1-associated breast cancer . For the other groups, early diagnosis and treatment works as expected, improving early diagnosis may hopefully further improve the results obtained so far, and the principles of chemoprevention may be projected from sporadic cancers . In conclusion to the facts discussed above, most clinical genetic centres relating to inherited breast cancer today advocate annual mammography from the age of 30 onwards to women at risk for inherited non - brca1 breast cancer . It is agreed that besides brca1 carriers, oestrogen blockers / aromatase inhibitors may be beneficial - but there is no agreement on exactly how to implement such chemoprevention . We are now hoping mri to be better to avoid large numbers of prophylactic mastectomies . We are confused by the data on the effect of hormones and hormone blockers in brca1 carriers, and we all hope for chemoprevention to make the unpleasant discussion of prophylactic surgery superfluous if early detection and treatment does not work . Early diagnosis does not work for ovarian cancers, but oophorectomy is beneficial and advocated at the end of childbearing ages . As is the case with most scientific reports, this contribution has focused on unsolved problems . We may remember, however, that we actually have about 90% 5-year survival of non - brca1 breast cancer with today's means, and the great majority of inherited breast cancers belong to this group . Prophylactic oophorectomy at the end of childbearing ages in brca1 carriers reduces morbidity and mortality by more than 50% . The systematic attempts to prevent and cure inherited breast cancer have been undertaken for but about 10 years . The results are actually good, which is reflected in the high compliance from the affected kindreds . The attempts to prevent and cure inherited breast cancer is an example of a consumer - driven activity based on knowledge and collaboration from the patients needing our care . Actually, based on knowledge two brca1 carriers with small invasive tumours without spread this year have asked me for immediate chemotherapy . Trials we cannot impose upon them, may soon be initiated by patients who want to know . The physicians and the researchers have the role of producing, filing, retrieving and communicating knowledge as appropriate . The choice what to do, however, should be the patient's choice, there are no scientific arguments as to whether or not to undergo prophylactic oophorectomy . As we all know, there are more arguments about what to do with your life than the doctors' suggestions . The high compliance to our advice during the last decade most probably reflects that the families have identified their problems long ago and were waiting for our care . The high compliance to genetic testing obviously reflects the opinion that our activity may prevent and cure . To maintain the high compliance it is our obligation, however, to ensure that the advocated options are actually available to each single patient . In addition, we may produce arguments to advocate some options because they have consequences to our liking . The suggestions in table 1 may be agreed by most, and some would go further and actively advocate prophylactic mastectomy in brca1 carriers and chemoprevention for the rest . Genetic counselling is to present information and options so that any given patient may be supported in exploring her values to make her choices . The challenge is to support the patients who make choices not corresponding with your own priorities . Primary and secondary prevention for women at risk for inherited breast or breast - ovarian cancer
The past 15 years have seen major advances in our understanding of severity assessment in community - acquired pneumonia (cap). Prognostic tools have been promoted to guide all major management decisions in cap, including admission to the critical care unit . Several recent studies, including the study by renaud and colleagues, have challenged us to re - evaluate how we consider severe cap, a concept for which there is still no universally accepted definition . Since the development of the pneumonia severity index in 1997, severe cap has been considered in terms of a patient's risk of 30-day mortality determined by a combination of age, co - morbidities and physiological parameters measured on admission . The two most widely used scores, the pneumonia severity index and the curb65 score, were developed to predict 30-day mortality . It is recognised that the majority of pneumonia mortality occurs in older people, however, and that many patients who die are treated palliatively . Nearly 50% of all deaths in patients with pneumonia and more than one - quarter of deaths within 30 days are related to co - morbidities rather than being directly pneumonia related . These scores therefore have important limitations arising from the use of 30-day mortality as an outcome . The scores may underestimate severity in young people and they perform less well when considering outcomes such as intensive care unit (icu) admission or requirement for mechanical ventilation or vasopressor support [7 - 9]. As few as 20% of patients in the highest pneumonia severity index class (class v) require icu admission, illustrating the system's limited value for the critical care community . There is a growing consensus that icu admission and, more specifically, mechanical ventilation or vasopressor support are more useful outcomes than 30-day mortality to define severe cap and to identify the most acute ill patients [7,10 - 12]. The requirement for mechanical ventilation or vaso - pressor support is preferred to simply using icu admission, as evidence suggests that icu admission rates and criteria vary widely across different healthcare systems . This helps to explain why we see icu admission rates of 17% in spain compared with 8.7% in the uk or 4% in hong kong . The revised british thoracic society cap guidelines are due to be published in 2009 and will recommend using the curb65 criteria to determine icu admission . The infectious disease society of america american thoracic society guidelines recommend the revised american thoracic society criteria, which comprise two major criteria (the requirement for mechanical ventilation and vasopressor support) or three minor criteria (comprising respiratory rate, pao2/fio2 ratio, multilobar infiltrates, confusion, uraemia, leucopenia, thrombocytopenia, hypothermia and hypotension requiring aggressive fluid resuscitation). Alongside these criteria, renaud and colleagues, charles and colleagues and espana and colleagues it is reassuring that the high - risk features identified in each of these studies are similar, with acidosis, systolic blood pressure, respiratory rate, uraemia, confusion, hypoxaemia and multilobar infiltrates featuring in each of the derived scores . The abundance of severity criteria, however, reveals the lack of consensus over which patients should be initially managed in the icu . Delayed transfer to the icu is associated with increased mortality, and therefore early recognition of these patients is important . The risk of early admission to intensive care unit score has been shown to predict patients with delayed admission to the icu . This group probably consists of patients in whom severity was underestimated on admission, of patients with treatment failure and of patients with unstable co - morbidities and nosocomial superinfection . All of the new scores are complex, making them difficult to implement in clinical practice . Evidence suggests that current severity criteria, such as the curb65 score, are under - utilised . It may therefore be impractical to expect staff to use the curb65 score to decide on the site of care, then use smart - cop or the american thoracic society criteria to decide whether a patient requires icu care, and then use the risk of early admission to intensive care unit score to assess their risk of requiring icu subsequently . A perfect scoring system may not exist, but it should ideally predict both 30-day mortality and the requirement for mechanical ventilation or vasopressor support . The scoring system should be simple, composed of the fewest possible factors, and easy to remember in a busy emergency department . The system should function equally well in older patients and young patients, and should be based on physiological derangement and organ dysfunction rather than on age or co - morbidities . The hope is that future studies can identify physiological scoring systems or biomarkers that can achieve these goals and provide an effective adjunct to clinical judgement in the early management of cap . Cap: community - acquired pneumonia; curb65: confusion, urea> 7 mmol / l, respiratory rate 30/min, blood pressure <90 mmhg systolic and/or diastolic blood pressure 60 mmhg, and age 65 years; icu: intensive care unit; smart - cop: systolic blood pressure, multilobar chest radiograph involvement, albumin, respiratory rate, tachycardia, confusion, oxygenation and arterial ph.
Stroke is still a major cause of death and long - term disability worldwide and it is associated with significant clinical and socioeconomical problems . Despite the continuous efforts to develop the new pharmacological strategies, there is no effective neuroprotective therapy so far for ischemic stroke . Novel approaches are needed to improve the recovery and quality of life of stroke patients . Development of tissue damage after ischemic insult is dependent not only on duration and intensity of the blood flow reduction, but also on flow independent mechanisms, especially in the peri - infarct brain area . The blood flow dependent mechanisms of tissue damage develop in brain ischemic focus in the short time after onset of blood flow reduction . At that time cell death is a consequence of the acute energy failure and permanent anoxic cells depolarization is induced by loss of ionic gradients . A few hours later, the infarct expands into the adjacent penumbra, and cellular damage is mainly triggered by excitotoxicity, mitochondrial disturbances, reactive oxygen species production, and programmed cell death [1, 2]. Excitotoxicity is a pathologic process based on massive activation of ampa and nmda receptors in the brain . Inappropriate activation of ampa and nmda receptors is a trigger for subsequent dysregulation of calcium ions homeostasis in the neurons and finally results in neuronal loss . Massive activation of those receptors is observed in many cns disorders including stroke, epilepsy, multiple sclerosis, amyotrophic lateral sclerosis, parkinson, alzheimer, and huntington diseases . The most important factor leading to ampa and nmda upregulation is glutamate . Glutamate is an important neurotransmitter in physiological concentration, but in pathologically high concentration it is neurotoxic [35]. Lately, it is suggested that stroke triggers immune responses leading to inflammatory cell activation and infiltration of cerebral parenchyma . In the stroke brain upregulation of a variety of cytotoxic agents like cytokines, matrix metalloproteinases (mmps), nitric oxide (no), and more ros can be detected [68]. There is also upregulation of expression of some chemokines like ccl2 in the csf [9, 10] and serum of patients with stroke . Studies in experimental stroke (middle cerebral artery occlusion model (mcao)) confirmed involvement of chemokine ccl2 and its receptors ccr2 in stroke development . Reported no difference in the level of ccl5 but montecucco and colleagues detected increased expression of plasma ccl5 in symptomatic as compared with asymptomatic patients . Moreover, canou - poitrine confirmed that, higher systemic levels of ccl5 and cxcl10 in asymptomatic men are independent predictors of ischemic stroke . There is also a recent report from tokami et al . Supporting the concept that ccl5 may be neuroprotective during stroke development . They showed upregulation of ccl5 but not ccl2, ccl3, and ccl4 on day 0 in stroke patients . This upregulation correlated with plasma concentrations of neuroprotective factors bdnf, egf, and vegf . Other data from mcao model also showed upregulation of several chemokines and their receptors including ccl7, cxcl10, ccl20, and chemokine receptors cxcr4 and ccr6 . Et-1 induced model of stroke has been previously described by anthony et al . Who induced the acute rat cerebral blood volume changes after intravenous and intracranial injections of this vasoconstrictor [21, 22]. After microinjection of et-1 into selected brain regions they observed using magnetic resonance imaging (mri) an acute reduction of local perfusion in the injected hemisphere, loss of neurons in the grey matter and a macrophage / microglia and astrocyte response . After injection of et-1 into the cortical white matter, those authors observed amyloid precursor protein - positive immunostaining (indicative of axonal disruption) and an increase in tau-1 immunostaining in oligodendrocytes . Similar to the grey matter lesions, no neutrophils were present and macrophage / microglia response did not occur . Additionally, no breakdown in the blood - brain barrier was detected in the white and grey matter . In this study expression of several chemokines including: ccl2, ccl3, ccl5, and cxcl2 as well as expression of markers of neuroinflammation like cd3, f4/80, and il-1 beta was studied . Correlation of this expression with intensity of early neurodegeneration detected in the brain during the et-1 induced model of stroke was also analyzed . In all experiments, 8- to 12-week - old female sjl / j mice (n = five for each time point) were used . All animals were housed at the animal facility of the medical university of lodz, lodz, poland, under standard conditions . All experiments in this study have been approved by the local ethics committee for affairs experiments on animals . Animal stroke model was induced by stereotactic, intracerebral injection of endothelin-1 (et-1, sigma - aldrich, poznan, poland,) (20 pmol in 1 l of pbs per mouse) into the left hemisphere of the brain . Prior injection mice were anaesthetized with mixture of ketamine (1,15 mg, biowet, pulawy, poland) and ksylazine (0,1 mg, biowet, pulawy, poland) per mouse . After complete anaesthetization mice were placed in stereotactic frame (david kopf instruments, ca, usa), skin on the head was cut, and a small hole in the skull was made using surgical drill . Et-1 was administered with a hamilton syringe (32 g needle) (hamilton company, bonaduz, gr, switzerland). Site of injection (a-2 mm, l-1, 2 mm, d-2, 5 mm) was selected using the stereotactic atlas tissue samples were collected 24 and 72 hours after the model induction . As a controls, brains from uninjected mice and from mice injected in the same way with pbs were used . To obtain rna animals, were perfused with a saline solution . Tissues were weighed and then homogenized using a mechanical homogenizer ultra turrax (ika, staufen, germany). Tissues were homogenized in a volume of 1ml of trizol ls reagent (gibco brl, invitrogen, carlsbad, ca, usa). Rna was isolated from the homogenates with trizol ls reagent using phenol - chloroform method described by chomczynski and sacchi (chomczynski and sacchi, 1987). After rna isolation, its concentration was estimated using the photometric method (biophotometr plus, eppendorf company, wien, austria). To obtain the proteins for the elisa assay harvested organs were weighed using a laboratory balance (radwag radom, poland) and homogenized using a mechanical homogenizer ultra turrax (ika). Homogenisation was performed in a volume of 1 ml hepes buffer ph 7.4 containing: hepes 20 mm; edta 1.5 mm; benzamidyn 0.5 mm; chicken egg owoinhibitor 10 ug / ml pmsf (phenylmetylsulfonyl fluoride) 0.1 mm (sigma - aldrich, poznan, poland). Supernatants were obtained after centrifugation (20 000 g, time 30 minutes at 4c mpw, warsaw, poland). Analysis of the rna expression was performed using the corbett real - time pcr machine rotor gene 3000 apparatus (corbett research, sydney, australia). The key enzyme used in this reaction was taq polymerase with activity of 5 u / ml . Additional reaction components were buffer for polymerase, 25 mm mgcl2, 10 mm dntps, fluorescent dye evagreen (biomibo, warsaw, poland), 10 m primers specific to the duplicated sequences, and rnase / dnase free water . For each reaction 2 l of cdna derived from the reverse transcription reaction was used and the total volume was 20 l . As a control histone h3 gene and reference rna (qpcr mouse reference total cellular rna, stratagene, la jolla, ca, usa) were used . Quantitative analysis of gene expression at the protein level was performed using elisa method with commercially available immunoenzymatic quantikine kits (r & d systems, mn, usa). Each set consisted of 96 well plates coated by manufacturer, standard proteins used to prepare the calibration, secondary and tertiary antibodies combined with the horseradish peroxidase enzyme, and washing buffer and color substrate for peroxidase . The assay procedure was performed according to the protocol provided by the manufacturer . After stopping the color reaction protein concentration was evaluated using a photometric reader victor2 wallac 1420 (perkinelmer, waltham, ma, usa) with for 450 nm filters, corrected at 595 nm . All samples were analyzed in duplicates . Quantitative assessment of the intensity of neurodegeneration was performed using elisa method with primary antibodies directed against phosphorylated neurofilaments . The first step was the coating of 96 well maxisorb microtitre plate (nunc, roskilde, denmark) with monoclonal anti - nfh antibodies (smi35r, sternberger monoclonals, convance princeton, nj, usa) and overnight incubation at 4c . The next day tested samples and standard curve samples (neurofilament 200 kd, progen, heidelberg, germany) were added . As a secondary antibody rabbit polyclonal antineurofilament 200 antibody (sigma - aldrich, poznan, poland) was used . As a tertiary antibody swine antibodies against rabbit immunoglobulin conjugated with horseradish peroxidase (dako, glostrup, denmark) were used . The final step was the addition of color substrate for horseradish peroxidase, which was 3,35,5-tetramethylbenzidine (sigma - aldrich, poznan, poland). Inhibition of the reaction was performed with 1 m hcl and finally color photometric assessment was done using victor2 reader wallac 1420 (perkinelmer, waltham, ma, usa). The analysis was performed using 450 nm filter with correction at 595 nm . All samples were analyzed in duplicates and the concentration of nfh was determined by referring to the standard curve . Assessment of the localization and severity of neurodegeneration at the level of protein was performed using the fluorescent fluoro - jade c dye (chemicon, millipore, warsaw, poland). Animals were perfused with 4% buffered formalin solution and tissues samples were embedded in paraffin blocks . 10 m thick sections were applied to a polished super frost slides (menzel - glaser braunschweig, germany). Before final staining paraffin fluoro - jade c staining was performed according to the protocol provided by the manufacturer (chemicon). For staining of nuclei sections were counterstained using the blue fluorescent dye dapi (sigma - aldrich, poznan, poland). Then the tissue was mounted and coverslipped using dpx (sigma - aldrich, poznan, poland). For the analysis and acquisition of images an inverted microscope axioobserver a1 (carl zeiss inc ., the following lenses made by carl zeiss inc . Were used: plan - achromat: 4x/0.10, a- plan 10x/0.25 ph1; ld a - plan 20x/0.3; ld plan - neofluar 40x/0.6, ph2 korr . The images were obtained with a digital camera, axiocam mrc5 (carl zeiss group, goettingen, germany) attached to the microscope . For image acquisition we used axio - vision rel . Nonparametric kruskal - wallis and mann - whitney tests were used . For correlation analyses kendal significant upregulation of expression of t cell line marker - cd3 was observed in the et-1-injected hemisphere at 72 h after injection (p = 0.03, mann - whitney test) (figure 1(a)). At that time a significant difference in expression of cd3 was detected between ipsilateral and contralateral hemispheres (p = 0.019, mann - whitney test) (figure 1(a)). Expression of cd3 in ipsilateral hemisphere was also increased when compared to pbs injected hemisphere (p = 0.28, mann - whitney test). The expression of monocyte / macrophage lineage marker f4/80 was significantly elevated only in et-1 injected hemisphere at 72 hours after injection . At that time significant difference was observed in expression of f4/80 between et-1 injected hemisphere and untreated control group (p = 0.022; mann - whitney test) (figure 1(b)). We detected also a significant difference in expression of f4/80 between ipsilateral and contralateral hemispheres of et-1 injected mice at 72 hours after injection (p = 0.035, mann - whitney test) (figure 1(b)). Upregulation of cytokine il-1 expression was observed in et-1 injected hemispheres only at 24 h after injection . Significant difference in expression of il-1 was observed between contralateral hemispheres and normal control group at 72 hours after injection (p = 0.03 and 0.019, resp . ; we detected also a significant difference in expression of il-1 between ipsilateral and contralateral hemispheres of et-1 injected mice 72 hours after injection (p = 0.019, p = 0.019, resp . ; upregulation of chemokine ccl2 expression was observed in ipsilateral hemispheres at 24 and 72 h after injection of et-1 (p = 0.005, p = 0.005, resp . ; mann - whitney test) (figure 2(a)). At 24 h ccl2 expression in ipsilateral hemisphere was significantly higher than at 72 h (p = 0.019; mann - whitney test). Significant difference in ccl2 expression after et-1 injection was also observed between ipsilateral and contralateral hemispheres at 24 h and 72 h (p = 0.012 and 0.036, resp . ; we also showed that during early stage of et-1-injection stroke model expression of ccl3 is significantly upregulated at 24 and 72 h after model induction (figure 2(b)). There was significant upregulation of ccl3 expression in ipsilateral hemispheres of et-1 injected mice in comparison to normal controls and contralateral hemispheres at 24 h after injection (p = 0.008 and 0.012, resp . ; mann - whitney test). At 72 h after model induction we observed significant upregulation of ccl3 expression in et-1-injected hemispheres in comparison to normal brains and contralateral hemispheres (p = 0.014 and 0.019, resp . ; mann - whitney test) (figure 2(b)). Ccl5 was observed in et-1-injected hemispheres in comparison to uninjected animals at 24 and 72 h (p = 0.008, and 0.008 resp . ; significant difference was also observed in ccl5 expression between ipsilateral and contralateral hemispheres at 24 h and 72 h after injection of et-1 (p = 0.008 and 0.012, resp . ; mann - whitney test) (figure 2(c)). Initially increasing expression of cxcl2 in et-1 injected hemispheres was detected with the peak at 24 h and subsequent decrease at 72 h but still significantly higher than in normal controls (p = 0.036, and 0.036, resp . ; mann - whitney test) (figure 2(d)). At 24 h cxcl2 expression in ipsilateral hemisphere was significantly higher than at 72 h (p = 0.012; mann - whitney test) and then at 24 h after et-1 injection in contralateral hemispheres (p = 0.012; mann - whitney test) (figure 2(d)). The expression of cxcl12 in the et-1 and pbs - injected brains and normal controls did not show a significant difference between analysed groups (data not shown). The most severe neurodegeneration was observed in et-1-injected hemispheres at 24 and 72 h after model induction (p = 0.019 and 0.029, resp . ; there was also increased neurodegeneration in contralateral hemispheres of et-1 injected mice at 24 and 72 h, but it was significantly lower than in ipsilateral hemispheres (p = 0.03, and 0.03, resp . ; the localization of ischemic lesion was detected in et-1 injected ipsilateral hemispheres using cresyl violet staining (figure 3(b), large box). Inside the ischemic focus injured neurons were abundant (detected by fluoro - jade and marked by arrows) cells nuclei counterstained with dapi are marked on the picture by arrowheads (figure 3(c)). We observed the positive correlation between expression of lymphocyte lineage marker cd3 (kendall tau = 0,62; p = 0.0004) (figure 4(a)) as well as monocyte / macrophage lineage marker f4/80 (kendall tau = 0,56; p = 0.0007) (figure 4(b)) and the severity of neurodegeneration in et-1 injected brain hemispheres . Although the expression of several studied chemotactic inflammatory mediators (chemokines ccl2, ccl3, ccl5, and cxcl2) was significantly increased in the early stage of this stroke model, there was no clear correlation between this expression and intensity of neurodegeneration (data not shown). In this study we analyzed potential relationship between neuroinflammation and neurodegeneration in experimental model of ischemic stroke induced by intracerebral et-1 injection . We focused on a group of proinflammatory chemokines, especially the classical representatives of ccl subfamily . The reason for selecting these chemokines was their confirmed participation in pathogenesis of many central nervous system diseases . During the first few days of the experimental brain ischemia we observed increasing neurodegeneration in et-1 injected hemisphere . There are several studies showing that neurodegeneration occurs early during brain ischaemia [23, 24]. At that time also the relationship between those two processes is complex and still requires further studies . To measure the intensity of neuroinflammation the expression of inflammatory cells markers (cd3 for t cells and f4/80 for monocytes / macrophages) has been measured at the same time . This analysis showed increased lymphocyte migration to ischemic brain hemisphere at 72 h after model induction . Similarly, infiltration of ipsilateral hemisphere by monocytes / macrophages was significantly increased at 72 h after initiation of brain ischemia . Comparable observation was reported by others who showed the presence of macrophages / activated microglia at 72 h after intracerebral injection of et-1 to rat brain . In another study using mcao stroke model, the influx of mononuclear cells to the site of brain ischemia was recorded between 2 and 15 days after model induction . The presence of neuroinflammation during early brain ischemia was also confirmed in our study by elevated expression of inflammatory mediator - cytokine il-1. Its presence was observed as early as 24 h after model induction . In several cell types including astrocytes, microglia, neurons, and endothelium . In another study increased production of il-1 was reported even at 36 hours after induction of brain ischemia . The peak of this expression was observed at 12 h, and it returned to baseline level after 5 days . Other studies confirmed also that inflammatory mediators, such as il-1 and tnf, are important contributors to cns neural tissue damage induced by ischemia [28, 29]. In our stroke model analysis of the relationship between the infiltration of ischemic hemisphere by mononuclear inflammatory cells and this may suggest that there is close connection between neuroinflammation and neurodegeneration in ischemic stroke . Migration of inflammatory cells from the blood to the ischemic brain may be at least partially induced by chemotactic cytokines - chemokines . To study this concept the highest expression of ccl2 was observed in our model at 24 h after initiation of brain ischemia . Increased expression of ccl2 was still observed at 72 h but was at that time significantly lower . Increased expression of ccl2 in mcao model in the ipsilateral hemisphere was observed on neurons at 12 h and on astrocytes at 24 h after cardiac arrest, suggesting that these cells are the potential source of ccl2 during ischemic stroke . Minami and satoh using double in situ hybridization method pointed to microglia as the cellular source of ccl2 during mcao . It was shown in another mcao study that ccl2 leads to infiltration of the cns by monocytes and thus enhances brain damage induced by ischemia . Also in human stroke patients elevated level of ccl2 was detected in cerebrospinal fluid and serum [9, 11]. The highest ccl3 expression was detected at 24 h after et-1 injection . At 72 h this expression was still increased but it was much lower than at 24 h. also at the protein level we observed significant increase in ccl3 production in the ischemic hemisphere . Our results are in line with the report by gourmala et al . Who observed an increase in ccl3 expression at mrna level already at 1 h after mcao in rats, with peak expression at 816 h . In addition, they observed higher expression of ccl3 during temporary mcao than in permanent mcao, suggesting the impact of reperfusion on the neuroinflammation in the damaged tissue . Gourmala et al . Using in situ hybridization localized the expression of ccl3 on microglial cells / macrophages during brain ischemia . In addition, another studies have concluded that ccl3 application to the brain ventricles after complete mcao enhances mcao harmful effects . We observed almost 46-fold and 30-fold increase in ccl5 expression at 24 h and 72 h, respectively, after induction of et-1 induced stroke model . There are only a few reports concerning the role of ccl5 in the development of ischemic stroke . It was suggested that ccl5 mediates blood - brain - barrier (bbb) disruption and cns tissue damage as well as inflammation after reperfusion during mcao model . These data were not confirmed by tokami and colleagues who observed neuroprotective effect of ccl5 in ischemic stroke suggesting that ccl5 is expressed during stroke mostly in neurons . In et-1 induced experimental stroke a significant increase in cxcl2 expression at 24 h after brain ischemia induction was also observed . Observed increased expression of cxcl2 in the brain of rats with the permanent mcao as well as in the brain and spleen during temporary mcao in mice . In other study increased cxcl2 expression was observed at 6 h of reperfusion and decreased by almost half at 22 h after reperfusion . Vikman et al . Showed increased cxcl2 expression in the brain vessels in the model of subarachnoid haemorrhage and in organotypic cultures . Cxcl2 involvement in the inflammatory process in the cns during mcao was also confirmed in a scid mice . Mcao induced in scid mice led to development of significantly reduced area of brain damage and lower inflammatory infiltration in ipsilateral hemispheres . Reduced expression of many inflammatory mediators including cxcl2 was also observed in t- and b - cell - deficient mice mcao study . Unfortunately, therapy of ischemic stroke with cxcl2 receptor - cxcr2 antagonists sb225002 was not successful . In report presented by copin et al . The cxcl1/cxcl2 chemokine - binding protein evasin-3 treatment was associated with reduction in neutrophilic inflammation in mice mcao model . Although in our study the expression of several studied chemokines was significantly increased at the early phase of et-1 induced stroke model, no clear correlation of this expression with neurodegeneration was observed . That they suggest that inhibition of inflammatory cell accumulation in the brain at the early stage of stroke may lead to amelioration of ischemic neurodegeneration . Upregulated in the ischemic brain chemokines may be a potential target for future therapies reducing inflammatory cell migration to the brain in early stroke.
Stress urinary incontinence (sui) is defined as the complaint of involuntary leakage on effort or exertion or on sneezing or coughing . Although sui is not a life - threatening condition surgical therapy is employed in patients who have severe degrees of sui or those patients in whom conservative or pharmacological treatments have failed . Sling procedures for genuine sui are today the mainstay of treatment and have been used for over a century with first procedure reported by schultze in 1888 . The integral theory of female urinary continence described by petros and ulmsten redefined the modern approach to anti - incontinence surgery and ushered the era of the midurethral sling . The concept was applied clinically by placing the sling to a more distal location beneath the urethra then as compared to the previous techniques . Subsequently excellent results were presented using suprapubic arc system (sparc, american medical systems inc . Some authors have even termed midurethral sling surgery as the new gold - standard for sui . With the available midurethral slings, the trocar has to be passed blindly either from above (suprapubically) or below (transvaginally), which increases the chances of injury to the pelvic organs and blood vessels . Shlomo raz modified the technique of sling placement with opening the endopelvic fascia and passing the needle under controlled digital palpation, thereby decreasing the chances of injury to surrounding pelvic organs as well as significantly decreasing cost using tailor - made mesh . Their finger - guided passing of needle was similar to the raz procedure of bladder neck suspension . We present our experience with the use of large pore polypropylene mesh / polypropylene - polyglactin mesh as a pubovaginal sling (midurethral) in the treatment of sui with the modified raz technique . A retrospective analysis was performed of consecutive 53 patients of pure sui who underwent midurethral slings procedure with the modified technique from june 2003 to december 2008 at our institute . Preoperative evaluation included a history, physical examination, urine microscopic examination, and culture . Severity of sui was defined by the number of pads used by the patients per day as mild (<2), moderate (24), and severe (> 4). Patients were examined in lithotomy and standing positions to demonstrate sui on cough test and valsalva maneuver . Four patients of our series underwent multichannel urodynamic examination for history suggestive of mixed incontinence in accordance with nice guidelines . All patients were counseled regarding the need of postoperative clean intermittent catheterization (cic) and transient voiding dysfunction . Vaginal tissue was atrophic in four patients and they were preoperatively treated with local estrogen cream . Twenty patients gave previous history of hysterectomy; others had history of undergoing gynecological procedures, details of which were not available . None of the patients had previous history of surgery for incontinence or pelvic organ prolapsed . Eight patients had grade 1 cystocele and two patients had grade 1 rectocele, which did not require treatment . Five patients underwent simultaneous vaginal hysterectomy for gynecological indications . A polypropylene mesh (prolene) /polypropylene - polyglactin mesh (vipro) measuring 1 10 cm (ethicon, johnson and johnson, usa) was fashioned from commercially available 15 7.5 cm mesh . This strip was soaked in antibiotic saline and stitched at all four corners to 1 - 0 polyglactin suture . 16 fr foley catheter was placed in urinary bladder and balloon was palpated at bladder neck to estimate urethral length . Two percent of xylocaine with adrenaline was infiltrated in the vaginal mucosa overlying the urethra . A 1.52 cm mid - line incision was made over the midurethra (1.5 cm proximal to external urethral meatus). Vaginal mucosal flaps were dissected on either side extending into avascular plane, until endopelvic fascia was reached . Blunt dissection was carried out in retropubic space by inserting a finger and the bladder was swept medially . Two small punctures were made suprapubically and a double - pronged needle (cook urological inc ., indiana, usa) is passed under finger control through the fascia and retropubic space . A marking catgut suture is placed in the center of the mesh along its length to ensure that mesh placement is equidistant . The polyglactin suture was pulled and tension adjusted by placing the tip of an artery forceps while positioning sling against midurethra . Vaginal pack was removed after 24 hours of surgery and providine - iodine vaginal pressary was advised for 5 days . If residual urine was more than 50 ml, patient was advised cic . In sexually active patients, the patients were followed up with history and clinical examination by the operating surgeon in the opd . Social dryness was defined as patient requiring 1 pad per day and acceptable leak while carrying out routine tasks . Five of the patients also underwent simultaneous vaginal hysterectomy for gynecological indications with no increase in morbidity . Mean duration of follow - up was 46.1 months (1278 months) [table 1]. Forty - five (85%) patients were completely dry and eight (15%) were socially dry at the end of the follow - up . Four patients failed voiding trial and were advised cic, which was later discontinued after 38 weeks, when their pvr fell to <50 ml . Two patients complained of dull aching lower abdominal pain, which was relieved by administration of oral analgesic agents . Five of our patients complained of mild dyspareunia, which was transient and did not require treatment [table 2]. None of the patients reported significant voiding dysfunction, infection, nonhealing, or erosion of the sling till their last follow - up [table 2]. Over last few years, many procedures using autologous material (rectus sheath, fascia lata) or synthetic material (polypropylene, mersilene) have been reported in literature . Continued refinements in materials were sought to identify an ideal compound for use in transvaginal slings that would be inert, sterile, noncarcinogenic, and mechanically durable . Synthetic materials have the advantage of being readily available and do not require harvesting from another site . This decreases the operative time, discomfort, and potential donor site complications after the surgery . Histological and clinical studies have shown that polypropylene is a synthetic material that is well - tolerated by the body, with little exposure of the patient to infection and vaginal or urethral erosion . Cure rates using synthetic slings have been shown to be around 7395% . In a review of contemporary literature, daneshgari et al . Have found complication rates ranging from 4.3% to 75.1% for retropubic midurethral slings . They have quoted postoperative obstruction ranging from 1.9% to 19.7% from various series . In these patients, resolution is commonly spontaneous; the intervening period can be managed with cic or indwelling catheter . A recent meta - analysis showed that tvt outperformed burch colposuspension both in terms of postoperative continence rates, whereas success rate efficacies were similar after tvt and pubovaginal slings . Comparing tvt to the other retropubic tension - free midurethral vaginal slings, tvt was more efficacious than both intravaginal slingplasty (ivs) and sparc . Some authors have even described midurethral slings as the new gold - standard for the treatment of female sui . The reasons for popularity of these procedures are effectiveness, ease, and low rate of serious complications . A recent meta - analysis of complications of these procedures have highlighted significantly high rates of bladder perforation after tvt . Have questioned the authenticity of reported complication rates and have described major complications and even 10 deaths as retrieved after systemic search of food and drug administration (fda) manufacturer and user facility device experience (maude) database . Rodriguez and raz have described a mid - distal urethral sling procedure in which distal urethra is defined as anything distal to the pubourethral ligament . They have explained the mechanism of action of tvt procedure by providing support as well as contributing to normal function of distal urethral complex (composed of the pubourethral ligaments, intrinsic sphincteric mechanism, extrinsic sphincter, and levator muscles located immediately distal to the pubourethral ligaments). Furthermore, they have enumerated the drawbacks of current midurethral sling systems as being blind procedures with consequently higher incidences of major complications . In their modification, a sling is refashioned from commercially available mesh, which is cheap, does not require any special instrumentation, and is placed only within the retropubic space . The optimal surgical approach should minimize the risk of damage to the bladder neck, vagina, and urethra . This is achieved by developing retropubic space with blunt dissection and passing double - pronged needle under finger guidance . The procedure should augment the urethral resistance during sudden increase in the intra - abdominal pressure without preventing normal decreases in urethral pressure during voiding . Placing a sling beneath the urethra increases the urethral compression and provides a plate for receiving the transmitted intra - abdominal pressure to the bladder neck and proximal urethra . The safety of the procedure has also been demonstrated in their series with no incidence of major complications . Conventional guidelines recommended multichannel urodynamic studies in sui patients planned for surgery . With the advent of midurethral slings, which have shown to be effective in all types of urinary incontinence, studies have questioned the routine use of urodynamic parameters like valsalva leak point pressure in predicting outcome of sling surgery . Have proposed that standard use of urodynamic investigation in the preoperative workup of midurethral slings needs to be revisited . In our series we had cure rate in all the 53 patients till their last follow - up . Sling procedures that are successful at 6 months are likely to remain successful for many years . In our series, all the patients had a follow - up of more than 12 months and all these patients were doing well till their last follow - up . In a comprehensive meta - analysis of complications of midurethral slings, novara et al . Have found the incidences of various complications bladder / vaginal perforation 2.919.31%; hematoma 1.453.9%, uti 3.77.5%, and cic in 77.5% of cases in various rcts and non - randomized studies . Rodriguez et al . Have described pelvic hematoma (not requiring treatment) in 0.33% and suprapubic pain in 0.66% of cases . Three of their patients required cic for maximum of 3 months after which they were all spontaneously voiding . In our series, four (7.5%) patients required cic after failed voiding trial, which was discontinued after a period of 38 weeks . We attribute this to be the procedure - related local tissue edema / pain, which gradually subsided . Other minor complications in our series were hematoma (not requiring treatment) in 1.8%, uti in 3.7%, low back pain in 3.7%, and dyspareunia in 9.4% of cases . Major concerns about the erosion of the sling into the urinary tract have been diminished as a result of meticulous detail in placing the mesh through a small incision and tying the mesh loosely so as to avoid excessive compression and ischemia . We did not encounter any incidence of mesh erosion into the urethra in our series of patients . We faced none of the major injuries like vascular injury, bowel injury, necrotizing fasciitis, sepsis, or death, a fact emphasized by the shlomo raz group . One standard - sized polypropylene mesh costs around inr 1800 and polypropylene - polyglactin (vipro) mesh costs around inr 2300 . This is economically friendlier as compared to custom - made mesh systems commercially available, ranging from inr 18,000 to 25,000, especially in developing country like india . The limitations of this study are lack of objective analysis and quantification of sui . Outcomes were based on patients interview on opd basis by the operating surgeon and not by patient - driven questionnaires, possibly influencing the overall results . Despite the limitations of the study, we believe this procedure is a cost - effective alternative to other minimally invasive procedures using commercially available kits and with comparable outcomes . Polypropylene mesh as midurethral slings by modified raz technique is cost - effective, safe, and has acceptable complication rates . Although our series is a not big enough to draw any formal conclusions, but we can safely infer that the results of this procedure are comparable to other techniques used in patients with pure sui.
This causes misalignment between the sleep and wake propensities that are controlled by hypothalamic circadian pacemaker and results into shift work sleep disorder (swsd). The reported incidence of swsd in india is about 44.8% of night - shift workers and 35.8% of rotating workers . Swsd is characterized by persistent excessive sleepiness during night work and insomnia when attempting sleep in the daytime . Individuals with swsd have significantly higher incidence of sleepiness - related accidents, absenteeism, depression, and missed family and social activities as compared with other night - shift workers . It is also associated with higher incidence of ulcers, cardiovascular disease, and deficit in cognition and psychomotor performance [4, 5]. The pharmacological management of swsd involves treatment with modafinil that has been shown to improve wakefulness and ability to sustain attention in these patients . However, despite the half - life of 15 hours, the wakefulness promoting effect of modafinil is found to be ill - sustained in the last one third of night shift hours . The lack of efficacy in the early morning hours and undue patient confidence in the drug can result into excessive sleepiness while commuting home . Armodafinil, the chirally pure r - enantiomer of modafinil, approved by us fda in 2007 has half - life (t1/2 = 15 hours) three times longer than its s - enantiomer (t1/2 = 3 hours). Despite the same half lives, comparison of the equivalent (200 mg) doses of modafinil and armodafinil, in humans has revealed that armodafinil sustains higher plasma concentrations 614 hrs postadministration than that of racemic modafinil with longer maintenance of wakefulness [810]. This was a randomized, comparative, double - blind, and multicentric study comparing the effects of modafinil 200 mg with armodafinil 150 mg in indian patients of swsd . Prior approval was obtained from drug controller general of india (dcgi) and appropriate ethics committees . The study was conducted in accordance of good clinical practice guidelines (issued by central drugs standard control organization, government of india) and according to the declaration of helsinki . The trial was registered at the clinical trials registry, india (http://www.ctri.in/). After obtaining written informed consent, patients of either sex, aged between 18 and 60 years, attending outpatient clinics of the authors, and suffering from excessive sleepiness associated with swsd (assessed basis patient' primary complaint and using the diagnostic criteria adopted from international classification for sleep disorders (table 1)) were enrolled . Patients were working at least five night shifts every month for 12 hours or less, with 6 hours or more working between 10 p.m. and 8 a.m. and at least three shifts occurring consecutively . The major exclusion criteria were patients with significant liver or kidney or heart diseases, patients with clinically significant, uncontrolled psychiatric or medical condition, patients with known history of hypersensitivity to formulation, patients operating an automobile or hazardous machinery, caffeine consumption averaging more than 600 mg / day within 1 week of baseline, use of other concomitant medications which inhibit, induce, or are metabolized by cyp450, patients using sedative or cns acting drugs or medication liable to affect outcome of the study (e.g., antihistamines, selective serotonin reuptake inhibitors, tricyclic antidepressants, lithium, anti - psychotics, anticonvulsants, monoamine oxidase inhibitor, benzodiazepines, psychostimulants, and anticoagulants), pregnant and lactating mothers, females of reproductive age and expecting pregnancy or using steroidal contraception, and patients with alcohol or drug abuse . This was a multi - centric, randomized, comparative, and double - blind parallel group, clinical trial conducted over 18 sites across india . 1 ratio for test and reference products online at http://www.randomization.com/. Patients received orally either armodafinil 150 mg tablet (emcure pharmaceuticals ltd ., india) or modafinil 200 mg tablet (from commercial source) one hour prior to start of every night shift for 12 weeks . The test formulation was earlier found to be bioequivalent to the us fda - approved formulation of armodafinil, in 26 healthy indian volunteers . The tablets of armodafinil and modafinil were identical in shape, size, and color and were dispensed in coded, identical, and opaque packs to conceal identity and maintain blinding . Patients were evaluated for sleepiness score based on stanford sleepiness scale (sss) at baseline, 4 weeks, 8 weeks, and 12 weeks . All the assessments were done in the morning hours at the end of three consecutive night shifts . The primary efficacy endpoint was proportion of patients showing at least 2 grades of improvement (responder) based on sss in both groups . The other efficacy variables included improvement in mean sss grades compared to baseline, compliance to therapy, and patients' as well as physicians' global assessment for efficacy . Global assessment of efficacy was performed using the following grades: (i) excellent = reduction of> 75% of symptoms, (ii) good = reduction of 5175% of symptoms, (iii) fair = reduction of 2650% of symptoms, and (iv) poor = no improvement or reduction in <25% of symptoms . Patients' compliance to the therapy was calculated in percentage by using following formula: (number of tablets actually taken 100)/number of tablets supposed to be taken . A general and detailed systemic examination was performed for all patients during each study visit . Blood samples were collected at baseline and at the end of the study for complete hemograms, liver function tests, renal function tests, lipid profile, and fasting blood glucose levels . Electrocardiograms were performed for all patients at baseline and at the end of the study . Tolerability was assessed by recording patients' global assessment about the tolerability of the drug and percent of the patients experiencing any drug - related adverse events . The global assessment of tolerability was performed using following grades: (i) excellent = no adverse drug reaction, (ii) good = mild adverse drug reaction but no interference with normal lifestyle, (iii) fair = mild adverse drug reaction which interference with normal lifestyle . However, benefits of drug therapy outweigh the inconvenience, (iv) poor = drug withdrawn . Prestudy calculations showed that a sample size of 100 in each group would have 80% power to detect a difference of at least 19% in responder rate with a significance level (alpha) of.05 (two tailed). Was done by comparing the proportion of patients showing excellent and good response against proportion of patients showing fair and poor response . For all statistical tests, a p value of less than or equal to 0.05 was considered as significant, after correction for any multiple comparisons . Two hundred and eleven patients of swsd were recruited with 105 subjects in armodafinil group and 106 subjects in the modafinil group (figure 1). Both modafinil and armodafinil significantly improved sleepiness grades as compared to baseline (p <.0001) (figure 2). Responder rates with armodafinil (72.12%) and modafinil (74.29%) were comparable (p = .76). At the end of therapy, compliance in both modafinil group (99.31% 3.06%) and armodafinil group (99.13% 2.35%) was found to be good and comparable (p = .63) indicating adequate patient adherence to therapy . Both physicians' and patients' assessment of efficacy was found to be comparable between armodafinil and modafinil group (figure 3). The intention - to - treat analysis showed that the adverse event incidences in modafinil (40.57%) and armodafinil (42.87%) groups were similar (p = .78). The adverse effect profile of both drugs was found to be similar with headache, nausea, and dry mouth being the common adverse effects (table 3). No incidences of accidents or absenteeism from work were noted during the study period as assessed from patient history . Physicians' and patients' assessment of tolerability was found to be comparable between armodafinil and modafinil group (figure 4). The baseline and after - therapy biochemical values were within normal range and similar between two groups, except that there was slight increase in mean sgpt in both armodafinil and modafinil groups as compared to baseline (p = .008 and .0007) without inter - group significance and mean blood urea value in armodafinil group increased (p = .002) compared to baseline . However, the increased values were within normal limits . In both groups, electrocardiograms were within normal at baseline and after completion of therapy in all patients . The adverse events that led to discontinuation were palpitation, anxiety, hypertension, depression, nervousness, and depressed mood in a patient receiving armodafinil and vomiting along with dizziness in another patient receiving modafinil . The present study confirms the efficacy of armodafinil 150 mg in patients of swsd . The efficacy of armodafinil was found to be comparable to 200 mg of modafinil in maintaining wakefulness . Both modafinil and armodafinil caused a slight increase in liver enzymes, and armodafinil caused a slight increase in blood urea nitrogen . This was not of clinical significance as the increased values were within normal laboratory limits . Armodafinil 150 mg was comparable to modafinil 200 mg, which indicates that armodafinil is 1.33 time more potent than racemic modafinil . The use of r - enantiomer of modafinil avoids unnecessary use of s - isomer and exerts less metabolic load on the body . In previous studies, 200 mg of armodafinil was shown to provide more sustained plasma concentrations late in the day as compared to 200 mg of modafinil and monophasic plasma elimination kinetics as compared biphasic for modafinil . We chose the 150 mg dose of armodafinil, as this was the approved dosage for the present indication . Our study demonstrated no difference in the efficacy of 150 mg of armodafinil over 200 mg of modafinil . The comparative efficacy of 200 mg of armodafinil with modafinil in swsd has not yet been assessed . A limitation of the present study is that the assessment of sleep latency and polysomnography throughout the nightshift could not be done due to unavailability of patients and investigators . The study did not demonstrate any difference in efficacy and safety between armodafinil 150 mg and modafinil 200 mg, and both drugs were comparable.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.