article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
gamma - aminobutyric acid ( gaba ) receptora ( gabaa ) receptors are members of the large cys - loop super - family of evolutionarily related and structurally similar ligand - gated ion channels that also includes the nicotinic acetylcholine , glycine , and 5-ht3 receptors . the gaba receptor is predominantly expressed in the central nervous system , and forms a chloride - selective transmembrane channel in the post - synaptic sites of nerve terminals .
for example , kimura et al . showed that ginsenosides differentially regulate [ h]-f1unitrazepam or [ h]-muscimol binding to the gabaa receptor in a rat brain membrane fraction .
kim et al . reported that prolonged infusion with ginsenoside rc , but not ginsenoside rg1 , into rat brain elevates [ h]-muscimol binding to the gabaa receptor in a brain region - specific manner .
thus , ginsenosides may regulate the gabaa receptor by affecting ligand affinity for its receptor , but there is no direct evidence on the regulation of gabaa receptor channel activity by ginsenosides . on the other hand , choi et al . showed that ginsenoside rc enhances gaba - mediated ion currents in oocytes expressing the gabaa receptor .
it is known that protopanaxadiol and protopanaxatriol ginsenosides are metabolized into protopanaxadiol ( ppd ) and m4 , respectively , by gastric juice and intestinal microorganisms after ginseng intake .
however , little is known about whether ppd or m4 regulates gabaa receptor channel activity . in the present study
we injected neuronal human gabaa ( 112s ) receptor crnas into xenopus oocytes and examined the effect of ginsenoside metabolites on the gaba - elicited inward peak currents ( igaba ) .
treatment with ginsenoside metabolites inhibited igaba in a reversible , dose - dependent and non - competitive manner .
the ginsenoside metabolites m4 and ppd were provided by the ambo institute ( seoul , korea ) ( fig .
all other reagents were purchased from sigma - aldrich ( st . louis , mo , usa ) .
xenopus laevis frogs were purchased from xenopus i ( ann arbor , mi , usa ) .
their care and handling were in accordance with the highest standards of institutional guidelines of konkuk university .
for isolation of oocytes , frogs were anesthetized with an aerated solution of 3-amino benzoic acid ethyl ester followed by removal of ovarian follicles .
the oocytes were treated with collagenase and then agitated for 2 h in a ca - free medium containing 82.5 mm nacl , 2 mm kcl , 1 mm mgcl2 , 5 mm hepes , 2.5 mm sodium pyruvate , 100 units / ml penicillin , and 100 g / ml streptomycin .
stage v - vi oocytes were collected and stored in nd96 medium ( in mm : 96 nacl , 2 kcl , 1 mgcl2 , 1.8 cacl2 , and 5 hepes , ph 7.5 ) supplemented with 50 g / ml gentamicin .
the oocyte - containing solution was maintained at 18 with continuous gentle shaking and renewed daily .
electrophysiological experiments were performed within 5 to 6 d of oocyte isolation , with ginsenoside metabolites added to the bath . for gabaa receptor activity experiments , each gabaa receptor subunit - encoding crna ( 40 nl )
was injected into the animal or vegetal pole of each oocyte one day after isolation , using a 10 l microdispenser ( vwr scientific , san francisco , ca , usa ) fitted with a tapered glass pipette tip 15 to 20 m in diameter . a custom - made plexiglas net chamber
the oocytes were impaled with two microelectrodes filled with 3 m kcl ( 0.2 - 0.7 m ) , and electrophysiological experiments were carried out at room temperature using an oocyte clamp ( oc-725c ; warner instruments , hamsden , ct , usa ) . stimulation and data acquisition were controlled with a pclamp 8 ( axon instruments , union city , ca , usa ) . for most electrophysiological experiments
, oocytes were perfused initially with nd96 solution ( in mm : 96 nacl , 3 kcl , 2 cacl2 , and 5 hepes ; ph 7.4 with naoh ) and control current recordings were obtained . for most electrophysiological data , the oocytes were clamped at a holding potential of 80 mv .
for current and voltage ( i - v ) relationship , voltage ramps were applied from 100 to + 40 mv for 300 ms . in the different membrane - holding potential experiments ,
linear leak and capacitance currents were corrected by means of the leak subtraction procedure . to obtain the concentration - response curve for the effect of ginsenoside metabolites on the inward peak igaba mediated by the gabaa receptor
, the igaba peak was plotted at different concentrations of gaba and origin software ( origin , northampton , ma , usa ) was used to fit the plot to the hill equation : y / ymax=[a]/([a ] + [ ic50 ] ) , where y is the peak current at a given concentration of ginsenoside metabolites , ymax is the maximal peak current , half - inhibitory concentration ( ic50 ) is the concentration of ginsenoside metabolites producing a half - maximal effect , [ a ] is the concentration of ginsenoside metabolites , and nh is the hill coefficient .
the significance of differences between the mean control and treatment values was determined using student s t - test
the ginsenoside metabolites m4 and ppd were provided by the ambo institute ( seoul , korea ) ( fig .
all other reagents were purchased from sigma - aldrich ( st . louis , mo , usa ) .
xenopus laevis frogs were purchased from xenopus i ( ann arbor , mi , usa ) .
their care and handling were in accordance with the highest standards of institutional guidelines of konkuk university .
for isolation of oocytes , frogs were anesthetized with an aerated solution of 3-amino benzoic acid ethyl ester followed by removal of ovarian follicles .
the oocytes were treated with collagenase and then agitated for 2 h in a ca - free medium containing 82.5 mm nacl , 2 mm kcl , 1 mm mgcl2 , 5 mm hepes , 2.5 mm sodium pyruvate , 100 units / ml penicillin , and 100 g / ml streptomycin .
stage v - vi oocytes were collected and stored in nd96 medium ( in mm : 96 nacl , 2 kcl , 1 mgcl2 , 1.8 cacl2 , and 5 hepes , ph 7.5 ) supplemented with 50 g / ml gentamicin .
the oocyte - containing solution was maintained at 18 with continuous gentle shaking and renewed daily .
electrophysiological experiments were performed within 5 to 6 d of oocyte isolation , with ginsenoside metabolites added to the bath . for gabaa receptor activity experiments , each gabaa receptor subunit - encoding crna ( 40 nl )
was injected into the animal or vegetal pole of each oocyte one day after isolation , using a 10 l microdispenser ( vwr scientific , san francisco , ca , usa ) fitted with a tapered glass pipette tip 15 to 20 m in diameter .
a custom - made plexiglas net chamber was used for two - electrode voltage - clamp recordings as previously reported .
the oocytes were impaled with two microelectrodes filled with 3 m kcl ( 0.2 - 0.7 m ) , and electrophysiological experiments were carried out at room temperature using an oocyte clamp ( oc-725c ; warner instruments , hamsden , ct , usa ) . stimulation and data acquisition were controlled with a pclamp 8 ( axon instruments , union city , ca , usa ) . for most electrophysiological experiments
, oocytes were perfused initially with nd96 solution ( in mm : 96 nacl , 3 kcl , 2 cacl2 , and 5 hepes ; ph 7.4 with naoh ) and control current recordings were obtained . for most electrophysiological data , the oocytes were clamped at a holding potential of 80 mv . for current and voltage ( i - v ) relationship , voltage ramps were applied from 100 to + 40 mv for 300 ms . in the different membrane - holding potential experiments ,
to obtain the concentration - response curve for the effect of ginsenoside metabolites on the inward peak igaba mediated by the gabaa receptor , the igaba peak was plotted at different concentrations of gaba and origin software ( origin , northampton , ma , usa ) was used to fit the plot to the hill equation : y / ymax=[a]/([a ] + [ ic50 ] ) , where y is the peak current at a given concentration of ginsenoside metabolites , ymax is the maximal peak current , half - inhibitory concentration ( ic50 ) is the concentration of ginsenoside metabolites producing a half - maximal effect , [ a ] is the concentration of ginsenoside metabolites , and nh is the hill coefficient .
the significance of differences between the mean control and treatment values was determined using student s t - test
the addition of gaba ( 10 m ) to the bathing medium induced a large inward current ( igaba ) in oocytes injected with gabaa receptor subunits crnas , indicating that the gabaa receptor was functionally expressed ( fig .
expressing gabaa receptor , the treatment of ginsenoside metabolites such as m4 or ppd had no effect . moreover , co- or pre - treatment with ginsenoside metabolites for 30 s with gaba induced an inhibition of igaba in a reversible manner ( fig .
2a , b ; n=15 from three different frogs ) . as shown in fig .
2c , m4 more significantly inhibited igaba than ppd . in concentration - response experiments with m4 or ppd , co - treatment with m4 and
ppd inhibited igaba in a dose - dependent manner in oocytes expressing the gabaa receptor ( fig .
the ic50 of igaba by m4 and ppd was 17.12.2 and 23.18.6 m , respectively , in oocytes expressing the gabaa receptor ( n=9 - 12 from three different frogs at each point ) ( fig .
the membrane potential was held at 80 mv and a voltage ramp was applied from 100 to + 40 mv for 300 ms . in the absence of gaba , the inward current at 100 mv was < 0.3 a and the outward current at + 40 mv was 0.3 - 0.5 a .
the addition of gaba to the bathing medium resulted in an increase of the inward current at a potential more negative than 20 mv .
in contrast , at a potential more positive than 20 mv , gaba caused a large increase in the outward current .
co - treatment of gaba with m4 or ppd inhibited both inward and outward currents as compared with those induced by gaba treatment alone .
the reversal potential was near 20 mv in gaba alone and in gaba + m4 or ppd , which indicates that gaba induces the ci current .
also , co - treatment of gaba with m4 or ppd did not affect the channel property of the gabaa receptor ( fig .
, our results further revealed that the inhibitory effects of m4 and ppd on igaba in oocytes expressing human gabaa receptors were independent of the membrane holding potential ( fig .
holding potentials of 100 , 80 , 60 , 40 , and 20 mv , m4 inhibited igaba by 53.82.5% , 52.44.0% , 52.81.5% , 54.11.7% and 53.92.9% , respectively ( n=9 - 12 , from three different frogs ) .
ppd inhibited igaba by 20.91.9% , 23.31.4% , 22.13.8% , 20.71.3% and 21.63.0% , same respective order ( n=9 - 12 , from three different frogs ) . to begin studying the mechanism
by which m4 or ppd inhibit igaba in oocytes expressing human gabaa receptors , we analyzed the effect of 100 m m4 or ppd on the igaba evoked by different gaba concentrations ( fig .
co - treatment of oocytes expressing human gabaa receptors with 100 m m4 or ppd plus different concentrations of gaba did not significantly shift the dose - response curve of gaba to the right .
the ec50 values were 15.82.5 , 18.32.4 and 15.42.6 m for gaba alone , gaba+m4 and gaba+ppd , respectively , and the hill coefficients were 1.6 , 1.5 and 1.7 , in the same respective order .
thus , m4 and ppd significantly inhibited the igaba elicited by 10 , 30 , and 100 m of gaba , independent of the gaba concentration ( n=6 - 8 from three different frogs ) ( fig .
aglycone is the backbone of the ginsenoside , with a hydrophobic four - ring steroid - like structure that may be non - polar , whereas the carbohydrates on carbons 3 , 6 , and 20 of the backbone are polar ( fig .
have shown that ginsenosides administered orally are metabolized and finally become an agylcone such as m4 and ppd .
these ginsenoside metabolites might also induce apoptosis of cancer cells and play a role as anti - cancer agents , suggesting that ginsenosides are pro - drugs of these metabolites .
however , relatively little is known regarding how ginsenoside metabolites regulate ion channel or receptor activity , especially on gabaa receptor . in the present study , we investigated the effects of ginsenoside metabolites on human gabaa receptors heterologously expressed in xenopus oocytes .
we found that co- or pre - treatment with m4 rather than ppd induced a large inhibition of igaba in reversible manners , treatment of m4 and ppd inhibited igaba in oocytes expressing gabaa receptors in concentration - dependent manners , and inhibition of igaba by treatment of m4 or ppd occurred in a voltage - independent and non - competitive manner in oocytes expressing gabaa receptors .
these results indicate that the ginsenoside metabolites m4 and ppd might be novel gabaa receptor regulators .
gaba is one of major inhibitory neurotransmitters in the mammalian brain and it has long been known that many neuroactive drugs , such as the benzodiazepines , nonbenzodiazepines , barbiturates , ethanol , neuroactive steroids , anaethetics , and picrotoxin interact with gabaa receptors by binding to modulatory sites of the receptor .
thus , gabaa receptor regulators are clinically important for treatment of various mental dysfunctions . for example , benzodiazepines , which are known to potentiate igaba , have been used for their anxiolytic , sedative , and myorelaxant effects . however , many unwanted side effects such as amnesic - like effects , ataxia , ethanol and barbiturate potentiation , and tolerance and dependence , appear and result in a reduction in the therapeutic value of benzodiazepines [ 13 - 15 ] . on the other hand , we have shown that ginsenoside rc enhances igaba
; these results are well coupled to the report that some subsets of ginsenosides have anxiolytic - like effects in animal model .
presently , m4 and ppd displayed inhibitory effects on igaba rather than enhancing effects , indicating the possibility that ginsenoside metabolites are different from intact ginsenosides in the regulation of gabaa receptor - mediated ion channel regulations .
we have previously reported that ginsenoside metabolites such as compound k ( ck ) , m4 , and ppd differentially regulate ion channels and receptors .
for example , ck , but not protopanaxatriol ( ppt ) , potently inhibits the voltage - dependent 1g - type ca channel .
similarly , we also demonstrated that ck , but not m4 ( ppt ) , inhibits a neuronal na ( nav1.2 ) channel , and that m4 , but not ck , inhibits 5-ht3a receptor - mediated currents .
recently , we also reported that , although ppd itself does not affect human herg k channel activity , it inhibits ginsenoside rg3-mediated decelerating effects of herg k channel currents .
in the present study , m4 more strongly inhibited gabaa - receptor - mediated ion currents than ppd .
the previous and present findings indicate that ginsenoside metabolites as well as ginsenosides have regulatory effects on voltage - dependent ion channel and receptor activities , but they differentially affect the regulation of ion channels or receptors . in summary , we have examined the effects of ginsenoside metabolites such as m4 and ppd on human gabaa receptor channel activities heterologously expressed in xenopus oocytes .
human gabaa receptors are mainly involved in the modulations of various physiological and pathophysiological activities in the central nervous system , the inhibitory effects of m4 on igaba could provide a molecular basis for the pharmacological actions of ginsenoside metaobolites in the nervous system . | in a previous report , we demonstrated that ginsenoside rc , one of major ginsenosides from panax ginseng , enhances -aminobutyric acid ( gaba ) receptora ( gabaa)-mediated ion channel currents .
however , little is known about the effects of ginsenoside metabolites on gabaa receptor channel activity .
the present study investigated the effects of ginsenoside metabolites on human recombinant gabaa receptor ( 112s ) channel activity expressed in xenopus oocytes using a two - electrode voltage clamp technique .
m4 , a metabolite of protopanaxatriol ginsenosides , more potently inhibited the gaba - induced inward peak current ( igaba ) than protopanaxadiol ( ppd ) , a metabolite of ppd ginsenosides .
the effect of m4 and ppd on igaba was both concentration - dependent and reversible .
the half - inhibitory concentration ( ic50 ) values of m4 and ppd were 17.12.2 and 23.18.6 m , respectively .
the inhibition of igaba by m4 and ppd was voltage - independent and non - competitive .
this study implies that the regulation of gabaa receptor channel activity by ginsenoside metabolites differs from that of ginsenosides . |
the bael fruit ( aegle marmelos correa ) has been attributed with various nutritional and therapeutic properties .
the bael fruit pulp contains many functional and bioactive compounds such as carotenoids , phenolics , alkaloids , coumarins , flavonoids , terpenoids , and other antioxidants which may protect against chronic diseases .
it has been surmised that the psoralen in the pulp increases tolerance of sunlight and aids in the maintaining of normal skin color and is considered fruitful in the treatment of leucoderma .
the marmelosin ( c13h12o3 ) content , found in the bael fruit , is considered as panacea of various stomach ailments .
bael fruit , because of its hard shell , mucilaginous texture , and numerous seeds , is not popular as fresh fruit .
however , the excellent flavor and nutritive and therapeutic value of bael fruits show potential for processing into values added products .
bael is commercially considered as an important fruit , but the potential of the fruit is not fully tapped .
the edible pulp , 100 g of bael fruit contains 61.5 g water , 1.8 g protein , 0.39 g fat , 1.7 g minerals , 31.8 g carbohydrate , 55 mg carotene , 0.13 mg thiamine , 1.19 mg riboflavin , 1.1 mg niacin , and 7 to 21 mg ascorbic acid . generally , three methods of juice extraction are employed , namely , cold , hot , and enzymatic methods .
the use of fungal enzyme in fruit juice extraction had shown significant increase in juice recovery as compared to cold and hot extraction methods .
the enzymes , mainly pectinases , and cellulases assist in pectin and cellulolytic hydrolysis , respectively , which cause a reduction in pulp viscosity and a significant increase in juice yield .
the extraction of bael juice on large scale has not been explored for its commercial scale viability and exploitation but conventionally , the extraction includes addition of water to pulp , boiling and pressing of juice from the mixture . the residual pulp remaining after juice extraction still contains valuable extractable material such as particulate , flavour , and soluble solids which may further improve the final quality of the juice .
by adding cell wall liquefying enzymes , it is possible to further extract valuable juice components from pulp .
the area requires wider research in terms of utilization of residue , enhanced juice yield with optimum overall acceptability .
the application of commercial enzyme for the different juice clarification is reported by several researchers [ 68 ] .
it is more economical to use crude enzyme ( spore free and produced from gras fermentation ) for the improvement of juice yield and clarity .
therefore , the present study was undertaken to use crude enzyme from a. niger for the treatment of the bael pulp to improve the juice yield with optimum overall acceptability and examine the comparative effect of enzymes in crude and purified form by using principal component analysis ( pca ) .
fully ripe fresh bael fruits ( aegle marmelos correa ) of kagazi variety , without any visual defects , were procured from agricultural farm of rbs college , bichpuri , agra ( india ) .
the bael fruits were broken by hammering , and the pulp was scooped out with the help of stainless steel spoon .
the strain of aspergillus niger ncim 548 was obtained from the national chemical laboratory , pune .
the strain was cultured on potato dextrose agar slant and subcultured after every 68 weeks .
this strain was used for the production of crude enzyme under solid state fermentation ( ssf ) using wheat bran , corn bran , and kinnow peel ( in 2 : 1 : 2 ratio ) as substrate as per the method reported by kumar et al . .
the enzyme contained 50 u / ml of the pectinase and 20 u / ml of the cellulase and was used for the treatment of bael fruit pulp to improve the juice yield and quality .
response surface methodology ( rsm ) was used in designing the experiments as it provides the modeling and analysis of the problem in which several variables influence the output parameter , and the objective is to optimize this parameter .
rsm provides a reduced number of experimental runs needed to obtain sufficient information for statistically acceptable results . a five - level three - factor
the independent variables were the temperature of enzyme treatment ( x1 ) , time of treatment ( x2 ) , and used enzyme concentration ( x3 ) .
the variables and their levels were chosen based on the limited literature available on enzymatic hydrolysis of fruits [ 68 ] .
these were the temperature ( x1 ; 3555c ) , time ( x2 ; 210540 min ) of the enzymatic treatment , and concentration of enzyme ( x3 ; 0.060.20 ml/25 g pulp ) .
the experimental design matrix in coded ( x ) form and at the actual level ( x ) of variables is given in table 1 .
a total of 20 experiments were carried out by using crude enzyme under different experimental conditions as given in table 2 .
the response function ( y ) was related to the coded variables by a second degree polynomial equation ( 1 ) as follows :
( 1)y = b0+b1x1+b2x2+b3x3 + b12x1x2+b13x1x3+b23x2x3+b11x21+b22x22+b33x23+. the coefficients of the polynomial were represented by b0 ( constant ) , b1 , b2 , b3 ( linear effects ) , b12 , b13 , b23 ( interaction effects ) , b11 , b22 , b33 ( quadratic effects ) , and ( random error ) .
the pretreatment conditions based on the application of commercial enzyme on the juice recovery from bael fruit were also optimized in our laboratory using ccrd design of response surface methodology .
the optimum conditions observed were concentration of pectinase 5 mg/25 g of pulp ( 1.64 iu / mg ) , time 425 min , and temperature 47c as given in table 4 .
the bael pulp for the treatment of enzymes was prepared as per the procedure adopted by singh et al . .
the temperature was adjusted to the required level by using a high precision water bath ( seco , model 129 , india ) for all enzymatic treatment combinations . at the completion of the enzyme treatment ,
the treated mixture was filtered by using 6-fold cheese cloth , and the extract was heated at 90c for 5 min to inactivate the enzyme .
the extract thus obtained was considered as clear juice for determining the juice yield .
the clarity was determined by the method given by krop and pilnik , and viscosity of the juice was determined as per the method reported by ranganna .
the juice was shaken , and 10 ml portion of juice was centrifuged at 3000 rpm for 10 min to remove pulp coarse cloud particles .
the clarity of the juice obtained was determined by measuring the transmittance at a wavelength of 590 nm using uv - vis spectrophotometer ( uv 5704ss , electronics corporation of india ltd . ) .
time required to flow through the capillary section of the oswald viscometer was noted using a stopwatch for the reference and the sample at 20 2c .
the optimal level of three independent variables , namely , temperature ( x1 ) , time ( x2 ) of the enzymatic treatment , and concentration of enzyme ( x3 ) , was established with the help of graphical and numerical optimization procedures resulting to desirable responses which were maximum yield , maximum clarity , and minimum viscosity . for graphical optimization ,
a three - dimensional response surface was plotted by varying the two variables in the experimental range while keeping rest one variable constant at the centre point .
the exact optimum value of individual and multiple responses was determined by a numerical optimization process using design expert software ( de6 ) ( trial version ; stat - ease inc . ,
the predictive models were validated on the basis of r , adjusted r , f - value , lack of fit , and so forth obtained from the analysis of the experimental data by using design expert software . for exploring the feasibility of the application of the crude enzyme in place of commercial enzymes , the usages of commercial enzymes
were compared with the crude enzymes under the optimized conditions , on the same variety of bael fruit .
principal component analysis was carried out by using software minitab version 16.1 ( trial version ; minitab inc . ,
usa ) to form a smaller number of uncorrelated variables from a large set of data .
a large number of variables are reduced to a few variables called principal components ( pcs ) that describe the greatest variance in the data analyzed .
the technique helps to understand the similarities and differences between the samples treated with crude and commercial enzymes separately and also establishes an interrelationship between the measured properties of the samples .
the juice extracted from enzyme treated and untreated ( control ) pulp was evaluated for the juice yield ( % ) , viscosity , and clarity . table 2 shows the juice yield , apparent viscosity , and clarity under the different experimental conditions by using crude enzyme .
it is clear from the data obtained that the juice has been improved significantly with respect to quantity as well as quality by the enzymatic treatment .
the model was judged for its fitness and adequacy by the coefficient of determination ( r ) , which is the ratio of the explained variation to the total variation .
the closer the r value to unity , the better the empirical model fits the actual data .
the coefficients of determination , r , in the model were 0.9764 , 0.9738 , and 0.9806 ( table 3 ) for the regressed models predicting the juice yield , viscosity , and clarity , respectively , suggesting a good fit for the models .
the adjusted r was a corrected value for r after elimination of the unnecessary model terms , which was very close to their corresponding r values for all the responses .
the f value of 45.92 , 41.38 , and 56.04 for juice yield , viscosity , and juice clarity , respectively , also inferred that the models were significant ( p < 0.001 ) .
the model for the juice yield , viscosity , and clarity can be derived by using the coefficients ( table 3 ) for the predictions of the data .
the coefficient of variation ( cv ) describes to which extent the data are dispersed and is defined as a measure of residual variation of the data relative to the size of the mean ; the small values of cv give better reproducibility .
the small cv values 1.31 , 1.33 , and 1.34 ( table 3 ) of juice yield , viscosity , and clarity , respectively , suggested that the experimental results were precise and reliable .
the yield was minimum when crude pectinase enzyme 0.06 ml/25 g pulp was used for 210 min at 55c , whereas the maximum juice yield was at 0.25 ml/25 g crude pectinase enzyme concentration for 375 min at 45c . to understand the interaction of different variables and to find the optimum level of each variable , the response surface curves were plotted .
the response surface curves for juice yield are shown in figures 1(a ) and 1(b ) .
each response surface curve explains the effect of two variables while keeping the third variable at middle level .
figure 1(a ) represents the interactive effect of incubation temperature ( x1 ) and incubation time ( x2 ) on the juice yield , whereas the concentration of crude enzyme ( x3 ) was kept at middle level , that is , 0.13 ml/25 g of bael pulp .
the juice yield increased with the increase in both time and temperature up to 473 min of time and 45.8c temperature . with further increase in temperature ,
the decrease in juice yield with increasing temperature beyond 45.8c may be due to denaturation of protein which may lead to decrease in enzyme activity at higher temperature .
the results are supported by the findings of kaur et al . , who reported that the maximum juice yield from guava is obtained by pectinolytic enzyme treatment of pulp at 43.3c temperature for 447 min of time .
figure 1(b ) presents the interaction effect of incubation temperature ( x1 ) and crude enzyme concentration ( x3 ) to juice yield . at higher temperature and enzyme concentration ,
the juice yield followed a linear behaviour which reflects that with increase in enzyme concentration and temperature , juice yield increased up to maximum concentration of enzyme , that is , 0.20 ml/25 g pulp and 45c temperature , respectively .
thereafter , the juice yield decreased slowly beyond 45c , which may be due to decrease in enzyme activity at higher temperature .
the increase in plum juice yield with pectinase enzyme is also supported by singh and das gupta who reported that pectinases increase the juice yield from 48% to 77.5% .
the viscosity of the bael juice ranged from 1.40 to 1.69 cps under the different experimental conditions ( table 2 ) .
the minimum viscosity was observed at 0.25 ml/25 g crude enzyme concentration for 375 min at 45c .
the corresponding condition for maximum viscosity was 0.06 ml/25 g crude enzyme concentration , for 210 min at 55c .
it is clear from figure 2(a ) that viscosity decreased with increase in both time and temperature up to 510 min of time and 44c temperature .
the findings are in accordance with kumar and sharma who reported that the viscosity of the juice decreased with increase in temperature up to 47c .
the temperature increases the rate of enzymatic reactions . upon enzyme treatment , degradation of pectin
leads to a reduction of water holding capacity , and consequently free water was released to the system thus reducing the viscosity of the juice .
figure 2(b ) presents the interaction effect of incubation temperature ( x1 ) and crude enzyme concentration ( x3 ) to viscosity .
the viscosity decreased with the increase in both concentration of enzyme and incubation temperature up to 0.20 ml/25 g of pulp of crude enzyme concentration and 40c temperature .
observed that the viscosity of the juice decreases when the enzyme concentration is increased from 0.01% to its maximum value ( 0.1% ) .
the clarity of the extracted juice was in a range from 16.60 to 21.10 % t. the minimum clarity was observed when 0.13 ml/25 g pulp , crude enzyme concentration was used for 375 min at 61.81c .
the rate of clarification increases with an increase in enzyme concentration may be due to the exposure of positively charged protein beneath , which reduces electrostatic repulsion between cloud particles causing these particles to aggregate into larger particles and eventually settled out .
multiple regression technique was used to develop a response surface analysis of juice clarity as a function of enzymatic hydrolysis process variables .
all the variables affected the juice clarity significantly ( table 2 ) . the time ( x2 ) had the most significant effect .
the response surface curves were plotted to explain the interaction of the variables and to determine the optimum level of each variable ( figures 3(a ) and 3(b ) ) .
figure 3(a ) shows the effect of incubation temperature ( x1 ) and time ( x2 ) on juice clarity keeping the third at its middle level .
it is clear from the figure that the clarity of the juice increased with both incubation time and temperature up to 509.60 min and 43.81c temperature , respectively .
observed that the clarity of the blended carrot - orange juice decreased when the temperature was increased above 50c .
figure 3(b ) reveals the effect of incubation temperature ( x1 ) and crude enzyme concentration ( x3 ) on the clarity of juice .
it was evident that the clarity of juice increased with increase in temperature up to 43.90c and crude enzyme concentration of 0.19 ml / per 25 g of pulp .
degradation of the polysaccharides like pectin leads to a reduction in water holding capacity , and consequently , free water is released to the system which increases the yield and clarity of juice . with further increase in the incubation temperature ,
the process was optimized by keeping the main constraints as maximum possible juice yield , maximum clarity , and minimum viscosity of juice . under these constraints ,
the optimum treatment conditions were found to be incubation temperature 44.97c , time 474.50 min , and concentration of crude enzyme 0.20 ml/25 g of pulp ( table 4 ) .
but practically , it is difficult to maintain the recommended conditions during processing , and it is expected that there may be some deviation .
hence , the optimum conditions were targeted as temperature 45c , time 475 min , and concentration of enzyme 0.20 ml/25 g of pulp .
the experiments were conducted to check the variation in juice yield , viscosity , and clarity of juice under the optimum conditions while keeping the target constraints .
the results indicate a high fit degree between the observed and predicted values from the regression model . the optimized conditions for the pretreatment of bael pulp using commercial enzymes were concentration of pectinase 5 mg/25 g of pulp ( 1.64 iu / mg ) , time 425 min , and temperature 47c ( table 4 ) , and the responses , juice recovery , viscosity , and clarity , were 84.5% , 1.35 cps , and 22.43%t , respectively , under the optimized conditions .
the juice yield , viscosity , and clarity from the crude enzyme treated pulp were 82.9% , 1.41 cps , and 21.32%t , respectively , under the optimized conditions .
it is evident from the data ( table 5 ) that the crude enzyme treatment is equally competitive to the commercial enzymes .
the possible cause of crude enzyme competitiveness may be a cumulative effect of other polysaccharases such as cellulases and hemicellulases along with the pectinases present in the crude enzyme . principal component analysis ( pca )
was used to obtain a lesser number of uncorrelated variables from a large set of data .
the objective of principal components analysis was to explain the maximum amount of variance with the least number of principal components .
the pca plots provide an overview of the similarities and differences between the crude and commercial enzyme treated samples and of the interrelationships among the various measured properties .
the distance between the locations of both the samples on the score plot is directly proportional to the degree of difference or similarity between them ( figure 4(b ) ) .
the score plot ( figure 4(b ) ) clearly indicates that the commercial enzyme treated sample shows maximum variance in first principal component , whereas crude enzyme treated sample shows maximum variance in second principal component .
therefore , the variables of commercial enzyme treated samples can be considered as significant first principal components .
maximum covariance of 57% was obtained in first principal component , whereas in second principal component , variances of 68% , 73% , and 5.1% were found for yield , viscosity , and clarity , respectively . the maximum eigen value in the correlation matrix was 3 , which was the nearest to the variance derived from clarity ; thereby , the variable clarity in second principal component can be considered as a significant variable to differentiate between crude and commercial enzymes treated juices .
it is evident from the loading plot of variables , that clarity and yield are correlated to higher degree as compared to the viscosity .
it is suggested from this analysis that only two variables that is , clarity and yield , are to be studied for comparing samples of juice treated with either of enzymes .
the present study concluded that bael juice yield , viscosity , and clarity are functions of enzymatic hydrolysis conditions .
significant regression model describing the variation of juice yield , viscosity , and clarity with respect to the independent variables , temperature , time , and concentration of crude enzyme , was found adequately fit to predict the responses under study . the usage of either crude or commercial enzymes significantly enhanced juice yield and clarity as compared to the control . according to principal component analysis
, it is suggested to study juice yield and clarity while comparing the different samples treated with either of the enzymes .
the study also indicates the equal effectiveness and competitiveness of crude enzyme as of commercial enzymes , and thus it may be one of the important considerations to reduce the processing cost . | the effect of incubation time , incubation temperature , and crude enzyme concentration was observed on the yield , viscosity , and clarity of the juice obtained from bael fruit pulp .
the recommended enzymatic treatment conditions from the study were incubation time 475 min , incubation temperature 45c , and crude enzyme concentration 0.20 ml/25 g bael fruit pulp .
the recovery , viscosity , and clarity of the juice under these conditions were 82.9% , 1.41 cps , and 21.32%t , respectively .
the variables , clarity , and yield were found as principal components for comparing different samples of the juice treated with enzyme . |
hypoparathyroidism - deafness - renal dysplasia ( hdr ) syndrome ( mim 146255 ) , also known as barakat syndrome , is a rare autosomal dominant disorder named from a triad of hypoparathyroidism , sensorineural deafness , and renal dysplasia .
sensorineural deafness could be the most common clinical feature , while hypoparathyroidism and renal dysplasia were described by various expressions and even could be asymptomatic , making a timely diagnosis of hdr syndrome more important .
gata binding protein 3 ( gata3 ) , a gene belonging to the family of zinc finger transcription factors and binding to the [ a / t ] gata [ a / g ] consensus sequence , is the only reported gene responsible for this unusual developmental disease .
located on chromosome 10p15 , gata3 contains two n - terminal transactivating domains ( ta1 and ta2 ) and two c - terminal zinc finger domains ( znf1 and znf2 ) , as shown in figure 1 . to date , more than fifty gata3 mutations related with both sporadic and familial hdr syndrome have been reported , and gata3 haploinsufficiency has been considered as the underlying mechanism . compared with sporadic cases , familial cases provide us the opportunity to explore the inheritance pattern and to consider the possible genetic anticipation in patients with hdr .
structure map of gata3 gene : gata3 contains 6 exons and the arrow denotes the mutation identified in family 7121 located within exon4 ; gata3 : gata binding protein 3 .
n : n - terminus ; ta : transactivating domains ; znf : zinc fingers domains ; c : c - terminus . in the present study , we identified a nonsense mutation in gata3 in a hearing impaired chinese family with various clinical features of hdr syndrome by using targeted capture and next - generation sequencing ( ngs ) .
in addition , auditory phenotype in familial hdr syndrome associated with gata3 mutation was analyzed by reviewing previous literatures .
a 7-year - old boy ( proband ) came from chinese family 7121 , a three - generation family with a segregating autosomal dominant hearing loss ( hl ) as shown in figure 2 , and four family members were recruited and gave written consent .
this study was approved by the ethics committee of chinese people 's liberation army general hospital .
, immittance testing , pure tone audiometric examination , and speech audiometry were performed on the three affected members to evaluate the auditory conditions .
the diagnosis of sensorineural hearing impairment was made according to the world health organization criteria available at http://www.who.int/. the degrees of hl were categorized as mild ( 2640 db hl ) , moderate ( 4160 db hl ) , severe ( 6180 db hl ) , and profound hl ( > 80 db hl ) . a computed tomography ( ct ) scan for the temporal bone of both ears was also performed on the proband .
biochemical laboratory tests included serum calcium , magnesium , phosphorus , and intact parathyroid hormone ( ipth ) levels , plasma creatinine , and carbamide levels , whereas urinalysis , renal ultrasound , and nuclear examinations were applied to detect the renal anomalies .
genomic dna was extracted from peripheral blood sample from the three affected members and one unaffected member .
after the examination of dna quality , beijing genomics institute built the dna libraries by following the illumina 's protocol , and then 307 deafness - related genes [ supplementary table 1 ] including exons , splicing sites , and their flanking introns were captured by using a custom probe and sequenced by illumina hiseq2000 ( illumina , san diego , ca , usa ) , which had been previously described .
targeted captured genes list the paired - end reads generated by sequencing were aligned to ncbi37/hg19 assembly by the burrows - wheeler alignment tool ( version 0.7.10 , http://bio-bwa.sourceforge.net/ ) , and variant calling was performed by genome analysis toolkit ( version 3.3 - 0 , https://software.broadinstitute.org/gatk/index.php ) .
variants with allele frequencies higher than 5% in the 1000 genomes project and the local database were excluded .
moreover , sift ( http://sift.jcvi.org/ ) and polyphen2 ( http://genetics.bwh.harvard.edu/pph2/ ) softwares were used to evaluate the pathogenic possibility of missense variants .
sanger sequencing was performed to establish the co - segregation of the candidate gene mutations with the phenotype in the family members .
a three - dimensional structure of gata3 was built by swiss - model ( http://swissmodel.expasy.org/workspace/ ) and then visualized by swiss - pdbviewer ( version 4.1 , http://spdbv.vital-it.ch/ ) .
then , a comprehensive inter- and intra - family comparison of clinical deafness characteristics was performed .
a 7-year - old boy ( proband ) came from chinese family 7121 , a three - generation family with a segregating autosomal dominant hearing loss ( hl ) as shown in figure 2 , and four family members were recruited and gave written consent .
this study was approved by the ethics committee of chinese people 's liberation army general hospital .
their medical histories were collected by a questionnaire . physical examination , otoscopy , immittance testing , pure tone audiometric examination , and speech audiometry were performed on the three affected members to evaluate the auditory conditions .
the diagnosis of sensorineural hearing impairment was made according to the world health organization criteria available at http://www.who.int/. the degrees of hl were categorized as mild ( 2640 db hl ) , moderate ( 4160 db hl ) , severe ( 6180 db hl ) , and profound hl ( > 80 db hl ) .
a computed tomography ( ct ) scan for the temporal bone of both ears was also performed on the proband .
biochemical laboratory tests included serum calcium , magnesium , phosphorus , and intact parathyroid hormone ( ipth ) levels , plasma creatinine , and carbamide levels , whereas urinalysis , renal ultrasound , and nuclear examinations were applied to detect the renal anomalies .
genomic dna was extracted from peripheral blood sample from the three affected members and one unaffected member .
after the examination of dna quality , beijing genomics institute built the dna libraries by following the illumina 's protocol , and then 307 deafness - related genes [ supplementary table 1 ] including exons , splicing sites , and their flanking introns were captured by using a custom probe and sequenced by illumina hiseq2000 ( illumina , san diego , ca , usa ) , which had been previously described .
targeted captured genes list the paired - end reads generated by sequencing were aligned to ncbi37/hg19 assembly by the burrows - wheeler alignment tool ( version 0.7.10 , http://bio-bwa.sourceforge.net/ ) , and variant calling was performed by genome analysis toolkit ( version 3.3 - 0 , https://software.broadinstitute.org/gatk/index.php ) .
variants with allele frequencies higher than 5% in the 1000 genomes project and the local database were excluded .
moreover , sift ( http://sift.jcvi.org/ ) and polyphen2 ( http://genetics.bwh.harvard.edu/pph2/ ) softwares were used to evaluate the pathogenic possibility of missense variants .
sanger sequencing was performed to establish the co - segregation of the candidate gene mutations with the phenotype in the family members .
a three - dimensional structure of gata3 was built by swiss - model ( http://swissmodel.expasy.org/workspace/ ) and then visualized by swiss - pdbviewer ( version 4.1 , http://spdbv.vital-it.ch/ ) .
literature review was performed by searching embase and pubmed databases . the genotypes and auditory phenotypes of these familial hdr syndrome cases
then , a comprehensive inter- and intra - family comparison of clinical deafness characteristics was performed .
all the three hearing - impaired family members were identified to carry out the same gata3 mutation .
the heterozygous c.826c > t ( nm_002051.2 ) is a nonsense mutation located within exon4 that resulted in a premature termination codon ( r276 * ) predicted to lead to gata3 haploinsufficiency [ figures 1 and 2 ] .
co - segregation of this mutation with the disease was confirmed by using sanger sequencing as shown in figure 3 .
the normal member among the siblings did not have the mutation , while the other three affected members were carrying the same nonsense mutation .
moreover , the absence of this mutation in the 1000 genomes project and 1751 ethnicity - matched normal hearing individuals further supported the pathogenicity .
sanger sequencing results and the co - segregation of the mutation with the phenotype in the family members with hypoparathyroidism - deafness - renal syndrome .
as shown in table 1 and figure 4 , the three affected members in family 7121 had early - onset sensorineural deafness .
the average hearing thresholds in the better ears of proband and his mother ( ii2 ) were 56 and 45 db hl , respectively , belonging to moderate hl according to the grades of hearing impairment from the world health organization . however , grandmother of proband ( i2 ) had profound hearing impairment with the average hearing threshold of 85 db hl .
the proband and his mother ( ii2 ) could communicate without any difficulty because their hearing disturbances were not severe .
pure - tone audiograms of the three affected family members with gata3 mutation p.r276 * : blue represents left ear , red represents right ear .
hl : hearing loss ; gata3 : gata binding protein . the results of biochemistry tests are summarized in table 1 .
clinically , they all had no symptom for hypoparathyroidism , but the assessment showed hypocalcemia , lower ipth level , and mild hyperphosphaturia .
in contrast , the urinalysis of all the affected members revealed no abnormalities and indicated a normal renal function .
however , nephrosonography showed that the proband had left renal agenesis while the other two affected family members had normal bilateral kidneys without any detectable abnormality .
the reported familial cases of hdr syndrome were summarized in table 2 by different mutations .
a total of 30 families carrying various gata3 abnormalities contained missense / nonsense mutations , small deletions and insertions ( indels ) , splicing , and gross deletions . all the corresponding onset time and laterality of hl
remarkably , nine parent - child pairs were proved to have hearing impairment earlier more than a decade or more severe in the younger generation , which was observed in 30% of all familial cases .
there was a significant difference in the types of the mutations in these nine familial cases , indicating a high proportion of premature stop mutations as much as 66.7% .
review of genotype and auditory phenotypes in familial hypoparathyroidism - deafness - renal syndrome * represents the stop of coding , hearing impairment occurred earlier at least a decade or more severe in parent - child pairs .
b : bilateral ; r : right ear ; l : left ear ; nm : not mentioned ; abr : auditory brainstem response ; no : no existence of deafness .
all the three hearing - impaired family members were identified to carry out the same gata3 mutation .
the heterozygous c.826c > t ( nm_002051.2 ) is a nonsense mutation located within exon4 that resulted in a premature termination codon ( r276 * ) predicted to lead to gata3 haploinsufficiency [ figures 1 and 2 ] .
co - segregation of this mutation with the disease was confirmed by using sanger sequencing as shown in figure 3 .
the normal member among the siblings did not have the mutation , while the other three affected members were carrying the same nonsense mutation .
moreover , the absence of this mutation in the 1000 genomes project and 1751 ethnicity - matched normal hearing individuals further supported the pathogenicity .
sanger sequencing results and the co - segregation of the mutation with the phenotype in the family members with hypoparathyroidism - deafness - renal syndrome .
as shown in table 1 and figure 4 , the three affected members in family 7121 had early - onset sensorineural deafness .
the average hearing thresholds in the better ears of proband and his mother ( ii2 ) were 56 and 45 db hl , respectively , belonging to moderate hl according to the grades of hearing impairment from the world health organization . however , grandmother of proband ( i2 ) had profound hearing impairment with the average hearing threshold of 85 db hl .
the proband and his mother ( ii2 ) could communicate without any difficulty because their hearing disturbances were not severe .
pure - tone audiograms of the three affected family members with gata3 mutation p.r276 * : blue represents left ear , red represents right ear .
hl : hearing loss ; gata3 : gata binding protein . the results of biochemistry tests are summarized in table 1 .
clinically , they all had no symptom for hypoparathyroidism , but the assessment showed hypocalcemia , lower ipth level , and mild hyperphosphaturia .
in contrast , the urinalysis of all the affected members revealed no abnormalities and indicated a normal renal function .
however , nephrosonography showed that the proband had left renal agenesis while the other two affected family members had normal bilateral kidneys without any detectable abnormality .
the reported familial cases of hdr syndrome were summarized in table 2 by different mutations .
a total of 30 families carrying various gata3 abnormalities contained missense / nonsense mutations , small deletions and insertions ( indels ) , splicing , and gross deletions . all the corresponding onset time and laterality of hl
remarkably , nine parent - child pairs were proved to have hearing impairment earlier more than a decade or more severe in the younger generation , which was observed in 30% of all familial cases .
there was a significant difference in the types of the mutations in these nine familial cases , indicating a high proportion of premature stop mutations as much as 66.7% .
review of genotype and auditory phenotypes in familial hypoparathyroidism - deafness - renal syndrome * represents the stop of coding , hearing impairment occurred earlier at least a decade or more severe in parent - child pairs .
b : bilateral ; r : right ear ; l : left ear ; nm : not mentioned ; abr : auditory brainstem response ; no : no existence of deafness .
in the present study , a heterozygous gata3 nonsense mutation c.826c > t ( p. r276 * ) was identified in a chinese hdr family 7121 by applying a combination of the target deafness genes capture and ngs . initially , all the affected members from three generations came to consult for their autosomal dominant hearing disturbances .
then , hdr syndrome was diagnosed precisely and effectively by using advanced genetic testing technology although there was no symptom of hypocalcemia and renal agenesis .
the mutation c.826c > t ( p.r276 * ) reported in the present study had been identified in a family 12/99 by van esch et al . in the year 2000 .
the identification of r276 * in the chinese family 7121 further ensured its pathogenic possibility in hdr syndrome : ( 1 ) sanger sequencing confirmed the co - segregation of this mutation with the phenotype in chinese family 7121 , and this specific mutation was absent in both the 1000 genomes and 1751 ethnicity - matched controls ; ( 2 ) the location of mutation c.826c > tin gata3 was visualized clearly and this nonsense mutation resulted in truncating gata3 protein completely by losing both znf1 and znf2 domains [ figures 1 and 5 ] .
notably , the two zinc fingers domains were described to be necessary for gata3 protein in binding to dna as well as the stabilization of binding function .
further functional studies demonstrated that cochlear wiring and postsynaptic differentiation were disrupted without normal gata3 expression .
three - dimensional structure of gata3 wild - type created by swiss - model mutation p.r276 * causing loss of both znf1 and znf2 domains .
gata3 : gata binding protein 3 . clinical spectrum of hdr syndrome includes hypoparathyroidism , sensorineural deafness , and renal dysplasia . as previously reported , about 62.3% of the patients had complete clinical triad in hdr syndrome .
the patients carrying the same mutation p.r276 * in another european family displayed different clinical phenotypes .
contrary to the chinese family 7121 , the two affected members in 12/99 family did not have any renal anomaly .
moreover , clinical features of patients with hdr syndrome were variable even in the same chinese family 7121 , which was also observed in other cases .
in fact , due to the high heterogeneous expression in individuals , it is not easy for clinicians to make a distinction between human nonsyndromic and syndromic hereditary hl such as hdr syndrome .
therefore , ngs technology could be a powerful tool in early diagnosis and appropriate management .
genetic anticipation is a biological symptom in successive generation , in which the pedigrees appear to have earlier onset or more severity in the disease tendency .
considering the existing ascertainment bias , we insist on the presence of genetic anticipation that only a different decade is significant and reveal that at least 30% of familial cases ( a total of 9 families ) showed the possible genetic anticipation , which might be one of the characteristics of familial hdr syndrome .
this information is especially important for assisting with family planning in genetic consulting . to our knowledge ,
a number of genetic diseases such as charcot - marie - tooth disease , lynch syndrome , and familial essential tremor have been recognized with anticipation in the different mechanisms including trinucleotide repeat expansion , telomeric dysfunction as well as epigenetic factors .
regarding the study , gata3 mutation analysis in table 2 reflected a high proportion of premature stop mutations in familial patients with the possible genetic anticipation , which might be associated with the potential mechanism . in conclusion ,
we have described a three - generation hearing impaired family with gata3 nonsense mutation p.r276 * , which was identified in chinese population for the first time by targeted genes capture and ngs technology .
an overview of familial cases revealed a decrease in the age at onset of deafness or more severity between generations in 30% of families , indicating the presence of possible anticipation .
further studies are needed to elucidate the molecular mechanisms of this phenomenon in hdr syndrome .
supplementary information is linked to the online version of the paper on the chinese medical journal website .
this work was supported by grants from the national natural science foundation of china ( no .
2014cb943001 ) , and the china postdoctoral science foundation ( no . 2015m572766 and no .
this work was supported by grants from the national natural science foundation of china ( no .
2014cb943001 ) , and the china postdoctoral science foundation ( no . 2015m572766 and no .
| background : hypoparathyroidism - deafness - renal dysplasia ( hdr ) syndrome is an autosomal dominant disorder primarily caused by haploinsufficiency of gata binding protein 3 ( gata3 ) gene mutations , and hearing loss is the most frequent phenotypic feature .
this study aimed at identifying the causative gene mutation for a three - generation chinese family with hdr syndrome and analyzing auditory phenotypes in all familial hdr syndrome cases.methods:three affected family members underwent otologic examinations , biochemistry tests , and other clinical evaluations .
targeted genes capture combining next - generation sequencing was performed within the family .
sanger sequencing was used to confirm the causative mutation .
the auditory phenotypes of all reported familial hdr syndrome cases analyzed were provided.results:in chinese family 7121 , a heterozygous nonsense mutation c.826c > t ( p.r276 * ) was identified in gata3 .
all the three affected members suffered from sensorineural deafness and hypocalcemia ; however , renal dysplasia only appeared in the youngest patient .
furthermore , an overview of thirty hdr syndrome families with corresponding gata3 mutations revealed that hearing impairment occurred earlier in the younger generation in at least nine familial cases ( 30% ) and two thirds of them were found to carry premature stop mutations.conclusions:this study highlights the phenotypic heterogeneity of hdr and points to a possible genetic anticipation in patients with hdr , which needs to be further investigated . |
the prevalence of type 2 diabetes mellitus ( t2 dm ) is rising globally , especially in asian indians . decreased bone mineral density ( bmd )
is an established complication of type 1 diabetes mellitus and has been attributed to early age at diagnosis leading to decreased bone accrual , long duration , prolonged poor glycemic control and high insulin doses .
several studies have shown that bmd at the lumbar spine and femoral neck were either similar , increased or rarely decreased in comparison with healthy controls .
the exact pathophysiology behind the bmd changes in t2 dm has not been well elucidated .
bone mineral density in diabetics is influenced by factors like calcium balance , osteoblast function , advanced glycation end products in bone collagen , inflammatory cytokines like leptin , peroxisome proliferator - activated receptors ( ppar ) isoform status and vitamin d status .
high bmd in most of the recent studies with t2 dm is secondary to lower bone volume and functional hypoparathyroidism .
there are no studies regarding bmd status in t2 dm without known complications in the asian indian population or of the various factors affecting it : viz sunlight , vitamin d status and lifestyle .
hence , we studied the bmd profile and its relation if any , to clinical , hormonal and metabolic factors in asian indian t2 dm patients .
it is a cross sectional prospective observational study comparing the bmd of t2 dm patients with that of sex matched healthy volunteers who attained peak bone mass ( pbm ) .
diagnosis of t2 dm was based on american diabetic association ( ada ) criteria , 2008 .
subjects with t2 dm were recruited from outpatient endocrinology department of tertiary care hospital in india .
sex matched healthy control subjects who had crossed the age for pbm were recruited from community based health camps .
the study was approved by the institutional ethics committee and a written informed consent was obtained from all participants .
two hundred and fourteen t2 dm patients were screened for the study of which 21 refused to participate in the study .
one hundred and ninety four ( 97 men and 97 women ) t2 dm patients and 571 healthy volunteers ( 262 men and 309 women ) aged between 30 to 50 years formed the study participants .
postmenopausal status , smoking ( > 1 year ) , chronic alcoholism , serum creatinine > 1.4 mg / dl , pre - existing hypogonadism , hypopituitarism , thyrotoxicosis , past or present drug intake that may alter bone metabolism ( e.g. , vitamin d supplements , steroids , bisphosphonates , cytotoxics , anticonvulsants , thyroxine ) and evidence of diabetic end organ complications constituted the exclusion criteria .
diabetes and other medical conditions were ruled out with appropriate investigations in controls and their baseline demographic data with bmd were used for this study .
the diabetic study group underwent biochemical and hormonal evaluation along with bmd and study related procedures .
a detailed clinical evaluation of the diabetes patients with respect to its treatment ( sulfonylureas , metformin , thiazolidinediones and statins ) and presence of complications was carried out .
subjects with body mass index ( bmi ) > 25 kg / m were considered obese . sunlight exposure ( to exposed areas especially face and hands ) in terms of duration of outdoor activity , weekly schedule and outdoor attire
the rule of nine was adapted to estimate the fraction of body surface area exposed to sunlight by each subject 's usual outdoor attire .
physical activity was evaluated by global physical activity questionnaire developed by world health organization ( who ) .
nutritional intake was calculated using a questionnaire with specific reference to dietary intake of energy , protein , calcium and phosphorous .
biochemical investigations included serum calcium , phosphorus , alkaline phosphatase ( normal range 30 - 150
iu / l ) , albumin , creatinine , glycosylated hemoglobin ( hba1c ) , fasting lipid profile and urine calcium creatinine ratio ( ur.cr/ca ) .
hormonal investigations included parathyroid hormone ( pth ) ( intra assay coefficient of variation ( cv ) : 5.5 - 6.3% , inter assay coefficient of variation ( ce ) : 7.9 - 8.6% and analytical sensitivity ( s ) : 3 pg / ml ) , serum 25-hydroxy vitamin d ( 25(oh ) d ) ( cv : 8.2 - 11% , ce : 9.6 - 12.5% , s : 1.5 ng / ml ) , follicular stimulating hormone ( fsh ) ( cv : 2.3 - 3.7% , ce : 5.4 - 6.7% , s : 0.1
iu / l ) , leutinising hormone ( lh ) ( cv : 4.8 - 6.5% , ce : 7.2 - 26% , s : 0.1
iu / l ) , estradiol ( e2 ) ( cv : 6.3 - 15% , ce : 6.4 - 16% , s : 15 pg / ml ) , testosterone ( t ) ( cv : 4.9 - 17% , ce : 6.0 - 12% and s : 15 ng / dl ) , sex hormone - binding globulin ( shbg ) ( cv : 4.1 - 7.7% , ce : 5.8 - 13% and s : 0.2 nmol / l ) , total tri - iodothyronine ( t3 ) ( cv : 5.4 - 13.2% , ce : 7.7 - 15.6% and s : 35 ng / dl ) , total tetra - iodothyronine ( t4 ) ( cv : 6.3 - 8.4% , ce : 6.7 - 9.8% and s : 0.4 g / dl ) , thyroid stimulating hormone ( tsh ) ( cv : 3.9 - 13.8% , ce : 8 - 17.5% and s : 0.004 iu / ml ) and urine free deoxypyridinoline ( ur.dpd ) ( cv : 8 - 15% , ce : 8 - 20% and s : 6 nm ) .
we estimated calculated free testosterone ( cft ) from total testosterone and shbg , using the method of vermeulen et al .
, by a computer program ( free and bioavailable testosterone calculator , developed at the hormonology department , university hospital , ghent , belgium and available at http://www.issam.ch/freetesto.htm ) .
all hormonal investigations except 25(oh ) d were done by chemiluminescent immunometric assay with immulite 1000 system of diagnostic products corporation , los angeles , usa .
serum 25(oh ) d levels of > 30 ng / ml , 20 - 30 ng / ml and < 20 ng / ml were taken as suggestive of vitamin d sufficiency , insufficiency and deficiency respectively .
assessment of bmd was performed with the dual energy x - ray absorptiometry ( dxa ) ( hologic inc .
measurements included dxa of the total hip , left femoral neck , intertrochanter , ward 's area and lumbar spine ( posterior anterior projection ) .
all the above sites were used to divide the diabetes study group into groups i [ normal bmd ( z score > -2 ) ] and ii [ low bmd ( z score < -2 ) ] , but only the total hip and lumbar spine were used to compare bmd in the study group and the controls .
bmi matched controls were selected with bmi criteria of 22 - 30 kg / m in men and 24 - 30 kg / m in women .
the short term in vivo precision ( cv% ) of dxa unit were as follows : lumbar spine-1.09% , femoral neck-3.29% and total hip-1.26% , intertrochanter-3.09% , wards area-2.04% .
bmd was reported in terms of g / cm and also in z - scores .
z - scores were based on the caucasian normative database in the absence of normative data in asian indians .
all results are expressed as mean standard deviation of the mean ( sd ) and median .
the statistical significance between means was calculated by student 's t - test , analysis of variance or mann - whitney u test when appropriate .
multivariate linear regression analysis was used to determine independent associates of bmd in the diabetes group .
assessment of bmd was performed with the dual energy x - ray absorptiometry ( dxa ) ( hologic inc .
measurements included dxa of the total hip , left femoral neck , intertrochanter , ward 's area and lumbar spine ( posterior anterior projection ) .
all the above sites were used to divide the diabetes study group into groups i [ normal bmd ( z score > -2 ) ] and ii [ low bmd ( z score < -2 ) ] , but only the total hip and lumbar spine were used to compare bmd in the study group and the controls .
bmi matched controls were selected with bmi criteria of 22 - 30 kg / m in men and 24 - 30 kg / m in women .
the short term in vivo precision ( cv% ) of dxa unit were as follows : lumbar spine-1.09% , femoral neck-3.29% and total hip-1.26% , intertrochanter-3.09% , wards area-2.04% .
bmd was reported in terms of g / cm and also in z - scores .
z - scores were based on the caucasian normative database in the absence of normative data in asian indians .
all results are expressed as mean standard deviation of the mean ( sd ) and median . the statistical significance between means
was calculated by student 's t - test , analysis of variance or mann - whitney u test when appropriate .
multivariate linear regression analysis was used to determine independent associates of bmd in the diabetes group .
the diabetes study group consisted of 97 m and 97 f each , respectively ( age range : 30 - 50 years ) with t2 dm without micro or macrovascular complications
ninety eight ( 58 : fand 40 : m ) patients ( 51% ) were obese .
the general characteristics of the study group in the diabetes study group , 156 ( 76 : mand 80 : f ) had normal bmd , i.e. , group i. bmd greater than the mean of the age and sex matched caucasian controls ( z score > 0 ) was seen in 75 of 156 with normal bmd ( 48% ) .
low bmd was present in 38 ( 21 m and17 f ) , i.e. , group ii .
the control group was significantly younger and had a lower bmi than the study group .
a comparison of baseline characteristics in t2 dm showed a significant increase in weight and bmi in group i ( m and f ) [ table 2 ] .
the mean duration of t2 dm ( 41.1 vs 41.3 years ) was not significantly different in groups i and ii , respectively .
glycemic control was similar in both groups i and ii ( mean hba1c : 7.26 vs 7.44 ) .
bmd in t2 dm patients was significantly higher than that of the control group in all regions of interest except in total hip in men [ table 3 ] .
in a subgroup of controls with matched bmi ( m-161 ; f-114 ) , the difference in bmd and z - scores between the diabetes group and the controls was no longer significant at both lumbar spine and total hip .
comparison of different baseline characteristics in t2 dm patients based on bmd comparison of bmd of control and diabetes study cohorts patients on statin ( atorvastatin 10 - 40 mg , mean of 12.7 mg ) treatment for a minimum of 6 m were compared in group i ( n-109 ) and group ii ( n-23 ) .
there was no significant difference in the use of statins between them in our study .
patients exposed to thiazolidinedione ( rosiglitazone ( n-6,2 - 8 mg , mean : 4.7 mg ) ; pioglitazone ( n-16,15 - 45 mg , mean : 28.8 mg ) ) were evaluated for any correlation with bmd .
there was no significant difference in use of thiazolidinediones between groups i and ii ( m and f ) .
this could be due to the small subgroup size ( only 22 patients were on thiazolidinediones ) .
the mean calorie intake was similar in groups i and ii ( m and f ) . in group
i the calcium intake was 782 mg / d and 590 mg / d in males and females respectively , while in group ii it was 715 mg / d and 514 mg / d , respectively [ table 4 ] .
the calcium / phosphorus ratio was 0.45 and 0.47 in group i males and females respectively , while in group ii it was 0.53 and 0.57 respectively .
calcium / protein ratio ( mg / g ) was also low ( < 13 ) in groups i and ii ( m and f ) .
comparison of dietary parameters in t2 dm patients based on bmd parathyroid hormone was normal in group i ( m and f ) but elevated in male patients in group ii [ table 5 ] .
serum calcium , phosphorus , alkaline phosphatase , u.ca/cr and u.dpd/cr ratios were not significantly different among groups i and ii ( m and f ) .
there was also no correlation in levels of e2 and cft with bmd ( m and f ) .
comparison of biochemical parameters in patients with t2 dm based on bmd there was no significant statistical difference in 25(oh ) d levels between groups i and ii ( m and f ) [ table 6 ] . in the diabetes study group as a whole , 8.2% , 42.3% and 49.5% of men had normal , insufficient and deficient 25(oh ) d levels respectively .
similarly , 2.1% , 34% and 63.9% of women had normal , insufficient and deficient 25(oh ) d levels respectively [ figure 1 ] .
the mean 25(oh ) d level of our diabetes subjects was 20.3 ng / ml ( m ) and 17.1 ng / ml ( f ) .
there was no correlation with the 25(oh ) d levels and bmd in our cohort .
distribution of vitamin d status in t2 dm patients based on bmd distribution of vitamin d status in type 2 dm patients physical activity was found to be moderate in groups i and ii ( m and f ) and there was no significant difference between them .
similarly , the sunlight exposure was comparable in both groups i and ii ( m and f ) , ( 143.54 vs 132.05 minutes per week in males and 108.19 vs 92.06 min per week in females respectively ) .
a multiple linear regression analysis of affecting factors in the diabetes study group ( both men and women taken together and separately ) , showed bmi and weight to be independent predictors of bmd at both the spine and hip [ table 7 ] .
sex was an independent predictor of bmd at the total hip in the whole study group .
other variables like age , estradiol , free testosterone and calcium intake , when evaluated , were not independently associated with bmd .
the mean calorie intake was similar in groups i and ii ( m and f ) . in group
i the calcium intake was 782 mg / d and 590 mg / d in males and females respectively , while in group ii it was 715 mg / d and 514 mg / d , respectively [ table 4 ] .
the calcium / phosphorus ratio was 0.45 and 0.47 in group i males and females respectively , while in group ii it was 0.53 and 0.57 respectively .
calcium / protein ratio ( mg / g ) was also low ( < 13 ) in groups i and ii ( m and f ) .
parathyroid hormone was normal in group i ( m and f ) but elevated in male patients in group ii [ table 5 ] .
serum calcium , phosphorus , alkaline phosphatase , u.ca/cr and u.dpd/cr ratios were not significantly different among groups i and ii ( m and f ) .
there was also no correlation in levels of e2 and cft with bmd ( m and f ) .
there was no significant statistical difference in 25(oh ) d levels between groups i and ii ( m and f ) [ table 6 ] . in the diabetes study group as a whole , 8.2% , 42.3% and 49.5% of men had normal , insufficient and deficient 25(oh ) d levels respectively .
similarly , 2.1% , 34% and 63.9% of women had normal , insufficient and deficient 25(oh ) d levels respectively [ figure 1 ] .
the mean 25(oh ) d level of our diabetes subjects was 20.3 ng / ml ( m ) and 17.1 ng / ml ( f ) . there was no correlation with the 25(oh ) d levels and bmd in our cohort .
distribution of vitamin d status in t2 dm patients based on bmd distribution of vitamin d status in type 2 dm patients
physical activity was found to be moderate in groups i and ii ( m and f ) and there was no significant difference between them . similarly , the sunlight exposure was comparable in both groups i and ii ( m and f ) , ( 143.54 vs 132.05 minutes per week in males and 108.19 vs 92.06 min per week in females respectively ) .
a multiple linear regression analysis of affecting factors in the diabetes study group ( both men and women taken together and separately ) , showed bmi and weight to be independent predictors of bmd at both the spine and hip [ table 7 ] .
sex was an independent predictor of bmd at the total hip in the whole study group .
other variables like age , estradiol , free testosterone and calcium intake , when evaluated , were not independently associated with bmd .
bmd in t2 dm is determined by various pathogenetic factors and several acquired conditions pertaining to diabetes .
circulating insulin / insulin growth factors and estrogen levels are the most important among the pathogenetic factors . a majority of studies on bmd in t2 dm
have documented increased or normal bmd in different areas of the body using different modalities .
fremantle diabetes study ( fds ) by rakic et al . documented an increase in bmd in t2 dm in both sexes .
the bmd in the femoral neck were 0.851 and 0.808 gms / cm in males and females respectively , and in the total spine was 1.117 and 1.031 gms / cm and was greater than the age and sex matched non - diabetic controls .
. this could be largely due to the fact that indians typically have bmd which is approximately 5% lower than the caucasian population .
tuominen et al . , and sosa et al . , documented normal bmd in t2 dm . decreased bmd was documented by guven et al . , and al - maatouq et al .
guven et al . , documented a femoral neck bmd of 0.769 and 0.716 gms / cm in men and women respectively and lumbar spine bmd of 0.912 and 0.845 gms / cm in the same cohort , respectively .
both the studies , done in a predominantly muslim population had control groups with higher bmd . a majority of studies show no correlation of bmd to glucose control .
however , the fremantle study of 194 t2 dm patients showed that hba1c was independently associated with bmd at the hip and femoral neck .
the diabetes study group when compared to the non - diabetic control group had a higher bmi and this was statistically significant in both sexes in our study .
studies done by strotmeyer et al . , have uniformly shown bmi to be an important variable affecting bmd .
obesity itself is known to be associated with an increased bone mass in most studies .
since t2 dm is preceded by a period of insulin resistance , it is postulated that hyperinsulinemia may confer a protective effect on bmd , either directly through elevated fasting insulin or indirectly through bmi .
obesity could have the additional favorable effect of decreasing shbg levels and increasing the production of metabolically active free estrogen .
it leads to increased osteoblastic differentiation and may also reduce osteoclastogenesis by altering the expression of rankl and osteoprotegerin in stromal cells .
the aromatization of androgens to estrogens in adipose tissue represents an important source of estrogen , which is anabolic for bone .
statins are reportedly associated with an increase in bone morphogenic protein-2 , a protein that plays an important role in osteoblast differentiation and bone formation .
documented an increase in bmd in the femoral neck and total hip but not at the lumbar spine in patients on statin therapy .
ppar- is essential for normal adipocyte differentiation and proliferation as well as fatty acid uptake and storage .
schwartz et al . , documented increased bone loss at total body , trochanter and lumbar spine in women with the use of thiazolidinediones .
it is in contrast however , to the study by harinarayan et al . from south india
where the calcium intake was less than the indian council of medical research recommendations of 400 mg / d across socioeconomic status and vitamin d levels .
there was a significant difference in pth levels in group ii in men as compared to group i. this can not be explained by vitamin d deficiency , as the vitamin d levels were comparable in groups i and ii ( m and f )
. the mean 25(oh ) d level of our study group was lower than that in fds which could be attributed to increased skin pigmentation , crowded housing with limited sunlight exposure , smog , and the angle of ultraviolet rays .
duration of sunlight exposure is positively correlated with bone density and 25(oh ) d levels in various studies .
there was no significant difference in sun exposure between groups i and ii ( m and f ) subjects with t2 dm .
vitamin d deficiency and insufficiency was seen in 50% and 42% of male diabetes study subjects and 64% and 34% of female diabetes study subjects , respectively , despite adequate sunlight exposure .
cross sectional studies have shown a positive correlation between bmd and exercise while interventional studies suggest that high impact exercises are better at increasing bmd .
moderate physical activity has also been documented to lead to better bone health in studies in t2 dm in contrast to heavy physical activity .
physical activity was found to be moderate in groups i and ii ( m and f ) in our study and there was no significant difference between them .
most recent studies regarding bone mineral changes in t2 dm have shown increased density . in our study , more than 80% of subjects with diabetes had normal bmd . life style measures including adequate sunlight exposure , good calcium intake and moderate physical activity seen in our subjects could be significant factors contributing to normal bmd .
however , the effect of age is likely to be minimal once it has crossed the age for peak bone mass .
the bmd of t2 dm patients is moreover , greater than the controls , who recently attained peak bone mass .
comparison with the caucasian database could have resulted in overestimation of low bmd and underestimation of normal bmd in our study .
a comparative study of factors affecting bmd in the non - diabetic control group would have added strength to our study .
bmd of t2 dm asian indian subjects following up in a tertiary care hospital in india was similar to that of the general population .
weight and bmi had the most significant impact on bmd in both men and women . | objective : to assess bone mineral density ( bmd ) in type 2 diabetes mellitus ( t2 dm ) patients and its relation , if any , to clinical , hormonal and metabolic factors.materials and methods : a prospective evaluation of 194 t2 dm patients ( 97 men and 97 women ) was carried out .
bmd was done with dual energy x - ray absorptiometry ( dxa ) at the lumbar spine and total hip .
physical activity , nutritional intake and sunlight exposure were calculated .
biochemical and hormonal tests included serum 25 hydroxy vitamin d [ 25(oh ) d ] , parathyroid hormone , estrogen , testosterone and urinary calcium - creatinine ratio .
glycosylated hemoglobin and complete lipid profiles were done in patients with diabetes .
five hundred and seventy one non - diabetic controls ( 262 males and 309 females ) were evaluated for bmd alone.results:bmd was normal ( z score > -2 ) in 156 ( 80.5% ) and low ( z score -2 ) in 38 ( 19.5% ) patients in the diabetes study group .
bmd in the diabetes group was significantly higher than the control group in both sexes at the hip and spine .
the difference was no longer significant on analysis of a bmi matched control subgroup .
weight and bmi showed significant correlation to bmd .
duration of t2 dm , degree of glycemic control , use of drugs like statins and thiazolidinediones , 25(oh ) d levels , calcium intake , sunlight exposure and physical activity did not significantly affect bmd in this cohort of individuals with diabetes.conclusions:bone mineral density of asian indian t2 dm subjects was similar to that of healthy volunteers in this study . |
zostao dobrze udokumentowane , e starszy wiek , przewleke choroby wspistniejce ( takie jak cukrzyca , przewleka obturacyjna choroba puc itp . )
i pogorszy oglne wyniki operacji pomostowania aortalno - wiecowego ( coronary artery bypass cabg ) z jednoczesn napraw niedokrwiennej niedomykalnoci zastawki mitralnej .
przeanalizowano retrospektywne dane 394 pacjentw po cabg i zaopatrzeniu zastawki mitralnej ( gwnie anuloplastyce ) .
pacjentw podzielono na grupy wedug wieku , obecnoci cukrzycy oraz frakcji wyrzutowej lewej komory ( left ventricular ejection fraction lvef ) .
dane echokardiograficzne , wskaniki powika pooperacyjnych ( wstrzs kardiogenny , przedoperacyjny zawa minia sercowego , krwawienie z przewodu pokarmowego , zaburzenia poznawcze , udar , posocznica , gbokie zakaenie rany operacyjnej ) oraz wczesn
pacjenci z cukrzyc nie wykazywali zmian pomidzy przed- i pooperacyjn klas nyha , a okoooperacyjna niedomykalno zastawki mitralnej wystpowaa wrd nich czciej ni u pacjentw bez cukrzycy ( odpowiednio 10,3% i 3,1% , p < 0,05 ) .
we wszystkich grupach lvef niedomykalno zostaa znaczco zmniejszona , jednake przebudowa lewej komory bya wyrana jedynie u pacjentw z , , niskimi
i , , umiarkowanie obnionymi wartociami lvef . wspomniane trzy grupy nie rniy si pod wzgldem powika pooperacyjnych .
starszy wiek , wspistniejca cukrzyca i obniona warto lvef nie wpywaj na wczesn i odleg miertelno , w tym na wczesne wyniki pooperacyjnej naprawy niedokrwiennej niedomykalnoci zastawki mitralnej po cabg .
ischemic mitral regurgitation ( mr ) is caused by local and global myocardial ischemia , leading to altered global and regional myocardial contraction and geometry , which subsequently leads to mitral valve apparatus distortion and insufficiency .
the surgical approach is expected to lead to reverse left ventricular remodeling after surgery and is associated with improved symptoms and prognosis .
it is debatable whether mild mr should be repaired during the cabg surgery [ 2 , 3 ] , although most authors agree that cabg and mitral valve ( mv ) repair surgery improve the chances of survival despite the degree of mr [ 1 , 47 ] .
it is obvious that early and late postoperative outcomes depend not only on the type of surgery , but also on the preoperative patient condition , including comorbidities as well .
usually , patients with a coronary artery disease are older and tend to have impaired left ventricular function and the presence of chronic concomitant diseases ( such as diabetes mellitus , metabolic syndrome , obesity , chronic obstructive lung disease , etc . ) . though nowadays more and more authors claim good postoperative outcomes in the elderly , kang et al . found in their study that patients age was an independent determinant increasing postoperative mortality after cabg followed by mv repair .
claim that the risk factors associated with late death include older age and insulin treated diabetes .
stated in their paper that diabetes ( diet and insulin controlled ) and lv systolic function were among the most significant factors of long - term survival in patients under the age of 65 . a recent extensive study by ranucci et al . showed that age and lvef do not increase mortality in low risk patients , but greatly increase mortality in high operative risk patients .
very similar results were obtained by sadeghi et al . , who found that age , poor lv function , and neurologic disorders were risk factors associated with the overall mortality rate .
our study was designed to explore the influence of older age , the presence of diabetes , and lvef on early and late postoperative outcomes in patients after cabg and mv repair surgery .
during the period of 2000 - 2011 , 1385 patients underwent mitral valve repair surgery in kaunas hospital , lithuanian university of health sciences .
five hundred and ninety - four of them underwent a coronary artery bypass with concomitant mv repair for ischemic mitral regurgitation ( mr ) .
patients who underwent the emergency procedure and those who had complex surgery ( e.g. other heart valves were repaired or replaced and/or a carotid endarterectomy was performed ) were excluded .
since the data were collected retrospectively , some of the patients , whose data were incomplete , also were excluded from the study . finally , retrospective data of 394 patients were analyzed .
patients were divided into groups according to their age and the presence or absence of diabetes mellitus ( dm ) and lvef . based on their age ,
the patients were divided into group a ( 70 years and older ) and group b ( younger than 70 years ) . based on dm ,
patients were divided into those with dm ( dm ( + ) ) and without dm ( dm ( ) ) . and finally , all patients were grouped according to their lvef : group i included patients who had poor lvef ( < 30% ) , group ii included patients with lowered lvef ( 50% < lvef 30% ) , and group iii included patients with good lvef ( 50% ) .
operative data ( cardiopulmonary bypass time , aortic cross - clamp time , postoperative ventilation time , and intensive care unit ( icu ) stay ) were compared between the groups . left ventricular systolic and diastolic function and reverse positive remodeling were evaluated analyzing transthoracic echocardiographic ( tte ) data before and three months after the surgery and were compared in each group .
the left ventricular end diastolic diameter ( lvedd ) was evaluated from the parasternal long axis , and lvef was calculated using simpson 's method . left ventricular diastolic function was evaluated by measuring the decrease of the early diastolic filling velocity the deceleration time ( dt ) .
the mr grade was evaluated from the apical four - chamber view using color flow doppler .
the rate of postoperative complications ( cardiogenic shock , perioperative myocardial infarction , bleeding from gastrointestinal tract , cognitive disorders , stroke , sepsis , deep wound infection ) , as well as the early and late mortality rate were evaluated and compared between paired groups . during the surgery ,
standard endotracheal anesthesia was applied ( 3 gkgh fentanyl , 1 - 4 mg / h midazolam , and 1.5 - 2% minimal alveolar concentration sevoflurane , depending on the hemodynamic status ) . the cardiopulmonary bypass ( cpb ) system was filled with 1,500 ml of ringer 's acetate solution and 1,000 units of heparin .
a roller pump , a membrane oxygenator ( dideco d703 , mirandola ) , and a venous reservoir were used for cpb .
coronary artery bypass was performed using the standard technique via mid line sternotomy using cold ( 4c ) crystalloid antegrade cardioplegia ( st . thomas solution ) and a conventional cardiopulmonary bypass ( cpb ) using bicaval cannulation .
distal anastomoses were constructed first , the proximal ones on the beating heart and a side clamp on the aorta .
cardiopulmonary bypass was performed under normothermia or deliberate temperature drifting down , but no less than 32c core temperature .
double semi purse 2/0 ethibond ( johnson & johnson ) suture , reinforced with teflon pledgets , was used . using annuloplasty sutures ,
the mv annulus was constricted to the size ( area ) of the anterior mitral valve leaflet .
no patient left the operating room with a residual mr grade higher than 1 under transesophageal echocardiography ( tee ) control .
after the surgery , patients were transferred to the icu . during the surgery and in the icu ,
mmol / l , patients received an intravenous bolus of four units of insulin every hour . if the blood glucose level increased over 10
mmol / l , a continuous infusion of insulin was administered to keep the blood glucose below 8 mmol / l .
the quantitative data are presented as the mean and the standard deviation ( m sd ) .
the analyzed parameters were described using the general statistical status , distribution , and symmetry .
the tests of kolmogorov - smirnov and shapiro - wilk were used to check the normal data distribution .
when the statistical hypothesis was verified , the following criterion was used : p < 0.05 ( statistically significant ) . the p - value is the marginal level of statistical significance in hypothesis verification .
the quantitative data are presented as the mean and the standard deviation ( m sd ) .
the analyzed parameters were described using the general statistical status , distribution , and symmetry .
the tests of kolmogorov - smirnov and shapiro - wilk were used to check the normal data distribution .
when the statistical hypothesis was verified , the following criterion was used : p < 0.05 ( statistically significant ) . the p - value is the marginal level of statistical significance in hypothesis verification .
71.57% ( 282 ) of the patients were women and 28.17% ( 111 ) were men .
the cardiopulmonary bypass time , the aortic cross - clamp time , the artificial lung ventilation time and the duration of stay in the icu did not differ between the paired groups ( table i ) .
comparison of operative data between groups ao aorta , alv artificial lung ventilation , cpb cardiopulmonary bypass , dm ( + ) group with diabetes mellitus , dm ( ) group without diabetes mellitus , icu intensive care unit , lvef left ventricular ejection fraction , sd standard deviation group a included 170 patients aged 70 years and over .
there were significantly more women in group b than in group a ( respectively , 77.4% of women and 22.6% of men vs. 63.7% of women and 36.3% of men , p < 0.05 ) .
the ratio of patients with dm did not differ significantly between the groups ( 27 [ 15.9% ] in group a and 48 [ 21.4% ] in group b , p > 0.05 ) . in relation to the ratio of patients with poor ( lvef < 30% ) ,
moderately lowered ( 50% < lvef 30% ) and good ( lvef 50% ) lvef , the age groups did not differ significantly ( respectively , 34.7% in group a vs. 33.9% in group b , p > 0.05 ; 55.9% in group a vs. 49.6% in group b , p > 0.05 ; 9.4% , in group a vs. 16.5% in group b , p > 0.05 ) ( table ii ) .
the nyha class before the surgery did not differ significantly between the groups ( 2.9 0.6 and 2.8 0.6 , p > 0.05 ) .
however , it decreased significantly in groups a and b after the surgery , when compared to that before the surgery ( table iii ) .
the comparison of lvedd and mr before and after the surgery in both groups is given in table iv .
when evaluating echocardiographic data , we detected that mr decreased significantly in both groups following the operation when compared to preoperative data ( from 2.8 0.5 to 0.98 0.9 in group a and from 2.7 0.6 to 1.2 0.9 in group b , p < 0.001 ) . in group
b , lvedd decreased significantly ( 56.5 7.3 mm and 54.1 8.0 mm , respectively , p < 0.001 ) while in group a , lvedd showed only a tendency to decrease after the surgery ( 57.5 7.0 mm and 56.4 8.0 mm , respectively , p > 0.05 ) .
comparison of preoperative data between age groups dm ( + ) group with diabetes mellitus , dm ( ) group without diabetes mellitus , lvef left ventricular ejection fraction comparison of heart failure grade ( nyha class ) before and after surgery dm ( + ) group with diabetes mellitus , dm ( ) group without diabetes mellitus , lvef
left ventricular ejection fraction , nyha new york heart association , sd standard deviation comparison of left ventricular end diastolic diameter and mitral regurgitation before and after surgery dm ( + ) with diabetes mellitus , dm ( ) without diabetes mellitus , lvedd
left ventricular ejection fraction , mr mitral regurgitation , sd standard deviation in group b , a significant increase in dt was noted ( 0.17 0.05 ms vs. 0.21 0.06 ms , p < 0.001 ) after the surgery .
group dm ( + ) included 75 patients and group dm ( ) included 319 patients .
the dm ( ) group included significantly more men compared to the dm ( + ) group ( 75.1% men and 24.9% women vs. 57.7% men and 42.3% women , respectively ; p < 0.05 ) .
the nyha class did not differ between the groups before the surgery ( 2.8 0.7 and 2.9 0.4 , p > 0.05 ) .
the groups did not differ in the number of grafts performed . in the majority of patients in both groups ,
three grafts ( 72.1% in group dm ( ) and 75.6% in group dm ( + ) , p >
0.05 ) were performed , while two grafts were performed in 23.7% of patients in group dm ( ) and 21.8% in group dm ( + ) ( p > 0.05 ) .
four grafts were performed only in 1.9% of patients in group dm ( ) and 1.3% in group dm ( + ) ( p > 0.05 ) .
left ventricular end diastolic diameter and mr before and after the surgery in both groups are given in table iv .
the comparison of echocardiographic data before and after the surgery revealed a significant decrease in lvedd , left ventricular end systolic diameter ( lvesd ) ( from 46.7 9.9 mm to 43.0 14.0 mm , p < 0.05 ) , and the mr grade ( 2.8 0.6 vs. 1.1 0.9 , p < 0.001 ) in group dm ( ) ( table iv ) . in group
dm ( + ) , only the mr grade decreased significantly ( 2.6 0.5 vs. 1.2 0.9 , p < 0.001 ) and a tendency for a lvedd decrease was observed ( table iv ) .
group i included 135 patients , group ii 206 patients , and group iii 53 patients .
the groups did not differ according the number of grafts performed during the surgery . in the majority of patients ,
three grafts were performed ( group i 77.5% , group ii 70.5% , group iii 63.6% ,
p > 0.05 ) , while two grafts were performed in 18% in group i , 25.7% in group ii , and 36.4% in group iii ( p > 0.05 ) . in all three groups
left ventricular end diastolic diameter and the mr grade before and after the surgery in all groups are given in table iv .
the analysis of echocardiographic data indicated that in group i after the surgery , lvef increased ( from 23.6 4.3 to 29.7 9.4% , p < 0.001 ) and mr significantly decreased . in group
ii , mr and lvedd decreased significantly ( table iv ) and dt increased significantly ( from 0.19 0.05 ms to 0.24 0.07 ms , p < 0.001 ) after the surgery , whereas in group iii , only the mr grade decreased significantly ( 2.9 0.5 vs. 1.4 1.0 , p < 0.001 )
27.6% of patients required low doses of inotropic medications , 19.3% required medium doses , and 19.0% required high doses of inotropic medications .
perioperative myocardial infarction was detected in 4.5% of patients , bleeding from gi tract in 2.26% of patients , postoperative cognitive dysfunction in 1.7% , and stroke in 2.5% of patients .
the rate of early mortality was 16.24% , while the rate of late mortality was 2.03% . when postoperative complications were compared between paired groups , a significantly higher perioperative myocardial infarction rate was found in group dm ( + ) as compared to group dm ( ) ( 10.3% vs. 3.1% , respectively , p < 0.01 ) .
moreover , in group a , a significantly higher incidence of sepsis ( 4.9% in group b vs. 0.6% in group a , p < 0.05 ) and deep wound infection ( 8.0% in group b vs. 1.8% in group a , p < 0.05 ) was observed .
the rate of other complications , as well as early and late mortality , did not differ between the paired groups .
there were significantly more women in group b than in group a ( respectively , 77.4% of women and 22.6% of men vs. 63.7% of women and 36.3% of men , p < 0.05 ) .
the ratio of patients with dm did not differ significantly between the groups ( 27 [ 15.9% ] in group a and 48 [ 21.4% ] in group b , p > 0.05 ) . in relation to the ratio of patients with poor ( lvef < 30% ) ,
moderately lowered ( 50% < lvef 30% ) and good ( lvef 50% ) lvef , the age groups did not differ significantly ( respectively , 34.7% in group a vs. 33.9% in group b , p > 0.05 ; 55.9% in group a vs. 49.6% in group b , p > 0.05 ; 9.4% , in group a vs. 16.5% in group b , p > 0.05 ) ( table ii ) .
the nyha class before the surgery did not differ significantly between the groups ( 2.9 0.6 and 2.8 0.6 , p > 0.05 ) .
however , it decreased significantly in groups a and b after the surgery , when compared to that before the surgery ( table iii ) . the comparison of lvedd and mr before and after the surgery in both groups is given in table iv .
when evaluating echocardiographic data , we detected that mr decreased significantly in both groups following the operation when compared to preoperative data ( from 2.8 0.5 to 0.98 0.9 in group a and from 2.7 0.6 to 1.2 0.9 in group b , p < 0.001 ) . in group b , lvedd decreased significantly ( 56.5 7.3 mm and 54.1 8.0 mm , respectively , p < 0.001 ) while in group a , lvedd showed only a tendency to decrease after the surgery ( 57.5 7.0 mm and 56.4 8.0 mm , respectively , p > 0.05 ) .
comparison of preoperative data between age groups dm ( + ) group with diabetes mellitus , dm ( ) group without diabetes mellitus , lvef left ventricular ejection fraction comparison of heart failure grade ( nyha class ) before and after surgery dm ( + ) group with diabetes mellitus , dm ( ) group without diabetes mellitus , lvef
left ventricular ejection fraction , nyha new york heart association , sd standard deviation comparison of left ventricular end diastolic diameter and mitral regurgitation before and after surgery dm ( + ) with diabetes mellitus , dm ( ) without diabetes mellitus , lvedd
left ventricular ejection fraction , mr mitral regurgitation , sd standard deviation in group b , a significant increase in dt was noted ( 0.17 0.05 ms vs. 0.21 0.06 ms , p <
group dm ( + ) included 75 patients and group dm ( ) included 319 patients .
the dm ( ) group included significantly more men compared to the dm ( + ) group ( 75.1% men and 24.9% women vs. 57.7% men and 42.3% women , respectively ; p < 0.05 ) .
the nyha class did not differ between the groups before the surgery ( 2.8 0.7 and 2.9 0.4 , p > 0.05 ) .
the groups did not differ in the number of grafts performed . in the majority of patients in both groups ,
three grafts ( 72.1% in group dm ( ) and 75.6% in group dm ( + ) , p > 0.05 ) were performed , while two grafts were performed in 23.7% of patients in group dm ( ) and 21.8% in group dm ( + ) ( p > 0.05 ) .
four grafts were performed only in 1.9% of patients in group dm ( ) and 1.3% in group dm ( + ) ( p > 0.05 ) .
the nyha class decreased significantly ( p < 0.05 ) ( table iii ) . left ventricular end diastolic diameter and mr before and after the surgery in both groups are given in table iv .
the comparison of echocardiographic data before and after the surgery revealed a significant decrease in lvedd , left ventricular end systolic diameter ( lvesd ) ( from 46.7 9.9 mm to 43.0 14.0 mm , p < 0.05 ) , and the mr grade ( 2.8 0.6 vs. 1.1 0.9 , p < 0.001 ) in group dm ( ) ( table iv ) . in group
dm ( + ) , only the mr grade decreased significantly ( 2.6 0.5 vs. 1.2 0.9 , p < 0.001 ) and a tendency for a lvedd decrease was observed ( table iv ) .
group i included 135 patients , group ii 206 patients , and group iii 53 patients .
the groups did not differ according the number of grafts performed during the surgery . in the majority of patients ,
three grafts were performed ( group i 77.5% , group ii 70.5% , group iii 63.6% ,
p > 0.05 ) , while two grafts were performed in 18% in group i , 25.7% in group ii , and 36.4% in group iii ( p > 0.05 ) . in all three groups
left ventricular end diastolic diameter and the mr grade before and after the surgery in all groups are given in table iv .
the analysis of echocardiographic data indicated that in group i after the surgery , lvef increased ( from 23.6 4.3 to 29.7 9.4% , p < 0.001 ) and mr significantly decreased . in group
ii , mr and lvedd decreased significantly ( table iv ) and dt increased significantly ( from 0.19 0.05 ms to 0.24 0.07 ms , p < 0.001 ) after the surgery , whereas in group iii , only the mr grade decreased significantly ( 2.9 0.5 vs. 1.4 1.0 , p < 0.001 ) .
27.6% of patients required low doses of inotropic medications , 19.3% required medium doses , and 19.0% required high doses of inotropic medications .
perioperative myocardial infarction was detected in 4.5% of patients , bleeding from gi tract in 2.26% of patients , postoperative cognitive dysfunction in 1.7% , and stroke in 2.5% of patients .
the rate of early mortality was 16.24% , while the rate of late mortality was 2.03% . when postoperative complications were compared between paired groups , a significantly higher perioperative myocardial infarction rate was found in group dm ( + ) as compared to group dm ( ) ( 10.3% vs. 3.1% , respectively , p < 0.01 ) .
moreover , in group a , a significantly higher incidence of sepsis ( 4.9% in group b vs. 0.6% in group a , p < 0.05 ) and deep wound infection ( 8.0% in group b vs. 1.8% in group a , p < 0.05 ) was observed .
the rate of other complications , as well as early and late mortality , did not differ between the paired groups .
some authors recommend performing cabg as a stand - alone procedure in patients with mild mr and increased perioperative risk factors , such as old age , the presence of diabetes and poor lv systolic function .
they refer to the extended length of the surgery and the questionable improvement of long - term outcomes [ 1 , 2 , 7 , 11 , 12 ] . in our study
, we compared the impact of high operative risk factors ( age over 70 years , presence of dm , poor lvef ) on the outcomes of cabg and mv repair .
the results of our study indicate that older age , concomitant diabetes , and lowered or poor lvef did not increase early and late postoperative mortality after cabg and the mv repair surgery in patients with ischemic heart disease and ischemic mr .
moreover , they did not significantly influence the time of artificial lung ventilation or the length of stay in the icu after the surgery . having
compared postoperative complications in age groups , we found that infectious complications had a higher rate in the group of younger patients .
the ratio of patients with dm in both groups was similar and did not differ statistically significantly .
many postoperative complications after the cardiac surgery with cpb are related to the systemic inflammatory response syndrome ( sirs ) .
cardiopulmonary bypass may itself provoke a systemic inflammatory response , caused by blood contact with the artificial bypass surface , cold cardiac ischemia , and hypothermia [ 13 , 14 ] .
they bind to specific receptors on target cells and call into play many other cells and substances , including elements of the inflammatory response .
older age is associated with a chronic low grade inflammation process , caused by significantly reduced levels of t cells , while younger age is usually associated with better reactivity of the immune system [ 15 , 16 ] . in any case
after the operation , the functional capacity of the cardiovascular system ( expressed as the nyha class ) increased in both age groups .
although in the group of younger patients , lvedd had only a tendency to decrease , the deceleration time increased and showed an improvement in the lv diastolic function . in the group of older patients , the reversible remodeling of lv
, we found that despite good surgical results ( mr decreased significantly from grade ii - iii to grade i in both groups ) , the functional capacity of the cardiovascular system did not improve in patients with diabetes ( the nyha class did not change significantly ) .
moreover , reversible remodeling of lv was not found in patients with diabetes , although a tendency of lvedd to decrease was observed .
additionally , a higher incidence of perioperative mi was detected in the diabetes group of patients .
diabetes causes not only vascular disorders in the heart , but also disorders in the entire body .
there is another type of heart disease related to diabetes and the metabolic syndrome which is not associated with hypertension or coronary artery disease .
diabetic cardiomyopathy is characterized by an impaired diastolic relaxation time ( diastolic dysfunction ) and reduced contractility ( systolic dysfunction ) .
the diastolic dysfunction is the initial heart lesion and when the systolic dysfunction develops , the diastolic dysfunction is usually already significantly advanced .
the underlying pathophysiological mechanisms involve interstitial and perivascular fibrosis due to necrotic and increased apoptotic myocardial cell death , impaired calcium reuptake caused by functional alterations in cellular ion channels , structural and functional changes in small coronary arteries ( atheromas are more extensive and diffuse and involve small vessels , capillary basement membranes are thickened , microaneurysms are formed ) , and cardiac autonomic neuropathy .
the latter leads to parasympathetic - sympathetic nervous system imbalance , when the tone of the parasympathetic system is decreased and the sympathetic tone is relatively increasing . preexisting diabetic cardiomyopathy
so , it may be supposed that diabetic cardiomyopathy determined residual lv remodeling and the remaining high nyha functional class , just as it can predispose to a higher incidence of perioperative mi in our study [ 20 , 21 ] .
when patients were grouped according to lvef , it appeared that the functional cardiovascular status improved in all three groups after the surgery .
echocardiographic data also showed that postoperative results improved in all three groups , although to a different degree . in patients with poor lvef ,
, the ejection fraction did not show such an improvement , probably because the baseline lvef was better and the change was not statistically significant .
although mr decreased in all groups , reversible positive lv remodeling and an improvement of diastolic function were detected only in patients with moderately lowered lvef .
we suppose that precisely this group of patients can benefit the most from cabg and mv repair surgery .
the main limitation of the present study is its retrospective design . as data were analyzed retrospectively , we had to exclude patients with incomplete data , so the sample size was limited .
these data reflect the experience of a single center , which may limit the study 's more general nature .
elderly age and a lowered left ventricular ejection fraction did not worsen early postoperative outcomes and did not increase early and late mortality after mitral valve repair for ischemic mitral regurgitation .
the presence of diabetes did not influence early and late mortality after mitral valve repair for ischemic mitral regurgitation .
the presence of diabetes increased the perioperative myocardial infarction rate , while younger age was associated with an increased risk of infectious complications after mitral valve repair for ischemic mitral regurgitation . regardless of reduced mitral regurgitation ,
reversible remodeling of the left ventricle was observed only in the group of patients without diabetes and with a moderately lowered left ventricular ejection fraction .
| introductionit is well documented that older age , chronic concomitant diseases ( such as diabetes mellitus , chronic obstructive lung disease , etc . ) , and poor left ventricular function can increase the postoperative complication rate and worsen the general outcomes of coronary artery bypass ( cabg ) and concomitant repair of ischemic mitral regurgitation ( mr).material and methodsretrospective data of 394 patients after cabg and mitral valve ( mv ) repair ( mainly annuloplasty ) were analyzed .
patients were grouped according to age , diabetes mellitus ( dm ) , and left ventricular ejection fraction ( lvef ) .
echocardiography data , the rate of postoperative complications ( cardiogenic shock , preoperative myocardial infarction , bleeding from the gastrointestinal tract , cognitive disorders , stroke , sepsis , deep wound infection ) , and early and late mortality were compared between paired groups.resultsthere were no differences between age groups in reverse positive remodeling of lv
. a significantly higher incidence of sepsis and deep wound infection in younger patients was observed .
patients with dm had no change in the pre - postoperative nyha class and a higher rate of perioperative mi ( 10.3% vs. 3.1% respectively , p < 0.05 ) in comparison to patients with no dm . in all lvef groups ,
mr was significantly decreased , but reverse positive remodeling of lv was pronounced only in those with
poor and moderately lowered lvef .
postoperative complications did not differ among these three groups.conclusionselderly age , concomitant dm and lowered lvef do not influence either early or late mortality , including early postoperative outcomes after mv repair for ischemic mr following cabg .
concomitant dm increases the rate of perioperative mi and impairs reverse remodeling of lv . |
in view of the fact that in the kitchens used for communal catering , microroganisms are often introduced through raw foodstuffs and personnel , several legal measures aimed at infection prevention have been enacted ( infection control policies , temperature control regulations for assurance of the cold - hot chain , regular information updates for personnel , supervision of working practices , etc . ) . however , my experiences from infection control inspections in hospitals , rehabilitation clinics and nursing homes show that the preventive measures intended to assure hygienic provision of foodstuffs are often patchy and poorly observed . note : the food in the central kitchen is not sterile .
therefore when food is allowed to stand at room temperature for a long time , both in the case of food cooked for lunch and of food intended for supper which has been previously chilled , there is the possibility of massive spore germination or of dangerous toxin formation .
formulation of an infection control policy that should be checked and updated at regular intervals . informing staff about the risk of spore germination and toxin formation in foods supplied ( often , mistaken views held by auxiliary staff have to be corrected ) . as borne out by table 1 ( tab .
1 ) , more stringent measures are needed for instant products that are not cooked.spot checks of temperature of supplied foods.specification of how long the supplied food , e.g. if the patient is absent , can be kept on the ward ( e.g. refrigerator , ward room , ward kitchen , patient s room).need for reheating , e.g. in microwave to a core temperature of above 65 c ( caution : fish and meat portions).preparation and storage of dispensed teas must also be borne in mind as regards brewing with boiling water and avoidance of long standing time in patient s or resident s room .
formulation of an infection control policy that should be checked and updated at regular intervals . informing staff about the risk of spore germination and toxin formation in foods supplied ( often , mistaken views held by auxiliary staff have to be corrected ) . as borne out by table 1 ( tab .
1 ) , more stringent measures are needed for instant products that are not cooked .
specification of how long the supplied food , e.g. if the patient is absent , can be kept on the ward ( e.g. refrigerator , ward room , ward kitchen , patient s room ) .
need for reheating , e.g. in microwave to a core temperature of above 65 c ( caution : fish and meat portions ) .
preparation and storage of dispensed teas must also be borne in mind as regards brewing with boiling water and avoidance of long standing time in patient s or resident s room .
note : the aim must be to maintain as far as possible the cold or hot chain on the ward .
kitchen workstations : regular cleaning is necessary ( cleaning policy ! ) bacteriological spot checks advisable after cleaning ( check of efficiency).cleaning cloths : if disposable wipes , the best solution , are not available for the worktops and equipment coming into direct contact with foodstuffs , cleaning cloths ( ideal breeding ground thanks to humidity , contamination , room temperature and time ) .
such cloths are no longer suitable for cleaning but rather for uniform distribution of any pathogenic microbes present in the kitchen.hygienic hand disinfection is needed after performing any care / nursing activities and before handing out or preparing food in the ward kitchen .
refrigerators should be available for storage of foodstuffs on the wards if this is warranted by the hygienic or organizational situation.cleaning crockery : occasional microbiological spot checks , e.g. with rodac plates , of the cleaned crockery advisable .
this is all the more needed if there is visible evidence of inadequate cleaning or drying .
the aim aspired to must be not to exceed a maximum count of 50 cfu / dm for clean crockery .
kitchen workstations : regular cleaning is necessary ( cleaning policy ! ) bacteriological spot checks advisable after cleaning ( check of efficiency ) .
cleaning cloths : if disposable wipes , the best solution , are not available for the worktops and equipment coming into direct contact with foodstuffs , cleaning cloths ( ideal breeding ground thanks to humidity , contamination , room temperature and time ) .
such cloths are no longer suitable for cleaning but rather for uniform distribution of any pathogenic microbes present in the kitchen .
hygienic hand disinfection is needed after performing any care / nursing activities and before handing out or preparing food in the ward kitchen .
refrigerators should be available for storage of foodstuffs on the wards if this is warranted by the hygienic or organizational situation .
cleaning crockery : occasional microbiological spot checks , e.g. with rodac plates , of the cleaned crockery advisable .
this is all the more needed if there is visible evidence of inadequate cleaning or drying .
the aim aspired to must be not to exceed a maximum count of 50 cfu / dm for clean crockery .
as ward staff are well aware of , this presents a special hygienic and organizational problem . as shown in table 2 ( tab .
2 ) , already high baseline microbial counts can be expected in the case of inadequately baked fillings .
often , pieces of cake at left in the patient s room and eaten only hours later .
it is therefore the duty of the nursing staff or ward doctors to make patients , and possibly also visitors , aware of the problems involved .
again , because of their underlying disease or for dietary reasons patients are often not supposed to eat foodstuffs with a very high fat .
3 ) , confectionery and ice cream with a score of 33.4% are the chief causes of foodborne disease .
maintenance of the cold - hot chainnot only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitors , in particular of confectionery.cleanliness and minimal contamination of kitchen worktopscleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution .
maintenance of the cold - hot chain not only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitors , in particular of confectionery . cleanliness and minimal contamination of kitchen worktops cleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution .
formulation of an infection control policy that should be checked and updated at regular intervals . informing staff about the risk of spore germination and toxin formation in foods supplied ( often , mistaken views held by auxiliary staff have to be corrected ) . as borne out by table 1 ( tab .
1 ) , more stringent measures are needed for instant products that are not cooked.spot checks of temperature of supplied foods.specification of how long the supplied food , e.g. if the patient is absent , can be kept on the ward ( e.g. refrigerator , ward room , ward kitchen , patient s room).need for reheating , e.g. in microwave to a core temperature of above 65 c ( caution : fish and meat portions).preparation and storage of dispensed teas must also be borne in mind as regards brewing with boiling water and avoidance of long standing time in patient s or resident s room .
formulation of an infection control policy that should be checked and updated at regular intervals . informing staff about the risk of spore germination and toxin formation in foods supplied ( often , mistaken views held by auxiliary staff have to be corrected ) . as borne out by table 1 ( tab .
1 ) , more stringent measures are needed for instant products that are not cooked .
specification of how long the supplied food , e.g. if the patient is absent , can be kept on the ward ( e.g. refrigerator , ward room , ward kitchen , patient s room ) .
need for reheating , e.g. in microwave to a core temperature of above 65 c ( caution : fish and meat portions ) .
preparation and storage of dispensed teas must also be borne in mind as regards brewing with boiling water and avoidance of long standing time in patient s or resident s room .
note : the aim must be to maintain as far as possible the cold or hot chain on the ward .
kitchen workstations : regular cleaning is necessary ( cleaning policy ! ) bacteriological spot checks advisable after cleaning ( check of efficiency).cleaning cloths : if disposable wipes , the best solution , are not available for the worktops and equipment coming into direct contact with foodstuffs , cleaning cloths ( ideal breeding ground thanks to humidity , contamination , room temperature and time ) .
such cloths are no longer suitable for cleaning but rather for uniform distribution of any pathogenic microbes present in the kitchen.hygienic hand disinfection is needed after performing any care / nursing activities and before handing out or preparing food in the ward kitchen .
refrigerators should be available for storage of foodstuffs on the wards if this is warranted by the hygienic or organizational situation.cleaning crockery : occasional microbiological spot checks , e.g. with rodac plates , of the cleaned crockery advisable .
this is all the more needed if there is visible evidence of inadequate cleaning or drying .
the aim aspired to must be not to exceed a maximum count of 50 cfu / dm for clean crockery .
kitchen workstations : regular cleaning is necessary ( cleaning policy ! ) bacteriological spot checks advisable after cleaning ( check of efficiency ) .
cleaning cloths : if disposable wipes , the best solution , are not available for the worktops and equipment coming into direct contact with foodstuffs , cleaning cloths ( ideal breeding ground thanks to humidity , contamination , room temperature and time ) .
such cloths are no longer suitable for cleaning but rather for uniform distribution of any pathogenic microbes present in the kitchen
. hygienic hand disinfection is needed after performing any care / nursing activities and before handing out or preparing food in the ward kitchen .
refrigerators should be available for storage of foodstuffs on the wards if this is warranted by the hygienic or organizational situation .
cleaning crockery : occasional microbiological spot checks , e.g. with rodac plates , of the cleaned crockery advisable .
this is all the more needed if there is visible evidence of inadequate cleaning or drying .
the aim aspired to must be not to exceed a maximum count of 50 cfu / dm for clean crockery . as ward staff are well aware of , this presents a special hygienic and organizational problem . as shown in table 2 ( tab .
2 ) , already high baseline microbial counts can be expected in the case of inadequately baked fillings .
often , pieces of cake at left in the patient s room and eaten only hours later .
it is therefore the duty of the nursing staff or ward doctors to make patients , and possibly also visitors , aware of the problems involved .
again , because of their underlying disease or for dietary reasons patients are often not supposed to eat foodstuffs with a very high fat .
3 ) , confectionery and ice cream with a score of 33.4% are the chief causes of foodborne disease . maintenance of the cold - hot chainnot only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitors , in particular of confectionery.cleanliness and minimal contamination of kitchen worktopscleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution .
maintenance of the cold - hot chain not only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitors , in particular of confectionery . cleanliness and minimal contamination of kitchen worktops cleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution .
kitchen workstations : regular cleaning is necessary ( cleaning policy ! ) bacteriological spot checks advisable after cleaning ( check of efficiency).cleaning cloths : if disposable wipes , the best solution , are not available for the worktops and equipment coming into direct contact with foodstuffs , cleaning cloths ( ideal breeding ground thanks to humidity , contamination , room temperature and time ) .
such cloths are no longer suitable for cleaning but rather for uniform distribution of any pathogenic microbes present in the kitchen.hygienic hand disinfection is needed after performing any care / nursing activities and before handing out or preparing food in the ward kitchen .
refrigerators should be available for storage of foodstuffs on the wards if this is warranted by the hygienic or organizational situation.cleaning crockery : occasional microbiological spot checks , e.g. with rodac plates , of the cleaned crockery advisable .
this is all the more needed if there is visible evidence of inadequate cleaning or drying .
the aim aspired to must be not to exceed a maximum count of 50 cfu / dm for clean crockery .
kitchen workstations : regular cleaning is necessary ( cleaning policy ! ) bacteriological spot checks advisable after cleaning ( check of efficiency ) .
cleaning cloths : if disposable wipes , the best solution , are not available for the worktops and equipment coming into direct contact with foodstuffs , cleaning cloths ( ideal breeding ground thanks to humidity , contamination , room temperature and time ) .
such cloths are no longer suitable for cleaning but rather for uniform distribution of any pathogenic microbes present in the kitchen .
hygienic hand disinfection is needed after performing any care / nursing activities and before handing out or preparing food in the ward kitchen .
refrigerators should be available for storage of foodstuffs on the wards if this is warranted by the hygienic or organizational situation .
cleaning crockery : occasional microbiological spot checks , e.g. with rodac plates , of the cleaned crockery advisable .
this is all the more needed if there is visible evidence of inadequate cleaning or drying .
the aim aspired to must be not to exceed a maximum count of 50 cfu / dm for clean crockery .
as ward staff are well aware of , this presents a special hygienic and organizational problem . as shown in table 2 ( tab .
2 ) , already high baseline microbial counts can be expected in the case of inadequately baked fillings .
often , pieces of cake at left in the patient s room and eaten only hours later .
it is therefore the duty of the nursing staff or ward doctors to make patients , and possibly also visitors , aware of the problems involved .
again , because of their underlying disease or for dietary reasons patients are often not supposed to eat foodstuffs with a very high fat .
3 ) , confectionery and ice cream with a score of 33.4% are the chief causes of foodborne disease .
maintenance of the cold - hot chainnot only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitors , in particular of confectionery.cleanliness and minimal contamination of kitchen worktopscleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution .
maintenance of the cold - hot chain not only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitors , in particular of confectionery . cleanliness and minimal contamination of kitchen worktops cleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution .
walter steuer was reading medicine in munich , where he did his doctorate in 1959 and received his licence to practice medicine . as a young doctor he worked in hospitals and runs a doctor s practice in stuttgart . from stuttgart
he moved to the institute for hygiene in tbingen , took his federal medicinal test in 1959 and became public health officer at the public health department bblingen .
1968 he was head of the medicinal testing laboratory of stuttgart and furthermore president of the federal health authority of baden - wurttemberg in 1991 . his retirement has become a real turbulent one : professor steuer is still consultant hygienist for the technical control board and the federal insurance institution for employees , he is director of the institute for hygiene of the research institute hohenstein as well as external consultant for hospitals , rehab - hospitals and nursing homes ; he is also member of numerous committees , commissions and managing boards . in addition
he acts as author and editor and recently added his publications and books to a new important one : hygiene in nursing care .
walter steuer was reading medicine in munich , where he did his doctorate in 1959 and received his licence to practice medicine . as a young doctor he worked in hospitals and runs a doctor s practice in stuttgart . from stuttgart
he moved to the institute for hygiene in tbingen , took his federal medicinal test in 1959 and became public health officer at the public health department bblingen .
1968 he was head of the medicinal testing laboratory of stuttgart and furthermore president of the federal health authority of baden - wurttemberg in 1991 . his retirement has become a real turbulent one : professor steuer is still consultant hygienist for the technical control board and the federal insurance institution for employees , he is director of the institute for hygiene of the research institute hohenstein as well as external consultant for hospitals , rehab - hospitals and nursing homes ; he is also member of numerous committees , commissions and managing boards . in addition
he acts as author and editor and recently added his publications and books to a new important one : hygiene in nursing care . | a problem that is often overlooked or simply not given enough attention : the food served to patients from the kitchen is not sterile . if food is allowed to stand at room temperature for a long time , both in the case of food cooked for lunch and of food intended for supper which has been previously chilled , there is the possibility of massive spore germination or of dangerous toxin formation .
therefore regulations on how to handle food and beverages ( e.g. tea ) must be set out in the infection control policy , and checks carried out to monitor compliance with the rules relating to temperature checks , duration and type of storage , need for reheating , etc . making staff aware of the issues involved
is of paramount importance .
these include monitoring hygiene standards in the ward kitchen , formulation of a cleaning policy , periodic bacteriological checks ( not only of workstations but also of the dishwasher results ) , whenever possible the use of disposable cloths for working surfaces and equipment , changing cleaning cloths at least once daily and hygienic hand disinfection before and after handing out food .
foodstuffs brought in by visitors represent a special hygienic and organizational problem because in many cases they already have a high baseline microbial count .
visitors must be made aware that , for example , slices of cake left in the patient s room and often eaten only hours later can pose a risk of infection.in summary , the following principles of food hygiene must be observed on the wards : maintenance of the cold - hot chainnot only reheat food , but ensure it is well heated throughout avoid situations giving rise to spore germination in foodstuffs brought in by visitorscleanliness and minimal contamination of kitchen worktopscleanliness of crockery and kitchen towels do not allow food to stand at room temperature for a long time , in particular desserts and confectionery a standard policy must be enforced to define the hygienic status and organization for food distribution for ward kitchens too . |
severe combined immunodeficiency ( scid ) refers to a group of life - threatening fatal , congenital disorders characterized by absent or reduced t - cell number and reduced or non - functional b - cells .
an early diagnosis of scid allows for avoidance of exposure to infections , live virus vaccines and non - irradiated blood products , and also makes possible early hematopoietic stem cell transplantation ( hsct ) or other immune system restoring treatments , adenosine deaminase enzyme replacement , or gene therapy . since beginning in 2008 in wisconsin , newborn screening for scid
the assay employs pcr quantification of circular dna byproducts of t - cell receptor gene rearrangement , t - cell receptor excision circles ( trecs ) .
although trecs have no identifiable function , their presence serves as a marker for the maturation of t - cells .
insufficiency of trecs characterizes scid and other t - lymphopenic disorders including complete digeorge syndrome and some cases of ataxia telangiectasia ( at ) . like at
, nijmegen breakage syndrome ( nbs ) [ 69 ] ( formerly known as an at variant 1 ) is a disorder of dna repair associated with chromosomal instability and immune compromise that may be identified through trec screening .
herein , we describe a baby with a complex perinatal history and low trecs near birth .
whole exome sequencing identified heterozygous mutations in nbn , the gene that encodes nibrin , a component of a molecular complex involved in the early recognition and subsequent repair of dna damage .
nibrin was absent from nuclear lysates on immunoblots , and the patient s cells were hypersensitive to ionizing radiation by colony survival assay [ 11 , 12 ] .
a 41-week gestational age male ( nbs20la ) , weighing 2860 grams , was born via normal vaginal delivery to a 23-year - old , gravida 1 , paragravida 0 mother following prenatal identification of increased cerebrospinal fluid on ultrasound .
postnatally , the infant was hospitalized for 1 week for meconium aspiration . by 4 weeks of age progressive hydrocephalus
required a ventriculo - peritoneal shunt . at 17 weeks , he was hospitalized for a presumed urinary tract infection ; renal ultrasound showed left hydronephrosis . during the first year of life he also exhibited developmental delay and failure to thrive with weight and length for age persistently below the 3rd percentiles and head circumference at 8 months of age below the 2nd percentile . at 3 weeks of age
, scid newborn screening results were interpreted as incomplete : trec , 13 copies / mcl ( normal > 25 ) and actin control , 9,510 copies / mcl ( normal > 10,000 ) .
repeat screening was positive : trec , 12 copies / mcl and actin , 19,800 copies / mcl .
subsequent flow cytometry at 6 weeks of life demonstrated persistent t - lymphopenia and elevated nk cell percentages and numbers ( table 1).table 1laboratory values of patient nbs20la from 1.5 months to 1 year of agepatient age1.5 month3 months5.5 months10 monthsreference rangesbirth to 2 months2 months to 4 months4 months to 1 yeartotal wbc cells / ul6800512055007880500017,000500017,000500017,000%neutrophils47445856254525452545%lymphocytes33272322466646664666%monocytes819121428 % 28 % 28 % % eosinophils121078030303cd 3 + t cells / ml ( % ) 924 ( 42)259 ( 24)289 ( 18)381 ( 22)13757129 ( 6993)25336778 ( 5579)28897995 ( 5980)cd 4 + t cells / ml ( % ) 660 ( 30)65 ( 5)224 ( 15.1)320 ( 19)11695623 ( 4875)13925210 ( 3562)17865141 ( 3861)cd 8 + t cells / ml ( % ) 242 ( 11)99 ( 8)63 ( 4)72 ( 4)2671860 ( 1333)6522449 ( 1430)9462791 ( 1434)cd19 + b - cells / ml ( % ) 88 ( 4)26 ( 2)72 ( 5)174 ( 10)1041448 ( 426)7453499 ( 1439)8583774 ( 1636)cd3-cd16/56 + nk cells /mm3 ( % ) 638 ( 29)680 ( 66)1123 ( 73)1169 ( 68)60434 ( 214)194994 ( 314)1821581 ( 313)igg ( mg / dl ) [ reference range]220 [ 198577]202 [ 165781]316 [ 2821026]igm ( mg / dl ) [ reference range]24 [ 16100]34 [ 31103]70 [ 39142]iga ( mg / dl ) [ reference range]<7 [ 152]7 [ 883]16 [ 1683]ab responses : tetanus ( iu / ml ) ( rr : 0.17)2.192.71h .
influenzae b ( mcg / ml ) ( rr : 1.010.0)0.151.16lpa responses : phytohemaglutinin ( si ) [ 1:125]1734442pokeweed mitogen ( si)237523tetanus antigen ( si)21candida antigen ( si)46 laboratory values of patient nbs20la from 1.5 months to 1 year of age targeted sequencing of scid associated genes ada , ak2 , cd3d , cd3zeta , dclre1c , ilrg , il7r , jak3 , lig4 , nhej1 , pnp , ptprc , rac2 , rag1 , rag2 , rmrp , and zap70 ( genedx , gaithersburg , md ) and enzyme assays for adenosine deaminase and nucleoside phosphorylase revealed no abnormalities .
informed consent was obtained for research , including cellular immune studies and whole exome sequencing ( wes ) , for the infant and both parents under approved protocols at children s hospital los angeles ( chla ) and the university of california san francisco ( ucsf ) .
genomic dna from edta - anticoagulated whole blood was prepared using a gentra puregene blood kit ( qiagen usa : germantown , md ) .
briefly , libraries prepared by ligating truseq adaptors ( illumina : san diego , ca ) to genomic dna fragments of 200300 bp were enriched with 10 cycles of pcr , pooled and submitted to exon capture using a roche nimblegen version 3.0 capture array .
after 10 additional amplification cycles , 100 bp paired end sequence reads were generated ( hiseq2000 , llumina ) , yielding 3.8 % duplicates and a mean of > 100 reads covering the targeted regions , with > 95 % of target regions having 10 reads . reads were aligned against grch37 ( aug 2009 release ) using bwa ( v0.6.2 ) .
the results were converted to bam , sorted by coordinate , indexed , and marked for pcr duplicate reads using the picard toolkit ( v 1.81 ) ( http://picard.sourceforge.net ) .
local realignment was performed around known indel locations , and base quality scores were re - calibrated using gatk ( v 2.6.5 ) [ 14 , 15 ] .
gatk variant quality scores were re - calibrated by vqsr ( variant quality score recalibration ) using the trio of exomes in this report , as well as 65 others sequenced at our site .
hapmap v3.3 , 1000 genomes high confidence snps ( phase1 v3 2010 - 11 - 23 ) and omni chip array sets were used as training data , and to provided truth sites for snps , while the mills dataset from the 1000 genomes was used for indels , using a truth sensitivity cutoff of 99 % .
variant annotation ( including region , effect , allele frequency , disease phenotype annotation , and conservation ) was performed using our custom tool varant ( http://compbio.berkeley.edu/proj/varant/ ) .
particular attention was given to high - confidence , rare , likely - damaging , protein - altering variants in genes associated with primary cellular immunodeficiency and to those conforming to models of autosomal or x - linked recessive inheritance in the family , or de novo mutations that may be dominant .
peripheral blood lymphoblastoid cell lines ( lcl ) from the patient nbs20la and controls were made with epstein - barr virus as described , and 50 g of nuclear protein lysate from each was electrophoresed on a 6 % sds - polyacrylamide gel ( page ) , blotted onto pvdf membrane ( biorad , hercules , ca ) and incubated with antibodies to nibrin ( novus , nb100 - 143 at 1:5000 , littleton , co ) overnight at 4 c .
the immunoblots were subsequently incubated with an hrp - conjugated anti - rabbit secondary antibody at room temperature for 40 min for detection by enhanced chemiluminescence ( ecl ) ( amersham pharmacia , piscataway , nj ) . under the conditions of the assay
p84 was used as a loading control ( genetex gtx70220 at 1:3000 ) . on the same blot , mre11 and rad50
were also measured ( novus 100142 at 1:15,000 and novus 100154 at 1:500 , respectively ) .
peripheral blood lymphocytes from the patient nbs20la and controls were immortalized with epstein - barr virus as previously described , and 50 g of nuclear lysate protein from the each lymphoblastoid cell line ( lcl ) was electrophoresed on a 6 % sds - polyacrylamide gel ( page ) , blotted onto pvdf membrane ( biorad , hercules , ca ) and incubated with antibodies to nibrin and dna repair proteins mre11 , rad50 and atm ( novus , littleton , co ) overnight at 4 c .
the immunoblots were subsequently incubated with an hrp - conjugated anti - rabbit secondary antibody at room temperature for 40 min for detection by enhanced chemiluminescence ( ecl ) ( amersham pharmacia , piscataway , nj ) . under the conditions of the assay , as little as 1 g of nibrin protein can be detected .
lcls from wild type ( healthy controls ) , individuals with at ( radiosensitive controls ) , and nbs20la were maintained in rmpi 1640 medium with 10 % fetal bovine serum and 1 % penicillin - streptomycin - l - glutamine .
after plating into paired 96-well trays , one of each pair was irradiated with 1 gray .
after incubation at 37 c for 2 weeks , the trays were stained with 0.1 % 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide .
individual wells with at least one colony composed of > 32 cells ( i.e. , > 5 divisions ) were scored as positive .
the number of positive wells in irradiated- versus non - irradiated plates was compared to determine the survival fraction .
results were compared to measurements performed by sun et al . using 104 at patients and 29 healthy controls .
informed consent was obtained for research , including cellular immune studies and whole exome sequencing ( wes ) , for the infant and both parents under approved protocols at children s hospital los angeles ( chla ) and the university of california san francisco ( ucsf ) .
genomic dna from edta - anticoagulated whole blood was prepared using a gentra puregene blood kit ( qiagen usa : germantown , md ) .
briefly , libraries prepared by ligating truseq adaptors ( illumina : san diego , ca ) to genomic dna fragments of 200300 bp were enriched with 10 cycles of pcr , pooled and submitted to exon capture using a roche nimblegen version 3.0 capture array .
after 10 additional amplification cycles , 100 bp paired end sequence reads were generated ( hiseq2000 , llumina ) , yielding 3.8 % duplicates and a mean of > 100 reads covering the targeted regions , with > 95 % of target regions having 10 reads .
reads were aligned against grch37 ( aug 2009 release ) using bwa ( v0.6.2 ) .
the results were converted to bam , sorted by coordinate , indexed , and marked for pcr duplicate reads using the picard toolkit ( v 1.81 ) ( http://picard.sourceforge.net ) .
local realignment was performed around known indel locations , and base quality scores were re - calibrated using gatk ( v 2.6.5 ) [ 14 , 15 ] . variants were called using gatk unifiedgenotyper and freebayes ( vesion 0.9.10 ) .
gatk variant quality scores were re - calibrated by vqsr ( variant quality score recalibration ) using the trio of exomes in this report , as well as 65 others sequenced at our site .
hapmap v3.3 , 1000 genomes high confidence snps ( phase1 v3 2010 - 11 - 23 ) and omni chip array sets were used as training data , and to provided truth sites for snps , while the mills dataset from the 1000 genomes was used for indels , using a truth sensitivity cutoff of 99 % .
variant annotation ( including region , effect , allele frequency , disease phenotype annotation , and conservation ) was performed using our custom tool varant ( http://compbio.berkeley.edu/proj/varant/ ) .
particular attention was given to high - confidence , rare , likely - damaging , protein - altering variants in genes associated with primary cellular immunodeficiency and to those conforming to models of autosomal or x - linked recessive inheritance in the family , or de novo mutations that may be dominant .
peripheral blood lymphoblastoid cell lines ( lcl ) from the patient nbs20la and controls were made with epstein - barr virus as described , and 50 g of nuclear protein lysate from each was electrophoresed on a 6 % sds - polyacrylamide gel ( page ) , blotted onto pvdf membrane ( biorad , hercules , ca ) and incubated with antibodies to nibrin ( novus , nb100 - 143 at 1:5000 , littleton , co ) overnight at 4 c .
the immunoblots were subsequently incubated with an hrp - conjugated anti - rabbit secondary antibody at room temperature for 40 min for detection by enhanced chemiluminescence ( ecl ) ( amersham pharmacia , piscataway , nj ) . under the conditions of the assay , as little as 1 g of nibrin protein could be detected .
on the same blot , mre11 and rad50 were also measured ( novus 100142 at 1:15,000 and novus 100154 at 1:500 , respectively ) .
peripheral blood lymphocytes from the patient nbs20la and controls were immortalized with epstein - barr virus as previously described , and 50 g of nuclear lysate protein from the each lymphoblastoid cell line ( lcl ) was electrophoresed on a 6 % sds - polyacrylamide gel ( page ) , blotted onto pvdf membrane ( biorad , hercules , ca ) and incubated with antibodies to nibrin and dna repair proteins mre11 ,
rad50 and atm ( novus , littleton , co ) overnight at 4 c .
the immunoblots were subsequently incubated with an hrp - conjugated anti - rabbit secondary antibody at room temperature for 40 min for detection by enhanced chemiluminescence ( ecl ) ( amersham pharmacia , piscataway , nj ) . under the conditions of the assay , as little as 1 g of nibrin protein can be detected .
lcls from wild type ( healthy controls ) , individuals with at ( radiosensitive controls ) , and nbs20la were maintained in rmpi 1640 medium with 10 % fetal bovine serum and 1 % penicillin - streptomycin - l - glutamine . after plating into paired 96-well trays , one of each pair was irradiated with 1 gray .
after incubation at 37 c for 2 weeks , the trays were stained with 0.1 % 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide .
individual wells with at least one colony composed of > 32 cells ( i.e. , > 5 divisions ) were scored as positive .
the number of positive wells in irradiated- versus non - irradiated plates was compared to determine the survival fraction .
results were compared to measurements performed by sun et al . using 104 at patients and 29 healthy controls .
wes analysis by our varant tool identified two nonsense mutations in nbn on chromosome 8q21.3 in the patient , suggesting a diagnosis of nbs . the patient and his father shared a thymine to guanine transversion cdna 842 t > g ( nm_002485.4(nbn):c.842 t >
g ) in exon 6 , changing leucine 281 to a stop codon ( protein l281x ) ( clinvar provisional accession : scv000196640 ) , while the infant and mother shared a cytosine to thymine transition cdna 1030c > t ( nm_002485.4(nbn):c.1030c > t ) in exon 9 , changing glutamine 344 to a stop codon ( q344x ) ( clinvar provisional accession : scv000196641 ) .
a rare x - linked cd40lg gene variant noted in our patient and mother nm_000074 ( cd40lg):c.542 g > c ( chrx : 135741330 , g > c ; r181p in cd40lg ) was predicted damaging by polyphen-2 software , but was inconsistent with the patient s phenotoype .
no other high quality dna variants in the targeted exome regions were as consistent with the phenotype .
neither variant had been reported in other patients with nbs nor in the 1000 genomes , espdb or dbsnp ( v137 ) databases .
the patient s paternally inherited allele carried l281x , while his maternally inherited allele carried q344x .
confirmatory sanger sequencing was performed by the clia - approved molecular genetics laboratory at the university of california los angeles school of medicine .
an immunoblot showed no detectable nibrin protein in nbs20la ( fig . 1 , penultimate lane ) .
interestingly , mre11 and rad50 protein levels were also reduced ; this reflects the instability of the mre11-rad50-nibrin ( mrn ) complex whenever nibrin is absent .
lane 2 contains lcl protein from an at patient whose cell lines were radiosensitive in fig .
atm protein was absent in the atm lcl , but was present in nbs20la ( not shown ) .
1 were from healthy individuals and showed normal amounts of mrn - complex proteins and the loading control , p84 .
these findings provided functional confirmation that the patient s nbn variants were both null mutations that abrogated protein expression , and that his cells scored as radiosensitive.fig .
1immunoblot allows comparison of nibrin ( nbs ) , mre11 and rad50 protein levels in an nbs cell line ( nbs20la ) to wild type and at cells .
2colony survival assay for at and nbs b lymphoblastoid cell lines showing that both the at control cells and those of patient nbs20la are in the radiosensitive range , as defined by sun et al .
2002 immunoblot allows comparison of nibrin ( nbs ) , mre11 and rad50 protein levels in an nbs cell line ( nbs20la ) to wild type and at cells .
protein loading control was p84 colony survival assay for at and nbs b lymphoblastoid cell lines showing that both the at control cells and those of patient nbs20la are in the radiosensitive range , as defined by sun et al .
although the primary goal of newborn screening with trecs has been the pre - symptomatic diagnosis of scid , thereby allowing early intervention , this screening has also identified individuals with non - scid t - lymphopenia . in california , the first 2 years of newborn screening for scid identified 50 infants with t - lymphopenia , defined as < 1500 t cells / mcl : 11 had typical scid , five had idiopathic t - lymphopenia or variant scid ( defined as significant t cell defects without mutation in known scid genes ) , eight had partial and one had complete digeorge syndrome , four had trisomy 21 , and three had at .
, exome sequencing was utilized to identify at as the cause of t - lymphopenia in two patients with positive scid screens . in this same study retrospective analysis of older at patients suggested that approximately half of patients with at will have a positive newborn scid screen .
nbs is a distinct dna breakage / chromosomal instability disorder caused by defects in nibrin , part of the same dna repair pathway as at mutated protein .
the immune defects in at and nbs are similar and include impaired vdj recombination , which affects t - cell receptor and immunoglobulin rearrangement .
t - lymphopenia and decreased trecs as seen in patients with at would thus also be expected in patients with nbs . in our patient ,
the trec newborn screening for scid was positive , but an extensive search for scid gene mutations was unrevealing .
in contrast , exome sequencing revealed novel , compound heterozygous nbn mutations that were associated with absence of nibrin and radiosensitivity . a r181p missense variant in cd40lg , the gene associated with x - linked hyper - igm syndrome ,
was also predicted to be damaging but was inconsistent with the patient s clinical and laboratory data including absent nibrin and a total serum igg concentration in the normal range and positive igg antibody responses to tetanus and h. influenzae b. although it is not impossible for a patient to have two primary immune disorders , nbn mutations fully explain the low t cells , absent nibrin and cellular radiosensitivity that establish the diagnosis of nbs in this patient , while the features of cd40l deficient hyper - igm syndrome are absent .
most patients are full term , but may have microcephaly at birth with subsequent growth failure .
most patients meet early developmental milestones but have varying degrees of intellectual disability later in life [ 7 , 2527 ] .
perinatal hydrocephalus as seen in our patient has been reported in two children with nbs .
hydronephrosis , renal anomalies such as horseshoe or dysplastic kidneys , skeletal anomalies such as clinodactyly and partial syndactyly , caf au lait spots and vitiligo have all been seen , but are not constant features and are also found in other conditions [ 8 , 28 ] .
lymphoid malignancy affects up to 40 % of patients with nbs by their 21st year .
onset of malignancy can vary in these patients depending on the mutation inherited and degree of nibrin dysfunction .
most patients with nbs show some degree of immunodeficiency . in a review of 57 patients from the polish nijmegen breakage syndrome registry ,
19 % had normal total serum immunoglobulins , while 25 % had severe hypogammaglobulinemia .
at least one igg subclass was deficient in all patients : 89 % igg4 , 73 % igg2 and 54 % igg1 .
similarly , our patient had variably low total serum immunoglobulins that trended upward with age ( table 1 ) , but igg3 and igg4 remained low ( data not shown ) .
specific antibody response after two h. influenza type b immunizations was negative at 6 months , but positive at 10 months following an additional immunization .
our patient s absolute cd19 + b cells were reduced during the first year of life , as seen in 72 % of polish registry patients . in the polish cohort , 84 % of patients received immunoglobulin replacement therapy for frequent or prolonged respiratory tract infections , which have not occurred in our patient up to the present .
lymphocyte subset analysis in nbs has shown decreased t cells , with cd4 + t cells affected most severely .
this is consistent with our patient s findings ( table 1 ) . the elevated proportion of nk cells seen in our patient was also noted previously in 25 out of 40 patients .
the treatment of choice for scid is most often hsct . to date , however , there is limited experience with hsct in patients with nbs .
indications for attempting transplantation have included severe immunodeficiency and hematologic malignancy ; pre - emptive hsct has not been reported .
of particular concern has been the use of dna - damaging chemotherapeutic conditioning regimens and the potential to induce de novo malignancies in patients with a pre - existing dna repair deficit .
there has been some success with reduced intensity pre - hsct conditioning regimens , but studies to date are limited by their retrospective nature , small sample size and relatively short term follow - up .
with widespread adoption of trec screening for scid , nbs may be identified prospectively , enabling the population incidence and natural history to be better understood .
our case expands our appreciation of the association of nbs with hydrocephalus and hydronephrosis and illustrates the utility of wes as applied to diagnose the underlying cause of idiopathic t lymphopenia found by trec screening .
there are more than 200 known genetic defects for primary immunodeficiency [ 19 , 32 ] , and testing of individual genes can be costly and time intensive .
wes resulted in prompt detection of two nonsense mutations in nbn and definitive diagnosis in our patient , who presented with atypical features of nbs . establishing the diagnosis allowed avoidance of live virus vaccines and exposure to ionizing radiation , as well as anticipatory monitoring for serious infections and malignancy .
trimethoprim / sulfamethoxazole was started to prevent pneumocystis jiroveci pneumonia ; however he has not received immunoglobulin infusions or hsct .
exome sequencing of the parents also established the nbn mutations as inherited versus de novo and allowed for accurate and informative counseling regarding the risk of future offspring inheriting both affected genes and having nbs .
the parents were informed that other family members could be carriers of these same mutations . | purposesevere combined immunodeficiency ( scid ) encompasses a group of disorders characterized by reduced or absent t - cell number and function and identified by newborn screening utilizing t - cell receptor excision circles ( trecs ) .
this screening has also identified infants with t lymphopenia who lack mutations in typical scid genes .
we report an infant with low trecs and non - scid t lymphopenia , who proved upon whole exome sequencing to have nijmegen breakage syndrome ( nbs).methodsexome sequencing of dna from the infant and his parents was performed .
genomic analysis revealed deleterious variants in the nbn gene .
confirmatory testing included sanger sequencing and immunoblotting and radiosensitivity testing of patient lymphocytes.resultstwo novel nonsense mutations in nbn were identified in genomic dna from the family .
immunoblotting showed absence of nibrin protein .
a colony survival assay demonstrated radiosensitivity comparable to patients with ataxia telangiectasia.conclusionsalthough trec screening was developed to identify newborns with scid , it has also identified t lymphopenic disorders that may not otherwise be diagnosed until later in life .
timely identification of an infant with t lymphopenia allowed for prompt pursuit of underlying etiology , making possible a diagnosis of nbs , genetic counseling , and early intervention to minimize complications . |
in vertebrates , melatonin and its signaling through g - protein - coupled receptors ( gpcrs ) play a fundamental role in the circadian modulation of physiology and behavior .
melatonin is a highly diffusible hormone secreted at night by the pineal organ , which in nonmammalian vertebrates is directly light sensitive ( lamb , 2013 ) . as a hormone of darkness , melatonin levels change according to circadian , lunar , and seasonal cycles ( reiter , 1993 ) .
a conserved function of melatonin in vertebrates , from fish to mammals , is the regulation of sleep ( dollins et al . , 1994 ; zhdanova et al . , 2001 ) .
in mammals , this occurs through direct modulation of neuronal excitability in the suprachiasmatic nucleus , the brain circadian pacemaker ( jiang et al . ,
1995 ) , and in the thalamus , where sleep is initiated ( ochoa - sanchez et al . , 2011 ) .
melatonin is one of the oldest biologically active molecules in nature , present in a nearly ubiquitous range of organisms , including bacteria and plants .
its rhythmic production has been reported not only in vertebrates , but also in various protostomes , in cnidarians , and in dinoflagellates ( balzer and hardeland , 1991 ; hardeland and poeggeler , 2003 ; roopin and levy , 2012 ) .
the ubiquitous presence of melatonin ( hardeland and poeggeler , 2003 ) has been linked to its chemical properties , which make it one of the most powerful radical scavengers known in nature ( tan et al . , 2007 ) . beyond that
, the presence of melatonin receptors in all animal lineages , except sponges ( feuda et al . , 2012 ) , indicates that melatonin acquired an additional signaling function early in animal evolution .
it has been speculated that the role of melatonin as the hormone of darkness has evolved directly from its antioxidant properties : in a system with constant melatonin synthesis , the reduction of melatonin levels during the day due to its light - dependent oxidation would make it a suitable signal for darkness ( hardeland et al . , 1995 ) .
chemical indicator of darkness for the circadian regulation of some physiological process and/or behavior . however , the nature of such melatonin - controlled behavior has so far remained elusive , as the role of melatonin signaling has been poorly investigated outside vertebrates . in few cases , it has been demonstrated that melatonin has modulatory ( often inhibitory ) effects on locomotion ( anctil et al .
, 1991 ; bentkowski et al . , 2010 ; tanaka et al . , 2007 ; tilden et al . ,
2003 ) ; yet it is not clear whether these effects are linked to circadian rhythms and how they relate to the ancient role of melatonin signaling in animals . to broaden our perspective on the function of melatonin signaling in metazoans , we investigated its possible role in the day / night control of zooplankton locomotion .
primary larvae forming most of the zooplankton are part of the life cycle in the majority of animal phyla .
they swim using locomotor cilia , which are either distributed over the entire body surface or concentrated in specialized ciliary bands . in the ocean ,
almost all of these larvae show a pronounced rhythmic behavior , known as diel vertical migration ( dvm ) , which generally consists of an upward swimming phase at dusk and a downward displacement phase throughout the night and/or at dawn ( alldredge and king , 1980 ; forward , 1988 ; rudjakov , 1970 ) .
the control of vertical migration in the oceans has been linked to the origin of animal circadian rhythms ( gehring and rosbash , 2003 ; pittendrigh , 1993 ) , as a mechanism to escape damaging uv irradiation during the daytime ( calkins and thordardottir , 1980 ; rhode et al . , 2001 ) .
we thus considered it an attractive hypothesis that melatonin signaling may play a role in the diurnal control of ciliary swimming . to elucidate the possible interplay between
ambient light detection , melatonin signaling , and circadian larval swimming activity in an invertebrate zooplankton larva , we chose the annelid platynereis dumerilii , a marine animal model amenable to molecular and behavioral studies , which has conserved vertebrate - type ciliary photoreceptors ( arendt et al . , 2004 ; jkely et al . ,
as an entry point , we found that the most specific marker of melatonin synthesis , the gene hydroxyindole - o - methyltransferase ( hiomt ) ( nowak et al . , 1993 ) , is conserved in several bilaterian genomes ( figure s1 available online ) .
therefore , in order to identify the platynereis melatonin - producing cells , we performed whole - mount in situ hybridization ( wmish ) with probes detecting transcripts of platynereis hiomt and of marker genes for phototransduction and circadian clock ( figure 1 )
. expression was detected in the episphere , where the larval brain differentiates ( figures 1a and 1b ) , starting at 34 hr postfertilization ( hpf ) in dorsomedial cells ( figures 1d1f ) and covering the extended ciliary photoreceptor region at 48 hpf ( dashed circles in figures 1g1j ) .
this area comprises the previously described ciliary photoreceptors expressing c - opsin1 ( arendt et al . , 2004 ) .
in vertebrate ciliary photoreceptors , phototransduction involves the g - alpha subunit gt , a member of the gi family , and nonselective cationic cyclic nucleotide - gated ( cng ) channels , which lead to an off response ( hyperpolarization ) in the presence of light .
the same phototransduction components were expressed specifically in the platynereis dorsal brain ( figures s2a s2c , 1e , 1h , and 1k ) .
intriguingly , markers of the circadian clock , like bmal ( arendt et al . , 2004 ) , vrille , and l - cry , the ortholog of the drosophila light - sensitive cryptochrome , were expressed in the same region ( figures s2d , 1f , and 1i ; see also zantke et al . , 2013 ) .
coexpression of these genes was apparent from the similar position of stained cells adjacent to the photoreceptor cilia ( arrows in figure 1 ) and confirmed with the profiling by image registration ( primr ) technique ( tomer et al . , 2010 ) , which revealed coexpression of platynereis hiomt , l - cry , cnga , and c - opsin1 in a few cells of the dorsal brain , including the ciliary photoreceptors ( blue in figure 1c ) .
interestingly , the expression of melatonin synthesis , phototransduction , and clock markers was broader than the highly restricted c - opsin1 expression ( magenta in figure 1c ) and overlapped with that of other opsin family representatives , such as neuropsin ( figure s2e ) and peropsin ( figure 1j ; compare extended red coexpression region in summary figure 1l ) .
our data suggest that photosensitivity , circadian entrainment , and melatonin release are directly coupled , at the cellular level , in the platynereis dorsal brain , just as in pineal photoreceptors .
the first experimental evidence for such coupling was obtained from a quantification of gene expression dynamics during the light - dark cycle .
we measured simultaneously the expression levels of clock genes , neuropeptides , opsins , and genes of the melatonin synthesis pathway using a high - throughput quantitative pcr ( qpcr ) screen ( figures 2 and s3 ) . to this aim
, platynereis larvae were sampled between 45 and 75 hpf ( with the night phase between 56 and 64 hpf ) .
the circadian system is already active and entrainable at these larval stages : the expression levels of clock genes ( such as clock , period , and tr - cry ; zantke et al . ,
2013 ) oscillated throughout the light - dark cycle , and in sibling larvae raised in an inverted light - dark cycle ( shifted by 12 hr ) , the phase of clock gene expression was likewise shifted by 12 hr ( figure 2b ) .
clustering analysis of gene expression changes over our entire data set retrieved two major groups : genes with expression levels constantly increasing throughout development ( reflecting the steady increase in the number of differentiated cells at these stages ) and genes upregulated specifically during the night ( figures 2a , 2c , and s3 ) .
the first group included neuronal differentiation markers , such as synaptotagmin ( syt ) and prohormone convertase 2 ( phc2 ) , several neuropeptides ( conzelmann et al . , 2011 ) , and rhabdomeric opsins expressed in the eyes ( r - ops1 and r - ops3 ; randel et al . , 2013 ) .
the second group included several genes expressed in the hiomt+ cells , such as peropsin , neuropsin , and cng channel subunits , indicating a night - dependent change of light sensitivity .
moreover , all genes involved in the melatonin synthesis and degradation pathway ( tph , ddc , mao , aanat , and hiomt ) were upregulated at night , whereas those exclusively involved in serotonin signaling ( vmat , sert ) were not ( figures 2c and 2d ) .
these findings suggested that melatonin itself is produced and released during the night , as reported in other invertebrate species ( hardeland and poeggeler , 2003 ) , and that melatonin release is directly controlled by light and/or by the circadian clock . to identify and characterize a possible effect of nocturnal melatonin release on larval behavior , we assayed larval ciliary swimming . in platynereis , the larval brain controls ciliary locomotion by direct innervation of the prototroch , an equatorial girdle of cells equipped with multiple motile cilia ( figures 1a and 1b ) .
changes in the ciliary beating frequency ( cbf ) and in ciliary closure time ( i.e. , length and frequency of ciliary arrests ) differentially affect swimming speed , depth , and direction ( conzelmann et al .
thus , we assayed cbf and ciliary arrests at 52 hpf , comparing larvae in their midday and midnight ( zt8 and zt20 ; zt , zeitgeber time ; figure 3a ) .
although cbf did not differ significantly between day and night ( figure 3b ) , we found a significant increase in overall ciliary closure time at night ( figure 3c ) .
treatment at night with the melatonin receptor antagonist luzindole dramatically decreased closure time ( figure 3d ) , indicating that the nocturnal increase in ciliary closure time depends on melatonin signaling .
consistently , daytime treatment with 100 m melatonin was sufficient to almost double ciliary closure time ( figure 3e ) .
finally , we found that absence of light during daytime was not sufficient by itself to increase ciliary closure time ( figure 3f ) .
our data are thus consistent with the possibility that the circadian clock contributes to the regulation of the melatonin rhythm ( as in vertebrates ; falcn et al . , 2010 ) .
next , we reasoned that the ciliary closure time depends on two parameters : the frequency and the length of the closure events .
therefore , we dissected how these parameters change during day and night . at night , the frequency of ciliary arrests is significantly higher compared to daytime ( figure 3 g ) .
moreover , the bimodal distribution of ciliary closure lengths ( figure 3h ) indicated the existence of two distinct kinds of arrests , the short and long closures ( with an average length of 0.2 and 2.2 s , respectively ; figure 3h ) .
the day - night transition involves a significant increase of the proportion of long closures ( figures 3i and 3i ) .
the melatonin receptor antagonist luzindole applied at night recapitulated the diurnal condition : the overall frequency of arrests was reduced ( figure 3j ) and the long closures were suppressed ( figures 3k and k ) .
conversely , treatment with melatonin during the day increased the proportion of long closures to night levels ( figures 3l and 3l ) . taken together , our data indicate the existence of two alternative behavioral states during day and night , which correlate with the day - night differences in gene expression profile .
melatonin signaling is necessary and sufficient to increase ciliary closure frequency and length , establishing the nocturnal behavioral state . to dissect the mechanism of ciliary arrest
ciliomotor neurons driving ciliary arrests and to test whether they are responsive to melatonin signaling .
given that the prototroch cells express the acetylcholine receptor 9/10 ( jkely et al .
, 2008 ) , the best candidates were the early developing cholinergic neurons previously identified in the larval brain ( jkely et al . , 2008 ) .
consistent with this , application of acetylcholine ( ach ) significantly increased ciliary closure time , whereas the acetylcholine receptor antagonist mecamylamine was able to suppress the ach effect and reduce ciliary arrests ( figure 4a ) .
notably , mecamylamine specifically suppressed the long closures that are regulated by melatonin signaling ( figure 4b ) .
acetylcholinesterase staining confirmed direct innervation of the prototroch by cholinergic axons ( figure 4c ) .
in particular , the ventral cholinergic neurons , some of which directly innervate the prototroch ( cfr mn3l / mn3r in randel et al . , 2014 ) , qualified as candidate melatonin - responsive neurons , as indicated by the coexpression of the platynereis melatonin receptor ( mtnr ; figure s2 ) and the cholinergic marker chat ( figure 4d ) . to test whether melatonin signaling modulates neuronal activity , we performed two - photon imaging on larvae expressing the genetically encoded calcium indicator gcamp6s . to facilitate the identification of the ventral cholinergic neurons , we took advantage of the fact that these cells are located at the interface between the two halves of the larval brain developing from the ab and cd blastomeres ( figure s4 ) . therefore , we expressed gcamp6s and h2b - rfp in the cd lineage by single - blastomere injections ( figure 5a ) . in control conditions , we detected sparse , arrhythmic small - amplitude calcium transients in these neurons and along their projections .
unexpectedly , the application of melatonin elicited enhanced neuronal activity in the most ventral cell of the cholinergic cluster .
this heightened neuronal activity also revealed a direct contralateral projection to the prototroch cells through the ventral cerebral commissure ( figure 5b ) .
melatonin robustly induced a sustained rhythmic activity pattern , characterized by the appearance of gcamp6s peaks of regular amplitude and frequency ( mean frequency : 0.43 hz ; figure 5c ; movie s1 ) .
the melatonin - induced calcium peaks were readily suppressed by subsequent addition of the melatonin receptor antagonist luzindole ( figure 5c ) .
moreover , we detected this activity pattern specifically in the prototroch - projecting ciliomotor neuron and never in any of the neighboring cd cells ( figure 5d ) . to test
whether the melatonin - induced activity recapitulates the nocturnal endogenous activity , we performed the same experiments at night . in untreated larvae
, we found spontaneous rhythmic calcium peaks reminiscent of the melatonin - induced activity ( mean frequency : 0.31 hz ; figure 5e ) .
these peaks were suppressed by application of luzindole ( figure 5e ) , indicating that at night this rhythmic activity is induced by endogenous melatonin release .
analysis of gcamp6s peak frequency and temporal distribution confirmed that daytime administration of melatonin mimics the spontaneous nocturnal activity ( figures 5f and 5 g ) .
notably , the rhythmic activity of the cholinergic neuron proved insensitive to mecamylamine treatment ( figure s5 ) , indicating that the effect of cholinergic agonists and antagonists on ciliary arrests occurs downstream of these neurons ( i.e. , at the cholinergic ciliomotor synapses on the prototroch cells ) . to better understand the neurophysiological processes that underlie the observed rhythmic firing and the nocturnal change in ciliary arrests , we performed intracellular sharp electrode recordings from prototroch cells .
ciliary arrests coincided with electrical activity , as reported previously from extracellular field potential recordings ( conzelmann et al . , 2011 ) ; however , intracellular recordings with simultaneous imaging of ciliary beating revealed that these arrests coincide with depolarizations that arise from an intrinsic electrical excitability of the prototroch cell ( figure 6a ) .
consistent with excitatory cholinergic transmission , application of acetylcholine induced prototroch depolarization , and this effect was suppressed by concurrent mecamylamine application ( figure s6 ) .
application of melatonin caused a significant increase in prototroch spike frequency ( figures 6a6c ) , as well as a decrease in the distribution of interspike intervals ( figure 6d ) , reflecting the sustained electrical activity that would be expected given the effect melatonin has on the length of ciliary arrests .
intracellular recordings also revealed the presence of excitatory postsynaptic potentials ( epsps ) . in agreement with the calcium imaging data , melatonin changed prototroch epsps from single sparse events to regular periodic bursts , each characterized by a duration of 0.25 0.08 s ( figure 6e ) .
the effect of melatonin was reversible with application of the melatonin receptor antagonist luzindole ( figure 6e ) .
moreover , application of mecamylamine after melatonin treatment completely eliminated excitatory synaptic transmission , indicating that this activity was exclusively cholinergic ( figure 6e ) .
these results indicate that each nocturnal peak of gcamp6s fluorescence corresponds to a burst of action potentials in the presynaptic cholinergic cells , increasing the likelihood of prototroch spiking . to further assess the effect of melatonin - induced bursting on synaptic transmission
this revealed a significant increase of the mean epsp amplitude , indicating that the number of synaptic vesicles released per action potential more than doubles during the melatonin - induced bursting ( figures 6f and 6 g ) . at the same time , the mean resting membrane potential of the prototroch cells ( which do not express mtnr ) was not significantly altered in presence of melatonin ( from 70.45 to 70.39 mv , n = 7 , ns ) .
therefore , we conclude that at night melatonin signaling directly controls the excitability of presynaptic cholinergic neurons , that it induces rhythmic bursting and potentiates synaptic transmission at the ciliomotor - prototroch cells synapses , and that this augmented release of acetylcholine enhances the frequency and duration of ciliary arrests .
our combination of expression profiling , neuronal activity imaging , and intracellular recordings in a zooplankton model reveals a role of melatonin signaling in the circadian control of ciliary swimming . in platynereis , melatonin is necessary and sufficient to establish a nocturnal behavioral state characterized by enhanced ciliary arrests .
we can distill the underlying circuit architecture into two major components ( red and blue in figure 7 ) .
the first is the sensory - neuromodulatory component , constituted by melatonin - releasing , ambient light - detecting photoreceptors that harbor a circadian clock .
the second is the effector component , represented by the cholinergic ciliomotor neurons , which are direct targets of nocturnal melatonin signaling and respond by rhythmic bursting .
this system represents a minimalistic example of integration of sensory - neuromodulatory and motor circuits in animal nervous systems .
comparative evidence indicates that at least parts of these circuits are of more widespread occurrence in animals and may thus be evolutionary ancient .
the shared key feature of the dorsal brain neurons described here is the coexpression of hiomt with markers of opsin - based phototransduction and the circadian clock .
the circadian clock is already entrained in early larvae , and several genes expressed in these cells , including hiomt itself , are upregulated at night , suggesting that ambient light detection and the circadian clock control melatonin synthesis . a coupling of these three processes in the same cells is also observed in the pineal photoreceptors of lower vertebrates ( lamb , 2013 ) , and intriguingly , the platynereis ciliary photoreceptors ( previously compared to pineal and retinal photoreceptors ; arendt et al . , 2004 ) are part of the clock - controlled , melatonin - releasing system . the expression of multiple opsins in nonvisual photoreceptors of the most anterior ( or apical ) part of the larval nervous system has been documented in other protostomes and in deuterostomes ( ooka et al . , 2010 ; passamaneck et al . ,
a shared feature of this so - defined larval apical nervous system ( specified by conserved developmental patterning mechanisms ; marlow et al . , 2014 ) is the presence of multiple sensory cells that project into a neurosecretory neuropil and release hormones and neuromodulators ( tosches and arendt , 2013 ) .
the expression of different opsins in subsets of hiomt+ cells in platynereis hints at a sophisticated responsiveness of the apical nervous system to light .
opsins responding to different wavelengths would allow dissecting the spectral composition of light at different depths or during dusk and dawn and may also contribute to moonlight detection for the regulation of circalunar rhythms , which in adult worms has been attributed to the brain region harboring the ciliary photoreceptors ( zantke et al . , 2013 ) .
the upregulation of peropsin , neuropsin , and cng channels during the dark phase might then prepare the larvae to sense moonlight .
the expanding array of functional tools available for platynereis ( zantke et al . , 2014 ) will allow testing these hypotheses and unraveling the contributions of individual opsins and neuropeptides to the annelid ambient light - dependent behaviors .
on the effector side , we identify a pair of cholinergic ciliomotor neurons as regulators of ciliary arrests .
these neurons belong to a larger cholinergic system that innervates larval ciliary bands , as revealed by acetylcholinesterase staining ; within this system , they are the only neurons expressing the melatonin receptor and responding to melatonin treatments .
cholinergic innervation of ciliary bands has been observed in most protostome and deuterostome larvae , and a general requirement of cholinergic transmission for ciliary arrests has been also documented ( lacalli and gilmour , 1990 ; lacalli et al . , 1990 ) , indicating that the cholinergic ciliomotor system described here is of broader relevance for understanding zooplankton neurobiology . in platynereis larvae ,
the melatonin - sensitive cholinergic system regulates distinct , long - lasting diurnal and nocturnal behavioral states . at the level of the ciliomotor neurons , this regulation involves the switch from sparse firing to rhythmic bursting .
this finding is especially interesting as it may shed light on the evolutionary origin of circadian behavioral states in animals .
circadian behavioral states , such as sleep - wake cycles , are widespread in the animal kingdom , indicating that the day - night regulation of activity rhythms is crucial for homeostasis and survival ( allada and siegel , 2008 ) .
a defining and conserved feature of sleep , which makes it distinct from rest , is the disconnection of the brain from the sensory environment and hence the increase of arousal threshold .
platynereis larvae can respond to a variety of sensory cues , which would ultimately affect ciliary arrests through the same ciliomotor system .
for example , ciliomotor neurons are innervated by interneurons of the larval visual system , indicating that they respond to visual stimuli , together with other motoneurons ( randel et al . , 2014 ) .
but could any sensory cue be relayed in presence of rhythmic bursting ? if not , the nocturnal rhythmic burst firing might be a mechanism that filters incoming sensory information and reduces responsiveness to sensory stimuli . in a similar way , in mammals , the switch of thalamic relay neurons to rhythmic burst firing is responsible for filtering sensory information during sleep ( mccormick and feeser , 1990 ) and can be induced directly by melatonin ( ochoa - sanchez et al . , 2011 ) .
it will be interesting to determine whether these functional analogies correspond to conserved molecular mechanisms , for instance , to conserved targets downstream of melatonin signaling .
promising candidates are shaker voltage - gated potassium channels , key determinants of neuronal excitability , which are regulated by melatonin ( yang et al . , 2011 ) and are necessary for sleep in flies and mammals ( cirelli et al . , 2005 ; douglas et al . , 2007 )
the most prominent behavior associated with day - night cycles is dvm ( see introduction ) .
we propose that the day - night changes in ciliary closure time evoked by melatonin signaling in platynereis correspond to different phases of dvm in the field .
in platynereis , a long ciliary closure time correlates with a low vertical position ( conzelmann et al . , 2011 ) ; therefore , the nocturnal behavior would lead to the slow descent of larvae in the water column . in line with this conclusion
, field studies have shown that planktonic annelids reach their highest position in the water column at dusk and then sink throughout the whole night ( alldredge and king , 1980 ) .
other zooplankton species show different temporal dvm regimes that often involve muscular rather than ciliary swimming , suggesting a more complex regulation of locomotor activities downstream of melatonin signaling as an adaptation to variable ecological constraints ( lampert , 1989 ) .
interestingly , it has been proposed that circadian rhythms and ambient light detection evolved in the context of dvm , an advantageous behavior facilitating escape from light - induced oxidative stress ( gehring and rosbash , 2003 ; pittendrigh , 1993 ) .
light - sensitive cryptochromes , present in all basal metazoan phyla , including sponges ( rivera et al . , 2012 ) , might have represented the first link between ambient light detection and clock entrainment .
we now extend this reasoning with the idea that melatonin signaling has been added to this system as an efficient paracrine signal , ensuring better coordination of the organismal response and whole - body physiology and becoming a perfect chemical indicator of darkness after its original radical scavenger role . because melatonin receptors and opsins arose from the same duplication of an ancestral g - protein - coupled receptor ( feuda et al . , 2012 ) , we further hypothesize that melatonin signaling and opsin - based phototransduction evolved in the same dvm context . as photopigment ,
opsin outperformed cryptochrome by increased signaling speed , signal amplification , coupling with different transduction cascades and an evolvable spectral tuning that , after repeated duplications , allowed perception of colors at different depths and times of the day ( nilsson , 2013 ) .
this way the full system involving opsin - based ambient light detection , circadian clock , and melatonin signaling became a key regulator of circadian behavior and persisted in the dorsal brain of annelids and in the pineal and retinal photoreceptors of vertebrates .
platynereis genes were either obtained from expressed sequence tag libraries or cloned with rapid amplification of cdna ends ( race ) pcrs and/or rt - pcr using gene specific primers ( pcr primers are listed in the extended experimental procedures ) . in situ hybridizations and acetylcholinesterase stainings (
ache ) were performed and imaged following established protocols , as detailed in the extended experimental procedures .
platynereis larvae were fertilized at zt8 ( midday ) and raised in an 18c incubator , under a 16l:8d cycle .
nine groups were sampled at different time points , as indicated in figures 2 and s3 . at night , animals were collected under dim red light . for the experiments with the inverted cycle conditions , immediately after fertilization , sibling larvae were raised under an inverted light cycle ( 12 hr shift ) .
cdna was synthesized from 100 ng of total rna ; 1.25 l of each cdna was used as a template for a preamplification reaction ( preamp ) of target genes .
diluted preamps were loaded on a 48.48 fluidigm biomark dynamic array chip ( spurgeon et al . , 2008 ) .
the chip was run following manufacturer s instructions ( see the extended experimental procedures for further details on the protocol and the list of primers used ) .
fluidigm data were analyzed with the bioconductor htqpcr package ( dvinge and bertone , 2009 ) .
the genes cdc5 and rps9 were used to obtain the normalized dcq values , and for each time point the two dcqs from the two preamps were averaged .
expression relative to the first time point ( 45 hpf ) was calculated as 2 .
the expression values of all the genes ( except the housekeeping genes ) were used for clustering analysis .
clustering was performed with the average method using the euclidean distance . for clustering ,
expression values were scaled to the same range in order to compare similar trends regardless of the amplitude of expression changes .
the following drugs were used : l - cis - diltiazem ( enzo life sciences ) in natural sea water ( nsw ) , luzindole ( tocris ) , stock in dmso , mecamylamine ( sigma ) , stock in 95% etoh or nsw , and melatonin ( sigma ) and acetylcholine ( sigma ) solutions freshly prepared in nsw .
drugs were diluted to their final concentration in nsw ; corresponding concentrations of vehicle were used as controls .
ciliary beating and arrests were imaged as described ( conzelmann et al . , 2011 ) , with a dmk 21bf04 camera ( the imaging source ) and a frame rate of 60 or 15 frames / s ,
a 750-nm - long pass filter was always interposed between the light source and larvae .
behavioral data were analyzed in r. all the experiments were repeated at least twice with larvae from different embryonic batches .
platynereis cd blastomeres were injected with gcamp6s ( chen et al . , 2013 ) and h2b - rfp mrnas ( final concentration of 250 g/l each ) . injected larvae at the 4852 hpf stage were mounted in 3% low - melting agarose on glass - bottom culture dishes ( mattek ) and maintained in nsw .
imaging was performed using a zeiss lsm780 microscope , with a 32-ch gaasp detector and a two - photon light source ( chamaleon , coherent ) set at 910 nm .
two - photon imaging was chosen to avoid any interference of light with behavioral responses .
movies ( 248 250 pixels ) were acquired under a 40 oil - immersion objective and with a temporal resolution between 8.26 and 16 hz . responses to drugs were imaged 520 min after application to the bath and without any change of imaging settings .
gcamp6s movies were analyzed using fiji and r , as described in the extended experimental procedures .
the same region of interest ( roi ) was used to quantify fluorescence before and after drug application .
sharp electrode recordings with simultaneous high - speed imaging were performed on 4060 hpf platynereis larvae .
holding pipettes were made from borosilicate glass ( science products ) with an outer diameter ( od ) of 1 mm and were fire polished to minimize damage to the larvae .
recording electrodes were made from pipettes with an od of 1.5 mm , filled with 3 m kcl , and showed resistances between 1525 m. to facilitate electrode placement , larvae were digested with 46.7 g / ml of proteinase k for 1015 min .
signals were acquired at 20 khz and analyzed using clampfit 10.3 ( molecular devices ) .
input resistances of prototroch cells were monitored by delivering small hyperpolarizing currents via the recording electrode , and only prototroch cells that displayed resting potentials between 65 to 80 mv and input resistances between 1025 m were used for analysis . simultaneous high - speed ( 20 hz ) imaging of ciliary beating was performed on an andor neo s - cmos camera and analyzed using fiji .
larvae were raised in natural seawater ( nsw ) , at 18c under a 16 hr light - 8 hr dark cycle.sources of platynereis genes and phylogenetic analysisgenesnew platynereis genes were cloned either directly , with rt - pcr and gene specific primers , or first with race pcrs using a mixed stages cdna library ( from 24hpf , 39hpf , 48hpf , 56hpf , 72hpf and 5 dpf larvae , invitrogen generacer kit ) .
pcr primers were designed on the basis of available transcriptome and est data , and for amplification we used either the hotstart taq polymerase ( qiagen ) or the phusion polymerase ( new england biolabs ) .
pcr fragments were cloned in the pcrii - topo vector ( invitrogen ) and verified by sequencing.the following race primers were used to isolate the hiomt cdna sequence : ttggagcataaatgattgggctgatgg , aaggtggcgatattccttccctgaacg , atgcctccaccagggttgattttctca , gctcagcaggtagaggtcggcttca , tgatgaagaagtccccgggcaaa , tgcatgagagatacagggccttcgaca , agtgctgtcgatttaggagctggcaca.the following pcr primers were used to amplify cdnas and produce probes for in situ hybridization : gene nameforward primerreverse primeraanattggtgtaggtatagcacaagtcacatctttttatgttgaaattgagtttggatttcngaacttggattgcagggtacttggagcaaacattatgaccatggcgttccaactgacngbcagtctgcagatgcagcgaagacaaattgtgagcttcagggtagtcactcatgggchgactccagcgacgtcagtcctatccatgtttgattggtggactgcacattttcggiacaaatctttaagacaggatggagggttcgtaacaacactgtacchiomtcaggggaaggacggaaagcacaattaccaccaaaactttgtgcacatatcacctcamaoaggagcaggcataagtggtctctcagccacagtcagaaagcacacactggcaganeuropsinttcccgggatcctgttacccagttagggagggctctgaccgactcttgttgtgaperopsintggtgatgtgccactgctagtcagcatgcaaactgcataaaccagagggacacctgvmattactcggacgacaaacaaaggagcagagcagccatcttgaaacgcacacataagvrilleggacaccaccaagtgtgccactccactgttttcgcttgtggcggtgttactin order to design qpcr primers and/or produce probes for in situ hybridization , the sequences for the following genes were obtained from previous publications : ddc ( raible et al . , 2005 ) , fmrf , phc2 , tph and vtn ( tessmar - raible et al . , 2007 ) , chat ( denes et al . , 2007 ) ,
fvri ( jkely et al . , 2008 ) , dlamide , flamide , fvamide , yfamide , ryamide and wldamide ( conzelmann et al . , 2011 ) , r - opsin4 ( randel et al . , 2013 ) , tr - cry and clock ( zantke et al . , 2013 ) and npy-4 ( conzelmann et al . , 2013).phylogenetic analysessequence data were retrieved from the jgi genome portal webserver , ncbi and ensembl .
multiple sequence alignments of protein sequences were generated with muscle ( http://www.ebi.ac.uk/tools/msa/muscle/ ) and with webprank ( lytynoja and goldman , 2008 ) , inspected and corrected in jalview ( waterhouse et al .
phylogenetic trees with the maximum likelihood method were computed with phyml 3.0 ( guindon et al . , 2010 ) , with 100x bootstrap .
phylogenetic trees were plotted with figtree.imaging of gene expression patternsin situ hybridizationswhole mount in situ hybridizations and tubulin counterstaining were performed as described previously ( arendt et al . , 2001 ) , with few modifications .
for hiomt in situs , probe binding specificity was improved by carrying hybridization and post - hybridization washes at 62c and by using a lower ssc concentration for the last post - hybridization washes ( 0.1x ssc instead of 0.2x ssc ) . in situ hybridizations
were normally counterstained with an anti - acetylated tubulin antibody ( sigma , t7451 ) , which labels the axonal scaffold and the ciliary bands . for early developmental stages
, larvae were acetylated after the proteinase k digestion with the following protocol : 5 min in 1% triethanolamine , 5 min in 1% triethanolamine 3 l / ml acetic anhydride , 5 min in 1% triethanolamine 6
acetylated larvae were counterstained with the anti - tyrosinated tubulin antibody ( sigma t9028).imagingwe used a zeiss axio imager.m1 microscope for light microscopy and a leica tcs spe and a leica tsc sp8 for confocal microscopy .
confocal stacks of expression patterns were acquired with reflection microscopy ( jkely and arendt , 2007 ) , using a 40x oil immersion objective .
contrast and brightness were adjusted equally throughout the images.image registrationprofiling by image registration ( primr ) was performed as described in tomer et al .
average expression patterns was performed using built - in functions in fiji and imaris.acetylcholinesterase staining and imagingacetylcholinesterase ( ache ) staining was performed according to denes et al .
( 2007 ) and karnovsky and roots ( 1964 ) , with some modifications . before fixation
, larvae were digested for 1 min with 46.7 g / ml of proteinase k in nsw .
larvae were then fixed in ice - cold etoh for 2 min or in 4% pfa for 10 min , and stained for 3 - 4 hr at room temperature in 65 mm phosphate buffer ph 6 , 0.5mg / ml ach iodide , 5 mm sodium citrate , 3 mm copper sulfate and 0.5 mm potassium ferricyanide . staining was stopped with 50% etoh , then larvae were dehydrated with an etoh series and transferred in 87% glycerol for imaging .
reflection microscopy was used for confocal imaging of the ache signal.qrt-pcr screen with fluidigm dynamic arrayssample preparationeight batches of platynereis larvae were fertilized at the same time at zt8 ( midday ) .
they were subsequently pooled , separated again into nine groups and raised in a 18c incubator , under a 16 hr light - 8 hr dark cycle .
the nine groups were sampled at different time points between 45hpf and 75hpf , and frozen in liquid nitrogen .
the time points were selected as follows ( see also figure 2a ) : 1 ) 45hpf zt5 ; 2 ) 48hpf zt8 ; 3 ) 54hpf zt14 ; 4 ) 57hpf zt17 ; 5 ) 60hpf zt20 ; 6 ) 63.5hpf zt23.5 ; 7 ) 67.5hpf zt3.5 ; 8) 72.5hpf zt8.5 ; 9 ) 75hpf zt11 . for the nighttime samples ,
animals were collected under dim red light . for the experiments with the inverted cycle conditions , immediately after fertilization sibling larvae were transferred into a different 18c incubator with inverted light cycle conditions ( 12 hr shift ) , and then sampled at the same developmental stages .
total rna was extracted from frozen samples using trizol ( peqlab ) and phenol - chloroform , and rna quality was assessed with bioanalyzer ( agilent technologies).reverse transcription , preamplification of cdna , and qrt - pcrfor each sample , 100ng of total rna were reversed transcribed with superscriptiii first - strand synthesis supermix for qrt - pcr ( invitrogen ) , in a 10 l reaction with oligo - d(t ) and random hexameres .
1.25 l of each cdna ( corresponding to 12.5ng of initial rna ) were used as template for a preamplification reaction ( preamp ) with the abi preamp mastermix kit ( pn4391128 ) .
for each sample , preamps were run in duplicate.each preamp consisted in the specific target amplification ( sta ) of all the 48 target genes . the gene specific primers were pooled to a final concentration of 50 nm each , and preamplification was carried out for 14 cycles .
after preamp , sta primers were removed with exonuclease i ( neb ) , and the cdnas were diluted 10 times .
conventional qpcr was used to confirm the linearity of the preamp reactions.to quantify gene expression levels , we used a high - throughput microfluidics
48.48 fluidigm biomark dynamic array chips were used to measure the expression of 48 target genes , following the manufacturer instructions .
the inlets were loaded with 2.25 l of the diluted preamp cdnas or with gene specific primers , to an inlet concentration of 5 m ( corresponding to a 500 nm concentration in the final reaction ) . serial dilutions of the templates were included to control the linearity of the amplification .
the fluidigm real time pcr analysis software was used to set an optimal global threshold for all the target genes and obtain cq values .
these results were confirmed with independent qpcr experiments on a subset of target genes.data analysisthe fluidigm data were analyzed with the bioconductor htqpcr package ( dvinge and bertone , 2009 ) .
the genes cdc5 and rps9 , previously shown as reliable normalization genes ( dray et al . , 2010 ) , were used to obtain the normalized dcq values , and for each time point the two dcqs from the two preamps were averaged .
the expression values for all the genes ( except the housekeeping genes ) were used for clustering analysis .
clustering was performed with the average method using the euclidean distance . for clustering
, expression values were scaled in order to compare similar trends regardless of the amplitude of expression changes .
we obtained comparable results for other two biological replicates assayed independently.qpcr primersqpcr primers were designed to target , whenever possible , sequences without snps , and to span exon - exon junctions ( as assessed from internal transcriptomic and genomic resources ) .
the efficiency of all the primer pairs was determined experimentally using as template a dilution series of cdna ; only primers with efficiency between 90% and 110% were used .
the selected primers have an average tm of 60c and an average amplicon size of 91.4bp .
all the primers used for qpcr are listed in the following table ( gene name , forward primer , reverse primer):gene nameforward qpcr primerreverse qpcr primercdc5cctattgacatggacgaagatgttccctgtgtgttcgcaagrps9cgccagagagttgctgactactccaatacggaccagacgaanatccaaacatcatggcactgacagtggcagcttcatcacttgddcatgttgttccgaccgatgacgaaagcacatgtcggagttggchaaagccctcctctacttcacctctcggacaatcaccatctchiomtacatgtgggacaccttcatcaggtggcgatattccttccmaoatctgggaggtcgataatgggctgacttgcattgaacctcmtnratcaatcccttcagcattacagcgacagaggcccaaattatcsertcaacgagaccaacgtcaaaccccaagcctcttgctttatctphccctcaagaagctgaatctgatttcgagagttggggtctcvmatgatggttatcagccggattcgaatgggatacaagccaagcbmalcagcatgccataaaaagaaacgcaggatttcaaataaccagcaaaaclockgaggttcccgaatattcaaatcagtcagagagatcggttcgtagl - cryagaagcccttcaacaagtgggcgttcaatcatgagacgagtr - cryatgggacaagaatccagaggcatgacgagcaagatgatggvrilleactggatgaagagacgcaagttagctcacgacgaaggttgperiodtcctgcagcacatgaagaagtggcaccaaggagttctatgc - ops1tctgcaagtggtatggcttcaaacttccaagcctcaggacneuropsatttcgccgagaggtgatagtcgccatggttgcattagperopscgaggtatgctttggacaaggaagcagctcatggttatggr - ops1accctatgccgtcgttggaggcgagcagagggtggatr - ops3tcattcactgggtcatagggtggacggagttcgtaatgagr - ops4aaagccatccagcactcaccaatagccagatgggttgagbsxcccagaaagagtggaattggtgcggtgaatgtgactgttcnotaaagtcaggagggatggttccctaaccctctttgctttgcdlamidegcattgccttacagaagcagtgagaagacactgacgaccagflamidecacacttaaaggaggcaagcgagcctacattggcactttgfmrfattcgggaaacgggaaagcttcccaaacctcatgaaccfvamidectcactaggtgggcaaaatgtcatcttcgtcatcctctcgfvricaaagaccgacttcaccaagcatactgtcacaacggactggyfamidecaatggtgaactgcaagaccggatatctcttctcgctgtcgnpy-4gcaagaggacaatagcagagtggtggatatgttccatggcttcpdfaggatgggatcaagcaagacagacaacctgcatgacgaacryamidectctcattctcgctttagcccctcgcttgtcatcttcatcvtncagtgtttcggacccaacattaacgtgttaatgtagcatcctattgawldamideaaacgccgtcctaactcaaggtggcagtttgtttgctgtgcngattgctggtcacagaaagaggaatcagtgggaaggatggaccngatgccgtccatagcagtaaaccaaagcgcactacaaagctgcngbagtcctgcctaagatcctgaagaagagctgcactttgctgagphc2caacggagaacacaactggacatatccgaagaggtggttgasytaaagaaaaggtgcagcctgatcatagatggcgaacaccagbehavioral experimentsanimalsfor all the behavioral experiments , animals were raised in an 18c incubator , under a 16 hr light - 8 hr dark cycle .
all experiments were typically performed between 51 and 55hpf . for the midday conditions ( zt8 ) , fertilizations were set up at zt4 , whereas for midnight conditions ( zt20 ) fertilizations were set up at zt16 . therefore the night experiments were specifically performed in the second half of the night phase.pharmacologythe following drugs were used : l - cis - diltiazem ( enzo life sciences ) , 10 mm stock in nsw ; luzindole ( tocris ) , 100 mm stock in dmso ; mecamylamine ( sigma ) , 10 mm stock in 95% etoh or freshly dissolved in nsw ; melatonin ( sigma ) and ach ( sigma ) solutions were freshly prepared in nsw .
the drugs were diluted to the final concentration in nsw ; corresponding concentrations of vehicle were used as controls.imagingciliary beating and ciliary arrests were imaged as described ( conzelmann et al . , 2011 ) , with a zeiss axiophot microscope equipped with a dmk 21bf04 camera ( the imaging source ) .
movies were acquired with a frame rate of 60 or 15 frames / s , respectively . a 750 nm long pass filter
for the nighttime measurements , larvae were quickly mounted under a dim red light and imaging was performed in complete darkness . for the ach experiments ( figure 4 ) ,
each larva was imaged after acute treatment with ach and/or mecamylamine ( within 1 min after drug application ) . for the melatonin and luzindole experiments
, larvae were incubated with the drugs for at least 20 min before mounting and imaging.data analysisbehavioral data were analyzed in r ( r core team , 2012 ) .
all the experiments were repeated at least twice with larvae from different embryonic batches . for the analysis of closure length distribution ,
the log10 transformed data set was used in the histograms of figure 3 , and the data are normalized according to the number of larvae imaged in each condition.two-photon calcium imaging with gcamp6smicroinjection of zygotesplatynereis zygotes were injected using a zeiss axiovert 40c inverted microscope , equipped with a joystick micromanipulator ( narishige ) and a microinjector ( femtojet , eppendorf ) .
injection needles were pooled from glass capillaries ( borosilicate thin wall with filament , 1.0 mm outer diameter , 0.78 mm inner diameter , harvard apparatus ) using a sutter needle pooler .
embryos were accommodated on an agarose stage , customized for platynereis injections.gcamp6s ( chen et al . , 2013 )
was kindly provided by the genie project , janelia farm research campus , howard hughes medical institute ( addgene plasmid 40753 ) .
the gcamp6s coding sequence was subcloned in the pcs2 + vector , and mrna was in vitro transcribed with the sp6 mmessage mmachine high yield capped rna transcription kit ( ambion ) .
gcamp6s mrna was injected in the cd blastomere to a final concentration of 250 g/l .
h2b - rfp mrna was co - injected at the same concentration in order to label the cd lineage.two-photon imagingfor calcium imaging , 48 - 52hpf larvae were mounted on glass bottom culture dishes ( mattek ) in 3% low melting agarose , and maintained in natural seawater .
imaging was performed using a zeiss lsm780 microscope , with a 32-ch gaasp detector and a two - photon light source ( chamaleon , coherent ) running at 910 nm .
movies ( 248x250 pixels ) were acquired under a 40x oil - immersion objective , for at least one minute and with a temporal resolution ranging from 8.26hz to 16hz .
drugs were applied directly to the seawater , and responses were imaged 20 min after application ( or 5 min after application for the mecamylamine experiment in figure s5 ) . for the calcium imaging experiments during the night
, larvae were mounted under dim red light and imaged in complete darkness.image analysisgcamp6s movies were analyzed using fiji and r. the cholinergic ciliomotor neuron was identified on the basis of its position within the cd domain and the presence of a contralateral projection .
rois ( region of interest ) were manually selected around the cell body and/or the axon of the cholinergic ciliomotor neuron . in each experiment ,
the same roi was used to compare gcamp6s fluorescence before and after the drug treatments . for the calculation of normalized f / f0 data with a global baseline
, f0 was set as the average fluorescence of the 11-frames interval centered on the minimum fluorescence value . for the calculation of normalized f / f0 data with the moving average approach , a sliding window of 0.8
s was used to calculate f0 . for the analysis of peak frequency and peak - to - peak intervals ,
peaks were extracted from the imaging data with custom - written algorithms.electrophysiologysharp electrode recordings along with simultaneous high - speed imaging were performed on 4060 hpf platynereis larvae .
holding pipettes were made from borosilicate glass ( science products gmbh , hofheim ) with an outer diameter ( o.d . ) of 1 mm and were fire polished to minimize damage to the larvae .
of 1.5 mm , filled with 3 m kcl , and showed resistances between 15 25 m. to facilitate electrode placement , larvae were digested with 46.7 g / ml of proteinase k for 10 - 15 min.electrophysiological recordings were performed on a multiclamp 700a amplifier .
signals were acquired at 20 khz and analyzed using clampfit 10.3 ( molecular devices , union city , ca ) .
input resistances of prototroch cells were monitored by delivering small hyperpolarizing currents via the recording electrode and only prototroch cells which displayed resting potentials between 65 to 80 mv and input resistances between 10 25 m were used for analysis
. simultaneous high - speed ( 20 hz ) imaging was performed on an andor neo s - cmos camera and analyzed using fiji .
larvae were raised in natural seawater ( nsw ) , at 18c under a 16 hr light - 8 hr dark cycle .
new platynereis genes were cloned either directly , with rt - pcr and gene specific primers , or first with race pcrs using a mixed stages cdna library ( from 24hpf , 39hpf , 48hpf , 56hpf , 72hpf and 5 dpf larvae , invitrogen generacer kit ) .
pcr primers were designed on the basis of available transcriptome and est data , and for amplification we used either the hotstart taq polymerase ( qiagen ) or the phusion polymerase ( new england biolabs ) .
pcr fragments were cloned in the pcrii - topo vector ( invitrogen ) and verified by sequencing .
the following race primers were used to isolate the hiomt cdna sequence : ttggagcataaatgattgggctgatgg , aaggtggcgatattccttccctgaacg , atgcctccaccagggttgattttctca , gctcagcaggtagaggtcggcttca , tgatgaagaagtccccgggcaaa , tgcatgagagatacagggccttcgaca , agtgctgtcgatttaggagctggcaca .
the following pcr primers were used to amplify cdnas and produce probes for in situ hybridization : gene nameforward primerreverse primeraanattggtgtaggtatagcacaagtcacatctttttatgttgaaattgagtttggatttcngaacttggattgcagggtacttggagcaaacattatgaccatggcgttccaactgacngbcagtctgcagatgcagcgaagacaaattgtgagcttcagggtagtcactcatgggchgactccagcgacgtcagtcctatccatgtttgattggtggactgcacattttcggiacaaatctttaagacaggatggagggttcgtaacaacactgtacchiomtcaggggaaggacggaaagcacaattaccaccaaaactttgtgcacatatcacctcamaoaggagcaggcataagtggtctctcagccacagtcagaaagcacacactggcaganeuropsinttcccgggatcctgttacccagttagggagggctctgaccgactcttgttgtgaperopsintggtgatgtgccactgctagtcagcatgcaaactgcataaaccagagggacacctgvmattactcggacgacaaacaaaggagcagagcagccatcttgaaacgcacacataagvrilleggacaccaccaagtgtgccactccactgttttcgcttgtggcggtgttact in order to design qpcr primers and/or produce probes for in situ hybridization , the sequences for the following genes were obtained from previous publications : ddc ( raible et al . , 2005 ) , fmrf , phc2 , tph and vtn ( tessmar - raible et al . , 2007 ) , chat ( denes et al . , 2007 ) ,
fvri ( jkely et al . , 2008 ) , dlamide , flamide , fvamide , yfamide , ryamide and wldamide ( conzelmann et al . , 2011 ) , r - opsin4 ( randel et al . , 2013 ) ,
tr - cry and clock ( zantke et al . , 2013 ) and npy-4 ( conzelmann et al . , 2013 ) .
multiple sequence alignments of protein sequences were generated with muscle ( http://www.ebi.ac.uk/tools/msa/muscle/ ) and with webprank ( lytynoja and goldman , 2008 ) , inspected and corrected in jalview ( waterhouse et al . , 2009 ) , and trimmed with gblocks ( castresana , 2000 ) .
phylogenetic trees with the maximum likelihood method were computed with phyml 3.0 ( guindon et al . , 2010 ) , with 100x bootstrap .
whole mount in situ hybridizations and tubulin counterstaining were performed as described previously ( arendt et al . , 2001 ) , with few modifications .
for hiomt in situs , probe binding specificity was improved by carrying hybridization and post - hybridization washes at 62c and by using a lower ssc concentration for the last post - hybridization washes ( 0.1x ssc instead of 0.2x ssc ) . in situ hybridizations
were normally counterstained with an anti - acetylated tubulin antibody ( sigma , t7451 ) , which labels the axonal scaffold and the ciliary bands . for early developmental stages
, larvae were acetylated after the proteinase k digestion with the following protocol : 5 min in 1% triethanolamine , 5 min in 1% triethanolamine 3 l / ml acetic anhydride , 5 min in 1% triethanolamine 6
acetylated larvae were counterstained with the anti - tyrosinated tubulin antibody ( sigma t9028 ) .
we used a zeiss axio imager.m1 microscope for light microscopy and a leica tcs spe and a leica tsc sp8 for confocal microscopy .
confocal stacks of expression patterns were acquired with reflection microscopy ( jkely and arendt , 2007 ) , using a 40x oil immersion objective .
profiling by image registration ( primr ) was performed as described in tomer et al .
( 2007 ) and karnovsky and roots ( 1964 ) , with some modifications . before fixation
, larvae were digested for 1 min with 46.7 g / ml of proteinase k in nsw .
larvae were then fixed in ice - cold etoh for 2 min or in 4% pfa for 10 min , and stained for 3 - 4 hr at room temperature in 65 mm phosphate buffer ph 6 , 0.5mg / ml ach iodide , 5 mm sodium citrate , 3 mm copper sulfate and 0.5 mm potassium ferricyanide .
staining was stopped with 50% etoh , then larvae were dehydrated with an etoh series and transferred in 87% glycerol for imaging .
eight batches of platynereis larvae were fertilized at the same time at zt8 ( midday ) .
they were subsequently pooled , separated again into nine groups and raised in a 18c incubator , under a 16 hr light - 8 hr dark cycle .
the nine groups were sampled at different time points between 45hpf and 75hpf , and frozen in liquid nitrogen .
the time points were selected as follows ( see also figure 2a ) : 1 ) 45hpf zt5 ; 2 ) 48hpf zt8 ; 3 ) 54hpf zt14 ; 4 ) 57hpf zt17 ; 5 ) 60hpf zt20 ; 6 ) 63.5hpf zt23.5 ; 7 ) 67.5hpf zt3.5 ; 8) 72.5hpf zt8.5 ; 9 ) 75hpf zt11 . for the nighttime samples ,
animals were collected under dim red light . for the experiments with the inverted cycle conditions , immediately after fertilization sibling larvae were transferred into a different 18c incubator with inverted light cycle conditions ( 12 hr shift ) , and then sampled at the same developmental stages .
total rna was extracted from frozen samples using trizol ( peqlab ) and phenol - chloroform , and rna quality was assessed with bioanalyzer ( agilent technologies ) . for each sample ,
100ng of total rna were reversed transcribed with superscriptiii first - strand synthesis supermix for qrt - pcr ( invitrogen ) , in a 10 l reaction with oligo - d(t ) and random hexameres .
1.25 l of each cdna ( corresponding to 12.5ng of initial rna ) were used as template for a preamplification reaction ( preamp ) with the abi preamp mastermix kit ( pn4391128 ) . for each sample
each preamp consisted in the specific target amplification ( sta ) of all the 48 target genes .
the gene specific primers were pooled to a final concentration of 50 nm each , and preamplification was carried out for 14 cycles .
after preamp , sta primers were removed with exonuclease i ( neb ) , and the cdnas were diluted 10 times .
conventional qpcr was used to confirm the linearity of the preamp reactions . to quantify gene expression levels
, we used a high - throughput microfluidics qpcr system from fluidigm ( spurgeon et al . , 2008 ) .
48.48 fluidigm biomark dynamic array chips were used to measure the expression of 48 target genes , following the manufacturer instructions .
the inlets were loaded with 2.25 l of the diluted preamp cdnas or with gene specific primers , to an inlet concentration of 5 m ( corresponding to a 500 nm concentration in the final reaction ) .
the fluidigm real time pcr analysis software was used to set an optimal global threshold for all the target genes and obtain cq values .
the fluidigm data were analyzed with the bioconductor htqpcr package ( dvinge and bertone , 2009 ) .
the genes cdc5 and rps9 , previously shown as reliable normalization genes ( dray et al . , 2010 ) , were used to obtain the normalized dcq values , and for each time point the two dcqs from the two preamps were averaged .
the expression values for all the genes ( except the housekeeping genes ) were used for clustering analysis .
clustering was performed with the average method using the euclidean distance . for clustering
, expression values were scaled in order to compare similar trends regardless of the amplitude of expression changes .
qpcr primers were designed to target , whenever possible , sequences without snps , and to span exon - exon junctions ( as assessed from internal transcriptomic and genomic resources ) .
the efficiency of all the primer pairs was determined experimentally using as template a dilution series of cdna ; only primers with efficiency between 90% and 110% were used .
the selected primers have an average tm of 60c and an average amplicon size of 91.4bp .
all the primers used for qpcr are listed in the following table ( gene name , forward primer , reverse primer):gene nameforward qpcr primerreverse qpcr primercdc5cctattgacatggacgaagatgttccctgtgtgttcgcaagrps9cgccagagagttgctgactactccaatacggaccagacgaanatccaaacatcatggcactgacagtggcagcttcatcacttgddcatgttgttccgaccgatgacgaaagcacatgtcggagttggchaaagccctcctctacttcacctctcggacaatcaccatctchiomtacatgtgggacaccttcatcaggtggcgatattccttccmaoatctgggaggtcgataatgggctgacttgcattgaacctcmtnratcaatcccttcagcattacagcgacagaggcccaaattatcsertcaacgagaccaacgtcaaaccccaagcctcttgctttatctphccctcaagaagctgaatctgatttcgagagttggggtctcvmatgatggttatcagccggattcgaatgggatacaagccaagcbmalcagcatgccataaaaagaaacgcaggatttcaaataaccagcaaaaclockgaggttcccgaatattcaaatcagtcagagagatcggttcgtagl - cryagaagcccttcaacaagtgggcgttcaatcatgagacgagtr - cryatgggacaagaatccagaggcatgacgagcaagatgatggvrilleactggatgaagagacgcaagttagctcacgacgaaggttgperiodtcctgcagcacatgaagaagtggcaccaaggagttctatgc - ops1tctgcaagtggtatggcttcaaacttccaagcctcaggacneuropsatttcgccgagaggtgatagtcgccatggttgcattagperopscgaggtatgctttggacaaggaagcagctcatggttatggr - ops1accctatgccgtcgttggaggcgagcagagggtggatr - ops3tcattcactgggtcatagggtggacggagttcgtaatgagr - ops4aaagccatccagcactcaccaatagccagatgggttgagbsxcccagaaagagtggaattggtgcggtgaatgtgactgttcnotaaagtcaggagggatggttccctaaccctctttgctttgcdlamidegcattgccttacagaagcagtgagaagacactgacgaccagflamidecacacttaaaggaggcaagcgagcctacattggcactttgfmrfattcgggaaacgggaaagcttcccaaacctcatgaaccfvamidectcactaggtgggcaaaatgtcatcttcgtcatcctctcgfvricaaagaccgacttcaccaagcatactgtcacaacggactggyfamidecaatggtgaactgcaagaccggatatctcttctcgctgtcgnpy-4gcaagaggacaatagcagagtggtggatatgttccatggcttcpdfaggatgggatcaagcaagacagacaacctgcatgacgaacryamidectctcattctcgctttagcccctcgcttgtcatcttcatcvtncagtgtttcggacccaacattaacgtgttaatgtagcatcctattgawldamideaaacgccgtcctaactcaaggtggcagtttgtttgctgtgcngattgctggtcacagaaagaggaatcagtgggaaggatggaccngatgccgtccatagcagtaaaccaaagcgcactacaaagctgcngbagtcctgcctaagatcctgaagaagagctgcactttgctgagphc2caacggagaacacaactggacatatccgaagaggtggttgasytaaagaaaaggtgcagcctgatcatagatggcgaacaccag for all the behavioral experiments , animals were raised in an 18c incubator , under a 16 hr light - 8 hr dark cycle .
all experiments were typically performed between 51 and 55hpf . for the midday conditions ( zt8 ) , fertilizations were set up at zt4 , whereas for midnight conditions ( zt20 ) fertilizations were set up at zt16 . therefore the night experiments were specifically performed in the second half of the night phase .
the following drugs were used : l - cis - diltiazem ( enzo life sciences ) , 10 mm stock in nsw ; luzindole ( tocris ) , 100 mm stock in dmso ; mecamylamine ( sigma ) , 10 mm stock in 95% etoh or freshly dissolved in nsw ; melatonin ( sigma ) and ach ( sigma ) solutions were freshly prepared in nsw .
the drugs were diluted to the final concentration in nsw ; corresponding concentrations of vehicle were used as controls .
ciliary beating and ciliary arrests were imaged as described ( conzelmann et al . , 2011 ) , with a zeiss axiophot microscope equipped with a dmk 21bf04 camera ( the imaging source ) .
movies were acquired with a frame rate of 60 or 15 frames / s , respectively . a 750 nm long pass filter was always interposed between the light source and larvae .
ciliary closure time was measured from 1 min long movies . for the nighttime measurements ,
larvae were quickly mounted under a dim red light and imaging was performed in complete darkness . for the ach experiments ( figure 4 ) , each larva was imaged after acute treatment with ach and/or mecamylamine ( within 1 min after drug application ) .
for the melatonin and luzindole experiments , larvae were incubated with the drugs for at least 20 min before mounting and imaging .
all the experiments were repeated at least twice with larvae from different embryonic batches . for the analysis of closure length distribution
, the log10 transformed data set was used in the histograms of figure 3 , and the data are normalized according to the number of larvae imaged in each condition .
platynereis zygotes were injected using a zeiss axiovert 40c inverted microscope , equipped with a joystick micromanipulator ( narishige ) and a microinjector ( femtojet , eppendorf ) .
injection needles were pooled from glass capillaries ( borosilicate thin wall with filament , 1.0 mm outer diameter , 0.78 mm inner diameter , harvard apparatus ) using a sutter needle pooler .
gcamp6s ( chen et al . , 2013 ) was kindly provided by the genie project , janelia farm research campus , howard hughes medical institute ( addgene plasmid 40753 ) .
the gcamp6s coding sequence was subcloned in the pcs2 + vector , and mrna was in vitro transcribed with the sp6 mmessage mmachine high yield capped rna transcription kit ( ambion ) .
gcamp6s mrna was injected in the cd blastomere to a final concentration of 250 g/l .
h2b - rfp mrna was co - injected at the same concentration in order to label the cd lineage . for calcium imaging ,
48 - 52hpf larvae were mounted on glass bottom culture dishes ( mattek ) in 3% low melting agarose , and maintained in natural seawater .
imaging was performed using a zeiss lsm780 microscope , with a 32-ch gaasp detector and a two - photon light source ( chamaleon , coherent ) running at 910 nm .
movies ( 248x250 pixels ) were acquired under a 40x oil - immersion objective , for at least one minute and with a temporal resolution ranging from 8.26hz to 16hz .
drugs were applied directly to the seawater , and responses were imaged 20 min after application ( or 5 min after application for the mecamylamine experiment in figure s5 ) . for the calcium imaging experiments during the night
gcamp6s movies were analyzed using fiji and r. the cholinergic ciliomotor neuron was identified on the basis of its position within the cd domain and the presence of a contralateral projection .
rois ( region of interest ) were manually selected around the cell body and/or the axon of the cholinergic ciliomotor neuron . in each experiment ,
the same roi was used to compare gcamp6s fluorescence before and after the drug treatments . for the calculation of normalized f / f0 data with a global baseline
, f0 was set as the average fluorescence of the 11-frames interval centered on the minimum fluorescence value . for the calculation of normalized f / f0 data with the moving average approach , a sliding window of 0.8
s was used to calculate f0 . for the analysis of peak frequency and peak - to - peak intervals
sharp electrode recordings along with simultaneous high - speed imaging were performed on 4060 hpf platynereis larvae .
holding pipettes were made from borosilicate glass ( science products gmbh , hofheim ) with an outer diameter ( o.d . ) of 1 mm and were fire polished to minimize damage to the larvae .
of 1.5 mm , filled with 3 m kcl , and showed resistances between 15 25 m. to facilitate electrode placement , larvae were digested with 46.7 g / ml of proteinase k for 10 - 15 min .
signals were acquired at 20 khz and analyzed using clampfit 10.3 ( molecular devices , union city , ca ) .
input resistances of prototroch cells were monitored by delivering small hyperpolarizing currents via the recording electrode and only prototroch cells which displayed resting potentials between 65 to 80 mv and input resistances between 10 25 m were used for analysis . simultaneous high - speed ( 20 hz ) imaging was performed on an andor neo s - cmos camera and analyzed using fiji . | summarymelatonin , the hormone of darkness , is a key regulator of vertebrate circadian physiology and behavior . despite its ubiquitous presence in metazoa
, the function of melatonin signaling outside vertebrates is poorly understood . here
, we investigate the effect of melatonin signaling on circadian swimming behavior in a zooplankton model , the marine annelid platynereis dumerilii .
we find that melatonin is produced in brain photoreceptors with a vertebrate - type opsin - based phototransduction cascade and a light - entrained clock .
melatonin released at night induces rhythmic burst firing of cholinergic neurons that innervate locomotor - ciliated cells .
this establishes a nocturnal behavioral state by modulating the length and the frequency of ciliary arrests .
based on our findings , we propose that melatonin signaling plays a role in the circadian control of ciliary swimming to adjust the vertical position of zooplankton in response to ambient light . |
superoxide dismutases ( sod , ec 1.15.1.1 ) are a class of enzymes that catalyze the dismutation of superoxide into oxygen and hydrogen peroxide [ 13 ] .
they play an important antioxidant defense role in skins exposed to oxygen . in this regard ,
for the treatment of systemic inflammatory diseases including skin ulcer lesions , the topical application of free mn - sod or cu , zn - sod extracted from bovine , bacterial , and other species was dramatically effective in skin lesions .
it has been reported that significant increase in the levels of sod occurs in vitiligo patients due to the increased oxidative stress .
the involvement of oxidative stress in chronic idiopathic urticaria associated with sod was also reported : the activity of sod was markedly increased in lesional skin as compared with skin of healthy subjects , indicating that oxidative stress is crucially involved in chronic idiopathic urticaria and suggesting that oxidative stress is secondary to the development of inflammation .
the earlier reports [ 7 , 8 ] suggested that the activity of activator protein-1 , which is associated with tumor promotion , was reduced in mn - sod transgenic mice overexpressing mn - sod in the skin , suggesting that mn - sod reduced tumor incidence by suppressing activator protein-1 activation .
the mechanism of mn - sod catalysis is very important , and the mechanism therefore needs to be investigated from different sources using various kinetic methods .
the information regarding the tertiary structure and the structural integrity of the active site of mn - sod is little known and in this regard , investigation on structure - function relationships in this enzyme including docking of a ligand is important . in this study , we applied al to understand mn - sod structural changes and inhibition mechanisms . as a result , we proposed an inhibitory effect of al on mn - sod and suggest the mechanisms of combination between inhibition kinetics and computational prediction to depict the al action in the catalysis of mn - sod .
aluminum chloride crystal ( alcl36h20 ) , pyrogallol , and ans were purchased from sigma - aldrich ( usa ) .
the crude form of mn - sod ( from thermus thermophilus ) was purchased from biotech company ( china ) .
we further purified mn - sod using the ktafplc system ( ge healthcare , usa ) ; a single band was obtained on both sds - page and native nonreducing page gels .
10 mm tris - hcl buffer ( ph 8.2 ) was used during preparing all samples in this study . the assay for mn - sod
the activity of sod was calculated according to the procedures of pyrogallol 's autoxidation , which could be monitored by the change in absorbance at 325 nm per min .
reactions were performed in a typical reaction volume of 1 ml to which 10 l of enzyme solution was added to measure mn - sod activity .
the activity and absorption were measured with a perkin elmer lambda bio u / v spectrophotometer .
far - uv cd spectra of mn - sod at different al concentrations were recorded on a jasco j-810 spectropolarimeter in the region of 190250 nm at room temperature .
mn - sod was denatured by incubation in 10 mm tris - hcl ( ph 8.2 ) containing various concentrations of al for 3 h , 25c .
the fluorescence emission spectra were measured with a jasco fp750 spectrofluorometer with the use of a 1 cm path - length cuvette .
an excitation wavelength of 280 nm was used for the tryptophan fluorescence measurements , and the emission wavelength ranged between 300 and 410 nm .
the changes of the ans - binding fluorescence intensity for mn - sod were studied by labeling with 40 m ans for 30 min prior to measurement .
an excitation wavelength of 380 nm was used for the ans - binding fluorescence , and the emission wavelength ranged from 400 to 650 nm . according to a previous report , when small molecules are bound to equivalent sites on a macromolecule , the equilibrium between free and bound molecules are given by the following equation to evaluate the binding constant ( k ) and number of binding sites ( n ) :
( 1)f0f0f=1n+1k1[q ] ,
where f0 and f are the relative steady - state fluorescence intensities in the absence and presence of quencher , respectively .
the values for k and n can be derived from the intercept and slope of a plot based on ( 1 ) .
the known 3d structure of mn - sod was obtained from pdb data base ( i d : 3mds ) . among the many tools available for in silico protein - ligand docking ,
the program performed ligand docking using a set of predefined 3d grids of the target protein and used a systemic search technique .
the original structure of al was derived from the pubchem database ( compound i d : 104727 , http://www.pubchem.org/ ) . to prepare for the docking procedure ,
the following steps were taken : ( 1 ) conversion of 2d structures to 3d structures , ( 2 ) calculation of charges , ( 3 ) addition of hydrogen atoms , and ( 4 ) location of pockets .
for these steps , we used the fconverter program of the j - chem package ( http://www.chemaxon.com/ ) and openbabel ( http://openbabel.org/ ) .
we assayed mn - sod at the equilibrium and the kinetic states in the presence of al .
mn - sod was significantly inactivated by al with a dose - dependent manner ( figure 1 ) . when the al concentration was increased to 0.8 mm
the ic50 value was measured as 0.19 mm ( n = 2 ) . to evaluate the
the different time courses of mn - sod in the presence of 0.2 , 0.3 , and 0.4 mm al , respectively , were recorded ( figure 2(a ) ) .
the enzyme activity was gradually decreased with time intervals and this implied that al may induce mn - sod tertiary structural change due to the fact that the activity of mn - sod was synchronized with the conformational changes .
the microscopic inactivation rates constants ( ka ) were properly calculated from the semilogarithmic plots ( figure 2(b ) ) where the reactions were plotting as two - phasic courses ( fast , k1 and slow , k2 ) .
the rate constants for 0.2 , 0.3 , and 0.4 mm al were obtained as k1 = 7.39 , 7.83 , and 13.3 10 s , respectively , and k2 = 0.58 , 1.25 , and 1.73 10 s , respectively .
these results suggested that the mn - sod inactivation by al followed the first - order kinetic process , and the enhancing al concentration could promote the inactivation rate . to compare the enzyme activity changes with the secondary structural changes , we performed the far - uv circular dichroism ( cd ) spectroscopy .
as the concentration of alincreased , the overall amount of secondary structure decreased gradually in a dose - dependent manner : specifically , the measurements for both 208 and 222 nm indicated that overall helical contents were decreased with increasing al concentration ( figure 3 ) .
interestingly , the overall secondary structure of mn - sod was mostly sustained at lower than 0.3 mm al but the activity was drastically abolished by al in this range as shown in figure 1 .
next , tertiary structural changes of mn - sod in the presence of al were also measured by intrinsic and ans - binding fluorescences measurements .
the intrinsic fluorescence changes showed that almight induce the unfolding of mn - sod which was monitored by the decrease of intrinsic fluorescence spectra ( figure 4 ) .
based on the quenching effect of aland ( 1 ) , we deduced a double reciprocal plot revealing a linear relationship ( figure 5 ) . from this data , we calculated the binding constant as k = 5.4 0.8 10 m and the binding number as n = 1.5 0.3 according to plotting results and ( 1 ) .
these results revealed that al has a strong binding affinity for tyrosinase in the absence of substrate and that there are one or two possible binding sites .
the kinetics of mn - sod unfolding was also monitored ( figure 6(a ) ) .
the data of the semilogarithmic plots showed that the unfolding process also followed the first - order kinetics where the reactions were plotting as two - phasic courses ( fast , ku1 and slow , ku2 ) .
the rates constants were calculated as ku1 = 2.89 and ku2 = 0.21 10 s ( figure 6(b ) ) .
these results indicated that unfolding process of mn - sod was synchronized with the activity inactivation with the same order reaction , which was comparative to the results in figure 2 . in the next step
, we monitored the hydrophobicity changes of mn - sod in the presence of al .
the ans - fluorescence intensities were changed by overall range of al concentrations ( figure 7 ) , indicating that hydrophobic surfaces of mn - sod were exposed during al - mediated unfolding . in general ,
ans dye can bind to hydrophobic amino acid residues , thus , it is used to monitor the tertiary structural disruption of the enzyme in the presence of inactivator .
our results showed that increase al concentration caused the mn - sod ans - fluorescence intensity increase in a concentration - dependent manner . because the crystallographic structure of mn - sod from thermus thermophilus has been elucidated ( pdb i d : 3mds )
the docking between mn - sod and al by using dock6.3 was successful with significant score ( 14.07 kcal / mol ) and we searched for al binding residues of mn - sod .
we found that the most important expected binding residues interacting with al were asp152 and glu157 residues ( box in figure 8) .
the docking simulation provided the supportive information for the inactivation of mn - sod by al where the binding site is not located in the manganese - containing active site pocket ( figure 9 ) .
we found that al - induced inactivation of mn - sod is not due to the replacement of manganese or chelating from the active site .
several biological effects of al have been reported [ 1215 ] : the results were mostly focused on the toxic effects such as the involvement of oxidative stress , deregulation of cell signaling , membrane biophysics alterations , and the neurotoxicity in neurotransmission . on the contrary ,
a study reported that al can promote faster wound healing in response to skin injury when it is prepared as the template to generate large uniform membranes with differing nanopore sizes .
our investigation suggested a possible cytotoxic effect of al induced by mn - sod inhibition and it may sequentially induce the oxidative damage . our data consistently supports the previous report that al acted as a toxic material for skin fibroblasts .
the changes of enzyme activity and structure in various ions have been extensively studied . for the case of al ,
it has been applied to several enzymes [ 1820 ] to test its effects on the activities .
the biological effect of al has been gradually elucidated and in this regard , we mainly focused on the changes in mn - sod activity and structures in al solutions in the present study , and we found that al worked as an inactivator to mn - sod accompanying with kinetic unfolding processes both in activity and structures . the relative activity and
the activity of mn - sod was conspicuously observed when the secondary structure change has not yet occurred .
the tertiary structural change of mn - sod by al was confirmed by the result of exposing the hydrophobic surface . even at low concentration of al , the overall structure of mn - sod
was changed and this directly affected the structural shape of active site pocket , regardless of mn - sod active center site is very impact and stable due to manganese contained inside .
al did not directly compete with substrate but it affect the catalysis with a dose - dependent manner , implying that al binding site is near to substrate docking site . the computational simulations supported this observation that al can form a ligand - binding complex directly with asp152 and glu157 residues of mn - sod , and these amino acid residues are not located in the active site .
therefore , the conformational changes were observed firstly prior to the occurrence of activity loss since the active site is relative compact and stable via manganese presence and al docking site is relative flexible part of mn - sod . according to the results
observed in the present study , we deduced the mechanisms of mn - sod response to al : ( i ) al ligand - binding to mn - sod causes fist - order kinetic inactivation which was synchronized with conformational changes ; ( ii ) al also induced the decrease of secondary structure at relatively high concentration but compared to the activity and tertiary structural changes , the secondary structure was less sensitive to al than the tertiary structure ; ( iii ) interestingly , the result of computational simulation support our supposition that mn - sod was bound to the near of active site , not in the inner site of active site pocket . in conclusion , mn - sod from extremophile such as thermus thermophilus was tend to be very stable against the changes of temperature and ph , as well as denaturants addition such as urea and guanidine hydrochloride .
however , we found that mn - sod from thermus thermophilus was conspicuously denatured by al . taken together
, the inhibition kinetics combined with the computational prediction allowed us to elucidate into the relationship between enzymatic reaction and structural changes of mn - sod from thermus thermophilus and provides greater insight regarding the folding of mn - sod as well as the cytotoxicity of al .
| superoxide dismutase ( sod , ec 1.15.1.1 ) plays an important antioxidant defense role in skins exposed to oxygen .
we studied the inhibitory effects of al3 + on the activity and conformation of manganese - containing sod ( mn - sod ) .
mn - sod was significantly inactivated by al3 + in a dose - dependent manner .
the kinetic studies showed that al3 + inactivated mn - sod follows the first - order reaction .
al3 + increased the degree of secondary structure of mn - sod and also disrupted the tertiary structure of mn - sod , which directly resulted in enzyme inactivation .
we further simulated the docking between mn - sod and al3 + ( binding energy for dock 6.3 : 14.07 kcal / mol ) and suggested that asp152 and glu157 residues were predicted to interact with al3 + , which are not located in the mn - contained active site .
our results provide insight into the inactivation of mn - sod during unfolding in the presence of al3 + and allow us to describe a ligand binding via inhibition kinetics combined with the computational prediction . |
the glycerol 3-phosphate can then be reduced to dihydroxyacetone phosphate which enters the glycolytic pathway , or be used as the backbone for the formation of glycerolipids ( triglycerides and plasmalogens ) as well as glycerol phospholipids .
glycerol kinase deficiency ( gkd : mim : 307030 ) is an x - linked inborn error of metabolism that is due to mutations , deletions or insertions within the gk gene on xp21 .
patients with isolated gkd ( igkd ) can be either symptomatic with episodes of metabolic acidosis and central nervous system decompensation or asymptomatic with only pseudo - hypertriglyceridemia .
we and others have previously shown that there is no genotype phenotype correlation in gkd and therefore , we can not predict by the dna mutation or the gkd activity , which patients will be symptomatic and which will be asymptomatic , .
this suggests that there is additional complexity in the system and we have hypothesized that this complexity is due in part to other factors that are inherited independently , including modifier genes , flux through related metabolic pathways , post - transcriptional and post - translational modifications , and the cellular network within which gk functions , , .
given that gk is at the interface of fat and carbohydrate metabolism , it is interesting to note that gk and gkd have links to both obesity and type 2 diabetes mellitus ( t2 dm ) .
reported that 12 out of 18 men carrying a gkd missense mutation ( n288d ) had obesity and met the criteria for impaired glucose tolerance and/or t2 dm .
we determined that the lymphoblastoid cell line from a patient with the n288d missense mutation had residual gk enzymatic activity .
in addition , the thiazolidinediones , common drugs to treat t2 dm , increase gk expression in adipocytes and treat insulin insensitivity by making a futile cycle involving gk that ultimately reduces free fatty acids , , .
gk also plays a role in obesity in mice . in a mouse cross using quantitative traits to identify genes important in abdominal obesity , gk was identified as one of the top ten genes important for the predisposition for abdominal obesity .
a gyk ( the mouse ortholog of gk ) knockout ( ko ) mouse was made by gene - targeted deletion using a mouse gyk cdna .
the gyk ko male mice are born in the expected numbers and are normal at birth .
the ko mice have a > 80 fold increase in plasma glycerol and ~ 3 fold increase of free fatty acid .
the ultimate cause of death of the mice still remains unclear , but we have shown that it is due in part to extensive metabolic acidosis . additionally , we have previously shown that there are altered expression levels of genes in metabolism and insulin signaling pathway in glycerol kinase ( gyk ) knockout ( ko ) mouse liver , brown fat , and muscle . the altered expression of insulin signaling genes in the gyk ko mice suggested that they have reduced glucose uptake , and consequently reduced insulin sensitivity .
after consent using a ucla irb approved protocol , a lymphoblastoid cell line was made from blood isolated from the proband and his mother as previously described . for the proband , his mother and maternal grandmother , we sequenced the 20 exons and intron exon boundaries of the xp21 gk gene as previously described .
the instt mutation was confirmed by restriction fragment polymorphism with the ddei restriction enzyme ( new england biolabs , ipswich , ma ) .
the dna was digested for 13 h at 37 c with one unit of ddei enzyme per microgram of dna per manufacturer 's protocol and run on a 1% agarose gel .
we determined the gk activity in a lymphoblastoid cell line from the patient and his mother using a radiochemical assay as previously described .
after consent using a ucla irb approved protocol , a lymphoblastoid cell line was made from blood isolated from the proband and his mother as previously described . for the proband , his mother and maternal grandmother , we sequenced the 20 exons and intron exon boundaries of the xp21 gk gene as previously described .
the instt mutation was confirmed by restriction fragment polymorphism with the ddei restriction enzyme ( new england biolabs , ipswich , ma ) .
the dna was digested for 13 h at 37 c with one unit of ddei enzyme per microgram of dna per manufacturer 's protocol and run on a 1% agarose gel .
we determined the gk activity in a lymphoblastoid cell line from the patient and his mother using a radiochemical assay as previously described .
urine organic acids revealed glyceroluria and blood analysis showed elevated triglycerides ( pseudo - hypertriglyceridemia ) , which are consistent with the symptomatic form of isolated glycerol kinase deficiency ( gkd ) .
he was born at 37 weeks gestational age , and his birth weight was 3785 g , birth length 57 cm and head circumference 36 cm .
he was born by induced vaginal delivery and the umbilical cord was wrapped around a leg . otherwise the birth history was unremarkable .
the first pregnancy was uneventful and oral glucose tolerance test ( ogtt ) was normal . with the second pregnancy ( when she carried this affected fetus ) she had gestational diabetes .
while this is a modest insulin dose , it is striking that she required insulin given that only 10% of pregnancies result in gestational diabetes and many of these are treated with only diet and exercise .
the diabetes resolved after the pregnancy indicating she was not one of the many individuals for whom the diagnosis of gestational diabetes was simply revealing type 2 diabetes that was not yet diagnosed .
in the first pregnancy she had gestational diabetes and required insulin therapy starting in the 6th month of gestation . in her second pregnancy , she had trace glucose in the urine but normal blood sugars . in the last two pregnancies
sequence analysis of the proband ( iii-2 ) revealed an insertion of two thymidine ( tt ) residues at position 378 of the xp21 gk cdna ( 378379instt ) which was confirmed by allele specific cleavage with the restriction enzyme ddei ( table 1 , fig .
his mother ( ii-1 ) was heterozygous for this mutation and therefore a carrier for gkd .
the proband 's gk activity in the lymphoblastoid cell line was 0.8% of a normal control .
she had gestational diabetes requiring insulin during this pregnancy but not in her previous pregnancy .
, gk is at the interface of fat and carbohydrate metabolism and gkd has been shown to increase risk for obesity , insulin resistance and diabetes , , , , , .
recent data suggest that glycerol - stimulated proinsulin biosynthesis and insulin secretion in pancreatic islets after adenoviral - mediated expression of gk require the mitochondrial metabolism of glycerol .
one mechanism for obesity in gkd may be the need for frequent meals to treat the hypoglycemia .
in addition , there is evidence of increased fat storage in liver cells overexpressing gk suggesting that gk has a role in lipid storage . while there are many factors increasing risk of gestational diabetes , it is intriguing to note that the mother of the proband ( ii-1 ) had gestational diabetes when she was pregnant with an affected fetus ( iii-2 ) , but not with her other pregnancy ( iii-1 ) .
it is likely that some of the risk for the gestational diabetes was due to the fact that the mother was a carrier for this disorder and has only half the normal activity .
this risk was increased due to the fact that she was carrying an affected fetus with less than 1% activity .
this would add gkd to a host of other diseases where the maternal and fetal genotypes affect risk for pregnancy related complications .
this list includes risk of prenatal complications such as preeclampsia , low birth weight and hla - b maternal fetal genotype in families with risk for schizophrenia .
other inborn errors of metabolism ( iem ) also have been noted to have maternal fetal genotype effects . in particular pregnancies where the mother is carrying a fetus with an iem ( such as long - chain 3-hydroxyacyl coa dehydrogenase [ lchad ] ) , the mother can present with pre - eclampsia , hellp ( hemolysis , elevated liver enzymes and low platelets ) syndrome or acute fatty liver of pregnancy , ; in addition , the fetus may have non - immune hydrops .
given the complexity of gestational diabetes and the association of gkd with diabetes , , , it may be that the maternal ( gkd carrier status ) and the fetal ( gkd male ) milieu may be only one component in the etiology of this mother 's gestational diabetes .
the of the proband had a history of gestational diabetes in one of her four pregnancies and isolated glucosuria in another , but she was not a carrier of the 378379instt mutation .
therefore , it is likely that there are other genetic factors predisposing to gestational diabetes in this family and the gk mutation and/or glycerol load in her daughter ( ii-1 ) and her daughter 's fetus ( iii-2 ) contributed to manifest this predisposition in her daughter . in summary , this is a case of symptomatic gkd due to a novel gk mutation ( instt ) that suggests the possibility of a maternal fetal effect .
specifically , there may be an increased risk of gestational diabetes in a mother heterozygous for a gk frameshift mutation when carrying a hemizygous male fetus with that mutation that may result from the maternal fetal interaction .
the observations that gkd is associated with insulin resistance and diabetes ( , , ) , a group of drugs routinely used to treat t2 dm increases gk expression in fat , and gk plays an important role in murine obesity suggest that the possible maternal fetal interaction in this maternal fetal dyad may not be a coincidence .
we recommend that other metabolic centers monitor female carriers of gkd for gestational diabetes and see if gestational diabetes occurs more often when a carrier mother has an affected fetus . | glycerol kinase deficiency ( gkd ) is an x - linked inborn error of metabolism at the interface of fat and carbohydrate metabolism .
we report a male patient with gkd and a novel insertion of tt in exon 5 at position 378 of the gk cdna ( 378379instt ) .
this resulted in a premature stop codon and 0.8% normal gk activity .
the mother is a carrier for this mutation and had gestational diabetes requiring insulin during this pregnancy but not in her previous pregnancy .
given the association between gkd and type 2 diabetes mellitus , it is interesting that the mother had gestational diabetes while carrying an affected fetus .
therefore , gkd is another disease where there may be a maternal fetal interaction based on genotype .
further investigations may help elucidate the role of gkd in the carrier mother 's gestational diabetes .
in addition , these studies will provide better - informed counseling to families with gkd regarding the risk to carrier females . |
caffeine and theophylline are two methylxanthines that have been used to treat asthma , although their exact mechanisms of action are still unknown [ 1 , 2 ] .
the bronchodilating property of theophylline is largely attributed to inhibition of phosphodiesterase ( pde ) activity or the release of catecholamines , thereby increasing camp in airway smooth muscle . in use since the 1930s , lack of specificity , a narrow therapeutic window , and negative side effects , plus the development of inhaled glucocorticoids , and short- and long - acting 2-agonists have decreased the clinical utility of theophylline [ 1 , 4 , 5 ] .
however , the identification of airway - specific pde4 subtypes and subsequent development of pde4-selective inhibitors have resurrected this avenue as novel bronchodilators .
the newest pde4 inhibitor approved for use in respiratory disease is roflumilast ( daxas ) [ 6 , 7 ] . in patients with copd
, roflumilast has shown significant improvement of fev1 when taken in conjunction with long - acting 2-agonists or muscarinic antagonists . in preclinical studies ,
administration of selective pde4 inhibitors prevented bronchial hyperresponsiveness ( bhr ) in allergic mice , an in vivo model for asthma [ 9 , 10 ] .
although no pde4-selective inhibitor is currently approved for the treatment of asthma in the united states , similar studies showed that administration of pde4 inhibitors attenuated bhr in patients with allergic asthma [ 1113 ] . with
improved specificity for pde4 subtypes , pde4-selective inhibitors ( roflumilast , cdp840 , mk-0359 ) , have decreased side effects compared to theophylline although the therapeutic window is still narrow and still produces systemic effects due to oral administration .
development of inhaled pde4-selective inhibitors has shown potential in reducing early- and late - phase asthmatic responses in mild allergic asthmatics .
whether or not these improvements in fev1 are due to bronchodilation of airway smooth muscle or anti - inflammatory effects are yet to be determined ; however , inhalation will likely reduce plasma levels of drug and decrease side effects associated with oral delivery .
further work on developing pde4 subtype - specific inhibitors ( a d ) or combining various pde isoform inhibitors ( i.e. , pde1 , 3 , 7 with pde4 inhibitors ) may increase the efficacy of targeting this signaling pathway in treating asthma , providing a new application for a longstanding bronchodilator .
of note , one pde4-selective inhibitor , quercetin , is a naturally occurring flavonol found in fruits , vegetables , and tea leaves .
retrospective studies have shown increasing numbers of asthmatics self - treat their symptoms with herbal remedies [ 15 , 16 ] . in many cases ,
the exact mechanisms of action of these natural botanicals are unknown ; however recent work has focused on identifying the active constituents of herbal remedies and elucidating the signaling pathways involved in acute bronchodilation .
given the advances in pde inhibition and the natural origin of many methylxanthines , many of these natural phytotherapies may possess pde inhibitory action . recently , natural plant products have received accolades for the treatment of cough , respiratory infection , and bronchospasm .
it is estimated that 10%42% of asthmatics use herbal therapies to self - treat their asthma symptoms [ 16 , 18 ] ; however the efficacy and safety of most herbal therapies have not been scientifically evaluated .
the exact mechanism of action of most of these agents is unclear but may involve direct effects on airway smooth muscle , airway epithelium , airway nerves , inflammatory cytokines , and immune cells .
moreover , the formulations of these herbal compounds are made up of many individual bioactive compounds . as such , it is important to define both the positive and potential negative impacts of these individual compounds on the airway as well as explore the interaction of herbal therapies with existing asthma therapies ( corticosteroids and -agonists ) .
extensive preclinical , animal , and human studies have demonstrated that antiasthma simplified herbal medicine intervention ( ashmi ) , an extract of 3 plants ganoderma lucidum ( ling - zhi ) , sophora flavescens ( ku - shen ) and glycyrrhiza uralensis ( gan - cao ) , reduces lung inflammation , airway remodeling , and airway smooth muscle hyperresponsiveness [ 2022 ] .
a blinded randomized trial in 91 subjects with moderate to severe allergic asthma demonstrated that 4 weeks of oral ashmi were nearly equivalent to oral prednisone in the improvement in fev1 , peak flows , serum ige levels , and eosinophilia .
these clinical studies were followed by a series of pre - clinical studies that sought to identify the mechanism(s ) involved in the improvement of symptom and inflammatory profiles .
both chronic and acute beneficial effects of ashmi were demonstrated on mouse lung inflammation and responsiveness .
six weeks of oral administration of ashmi reduced inflammation and in vivo responses to acetylcholine [ 20 , 22 , 24 ] . acute treatment of isolated tracheal rings with ashmi from nave or ovalbumin sensitized mice demonstrated reduced acetylcholine - induced contractions in ex vivo organ bath experiments .
a possible mechanism for these acute effects was elucidated in human airway smooth muscle cells that liberated prostaglandins in response to ashmi , which could mediate relaxation through activation of gs - coupled ep2 or ep4 receptors .
current research is focused on identifying the specific purified chemical constituents of ashmi that mediate these chronic anti - inflammatory effects and acute airway smooth muscle relaxant effects .
although pge2 relaxes airway smooth muscle in many species and benefits of inhaled pge2 have been shown in asthmatics , a specific agonist for the ep2 receptor failed to show benefit in human trials .
however , newer studies suggest that targeting the ep4 receptor in human airway smooth muscle may be an alternative therapeutic target in patients with asthma .
another potential therapeutic target in the treatment of bronchoconstrictive disease involves the bitter taste receptor family ( tas2r ) . recently ,
both qrt - pcr analysis and immunofluorescence microscopy of human airway smooth muscle ( asm ) cells revealed robust expression of several members of this g - protein - coupled receptor family ( tasr-10 , -14 , and -31 ) and showed increases in intracellular calcium ( [ ca]i ) in response to subsequent exposure to bitter tastants , the agonists to these receptor subtypes . despite increasing asm [ ca]i via the same pathway ( g
plc ip3r ) shared by the classical contractile agonist acetylcholine , this group paradoxically found activation of tas2r in asm leads to a profound degree of asm bronchodilation in both isolated asm preparations as well as in vivo models of induced airway responsiveness .
interestingly , the magnitude of bronchodilation achieved by high - dose tas2r agonists in many of these studies rivaled maximal -agonist treatments and mechanistically was found to be camp- and pkc - independent .
this group has recently extended this observation to show that in relevant models of 2-adrenoceptor desensitization , chloroquine - mediated tas2r activation in asm retains its pro - bronchodilatory effects , a finding of considerable clinical relevance given the well - described concern of -agonist tachyphylaxis that occurs with repetitive -agonism . yet , it should be noted that tas2r activation in asm can lead to desensitization via a grk - mediated , -arrestin pathway , which may limit its therapeutic usefulness as it is seen currently with -adrenoceptor agonists .
mechanistically , tas2r activation in asm is thought to achieve relaxation via a localized [ ca]-dependent activation of the large conductance ca - activated k channel ( bkca ) leading to membrane hyperpolarization .
while other investigators have challenged the notion that bitter tastant - mediated asm relaxation is bkca - dependent , the evidence in human asm suggests at least a partial role of the bkca channel in what is likely a novel , multimodal mechanism leading to asm relaxation .
the possibility of tas2r activation in asm ( in the context of localized calcium release ) leading to non - bkca - mediated asm relaxation via yet undescribed pathways is another exciting prospect behind this work that may uncover other potent targets to facilitate relaxation not susceptible to gpcr tachyphylaxis .
chloride channels are expressed on airway smooth muscle and have been shown to effect airway smooth muscle force and cell length . in 2005 , hirota et al .
, described attenuation of acetylcholine - induced contractions in asm subsequent to calcium - activated chloride channel antagonism
. additionally , activation of the ligand - gated chloride channel , gabaa , relaxed airway smooth muscle precontracted with the tachykinin , substance p . in 2011 ,
another ligand - gated chloride channel , the glycine receptor , was shown to relax airway smooth muscle contracted with a selective neurokinin 2 receptor agonist .
these and other studies have led to the understanding that chloride channels may play a significant role in the airway smooth muscle contraction and relaxation mechanisms .
calcium - activated chloride channels have been described functionally ; however , the true molecular identity of calcium - activated chloride channels have only recently been identified as belonging to the ano or tmem16 receptor family .
the tmem16 receptors are membrane proteins with 8 transmembrane domains shown to allow chloride flux in the presence of increasing calcium while possessing voltage sensitive activity .
tmem16a mrna expression has been described in airway smooth muscle and its function in other cell types has been described as contributing to membrane depolarization during calcium increases . it has been hypothesized that acetylcholine- and caffeine - mediated release of calcium from the sarcoplasmic reticulum ( sr ) stimulates chloride efflux from the cell , leading to depolarization of the plasma membrane .
force studies in ex vivo airway smooth muscle preparations examining the effects of chloride channel antagonists , 5-nitro-2-(3-phenylpropylamino)benzoic acid ( nppb ) , and niflumic acid ( nfa ) , showed a large attenuation of acetylcholine - induced contraction by nppb while nfa failed to have an effect .
the differential effects of these chloride channel antagonists may be due to the effects on calcium - activated chloride channels located on the sr versus the plasma membrane .
recently , members of the tmem family were shown to be expressed on various intracellular compartments and not exclusively on the plasma membrane .
a possible mechanism of attenuated force generation in airway smooth muscle by calcium - activated chloride channel antagonism may be inhibition of chloride ion efflux during contractile agonist stimulus .
ligand - gated chloride channels have been well described in the central nervous system with two families dominating the role as inhibitory inputs , gabaa , and glycine receptor channels .
both gabaa and glycine receptors are expressed in asm and possess functional roles in the modulation of airway smooth muscle tone generation [ 35 , 36 ] . this inhibitory effect on asm contraction
may be attributed to a relative hyperpolarization of the membrane potential after it has surpassed the chloride reversal potential following exposure to a contractile stimulus .
this opening of the chloride channels causes an influx of chloride ions leading to a relative membrane hyperpolarization , eliminating , or attenuating the electromechanical component of contraction .
gabaa channels containing alpha4 or alpha5 subunits can be selectively targeted in airway smooth muscle resulting in effects on membrane potential and airway tone .
pharmacotherapies that are not gabaa subunit selective , such as the general anesthetic , propofol , have bronchodilatory capabilities . increased airway smooth muscle specificity will determine the viability of gabaa - related therapies as bronchorelaxants .
gabaa function in airway smooth muscle has been studied in both rodent and human ex vivo models , as well as in vivo rodent models [ 42 , 43 ] , producing strong evidence that this channel , once thought to be exclusively neuronally expressed , may have direct effects on airway tone . in the last ten years , the existence of chloride channels in airway smooth muscle has been confirmed yet our current understanding of their mechanistic and functional roles remains incomplete .
although poorly mechanistically understood [ 44 , 45 ] manipulation of chloride channels still remains a viable avenue of further research in the discovery of novel bronchodilators . continued research
will uncover the exact mechanisms that dictate the role for chloride channels in the balance of contraction and relaxation in the airway . while bronchodilators will likely continue to be a mainstay of asthma therapy far into the future ,
receptor desensitization , -agonist insensitivity , -agonist refractory bronchoconstriction , and even death are all risks associated with prolonged use of traditional -agonists . as such ,
it is important to continually investigate new therapeutics for the treatment of asthma ; keeping in mind that acute bronchodilation is the first line therapy during an asthmatic episode .
here we have illustrated 4 novel potential therapeutics that show functional bronchodilatory properties in the airway owing to a variety of mechanisms .
these novel compounds may augment existing -agonist relaxant effects as in the case of pde inhibitors or provide complementary avenues for relaxation when combined with current therapies .
table 1 summarizes beneficial aspects of traditional -agonists and these novel therapeutics as well as illustrating current limitations to implementing these novel bronchodilators .
interestingly , compounds that transiently elevate [ ca]i such as phytotherapeutics , bitter taste ligands , gabaa receptor ligands , and chloride channel antagonists subsequently lead to functional relaxation of airways .
this is counterintuitive in the face of decades of research closely linking global cellular calcium and smooth muscle contraction thus necessitating a broader understanding of complex calcium dynamics within cellular microdomains .
while the mechanism of action of these potential therapeutics is still under investigation , they open the door for assessing new therapeutics and mechanisms leading to bronchodilation . | bronchodilators are the first line therapy during acute asthmatic exacerbations to reverse airway obstruction primarily by relaxing airway smooth muscle
. only three categories of bronchodilators exist in clinical practice : -adrenergic agonists , anticholinergics , and methylxanthines .
each of these categories have specific drugs dating back to the early 20th century , raising the question of whether or not we can find better bronchodilators . while caffeine , theophylline , atropine , and epinephrine were the first generations of therapeutics in each of these drug classes
, there is no question that improvements have been made in the bronchodilators in each of these classes . in the following editorial
, we will briefly describe new classes of potential bronchodilators including : novel pde inhibitors , natural phytotherapeutics , bitter taste receptor ligands , and chloride channel modulators , which have the potential to be used alone or in combination with existing bronchodilators to reverse acute airway obstruction in the future . |
dmd is an inherited x - linked disorder with an incidence of 1 in 3,500 male births , and is due to the absence of dystrophin , a large protein linking the intracellular cytoskeleton to the extracellular matrix .
it follows a predictable clinical course marked by progressive skeletal muscle weakness , myocyte hypertrophy , atrophy , and fibrosis .
in general , the involvement of the heart leads to dilative cardiomyopathy ( dcm ) in 90% of patients .
death usually occurs in the second or third decade of life and is due to respiratory or circulatory failure . over the last 20 years
, respiratory care for these patients has improved because of the development of supportive equipment and techniques .
consequently , dcm is increasing as the major cause of death in people with dmd , so that currently 1040% of dmd patients ( 2030% on average ) die due to dcm .
the classical animal model for human dmd , the mdx mouse , is marked by a mutation genetically similar to the human deletion in the xp21.1 locus .
although the underlying gene defect is the same in humans and the mdx mouse , the clinical picture is quite different . in the mdx mouse , skeletal muscle undergoes an early acute phase of degeneration at about 34 weeks of age , followed by a successful regeneration phase .
the defect in the gene encoding dystrophin one of the cytoskeletal proteins may influence the susceptibility of the cardiac tissue to hypoxia .
myocardial injury secondary to hypoxia has been thoroughly investigated and described in the setting of myocardial infarction , and reflects local acute ischemic hypoxia and can lead to dcm under certain circumstances .
collateral blood vessels supplement normal coronary blood flow and coronary blood flow compromised by coronary artery disease , thereby protecting the myocardium from ischemia .
collateral vessel formation is the result of angiogenesis , which depends upon the appropriate expression of growth factors [ 1012 ] .
hypoxia is the main stimulating factor for the expression of vascular endothelial growth factor ( vegf ) [ 1316 ] .
vegf - a , also known as vascular permeability factor , is a potent angiogenic factor and endothelial cell - specific mitogen that is regulated by hypoxia in vitro and in vivo .
it also enhances embryonic and postnatal angiogenesis [ 12 , 19 , 20 ] and modulates vascular remodeling , tubulogenesis , and arteriogenesis .
available data suggest a relationship between impaired vegf expression , a disturbance in angiogenesis , and the progression of dcm [ 2224 ] .
the present study investigated alterations of the secretion of vegf - a in myocardium and heart vessels between healthy mice and dystrophic mice ( c57bl/10scsn mdx mice ) , which are the animal model of dmd .
all mice were handled according to the guidelines of the institutional animal care and use committee .
c57bl/10scsn and c57bl/10scsn mdx male mice , weighing 2030 grams , were purchased from jackson laboratory ( bar harbor , ma ) .
all mice were housed in an individually vented cage system with a 12-hour light / dark cycle and received standard mouse chow and water ad libitum .
adult mice c57bi/10scsn ( homozygotes + /+ in the locus encoding dystrophin , referred to herein as normal ) and adult mice c57bi/10scsn mdx ( homozygotes / in the locus encoding dystrophin , referred to herein as dystrophic or mdx ) were used in the experiment .
initially , each group was placed in a low - pressure chamber for 1 h. the change from normal air pressure to low pressure corresponded to a rise from the altitude of 113 meters above sea level ( p=1000 hpa , po2=210 hpa ) to 7000 m above sea level ( p=410.25 hpa ; po2= 86.15 hpa ) .
the target pressure was achieved within 10 minutes , and the initial pressure was restored within the same timeframe . in a previous study we showed that 7000 meters corresponds to the sublethal hypobaric hypoxia conditions , and that the dystrophin - deficient mdx mice were more susceptible to acute hypobaric hypoxia than were normal mice of the same strain .
hearts were harvested from the control group ( normobaric mice ) and mice exposed to low pressure directly after and 1 , 3 , 7 , and 21 days following the hypobaric exposure and fixed in a 4% solution of paraformaldehyde ( pfa ) in 0.01 m phosphate buffer ( pbs , ph=7.4 ) .
the heart specimens were dipped in paraffin and cut into 6 m thick sections along the plane perpendicular to the long axis of the heart ( transverse sections through the ventricles ) .
some of the material was frozen in liquid nitrogen and stored at 70c for later analysis .
specimens were subjected to western blot analysis , in situ hybridization , and immunohistochemical analysis .
vegf - a protein expression was determined using 100 mg of homogenized cardiac tissue suspended in 1 ml of mm tris - hcl buffer ( ph 7.4 ) and centrifuged at 10 000 rpm for 20 min . in order to select proper parameters for electrophoresis ,
the quantity of protein in the supernatant was assessed by the biuret reaction ( according to mejbaum - katzenellenbogen ) .
electrophoresis was carried out on a 12% polyacrylamide gel , chosen according to the molecular weight of vegf - a ( 46 kda ) .
the proteins were transferred ( semidry transfer ) to a nitrocellulose membrane ( 0.45 mm pore ; protran , schleicher & schnell bioscience ) using the mini semi - dry - blot device ( roth ) at 12 ma / cm over 12 h and at room temperature .
immunodetection of vegf - a was performed using the abc kit ( santa cruz biotechnology ) .
the membranes were blocked in 0.05%tween 20 for 1 h , then incubated with primary anti - vegf - a ( santa cruz biotechnology ) at 3 l / ml in 0.05% tween 20 in a humid chamber with orbital shaking for 1.5 h , followed by incubation with the secondary biotinylated antibody under similar conditions for 1 h. proteins were visualized using the horseradish peroxidase - diaminobenzidine system ( dab substrate kit for peroxidase ; sk-4100 , vector laboratories ) .
specimens were blocked using 1% solution of h2o2 and proteinase k ( 200 g / ml ) was added for cell permeabilization . in order to deactivate any remaining rnase and proteinase k ,
the sections were fixed a second time in 0.4% pfa at 4c for 20 min .
the samples were hybridized with the vegf - a mrna probe ( 5 biotin - tgg gtg cag cct ggg acc act tgg cat ggt gga ggt a - biotin-3 ; dna - gdansk , poland ) overnight under similar conditions .
after hybridization , the slides were washed 25 min in 4 ssc/30% formamide , 25 min in 2scc/30% formamide , 115 min in 0.1% triton x-100 in tbs with albumin .
the abc staining system kit ( santa cruz biotechnology , sc-2017 ) was used to detect the hybrids .
then , the preparations were dehydrated using a set of alcohol solutions and xylene , and mounted in mountex medium .
endogenous peroxidase was blocked by incubating samples in 0.1% h2o2 for 30 min , and then incubated with monoclonal mouse anti - vegf antibody ( santa cruz biochemistry , sc-7269 ) at 3 l / ml in 1.5% normal goat serum / pbs at room temperature for 30 min .
primary antibody was detected using the abc staining system kit ( santa cruz biochemistry , sc-2017 ) .
subsequently , the sections were incubated with biotinylated secondary antibody for 30 min and visualized using the dab - horseradish peroxidase system .
2 ( sigma ) , and then sections were dehydrated using a standard set of alcohol solutions and mounted in mountex medium .
adjacent sections used as negative controls were processed in the same manner except that primary antibodies were omitted .
the slides were evaluated by optical microscopy using a nikon eclypse 80i equipped with a digital camera ds-5mc ( 5 megapixel ) and software for digital analysis ( nis - elements , nikon ; japan ) .
mean optical density was determined under constant light conditions according to a gray scale ranging from 0 to 255 , where 0 = black and 255 = white .
nis - elements uses brightness / gray calibration curve evaluation of this parameter , and shows brightness / density ranges that correspond to the range of gray values recalculated via brightness / density calibration curves .
five samples from each group were chosen for analysis , and 6 preparations from each mouse were examined .
five fields of myocardium measuring 7050 m and not containing blood vessels were evaluated in each preparation ( figure 1 ) .
the result recorded for each mouse was the mean of the values obtained for each sample .
endothelial specimens on similar field sizes that contained cardiac vessels only were evaluated , and the mean value of all results was calculated for every group of 5 mice . for the control group ,
the mean optical density was defined as 100% of the change in optical density saturation for preparations containing both myocardium and vessels ( both arterioles / venules and capillaries ) , without distinguishing between these 2 compartments .
this allowed us to calculate the mean value for the whole organ ( figure 1 ) .
the results obtained in the experimental groups are expressed as percentages of the results for the control group .
the values obtained from in situ hybridization analysis were analyzed using the unpaired student s t test .
the values obtained from western analysis of vegf were analyzed using the wilcoxon signed rank test .
all mice were handled according to the guidelines of the institutional animal care and use committee .
c57bl/10scsn and c57bl/10scsn mdx male mice , weighing 2030 grams , were purchased from jackson laboratory ( bar harbor , ma ) .
all mice were housed in an individually vented cage system with a 12-hour light / dark cycle and received standard mouse chow and water ad libitum .
adult mice c57bi/10scsn ( homozygotes + /+ in the locus encoding dystrophin , referred to herein as normal ) and adult mice c57bi/10scsn mdx ( homozygotes / in the locus encoding dystrophin , referred to herein as dystrophic or mdx ) were used in the experiment .
initially , each group was placed in a low - pressure chamber for 1 h. the change from normal air pressure to low pressure corresponded to a rise from the altitude of 113 meters above sea level ( p=1000 hpa , po2=210 hpa ) to 7000 m above sea level ( p=410.25 hpa ; po2= 86.15 hpa ) .
the target pressure was achieved within 10 minutes , and the initial pressure was restored within the same timeframe . in a previous study we showed that 7000 meters corresponds to the sublethal hypobaric hypoxia conditions , and that the dystrophin - deficient mdx mice were more susceptible to acute hypobaric hypoxia than were normal mice of the same strain .
hearts were harvested from the control group ( normobaric mice ) and mice exposed to low pressure directly after and 1 , 3 , 7 , and 21 days following the hypobaric exposure and fixed in a 4% solution of paraformaldehyde ( pfa ) in 0.01 m phosphate buffer ( pbs , ph=7.4 ) .
the heart specimens were dipped in paraffin and cut into 6 m thick sections along the plane perpendicular to the long axis of the heart ( transverse sections through the ventricles ) .
some of the material was frozen in liquid nitrogen and stored at 70c for later analysis .
specimens were subjected to western blot analysis , in situ hybridization , and immunohistochemical analysis .
vegf - a protein expression was determined using 100 mg of homogenized cardiac tissue suspended in 1 ml of mm tris - hcl buffer ( ph 7.4 ) and centrifuged at 10 000 rpm for 20 min . in order to select proper parameters for electrophoresis ,
the quantity of protein in the supernatant was assessed by the biuret reaction ( according to mejbaum - katzenellenbogen ) .
electrophoresis was carried out on a 12% polyacrylamide gel , chosen according to the molecular weight of vegf - a ( 46 kda ) .
the proteins were transferred ( semidry transfer ) to a nitrocellulose membrane ( 0.45 mm pore ; protran , schleicher & schnell bioscience ) using the mini semi - dry - blot device ( roth ) at 12 ma / cm over 12 h and at room temperature .
immunodetection of vegf - a was performed using the abc kit ( santa cruz biotechnology ) .
the membranes were blocked in 0.05%tween 20 for 1 h , then incubated with primary anti - vegf - a ( santa cruz biotechnology ) at 3 l / ml in 0.05% tween 20 in a humid chamber with orbital shaking for 1.5 h , followed by incubation with the secondary biotinylated antibody under similar conditions for 1 h. proteins were visualized using the horseradish peroxidase - diaminobenzidine system ( dab substrate kit for peroxidase ; sk-4100 , vector laboratories ) .
specimens were blocked using 1% solution of h2o2 and proteinase k ( 200 g / ml ) was added for cell permeabilization . in order to deactivate any remaining rnase and proteinase k ,
the sections were fixed a second time in 0.4% pfa at 4c for 20 min .
the samples were hybridized with the vegf - a mrna probe ( 5 biotin - tgg gtg cag cct ggg acc act tgg cat ggt gga ggt a - biotin-3 ; dna - gdansk , poland ) overnight under similar conditions .
after hybridization , the slides were washed 25 min in 4 ssc/30% formamide , 25 min in 2scc/30% formamide , 115 min in 0.1% triton x-100 in tbs with albumin .
the abc staining system kit ( santa cruz biotechnology , sc-2017 ) was used to detect the hybrids .
then , the preparations were dehydrated using a set of alcohol solutions and xylene , and mounted in mountex medium .
endogenous peroxidase was blocked by incubating samples in 0.1% h2o2 for 30 min , and then incubated with monoclonal mouse anti - vegf antibody ( santa cruz biochemistry , sc-7269 ) at 3 l / ml in 1.5% normal goat serum / pbs at room temperature for 30 min .
primary antibody was detected using the abc staining system kit ( santa cruz biochemistry , sc-2017 ) .
subsequently , the sections were incubated with biotinylated secondary antibody for 30 min and visualized using the dab - horseradish peroxidase system .
nuclei were stained with gill s hematoxylin no . 2 ( sigma ) , and then sections were dehydrated using a standard set of alcohol solutions and mounted in mountex medium .
adjacent sections used as negative controls were processed in the same manner except that primary antibodies were omitted .
the slides were evaluated by optical microscopy using a nikon eclypse 80i equipped with a digital camera ds-5mc ( 5 megapixel ) and software for digital analysis ( nis - elements , nikon ; japan ) .
mean optical density was determined under constant light conditions according to a gray scale ranging from 0 to 255 , where 0 = black and 255 = white . mean brightness / gray value is the statistical mean of brightness values of pixels .
nis - elements uses brightness / gray calibration curve evaluation of this parameter , and shows brightness / density ranges that correspond to the range of gray values recalculated via brightness / density calibration curves .
five samples from each group were chosen for analysis , and 6 preparations from each mouse were examined .
five fields of myocardium measuring 7050 m and not containing blood vessels were evaluated in each preparation ( figure 1 ) .
the result recorded for each mouse was the mean of the values obtained for each sample .
endothelial specimens on similar field sizes that contained cardiac vessels only were evaluated , and the mean value of all results was calculated for every group of 5 mice . for the control group ,
the mean optical density was defined as 100% of the change in optical density saturation for preparations containing both myocardium and vessels ( both arterioles / venules and capillaries ) , without distinguishing between these 2 compartments .
this allowed us to calculate the mean value for the whole organ ( figure 1 ) .
the results obtained in the experimental groups are expressed as percentages of the results for the control group .
the values obtained from in situ hybridization analysis were analyzed using the unpaired student s t test .
the values obtained from western analysis of vegf were analyzed using the wilcoxon signed rank test .
there were significant differences in cardiac vegf expression in response to hypoxia between mdx and normal mice ( figure 2 ) . during the first days following hypoxia , expression of vegf in the hearts of
the control group did not differ from that observed in the hearts of the normal and mdx mice ( 1023% vs. 994% , respectively ) ( p>0.05 ) ( figure 2c ) . immediately after exposure to hypoxia , vegf expression was 985% and 966% in normal and mdx mice , respectively ( p>0.05 ) .
one day later , the changes in vegf concentrations were similar in normal ( 1688% ) and mdx mice ( 1729% ) ( p>0.05 ) .
the decrease in vegf expression was markedly greater among the mdx mice ( 1137% ) than the normal mice ( 1335% ) ( p<0.05 ) .
this trend reversed on day 7 vegf expression in normal mice continued to decrease ( 1075% ) , whereas it increased in mdx mice , reaching 1476% ( p<0.05 ) .
after day 21 , vegf expression began to decline in both groups , reaching its initial concentration in normal mice ( 1046% ) and falling below the initial concentration in mdx mice ( 704% ) ( p<0.05 ) .
effects on vegf mrna expression are depicted in figure 3a for the cardiac vessel endothelium cells and in figure 3b for the myocardium . in the case of cardiac endothelium cells
, there was no difference in vegf - a mrna expression between the control groups for normal and mdx mice ( 1018% vs. 997% , respectively ) ( p>0.05 ) or between the normal and dystrophic mice immediately following exposure to hypoxia ( 1039% vs. 988% , respectively ) ( p>0.05 ) , on day 1 ( 22813% vs. 23314% ) ( p>0.05 ) , and on day 3 ( 14410% vs. 1338% ) ( p>0.05 ) .
however , on day 1 there was a marked increase in vegf - a mrna expression in normal and mdx mice exposed to hypoxia as compared to normobaric control mice . by day 7 , vegf - a mrna expression levels had returned to their initial levels ( 10610% vs. 9313% , respectively ) ( p>0.05 ) . the difference in vegf -
a mrna expression in myocardium between normal and dystrophic animals was significant ( p>0.05 ) ( figure 3b ) .
after day 1 , normal mice expressed relatively more vegf mrna than did mdx mice ( 23415 vs. 1239% , respectively ) ( p<0.05 ) . on day 3 ,
vegf - a mrna expression in normal mice was similar to that in mdx mice ( 1329% vs. 1228% ) ( p>0.05 ) . by day 7 , vegf - a mrna expression in normal mice decreased to the initial level ( 836% ) , whereas in mdx mice , the level of mrna remained stable and twice as high as that in the control group ( 119%8% ) ( p<0.05 ) .
twenty - one days following hypoxia , the expression of vegf - a mrna was similar in both groups and similar to the initial levels ( 575% vs. 437% ) ( p>0.05 ) .
the expression of vegf - a mrna in control myocardium was lower than that in endothelial cells ( 60% vs. 100% , respectively ) .
there were also differences in the expression of vegf - a protein expression between the normal and mdx mice . in the case of endothelium
, there were no difference in vegf - a concentrations in normal and mdx mice ( figure 4a ) . in the case of myocardial cells , the initial control levels ( 997% vs. 926% , respectively ) and those measured immediately following hypoxia
( 1047% vs. 964% , respectively ) did not differ between normal and mdx mice ( p>0.05 ) ( figure 4b ) .
differences in vegf - a protein concentration became apparent 1 day after hypoxia in the normal group .
in these animals , there was an increase in optical density up to 168% ( 9% ) of the control level ( figure 5a ) .
in dystrophic mdx mice , the protein concentration remained constant at 957% ( p<0.05 ) ( figure 5b ) .
after 3 days , the concentration of vegf - a in normal mice fell to 120% ( 7% ) , but remained elevated relative to the initial level . in the mdx mice , the concentration of vegf remained stable at 868% ( p<0.05 ) .
after 7 days , the vegf - a concentration in normal mice returned to the initial value ( 994% ) ( figure 6a ) , whereas in the mdx mice , the level of vegf - a protein began to increase , reaching 1359% ( p<0.05 ) ( figure 6b ) .
after 21 days , there was a clear difference between the 2 groups in terms of vegf concentration . in control mice ,
the vegf concentration remained at its initial level ( 1037% ) but had decreased in mdx mice ( 768% ) ( p<0.05 ) .
hypoxia is the primary cause of ischemic cardiomyopathy , dcm . during ischemia , certain factors , such as fgf-2 or vegf and no ,
are released and cause the collateral vessels to open . in dystrophic mdx mice , the low concentration of no leads to ischemic cardiomyopathy . in normal muscular tissue , hypoxia induces an increase in vegf expression through increased transcription of vegf mrna and improved protein stability .
some reports have shown that dystrophinopathy is caused by lesions in the myocardium ( tissue ) but not in endothelial cells , in vessels .
the increased expression of vegf enhances both the quantity and density of vessels , and not only in heart
the vegf expression disorders in dystrophic mdx mice described in this paper , with the initial fall in the third day and a rise in the seventh day , are no exception . in their experiment with prolonged hypoxia of the brain ,
kuo et al described similar changes in vegf expression . after a fall on day 4 ,
since vegf expression disorders occur only in mdx mice and are not seen in normal mice , they do not have to be related to prolonged ischemia . in our experiment , vegf expression disorders in normal and dystrophic mdx mice were limited to inappropriate expression and transcription of vegf in myocardial cells .
it follows that expression of endothelial vegf would have an impact on total vegf expression in the heart only on day 1 after hypoxia ( figures 2 , 3a , 4a ) ; after that , the level of vegf expression in ischemic ( hypoxic ) cardiac tissue is the consequence of changes in the myocardium .
in fact , on the third day , the expression of vegf protein and vegf mrna are decreased ( figures 3b , 4b ) , leading to dissimilarities in vegf expression between normal and dystrophic hearts ( figure 2 ) .
increased expression of vegf mrna ( figure 4 ) and protein ( figure 4b ) in the myocardium influence this situation .
these increases could be due to increased vegf mrna stability , as well as increased transcription .
the situation changes between days 1 and 7 , when the relative expression of vegf mrna is higher . by day 21
vegf protein expression levels vary as well . however , the pattern of changes in vegf protein expression does not mirror that of vegf mrna expression . up to the 3rd day after hypoxia ,
, protein expression increases remarkably but falls again by day 21 . in the heart ,
the total level of vegf depends on vegf expression in myocardium , not in vessel endothelium , and our research demonstrates that the expression of vegf is dystrophin - dependent . the relationships between vascularization , other growth factors such as bfgf , pdgf , and dystrophin disorders have been documented .
the reason for the discrepancies between the levels of vegf protein and mrna expression in myocardium seems to be associated with decreased stimulation of vegf mrna expression in myocytes . in myocardium ,
higher levels of vegf expression are not associated with increased protein stability , as has been reported . instead , the secretion of vegf from dystrophic myocardium is compromised and vegf is retained in cells . even if the expression of vegf protein is increased only marginally , a negative feedback mechanism blocks secretion of vegf from the cell , resulting in an elevated level of vegf within the cell .
thus , the dramatic reduction in vegf mrna transcription on day 21 that we observed in our experiments was the result of the cells receiving incorrect ( inflated ) information about of the level of available vegf .
our results suggest that high - altitude hypoxia causes abnormalities in cardiac muscle functioning in dystrophic mdx mice .
the mutation in the dystrophin gene results in aberrant vegf secretion , which ultimately leads to ischemia .
the disorders localized to non - vascular cardiac tissues related to dystrophic cardiomyopathy have been also described by other authors .
impaired myocardial expression of vegf causes a significant loss of vegf to the whole organ .
these disturbances are not only quantitative the timing and speed of expression are affected as well .
therefore , in such a setting , the heart is not properly protected against hypoxia , which could promote the gradual progression of cardiomyopathy , eventually manifesting as heart failure [ 23,3739 ] .
our study investigated whether increased cardiac muscle susceptibility to ischemia was related to the efficacy of hypoxia - induced vegf expression .
we have provided new support for the role of dystrophin in angiogenesis through its interactions with other growth factors .
these data may aid in the development of new therapeutic options for dystrophin - related disorders . | summarybackgroundduchenne muscular dystrophy ( dmd ) is a genetic neuromuscular disorder that affects skeletal muscles and cardiac muscle tissue . in some cases ,
myocardial injury secondary to hypoxia can lead to dilative cardiomyopathy ( dcm ) .
a genetic defect in the dystrophin gene may increase the susceptibility of myocardium to hypoxia .
available data suggest that this may be caused by impaired secretion of no , which is bound with secretion of vegf-a.material/methodsmale mice c57bi/10scsn mdx ( animal model of dmd ) and healthy mice c57bi/10scsn were exposed to hypobaric hypoxia in low - pressure chambers .
their hearts were harvested immediately after and 1 , 3 , 7 , and 21 days after exposure to hypoxia .
normobaric mice were used as controls .
the expression of vegf - a in myocardium and cardiac vessel walls was evaluated using immunohistochemistry , western blotting , and in situ hybridization.resultsvegf-a expression in myocardium and vessel walls of healthy mice peaked 24 hours after exposure to hypoxia .
the expression of vegf - a in vessel walls was similar in dystrophic and healthy mice ; however , vegf - a expression in the myocardium of dystrophic mice was impaired , peaking around day 7 . in the heart ,
the total level of vegf depends on vegf expression in myocardium , not in vessel endothelium , and our research demonstrates that the expression of vegf is dystrophin-dependent.conclusionsdisordered secretion of vegf - a in hypoxic myocardium caused the total level of this factor to be impaired in the heart .
this factor , which in normal situations protect against hypoxia , promotes the gradual progression of cardiomyopathy . |
lots of research is performed on epitaxial thin films and heterostructures of complex oxides because of the wide range of functional properties that can be obtained by tuning the composition and structure of the materials . due to the development of several growth techniques
, nowadays it is possible to make a large range of films with compositions and crystalline qualities that can not be reached in bulk.together with the fact that the properties of these materials are highly anisotropic , this makes that in epitaxial films phenomena and functionalities are observed that are not obtained in bulk . besides
, epitaxial strain and the creation of heterostructures can be used to obtain new or enhanced properties . in order to grow epitaxial films and heterostructures with the desired properties , substrates with well - defined surfaces are required .
local differences in surface chemistry or morphology cause inhomogeneous nucleation and growth , which gives rise to undesired defects and grain boundaries in the film .
furthermore , the interface between film and substrate plays an important role in determining the properties because of the limited thickness of the film .
this means that substrates are required that are smooth and homogeneous on the atomic level .
this criterion is hard to reach when substrates are used that naturally do not have well - defined surfaces , e.g. , other complex oxides . from this perspective , perovskite oxides are one of the most studied substrate materials .
perovskite oxides can be represented by the general formula abo3 , in which a and b stand for metal ions .
almost all metals can be incorporated in the a or b site , which makes it possible to fabricate a wide range of different substrates .
the versatility of the substrate material allows one to tune the properties of the film grown on top of it by tuning the applied epitaxial strain and the structure at the interface . however , growth on these substrates is not straightforward due to the ambiguous nature of the perovskite surface , which is especially visible in ( 001 ) oriented substrates . in the ( 001 ) direction ,
when a ( 001 ) oriented substrate is made by cleaving from a larger crystal , both oxides are present at the surface .
this phenomenon is shown in figure 1 . since the crystal is never perfectly cleaved along the ( 001 ) plane , a surface forms consisting of terraces with unit cell height differences . however , height differences of half a unit cell exist as well , which indicates the presence of both types of surface terminations .
it is important to have single terminated perovskite substrates in order to grow a continuous film with homogeneous properties , as has been shown especially for the growth of perovskite oxide films .
the termination can cause a large difference in growth kinetics , leading to growth of non - continuous films .
furthermore , the stacking order should be similar across the complete film - substrate interface , since ao - bo interfaces can have totally different properties than bo - ao interfaces . the first successful method to obtain a single terminated perovskite oxide surface
kawasaki et al.introduced a wet etching method , which was later ameliorated by koster et al .
the method consists of increasing the sensitivity of the sro towards acidic etching by hydroxylating this oxide in water , followed by a short etch in buffered hydrogen fluoride ( bhf ) .
subsequent annealing to increase the crystallinity yields an atomically smooth surface were only tio2 is present .
later , a method to obtain single terminated rare earth scandates was developed by using the higher solubility of rare earth oxides compared to scandates in basic solution .
this method was especially described for the orthorhombic ( 110 ) oriented dysco3 , and it was shown that it is possible to obtain completely scandate terminated surfaces . the methods to obtain these single terminated srtio3 and dysco3 substrates are described in this protocol . though the value of single crystalline perovskite substrates is clear , alternatively , arbitrary substrates without suitable crystal structures can be used for epitaxial film growth as well .
substrates that are unsuitable for epitaxial film growth by themselves can be made into suitable templates by covering them with a layer of nanosheets .
nanosheets are essentially two - dimensional single crystals , with a thickness of a few nanometers and a lateral size in the micrometer range , and thus possess the ability to direct epitaxial growth of thin films . by depositing a layer of nanosheets on an arbitrary substrate ,
a seed layer is created for oriented growth of any film material with matching lattice parameters .
this approach has been reported successful for the oriented growth of for example zno , tio2 , srtio3 , lanio3 , pb(zr , ti)o3 and srruo3.by using nanosheets , the relatively high prices and size limitations of regular single crystalline substrates can be avoided and nanosheets can be deposited on virtually any substrate material .
nanosheets are generally obtained by delamination of a layered parent compound into its discrete layers , with their specific thickness determined by the crystal structure of the parent compound .
delamination can be achieved in aqueous environment by exchanging the interlayer metal ions in the parent compound with bulky organic ions , which causes the structure to swell and ultimately delaminate into unilamellar nanosheets .
this results in a colloidal dispersion of charged nanosheets that are surrounded by counter - charged organic ions .
a schematic representation of the delamination process is shown in figure 2 . in the present protocol
, ca2nb3o10 nanosheets were used as a model system and these can be obtained from the perovskite parent compound hca2nb3o10 .
ca2nb3o10 nanosheets have in - plane lattice parameters almost equal to those of srtio3 and display an atomically smooth , single terminated surface .
once an aqueous dispersion of nanosheets is obtained , they can be deposited on an arbitrary substrate by langmuir - blodgett ( lb ) deposition .
this method enables nanosheet deposition in monolayers with a high controllability that generally can not be achieved by other conventional techniques like electrophoretic deposition or flocculation .
the organic ions surrounding the nanosheets are surface - active molecules and tend to diffuse to the surface of the dispersion , creating a monolayer of floating nanosheets .
a schematic representation of the deposition process is shown in figure 3 ; a surface coverage of over 95% is generally achievable and this occurs mainly without stacking of nanosheets or overlapping edges .
ca2nb3o10 nanosheets were used as a model system , but the principle of using nanosheets as a seed layer for epitaxial film growth is more widely applicable .
though oxide nanosheets receive more attention as seed layers in literature , the concept may be extended to non - oxide nanosheets such as bn , gaas , tis2 , zns and mgb2as well .
furthermore , since nanosheets inherit the composition of their parent compound , various functionalities can be inserted by appropriate design of the parent structure .
in addition to their use as seed layer for oriented film growth , a wide variety of nanosheets has proven to be a valuable toolbox in studying fundamental material properties and engineering new functional structures .
this protocol shows the experimental procedures to obtain the different types of templates for epitaxial growth oxide thin films .
the complete procedures to obtain well - defined single terminated srtio3 and dysco3 substrates are described , as well as the procedure to fabricate ca2nb3o10 nanosheet layers on arbitrary of substrates .
cleaning srtio3 and dysco3 substrates immerse the substrates in a beaker filled with acetone ( purity 99.5% ) and place it in an ultrasonic bath ( ub ) for 10 min .
repeat this step with ethanol ( purity 99.8% ) , without drying the substrate in between . use a nitrogen gun to dry the samples by blowing the ethanol drops from the surface . in this way
, particles that are present in ethanol will not stay on the surface after drying.check the surface with an optical microscope .
remove any leftover particles by rubbing the substrate gently on a lens tissue , which is soaked in ethanol .
immerse the substrates in a beaker filled with acetone ( purity 99.5% ) and place it in an ultrasonic bath ( ub ) for 10 min .
repeat this step with ethanol ( purity 99.8% ) , without drying the substrate in between . use a nitrogen gun to dry the samples by blowing the ethanol drops from the surface . in this way
, particles that are present in ethanol will not stay on the surface after drying .
remove any leftover particles by rubbing the substrate gently on a lens tissue , which is soaked in ethanol .
dysco3 treatment annealing load the cleaned substrates in a quartz boat and anneal them in a clean tube oven at 1,000 c in flowing oxygen ( 150 ml / hr ) for 4 hr.check the surface with an optical microscope .
if dirt is visible , use the procedure described in step 1.1.2 to clean the surface .
load the cleaned substrates in a quartz boat and anneal them in a clean tube oven at 1,000 c in flowing oxygen ( 150 ml / hr ) for 4 hr . check the surface with an optical microscope .
if dirt is visible , use the procedure described in step 1.1.2 to clean the surface .
dysco3 treatment surface roughening by bhf immerse the clean substrates in a 100 ml beaker containing 40 ml deionized ( di ) water and place it in an ub for 30 min .
use a teflon holder to carry the substrates.fill three hf resistant 100 ml beakers with 40 ml di water . fill one 100 ml beaker with 40 ml of ethanol .
fill one hf resistant beaker with 40 ml 12.5% buffered hydrogen fluoride ( bhf , nh4f : hf = 87.5:12.5 , ph = 5.5 ) .
proper precautions should be taken.transfer the teflon holder carrying the substrates from the beaker with di water to the beaker containing bhf .
put the beaker in the ub for 30 sec.transfer the teflon holder to an hf resistant beaker containing di water and immerse for 20 sec , gently moving the holder up and down .
leave the holder with samples in the beaker containing ethanol.dispose of all bhf containing liquid.dry the substrates using a nitrogen gun .
check the surface with an optical microscope . if dirt is visible , repeat step 1.1.2 .
immerse the clean substrates in a 100 ml beaker containing 40 ml deionized ( di ) water and place it in an ub for 30 min . use a teflon holder to carry the substrates .
fill one hf resistant beaker with 40 ml 12.5% buffered hydrogen fluoride ( bhf , nh4f : hf = 87.5:12.5 , ph = 5.5 ) .
transfer the teflon holder carrying the substrates from the beaker with di water to the beaker containing bhf . put the beaker in the ub for 30 sec .
transfer the teflon holder to an hf resistant beaker containing di water and immerse for 20 sec , gently moving the holder up and down .
check the surface with an optical microscope . if dirt is visible , repeat step 1.1.2 .
dysco3 treatment selective etching by naoh fill a 100 ml beaker with 40 ml 12 m naoh ( aq ) .
immerse the samples using a teflon holder and place the beaker in an ub for 30 min.transfer the samples to a 100 ml beaker containing 40 ml 1 m naoh ( aq ) .
put it in the ub for 30 min.fill three beakers with di water and one beaker with ethanol .
rinse the samples by subsequent immersing in the three beakers with water and finally in the beaker with ethanol .
dry the samples using a nitrogen gun.check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
fill a 100 ml beaker with 40 ml 12 m naoh ( aq ) . immerse the samples using a teflon holder and place the beaker in an ub for 30 min .
transfer the samples to a 100 ml beaker containing 40 ml 1 m naoh ( aq ) . put it in the ub for 30 min .
rinse the samples by subsequent immersing in the three beakers with water and finally in the beaker with ethanol .
check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
note that , while this step is used for dysco3 just as a surface roughening step , the selective etching of sro occurs in this step.anneal the samples at 950 c in flowing oxygen ( 150 ml / hr ) for 90 min .
check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
note that , while this step is used for dysco3 just as a surface roughening step , the selective etching of sro occurs in this step .
anneal the samples at 950 c in flowing oxygen ( 150 ml / hr ) for 90 min .
check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
preparation of ca2nb3o10 nanosheets make a dispersion of hca2nb3o10 powder in di water with a concentration of 0.40 g/100 ml and add an equimolar amount of tetra - butyl ammonium hydroxide ( tbaoh ) . please refer to ebina et al.for the solid - state synthesis of kca2nb3o10 powder and its protonation to hca2nb3o10 .
note : tbaoh is corrosive ; wear gloves at all times and handle with care.gently shake the bottle by hand and place it horizontally on a rocking shaker at 30 hz for 14 days .
re - disperse the precipitation five to six times during these 14 days by slowly rolling the bottle.dilute the dispersion to 0.40
g / l and gently shake it again . let it stand for at least 24 hr before use in order to let large aggregates settle to the lower part of the dispersion .
initial batches of 100 ml and diluted batches of 500 ml were made , both in polypropylene bottles .
make a dispersion of hca2nb3o10 powder in di water with a concentration of 0.40 g/100 ml and add an equimolar amount of tetra - butyl ammonium hydroxide ( tbaoh ) .
please refer to ebina et al.for the solid - state synthesis of kca2nb3o10 powder and its protonation to hca2nb3o10 .
note : tbaoh is corrosive ; wear gloves at all times and handle with care . gently shake the bottle by hand and place it horizontally on a rocking shaker at 30 hz for 14 days .
re - disperse the precipitation five to six times during these 14 days by slowly rolling the bottle .
let it stand for at least 24 hr before use in order to let large aggregates settle to the lower part of the dispersion .
initial batches of 100 ml and diluted batches of 500 ml were made , both in polypropylene bottles .
deposition of ca2nb3o10 nanosheets note : various versions of equipment and software yield various operational settings
clean the wilhelmy plate by rinsing with di water and cleaning with oxygen plasma at high energy for at least 3 min for each side . store the wilhelmy plate in di water immediately afterwards .
note : if multiple depositions are done successively , the wilhelmy plate does not need to be treated with oxygen plasma every time.clean the langmuir - blodgett trough and the two barriers by rinsing with di water , brushing with ethanol , again rinsing with di water and drying with nitrogen gas . make sure the setup is placed on an anti - vibration table to protect against vibrations , and in a box that can be closed during deposition to protect against flowing air and dust.take 50 ml from the upper part of a fresh nanosheet dispersion with a syringe and slowly put it in the trough .
. the water surface must be slightly higher than the edges of the trough , to make sure that the barriers can compress the surface properly.let the dispersion rest for 15 min.choose an arbitrary substrate compatible with aqueous solutions and clean it properly .
attach the substrate to the holder of the lb setup and give it a final blow with nitrogen gas .
note : keep in mind that atomically flat films have to be grown on atomically flat substrates .
example data in this report were obtained with silicon substrates , which were cleaned with ethanol , a jet of supercritical co2 for 30 sec and oxygen plasma at high energy for 5 min.attach the substrate holder to the setup .
take the wilhelmy plate , dip it in the trough and carefully attach it to the spring .
remove droplets from the wire of the plate with a piece of paper.lower the substrate until it touches the surface of the nanosheet dispersion , set the height in the software to zero and lower the substrate further until the desired depth .
make sure that the substrate holder does not touch the nanosheet dispersion.set the surface pressure in the software to zero and let the dispersion rest for 15 min .
after 15 min the surface pressure typically reaches 1 to 2 mn / m . large deviations may indicate poor quality of the following deposition.set the surface pressure in the software to zero again and start the first stage of the deposition by moving the barriers with a rate of 3.0 mm / min to slowly compress the surface .
make sure that the value of the target pressure in the software is well above the maximum value expected in step 2.2.10 ( i.e. , 20 mn / m).monitor the development of surface pressure and surface area .
wait until the increase of the pressure slows down significantly and the pressure approaches its maximum .
the maximum pressure typically reaches 15.0 to 18.0 mn / m , but this is neither an absolute nor a constant value.enter the reached value as target pressure , set the dipper height to the actual value and start the second stage of the deposition by withdrawing the substrate from the dispersion with a rate of 1.0 mm / min . monitor the surface pressure.remove the wilhelmy plate when the deposition is finished , rinse it with di water and store it in di water again.remove the substrate after it has dried completely.for multilayer deposition , decompose the organic residues from the previous layer .
this can be done for example by heating to 600 c in a microwave oven for 30 min or by ultraviolet irradiation for 30 min .
repeat the protocol from step 2.2.2 , but do not clean the substrate other than with a blow of nitrogen gas .
clean the wilhelmy plate by rinsing with di water and cleaning with oxygen plasma at high energy for at least 3 min for each side . store the wilhelmy plate in di water immediately afterwards .
note : if multiple depositions are done successively , the wilhelmy plate does not need to be treated with oxygen plasma every time .
clean the langmuir - blodgett trough and the two barriers by rinsing with di water , brushing with ethanol , again rinsing with di water and drying with nitrogen gas . make sure
the setup is placed on an anti - vibration table to protect against vibrations , and in a box that can be closed during deposition to protect against flowing air and dust .
take 50 ml from the upper part of a fresh nanosheet dispersion with a syringe and slowly put it in the trough .
make sure the edges of the trough and the barriers are free of droplets . note : the amount required for one deposition depends on the size of the trough
. the water surface must be slightly higher than the edges of the trough , to make sure that the barriers can compress the surface properly .
attach the substrate to the holder of the lb setup and give it a final blow with nitrogen gas .
note : keep in mind that atomically flat films have to be grown on atomically flat substrates .
example data in this report were obtained with silicon substrates , which were cleaned with ethanol , a jet of supercritical co2 for 30 sec and oxygen plasma at high energy for 5 min .
take the wilhelmy plate , dip it in the trough and carefully attach it to the spring .
lower the substrate until it touches the surface of the nanosheet dispersion , set the height in the software to zero and lower the substrate further until the desired depth .
set the surface pressure in the software to zero and let the dispersion rest for 15 min .
after 15 min the surface pressure typically reaches 1 to 2 mn / m . large deviations may indicate poor quality of the following deposition .
set the surface pressure in the software to zero again and start the first stage of the deposition by moving the barriers with a rate of 3.0 mm / min to slowly compress the surface .
make sure that the value of the target pressure in the software is well above the maximum value expected in step 2.2.10 ( i.e. , 20 mn / m ) .
wait until the increase of the pressure slows down significantly and the pressure approaches its maximum .
the maximum pressure typically reaches 15.0 to 18.0 mn / m , but this is neither an absolute nor a constant value .
enter the reached value as target pressure , set the dipper height to the actual value and start the second stage of the deposition by withdrawing the substrate from the dispersion with a rate of 1.0 mm / min .
remove the wilhelmy plate when the deposition is finished , rinse it with di water and store it in di water again .
this can be done for example by heating to 600 c in a microwave oven for 30 min or by ultraviolet irradiation for 30 min .
repeat the protocol from step 2.2.2 , but do not clean the substrate other than with a blow of nitrogen gas .
cleaning srtio3 and dysco3 substrates immerse the substrates in a beaker filled with acetone ( purity 99.5% ) and place it in an ultrasonic bath ( ub ) for 10 min .
repeat this step with ethanol ( purity 99.8% ) , without drying the substrate in between . use a nitrogen gun to dry the samples by blowing the ethanol drops from the surface . in this way
, particles that are present in ethanol will not stay on the surface after drying.check the surface with an optical microscope .
remove any leftover particles by rubbing the substrate gently on a lens tissue , which is soaked in ethanol .
immerse the substrates in a beaker filled with acetone ( purity 99.5% ) and place it in an ultrasonic bath ( ub ) for 10 min .
repeat this step with ethanol ( purity 99.8% ) , without drying the substrate in between . use a nitrogen gun to dry the samples by blowing the ethanol drops from the surface . in this way
, particles that are present in ethanol will not stay on the surface after drying .
remove any leftover particles by rubbing the substrate gently on a lens tissue , which is soaked in ethanol .
dysco3 treatment annealing load the cleaned substrates in a quartz boat and anneal them in a clean tube oven at 1,000 c in flowing oxygen ( 150 ml / hr ) for 4 hr.check the surface with an optical microscope .
if dirt is visible , use the procedure described in step 1.1.2 to clean the surface .
load the cleaned substrates in a quartz boat and anneal them in a clean tube oven at 1,000 c in flowing oxygen ( 150 ml / hr ) for 4 hr . check the surface with an optical microscope .
if dirt is visible , use the procedure described in step 1.1.2 to clean the surface .
dysco3 treatment surface roughening by bhf immerse the clean substrates in a 100 ml beaker containing 40 ml deionized ( di ) water and place it in an ub for 30 min .
use a teflon holder to carry the substrates.fill three hf resistant 100 ml beakers with 40 ml di water . fill one 100 ml beaker with 40 ml of ethanol .
fill one hf resistant beaker with 40 ml 12.5% buffered hydrogen fluoride ( bhf , nh4f : hf = 87.5:12.5 , ph = 5.5 ) .
proper precautions should be taken.transfer the teflon holder carrying the substrates from the beaker with di water to the beaker containing bhf .
put the beaker in the ub for 30 sec.transfer the teflon holder to an hf resistant beaker containing di water and immerse for 20 sec , gently moving the holder up and down .
leave the holder with samples in the beaker containing ethanol.dispose of all bhf containing liquid.dry the substrates using a nitrogen gun .
check the surface with an optical microscope . if dirt is visible , repeat step 1.1.2 .
immerse the clean substrates in a 100 ml beaker containing 40 ml deionized ( di ) water and place it in an ub for 30 min . use a teflon holder to carry the substrates .
fill one hf resistant beaker with 40 ml 12.5% buffered hydrogen fluoride ( bhf , nh4f : hf = 87.5:12.5 , ph = 5.5 ) .
transfer the teflon holder carrying the substrates from the beaker with di water to the beaker containing bhf . put the beaker in the ub for 30 sec .
transfer the teflon holder to an hf resistant beaker containing di water and immerse for 20 sec , gently moving the holder up and down .
check the surface with an optical microscope . if dirt is visible , repeat step 1.1.2 .
dysco3 treatment selective etching by naoh fill a 100 ml beaker with 40 ml 12 m naoh ( aq ) .
immerse the samples using a teflon holder and place the beaker in an ub for 30 min.transfer the samples to a 100 ml beaker containing 40 ml 1 m naoh ( aq ) .
put it in the ub for 30 min.fill three beakers with di water and one beaker with ethanol .
rinse the samples by subsequent immersing in the three beakers with water and finally in the beaker with ethanol .
dry the samples using a nitrogen gun.check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
fill a 100 ml beaker with 40 ml 12 m naoh ( aq ) . immerse the samples using a teflon holder and place the beaker in an ub for 30 min .
transfer the samples to a 100 ml beaker containing 40 ml 1 m naoh ( aq ) . put it in the ub for 30 min .
rinse the samples by subsequent immersing in the three beakers with water and finally in the beaker with ethanol .
check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
note that , while this step is used for dysco3 just as a surface roughening step , the selective etching of sro occurs in this step.anneal the samples at 950 c in flowing oxygen ( 150 ml / hr ) for 90 min .
check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
note that , while this step is used for dysco3 just as a surface roughening step , the selective etching of sro occurs in this step .
anneal the samples at 950 c in flowing oxygen ( 150 ml / hr ) for 90 min .
check the surface with an optical microscope and clean if necessary , using the procedure described in step 1.1.2 .
preparation of ca2nb3o10 nanosheets make a dispersion of hca2nb3o10 powder in di water with a concentration of 0.40 g/100 ml and add an equimolar amount of tetra - butyl ammonium hydroxide ( tbaoh ) . please refer to ebina et al.for the solid - state synthesis of kca2nb3o10 powder and its protonation to hca2nb3o10 .
note : tbaoh is corrosive ; wear gloves at all times and handle with care.gently shake the bottle by hand and place it horizontally on a rocking shaker at 30 hz for 14 days .
re - disperse the precipitation five to six times during these 14 days by slowly rolling the bottle.dilute the dispersion to 0.40
let it stand for at least 24 hr before use in order to let large aggregates settle to the lower part of the dispersion .
initial batches of 100 ml and diluted batches of 500 ml were made , both in polypropylene bottles .
make a dispersion of hca2nb3o10 powder in di water with a concentration of 0.40 g/100 ml and add an equimolar amount of tetra - butyl ammonium hydroxide ( tbaoh ) . please refer to ebina et al.for the solid - state synthesis of kca2nb3o10 powder and its protonation to hca2nb3o10 .
note : tbaoh is corrosive ; wear gloves at all times and handle with care . gently shake the bottle by hand and place it horizontally on a rocking shaker at 30 hz for 14 days .
re - disperse the precipitation five to six times during these 14 days by slowly rolling the bottle .
let it stand for at least 24 hr before use in order to let large aggregates settle to the lower part of the dispersion .
initial batches of 100 ml and diluted batches of 500 ml were made , both in polypropylene bottles .
deposition of ca2nb3o10 nanosheets note : various versions of equipment and software yield various operational settings .
clean the wilhelmy plate by rinsing with di water and cleaning with oxygen plasma at high energy for at least 3 min for each side . store the wilhelmy plate in di water immediately afterwards .
note : if multiple depositions are done successively , the wilhelmy plate does not need to be treated with oxygen plasma every time.clean the langmuir - blodgett trough and the two barriers by rinsing with di water , brushing with ethanol , again rinsing with di water and drying with nitrogen gas . make sure the setup is placed on an anti - vibration table to protect against vibrations , and in a box that can be closed during deposition to protect against flowing air and dust.take 50 ml from the upper part of a fresh nanosheet dispersion with a syringe and slowly put it in the trough .
note : the amount required for one deposition depends on the size of the trough . the water surface must be slightly higher than the edges of the trough , to make sure that the barriers can compress the surface properly.let the dispersion rest for 15 min.choose an arbitrary substrate compatible with aqueous solutions and clean it properly . attach the substrate to the holder of the lb setup and give it a final blow with nitrogen gas .
note : keep in mind that atomically flat films have to be grown on atomically flat substrates .
example data in this report were obtained with silicon substrates , which were cleaned with ethanol , a jet of supercritical co2 for 30 sec and oxygen plasma at high energy for 5 min.attach the substrate holder to the setup .
take the wilhelmy plate , dip it in the trough and carefully attach it to the spring .
remove droplets from the wire of the plate with a piece of paper.lower the substrate until it touches the surface of the nanosheet dispersion , set the height in the software to zero and lower the substrate further until the desired depth .
make sure that the substrate holder does not touch the nanosheet dispersion.set the surface pressure in the software to zero and let the dispersion rest for 15 min .
after 15 min the surface pressure typically reaches 1 to 2 mn / m . large deviations may indicate poor quality of the following deposition.set the surface pressure in the software to zero again and start the first stage of the deposition by moving the barriers with a rate of 3.0 mm / min to slowly compress the surface .
make sure that the value of the target pressure in the software is well above the maximum value expected in step 2.2.10 ( i.e. , 20 mn / m).monitor the development of surface pressure and surface area .
wait until the increase of the pressure slows down significantly and the pressure approaches its maximum .
the maximum pressure typically reaches 15.0 to 18.0 mn / m , but this is neither an absolute nor a constant value.enter the reached value as target pressure , set the dipper height to the actual value and start the second stage of the deposition by withdrawing the substrate from the dispersion with a rate of 1.0 mm / min . monitor the surface pressure.remove the wilhelmy plate when the deposition is finished , rinse it with di water and store it in di water again.remove the substrate after it has dried completely.for multilayer deposition , decompose the organic residues from the previous layer .
this can be done for example by heating to 600 c in a microwave oven for 30 min or by ultraviolet irradiation for 30 min .
repeat the protocol from step 2.2.2 , but do not clean the substrate other than with a blow of nitrogen gas .
clean the wilhelmy plate by rinsing with di water and cleaning with oxygen plasma at high energy for at least 3 min for each side . store the wilhelmy plate in di water immediately afterwards .
note : if multiple depositions are done successively , the wilhelmy plate does not need to be treated with oxygen plasma every time .
clean the langmuir - blodgett trough and the two barriers by rinsing with di water , brushing with ethanol , again rinsing with di water and drying with nitrogen gas . make sure
the setup is placed on an anti - vibration table to protect against vibrations , and in a box that can be closed during deposition to protect against flowing air and dust .
take 50 ml from the upper part of a fresh nanosheet dispersion with a syringe and slowly put it in the trough .
. the water surface must be slightly higher than the edges of the trough , to make sure that the barriers can compress the surface properly .
attach the substrate to the holder of the lb setup and give it a final blow with nitrogen gas .
note : keep in mind that atomically flat films have to be grown on atomically flat substrates .
example data in this report were obtained with silicon substrates , which were cleaned with ethanol , a jet of supercritical co2 for 30 sec and oxygen plasma at high energy for 5 min .
take the wilhelmy plate , dip it in the trough and carefully attach it to the spring . remove droplets from the wire of the plate with a piece of paper .
lower the substrate until it touches the surface of the nanosheet dispersion , set the height in the software to zero and lower the substrate further until the desired depth .
set the surface pressure in the software to zero and let the dispersion rest for 15 min .
after 15 min the surface pressure typically reaches 1 to 2 mn / m . large deviations may indicate poor quality of the following deposition .
set the surface pressure in the software to zero again and start the first stage of the deposition by moving the barriers with a rate of 3.0 mm / min to slowly compress the surface .
make sure that the value of the target pressure in the software is well above the maximum value expected in step 2.2.10 ( i.e. , 20 mn / m ) .
wait until the increase of the pressure slows down significantly and the pressure approaches its maximum .
the maximum pressure typically reaches 15.0 to 18.0 mn / m , but this is neither an absolute nor a constant value .
enter the reached value as target pressure , set the dipper height to the actual value and start the second stage of the deposition by withdrawing the substrate from the dispersion with a rate of 1.0 mm / min .
remove the wilhelmy plate when the deposition is finished , rinse it with di water and store it in di water again .
this can be done for example by heating to 600 c in a microwave oven for 30 min or by ultraviolet irradiation for 30 min .
repeat the protocol from step 2.2.2 , but do not clean the substrate other than with a blow of nitrogen gas .
step 1 ) selective etching of srtio3 and dysco3 substrates
atomic force microscopy ( afm ) is a straightforward way to obtain an indication about the success of the treatment .
the afm image of an srtio3 substrate which had only been flashed to 650 c ( figure 4a ) shows a rough surface , demonstrating the necessity of a high temperature annealing step .
the afm data of an annealed substrate ( figures 4a - c ) clearly show two surface terminations , since clear contrast in the friction image is observed , as well as half unit cell height differences in a cross section of the height image .
figure 5 shows afm images of tio2 terminated srtio3 substrates , which were treated according to the method described in this protocol . on large scale ,
straight terrace ledges can be observed ( figure 5a ) . on smaller scale , very smooth terraces
are observed , and only unit cell height differences between the terraces are measured , as expected for single terminated surfaces . on substrates with larger terraces ,
i.e. , with smaller miscut angles , unit cell deep holes are visible near the terrace ledges ( figure 5b ) .
these holes disappear when longer annealing times are used , leading to morphologies similar to single terminated substrates with higher miscut angles ( figure 5c ) .
the morphology of these holes , as well as the morphology of the terrace ledges , are an important indication of single termination . on single terminated substrates ,
in contrast , sharp - edged terrace ledges and square holes are visible on double terminated substrates ( see figure 4b ) .
another indication of single termination appears in reflection high - energy electron diffraction ( rheed ) images , as shown in figure 6 . in rheed images of as received substrates , streaks appear due to poor crystallinity of the surface .
after annealing in oxygen or full treatment of the substrate , the surface is more ordered , as can be seen by the appearance of kikuchi lines and sharp diffraction spots . however , in the case of single terminated substrates , the diffraction spots are even smaller compared to substrates that are only annealed .
more important , besides the ( 1x1 ) spots , no additional spots are visible , which are always present in patterns of double terminated substrates in the case of dysco3 , it is more difficult to see whether or not a treatment is successful .
no differences can be seen between rheed patterns of annealed double terminated substrates and chemically treated sco2 terminated substrates in figure 7 , afm images of different annealed dysco3 substrates are shown .
figure 7e and f show the morphology expected for single terminated substrates , i.e. only 4 steps are visible .
due to the limited resolution of the afm , the areas of different terminations are not clearly visible .
higher surface roughness in both height and phase images compared to single terminated surfaces are an indication of the presence of both terminations
. scanning probe microscopy and surface diffraction techniques are not sufficient to completely determine the success of a treatment .
minor regions of the second termination may not be observed with both types of techniques due to limited resolution .
however , these minor regions can have a dramatic influence on the quality of the film , as shown in figure 8 .
although the afm images of the dysco3 and srtio3 substrates in respectively figure 8c and f seemed to show single terminated surfaces , growth of srruo3 shows that regions of the other termination were still present . in the end
, the success of a treatment can only be fully determined considering the quality of the grown film .
step 2 ) deposition of ca2nb3o10 nanosheets on arbitrary substrates
during nanosheet deposition , the change in surface pressure can be monitored and this gives an indication on how the deposition proceeds .
typical plots of the surface pressure during the initial surface area compression and the actual deposition of nanosheets are shown in figure 9 .
the pressure generally increases for an increasingly dense packing of floating nanosheets and increases more rapidly as the packing density approaches 100% .
the actual deposition should start just before the surface pressure reaches its maximum and this pressure will be maintained throughout the deposition . in case the pressure passes its maximum and ( slightly ) collapses , this could indicate that the high compressing force caused the edges of some nanosheets to overlap each other and create ( partial ) stacks .
as long as the pressure does not approach a maximum , the nanosheets are not yet organized into a dense packing . during the actual deposition , the barriers slowly move back and forth to enable local reorganization of the nanosheet monolayer and this causes a saw - like pressure profile .
the nanosheet surfaces are smooth and the height difference with adjacent gaps approaches the 1.44 nm crystallographic thickness of ca2nb3o10 layers in their parent compound .
a monolayer of nanosheets is fully ( 001 ) oriented in the out - of - plane direction , but has a random in - plane orientation due to the random in - plane ordering of nanosheets . to illustrate their crystal orientations and quality ,
figure 11 shows an electron backscatter diffraction ( ebsd ) image of epitaxial srruo3 grown on ca2nb3o10 nanosheets with an intermediate layer of srtio3 .
the film has an out - of - plane ( 001 ) orientation on all nanosheets and has a single in - plane orientation on individual nanosheets .
the surface morphology of such films is illustrated with the afm image in figure 12.the step heights in the continuous parts correspond either with the nanosheet thickness or with the unit cell height of srruo3 , confirming high quality film growth on atomically perfect nanosheets .
for an extended report on the properties of epitaxial srruo3 films grown by this approach , please refer to nijland et al .
the metal ions a and b are located in , respectively , the corners and center of the unit cell .
the oxygen atoms are located at the faces of the cube , forming an octahedron around the b ion .
( b ) schematic representation of a ( 001 ) oriented perovskite substrate . due to a miscut ,
( d ) afm image of the surface of a dysco3 substrate after annealing at 1,000 c for 4 hr . the roughness on the terraces is caused by the presence of two surface terminations , as shown in the line profile ( e ) , where not only the 4 unit cell steps , but also 2 height differences are visible . figures a - c are adapted from kleibeuker et al .
ion exchange with bulky molecules causes the structure to swell and reduces the interlayer electrostatic forces , allowing the layers to be separated from each other .
the nanosheets float towards the surface of the dispersion and are compressed into a dense packing by the barriers moving inward . the substrate is then slowly withdrawn from the dispersion
( a ) afm image of an srtio3 substrate which had been flashed to 650 c .
( b ) afm height and ( c ) friction image of a double terminated srtio3 substrate , showing sharp step edges and terraces with half a unit cell height difference compared to the adjacent terraces , as visible in the line profile of the afm height image shown in ( d ) .
the two different terminations cause a clear contrast in the friction image . figure taken with permission from koster et al .
d ) is a line profile of ( c ) , showing only unit cell height differences . the circle in ( b )
indicates one of the unit cell deep holes which are visible near the terrace ledges of substrates with low miscut angles . figure taken with permission from koster et al .
rheed images of ( a ) an as received srtio3 substrate , ( b ) an annealed substrate and ( c ) a single terminated srtio3 substrate . figure taken with permission from koster et al .
figure 7.afm images of annealed dysco3 substrates.(a - d ) show clearly double terminated surfaces .
the surfaces of ( e ) and ( f ) look more homogenous , and only unit cell height differences can be measured .
however , the resolution of the afm can be too low to measure small areas of a second termination .
the films in ( a ) and ( d ) are grown on respectively srtio3 and dysco3 substrates which were treated according to the methods described in this protocol .
the films are very smooth , and the corresponding line profiles shown in ( b ) and ( e ) show only unit cell height differences .
the films in ( c ) and ( f ) were grown on double terminated annealed substrates .
trenches are visible which are in the range of the film thickness . the insets in ( d ) and ( f ) show the substrate before growth .
note that both surfaces are very smooth . figure taken with permission from kleibeuker et al .
typical plots of the surface pressure during the initial surface area compression and the actual deposition of ca2nb3o10 nanosheets .
figure 10.typical afm image and line profile of a monolayer of ca2nb3o10 nanosheets deposited on a silicon substrate .
figure 11.ebsd image of epitaxial srruo3grown on ca2nb3o10 nanosheets with an intermediate layer of srtio3 .
the film has an out - of - plane ( 001 ) orientation on all nanosheets and has a single in - plane orientation on individual nanosheets .
figure 12.afm image and line profile of epitaxial srruo3 grown on ca2nb3o10 nanosheets with an intermediate layer of srtio3 .
step heights in the continuous parts match the nanosheet thickness of 1.4 nm and the srruo3 unit cell height of 0.4 nm .
the most important aspect of all perovskite oxide substrate treatments is the cleanliness of the work .
surface contaminations prevent etching of areas of the substrate , while unwanted reactions during annealing can easily damage the surface .
the order of the different steps is important as well . in the treatment of dysco3
, the annealing step should be performed before the etching step , since post - annealing leads to unwanted dy diffusion from the bulk to the surface of the substrate . after etching in the 12 m naoh solution , a 1 m solution should always be used in order to prevent precipitation of dysprosium hydroxide complexes onto the substrate surface .
soaking in water is necessary for the srtio3 treatment in order to hydroxylize the sro . in this way ,
short etching times can be used which prevents damaging of the surface due to uncontrolled etching .
this step is simply copied from the standardized srtio3 treatment procedure and is not expected to have any significance in the treatment .
the indicated annealing times for dysco3 and srtio3 treatments are times that , on average , lead to well defined step ledges
. however , sometimes the annealing time needs to be increased for substrates with a low miscut angle , i.e. , with wider terraces .
an increased diffusion length is then required for the surface atoms to find the optimal sites . in the case of srtio3 ,
a too long annealing time may cause unwanted diffusion of sr atoms from the bulk to the surface .
this second termination can be observed in the surface morphology by appearance of straight step edges and square holes , as described in the section on representative results . in that case , the surface treatment can be repeated , but the final annealing step should be performed at 920 c for 30 min .
the methods described in this protocol are the most successful methods for ( 001 ) srtio3 and rare earth scandates , but are applicable to these substrates only .
this is also required when substrates with other orientations are used , or when a - site instead of b - site termination is desired .
an overview of existing treatments can be found in snchez et al . and schlom et al . regarding seed layers of nanosheets , delicate parts of the process are to obtain high quality nanosheet dispersions and to prevent contamination during the deposition .
delamination of a layered parent compound into unilamellar nanosheets by addition of bulky organic ions occurs readily , but nanosheets tend to aggregate in dispersion and such aggregates will hinder the deposition of homogeneous monolayers .
therefore , it is very important to leave a freshly diluted dispersion at rest for at least 24 hr before use and not to use the lower part of the dispersion .
this leaves time for large aggregates to settle and the upper part of the dispersion will become relatively pure . since ongoing aggregation will continuously degrade the dispersion , use within one week after dilution is recommended .
please note that the occurring gradient in nanosheet concentration throughout the dispersion volume causes some variations in the surface pressure values during lb deposition , depending on the local nanosheet concentration in the volume taken from the stock dispersion .
furthermore , lb deposition is based on surface - active molecules and thus is very sensitive to contaminations and movement .
careful cleaning of the setup and wilhelmy plate ( preferably with cleaning tools dedicated to this setup only ) and protection against flowing air and vibrations are very important . the concept of creating a seed layer of nanosheets on arbitrary substrates by lb deposition is a valuable tool in the field of thin film growth .
the atomically perfect surface of nanosheets yields high quality epitaxial films of , in principle , any film material with matching lattice parameters .
nanosheets can be deposited on virtually any substrate material and thus other materials can replace relatively expensive and size - limited single crystalline substrates .
the lb method enables nanosheet deposition in monolayers with a high controllability that generally can not be achieved by other conventional techniques like electrophoretic deposition or flocculation .
high film qualities over large areas are required for reliable application in functional devices and to date , this has not been achieved . to deposit nanosheets with a perfect coverage and preferably also to control their in - plane orientation are main challenges in the field .
nevertheless , the current state of the art has already proven to be a valuable tool in research .
| atomically defined substrate surfaces are prerequisite for the epitaxial growth of complex oxide thin films . in this protocol ,
two approaches to obtain such surfaces are described .
the first approach is the preparation of single terminated perovskite srtio3 ( 001 ) and dysco3 ( 110 ) substrates .
wet etching was used to selectively remove one of the two possible surface terminations , while an annealing step was used to increase the smoothness of the surface .
the resulting single terminated surfaces allow for the heteroepitaxial growth of perovskite oxide thin films with high crystalline quality and well - defined interfaces between substrate and film . in the second approach ,
seed layers for epitaxial film growth on arbitrary substrates were created by langmuir - blodgett ( lb ) deposition of nanosheets . as model system ca2nb3o10- nanosheets
were used , prepared by delamination of their layered parent compound hca2nb3o10 .
a key advantage of creating seed layers with nanosheets is that relatively expensive and size - limited single crystalline substrates can be replaced by virtually any substrate material . |
pseudomyxoma peritonei ( pmp ) is an extremely rare disease , with an annual incidence of approximately one case per million .
although such tumours are typically slow - growing , they vary highly in their invasive and metastatic capacity . due to the heterogenous nature of pmp ,
proposed dividing pmp into 3 categories : disseminated peritoneal adenomucinosis , peritoneal mucinous carcinomatosis ( pmca ) the most aggressive subtype and an intermediate group with features of both subtypes .
in contrast , other authors such as misdraji have suggested classifying the pathology into low- and high - grade disease .
the optimal treatment of pmp is unclear ; however , the most common approach is surgical debulking with intraperitoneal chemotherapy during or immediately after surgery . in certain specialized centres , cytoreductive surgery with hyperthermic intraperitoneal chemotherapy is the treatment of choice .
as the disease progresses , mucinous ascites accumulate in the peritoneum , eventually leading to gastrointestinal obstruction .
because this bowel obstruction is frequently inoperable , the main aim of treatment is to relieve the associated symptoms ( primarily pain , nausea , and vomiting ) .
somatostatin analogues , such as lanreotide and octreotide , are also commonly used due to their antisecretory ac - tivity . here
we describe a patient with appendiceal pmca and peritoneal dissemination who responded well to symptomatic treatment with lanreotide , with radiological evidence demonstrating a notable reduction in peritoneal ascites .
in july 2011 , a 54-year - old female patient was referred to the gynaecology department for the evaluation of a suprapubic mass .
complementary tests performed during the diagnosis revealed the presence of several tumour markers [ carbohydrate antigen 199 ( ca 199 ) : 45 u / ml ; carcinoembryonic antigen ( cea ) : 2 ng / ml ; carbohydrate antigen 125 ( ca-125 ) : 56 u / ml ] .
an abdominal ultrasound revealed a mass of 10 cm located on the anterior wall of the uterus , with scant free liquid in the peritoneal cavity .
the patient underwent an abdominal laparotomy in august 2011 , revealing a 12-cm left adnexal mass with a stony consistency , identified as a signet ring cell carcinoma on intraoperative biopsy . a 4-cm tumour located on the right ovary
a hysterectomy and double adenexectomy were performed , and the exploration of the abdominal cavity revealed a hardened appendix , with miliary seeding of the peritoneum and the diaphragmatic cupola . given these findings , an appendicectomy and omentectomy were performed and multiple biopsies of the peritoneum were taken .
r2 surgery was then performed , although the cytoreductive surgery was deemed incomplete due to the persistence of the macroscopic disease ( > 2.5 cm ) . a pathological examination of the surgical specimen revealed a signet ring cell adenocarcinoma in the appendix , with metastases to the ovaries , fallopian tubes , omentum , and the left and right paracolic gutters .
the patient was not considered a candidate for hyperthermic intraperitoneal chemotherapy and was therefore referred to the medical oncology department in september 2011 for further evaluation and treatment .
first - line palliative chemotherapy was initiated according to the following scheme : capecitabine 2,000 mg / m / day for 14 days + oxaliplatin 130 mg / m ( 6 ) for 4 cycles until january 2012 , at which time second - line chemotherapy was initiated ; day 1 , 5-fu 400 mg / m + lv 400 mg / m + irinotecan 180 mg / m + 5-fu 2,400 mg / m in continuous perfusion for 46 h due to abdominal progression ( tense ascites ) and elevated serum tumour markers ( ca 199 : 104 u / ml ) .
the patient received a total of 12 cycles of chemotherapy until june 2012 when treatment was halted due to unacceptable toxicity ( diarrhoea and neutropaenia , both grade 3 ) .
after the patient recovered from the chemotherapy - induced toxicity , bimonthly follow - ups in the outpatient clinic were initiated .
her general health status remained good , without any notable digestive symptoms and with an excellent functional status .
however , in january 2013 , the patient developed bowel obstruction secondary to tumour progression and was admitted to the hospital .
an abdominal ct scan showed a peritoneal invasion , with a hypodense region surrounding both the liver and the spleen , and marked duodenal dilatation up to the ligament of treitz .
symptomatic treatment , including parenteral nutrition , corticosteroid therapy , antiemetics , and nasogastric intubation , was prescribed , with a good clinical response .
the general surgery department ( peritoneal carcinomatosis unit ) evaluated the patient for possible palliative surgery , but the case was considered unsuitable for surgery .
symptom control during hospitalization was good and the nasogastric tube was removed due to a lack of vomiting episodes .
the patient maintained adequate kidney , hematologic , and liver function , and she was discharged from the hospital to home care , which included continued parenteral nutrition , supportive care , and monthly follow - ups at the medical oncology outpatient department . from march to november 2013 , the patient presented a sufficient performance status [ eastern cooperative oncology group ( ecog ) grade 1 ] with no abdominal pain or bilious vomiting .
no radiological changes were observed on any images taken during outpatient follow - up . the only change of note was an increase in serum levels of ca 199 ( 330 u / ml ) . in january 2014
however , no worsening of other symptoms was observed , and kidney , liver , and hematologic functions remained adequate . considering the neuroendocrine differentiation of the primary tumour in the context of the patient 's increased vomiting frequency , we decided to initiate treatment with lanreotide autogel ( somatuline autogel ; ipsen ) , a long - lasting extended - release gel formulation of lanreotide , at a dose of 120 mg every 28 days .
a phase iii trial published in 2012 suggested that this drug might be effective in the symptomatic treatment of inoperable bowel obstruction due to peritoneal carcinomatosis .
our decision was further bolstered by a review published in that same year suggesting that somatostatin analogues may provide both direct and indirect antitumour effects in neuroendocrine tumours .
an abdominal ct scan performed after treatment with lanreotide autogel showed a clear tumour response , with a notable decrease in ascites ( fig .
1 ) . in addition , vomiting frequency was reduced , and serum ca 199 decreased from 330 to 230 u / ml . for several months , the patient continued treatment with lanreotide autogel , home parenteral nutrition ( without oral ingestion of food ) , and monthly check - ups .
however , in november 2014 , the patient was hospitalized due to acute respiratory failure in the context of a lower airway infection . a few days after admission , the patient died ( on november 11 , 2014 ) due to multiorgan failure ( despite the use of antibiotics , oxygen therapy , and non - invasive ventilatory support ) .
in the case report presented here , the use of lanreotide autogel reduced disease - related symptoms , and , interestingly , also reduced the number of peritoneal ascites .
these are important findings for patients with pmp given the highly negative impact of pmp - associated symptoms on quality of life and the poor long - term survival outcomes , especially in aggressive histological subtypes such as pcma .
the benefits of short - acting somatostatin analogues ( e.g. , octreotide ) for the symptomatic treatment in inoperable bowel obstruction are well documented [ 6 , 7 , 8 ] .
somatostatin analogues inhibit the release of various gastrointestinal hormones , thus reducing gastrointestinal secretions and slowing intestinal motility , and also increasing water and electrolyte absorption .
lanreotide microparticles , a synthetic somatostatin analogue , has also been proven efficacious for this indication .
recently , the same formulation of lanreotide ( lanreotide autogel ) that we used to treat the symptoms of bowel obstruction in our patient was reported to be efficacious in another case .
the authors of that case report highlighted an important advantage of long - acting lanreotide over octreotide : less frequent administration ( three times / day for short - acting somatostatin analogues vs. once monthly administration for lanreotide autogel ) .
in addition to the beneficial effects of somatostatin analogues on symptom control in secretory neuroendocrine tumours , several recent publications suggest that these drugs may also have direct and indirect antitumour effects .
a systematic review published in 2012 evaluated publications that supported an antitumour role for the somatostatin analogues octreotide and lanreotide .
according to that review , the published data support an antitumour effect for these drugs .
more recently , results were published from the clarinet trial , a randomized , double - blind , placebo - controlled multinational study of lanreotide autogel in patients with advanced , well- or moderately differentiated , grade 1 or 2 somatostatin receptor - positive neuroendocrine tumours .
patients randomized to receive somatuline autogel had a significantly longer progression - free survival , a finding that provides evidence for the antiproliferative effects of lanreotide .
in this case report , the use of lanreotide autogel reduced disease - related symptoms and peritoneal ascites in a patient presenting with pmp .
randomized studies are needed to further investigate the antiproliferative effects of lanreotide observed in this patient , who had a neoplasm with neuroendocrine differentiation and a negative octreoscan .
the patient 's data have been completely anonymized and , therefore , no informed consent was considered necessary .
| peritoneal mucinous carcinomatosis is an aggressive subtype of pseudomyxoma peritonei , which often leads to inoperable bowel obstruction and , ultimately , death . due to the poor prognosis , treatment is often symptomatic and aimed at alleviating the symptoms pain , nausea , and vomiting associated with gastrointestinal obstruction . due to their antisecretory activity ,
somatostatin analogues are commonly prescribed in such cases . in the case
presented here , a patient diagnosed with disseminated peritoneal mucinous carcinomatosis of appendiceal origin responded well to symptomatic treatment with lanreotide autogel at a dose of 120 mg/28 days . more importantly , radiological evidence of a reduction in peritoneal ascites , indicative of antiproliferative activity , was observed .
these findings are important , particularly given the negative impact of this disease on both quality of life and survival .
this case adds to the growing body of evidence supporting the antiproliferative and antisecretory activity of lanreotide autogel . |
bupropion extended - release ( xl ) is an important pharmacological option except nicotine for the treatment of smoking cessation .
it is thought to act on nicotine addiction by blocking dopamine reward pathway and reducing withdrawal symptoms that arise due to noradrenaline pathway furthermore , bupropion is used for the treatment of major depression because of it acts as noradrenaline dopamine reuptake inhibitor.13 ) the most common side effects with the use of bupropion can be listed as insomnia , headache , dry mouth , rash , nausea , sweating and hypertension.4 ) hypomania , psychotic relapse and visual hallusinations may also occur via use of bupropion.5,6 ) according to the diagnostic and statistical manual of mental disorders , fifth edition ( dsm-5 ) , tardive dyskinesia is characterized by choreiform or atetoid involuntary movements at least continuing several weeks due to neuroleptic use at least several months .
these involuntary movements are often seen on face , arms , legs , jaws and tongues.7 ) additionally , tardive dyskinesia may develop with drugs except neuroleptics.8 ) here , we report an adult patient who developed tardive dyskinesia during treatment with bupropion .
forty - six year old man was admitted to our psychiatry outpatient unit with complaints of malaise , unwillingness , fatigue , lack of energy , lack of sexual desire , hypersomnia .
his physical and laboratory examination ( complete blood count , thyroid function , b12 and folate tests ) were normal .
the patient received 15 points in the hamilton rating scale for depression ( ham - d ) scale .
bupropion xl 150 mg per day treatment was started to the patient with a diagnosis of major depression according to the dsm-5 . after a month , due to continued complaints of depression , bupropion xl dose was increased to 300 mg per day .
after two months of dose increase , the patient was admitted to our outpatient unit with complaints of involuntary movements on his tongue and lips .
bupropion xl dose was decreased to 150 mg per day . after a month , due to continued involuntary movements , bupropion was stopped .
naranjo adverse drug reaction probability scale was evaluated as 7 points , a probable adverse effect associated with bupropion.9 )
to our knowledge , this is the first case report regarding tardive dyskinesia associated with bupropion xl in a patient with no history of neuroleptic use or neurologic disorders .
anormal involuntary movements apperared two months after bupropion dose was increased to 300 mg per day and disappeared five months after discontinuation of bupropion with simultaneous use of lorazepam . in literature , there has been three reported cases of dyskinesia associated with bupropion . in first case , 70 year old woman with bipolar disorder , dyskinesia developed 2 days after bupropion ir 75 mg per day was added to her lithium treatment.10 ) in second case , 63 year old man with major depression , dyskinesia developed one week after bupropion xl dose was increased to 300 mg per day and this patient had a history of neuroleptic medication.11 ) in third case , 64 year old woman with major depression , dyskinesia developed one week after bupropion dose was increased to 300 mg per day.12 ) in all three cases , dyskinesia developed acutely .
patients were elderly in previous three cases therefore early stages of parkinson disease or other neurologic disorders has been associated with dyskinesias after initiation of bupropion . according to dsm-5 ,
dyskinesia associated with bupropion in our patient noted as tar - dive because of involuntary movements occured two months after bupropion dose was increased to 300 mg per day and disappeared five months after discontinuation of bupropion . also , our patient was 46 years old
so he was quite young for onset of neurologic diseases compared with other cases in literature and there was no history of neuroleptic use in our patient .
involuntary movements may occur with short term use of drugs as bromocriptine and l - dopa or lasting than a few weeks in which case the condition is called acute dyskinesia , if these movements develop with use of drugs for at least a few months and lasting a few weeks is called tar - dive dyskinesia according to dsm-5.7,13 ) in some patients acute dyskinesia may develop after reduction or discontinuation in dosage of drugs which is called withdrawal dyskinesia lasting less than 48 weeks .
if dyskinesia persists for longer than this time is called tardive dyskinesia.7 ) yet , there is no effective and safety treatment and main treatment strategy is preventive approaches for tardive dyskinesia and it causes permanent disability , therefore tardive dyskinesia is important to early diagnosis of tardive dyskinesia in clinical practice.14,15 ) neuroleptic induced tardive dyskinesia develops via dopamin receptor hypersensitivity , reduction in gaba cycle and increased glutamate and aspartate levels after d2 receptor blokage.16 ) the mechanism of tardive dyskinesia associated with bupropion is still unclear .
excessive dopaminergic transmission in striatum caused by bupropion could be the underlying mechanism of bupropion associated tardive dyskinesia.13 ) other prodopaminergic agents such as modafinil , methylphenidate , levodopa , amphetamine and other stimulants have been reported to be associated with involuntary movements.13,1719 ) finally , clinicians should be careful about tardive dyskinesia associated bupropion when they used this drug even if the patient is not elderly .
new studies may contribute to understand the mechanism of bupropion associated tar - dive dyskinesia . | present report describes a 46 year old male patient with a diagnosis of major depression who developed tardive dyskinesia during bupropion therapy .
our patient had no history of neuroleptic use and his laboratory and neurologic examinations were normal .
he had no family history of neurologic diseases .
although bupropion induced dyskinesia has been previously reported in the literature , it is rare and our case is the first case regarding tardive dyskinesia . |
subepithelial tumors ( sets ) in the stomach are usually found incidentally during endoscopic examinations .
most gastric sets do not cause symptoms and were formerly considered to have a benign nature , such as lipomas , inflammatory fibroid polyps , or several neural origin tumors ( i.e. , schwannomas ) . however , several gastric sets have malignant potential , especially when they originate from the muscularis propria ( mp ) layer , such as gastrointestinal stromal tumors ( gists ) , neuroendocrine tumors ( nets ) , glomus tumors , and even metastastic tumors .
thus , removal of gastric sets and histopathologic confirmation are required when gist or net is highly suspected . in this review ,
we summarize the critical points when planning endoscopic resection of gastric sets as well as the long - term clinical outcomes of endoscopic resection of gastric gist .
first , diagnostic yield can be improved by obtaining whole set tissue ; thus , endoscopists can avoid frequent re - examination .
second , physicians are able to confidently provide a therapeutic plan to patients according to definite diagnosis ; thus , reassuring patients and reducing their anxiety .
third , insurance - related conflicts can be avoided . unfortunately , neither strict guidelines nor widespread acceptance for endoscopic resection as the treatment for gastric sets have yet been established .
we cautiously suggest indications for endoscopic resection based on our clinical experiences as follows : gists less than 3.0 cm without positive endoscopic ultrasonography ( eus ) findings ( i.e. , irregular borders , cystic space , ulceration , echogenic foci , and heterogeneity ) or hypoechoic sets less than 3.0 cm .
first , the tumor should be smaller than 3.0 to 4.0 cm , even though the exact cut - off limit remains controversial .
if the tumor is larger than this limit , endoscopic resection might be technically unavailable or cause serious complications including macroperforation .
second , the endoscopic procedure is operator - dependent , because the techniques mentioned above require highly advanced skills and sufficient clinical experience .
third , only limited studies including small numbers of patients and short - term follow - up periods have been published and are thus subject to selection biases .
table 1 summarizes procedure - related outcomes of endoscopic resection of sets in the upper gastrointestinal tract ( ugit ) .
recent guidelines from the national comprehensive cancer network state that if gists are completely resected ( including r1 resection ) , adjuvant therapy with imatinib can be considered , especially for patients with a significant high risk of recurrence ( intermediate or high risk by recent world health organization classifications ) . however , imatinib therapy followed by endoscopic resection is neither approved nor covered by the national health insurance system in korea , and guidelines from the korean gist study group suggest that complete en bloc resection with negative margins should be performed regardless of tumor size ; therefore , even if the tumor is small , endoscopic shell - out procedure or enucleation should be avoided if gist is suspected .
further discussion and opinions should be based on clinical outcomes and long - term follow - up data of endoscopic procedures .
as technical skills have advanced and novel endoscopic procedures have been developed , complete en bloc endoscopic resection of gastric sets has been reported [ 6 - 17 ] .
however , they included only a small number of gastric gists , and their long - term follow - up results have not yet been reported .
recent studies have reported no recurrence of gastric gists resected by endoscopic procedure ; however , their follow - up periods were relatively short , ranging from 1 to 2 years . here
a total of 249 patients with set in the ugit underwent endoscopic resection in our hospital ; among them , 89 cases were confirmed as gastric gist by histopathologic examination .
the most common site of the gastric gists was the gastric body ( 43.3% ) , followed by the cardia ( 22.2% ) and fundus ( 21.1% ) .
the mean tumor size was 2.31.2 cm , and most were considered to have originated from the mp layer ( 64.4% ) based on pre - procedural eus findings .
most of the tumors were resected by endoscopic submucosal dissection ( 80.0% ) , followed by submucosal tunneling endoscopic resection ( 8.9% ) , and two cases ( 2.2% ) by endoscopic full - thickness resection .
the complication rate was 14.4% , including micro- and macroperforation ( 5.6%/4.4% , respectively ) and major bleeding ( 2.2% ) .
the recurrence rate was relatively low ( 2.2% ) during the long - term follow - up period ( 46.028.5 months ) despite the low r0 resection rate ( 25.0% ) and did not differ significantly from that of surgically resected gastric gist ( 5.0% ) .
this comparable recurrence rate may be explained by the fact that most of the gastric gists in the endoscopic resection group had smaller sizes and low mitotic index counts ( < 5/high power field , 84.4% ) , which consequently corresponded to very low ( 50.0% ) and low ( 31.1% ) risk .
indeed , if a gist is completely resected without residual tumor in an endoscopic view and is classified as lower risk by histopathological evaluation , the endoscopic procedure may be an alternative choice for optimal treatment of gist in the ugit , even with r1 resection margins .
endoscopic resection of gastric gist is increasingly used for tissue diagnosis and treatment , and is expected to be a substitute for surgical resection in selected cases .
endoscopic resection is a feasible and effective alternative therapeutic modality for lower risk gastric gist with acceptable long - term follow - up results . | endoscopic resection of gastric subepithelial tumors ( sets ) has several advantages over biopsy techniques , such as superior diagnostic yield and definite diagnosis .
removal of gastric sets and histopathologic confirmation should be considered whenever gastric sets are highly suspected to have malignant potential such as gastrointestinal stromal tumor ( gist ) or neuroendocrine tumor . according to our clinical experience
, we suggest that endoscopic resection of gastric sets is feasible for gists less than 3.0 cm without positive endoscopic ultrasonography findings or for hypoechoic sets less than 3.0 cm .
however , serious complications such as macroperforation may occur during endoscopic resection , and this procedure is highly dependent on endoscopists skills .
we recently reported the long - term clinical outcomes of endoscopic resection of gastric gist , which showed a relatively low recurrence rate ( 2.2% ) during long - term follow - up ( 46.028.5 months ) despite the low r0 resection rate ( 25.0% ) .
we suggest that endoscopic surveillance might be possible without additional surgical resection in completely resected gists without residual tumor confirmed to be lower risk , even if they show an r1 resection margin . |
bacterial vaginosis ( bv ) is the most common cause of vaginal discharge in reproductive age women , is present in approximately 29% of women in the united states , and is characterized by vaginal colonization with anaerobic bacterial species along with loss of lactobacilli .
the clinical sequelae of bv are significant a nearly two - fold - increased risk of hiv-1 acquisition [ 3 , 4 ] , preterm delivery [ 5 , 6 ] , and pelvic inflammatory disease ( pid ) and affect millions of women worldwide each year , making bv a significant health problem . treatment with antibiotics has a cure rate of 5080% [ 8 , 9 ] but recurrence within 1 to 3 months is common ( 3052% ) [ 1012 ] .
hydrogen peroxide ( h2o2- ) producing species of vaginal lactobacilli are associated with decreased rates of bv [ 13 , 14 ] , and better reproductive health outcomes [ 15 , 16 ] compared to non - h2o2-producing species .
lactobacillus crispatus is the most common vaginal h2o2-producing lactobacillus species [ 17 , 18 ] .
some hypothesize that the recurrence rate of bv is high because these protective lactobacilli do not recolonize the vagina after antibiotic treatment aimed at eradicating bv - associated anaerobes , and so leave an ecologic void that is quickly refilled by opportunistic organisms . in one study , only 40% of women were recolonized with any h2o2-producing species of lactobacilli 30 days after oral metronidazole treatment and 57% were recolonized 30 days after vaginal clindamycin .
most women are colonized with a single dominant species of lactobacillus , but it is unclear if this is because there is competition between species for the vaginal niche .
a majority of women studied in the us are colonized with lactobacillus iners [ 22 , 23 ] , a fastidious species that does not commonly produce h2o2 and that has been associated with increased risk of abnormal vaginal microbiota in pregnant women .
little is known about the effect of l. iners on a woman 's ability to colonize with beneficial h2o2-producing species .
presence of h2o2-producing lactobacilli [ 14 , 25 , 26 ] , specifically l. crispatus , has been associated with decreased risk of abnormal vaginal microbiota and bv ; thus , recolonization with these species after treatment for bv is likely an important marker of vaginal health .
we undertook this nested cohort study to evaluate the effect of sexual behavior on vaginal recolonization with two hydrogen peroxide producing lactobacillus species , l. crispatus and l. jensenii , one month after treatment for bv .
we conducted an analysis of women diagnosed with and treated for bv while enrolled in an observational cohort study in seattle , wa .
as previously described , participants were recruited through advertisements , media , and community referral , and had to be 16 years old and report having had sex with at least one woman in the previous year , a group with relatively high bv prevalence .
study visits were scheduled every three months for a year , with additional visits for vaginal symptoms and/or 4 weeks after treatment for bv . at each visit
, participants completed a computer - assisted self - interview ( casi ) that collected information about demographics , sexual practices , medical , and reproductive history .
the study was approved by the university of washington institutional review board and all participants provided informed consent at enrollment .
participants underwent pelvic examination with collection of vaginal swabs for saline microscopy , gram stain , and bacterial culture .
a separate foam swab was collected by rolling along the vaginal wall and was then frozen at 80c for use in molecular assays .
women diagnosed with bv by amsel 's clinical criteria were treated with vaginal metronidazole gel , 37.5 mg nightly for 5 nights , and assessed at a followup visit after 4 weeks .
, however , treatment success was defined solely as absence of bv by amsel 's criteria .
we included all participants who were diagnosed with bv during the study and whose followup visits occurred 3 to 8 weeks after treatment .
only the first bv - positive visit was included for participants who were diagnosed with bv more than once .
the study was conducted between october 2003 and december 2006 , but between 3/2/2004 and 12/8/2005 , only women with vaginal ph > 4.5 at the followup visit had samples taken follow - up ( due to limitations in study funding ) . because of this differential assessment and the resulting potential bias , all women whose followup visits fell within this time period were excluded .
participants whose samples did not have enough material to complete all pcr assays were also excluded .
frozen vaginal swabs from the bv - positive visit and a followup visit within 38 weeks were processed as previously described .
all extracted dna was tested in a quantitative pcr assay using primers targeting the human 18s rrna gene to validate that successful dna extraction occurred .
an internal amplification control pcr using exogenous dna from a jellyfish gene was used to test for presence of pcr inhibitors .
vaginal fluid samples were then subjected to taxon - directed 16s rrna gene quantitative pcr assays for the detection and quantification of l. crispatus , l. jensenii , and l. iners [ 30 , 32 ] . each assay has previously been validated and proven sensitive ( to a level of 110 dna copies / reaction ) and specific
( does not detect other bacteria at a concentration of 10 copies / reaction ) .
the assays use a taqman format , and are run on an abi 7500 thermocycler ( applied biosystems , foster city , ca ) or eppendorf mastercycler ep realplex thermal cycler ( eppendorf , westbury , ny ) .
the primary outcome of interest was presence or absence of l. crispatus or l. jensenii after treatment for bv .
in secondary analyses , we assessed the relationship between sexual behaviors and quantities of bacteria , expressed as 16s rdna gene copies / vaginal swab and log transformed .
univariate log binomial regression was used to assess the relationship between presence or absence of either l. crispatus or l. jensenii and ( a ) different behaviors , and ( b ) presence and quantity of l. iners .
univariate linear regression was used to assess the relationship between sexual behaviors and quantity of l. crispatus or l. jensenii in the subset of women who were colonized . given the relatively small number of women
a total of 336 women were enrolled in the observational cohort . of these , 136 ( 40% ) were diagnosed with bv during the study : 96 at enrollment , and 40 at a routine study visit or a nonscheduled visit with symptomatic bv .
eleven women never returned for followup , 58 women had followup visits that fell during the period of exclusion , and 23 did not have adequate sample remaining for all of the assays and were excluded , leaving 44 women available for this analysis .
the 44 women had a mean age of 25 3 years and were primarily white ( 35/44 ; 80% ) .
half of the visits occurred during the proliferative phase of the menstrual cycle , and half in the luteal phase .
the majority of women had only female partners ( 31/44 ; 70% ) , while smaller percentages had male only ( 4/44 ; 9% ) , partners of both genders ( 4/44 ; 9% ) or no sexual partner in the last 3 months ( 5/44 ; 11% ) .
all women had bv by amsel 's criteria , and 98% ( 43/44 ) also had bv by nugent 's score , which was significantly different than women excluded from this substudy , of whom only 85% ( 78/92 ) had bv by nugent 's score ( p = .02 ) .
this was the only characteristic that differed between women in the substudy and those that were excluded .
women in the substudy were as likely to complete antibiotic treatment for bv as women in the larger cohort ( 89% versus 90% ; p = .95 ) . at diagnosis ,
29/44 ( 66% ) women reported having had receptive oral - vaginal contact in the previous 90 days .
slightly more reported digital - vaginal sex ( 82% ) , while fewer reported toy - vaginal sex ( 36% ) during that same time .
only 8 ( 18% ) women reported sexual contact with a male partner in the 3 months prior to bv diagnosis , 7 of whom reported having penile - vaginal sex during that time .
all 44 women were colonized with l. iners at bv diagnosis , while few were colonized with l. crispatus ( 4/44 , 9% ) or l. jensenii ( 1/44 , 2% ) .
nearly all women ( 43/44 ; 98% ) were colonized with l. iners after treatment .
only 12/44 ( 27% ) were colonized with l. crispatus and 12/44 ( 27% ) with l. jensenii . of those ,
six women were colonized with both species , and six each with only one of the two species .
posttreatment , 18 women ( 41% ) still met amsel 's criteria for bv and were considered to have failed treatment , all of whom also had a nugent score 7 . among these women , only 3 ( 16.7% ) were colonized with l. crispatus and 2 ( 11.1% ) with l. jensenii . of the 26 women who achieved cure , a slightly higher percentage ( but still a minority ) were colonized with l. crispatus ( 9/26 ; 35% ) and l. jensenii ( 10/26 ; 38% ) .
presence of l. crispatus at diagnosis or followup trended towards association with cure ( risk ratio 1.41 ; 95% ci .89 , 2.24 ; p = .14 ) , but this was not statistically significant .
women colonized with l. jensenii after treatment had significantly higher rates of treatment success ( rr 1.67 ; 95% ci 1.09 , 2.56 ; p = .02 ) .
of the four women colonized with l. crispatus at bv diagnosis , one achieved cure and had higher concentrations after treatment , while 3 failed treatment , and had lower ( n = 2 ) or undetectable ( n = 1 ) concentrations .
the one woman colonized with l. jensenii at bv diagnosis no longer had detectable colonization after treatment , and also failed treatment ( figure 1 ) . among colonized women ,
mean log10 concentration of l. crispatus after treatment was 6.1 1.9 gene copies / ml and for l. jensenii was 6.0 .7 gene copies / ml . all 44 women were colonized with high quantities of l. iners at the bv diagnosis visit ( mean log10 copies 6.5 .9 ) , and the quantity did not change significantly at the followup visit ( mean log10 copies 6.7 1.1 ; p = .40 ) . between the visit at which bv was diagnosed and treatment provided , and subsequent followup
( median 33 days , iqr 2837 ) , 21/44 women ( 48% ) reported oral - vaginal sex , 26 ( 59% ) digital - vaginal sex , 8 ( 18% ) penile - vaginal sex , and 9 ( 20% ) toy - vaginal sex . among all 44 women ,
no interim sexual behaviors were associated with presence or absence of either l. jensenii or l. crispatus at the followup visit or with treatment failure ( table 1 ) . among women who were colonized with l. jensenii or l. crispatus at the followup visit
, we examined whether behaviors reported in the interim period between treatment and followup at 32 days were associated with quantity of bacteria detected at the followup visit ( table 2 ) . in the subset of 12 women establishing colonization by followup , report of digital - vaginal sex
was significantly associated with 2.6-log10 lower concentrations of l. crispatus ( 95% ci 4.87 , .33 ) .
report of receptive oral sex was associated with 2.2-log10 lower concentrations of l. crispatus ( 95% ci 4.38 , .02 ) .
in this cohort of women reporting sex with women , rates of vaginal colonization with two species of commensal h2o2-producing lactobacilli four weeks after treatment for bacterial vaginosis were low . though colonization was infrequent , women who were able to establish colonization achieved high concentrations of each of these bacteria . for clinicians and affected women , the high rate of bv recurrence after antibiotic treatment is exceedingly frustrating [ 1012 ] .
several groups have evaluated whether adding probiotic compounds containing lactobacilli to treatment improves outcomes , but results have been mixed [ 3336 ] . in a study of healthy women treated with vaginal probiotic capsules containing l. crispatus ,
participants who reported penile - vaginal sex between treatment and followup were less likely to establish colonization with the probiotic strain .
we hypothesized that sexual activity in the month after treatment may inhibit vaginal colonization with beneficial lactobacilli , possibly through reinoculation with bv - associated bacteria from vulvar or rectal reservoirs , which might increase risk for bv recurrence . in the parent study of nearly 350 women from which this nested case control study was derived
, we demonstrated that women cured of bv had higher rates of colonization by l. crispatus after treatment ( 42% ) than women with persistent bv ( 26% ; p = .0003 ) ; data on l. jensenii were not available .
a different study obtained vaginal swabs for culture and found that by 4 weeks after treatment with vaginal metronidazole 59% of women were colonized with hydrogen peroxide producing lactobacilli .
other studies used nugent score to characterize shifts of the vaginal bacteria , and reported that as many as 66% of treated women had at least some lactobacilli at 2130 days after treatment , though h2o2 production was not measured .
our group previously measured posttreatment quantity of l. crispatus in a cohort of pregnant women using pcr and found that only 9/53 ( 17% ) of women had detectable levels 46 weeks after treatment .
few studies have evaluated behavioral predictors of colonization with lactobacilli . in women with bv ,
those who report more sexual partners are less likely to be colonized with h2o2-producing lactobacilli . in our cohort , women colonized with l. crispatus who reported digital - vaginal and/or oral - vaginal sex had lower quantities of this bacterium . although it did not reach statistical significance , we saw a paradoxical opposite trend in the risk related to these behaviors for vaginal colonization with l. crispatus or l. jensenii , suggesting that women with more partners , or reporting more frequent oral - vaginal or digital - vaginal sex , were more likely to be colonized .
one possible explanation is that women colonized by l. crispatus and l. jensenii more likely achieved cure of bv , thus reducing the likelihood of vaginal symptoms that might deter them from engaging in sex .
this observation highlights the difficulty in studying the complex relationships between sexual behaviors and the dynamic nature of vaginal microbiology
temporal associations are difficult to ascertain unless both outcomes are measured frequently ( ideally , daily ) .
the main limitation of this study is the small sample size , which reduced our power to detect potential associations between behaviors and colonization with specific lactobacilli .
a significant number of participants with bv did not have a posttreatment sample , which limited our ability to examine the entire study group .
participants selected for this substudy were similar to the larger cohort except for having higher nugent scores at diagnosis , which may partially explain their high rate of treatment failure .
this cohort is composed primarily of women who have sex exclusively with women , and our results may differ from those obtained in a cohort of primarily heterosexual women . however , this allowed us to study the effect of several different types of sexual behavior on the vaginal microbiota .
the population had well - characterized information about sexual activity during the treatment period , and a very high rate of followup ( 92% ) .
our quantitative pcr analysis allowed detection of small quantities of bacteria and analysis of changes in quantity of bacteria after treatment with respect to sexual behaviors .
vaginal colonization with h2o2-producing lactobacilli 4 weeks after treatment for bv was uncommon , suggesting that there is a window of vulnerability during which women may be more susceptible to reinfection or recurrence . while no sexual behaviors were found to impact presence of colonization , quantity of l. crispatus
this suggests that some species of commensal lactobacilli may be more sensitive to the effect of sexual activity on the vaginal environment . | objective : evaluate predictors of vaginal colonization with lactobacilli after treatment for bacterial vaginosis ( bv ) . methods .
vaginal fluid specimens from women with bv underwent qpcr for lactobacillus crispatus , l. jensenii , and l. iners pre- and posttreatment .
results .
few women with bv were colonized with l. crispatus ( 4/44 , 9% ) or l. jensenii ( 1/44 , 2% ) , though all had l. iners .
one month posttreatment 12/44 ( 27% ) had l. crispatus , 12/44 ( 27% ) l. jensenii , and 43/44 ( 98% ) l. iners .
presence of l. jensenii posttreatment was associated with cure ( risk ratio ( rr ) 1.67 ; 95% ci 1.092.56 ) ; l. crispatus showed a similar trend ( rr 1.41 ; 95% ci 0.892.24 , p = 0.14 ) .
receptive oral sex was associated with 2.2-log10 lower concentration of l. crispatus ( 95% ci 4.38 , .02 ) , and digital - vaginal sex with 2.6-log10 lower concentration ( 95% ci 4.87 , .33 ) . conclusion .
one month after bv treatment , few women established colonization with l. crispatus or l. jensenii .
few behaviors were associated with colonization . |
3 full factorial design was used for the optimization . the levels for the selected independent variables
y = b0 + b1x1 + b2x2 + b12x1x2 + b11x12 + b22 x22 on the basis of the preliminary trials a 3 full factorial design was employed to study the effect of independent variables i.e. drug - to - polymer - to - polymer ( x1 ) and the stirring speed ( x2 ) on dependent variables like particle size , drug entrapment efficiency , the time required for 50% drug release ( t50 ) and drug released up to 5 hr ( y5 ) and 12 hr ( y12 ) .
the expected in vitro release pattern selected for the colonic delivery was not more than 10% of the drug release up to the end of small intestine ( 5 hr ) and more than 85% of drug release up to 12 hrs . in factorial design batches
microspheres thus obtained were recovered from the medium and dried subsequently and stored properly for the further studies .
the concentration of cross linking agent and stirring speed were varied in batches c1 to c9 .
potential variables such as concentration of chitosan solution , polymers to drug ratio ( 2:1 ) and amount of dispersion medium ( 500 ml ) were kept constant . in vitro drug release studies in simulated gastro intestinal fluids showed a burst release pattern in the initial hour necessitating microencapsulation with eudragit s100 by solvent evaporation technique .
the effect of different coat / core ratio on particle size , drug entrapment efficiency and in vitro drug release were studied .
the microspheres of all the batches of the factorial design were spherical and free flowing .
the average particle size of different chitosan microsphere formulations was found to be in the range of 9.93 m- 18.48 m and showed good correlation co - efficient ( 0.9932 ) .
results indicate that the effect of x1 ( stirring speed ) is more significant than x2 ( amount of cross linking agent ) .
when higher level of glutaraldehyde was used cross linking favoured and hence slower drug release was observed compared to the other batches .
the entrapment efficiency of different formulations was found to be between 66.65 to 92.07% and showed good correlation co - efficient ( 0.9293 ) .
the effect of stirring speed on entrapment efficiency showed that optimum speed should be 1000 rpm . in vitro dissolution of all the batches
indicates that the burst release pattern in the initial hour . within 5 hr 70 to 90% of drug
cumulative in vitro drug release of carvedilol from formulations c1 to c9 thus , only biodegradable polymers were not satisfactory for colonic delivery .
the burst release may be due to solubility of chitosan in the acidic ph . in order to prevent the drug release in stomach and small intestine these chitosan microspheres
were encapsulated with eudragit s100 , which shows solubility at a ph 7 . since formulation c4 showed high drug loading and drug release pattern , it is selected for microencapsulation process .
chitosan microspheres ( c4 ) were microencapsulated with eudragit s100 to achieve colonic delivery of carvedilol .
the effect of core - coat ratio on eudragit s100 microencapsulated chitosan microspheres was studied and found that the particle size was increased from 137.87 to 154.33 m with increasing the core - coat ratio from 1:8 to 1:12 .
the entrapment efficiency of microencapsulated formulations varied between 90 - 95% with increasing core - coat ratio .
the in vitro drug release studies of various eudragit coated chitosan microspheres were performed in simulated gastro intestinal fluids .
results showed that 8 - 12% of drug was released within initial 4 hrs and increased thereafter when the formulations were exposed to ph which is above solubility of eudragit s100 .
the best formulation then subjected to in vitro drug release in presence of rat ceacal contents .
a result of release studies indicates that eudragit s100 coating offers a high degree of protection from premature drug release in the stomach and small intestine .
eudragit coated chitosan microspheres deliver most of the drug load in the colon , an environment rich in bacterial enzyme that degrade the chitosan and allow drug release to occur at the desired site after proper transit time .
thus , the designed formulation is potential systems as multiparticulate for the chronotherapy of hypertension . | the purpose of this research was to design , and evaluate multiparticulate systems for chronotherapeutic delivery of beta blocker containing biodegradable polymers coated with ph sensitive polymers in hypertension .
chitosan was used as a carrier for drug delivery and eudragit s100 was used as an enteric coating polymer .
32 full factorial design was employed to optimize the proper formulation for chronotherapeutic drug delivery . |
the concept behind personalized / precision medicine is intuitive : patients are better modeled by a subgroup of patients that are most like them , rather than a larger , more general population of patients .
conceivably relevant biomarkers can be used to define subgroups of patients , and a patient s subgroup affiliation can be incorporated into medical decisions .
biomarkers such as prostate - specific antigen and specific mutations in genes encoding brca1/brca2 ( which increase breast and ovarian cancer risk ) , have been utilized in clinical practice for some time , so the concept of personalized / precision medicine is not a new one . however , the use of genetic testing and molecular diagnostics will almost certainly grow in the coming years . furthermore
, expectations regarding the level of precision for such tools will likely be increased by the perception that big data ( for example , clinical databases , high - throughput experimental datasets , bioinformatic resources ) can be translated into clinically relevant and useful information . if finding a biomarker can be compared to finding a needle in a haystack , then big data promises more needles , but with the challenge of substantively more haystacks .
for example , the high - throughput omics component of big data has demonstrated , across multiple studies , the potential for extreme genomic heterogeneity .
screening for biomarkers as covariates within classic statistical models requires that error rates be controlled in a manner that accounts for test multiplicity .
similarly , classic predictive model building approaches must minimize the potential for over - fitting models .
personalized - medicine - based clustering approaches , wherein patients are clustered into subgroups using statistical clustering heuristics , can not escape this multiplicity issue either .
rather , subgroup approaches , such as patients like me , must instead be considered as patients like me with respect to traits that are relevant to my particular medical decision ( for instance , treatment choice ) . clustering heuristics require the quantification of the distance between patients , where the distance is preferably measured with respect to a clinically relevant set of covariates . however , with data available for so many patient covariates ( for example , clinical , lifestyle , genetic or genomic factors ) , understanding which covariates are truly relevant is a major challenge .
inclusion of clinically irrelevant covariates will increase the variability of distance estimates and reduce the efficiency of clustering heuristics .
both classic statistical modeling and contemporary cluster - based approaches to precision medicine will be optimized if their inputs consist of refined , rather than expansive and diluted , lists of candidate biomarkers .
the refinement of a set of candidate biomarkers can be achieved through many different pipelines .
although all pipelines aim to end with the types of controlled studies that merit approval from , for example , the us food and drug administration , they may originate in different ways , with data - mining hypothesis - generating approaches having become more prevalent in recent years .
there are numerous open and important data analytic research questions associated with all stages of biomarker development .
clearly , the identification of better candidate biomarkers at the beginning of the development pipeline will prove beneficial in the later stages of the process .
here , we discuss a recent comparison study of different methods that generate prioritized lists of candidate biomarkers using data from small , hypothesis - generating studies .
the study by bottomly and colleagues provides recommendations regarding the use of existing tools for the identification of patient / sample aberrant feature values , such as gene expression values in small- to medium - sized ( 10 to 50 samples ) single - arm ( all patients part of the same disease subgroup with no control group ) studies .
the study compared the z score , r score , and both weighted and unweighted variants of the outlying degree ( od ) metric .
each of these metrics measures the extent to which an observation can be considered an aberration ( that is , an outlier ) with respect to the distribution of the balance of the observations .
the z score measures an observation s deviation from the mean in standard deviations , the r score measures an observation s deviation from the median in median absolute deviations , and the ( weighted ) outlying degree is the ( weighted ) sum of the k smallest absolute deviations involving a particular observation ( where k is the od tuning parameter ) .
provided simulation - based evidence suggesting the superiority of the od heuristic over the other heuristics .
their simulation studies suggest the superiority of the od heuristic over the z - score and r - score heuristics and support the practice of setting the od tuning parameter , k , equal to half the sample size . additionally , the authors proposed two specific weighting schemes and presented evidence that suggests that the weighted variants of the od heuristic can provide an improved performance if the hybridization characteristics of a substantial portion of the gene expression assays are profoundly affected in a few samples .
these conclusions were drawn primarily from simulations in which the univariate distribution of simulated expression values was closely approximated by what might be expected for affymetrix mrna expression array data using a robust multi - array average normalization approach .
their simulation design did not model the underlying expression covariance structure ; however , the design was computationally feasible and its parameters ( that is , a normal distribution with a mean of 7 and a variance of 1 , or a t distribution with a non - centrality parameter of 7 and 15 degrees of freedom ) were easily defined and interpretable .
study also included results from the analysis of affymetrix expression data from 12 pediatric acute b - cell lymphoblastic lymphoma patients .
most notably , the application of the od and z - score heuristics to the affymetrix expression scores for a particular sample returned a prioritized list that contained some biologically compelling candidate probe sets .
specifically , the sample was known to have had a single small interfering rna ( sirna ) hit and the prioritized list contained genes that would plausibly be dysregulated by such an event .
these results demonstrate that the heuristics have the potential to deliver prioritized lists that contain at least some promising candidate aberrant expression values .
however , the analysis of both simulated and real data suggests that the false - discovery rates of prioritized lists may be still be large , even within the top portion of the prioritized lists .
are hypothesis generating in nature and their value lies in their ability to provide a prioritized list in which biologically and/or clinically meaningful expression aberrations rise to the top. in order to be a valuable biomarker , a candidate assay must demonstrate properties to discriminate clinically relevant patient subgroups . in studies of the type considered by bottomly et al . , the prioritized lists that are generated have unknown statistical significance and must be interrogated and refined by incorporating information external to the original experimental data . since the statistical significance of the prioritized lists can not be determined using the original data , the ability of the list to provide biologically / clinically relevant aberrant expression patterns can only be assessed in subsequent studies .
for example , members of the prioritized od candidate list could be interrogated for biological importance , their assay values could be validated by other means ( such as quantitative pcr ) , and their behavior within publicly available datasets could be analyzed .
the most promising candidates could be carried forward from these additional analyses and assayed and tested within a properly powered validation study that includes suitable control groups .
biomarker study designs involving large - scale clinical samples ( for instance , sample sizes in the thousands ) are becoming more prevalent .
indeed , such sample sizes may be required to validate and properly model biomarkers of reasonable effect size . on the other hand
, smaller single - arm pilot studies may still contain invaluable information that can motivate the interrogation of other publicly available data sources , as well as guide the design and implementation of future studies .
bottomly and colleagues have provided a useful and timely comparison of methods for extracting such information in the context of a common class of small - sample studies .
| there are still many open questions in data - analytic research pertaining to biomarker development in the era of personalized / precision medicine and big data . among them
is the question of what constitutes best practice for the extraction of prioritized lists of candidate biomarkers from smaller studies that are
hypothesis generating in nature
. a recent comparison of methods to detect patient - specific aberrant expression events in small- to medium - sized ( 10 to 50 samples ) studies provides results that favor the use of outlying degree methods.see related research , http://genomemedicine.com/content/5/11/103 |
long regarded as a uniform group of tumors that differed only as a function of anatomic site , ongoing studies indicate that hnsccs may not be as homogenous as previously supposed .
recognition of distinct molecular genetic profiles now permits finer resolution of hnscc into distinct subtypes that differ with respect to risk factors , pathogenesis , and clinical behavior .
hpv - associated oropharyngeal carcinoma has recently been recognized as a unique subtype of hnscc .
hpv status has a profound effect on patient prognosis , and it may soon guide therapy . accordingly , hpv status will become a standard component in the diagnostic reporting of all oropharyngeal carcinomas . this review covers recent advances toward defining hpv - related oropharyngeal carcinoma , and draws specific attention to pathology concerns that impact on the diagnosis and reporting of these cancers .
hnscc is the eighth most common cancer worldwide with approximately 650,000 new cases reported annually . beginning in the early 1980s
, the incidence of hnscc in the united states and elsewhere has been in retreat .
accordingly , hnscc is often perceived as a preventable disease , and its ultimate demise simply a matter of implementing behavior modification strategies .
this great optimism has recently been shaken by a sobering escalation of a specific type of cancer that is asserting its dominance on the head and neck oncology landscape .
this anomalous rise bucks the prevailing notion that hnscc incident rates can be controlled through smoking prevention and cessation . indeed , the escalation of oropharyngeal carcinoma points to the participation of non - traditional behavioral and environmental factors driving this disturbing epidemiologic trend .
the prototypic patient with oral cancer is an older man who has smoked cigarettes and drank alcohol for many years .
this prototype , however , no longer fits the patient with oral cancer who now enters the doors of our clinics and hospitals .
patients now tend to be younger ( between 40 and 60 years ) white men who have never smoked cigarettes or drank alcohol .
traditional risk factors have been supplanted by other powerful risk factors relating to sexual practices , the most important of these being high number of sexual partners , history of oral - genital sex , and history of oral - anal sex [ 5 , 6 ] .
oral anogenital contact is an important route for the transmission of hpv to the oral cavity .
certain conditions and behaviors that alter antitumor immunity may be important in transforming an hpv oral infection towards hpv - related malignancy .
as one example , marijuana use has recently been identified as an independent risk factor for hpv - positive hnscc , and the strength of this association increases with intensity , duration , and cumulative years of marijuana smoking .
long scrutinized as a potential source of dna - damaging carcinogens , marijuana smoke may be more relevant for its immunomodulatory effects .
binding , in turn , can suppress immune responses , diminish host responses to viral pathogens , and attenuate antitumor activity .
these hpv - positive cancers are increasingly recognized as a distinct subgroup of hnscc with a biological and clinical profile that diverges from that of their hpv - negative counterparts ( table 1 ) . at the molecular genetic level ,
hpv - positive hnsccs express the viral oncoproteins e6 and e7 , overexpress the p16 gene product , and only infrequently harbor p53 gene mutations . regarding clinical behavior ,
the mechanisms underlying this favorable prognosis may involve the combined effects of immune surveillance to viral - specific tumor antigens , an intact apoptotic response to radiation , and the absence of widespread genetic alterations associated with smoking ( i.e. , field cancerization).table 1comparison of hpv - positive and hpv - negative head and neck cancershpv - positivehpv - negativeincidenceincreasingdecreasingageyoungeroldergender3:1 men3:1 menrisk factorssexual behaviortobacco , alcoholcofactorsmarijuana , immunosuppressiondiet , oral hygienemolecular genetics findingsp16 p16 rb rb p53 wild - typep53 mutatedanatomic sitelingual and palatine tonsilsall sitespathologic findings primarybasaloidkeratinized lymph node metastasiscysticsolidsurvivalbetterworse comparison of hpv - positive and hpv - negative head and neck cancers the pathologic features of hpv - positive hnscs also deviate from the moderately differentiated keratinizing morphology that typifies most hnsccs .
hpv - positive hnsccs consistently : ( 1 ) arise from the tonsillar crypts ; ( 2 ) are unassociated with dysplasia of the surface epithelium ; ( 3 ) exhibit lobular growth ; ( 4 ) are permeated by infiltrating lymphocytes ; ( 5 ) lack significant keratinization ; and ( 6 ) demonstrate a prominent basaloid morphology ( fig . 1 ) . two microscopic features of hpv - related oropharyngeal cancers are likely to cause diagnostic ambiguity .
first , hpv - related hnscc is customarily misperceived as a poorly differentiated carcinoma based on the immature appearance of the tumor cells . in point of fact
, the appearance of the tumor cells closely emulates the appearance of the reticulated epithelium the specialized epithelium lining the tonsillar crypts from which hpv - related cancers arise .
in other words , hpv - related oropharyngeal cancers are in fact highly differentiated , not poorly differentiated as so widely assumed .
second , use of the term basaloid as a diagnostic descriptor is confusing for the way it invites an erroneous connection with basaloid squamous cell carcinoma a subtype of hnscc notorious for its aggressive clinical behavior . within the basaloid subtype , detection of hpv
is a highly favorable prognostic factor that helps identify a subset of cancers that departs from the highly aggressive behavior associated with this variant .
until consensus panels put forward a classification scheme for oropharyngeal carcinomas that underscores their relationship with hpv while avoiding confusion with the aggressive basaloid variant , it is our practice to : ( 1 ) classify these tumors as non - keratinizing squamous cell carcinomas , ( 2 ) suspend the use of the descriptors such as poorly differentiated and basaloid , and ( 3 ) routinely report on the hpv status of all hnsccs arising in the oropharynx.fig . 1typical histopathologic appearance of an hpv - related cancer of the head and neck
. a the carcinomas tend to arise from the tonsillar crypts and infiltrate the lymphoid stroma as expanding tumor lobules .
b the lobules of tumor cells are permeated by lymphocytes , lack keratinization , and have a basaloid appearance typical histopathologic appearance of an hpv - related cancer of the head and neck .
a the carcinomas tend to arise from the tonsillar crypts and infiltrate the lymphoid stroma as expanding tumor lobules .
b the lobules of tumor cells are permeated by lymphocytes , lack keratinization , and have a basaloid appearance determination of hpv status will certainly become standard practice in the pathologic evaluation of oropharyngeal cancers . as a biomarker , hpv detection is emerging as a valid method of discerning the presence and progress of disease encompassing all aspects of patient care from early cancer detection , to tumor localization ( fig .
2 ) , to selection of patients most likely to benefit from specific therapies , to post - treatment tumor surveillance .
a variety of detection methods are in current use including pcr - based strategies , type - specific in situ hybridization ( ish ) techniques , and immunohistochemical detection of surrogate biomarkers ( e.g. p16 protein ) .
standardization of hpv detection in the clinical arena must begin with selection of the best detection platform for universal application.fig .
the presence of hpv as evident by p16 immunohistochemical staining ( b ) and hpv-16 in situ hybridization ( hybridization dots within tumor cell nuclei , inset ) point to the oropharynx as the site of tumor origin metastatic squamous cell carcinoma of unknown primary origin .
the presence of hpv as evident by p16 immunohistochemical staining ( b ) and hpv-16 in situ hybridization ( hybridization dots within tumor cell nuclei , inset ) point to the oropharynx as the site of tumor origin the preferential use of ish methods over pcr - based methods is supported both by biological and practical considerations .
the reported large variation of hpv prevalence in hnscc is a largely a reflection of the inability of non - quantitative pcr methods to discern virus that is biologically meaningful from virus that is biologically irrelevant .
in contrast , punctuate hybridization signals within the nuclei of tumor cells is a pattern of staining only seen following hpv dna integration into the host genome , and thus is more closely linked with relevant viral infections .
importantly , the improved specificity of hpv detection by ish does not come at the expense of sensitivity .
the introduction of various signal amplification steps has significantly improved the sensitivity of this technique , even to the point of viral detection down to one viral copy per cell .
the development of nonfluorescent chromogens now allows visualization of dna hybridization using conventional light microscope .
adaptation of ish to formalin - fixed and paraffin - embedded tissues has made this technique compatible with standard tissue - processing procedures and amendable to retrospective analysis of archival tissue blocks while most pcr - based methods are optimized to fresh frozen samples .
ish is a feasible and cost - effective test for most diagnostic laboratories that routinely process formalin - fixed and paraffin - embedded tissue blocks . in hpv - positive oropharyngeal carcinomas , functional inactivation of rb by the viral oncoprotein
e7 is known to induce an up regulation of p16 expression , reaching levels that can be readily detected by routine immunohistochemistry .
accordingly , p16 immunohistochemistry is often advocated as a reliable surrogate marker of hpv - induced neoplasia of oropharynx .
direct comparison of p16 immunohistochemical staining and hpv-16 ish for large numbers of hnsccs reveals a discrepancy rate of about 25% . in a subset of discrepant cases , high p16 expression is due to the presence of some other ( non-16 ) hpv type as confirmed by wide spectrum ish .
the remaining discrepancies likely reflect the imperfection of p16 as a surrogate marker . using e6/e7 mrna levels as conclusive evidence of hpv involvement
. the limitations of any single detection assay may be offset using algorithms that combine the strengths of complementary assays .
given a sensitivity that approaches 100% , p16 immunostaining is a good first line assay for eliminating hpv - negative cases from additional analysis .
ish can be run concurrently with p16 immunostaining or as a second - line assay following a positive p16 result . given a specificity approaching 100% ,
a positive hpv-16 ish reduces the numbers of false positive cases by p16 staining alone .
a p16-positive / hpv-16-negative result singles out a subset of tumors that qualify for rigorous analysis for other ( i.e. non-16 ) oncogenic hpv types . for this third - line assay ,
we use a consensus ish probe that that detects an extended panel of hpv types .
p16 immunohistochemistry and hpv ish are standardized techniques that are easily applied to formalin - fixed and paraffin - embedded tissues . as automated ish technologies
are brought on - line , turnaround time will be further shortened and standardization across various diagnostic laboratories will be enhanced .
the escalating incidence of oropharyngeal carcinoma in the absence of a parallel rise in smoking and alcohol consumption suggests that nontraditional behavioral and environmental factors are driving this aberration .
hpv , particularly type 16 , has been established as a causative agent in up to 70% of oropharyngeal cancers .
these hpv - positive hnsccs differ in important respects from hpv - negative hnscc including risk factors , molecular genetic alterations , microscopic appearance , and clinical behavior .
diagnostic pathologists are now faced with the challenge of accurately discerning hpv status of oropharyngeal cancers . | the longstanding notion that head and neck squamous cell carcinoma ( hnscc ) is a uniform disease process is changing .
divergence in epidemiologic trends among hnsccs arising in different anatomic subsites has introduced a view that hnscc is a heterogeneous group .
analysis of molecular genetic changes discloses not just individual tumor differences , but also consistent large - scale differences that permit the recognition of important tumor subtypes .
one recently recognized subtype is the human papillomavirus ( hpv)-positive oropharyngeal carcinoma .
hpv - positive oropharyngeal cancer now dominates the head and neck oncology landscape , and its escalating incidence is impacting on diagnostic , preventive and therapeutic practices . |
x - ray crystallographic studies on multisubunit rna polymerases ( rnaps ) from eukaryotes , bacteria and archaea have revealed highly related enzymes with structurally conserved active sites . for eukaryotic and bacterial enzymes , crystal structures of transcribing complexes have been solved , showing the locations of the dna template , the nascent rna product and the substrate - binding site .
structural studies have their limitations , however , which makes a comprehensive functional screen of amino - acid substitutions in domains critical for polymerase action published in journal of biology especially useful . the results of the study by robert weinzierl 's group ( tan et al .
) are in keeping with previous structural work and will be a valuable resource for interpreting future structural , single molecule and molecular modeling experiments .
initial structural studies on the prokaryotic and eukaryotic enzymes identified a conserved alpha - helical domain , termed the bridge helix , that spans between two main lobes of the enzyme ( for a useful bibliography of the structural literature on rna polymerase , see tan et al . ) .
further studies revealed interactions of this helix with the dna template , distorting its path adjacent to the nucleotide - addition site . moreover , the bridge helix appeared in two separate conformations '
straight ' in a eukaryotic rnap structure and ' kinked ' in a bacterial rnap structure raising the possibility that the conformational dynamics of the bridge might directly control enzyme translocation : that is , bending of the bridge helix might accompany movement of the polymerase along the dna template . lately
, attention has turned from the bridge helix to an adjacent domain of the enzyme , the trigger loop ( figure 1 ) .
this loop is mobile or unstructured in many rnap crystal structures and appears conformationally flexible . in recent structures of transcribing complexes
, the trigger loop has been seen to interact directly with template - specified nucleotide substrates , suggesting critical roles in catalysis and substrate selection .
indeed , mutations in trigger - loop residues alter elongation rate , transcriptional pausing , response to regulators , substrate selection and transcriptional fidelity .
the loop makes extensive contacts with the bridge helix , also raising the possibility that the concerted actions of these two domains may underlie key rnap dynamics during the nucleotide - addition cycle .
rna polymerase ii elongation complex showing positions of bridge helix ( bh ) and trigger loop ( tl ) .
( a ) cartoon representation of 10-subunit pol ii elongation complex ( pdb : 2e2h ) with protein shown in charcoal gray , template dna in blue , rna product in red , and non - template dna in green . buried within , near the active site , are the tl ( cyan ) and bh ( magenta ) .
( b ) transparent view of ( a ) showing the position of the bh and tl relative to the nucleic acid scaffold within pol ii . ( c ) rotated view of ( b ) showing the position of the bh and tl relative to the 3 ' end of the rna product ( the site of transcript elongation , shown by an arrow ) .
structural studies have important limitations in regard to understanding the transcription mechanism at the molecular level .
first , transcribing complexes designed for crystallographic studies are unavoidably compromised by alterations made to prevent phosphodiester bond formation . in some structural studies of eukaryotic rnaps , as with those of numerous dna polymerases , putative reaction intermediates contain 3'-deoxynucleotide - terminated nucleic acid primers to prevent chain elongation . in other eukaryotic rnap structures , and in a structure of a bacterial rnap transcribing complex
, non - hydrolyzable substrates were used to prevent phosphodiester bond formation . in either case
a second limitation of crystal structures is that they only provide snapshots of stable conformations , failing to fully reveal the dynamics involved in catalysis of phosphodiester bond formation and translocation of rnap along the template .
current structures of transcribing rnaps have not attained atomic resolution , placing the reaction mechanism out of reach . indeed , as modeled , eukaryotic rnap and bacterial elongation complexes containing bound substrates differ in putatively critical interactions between trigger loop and nucleotide that could have profound consequences for the rnap catalytic mechanism . in light of these shortcomings , biochemical studies such as those of tan
the current study by tan et al . uses a highly automated , high - throughput approach for the production and characterization of rnap variants developed previously by weinzierl and colleagues .
their approach takes advantage of a completely recombinant system for production of the rnap from the archaeon methanocaldococcus jannaschii . this recombinant archaeal polymerase is composed of nine subunits , a ' , a " , b ' , b " , d , h , l , n and p ( the other three subunits of the native enzyme showed no detectable effect on function in vitro and were therefore omitted ) .
recombinant rnaps may be expressed , purified , assembled and characterized in batches of 96 rnap variants over 12 days , making large - scale analysis of systematically designed rnap substitution mutants feasible .
in addition , the approach is highly automated and can probably be implemented for the study of any number of enzymatic systems , thus making it a generally useful technology for protein - engineering studies . in the ' rna polymerase factory ' ,
all amino - acid substitutions at a number of positions can be evaluated in parallel , giving an essentially unbiased approach to structure - function analysis that is not necessarily based on pre - existing structural information or limited by numbers of mutants that can be evaluated .
such high - throughput evaluation does not have to rely on in vivo genetic identification of variants , which can be limited by methods of mutagenesis that are able to generate only subsets of all possible substitutions , or by traditional site - directed mutagenesis approaches that rely on prior rationales for the design of variants .
in previous proof - of - principle work , weinzierl and colleagues applied their automated analysis to all 19 amino - acid substitution variants for m. jannaschii rnap subunit a ' ( mja ' ) residue g825 , within the bridge helix domain . in their current study , they extend this analysis to an astonishing 323 variants within the bridge helix , comprising all 19 single amino - acid substitutions within a 17 amino - acid stretch of the helix .
the authors also characterize an additional 38 substitutions , encompassing all 19 single amino - acid substitutions of trigger - loop residues mja " g72 and mja " i98 . in regard to elucidating the interactions between bridge helix and trigger loop , it is fascinating that the authors identify a large number of super - activating substitutions within the bridge helix as well as some within the trigger loop .
it was already known that certain trigger - loop substitutions in bacterial rnap and yeast rna polymerase ii ( pol ii ) allow the enzymes to transcribe more quickly than wild - type variants . in the study by tan et al .
gain - of - function substitutions are present within the region observed to bend in crystal structures and along one side of the helix facing the trigger loop .
double - substitution mutants containing gain - of - function substitutions in both bridge helix and trigger loop have no greater gain of activity than the most severe single substitution , suggesting that the two domains function together to promote transcription .
as mentioned above , the bridge helix can be observed in a number of conformations in crystal structures , with a kink or a bend in various positions ( figure 2 ) . in structures of thermus thermophilus ( tth )
movement of the trigger loop towards the bridge helix in a saccharomyces cerevisiae rnap also appears to perturb the helix by altering its path in the direction of the observed kink , although only to a small extent . in each case , the bend is in the same direction
away from the trigger loop . a kinked bridge helix has not yet been observed in a structure of the tth rnap elongation complex , raising the possibility that an extreme bridge helix kink may not necessarily function in transcription elongation .
the relative flexibility of the bridge helix , perhaps not unexpected for such an isolated helix , is underscored by the results of tan et al .
, who show that the bridge helix can be somewhat tolerant to helix - breaking prolyl substitutions along its length , including one substitution at the position of the observed helix kink ( mja ' s824p ) that super - activates rnap . furthermore , kinked bridge helix structures reveal an interaction between two residues of the helix ( analogs of mja ' residues 823 and 829 ) that may stabilize the kinked conformation .
substitutions at either of these putatively kink - stabilizing positions compromise rnap activity to various extents .
notably , re - establishment of a possible interaction between the two substituted positions results in a moderate restoration of activity , consistent with an on - pathway role for the observed interaction .
these results suggest that the kinked bridge helix promotes rnap activity , but whether in catalysis or translocation remains to be determined .
conformations of the bridge helix ( bh ) observed in crystal structures of multisubunit rnaps . ( a ) kinked orientation of the bh in some tth rnap crystal structures .
bh from tth holoenzyme without nucleic acids in the presence of streptolydigin [ pdb:1zyr ] ( yellow ) .
( b ) straight orientation of the bh in tth elongation complex structures with or without nucleoside triphosphate ( ntp ) substrate .
bh from the tth transcribing complex without ntp substrate ( the trigger loop ( tl ) in this structure is in the ' out ' position away from the substrate - addition site ) [ pdb:2o5i ] ( orange ) .
bh from tth elongation complex with ntp substrate ( the tl is folded ' in ' and contacting the ntp substrate in this structure ) [ pdb : id 2o5j ] ( lime green ) .
( c ) mild perturbation of the pol ii bh in elongation complex with matched ntp substrate in position for addition .
bh from s. cerevisiae ( sce ) pol ii elongation complex without substrate , pdb 1i6h ( magenta ) .
bh from the sce pol ii elongation complex with mismatched substrate ( the tl is in the ' out ' position away from substrate - addition site in this structure ) [ pdb:1r9 t ] ( teal ) .
bh from the sce pol ii elongation complex with matched substrate ( the tl is folded ' in ' and contacting the ntp substrate in this structure ) [ pdb:2e2h ] ( blue ) .
the rna polymerase factory has proved its usefulness for the characterization of a large number of rnap variants .
the next stage of this approach is likely to include comprehensive analysis of trigger - loop residues and active - site residues predicted to contact nucleotide substrates . a subset of the mutants identified by tan et al . should be characterized with more traditional assays that are able to directly measure rnap elongation rate , substrate selection and propensity for pausing .
information on such a wide spectrum of mutants will benefit single - molecule studies in which rnap variants with specific defects can be used to probe models of the transcription mechanism . in addition ,
molecular modeling studies that aim to accurately describe and elucidate the rnap mechanism can be tested for recapitulation of phenotypes demonstrated for a wide range of rnap variants , such as those described by tan et al . finally , biophysical studies able to directly probe and characterize rnap active - site dynamics , such as bridge helix and trigger loop movement , and how such movement is impacted by substrate binding and perturbation of rnap structure are likely to be important for understanding of the rnap mechanism at the near - atomic level .
an eventual complete elucidation of the rnap mechanism , specifically , the identification of the entire retinue of rnap amino acids required for catalysis and translocation , will be a first step for understanding the regulation of rnap activity in vivo .
we acknowledge funding from the nih to rdk ( gm36659 and gm49985 ) . due to journal policy
, we have only sparingly referenced the literature and apologize to those whose work we were unable to specifically reference . | a comprehensive survey of single amino - acid substitution mutations critical for rna polymerase function published in journal of biology supports a proposed mechanism for polymerase action in which movement of the polymerase ' bridge helix ' promotes transcriptional activity in cooperation with a critical substrate - interaction domain , the ' trigger loop ' . |
regression models are developed using statistical techniques to measure the response of outcomes of interest to predictor variables . in general ,
model development begins by employing a combination of literature search and expert panel knowledge to select factors believed to influence outcome variables of interest such as cost , complications , readmissions , or mortality .
once selected , candidate predictor variables must be further specified so that they can be identified within available data sources .
thus , a decision to test the effect of chronic obstructive pulmonary disease ( copd ) on patient cost first requires the creation of a variable to identify patients with copd .
the creation of the candidate predictor variables is a design decision affecting all subsequent results and may vary by developer . for example , developers must decide which international classification of diseases , tenth revision , codes constitute copd , the sites of service from which reported data are utilized to identify copd ( eg , inpatient data only or both inpatient and outpatient data ) and the time frame of the reported data used to identify copd ( eg , inpatient data only or inpatient data and data preceding the inpatient admission ) . after making these design decisions , the candidate predictor variables are tested within the framework of the statistical model .
the statistical framework is another design decision and can vary by both developer and the outcome being measured . for example , the hierarchical condition category ( hcc ) capitation risk - adjustment model is built from a multiple linear regression that treats the relationship between observed enrollee costs and the predictor variables as primarily additive ( pope et al . , 2004 ) .
thus , with a few exceptions , the presence of a predictor variable adds a fixed amount to the prediction of enrollee cost .
by contrast , the regression model developed for the hospital readmission reduction program ( hrrp ) is based upon the logistic ( odds ratio ) variant of the hierarchical generalized linear model , which is primarily multiplicative ( yale new haven health services corporation / center for outcomes research & evaluation , 2014 ) .
thus , the presence of a predictor variable increases the predicted risk of readmission by a fixed percentage .
the percentage increase is multiplicative to all other predictor variables , resulting in a compounding effect .
these design decisions are often made after testing the regression model to see which regression model offers superior fit ( better prediction of the outcome ) .
there is however a tendency for outcomes that are binary ( yes / no ) to be fitted with logistic regression models because of the possibility that standard regression models might predict an outcome with likelihood greater than 1 or less than 0 ( asymptotically constrained ) . because probabilities outside the range 0,1 are not meaningful , regression models for binary variables are first constrained within the probability range before optimizing data fit . after specifying variables of interest and the statistical framework ,
the developer must specify other requirements , such as whether there will be any patient - level exclusions , service carve - outs , outlier trims or caps , etc .
this entails using a development dataset complete with subsequent testing on a calibration , or validation dataset .
resulting coefficients and the overall fit of the model are subsequently reviewed for statistical significance . in summary ,
regression models hypothesize variables that will predict an outcome , define how those variables are to be constructed , specify a statistical framework within which the predictor variables interact , compute fixed coefficient values for each predictor variable , and test whether there is sufficient association between each predictor variable and outcome for it to be retained within the regression model .
the final model provides a formula from which the likelihood or magnitude of an outcome variable can be estimated given the presence of selected predictor variables ( risk factors ) .
once developed , the regression formula can be used to predict the outcome in other databases , following the same approaches in terms of patient exclusions , service carve - outs , and outliers .
as with regression models , clinical categorical models utilize predictor variables to estimate the value of an outcome . the process used in the development of a clinical categorical model is an iterative process of formulating clinical hypotheses regarding the relationship between the outcome of interest and predictor variables and then testing the hypotheses with historical data .
the historical data are used to confirm or refine the clinical hypotheses identified by clinicians . when there are discrepancies between clinical expectations and the data results from the historical data , the clinical expectations are refined to form the basis of the clinical categorical model .
typically , a clinical categorical model will be expressed as an exhaustive and mutually exclusive set of categories defined on the basis of the predictor variables with each category having a distinct predicted value of the outcome .
the prediction of the outcome is based on the clinical category assigned and is typically computed as the average value of outcome for all patients assigned to the category .
the most prominent example of a categorical model is diagnosis - related groups ( drgs ) . unlike regression models ,
categorical models require expert clinical opinion to hypothesize the likely effects ( eg , large steps in cost or the presence of attenuating circumstances ) of the predictor variables interaction with each other and the outcome of interest .
how predictor variables interact is generally hypothesized to vary across health conditions ; hence , a categorical model is hierarchically structured with layers of rules governing interactions among predictor variables .
the hcc regression model contains 111 distinct condition categories to predict enrollee cost within the medicare advantage risk - adjustment algorithm .
each variable carries with it a coefficient that can be added so as to predict enrollee cost .
a categorical model developed using the same number of condition categories needs to account for 2 possible interactions among these variables within its rules . to place a limit upon the number of rules employed by the categorical model ,
for example , medicare severity ( ms)-drgs are currently restricted to 749 payable ms - drgs . within these 749 categories ,
the impact of a particular predictor variable is neither assumed equal to its impact in another ms - drg nor assumed to have a uniform impact when combined with other predictor variables within the ms - drg . instead , the combined impact from risk factors for cases within same drg cells is hypothesized to have a similar impact upon the outcome variable . by allowing more cells
, the categorical model allows a greater range of different interactions to be recognized . at the other end of the spectrum from using 749 drgs to describe risk factor interaction for the medicare inpatient prospective payment system ( ipps ) , the diagnosis treatment combinations used for payment in holland have 29 000 distinct categories ( fleur , 2011 ) .
although there is no magic number determining the number of cells that a categorical model should contain , the final model needs to be understandable to health professionals affected by the model .
in addition , the final model needs to have sufficient volume distributed within cells so that the developers can assess the stability of the hypothesized relationships ( without overfitting ) . in summary ,
categorical models hypothesize variables that will predict outcomes , define how those variables are to be constructed , specify a clinical model with extensive rules that determine how the variables interact , and utilize data to test the clinical model at each stage as part of a process to confirm or revise the clinical rules .
an in - depth description of the process of forming clinical categorical models can be found in the original article describing the formation of the drgs ( thompson et al .
the end result is a clinical model that can be applied to many different population datasets from which weights or rates can be separately calculated . for the clinical model to be broadly applicable to different populations , it is essential that the dataset used for testing include a full cross - section of the population , including less common but serious conditions .
users work from the same model , but are free to calculate weights or rates differently in terms of exclusions , carve - outs , outliers , etc . unlike the coefficients in a regression model , the weights and rates used in a clinical model are independent of the underlying clinical model , allowing a uniform and stable clinical model to be maintained .
for example , different payers , ( eg , medicare and medicaid ) can use different prices in payment applications of drgs while calculating payment using the same drgs . in terms of similarities and differences ,
both models start by identifying variables of interest and operationalizing the definition of these variables from an available data source .
the regression model specifies a statistical framework within which the variables interact , and computes a mathematical formula with coefficient values for the predictor variables , which are held constant across the model .
the coefficients of the model are specific to a population dataset used to develop the regression formula . in contrast , the categorical model develops a clinical model with an extensive set of rules that specify the predictor variables and their varying interactions with each other and the outcome of interest .
the final model is a clinical model that is separate from and can be applied to many different population datasets , from which weights and rates can then be calculated .
in practice , the decision to enforce the uniformity of effect on an outcome within a category ( categorical ) or to enforce uniformity of an effect by a variable across all interactions ( regression ) leads to significant differences in the measurement of risk factors .
a general statement can be made that , in regression models , if the level of risk when 2 factors are present is greater than the sum of their individual risk then the calculated coefficients for individual risk factors will be overstated .
conversely , if the level of risk when the 2 factors are present is less than the sum of their individual risk , then the individual coefficients will be understated .
a simplification of this difference is shown in table 1 . in table 1 , we hypothesize 2 risk factors a and b that influence cost . in isolation ,
risk factor a is observed to increase cost by $ 100 and risk factor b by $ 300 . when found together ,
cost is observed to increase by $ 1000 because of the interaction of the 2 variables . in the example
we restrict the categorical model to 2 cells ( high and low ) and the regression to single terms only ( no interactions ) .
furthermore , we assume that there are equal amounts of cases with risk factors a , b , and a / b . in this example
, we assume the developers would be sufficiently proficient to structure the categorical model so as to keep the lower cost cases a and b ( low ) together , whereas the higher cost cases a / b ( high ) would form its own cell .
the regression model will calculate coefficients for a ( $ 300 ) and b ( $ 500 ) , with the results summed to provide an estimate for cases with both a and b ( $ 800 ) .
if it were this simple , a very accurate solution could easily be implemented . in the categorical model
, a third cell could be added , and it would not be necessary to average the difference between just a and just b. in the regression model , an interactive term could be added to produce a distinct coefficient for cases that have both risk factors .
in actuality , outcomes of interest are a lot more complex and difficult to predict , and it is not a matter of simply adding additional interaction terms or categorical cells until prediction power is added .
there are many reasons why developers restrict the number of terms or cells in a risk - adjustment model .
first , by including a wider array of complex variables to capture interactions , one runs the risk of introducing more instability in the measured relationships between variables and predicted outcomes .
this can be the result of underpowered cells ( too few individuals with the matching array of conditions upon which to base a firm conclusion ) , colinearity across predictor variables ( interaction effects between the predictors ) , clustering effects ( with fewer observations exhibiting the characteristics of interest , there is a higher likelihood that they come from a single source , ie , hospital or region , thus embedding the performance of the source within the estimate of the effect ) , or simply random variation .
second and related to the first reason , it is important to not overfit a risk - adjustment model to the development database .
it is key that predictor variables have a clear clinical rationale and will hold up across datasets and over time ( though periodically all models need to be reviewed and updated ) . to be successful
, the model needs to capture the essential predictors , not omit any key predictors ( omitted variable bias may give a false sense of precision to the coefficient or category estimates ) , and not include overlapping or redundant variables ( which would allow for double - counting of risk variables and make the model very vulnerable to variations in coding and code creep ) .
a third reason for restricting the number of predictor variables is that risk - adjustment models often need to avoid adjusting for unwanted and/or unnecessary variation .
for example , increases in cost can be explained by the unnecessary use of expensive resources or complications from treatment .
it is therefore reasonable to exclude those conditions that are predictive of cost but signal low - quality care from a risk - adjustment algorithm used for payment .
simply stated , a model that buries harm or poor performance within the algorithm , although it might improve explanatory power , provides no foundation for improvement .
fourth , overly large unwieldy models with large numbers of interaction terms or multiple small volume cells confuse interpretation .
overall , those seeking to understand and redress cost and quality failings require objective , transparent , and understandable comparative information to move forward . developers therefore attempt to deliver parsimonious models to achieve the optimal tradeoff between maximizing predictive accuracy ( consistent with policy objectives ) and using the fewest predictors .
the streamlining of models is not merely about the number of categories or variables but also the degree to which clinically meaningful distinctions can be drawn across them .
this is particularly true of categorical - clinical models as they are inherently conceived as management tools , but is likewise important for the integrity of regression models .
in simpler situations where there are fewer interacting variables , regression and categorical models can yield similar results .
that is , they can be used to predict similar amounts or rates of an outcome using the same predictor variables .
this is not necessarily the case when interactions become more complex and the measurement of predictive accuracy also becomes more complex . in addressing regression and categorical risk - adjustment models , it is important to understand risk and carefully evaluate predictive accuracy but it is also very important to evaluate a number of other attributes for system use and policy .
table 2 provides a comparison of design characteristics that should be considered and in the context of the 5 objectives of risk adjustment .
table 2 begins by considering how differences in the method of model development affect the presentation of the model to users .
a byproduct of creating a rule - based classification algorithm is that the rules used to classify patients and enrollees are available for review .
moreover , hierarchical classification results in discrete categories of patients ( or enrollees ) within understandable disease groupings .
this differs from regression models that permit a review of risk factor coefficients but only limited insight into why the interaction of patient risk factors manifests in a particular outcome .
independent review of payment and performance measures is important for credibility , but transparency has an even greater role in letting clinicians know how their relative performance impacts both patient outcome and their own finances and areas in need of improvement .
update , response to change , and accommodating policy variation ( carve - outs ) highlight how differences in the structure of the models affect their stability .
categorical clinical models are more robust in these circumstances as , after the initial extensive development , they are designed to tolerate changes within subsections of the model . as described previously , regression models are built with the requirement that risk factors have a common effect across all patient and disease subtypes , hence they require re - estimation and often respecification of the model in the face of change .
regression models , such as hccs , are not fully defined without the use of some categorical rules .
variables from the same family or those related by hierarchical severity require definition to avoid
double counting and a subsequent unwanted mix of paying for coding and misestimation of their effect size .
moreover , the creation of the model usually identifies some interactions across variables that warrant an additional adjustment requiring definition .
the issues of transparency , communication , and stability can be understood using the hrrp risk - adjustment model as an example .
the centers for medicare and medicaid services ( cms ) segments performance measurement within the hrrp by admission type so that congestive heart failure ( chf ) is modeled separately from pneumonia and acute myocardial infarction ( ami ) .
individual risk factor coefficients are permitted to vary across the models , thereby giving dissimilar signals , depending upon the admission type while holding the effect constant across all interactions within the model .
for example , the presence of asthma or history of coronary artery bypass grafting is associated with reduced readmission risk for pneumonia admissions , whereas history of coronary artery bypass grafting is associated with increased readmission risk for ami admissions and decreased risk for chf admissions .
the presence of asthma is associated with increased readmission risk for ami and chf admissions but not for all time periods .
the variation in coefficient values across models indicates potential problems for a regression model that unifies readmission risk across admission types without first understanding or adjusting for the source of variation .
stability of results over time , and thereby ability of users to identify important risk profiles , also requires interpretation .
for example , dementia is associated with an increased readmission risk for ami admissions in 1 year , decreased risk in the subsequent year , and little or no effect in a third .
a similar pattern is produced by the effect of being male upon hf admissions ( yale new haven health services corporation / center for outcomes research & evaluation , 2014 ) . a question posed by reviewing
the hrrp model is how clinicians can use the risk - adjustment model to routinely identify those patients who are at the highest risk of readmission and are suffering from systematic failures .
another arguably more important question is whether or not these findings are clinically logical or more likely an artifact of data patterns that were somewhat random , particular to a database , or resulting from how the regression model was specified .
in the introduction to this article , we described 5 attributes of a risk - adjustment model upon which it should be compared and evaluated . the first 2 attributes , matching payment to patient risk and avoiding incentives to select less complex patients , are amenable to statistical measurement but require an understanding of their interrelatedness .
evaluating the accuracy of a model in matching payment to cost , or risk to likelihood of an outcome , has a tendency to rely upon an r comparison of global fit .
although this may work with comparing overall historical patterns , it is essential to compare how well the model fits for subsections of a population such as those with a particular chronic condition , of a particular location , with particular challenges or other identifiable risk factor
. it should be assumed that those paid to take on risk will look for ways to minimize their risk relative to their payment and will adopt strategies to do so , making this more complex analysis more important than the overall measure of global fit usually utilized to compare models .
regression models require more detailed and complex interaction terms to account for instances where patients / enrollees have either greater or lesser risk in the presence of an additional risk factor than would be predicted by simply adding the risk of the separate variables .
not doing so can lead to the transfer of allowance for risk across high- and low - risk case types for a given predictor variable .
categorical models are reliant upon the rules derived to classify patients / enrollees and therefore can benefit from very detailed clinical review . classifying patients / enrollees within discrete cells
will generally average the risk of some higher and lower risk patient types . put differently ,
categorical models tend to transfer allowance for risk within high- or low - risk case types .
two models may appear equivalent in their ability to discriminate between outcome predictions at an aggregate level , yet conceal a bias against particular providers because of the clustering of high - risk cases in particular providers or conversely by classifying distinct patient types of varying risk within single cells .
the attributes of communication , transparency , and stability are harder to quantify but easier to compare .
categorical models are designed to promote comparison , enable review of the rules that are generated to differentiate risk and to be modified in the face of expert commentary and insight .
categorical models separate the weighting of an outcome variable ( such as cost ) from the definition of patient complexity .
the job of the model is to develop clinical rules to bring together similar patients / enrollees within a single consistent classification whereas the weight linking the model to risk adjustment ( or payment ) is computed and updated with changes in data and/or changes with regard to inclusions / exclusions , outlier policies , and other adjustment factors . as noted by the cms the separation of the methodologies for developing the clinical model and the payment weights was a critical factor in the success and widespread adoption of the drg system .
the separation of the clinical and payment weight methodologies allows stable clinical methodology to be maintained while the payment weights evolve in response to changing practice patterns .
but the separation of payment and classification introduced with the ipps not only set a reasonable price for a known product
( schweiker , 1982 ) but also created a language to link the clinical and financial aspects of care , thereby improving communication between administrators and clinicians .
thus , a clinical categorical model can remain relatively stable , providing a consistent and powerful communication tool , whereas weights fluctuate to reflect changing practice patterns and new technology . the same model by being structured to define differences in patients / enrollees can be employed over varying geographic areas , over time and for a variety of outcomes without being dependent upon the initial data used in its development .
although clinical categorical models have many advantages in terms of communication , transparency , and stability , their initial development requires a significant effort and clinical input .
regression models usually require less initial development effort but are unstable in a changing environment and fail to provide the same degree of communication value and transparency . | clinical risk - adjustment , the ability to standardize the comparison of individuals with different health needs , is based upon 2 main alternative approaches : regression models and clinical categorical models . in this article , we examine the impact of the differences in the way these models are constructed on end user applications . |
fat tissue is a source of many significant cytokines , such as leptin , adiponectin , and resistin , affecting metabolism , energetic balance , and modifying peripheral insulin sensitivity of tissues , as well as carbohydrate metabolism .
cytokine with mostly multipotential performance is leptin , encoded by the so - called obesity gene ob , which affects body mass regulation through hypothalamus influence on appetite and energy expenditure .
it is involved in many significant life processes like metabolism , hematopoiesis , and angiogenesis and in pubescence and reproductiveness [ 1 , 2 ] .
in vitro studies
had demonstrated that leptin stimulates human bones stem cells for differentiation into osteoblasts , increases the mineralization of bone tissue , and inhibits osteoclast genesis .
research in vivo have shown that the deficiency of leptin in ob / ob mice or db / db mice leads to an increase in bone mineral density .
it is commonly known that the final effect of leptin 's action is the result of its peripheral positive and central negative performance and depends on its concentration in serum .
both peripheral and central effects can timely equilibrate . in cases of obesity with hyperleptinemia and central insensitivity for leptin , dominant
is the beneficial peripheral effect , which consequently leads to higher bone mineral density among patients [ 36 ] .
one of the important factors regulating leptin 's concentration is its soluble ob - rb receptor , functioning as leptin - binding protein .
genetic screening of leptin receptor gene polymorphism is not influenced by leptin concentration changes ( for example , after meal consumption ) [ 3 , 4 ] .
few leptin receptor ( lepr ) genes polymorphism were identified , among them q223r ( gln223arg ) ,
gln223arg polymorphism is characterized by adenine on guanine substitution in 668 position of the 6th exon , which is followed by transmembrane permeability and the modification of functions .
relation between carrier state of gln223 ( a ) allele versus high leptin concentration in blood serum and body mass index ( bmi ) ; bone mass , bone mineral , and fat tissue content were described [ 2 , 3 , 79 ] . in children after completed anticancer treatment , there is a possibility of overweight occurrence and obesity as well as height deficiency , reduced bone density , and abnormal mineralization of bone tissue .
those disorders are caused by the disease itself , especially in the cases of leukemias and non - hodgkin 's lymphomas but also by long - standing steroid therapy , chemotherapy , central nervous system irradiation , eating disorders , low physical activity during and after the treatment , and by many other environmental factors to which patients can be exposed .
components of metabolic syndrome are observed much more often in children after antitumor treatment than in the population of healthy peers [ 10 , 11 ] .
attempts of explaining correlation between leptin concentration , polymorphism of the gene of leptin 's receptor , and bone tissue density were examined in the last decade by many authors .
most of the results are based on analyzing healthy adults and only few on children with disorders such as obesity , anorexia nervosa , human growth hormone deficiency , or rheumatological conditions .
the aim of our research was to distinguish the negative environmental factors from the influence of the single genetic factor on anthropometric and densitometry parameters in children after completed antitumor treatment [ 1217 ] .
74 caucasian patients ( 42 boys ) from the department of pediatric oncology and hematology of the medical university of bialystok were examined after the completed antineoplastic treatment for acute leukemia ( n = 64 ) and lymphomas ( nhl ; n = 10 ) ( table 1 ) .
only children aged 10 years old and older were qualified to the analysis because of the required cooperation during densitometry ( dxa ) .
control group for the data on lepr genotype and for estimation of the concentration of leptin in blood serum was recruited from 51 nonobese patients ( 34 boys ) hospitalized in the department due to reasons other than neoplastic diseases .
bioethical committee of the medical university of bialystok gave the permission to perform the analysis .
parents and guardians of each patient have signed the written consent to participate in the examination .
body mass index was calculated using the following formula :
( 1)bmi [ kg / m2]=body mass [ kg]/(height [ m])2 .
measurements of waist and hip circumference were made by standardized tape - measure ( in centimeters ) ; and waist to hip ratio ( whr ) was determined by the following formula : waist circumference ( cm)/hip circumference ( cm ) , where the value 0.85 was cut - off value .
measurements of total body fat mass ( fm ) , lean mass ( lm ) , bone mineral content ( bmc ) , and total bone mineral density ( total bmd ) as well as in spine bone mineral density ( spine bmd ) were performed with dual energy x - ray densitometry ( dxa ) using ge - lunar equipment . to gain reliable results ,
because of age diversity among examined patients and huge substantial differences in measurements , the values of both densitometry and anthropometric parameters were computed in sds .
to valuate leptin 's concentration in blood serum ( ng / ml ) elisa method with human leptin human leptin quantikine kit ( r&d systems , usa and canada ) was used . in evaluating polymorphism of leptin receptor gene ,
the method of restriction fragment length polymorphism ( rflp ) with polymerase chain reaction ( pcr ) was used .
samples of stabilized peripheral blood edta were taken from every patient and stored in the temperature of 20c degrees . to isolate genomic dna masterpure
amplification of gained dna ( in the capacity of 0.2 microl ) was performed in solution of 20 microliters of final capacity , with the consistence of 0.2 microliter of every primer ( forward 5 aaactcaacgacactctcctt 3 , reverse 5 tgaactgacattagaggtga 3 ) and 10 microns of taq polymerase ( jumpstart tm redtaq tm dna polymerase by sigma ) .
allele - specific polymerase chain reaction was performed in mj mini personal thermal cycler ( biorad ) according to the following scheme : initial denaturation in 94c for 4 minutes , thereafter 35 cycles in 94c for 40 seconds , primer binding in 55c for 40 seconds , and elongation in 72c . for separation of reaction 's products
longitudinal values were compared between examined groups with student 's t - test . for comparison of genotypes groups anova
the hardy - weinberg principle was used to rate the genotype distribution among the examined population .
distribution of q223r in examined and control group is shown in table 2 . as we expected , in our analysis both groups ( examined and control ) presented the majority of heterozygotes with ga genotype .
despite of no statistically important differences in distribution , the examined group higher percentage of ga genotype heterozygotes ( 56.8% ) than the control group ( 47.05% ) , where the balance is moved towards often occurrence of g alleles , although the percentage distribution of aa homozygotes is highly comparable in both groups . obtained distribution of particular genotypes in examined and control groups was comparable with the expected , based on hardy - weinberg principle .
genotype distribution after the division of the group into subgroups by sex and diagnosis showed the predominance of heterozygotes , similar to the whole group , with the exception of girls from control group , in which gg homozygous genotype was the dominating one ( table 2 ) .
values of the anthropometric and densitometric parameters in the whole group , according to q223r lepr genotype were shown in table 3 .
different q223r lepr genotype did not correlate with neither height , body mass index , whr , total bone mineral density , spine bone mineral density , fat mass , lean mass , nor bone mineral content expressed as sds .
total percentage of children with overweight and obesity defined by who definition ( bmi > 24
kg / m ( n = 14 ) showed the predominance of gg allele ( 50% ) over ag allele ( 42.85% ) and aa ( 7.15% ) .
leptin levels in overweight patients compared to nonoverweight were statistically higer ( 10.572 10.853
values of whr were within normal rate only in 4 from 14 children ( 33.3% ) in group with elevated bmi , compared to nonoverweight children .
whr in overweight and obese group was statistically higher than in nonoverweight group ( median 0.8950 ( 0.76000.9600 ) versus 0.8350 ( 0.62001.100 ) ; p < 0.0001 ) .
thirteen received dose of 12 g and 3 dose of 18 g , according to treatment protocols .
the distribution of lepr q223r genotype in irradiated patients was aa1 ( 6.25% ) , ag10 ( 62.5% ) , and gg5 ( 31.25% ) .
three from these 16 patients had bmi > 24 kg / m , two presented ag genotype and one genotype gg .
serum concentrations of leptin in the group of individuals who received crt were statistically higher than in group without radiotherapy ( p < 0.01 ) ( figure 1 ) .
we did not find any differences in leptin concentrations between girls and boys nor in children with a different tanner stage . in the comparison between the genotypic subgroups , significantly lower concentrations of leptin in homozygous gg groups ( p = 0.021 ) were noticed .
aa homozygotes presented the opposite relationship ( p = 0.031 ) ( table 4 ) .
in our analysis we did not find any correlations between leptin concentrations and anthropometric parameters such as height , body mass , whr , bmd , bmc , fat , and lean tissue in the whole group , as well as in subgroups with three different lepr genotypes .
all of the correlations are showen in the tables 5 , 6 , 7 , and 8 .
to estimate the factors which influence the risk of obesity the model of forward stepwise regression for bmi was prepared .
strong positive connection ( adjusted r = 0.8858 , f = 28.1607 , p = 0.00002 ) was found between bmi and fat mass and total bone mineral density ( table 9 ) .
other parameters such as age of the analysis , gender , tanner stage , crt , lepr genotype , leptin levels , lean mass , and bone mineral content did not influence bmi in this model . to find the factors influencing leptin levels forward stepwise regression was also used .
analysis showed strong positive influence ( adjusted r = 0.7577 , f = 9.7615 , p = 0.0019 ) of bone mineral density on leptin levels , whereas negative influence of spine bone mass .
carriage of the gg lepr genotype and cranial radiotherapy were also included in the model , amplifying it ( table 10 ) .
no influence of age , gender , age of diagnosis , other anthropometric and densitometric parameters on leptin levels was shown .
distribution of particular genotypes in presented analysis is similar to the previous analysis performed in our department on a group of 95 children52 diagnosed with neoplastic disease ( gg50% , ag21.2% , aa21.2% ) and 43 healthy peers ( gg39.5% , ag48.8% , aa11 ) .
ragin et al . performed the valuation of q223r lepr genotypes distribution in different ethnic groups containing 1400 individuals .
percentage value of the homozygous a allele carriers from the examined group resembles almost perfectly the one from the analysis performed by ragin et al .
( aa = 14.9% versus 14.16% ) and is only slightly lower in control group ( 13.7% ) . analyzing the whole group of cancer survivors we did not find any correlations between leptin levels and anthropometric parameters like bmi , whr , fat , and lean mass or bmd , although we found statistically higher concentration of leptin among those individuals with bmi over 24 kg / m .
analysis found no correlations between leptin concentrations and lepr polymorphism ; however , they observed significantly higher levels of leptin in obese children compared to healthy peers . in analysis
performed previously in our department in the population of 46 newly diagnosed all patients , we found a strong positive correlation between leptin levels and body mass index , with no difference between leptin values during maintenance therapy and after completion of the treatment .
no difference between leptin levels during maintenance therapy and after completion of the treatment was noted . in the present study , leptin concentrations in the control group
were statistically higher than in cancer survivors , but predominance of girls in the control group can be responsible for this .
analysis , which proved significantly higher concentrations of leptin in healthy polish children , while in leukemic patients this relationship was not present .
our study has not shown any differences in leptin concentrations between boys and girls neither between children in different tanner stages .
analysis in population of healthy children , where they found lower leptin levels in boys than in girls in every pubertal stage . analyzing serum leptin concentrations according to different lepr genotypes we found statistically higher leptin levels in homozygotic aa alleles carriers , whereas in control group gg homozygotes leptin levels
correlations between anthropometric parameters , especially bmi and body mass or fat mass content and q223r lepr polymorphism , were the subjects of numerous analyses .
many of them proved that a allele carriage is connected with the higher body mass , tendency to obesity , higher body mass index , and fat tissue content , as well as higher leptin concentration in blood serum , whereas others did not confirm similar correlations [ 2 , 24 ] . in comprehensive review , paracchini et al .
, based on meta - analysis of 18 english - language articles , have not found any correlations between different polymorphisms of the leptin receptor gene ( including q223r , k109r , and k656n ) and obesity .
considine et al . proved that the increasing content of fat tissue comes with the increasing leptin concentration , simultaneously suggesting the contribution of leptin resistance to the pathogenesis of obesity .
in population of polish obese children pyrzak et al . did not confirme relation between q223r polymorphism and tendency to obesity .
did not find any differences in lepr q223r genotypes distribution between obese and nonobese patients .
the risk of obesity and overweight in all survivors is estimated from few percent to even 57% , according to lughetti et al .
the frequency of overweight was 16.21% ( n = 12 , 10 boys ) and obesity 2.7% ( n = 2 , 2 boys ) ; all of the patients were treated for all . while the predominance of a allele was proved to be connected with higher fat mass and body mass index , in our analysis of the group of overweight and obese children we found predominance of allele g ( 50% ) , compared to whole analyzed group ( 28.4% ) and controls ( 39.21% ) .
performed on 82 polish all survivors found bmi > 24 kg / m in 31% of patients , more than in our analysis . in their study no correlation between lepr genotype and leptin levels was reported , although they observed higher concentrations of leptin in obese individuals compared to those with normal weight .
based on 600 all survivors found higher frequency of bmi 25 kg / m in girls homogenous with arg allele , while similar coincidence was not found in males . while antineoplastic treatment leads to overweight and obesity , cranial radiotherapy ( crt ) is proved to be one of the most important factors .
showed significantly higher bmi and leptin levels , especially in girls after crt , and similar results were achieved by birkebeak 's analysis [ 29 , 30 ] .
. showed no differences in serum leptin levels between irradiated and nonirradiated patients , as well as no differences were found between boys and girls . in our analysis
we did not find differences in bmi between these two groups of patients , but in the whole group of cancer survivors we found higher leptin levels in obese subjects compared to nonobese . taking under consideration the risk of obesity in the stepwise regression model for bmi we found strong connection with fat mass and bone mass , but we did not find any connection between body mass index and leptin concentrations neither with cranial radiotherapy .
, then ross et al . in his analysis based on 600 individuals confirmed the hypothesis that arg homozygous female all survivors have lower leptin binding affinity [ 2 , 11 ] . in the present study , we showed no correlations between leptin levels and bone mass in young cancer survivors , but the regression model for leptin demonstrated positive connection between leptin levels and total bone mineral density , but negative connection with bone mass in the lumbar region .
much research explored relationships between leptin and densitometric parameters such as bone mineral density in the different parts of skeleton and results were highly ambiguous .
yamauchi et al . indicated the correlation between bmd and blood concentration of leptin in postmenopausal woman , just like pasco et al . and
responsibility for the differences in the results of the analysis goes to high changeability of leptin secretion and its dependence from stressful , metabolic , or hormonal factors [ 1214 ] .
our results did not prove the influence of lepr genotype on total and spine bone mineral density nor on bone mineral content .
the group of prepubertal boys showed that the homozygous a allele carriers had higher bmc in comparison with homozygotes without that allele , whereas heterozygotes had middle values . in richert 's study no differences in bone mineral density in different skeleton regions , except femoral diaphysis were shown .
similarly , crabbe et al . also did not confirm influence of lepr q223r genotype on bone mineral mass either .
kim et al . in their analysis on a large group of korean females before and
after menopause did not find any differences in leptin concentration according to q223r genotype or any correlations between leptin concentration and bone mineral density in various skeletal areas .
oppositely , koh et al . had proven higher spine bmd among korean a allele carriers in comparison to those without allele g . to our knowledge , this is the first study exploring the influence of q223r gene polymorphism on bone mass in young survivors of childhood cancer .
firstly , it was based on small group of individuals , so some of the results can have coincidential character . secondly , there was a large age range of participants , which may additionally can bring divergent results . because our findings on relationship between specific genotype and anthropometric parameters correspond with some analyses reported elsewhere also contradict with the results of others ; and further prospective research on a larger group of individuals is needed . | childhood cancer survivors are in augmented risk for developing obesity . for many factors leptin and leptin receptor gene polymorphism play an important role in the development and metabolism not only of fat , but also , bone tissue . the aim of the analysis was to find the relationships between q223r , leptin levels , and anthropometric parameters .
patients and methods . in the study 74 cancer survivors participated ( all n = 64 , lymphomas n = 10 ) , and the control group consisted of 51 healthy peers .
leptin blood concentration was determined by elisa method . to estimate leptin receptor gene polymorphism ,
rflp method was used . bone mineral density ( bmd ) and content ( bmc ) , fat , and lean tissue measurements were obtained by dxa . results .
we found no correlations between serum leptin concentrations and anthropometric parameters nor bmd .
serum leptin concentrations were significantly lower in the group of cancer survivors compared to controls ; however , in those overweight from examined group we found leptin levels higher than those in nonoverweight .
genotype q223r was not associated with higher leptin levels , bmi , bmd , body fat or lean tissue . conclusion . to our knowledge , this is the first report describing the relationship between bmd and q223r polymorphism in childhood cancer survivors .
further analysis , based on a larger group of patients , is needed to confirm these findings . |
the online version of this article ( doi:10.1007/s10886 - 010 - 9821 - 3 ) contains supplementary material , which is available to authorized users .
most insects rely on chemical compounds ( pheromones ) to identify and attract conspecific mates ( wyatt , 2003 ) .
the chemical composition of mating pheromones may range from single molecules to diverse , complex mixtures ( symonds and elgar , 2004 , 2008 ; billeter et al . , 2009 ) . because mating pheromones usually consist of species - specific blends , they often mediate prezygotic reproductive isolation among closely related lineages ( card et al .
, 1977 ; roelofs et al . , 2002 ) . in insects , mating pheromones are synthesized de novo or from sequestered precursors . in either case ,
both biotic and abiotic factors influence pheromonal chemical composition ( stennett and etges , 1997 ; groot et al . , 2009 ) .
hence , an important question is how insect populations that colonize novel environments respond to environmental changes that influence mating pheromones .
in addition , to understand the underlying mechanisms of pheromone evolution in insects , we must examine intraspecific phenotypic variation in pheromone chemistry across habitats , geographic regions , and genetic gradients .
orchid ( or euglossine ) bees constitute a diverse lineage of neotropical insect pollinators ( ramrez , 2009 ; ramrez et al . , 2010 ) that are best known for their fragrance - collecting behavior ( darwin , 1862 ; dressler , 1968 ; dodson et al . , 1969 ) .
male bees collect volatile compounds from multiple floral and non - floral sources that they use subsequently during courtship display ( dressler , 1982 ; eltz et al . , 2005b ) .
males of all species of orchid bees ( 200 ) have enlarged hind - tibial organs in which they deposit perfumes that consist primarily of terpenoids and aromatic compounds ( williams and whitten , 1983 ; eltz et al . , 1999 ;
male orchid bees land on the surface of fragrance sources and secrete large quantities of long - chain lipids from cephalic labial glands that dissolve the volatile compounds to be collected ( whitten et al .
although it has not been confirmed directly via behavioral experiments , it is likely that perfume chemistry enables females to choose mates and/or discriminate non - specific males ( eltz et al . , 1999 , 2003 , 2005a ; bemb , 2004 ; zimmermann et al . , 2006 )
( 2009a ) analyzed the chemical composition of the fragrances acquired by male orchid bees from 15 closely related sympatric species in the genus euglossa from central panama .
they showed that related lineages of bees accumulate species - specific fragrance blends that have differentiated rapidly during lineage diversification , potentially in response to strong selection against hybridization or mating interference between species .
previous studies also have shown that perfume variation tends to be lower within lineages than between lineages ( eltz et al . , 1999 , 2005a , 2008 ; zimmermann et al . , 2006
) , even when individuals co - occur in the same habitat ( eltz et al .
however , the extent of intraspecific perfume variation across geographic regions and genetic gradients has not yet been examined .
male orchid bees may accidentally accumulate a considerable diversity of inactive ( noisy ) compounds during the process of perfume collection ( eltz et al .
, 2005a ) , as they often collect volatiles from multiple sources , even at local scales ( pemberton and wheeler , 2006 ) .
in addition , variation in the availability and abundance of specific chemicals among habitats may result in disparate fragrance phenotypes ( eltz et al .
thus , orchid bees must deal with environmentally induced variability while maintaining a reliable chemical communication system .
do conspecific male orchid bees collect similar compounds across disparate habitats ? can different chemical compounds serve homologous functions in distant populations ? we designed a comprehensive analysis of fragrance variation within and between interbreeding populations of a single species , euglossa aff .
in particular , we focused on elucidating phenotypic change in the perfumes of e. aff .
the green orchid bee euglossa viridissima is distributed throughout lowland dry forests in northern mesoamerica ( hinojosa - diaz et al . , 2009 ) , ranging in distribution from southern costa rica to northern mexico ( fig . 1 ) .
previous taxonomic treatments recognized e. viridissima as a single distinct species ( e.g. , roubik and hanson , 2004 ) . however , a recent study of populations from the yucatan peninsula ( mexico ) showed instead that this lineage consists of two cryptic sister species ( eltz et al . , 2008 ) .
the most prominent morphological difference between the two lineages is in the number of teeth on the mandible of males : two or three dentitions .
viridissima ) collect large quantities of the compound 2-hydroxy-6-nona-1,3-dienyl - benzaldehyde ( abbreviated hndb ) , males with two dentitions ( e. viridissima ) lack hndb in their perfumes ( eltz et al . , 2008 ) .
a detailed systematic analysis of these lineages based on morphology , chemistry , and genetic data is in preparation ( eltz et al . ,
native range populations in mesoamerica were el chote , monte pio , el remate , xmatkuil and acg .
naturalized populations in the united states were gumbo - limbo and fern forest map of mesoamerica and southern united states indicating sampling localities where male euglossa aff .
native range populations in mesoamerica were el chote , monte pio , el remate , xmatkuil and acg . naturalized populations in the united states were gumbo - limbo and fern forest as early as 2003 , bees of e. aff .
viridissima were introduced accidentally and naturalized in southeastern united states ( skov and wiley , 2005 ) . since then , vigorous populations have become established throughout most of the southern coastal peninsula of florida ( pemberton and liu , 2008 ; liu and pemberton , 2009 ; pemberton and ramrez , personal observation ) .
a chemical analysis of the perfumes of naturalized bees from florida showed that male bees collect multiple fragrance compounds from several plant species , including native , naturalized , and horticultural plants ( pemberton and wheeler , 2006 ) .
however , the composition of these fragrances has not been compared with that of native e. aff .
viridissima across its native range in mesoamerica and its introduced range in florida ( u.s . ) .
we estimated the magnitude of intraspecific geographical variation in fragrance composition and identified volatile compounds that vary within and between bee populations .
viridissima to the united states may have resulted in both a genetic bottleneck and a habitat shift , we asked whether changes in perfume chemistry have accompanied the naturalization of this lineage of bees .
viridissima lineage were collected from five localities across the native range in costa rica and mexico , and two localities in the introduced range in the u.s .
( florida ) in 2008 and 2009 ( fig . 1 ; supplementary material appendix 1 ) .
male bees were lured with synthetic chemical baits consisting of squares of blotter paper impregnated with p - dimethoxybenzene , methyl cinnamate , or eugenol ( sigma - aldrich , st .
the impregnated paper squares were suspended 1.5 m aboveground and covered with screen mesh to prevent male bees from accessing the bait .
males were captured with hand nets and kept in the shade inside screen cages until subsequent dissection , typically conducted the same day.florida populations were sampled at two natural area preserves .
fern forest ( broward county ) is primarily a tropical hardwood forest grading into freshwater cypress swamp and upland pine habitats .
gumbo - limbo nature center ( palm beach county ) is located on a barrier island with a tropical hardwood forest and mangroves .
mesoamerican populations were sampled from various habitats , including secondary seasonally dry tropical forest ( acg ) , secondary seasonally dry scrubland ( xmatkuil ) , farmland surrounded by stretches of tropical perennial forest ( el chote ) , settlement adjacent to tropical perennial forest ( monte pio ) , and coastal mangroves ( el remate ) .
fragrance extraction and chemical analysis male bees were cold - anaesthetized either on ice or inside a freezer ( 20c ) for 5 min immediately prior to dissection .
right hind tibiae were removed with clean dissecting scissors and deposited in 2 ml screw - cap autosampler vials ( agilent technologies , santa clara , ca , usa ) , which contained 500 l of hexane to extract the fragrances . to distinguish between exogenous volatiles and endogenous male - produced lipids , acetates , and straight - chain hydrocarbon compounds , labial glands were dissected , extracted , and analyzed from a subset of individuals ( n = 43 ) using the same protocol described above .
all compounds present in both leg extracts and labial glands were excluded from the analysis ( fig . 2 ) .
voucher specimens of all samples were either pinned or deposited in 200 proof ethanol .
2overlaid total ion current chromatograms corresponding to hind - leg ( black ) and labial gland ( grey ) extracts from the same individual bee .
compounds present in both hind legs and labial glands were considered endogenous in origin and thus were excluded from the analysis .
the y axis indicates ion abundancegas chromatography / mass spectrometry ( gc / ms ) was conducted at the department of environmental sciences , policy and management at the university of california berkeley , using a 7890a agilent gc coupled with a 5975c agilent mass selective detector ( agilent technologies , santa clara , ca , usa ) .
the gc was fitted with a 30 m long , 0.25 mm internal diam , non - polar agilent hp-5ms capillary column ( cat . #
sample aliquots of 1 l were injected by using an agilent 7683b automatic injector operated in splitless mode .
the oven temperature was programmed from 60 to 300c at 3c / min , using helium as carrier gas with a constant flow rate set to 0.7 ml / min
. mass selective detector ( msd ) scanning parameters ranged from 50 to 550 amu , with a sampling rate of 2.91 scans / sec and a threshold detection of 150 counts.chemical analyses revealed the presence of triclopyr 2-butoxyethyl ester ( hereafter triclopyr bee ) , in florida populations only .
viridissima were actively attracted to this compound , we performed attraction bioassays with both captive and wild bees .
captive bees were nest - trapped in florida ( august 2009 ) and reared at uc berkeley in an insectary facility maintained at 25c , 4060% humidity , and kept under a 12/12 h light / dark cycle .
male bees were not exposed to any fragrances prior to the bioassay , in which we presented male bees with hind leg extracts that contained large quantities of triclopyr bee and as little as possible of other volatile compounds .
we applied 100 l of the hexane extract to clean blotter paper squares placed inside a flight cage where the bees were reared . as an experimental control , we presented male bees with labial gland extracts from the same individuals for which fragrance extracts were selected in the experimental treatment .
the number of bees displaying fragrance gathering behavior within the first 2 min was recorded.in addition , to test whether male e. aff .
viridissima from native - range populations also were attracted to triclopyr bee , we purified this compound from leg extracts using a preparative gc system similar to that of nojima et al .
a megabore db-5 capillary column ( 30 m , 0.53 mm i d , 0.5 um film thickness ) was used to separate compounds in an hp 5890 ii gas chromatograph ( 50 to 300c at 10/min ) .
injection was on column , with a 30 m retention gap preceding the actual analytical column .
the peak of triclopyr bee was captured by using a 40 cm piece column trap ( hp-1 , 0.53 i d ) that was connected to the preparative outlet at the time of elution . the substance retained in the trap
repeated runs yielded approximately 75 g of purified triclopyr bee diluted in 1 ml of n - hexane .
the bioassay was conducted in a disturbed dry forest near xmatkuil ( merida , mexico ) during the morning of 14 march , 2010 .
we applied 200 l of isolated triclopyr bee in n - hexane ( 15 g ) to filter paper ( whatman 1 , 2 cm ) pinned to a small tree at breast height . in the vicinity ( > 4 m away ) , we also exposed two p - dimethoxybenzene baits , which were visited by dozens of male e. aff .
bees that landed on the triclopyr bee filter paper were observed briefly to verify volatile collection .
overlaid total ion current chromatograms corresponding to hind - leg ( black ) and labial gland ( grey ) extracts from the same individual bee .
compounds present in both hind legs and labial glands were considered endogenous in origin and thus were excluded from the analysis .
the y axis indicates ion abundance compound characterization we used the software chemstation ve.02.00 ( agilent technologies ) to register chromatogram peaks and save their corresponding spectra in user - built mass - spectral libraries ( ramrez and eltz , unpublished ) which we use to cross - reference additional chromatograms .
we further characterized individual compounds by comparing spectra against several published libraries ( adams , 2001 ; pal600k , palisade corporation , usa ) .
louis , mo , usa ) , injected and analyzed under the same conditions and instrument described above ( uc berkeley ) , were also used to corroborate compound identities ( table 1 ) .
uncharacterized compounds were named based on retention times and ei - mass spectrum ions ( table 1 ) .
automatic peak integration was conducted using the rte integrator in the software chemstation ve.02.00 ( agilent technologies ) set to a minimum - area detection threshold equivalent to 0.5% of the area of the largest peak .
viridissima ranked by their incidence ( % ) across populationscompound namecompound classretention time ( min)entry # incidence ( % ) contribution to dissimilarity ( % ) usa vs. mesoamericaeugenolphenylpropanoid23.679164798.542-hydroxy-6-nona-1,3-dienyl - benzaldehyde 4 ( hndb4)aromate50.698547419.04caryophyllenesesquiterpene26.288173682.60isolemecin , trans - na35.38861502.25ocimene , beta - monoterpene10.547199443.44benzyl benzoatearomate39.306218423.002-hydroxy-6-nona-1,3-dienyl - benzaldehyde 1 ( hndb1)aromate45.62851411.65m / z:55,69,81,95,107,119,135,147,161,175,189,207,218,426triterpene80.67559401.252-hydroxy-6-nona-1,3-dienyl - benzaldehyde 3 ( hndb3)aromate48.89053382.27m / z:53,65,74,92,120,155unknown16.572373361.17humulene , alpha - sesquiterpene27.673165361.22cadinene , delta - sesquiterpene30.465110350.07benzyl cinnamatena49.863208343.48m / z:55,68,81,93,107,121,133,147,161,175,189,204sesquiterpene25.149245321.26pinene , alpha - monoterpene6.639174280.61m / z:55,69,81,95,107,119,135,147,161,175,189,203,218unknown79.337127260.253-cyclohexane-1ol , 4-methyl-1 m ethylethylmonoterpene15.926180250.232-hydroxy-6-nona-1,3-dienyl - benzaldehyde 2 ( hndb2)aromate47.23152251.18triclopyr 2-butoxyethyl esteraromate53.553762517.37germacrene , dsesquiterpene28.794359250.69similar to elemicinaromate31.781413250.48similar to amorphene , alpha - sesquiterpene30.10545230.29similar to elemicinunknown31.75349230.33similar to amyrin , alpha - triterpene79.800424230.551,4-dimethoxybenzene , aromate15.308179190.14cubene , beta - sesquiterpene28.789194191.03epizonarenesesquiterpene29.50443180.45m / z:55,115,127,173,183,201,215,228,244,269,283,293,311,326,344unknown64.722333180.28cineole , 1,8-monoterpene9.906255180.23copaene , alpha - sesquiterpene24.486182180.20methyl esterna36.067235181.79myrcene , beta - monoterpene8.424254170.25bisabolene , beta - sesquiterpene29.922378160.82pinene , beta - monoterpene7.989175150.30barbatene , beta - sesquiterpene27.227188150.17m / z:55,67,77,81,91,105,119,133,161,204sesquiterpene28.068193150.13m / z:65,77,91,115,129,147,175,244,260unknown51.76672150.26m / z:55,71,99,115,128,141,157,171,186,200,213,228,245,301,326unknown62.691311150.10m / z:55,69,83,95,108,115,127,145,159,173,183,201,215,225,244,253,285,299,324,342unknown66.279334150.16similar to amorphene , alpha - sesquiterpene28.611161140.15similarity percentage ( simper ) was used to calculate the relative contribution of each compound to the observed dissimilarity between us and mesoamerican populations .
1% are indicated in bold most common exogenous fragrance compounds collected by male euglossa aff .
viridissima ranked by their incidence ( % ) across populations similarity percentage ( simper ) was used to calculate the relative contribution of each compound to the observed dissimilarity between us and mesoamerican populations .
1% are indicated in bold statistical methods we built a square matrix containing the absolute quantities ( total ion currents ) for each compound , containing all samples from all localities .
we compared individual chemical profiles within and between populations via non - metric multidimensional scaling ( mds ) , an ordination technique where a predetermined number of axes of variation are chosen , and non - metric distances are fitted to those dimensions . because ordination via mds makes few assumptions about the nature of the data , any distance measure can be applied .
we calculated a triangular distance matrix between samples ( individuals ) using the bray - curtis index of dissimilarity , which has the advantage of being insensitive to compounds jointly absent in sample pairs ( i.e. , pairwise dissimilarities are fixed ) .
we computed 2- and 3-dimensional mds plots ( 50 iterations per run ) using the software package ecodist v1.2.2 ( written in r ) .
to assess statistically whether orchid bee fragrances exhibit greater dissimilarity between populations than within populations , we conducted an analysis of similarity ( anosim ) test , implemented in the software package vegan v1.15 - 4 ( written in r ) .
additional descriptive statistics , tests , and plots were produced using r basic packages , freely available at www.cran.r-project.org .
we estimated the relative contribution of individual compounds to the observed ordinal dissimilarities using the similarity percentage ( simper ) method , implemented in the software package primer v6 ( clarke and gorley , 2006 ) .
we registered a total of 333 compounds in hind leg extracts of 114 males sampled from seven populations ( fig . 1 ) .
by comparing the chemical profiles of hind leg extracts against those from labial glands ( fig .
2 ) we determined that 41 compounds were produced in the bees labial glands ( endogenous origin ) , and included straight chain hydrocarbons , acetates , diacetates , and alcohols ( supplementary material appendix 2 ) .
the remaining 292 compounds are thus exogenous in origin , and included monoterpenes , sequiterpenes , bicyclic sesquiterpenes , triterpenes , and other compounds ( table 1 ) . the per - capita number of exogenous compounds across all populations ranged from 1 to 65 chemicals ( average 21.50 12.66 ) with marginally similar means in all seven populations ( anova f = 3.2118 , p = 0.075 ) .
on average , male bees from fern forest ( u.s . ) exhibited the lowest number of compounds per capita ( 15.83 10.08 ) , whereas el remate ( mexico ) exhibited the highest number ( 29.23 6.24 ; fig .
populations were combined , they had significantly fewer compounds per individual ( 17.46 10.78 ) than all mesoamerican populations combined ( 24.14 13.17 ; anova f = 8.0419 , p = 0.005 ) .
3boxplots of the number of volatile exogenous compounds per capita in fragrances of male euglossa aff .
viridissima in native and introduced populations boxplots of the number of volatile exogenous compounds per capita in fragrances of male euglossa aff .
viridissima in native and introduced populations our non - metric multidimensional scaling ( mds ) analysis included exogenous compounds only . when all volatile compounds in the data matrix were included ( coded by relative abundances ) , a strong clustering by population was found ( fig .
this observation was corroborated by the anosim results , which indicated that fragrance dissimilarity within populations was lower than among populations ( r = 0.433 , p < 0.001 ) .
we found a similar pattern when we excluded the two compounds with the highest contribution to the dissimilarity between u.s . and mesoamerica ( fig .
4b ; see simper analysis below ) , namely hndb4 ( one of four stereoisomers ) and triclopyr bee .
likewise , mds ordinations based only on the 50 compounds with the highest incidence ranks across all populations ( fig .
4c ) , and the entire dataset transformed into discrete binary ( presence / absence ) characters ( fig .
in addition , regardless of which data partition we used , we found that introduced ( u.s . ) and native ( mesoamerica ) populations were strongly differentiated ( fig .
4 ; anosim populations not pooled : r = 0.483 , p < 0.001 )
. to explore the possibility that per - capita compound diversity ( number of compounds ) affected population differences , we overlaid a bubble - plot on an mds ordination ( based on all fragrance data ) with circle diameters proportional to the number of compounds per capita ( fig . 5 ) .
3 ) , populations did not appear to cluster based on fragrance diversity alone ( fig .
4non - metric multidimensional scaling ( nmds ) plots based on the chemical composition of exogenous compounds present in hind legs of male euglossa aff .
ordination plots were computed based on a all volatile compounds , b all volatile compounds except the two most dissimilar between u.s .
and mesoamerican populations ( i.e. , hndb4 , triclopyr bee ) , c the 50 compounds with highest incidence across all populations , and d all volatile compounds coded as binary characters ( presence / absence ) . filled circles and triangles correspond to individuals from naturalized populationsfig .
circle diameters correspond to the number of volatile exogenous compounds present in the fragrances of each individual .
filled circles and triangles correspond to individuals from naturalized populations non - metric multidimensional scaling ( nmds ) plots based on the chemical composition of exogenous compounds present in hind legs of male euglossa aff .
ordination plots were computed based on a all volatile compounds , b all volatile compounds except the two most dissimilar between u.s . and
mesoamerican populations ( i.e. , hndb4 , triclopyr bee ) , c the 50 compounds with highest incidence across all populations , and d all volatile compounds coded as binary characters ( presence / absence ) . filled circles and triangles correspond to individuals from naturalized populations bubble plot overlaid on an mds ordination based on all exogenous fragrance compounds .
circle diameters correspond to the number of volatile exogenous compounds present in the fragrances of each individual .
analyses were performed using the software primer ( clarke and gorley 2006 ) . filled circles and triangles correspond to individuals from naturalized populations our simper analysis revealed that five compounds jointly contributed to > 50% of the observed chemical dissimilarity between populations from u.s . and mesoamerica ( table 1 ) . these included hndb4 ( 19.04% ) , triclopyr bee ( 17.37% ) , eugenol ( 8.54% ) , benzyl cinnamate ( 3.48% ) , and beta - ocimene ( 3.41% ) . with the exception of triclopyr bee , which was present only in u.s .
populations , these compounds exhibited high incidence values across all populations ( table 1 ) .
the simper analysis also revealed that of the ten most dissimilar compounds between u.s . and
mesoamerica , eight were present in both population sets ( table 1 ; fig .
6 except panels f , j ) . of these , six were present in more individuals and had greater relative quantities in mesoamerican than in u.s .
the two remaining compounds ( eugenol and caryophyllene ) were present in more individuals and had greater relative amounts in u.s .
triclopyr bee and benzyl benzoate were present only in u.s . and mesoamerica , respectively ( fig .
bees , and it was detected in 63% of individuals ( n = 43 ) .
benzyl benzoate contributed up to 17.84% of the fragrance composition in individual bees , and it was detected in 18% of mesoamerican individuals
6boxplots of per - capita relative concentration ( relative amount of each compound over all compounds ) of ten chemicals detected in bees sampled from native ( mesoamerica ) and naturalized ( u.s . )
these ten compounds had the greatest contributions to dissimilarity between native and naturalized populations boxplots of per - capita relative concentration ( relative amount of each compound over all compounds ) of ten chemicals detected in bees sampled from native ( mesoamerica ) and naturalized ( u.s . ) populations .
these ten compounds had the greatest contributions to dissimilarity between native and naturalized populations we also conducted a simper analysis among all seven populations . in 15 of the 21 possible pairwise comparisons , five compounds jointly explained > 50% of the observed fragrance dissimilarity ( supplementary material appendix 3 ) . in all but two pairwise comparisons , el remate ( mexico ) v. acg ( costa rica ) and el remate v. monte pio ( mexico ) , the compounds hndb4 and eugenol ranked among the top five compounds with highest dissimilarity between populations ( supplementary material appendix 3 ) .
sesquiterpene compounds , followed by monoterpenes , contributed the most to the observed dissimilarity between populations ( table 1 ; online appendix 3 ) .
viridissima ( eltz et al . , 2008 ) , four stereoisomers of the compound hndb were found in male perfumes ( supplementary material fig . 1 ) .
the compound hndb4 was by far the most abundant stereoisomer in the majority of populations , except in el remate ( mexico ) .
the fragrances of all individuals in el remate had greater relative amounts of the stereoisomers hndb1 , hndb2 , and hndb3 than all other populations . in some cases ,
other stereoisomers were more abundant than hndb4 itself ( supplmentary material fig . 1 ) .
because our spectral searches against published libraries did not return any significant matches for triclopyr bee , the identification of this compound was conducted by comparison against analytical standards provided by dow agrosciences ( indianapolis , in , us ) . both the retention time and ei - spectrum of the analytical standard of triclopyr
2-butoxyethyl ester ( triclopyr bee ) perfectly matched peaks in our samples ( fig .
viridissima were observed displaying fragrance collecting behavior on areas where the herbicide garlon had been applied in fern forest ( pemberton , pers .
triclopyr bee is one of three available active ingredients present in commercially available herbicides ( including garlon ) used for broadleaf weed control .
the other active ingredients are triclopyr acid and triclopyr triethylamine salt ( tea ) .
fig .
7mass spectrum of triclopyr 2-butoxyethyl ester , a prevalent compound found in leg extracts of males from naturalized populations of euglossa aff .
viridissima in florida ( u.s . ) and absent in native ( mesoamerican ) populations mass spectrum of triclopyr 2-butoxyethyl ester , a prevalent compound found in leg extracts of males from naturalized populations of euglossa aff .
viridissima in florida ( u.s . ) and absent in native ( mesoamerican ) populations in our laboratory bioassay , we presented 20 male bees with three hexane leg extracts containing large amounts of triclopyr bee and trace amounts of other volatile compounds . within the first two minutes of exposure , six , five , and six individual bees exhibited obvious collecting behavior in the three trials , respectively .
controls ( labial lipid extracts ) did not elicit fragrance - collecting behavior in any of the trials .
our bioassay using purified aliquots of triclopyr bee with native bee populations in the field revealed that male e. aff .
viridissima approached the filter paper with triclopyr bee , landed on it , and performed typical collection behavior .
euglossine bees acquire species - specific fragrance bouquets from a great diversity of floral and non - floral sources ( williams , 1982 ; whitten et al . , 1993 ; ramrez et al . , 2002 ; pemberton and wheeler , 2006 ; zimmermann et al
individual perfume phenotypes may not be attributable to single sources , but instead , emerge from multiple visits to numerous hosts ( eltz et al .
although sympatric species of orchid bees , and particularly closely related lineages ( eltz et al . , 1999 ; zimmermann et al . , 2006 , 2009a ) ,
exhibit divergent perfume phenotypes , it has been unclear to what extent fragrances vary across geographic regions within lineages .
viridissima maintain most of the individual compounds of their fragrance phenotypes across distant populations in disparate habitats , but a few major ( abundant ) compounds can be present or absent from perfume bouquets .
viridissima in florida have been stable for at least seven years , our data suggest that the observed phenotypic changes have negligible effects on population viability .
this observation is congruent with the previous report that male euglossa tridentata and e. erythrochlora sampled in isla del cao , an island 17 km off the coast of costa rica , collect substantially fewer compounds per capita than in mainland populations ( eltz et al .
the remarkable qualitative consistency we found in fragrance phenotypes is at odds with the considerable habitat variability among the seven sites sampled , but supports the hypothesis that orchid bee perfume preferences are under strong selection ( zimmermann et al . , 2009a ) .
the differences in perfume composition that we observed between native and naturalized populations could be attributed to environmental factors , to differences in chemical preference between populations , or to both .
first , species turnover ( beta diversity ) of fragrance hosts across habitats may force phenotypic changes via chemical abundance and availability .
in fact , a recent survey of volatile compounds present in resins of amazonian trees revealed not only a vast diversity of monoterpenes and sesquiterpenes , but also pronounced chemical turnover across tree species from different habitats ( courtois et al . , 2009 ) .
second , strong female preference for certain fragrance phenotypes may restrict the amount of perfume phenotypic plasticity .
although direct evidence for female choice of fragrance phenotypes is still missing for orchid bees , perfume phenotypes are likely to be under strong sexual selection ( zimmermann et al .
, 2009a , b ) . hence , it is also conceivable that , at evolutionary timescales , new male fragrance phenotypes may emerge through novel female preferences for perfumes that indicate mate genotypic quality or simply exploit a sensory bias ( andersson , 1994 ) .
unpublished data ) , and therefore it is possible that population differences in perfume phenotypes have an underlying genetic basis .
rapid evolutionary change in pheromone phenotypes has been demonstrated in several species of insects ( lofstedt , 1993 ; takanashi et al . , 2005 ; groot et al . ,
viridissima is broadly sympatric with its sister taxon ( e. viridissima ) throughout most of mesoamerica ( eltz et al .
the main difference in the perfumes of these two lineages is the presence of hndb in e. aff .
viridissima and its complete absence in e. viridissima ( eltz et al . , 2008 , unpublished data ) .
our data corroborated the presence of hndb as a major fragrance compound in both native and naturalized populations of e. aff .
viridissima and , interestingly , showed that the four known structural stereoisomers of hndb ( eltz et al . , 2008 )
highly variable ratios of hndb stereoisomers were found only in one population ( el remate , mexico ) .
although the source of hndb remains unknown , this either suggests that bees acquire hndb from the same host in both native and introduced populations , but from a different source in el remate , or that environmental differences between el remate and the other sites induced changes in the production of hndb stereoisomers by the same host .
the chemical structure of hndb is unique , but resembles compounds produced by phytopathological fungi ( suzuki et al . ,
the presence of large quantities of triclopyr bee in leg extracts of naturalized bee populations , together with our field and laboratory bioassays , demonstrates that male bees are attracted to and actively collect this herbicide active ingredient .
indeed , previous studies have shown that males of the orchid bee eufriesea purpurata from brazil collect large quantities of the synthetic pesticide ddt ( roberts et al . , 1982 ; walter and roberts , 2007 ) .
although we did not detect triclopyr bee in leg extracts from native populations , male bees from mesoamerica clearly were attracted to this compound .
this result suggests that a pre - existing sensory bias , rather than rapid adaptation among introduced populations , may explain the collection of organohalogen synthetic chemicals by male orchid bees .
both behavioral and neurophysiological approaches are needed to elucidate the sensory basis of this unusual behavior .
viridissima collect a broad diversity of molecules in native and introduced populations . as shown previously for orchid bees ( e.g. , williams and whitten , 1983 ; eltz et al . , 1999 , 2005a ;
we found that perfume compounds that differed the most in abundance among populations also tended to be common to all populations .
for example , whereas eugenol and hndb were present in > 73% of the sampled individuals and contributed significantly to population dissimilarity , most rare compounds contributed little to population dissimilarity .
despite contributing little to overall population differences , rare compounds were diverse in our dataset .
viridissima , but most of them were present in few individuals and in low concentrations . because triterpenes exhibit high molecular weights ( > 400 ) , and thus may not volatilize at ambient temperature , they may constitute poor airborne signaling molecules .
we speculate that orchid bees actually collect triterpenes accidentally since they are common components of tree resins ( e.g. , burseraceae ) , which are known to contain numerous volatile compounds ( de la cruz - caizares et al . , 2005 ; courtois et al . , 2009 ) .
hence , most of the compounds that were abundant in our dataset , such as sesquiterpenes , monoterpenes , and aromates , contributed the most to population differences , and also are likely to constitute the main courtship signaling molecules in orchid bees . in summary
, the preference for most fragrance compounds acquired by orchid bees appears to be under strong selection .
evidence for this comes from the fact that male bees managed to collect similar compounds across disparate habitats ranging from tropical rain forests to tropical dry forests , to mangroves , to disturbed habitats .
however , we also found evidence for pronounced quantitative and qualitative changes across geographic ( and possibly genetic ) gradients .
previous studies have suggested that saltational changes in fragrance preferences may constitute an important mechanism of evolution of perfume phenotypes as well as speciation in orchid bees ( eltz et al . , 2008 ; zimmermann et al .
, 2009a ) . because mutations that affect the olfactory system of orchid bees can induce the acquisition or loss of specific chemicals , perfume phenotypes have the potential to evolve fast enough to facilitate lineage differentiation ( eltz et al . , 2008
our analysis highlights the opportunistic capacity that orchid bees have to incorporate novel compounds in their perfumes , as illustrated by the gain and loss of several compounds in naturalized populations .
whether population - level changes in perfume phenotypes have underlying genetic components , and are thus subject to selection , should be a fruitful area of future research .
| male orchid bees collect volatiles , from both floral and non - floral sources , that they expose as pheromone analogues ( perfumes ) during courtship display .
the chemical profile of these perfumes , which includes terpenes and aromatic compounds , is both species - specific and divergent among closely related lineages .
thus , fragrance composition is thought to play an important role in prezygotic reproductive isolation in euglossine bees .
however , because orchid bees acquire fragrances entirely from exogenous sources , the chemical composition of male perfumes is prone to variation due to environmental heterogeneity across habitats .
we used gas chromatography / mass spectrometry ( gc / ms ) to characterize the perfumes of 114 individuals of the green orchid bee ( euglossa aff .
viridissima ) sampled from five native populations in mesoamerica and two naturalized populations in the southeastern united states .
we recorded a total of 292 fragrance compounds from hind - leg extracts , and found that overall perfume composition was different for each population .
we detected a pronounced chemical dissimilarity between native ( mesoamerica ) and naturalized ( u.s . )
populations that was driven both by proportional differences of common compounds as well as the presence of a few chemicals unique to each population group .
despite these differences , our data also revealed remarkable qualitative consistency in the presence of several major fragrance compounds across distant populations from dissimilar habitats .
in addition , we demonstrate that naturalized bees are attracted to and collect large quantities of triclopyr 2-butoxyethyl ester , the active ingredient of several commercially available herbicides . by comparing incidence values and consistency indices across populations ,
we identify putative functional compounds that may play an important role in courtship signaling in this species of orchid bee.electronic supplementary materialthe online version of this article ( doi:10.1007/s10886 - 010 - 9821 - 3 ) contains supplementary material , which is available to authorized users . |
an extended -conjugated system
is generally considered to
be a prerequisite for high electron mobility and , consequently , a
good performance in organic thin film devices .
pentacene and rubrene
are typical examples of this class of molecules . from the point of
view of mesomeric structures , 5,12-dihydro - quino[2,3-b]acridine-7,14-dione
shortly called quinacridone ( qa)is
a molecule with limited intramolecular -conjugation , as resonance
contributions of enol / imine mesomers are small .
advances that this view may require
revision : in their recent publications they illustrate the potential
of quinacridone as functional material in organic field effect transistors
( ofets ) and photovoltaics ( pv ) .
the authors were able to achieve
field effect mobilities larger than 0.1 cm/(vs ) and photocurrents in the ma / cm range under simulated solar illumination .
the surprisingly high
mobility is attributed to strong intermolecular interactions via hydrogen
bonds reinforcing -stacking and crystalline ordering .
quinacridone is a widely used organic pigment ( violet 19 , c20h12n2o2 , see inset of figure 2 for its structural formula ) , which is industrially
produced in large amounts and at low costs .
it is perhaps best - known as constituting the magenta
colorant for printer toners .
in contrast to the well - known
pentacene , its intramolecular conjugation is broken .
besides van der
waals interactions , intermolecular hydrogen bonds are most crucial
for its crystalline structure .
the polymorphs of the bulk material
can be divided into two groups . in the and phase ,
quinacridone forms flat rows of parallelly arranged molecules .
this
allows each quinacridone molecule to form two hydrogen bonds with
both adjacent neighbors in the row .
in contrast , the polymorph exhibits
a criss - cross arrangement so that each molecule is connected by one
hydrogen bond to each of its four neighbors ( for details on the bulk
polymorphs , see refs ( 79 ) ) .
predict that the hole mobility differs
by a factor 100 between the ( 4.44
10 cm/(v s ) ) and the
( 4.18 10 cm/(v s ) ) polymorph . in epitaxial thin films ,
one also has
to consider the orientation
of the crystallites , i.e. , which lattice plane is parallel to the
substrate surface .
depending on the crystallographic alignment , the
long axis of rodlike molecules will adopt an upright standing or a
flat - lying geometry on the surface .
since the highest mobility is
generally obtained along the -stacking direction , i.e. , perpendicular
to the long axis of the molecules , the orientation of the molecules
on the substrate surface is essential for the functionality of a thin
film device . for an ofet , where the current
flows parallel to the surface , an upright standing geometry is favored .
in contrast , for an oled or photovoltaic device where the charge transport
and the emitted or incident light are directed perpendicular to the
substrate surface , flat - lying molecules are preferred .
accordingly ,
gowacki et al . have prepared quinacridone films with a standing
up
configuration on an aluminum oxide surface passivated by
tetratetracontane to fabricate their ofets . on the other hand , adsorption of rodlike molecules on clean metal
surfaces generally adopt a flat - lying adsorption geometry due to the
strong interaction of the molecules with the metal substrate .
this
is also the case for hydrogen - bonded molecules like 4-[trans-2-(pyrid-4-ylvinyl)]benzoic acid ( pvba ) and 4-[(pyrid-4-ylethynyl)]benzoic
acid ( peba ) on ag(111 ) or indigo on cu(111 ) as well as for the adsorption of quinacridone
on ag(111 ) as will be reported below .
finally , we want to stress
the importance of 2d - chirality in the
context of the adsorption of molecules ( like quinacridone ) on surfaces .
although chirality is a central and powerful concept in chemistry
ever since its introduction by pasteur , the notion of surface
chirality and its fascinating consequences were explored only
recently . for a 2d , prochiral molecule with a 3d inversion
center like indigo or quinacridone , which is inclined with respect
to a high symmetry direction of the surface
, the 2d - mirror operation
about this axis will leave the adsorption configuration unchanged
but switch the handedness of the molecule on the surface .
therefore ,
the two adsorption configurations depicted in figure 1 are the energetically equivalent ones
for the two different 2d - enantiomers . however , in its ground state , each of the two enantiomers adopts
only one of the two mirror symmetric adsorption geometries , in particular
either or + according to its handedness . in
the following ,
we will take advantage of this conjunction to differentiate
between the two enantiomers of quinacridone molecules adsorbed on
the ag(111 ) surface .
schematic illustrating the relationship between the adsorption
geometry of a quinacridone molecule and its 2d - chirality . in this
example
, the mirror plane is parallel to 112
symmetry axis and normal to the surface .
the atoms of the quinacridone
are color coded as follows : carbon = gray , hydrogen = red , nitrogen
= white , and oxygen = blue .
the experiments were carried out in
an ultrahigh - vacuum system
housing an omicron vt afm / stm , an omicron low - energy electron diffraction
optics ( leed ) , and a focus photoelectron emission microscope ( peem ) .
the ag(111 ) single crystal was prepared by several cycles
of sputtering with ar ions ( 900 v , 4 a / cm for 60 min ) and subsequent annealing at 660 k. the quinacridone
was purchased from tci and purified by double temperature gradient
sublimation in a vacuum of 5 10 mbar .
the
quinacridone was deposited while monitoring the photoelectron emission
yield in the peem . during deposition ,
the quartz crucible with the
quinacridone powder was held at 553 k while the sample was at room
temperature .
a hg lamp ( 4.9 ev ) was used as excitation source for
the photoelectrons .
a typical transient of the electron yield as a
function of the deposition time is shown in figure 2 .
we assume that the maximum of the electron
yield corresponds to the completion of the first monolayer . in order
to prepare a single monolayer of quinacridone , the deposition was
stopped either after reaching the maximum of the electron yield or
after the deposition of an equivalent of 45 times this amount .
in the second case , the sample was heated to 550570 k to desorb
the excess molecules in the multilayer .
the stm and leed measurements
were carried out in the same vacuum
vessel without breaking the vacuum .
for the particular stm setup , the bias voltage is applied
to the tip while the sample is grounded .
if not stated otherwise ,
only a background subtraction and an optimization of the contrast
were applied to the stm data . in order to minimize the electron beam
induced damage during leed measurements ,
the sample was moved to a
fresh position every time a leed image was acquired .
although the leed pattern usually vanished after a couple of seconds
when exposing the organic thin film to the electron beam , we were
not able to detect any damaged molecules by stm .
in the same way we
can exclude that there is a significant decomposition of the molecules
due to the light exposure in the peem .
to monitor the growth of quinacridone ,
sequences of peem images ( movies ) were recorded while the ag(111 )
was exposed to quinacridone . during the deposition ,
no characteristic
features with length scales larger than 0.1 m were observed ;
i.e. , the local electron yield was spatially homogeneous within the
field of view varying between 80 and 145 m . even after deposition
of more than 10 monolayers of quinacridone
for other organic
materials like -sexithiophene ( 6t),p - sexiphenyl ( 6p ) , and perylene-3,4,9,10-tetracarboxylic
dianhydride ( ptcda ) , stranski
krastanov
growth is typically observed ; i.e. , after formation of a wetting layer
the growth of 3d islands sets in . as in these cases the ionization
potential ,
i.e. , the binding energy of the homo level with respect
to the vacuum level , is higher than the maximum photon energy supplied
by the hg lamp ; 3d crystalline structures have a lower emission yield
in the peem than the adjacent wetting layer and thus appear darker
than the surrounding wetting layer . for the case of quinacridone films ,
, we do not expect any photoelectron
emission from a thick layer of quinacridone if a hg lamp is used for
photoelectron excitation .
indeed , the electron yield depicted in figure 2 for the bare ag(111 ) surface ( deposition time t = 0 s ) is higher than for the surface covered with about
45 monolayer of quinacridone ( deposition time t = 1150 s ) . since for ag(111 ) work function values in the
range between 4.3 and 4.8 ev are reported , the pristine ag(111 ) surface
should ( and actually does ) appear bright in the peem images .
obviously , the growth transient depicted in figure 2 does not show a monotonous decrease of the electron yield
but a maximum which can be attributed to the completion of the first
monolayer of quinacridone .
the physical background of this feature
is the formation of an interface dipole during the deposition of the
first monolayer .
subsequent layers deposited on
top of this monolayer do not alter the metal organic interface
any further but lead to an attenuation of the electron yield due to
inelastic scattering of the photoelectrons excited at the interface
upon traversing the quinacridone layer . as a consequence
representative
peem images ( top ) and transient of the electron
yield acquired during deposition of quinacridone on the ag(111 ) surface
( buttom ) .
the white line shows the transient of the mean electron
yield ( averaged over the entire field of view of 80 m ) . the
dark ribbon behind the white line arises from vertical error
bars
, each of which is actually a complete histogram of the
electron yield sampled over the entire field of view .
the color ranges
from white ( low probability for the given electron yield ) to black
( high probability ) .
in other words , the width of the dark ribbon is
a measure for the variation of the electron yield across the peem
image recorded at a given time t. in total , the ribbon
shows the histograms of 702 images recorded during the growth experiment .
the time interval between subsequent images is 2 s. the inset shows
a structural formula of the quinacridone molecule .
the sample surface
shown in figure 3 was prepared by thermal evaporation
of quinacridone while the sample was held at room temperature .
once
the maximum of the electron yield was reached in the peem transient
( cf .
therefore , the coverage should be just above one monolayer
( 1 ml ) .
indeed , the stm micrograph in figure 3 shows a close - packed layer of quinacridone molecules .
the molecules
form extended quasi - one - dimensional rows of molecules segmented into
stacks of a few nanometers length .
the molecular rows have distinct
orientations inclined by about 11 with respect to one
of the three equivalent 112 crystallographic
axes of the substrate .
therefore , the two mirror domains combined
with the three rotationally equivalent 112
axes of the substrate give rise to a total of six possible orientations
of the rows .
the angle between two neighboring , mirror symmetric orientations
is 2 11 = 22 , as indicated in figure 3 .
this is consistent with the leed results discussed later
on , which reveal that the molecular rows are aligned 10.9
with respect to the 112 directions of the substrate
( see figure 6 ) .
stm image of a close - packed
monolayer of quinacridone on ag(111 )
deposited while the sample was held at room temperature .
the tunneling parameters
were u = 2 v and i = 2 pa . the white
arrow at the bottom marks the position of the cross section displayed
in the inset .
the dashed lines indicate the expected step height of
the ag(111 ) substrate . along the line profile indicated in figure 3 , two steps can be identified .
their height corresponds almost
exactly
to 0.24 nm , which is the expected step height on the ag(111 ) surface .
as no steps with other heights were observed , the coverage of quinacridone
corresponds to just a single monolayer as expected from the peem transient
in figure 2 .
excess molecules which might be
present in the second layer on top of the quinacridone monolayer can not
be imaged .
because of their small concentration , these molecules might
diffuse as a 2d molecular gas on top of the first layer , but the stm
is too slow to image them .
the occasional spikes in
the topography support this hypothesis : each time a molecule in the
second layer diffuses through the tunneling gap , the associated increase
of the tunneling current is counteracted by a small temporary retraction
of the tip . because of the high mobility of the molecules at room
temperature , these intermittent events lead to spikes
in the topographic images obtained in constant current mode .
figure 4 shows an stm image with molecular
resolution of the monolayer of quinacridone prepared at room temperature .
from this kind of image
we are able to extract the spacing between
neighboring rows of molecules to be b = ( 2.03
0.02 ) nm . the indicated error corresponds to the standard deviation
of the mean value and does not include any systematic error due to ,
e.g. , a poorly calibrated scanner . for the latter ,
a relative error
of 5% was estimated and has to be added to the statistical error .
within each stack , the molecules are oriented parallel to each other
and approximately perpendicular to the row direction .
the so - determined
unit cell would be a primitive one with orthogonal unit cell vectors .
the distance between adjacent molecules within the same stack is about a = ( 0.70 0.01 ) nm .
this value is in good agreement
with the spacing of hydrogen - bonded quinacridone molecules along the
molecular rows in the or polymorphs .
the same value
is also reported by trixler and co - workers for the spacing between
parallel quinacridone molecules within the quinacridone nanowires
as can be seen in the overview image in figure 3 , the bright parts ( stacks ) along the molecular
rows are separated by short darker sections ( defects ) . to avoid systematic
errors ,
we have extracted the intermolecular distance only from molecules
located within the same stacks . at higher magnification , the details
of the molecular arrangement can be resolved .
an example is shown
in figure 4 together with a network of solid
and dotted lines highlighting the positions and relative arrangement
of the quinacridone molecules .
thick
solid or dashed lines enclose stacks in neighboring rows where the
molecules are in perfect registry parallel and perpendicular to the
row direction .
these different sets of domains ( solid and dashed lines ) ,
however , form two antiphase domains with a lateral shift of half a
lattice spacing along the row direction .
the antiphase boundaries
are introduced by the defects between the stacks or
domains and are thus enclosed partly by solid and dotted thick lines .
the defects contain either one or two quinacridone molecules ( marked
by crosses in figure 4 ) which appear more fuzzy
than those in the neighboring stacks .
clearly , each defect introduces
a phase shift of ( half a unit cell ) between
the adjacent stacks along the row direction .
the apparently regular
arrangement of the defects in figure 4 is accidental :
a statistical analysis of the larger scale images ( see figure 3 ) reveals that the spacing between two defects along
the rows follows a random distribution , characterized by an exponentially
decaying pair distribution function with a mean spacing ( stack width )
of about 45 molecules .
stm image of a molecularly resolved monolayer
of quinacridone on
ag(111 ) at room temperature .
the stm was operated with a bias voltage of u = 0.5 v and a current set point of i = 5 pa .
the
thin ( solid and dashed ) lines mark the distance between molecules
with a regular spacing .
and form spacings that are 1.5 times
wider than the regular ones .
an explanation of the structures as revealed by stm involves
both
the hydrogen bonding and the 2d - chirality of the quinacridone molecules
and is illustrated by the model in figure 5 . the tendency to aggregate in stacks of parallel molecules with
an intermolecular spacing of about 0.7 nm can be attributed to the
strong interaction mediated by two c = oh n
hydrogen bonds between neighboring molecules with the same handedness
in a row .
the same bonding motif is also dominating the and
polymorphs in the bulk . on the other hand , the azimuthal orientation
of the molecules on the substrate , and , hence , the ( perpendicular )
orientation of the molecular rows ,
is determined by the interaction
of the quinacridone molecules with the ag(111 ) substrate , i.e. , the
corrugation of the molecule
( see figure 1 ) , quinacridone molecules with different azimuthal orientation
can be associated with different 2d - enantiomers , albeit our room temperature
stm data do not allow to determine the handedness , directly .
consequently ,
the two mirror domains composed of rows of molecules oriented + 11
and 11 with respect to the ag112
direction ( see figure 3 ) can be attributed
to two almost enantiopure phases with opposite handedness .
the defects
in figure 4 could thus be due to a residual
amount ( of about 18% ) of molecules with the wrong
handedness , which were trapped during the growth and coalescence of
the enantiopure stacks . as can be noticed in figure 4
, molecules in stacks on neighboring rows can have only two
possible relative alignments : they are either aligned ( in - phase ) or
shifted by half a unit cell spacing .
the existence of only two antiphase
domains along the rows suggests that the structure of the quinacridone
domains is commensurate along this direction .
in fact , the above
growth scenario is very similar to the one observed
for indigo on cu(111 ) by villagomez et al . in this case , the azimuthal orientation of the isolated indigo enantiomers
is inclined by about + 20 and 20 with respect to
the cu110 direction , respectively . upon 2d
condensation , the indigo molecules were found to self - assemble into
mirror domains composed of essentially enantiopure molecular rows
oriented + 9.5 and 9.5 with respect to the 110
direction .
were also observed along the rows which could be identified as indigo
molecules with the wrong handedness .
these defects
could be eliminated almost completely by annealing the sample at 100
c for 1 h. with their low - temperature stm villagomez et al .
,
the authors could actually determine the 2d - chirality from the asymmetry
of the shape of the stm image for each individual indigo enantiomer . in order to further quantify the superstructure of the quinacridone
adlayer and to explore its suspected commensurability ,
figure 6a shows the characteristic leed
pattern obtained from the same sample which was previously characterized
by stm ( see figures 3 and 4 ) .
a major problem with leed is that very low electron beam
energies have to be used to acquire diffraction patterns of large
organic molecules with correspondingly large unit cells .
these slow
electrons can interact very efficiently with the molecules , so that
the risk of beam damage is very high . for the particular system of
quinacridone on silver , the leed pattern was only visible for a couple
of seconds before it faded away .
therefore , we had to change the position
of the sample right before acquisition of a single leed pattern . in
addition , we did not align the sample in the usual way so that the
( 00 ) spot is back - reflected into the electron gun . because of this
intentional misalignment , we were able to image the diffraction spots
in close proximity to the specular ( 00 ) spot , but it also resulted
in a geometrical distortion of the diffraction pattern .
structure model
of the quinacridone monolayer on ag(111 ) as deposited
at room temperature .
the hexagonal mesh represents the ag(111 ) lattice .
at each intersection of the gray lines
the solid
and dotted lines separate neighboring quinacridone molecules as in
the overlay in the stm image of figure 4 . while
the molecules in the stacks all have the same handedness , a minority
of the molecules with the
handedness forms defects
which introduce antiphase domains with a phase shift corresponding
to half an intermolecular spacing along the row direction .
( a ) leed pattern of a monolayer of quinacridone deposited
on the
ag(111 ) surface at room temperature .
the sample was intentionally misaligned
so that the electron gun did not hide the diffraction spots around
the ( 00 ) diffraction beam .
( b ) simulated leed pattern on the basis
of the superstructure given by the matrix in eq 1 . besides the ( 00 ) spot , the ( 10 )
and the ( 01 ) spot of the silver
substrate can be identified in the leed pattern in figure 6a .
this allows determining the symmetry axes of
the substrate , i.e. , the 112 directions ( indicated
by the dotted lines in figure 6 ) and calibrating
the scale of the observed pattern .
the most prominent
features induced by the quinacridone adlayer are the two rings centered
around the ( 00 ) spot with radii a * and b*. the inner ring consists of 12 individual spots .
these 12 spots
form six pairs which are azimuthally centered in the middle of the
60 sector defined by the ( 00 ) , ( 10 ) , and ( 01 ) substrate peaks ;
i.e. , each pair is split symmetrically around the 110
direction of the substrate .
the radius b * of the
inner ring corresponds to a distance b = ( 2.00
0.17 ) nm in real space , which exactly matches the spacing between
neighboring rows of quinacridone molecules ( see figures 3 and 4 ) . as in the following ,
the experimental
error was always estimated from the width of the diffraction spots .
any distortion of the pattern , which is obviously present in figure 6a , is neglected . in agreement with the stm findings
concerning the relative orientations of the different rows of molecules
( figure 3 )
, the splitting between the two spots
forming a pair with respect to the 110 direction
is about 2025. this is fully consistent with the
stm observation showing molecular rows with an inclination of 11
with respect to the 112 direction . the
second ring with radius a * , marked with a
dash - dotted line in figure 6 , also consists
of 2 6 = 12 intense spots , but their azimuthal position is
rotated by 90 with respect to the inner ring .
in addition , six
additional very faint spots are located just slightly outside this
ring . the radius a * of the second ring
can be attributed
to the measured spacing a between neighboring molecules
in a close - packed stack . here
we find a real space value of a = ( 0.72 0.05 ) nm . upon closer inspection of the
leed pattern in figure 6a
, one can identify
rather diffuse rings with radii 2a * and 3a * which are concentric around the central ( 00 ) spot .
an
important detail for the structural analysis is that the ring with
radius 3a * does not intersect the first - order diffraction
spots of the substrate but has a radius which is about 7% larger than
the length of the { 10 } reciprocal lattice vectors of the substrate .
taking into account the so - derived values for a and b , the orientation with respect to the symmetry directions
of the substrate as well as the commensurability along the a - direction one arrives at a superstructure unit cell which
can be expressed in matrix notation as1for the two mirror domains , respectively .
the half integer values in the second row ( i.e. , along the b - direction ) suggest that the superstructure is actually
high - order commensurate with a commensurate coincidence
lattice with twice the lattice constant b and two
inequivalent quinacridone molecules within the commensurate supercell .
the primitive unit cell given by eq 1 is also
the basis for the model drawn in figure 5 .
within each close - packed stack all the molecules
have the same orientation
and , therefore , the same handedness on the surface .
the fact that
there are two antiphase domains with a relative shift of a/2 along the row direction and that no moir pattern was observed
in the stm images is consistent with a simple commensurability of
the structure along the a - direction ; i.e. , all the
molecules within the stacks are located on equivalent adsorption sites
on the ag(111 ) surface . for the model depicted in figure 5 we assumed that the center of the molecule is located
above a 2-fold bridge position of the substrate . in this case , also
the two outer aromatic rings are located very close to bridge sites .
moreover , the molecules in different antiphase domains and in neighboring
rows would also rest on bridge sites , albeit nonequivalent ones . a
similar arrangement , in which all the molecules are located on a single
type of lattice sites ,
although this might be a good argument in favor of this particular
adsorption geometry , the experimental data do not allow to determine
the absolute positions of the molecules .
the matrix is rather
speculative for the b direction
( i.e. , the second row of the superstructure matrix ) as neither stm
nor the leed measurements at low electron energies are free of distortions .
however , in the case of more complicated modes of epitaxy like point - on - line
or point - on - point structures , moir
patterns are usually observed in the stm images , which can help to
track down the structure . in our case
moreover , changing the values of the bottom row of the
matrix , i.e. , ( 1.5 , 6 ) or ( 1.5 , 7.5 ) , by 10% ( which
is an upper limit for the experimental uncertainty ) would fundamentally
change the symmetry of the unit cell , which would then be no longer
perfectly rectangular .
in addition , the arguments concerning a possible
single adsorption site for all quinacridone molecules would no longer
be valid .
although there is a good general agreement concerning
the main
features and symmetries between the simulated and the measured leed
pattern ( see figure 6a ) , the simulation predicts
many more spots . to make the simulation more accurate , the structure
factor of the quinacridone molecule
in addition , the stm data
show that the periodicity along the rows is quite often interrupted
by defects introducing antiphase boundaries between
consecutive stacks of molecules . for a realistic description of the
experimental leed pattern
the structural
properties of a quinacridone monolayer adsorbed on the ag(111 ) surface
change completely if the sample is heated up to 550 k. this temperature
corresponds to the one used in the evaporator during the preparation
of the quinacridone thin film .
therefore , we assume that excess molecules
in the second and higher layers gain enough thermal energy so that
they can desorb from the sample , whereas the quinacridone molecules
in the first monolayer in direct contact with the ag(111 ) substrate
remain on the surface . indeed , it is quite common that the desorption
of the molecules in the first monolayer of an organic film desorb
at significantly higher temperatures than those in the multilayer
. one can take advantage of this effect to prepare
well - defined molecular monolayers : at first , several layers of the
organic molecule are deposited , and subsequently all but the first
molecular layer are desorbed by heating the sample appropriately .
in the present case , quinacridone monolayers which were prepared by
depositing a single layer of molecules and subsequently heated ( see
figure 9a ) and those which were prepared by
multilayer desorption ( see figures 7 and 8) exhibit the same structure .
it is surprising
that the thermally treated samples have a completely different structure
( see figures 7 and 8) as compared to those deposited at room temperature without further
heating ( see figure 3 ) . the domains are often
larger than 50 nm in both lateral dimensions although the structures
may also be interrupted by discommensuration lines as seen , for instance ,
in figure 8 .
accordingly , the leed pattern
shown in figure 9a exhibits much sharper spots
than the nonannealed samples ( figure 6a ) .
the
stm images in figures 7 and 8 reveal rows of parallely stacked quinacridone molecules .
the row direction now coincides with the 110
symmetry axis of the substrate . while in the nonannealed case all
molecules were uniformly aligned along the rows ( a a stacking ) ,
the molecules in the annealed monolayer exhibit a kind of a
b
stacking . depending on the resolution of the stm tip ( and the tunneling
parameters ) , we can recognize two inequivalent molecules ( a and b
in figure 7 ) . along the molecular rows ( a - direction )
, the molecules are alternately shifted left
( a ) and right ( b ) in the direction of the b - axis
of the unit cell indicated in figure 7 .
the
stm image in figure 8 further reveals that
their are two possible , mirror symmetric arrangements of the molecules
for a given row direction , since the orientation of the b - axis is not perpendicular to the row direction . stm image of a quinacridone
monolayer on ag(111 ) , prepared by multilayer
desorption : a thick film was deposited while the sample surface was
held at room temperature . after deposition
, the temperature of the
sample was raised up to about 570 k , and then the heating was stopped .
the aim of this procedure was to desorb all molecules in excess of
one monolayer .
the stacking direction of the molecules now coincides
with the 110 symmetry axis of the substrate .
the image has a size of 20 20 nm and was acquired
with a bias voltage of u = 300 mv and a constant
tunneling current of i = 30 pa .
the inset shows an
averaged pattern obtained with the auto mesh average
algorithm of the wsxm software from an
stm image similar to the one shown here .
stm image of a quinacridone monolayer on ag(111 ) prepared by multilayer
desorption ( see text and figure 7 ) .
the image
has a size of 20 20 nm and was acquired with a
bias voltage of u = 1.0 v and a current set
point of i = 25 pa .
the mirror axis ( dashed
line ) is parallel to the row direction ( thick arrows ) and coincides
with the 110-direction of the substrate .
we measured the distance between equivalent molecules ,
i.e. , from
one a molecule to the next a molecule
along the row direction , to be a = ( 1.46 0.01 )
nm .
the distance between adjacent a and b
molecules is just half of this value , namely 0.73 nm , consistent with
the width of a single quinacridone molecule . for the spacing between
equivalent molecules in neighboring rows ,
we find a value of b = ( 1.69 0.01 ) nm . the angle between the two unit
cell vectors a and b is = ( 110 1) ( see inset in figure 7 ) . because of the dimer stacking
ab ab ,
the unit cell is no longer primitive but contains at least two molecules .
in fact , a closer inspection of figure 8 reveals that the orientation of the molecules in the two
mirror domains differs by ( 44 2). therefore , the long
axis of the molecules is rotated by ( [ 90 + 22 ] 2) = ( 112
2) with respect to the direction of the rows , which coincides
with the b - direction within the experimental error .
the pattern
looks much simpler than the one of the as - prepared surface ( see figure 6a ) .
the inner structure around the ( 00 ) spot is
just a simple hexagon .
the distance b * of these six
spots nearest to the ( 00 ) spot corresponds to a distance in real space
of b = ( 1.66 0.22 ) nm , which agrees well with
the value for the spacing between neighboring rows as extracted from
the stm images .
in addition , the six spots are located on the 112
symmetry axes of the substrate .
this confirms that the rows are aligned
along the 110-directions of the substrate because
this arrangement gives rise to a periodicity b along
the orthogonal 112-directions in the diffraction
pattern .
( a ) leed pattern of quinacridone on ag(111 ) after deposition of
slightly more than one monolayer at room temperature and subsequent
annealing at 550 k. the leed pattern was acquired with an electron
energy of 30 ev . the sample is intentionally misaligned so that the
electron gun does not hide the diffraction spots around the ( 00 ) beam .
the simulation is based
on the commensurate unit cells given in eq 2 and takes into account the 6-fold symmetry of the substrate .
the
kinematic simulation assumes point scatterers at the centers of the
molecules . outside the inner hexagon
the faint spots on the
sides of this hexagon occur in pairs centered around the 110-directions
at a distance 2a * from the ( 00 ) spot , which corresponds
to a spacing of a/2 = ( 0.74 0.04 ) nm . within
the experimental error this value is identical to the spacing between
neighboring a and b molecules as deduced from the stm images in figure 7 .
the two spots in each pair are split azimuthally
by 23 with respect to the 110
symmetry axes of the substrate .
the leed pattern can be explained
by a reciprocal unit cell and its mirror image indicated by the solid
and dashed lines in figure 9 , respectively .
in total
, there are six possible configurations for the unit cell :
three rotationally equivalent domains for each of the two mirror symmetric
superstructures .
transformation into real space yields the two characteristic
matrices2for the two
mirror domains .
these suggested
unit cells are also the basis of the kinematic leed simulations shown
in figure 9b , which are in very good agreement
with the measured leed pattern in figure 9a .
note that the first - order superstructure spot ( 10)s along
the a * direction ( and all other odd multiples ) are
absent in the leed pattern , such that only every other spot with a
spacing of 2a * can be seen .
this is due to the fact
that the superstructure unit cell is not a primitive one but contains
a second molecule at a position a/2 + b , i.e. , halfway along the molecular rows and shifted
by a fraction along the b - axis . as a result
,
the structure factor ( which is included in the kinematic simulations )
leads to an extinction of all the odd - numbered diffraction spots along
the a*-axis , independent of the relative shift .
however , other ( off - axis ) diffraction spots containing an odd multiple
of a * , like the ( 11)s spot , may
have a nonvanishing intensity depending on the value of . in
fact , the kinematic structure factor for the ( 11)s spot
varies as sin( ) .
this means that the ( 11)s spot is fully extinct for a perfectly uniform stacking (
= 0 ) but acquires maximum intensity for a centered c(2 2 ) type
arrangement ( = 1/2 ) . in the latter case , the odd - numbered
spots along the b*-axis would carry zero intensity .
since the ( 11)s spot ( which is located next to a ( 01)s spot of another rotational domain ) could not be detected
with a measurable intensity and since the ( 01)s spot is
very bright , we can conclude that the relative shift along
the b - axis between molecules a and b in the unit
cell is closer to 0 than to 0.5 . because of the different appearance
of the two inequivalent molecules a and b in the stm images ( see figure 7 ) , their relative shift is hard to judge
but should be in the range between 0.1 and 0.2 , in accordance with
the leed simulation .
model of the annealed monolayer of quinacridone on ag(111 )
as described
in the text .
the labeling of the molecules accounts for the inequivalent
sites in the unit cell ( a and b ) and
the different 2d - handedness of the molecules on the surface ( r
and l ) .
on the basis of the experimental findings , we propose a structure
model for the annealed quinacridone monolayer on ag(111 ) , which is
illustrated in figure 10 .
the model is based
on the unit cells in eq 2 with two flat - lying
molecules aligned along the b - axis and shifted by
a certain fraction along this axis . in order to arrange the
molecules within the unit cell
, we tried to optimize the number of
hydrogen bonds , especially those between the oxygen and the nh group
of adjacent molecules . in doing so
, we realized that the periodic
indentation of the molecules along the rows is incompatible with a
enantiopure stacking .
this would rather lead to uniform , quasi - one - dimensional
rows oriented perpendicular to the molecular long axis , as observed
in the nonannealed monolayer phase ( see figure 5 ) .
likewise , stacking molecules with alternating handedness would
also favor straight rows of molecules but with their long axis inclined
against the direction normal to the rows .
in fact , the periodic indentation
together with the observed inclination of the molecules can best be
accounted for by a combination of the two limiting cases , i.e. , a
sequence of homochiral dimers with alternating handedness . as a result ,
al bl
as shown in figure 10 is obtained where a
and
b refer to the two inequivalent lattice sites
and r ( right ) and l ( left ) denote
the two different 2d - chiral enantiomers .
we want to emphasize that
( i ) we have no experimental proof for this peculiar stacking sequence ,
apart from the intuitive arguments concerning the lateral interaction
strength , and ( ii ) we do not know the exact position and orientation
of the two molecules within the unit cell , except that the molecules
should be ( nearly ) parallel and aligned , within a few degrees , along
the b - axis ( 9 with respect to the nearest
110 axis of the substrate ) .
the biggest uncertainty
is the amount of the offset along the b - axis between
molecules a and b. varying this parameter ( ) , we can make the
stacking such that the hydrogen bonds between neighboring molecules
either form straight lines ( as chosen in figure 10 ) or zigzag chains across the molecules . clearly , submolecularly
resolved stm images and/or theoretical calculations are needed to
clarify these points . a direct consequence of the suggested
ar br al bl
stacking is that the actual periodicity along the rows ( a - direction ) is increased by a factor of 2 , so that the actual superstructure
unit cells taking into account the 2d - chirality of the molecules should
be given by3for the two
mirror domains .
each unit cell
thus contains four molecules ( two entantiomers with opposite handedness
for each of the two sites a and b ) .
the fact that neither the stm
images nor the leed patterns are sensitive to the doubling of the
periodicity from a to 2a along the
molecular rows is easily explained : the doubling of the periodicity
is solely due to the different handedness of adjacent quinacridone
dimers .
our stm studies were conducted at room temperature , and the
images do not allow to resolve the fine contrast between different
enantiomers .
as far as the leed measurements are concerned , the atom
factors for the backscattering of 30 ev electrons for the elements
carbon , nitrogen , and oxygen are almost the same , while the contribution of the hydrogen atoms can be totally
neglected .
in addition , the symmetry of the quinacridone molecules
reduces the effect of the 2d - chirality even further : the contribution
to the molecular structure factor of 18 carbon atoms , which do not
change their relative positions upon mirroring the quinacridone molecule
along its long axis , clearly outweigh the contribution of the two
carbon , two oxygen , and two nitrogen atoms , which actually exchange
positions .
therefore , the diffraction contrast between the two enantiomers
of the quinacridone molecules adsorbed on the surface is likely too
small to provide enough intensity at the half - integer positions along
the a*-direction in the leed pattern .
the
structures of the first layer of quinacridone can best be compared
to the phase discussed by paulus and co - workers
in ref ( 9 ) .
table 1 shows our data vis - - vis the ( 111 )
plane of this bulk polymorph .
only the polymorph
exhibits a primitive unit cell . for the other polymorphs ,
the unit
cell contains two molecules which are tilted with respect to each
other . in the polymorphs ,
each molecule interacts with four
of its neighbors via hydrogen bonds in a nonplanar geometry . in the
case of the and the polymorph ,
neighboring molecular rows do not share the same plane but are tilted
or vertically shifted , depending on the crystal plane that is used
to cut through the crystal .
a rather flat configuration is obtained
for the low index ( 112 ) plane of the polymorph .
therefore , we compare the quasi - two - dimensional monolayer structures
of quinacridone on ag(111 ) with this particular plane .
z represents
the number of molecules per unit cell given by the length of the vectors a = |a| and b =
|b| and the angle ( ) between the
two .
the final column contains the calculated area per molecule , i.e. , a = cos ab / z . for the as - prepared and
the annealed monolayer of quinacridone
on ag(111 ) , an intermolecular spacing of about 0.7 nm is found along
the stacking direction .
this is quite similar to the distance between
adjacent molecules along the direction of the polymorph , which amounts to 0.69 nm . along this direction
parallel
aligned molecules form hydrogen bonded stacks and can thus maximize
their binding energy .
whereas also the direction and the length
of the second unit cell
vector b of the annealed phase matches almost
perfectly the values of projected bulk unit cell , there are significant
differences between the as - prepared structure of quinacridone and
its polymorph . as quantified in table 1 , the annealed monolayer of quinacridone is considerably
denser than the as - prepared monolayer at room temperature . in the
early stage of deposition , the substrate surface will impose a particular
adsorption geometry ( with a mirror symmetric orientation for the two
2d - chiral enantiomers ) .
other quinacridone molecules will preferentially
attach via strong hydrogen bonds in a parallel configuration , thus
forming straight enantiopure stacks which assemble into extended domains
of molecular rows .
although the packing density in the nonannealed
phase is rather low , this structure is stable for days .
therefore ,
it is likely that the energy barrier required to initiate the transition
from the nonannealed phase into the more densely packed heterochiral
phase is considerably higher than the thermal energy available at
room temperature .
in fact , the temperature required to trigger the
transformation is only slightly lower than the sublimation temperature
of the quinacridone bulk phase .
this makes sense
if one considers that the transition from the homochiral phase into
the heterochiral phase upon annealing requires the breaking of the
strong hydrogen bonds between molecules originally arranged in homochiral
stacks .
the growth
and the monolayer stuctures of quinacridone on ag(111 )
were investigated by peem , stm , and leed .
the quinacridone molecule
is prochiral , since it acquires a handedness when adsorbed flat on
a surface .
for room temperature deposition a superstructure
and its
mirror domains are
obtained .
the structure is characterized by stacks of quinacridone
molecules of a few nanometers length , which assemble into quasi - one - dimensional
molecular rows .
the individual stacks and the row direction is oriented
at + 10.9 and 10.9 with respect to the 112
symmetry axis of the ag(111 ) surface .
the perpendicular orientation
of the molecules in the stacks and along the rows is a strong indication
that these are composed of molecules with the same handedness .
( probably molecules
with the wrong handedness ) , which introduce a large
number of antiphase boundaries . upon annealing at high temperature ,
the monolayer structure changes
completely . from the stm and leed data a well - ordered superstructure ,
containing two
molecules
per unit cell , and its mirror image are inferred . in the annealed
phase the quinacridone molecules also form extended rows , but the
molecules are no longer oriented perpendicular to the row direction .
in addition , every second molecule is shifted along the b - axis of the superstructure unit cell , such that rows are periodically
indented .
instead , we propose a stacking sequence of homochiral pairs
of molecules with alternating handedness . taking this heterochiral
ordering into account would double the periodicity along the rows
( a - direction ) , leading to a superstructure ( with four atoms
per unit
cell ) and the corresponding mirror image .
the observed monolayer
structures are the result of two competing
effects : ( i ) the interaction between the quinacridone molecules , in
particular , the strong hydrogen bonds connecting neighboring molecules
in the stacks , and ( ii ) the 2d - chirality of the adsorbed quinacridone
molecules which determines the arrangement of the molecules within
these stacks . as a result
, two very distinct structures can be stabilized
on the ag(111 ) surface for which the particular stacking sequence
is intimately linked with the different chiral ordering .
finally ,
the interaction between the quinacridone molecules and the ag(111 )
surface is responsible for the flat - lying geometry of the molecules
as well as the particular epitaxial relationships of the monolayer
structures , namely the specific orientations of the molecular rows
and the commensurability of the superstructures . in order to
transform the ( metastable ) nonannealed homochiral phase
into the denser heterochiral phase ,
the former has to be annealed
at very high temperature , as the chiral reodering requires the breaking
of the strong hydrogen bonds . | quinacridone ( qa ) has recently gained
attention as an organic semiconductor
with unexpectedly high performance in organic devices .
the strong
intermolecular connection via hydrogen bonds is expected to promote
good structural order . when deposited on a substrate ,
another relevant
factor comes into play , namely the 2d - chirality of the quinacridone
molecules adsorbed on a surface . scanning tunneling microscopy ( stm )
images of monolayer quinacridone on ag(111 ) deposited at room temperature
reveal the formation of quasi - one - dimensional rows of parallel quinacridone
molecules .
these rows are segmented into short stacks of a few molecules
in which adjacent , flat - lying molecules of a single handedness are
linked via hydrogen bonds .
after annealing to a temperature of t = 550570 k , which is close to the sublimation
temperature of bulk quinacridone , the structure changes into a stacking
of heterochiral quinacridone dimers with a markedly different intermolecular
arrangement . electron diffraction ( leed ) and
photoelectron emission
microscopy ( peem ) data corroborate the stm findings .
these results
illustrate how the effects of hydrogen bonding and chirality can compete
and give rise to very different ( meta)stable structures of quinacridone
on surfaces . |
liver tumors are the third most common malignancies of the gastrointestinal tract worldwide . in the western world
, secondary liver tumors are more frequent than primary ones , even though the incidence of hepatocellular carcinoma ( hcc ) has been increasing over the last 20 years , especially in males .
nearly 80% of liver tumors are diagnosed in advanced stages precluding curative therapies , and tumor markers for the early detection of liver growth lack high levels of sensitivity and specificity .
currently , -fetoprotein ( afp ) and carbohydrate antigen 19.9 ( ca19.9 ) are the most frequently used serum markers to detect hepatocellular carcinoma and cholangiocarcinoma , respectively [ 49 ] .
carcinoembryonic antigen ( cea ) is frequently used for detection and followup of colorectal liver metastases ; however it may be increased in many other medical conditions .
the ideal biomarker for early detection of liver cancer would be specific for the malignant condition and sensitive enough to detect the neoplasm at an early stage , when treatment is still possible .
serum metabolites related to oxidative stress are thought to be a potential biomarker for the early detection of cancer [ 12 , 13 ] .
tumor necrosis factor-(tnf-)and other cytokines have been implicated in promoting a low - energy intake with increased energy expenditure and negative energy balance , likely due to tumor growth .
found a significant elevation in tnf and il-6 along with a reduced activity of the enzyme glutathione peroxidase in patients with advanced stages of various cancers ( stage iii or iv ) .
glutathione peroxidase is considered a surrogate marker for body oxidative stress and its reduction may be due to a reduction of its substrate availability , reduced glutathione [ 12 , 13 ] .
in addition , reduced glutathione concentrations in plasma were significantly lower in patients with advanced cancer from different organs including renal , breast , lung , and colon cancers [ 1416 ] .
the glutathione ( gsh : gssg ) redox couple is one of the main cellular defenses against oxidative stress [ 1417 ] .
failure of the glutathione redox buffer system may result in mitochondrial failure and cell apoptosis .
ophthalmate ( oa ) is an analogue of glutathione in which the cysteine moiety is replaced by l-2-aminobutyrate , a catabolite of threonine .
oa synthesis occurs when same enzymes that catalyze the assembling of glutathione find cysteine availability low .
it was recently reported that the concentration of ophthalmate in rat liver and plasma increases when oxidative stress is induced by acetaminophen .
the liver has the highest concentration of reduced glutathione in the body , but the liver ophthalmate pool is very small ( 1% of the size of gsh : gssg ) since it is actively transported out of the cell .
we hypothesized that early stages of liver tumor growth may enhance cell oxidative stress with alterations of the redox state of the glutathione system , promoting an increase in ophthalmate concentration .
our laboratory developed a technique of stable isotopomer analyses for the measurement of the gsh / gssg / oa redox system by the labeling of glutathione species and oa from a deuterated water ( h2o ) load .
in addition , the vx2 rabbit model is a reliable model of secondary liver tumors .
first developed by shope and hurst in 1933 , the vx2 carcinoma is an anaplastic squamous cell carcinoma derived from a virus - induced papilloma .
it has been extensively used to induce the growth of secondary liver tumors [ 2024 ] .
thus , to test our hypothesis we made use of both the vx2 model and of new mass spectrometric techniques to measure the concentration and labeling of the gsh / gssg / oa redox system from deuterium - enriched body water .
a. exner laboratory ( case western reserve university school of medicine , cleveland , oh ) .
tumor donor rabbit ( f1 ; n = 1 ) was developed by intramuscular injection of the vx2 cell line in the thigh muscle ( vastus lateralis ) of a new zealand white male rabbit as previously described in .
after four weeks , the tumor was harvested and minced into tissue cubes of 1.0 mm and saved at 70c in fbs with 10% dmso until implantation . on the day of tumor implantation , grafts were thawed and washed three times in hanks ' buffered salt solution ( hbss ) .
general chemicals and reagents were obtained from sigma - aldrich ( st louis , mo ) .
deuterated water ( h2o at 99.9% , glass distilled ) was procured from isotec ( miamisburg , oh ) .
adult new zealand white male rabbits ( n = 8 ; covance , princeton , nj ) weighing 2,5003,000 g were placed in quarantine for 15 days prior to any experiment and kept under standard conditions of day cycle , temperature , and humidity with food ( rabbit chow , nj ) and water ad libitum .
studies on the animals were approved by the institutional animal care and use committee ( iacuc ) at case western reserve university and carried out according to its guidelines .
all surgical procedures were performed under sterile conditions and under the influence of intramuscular anesthesia with xylazine ( 5 mg / kg ) , ketamine ( 50 mg / kg ) , and acetylpromazine ( 10 mg / kg ) .
depth of anesthesia was monitored by recording heart rate , respiratory rate , eye reflex , and response to stimulus .
surgical site was shaved and swabbed with providian - iodine solution ( betadine , mi ) and marcaine 0.25% without epinephrine was administered subcutaneously for local anesthesia .
tumor recipient rabbits ( f2 ; experimental group , n = 6 ) underwent median laparotomy with implantation of vx2 tumors at two separate liver sites ( right medial and right posterior lobes ) through a 2 mm incision in the liver capsule and each site was closed and labeled with a 6 : 0 prolene suture ( ethicon , nj ) .
other rabbits underwent similar operative procedures with the implantation of gelfoam ( ethicon , nj ) as grafts .
they served as a control group ( f2 ; sham group , n = 2 ) ( figure 1 ) .
rabbits were given buprenorphine ( 0.3 mg / ml at a dose of 0.1 mg / kg ) ( sigma , mo ) administered subcutaneously twice daily for two days following any procedure .
penicillin ( 300,000 units / ml at a dose of 50,000 units / kg ) and gentamicin ( 40 mg / ml at a dose of 3 mg / kg ) were injected subcutaneously ( sc ) prior to the procedure and once daily for the two postoperative days .
20 ml of normal saline ( 0.9% ns ) was given sc after the procedure for insensible water losses .
all animals were monitored three times a day for 72 hours and then twice a day until animals were sacrificed .
biopsies of liver tissue adjacent to the tumor and from healthy tissue from the lobe without tumor were immediately frozen on liquid nitrogen , labeled and stored at 80c for further analysis and the rest was perfused - fixed with 10% formaldehyde and 90% pbs at room temperature .
slides of liver tissue from normal and tumor growth were paraffin embedded and submitted for standard hematoxylin and eosin ( h & e ) staining .
the largest tumor diameter and its calculated area were saved from each tumor using digi3 digital binocular microscope with digipro3.0 software ( labomed , ca ) .
f2 rabbits were injected intraperitoneally with saline made up in deuterated water 14 days prior and 10 days after the tumor implantation surgery . the volume of injection was calculated to achieve a 5% h - enrichment in body water , assuming that total body water accounts for 2/3 of body weight . since the oxidation of foodstuffs and endogenous substrates yields unlabeled water , the rabbits were given 5% h - enriched drinking water for 72 hours .
blood draws ( 1.5 ml ) were taken for 3 consecutive days from the marginal ear vein at days 13 , 12 , and 11 from tumor implantation ( day 0 ) and at days + 11 , + 12 , and + 13 after tumor implantation .
the amount of blood and the number of draws were regulated by the animal committee at case .
plasma was isolated after centrifugation at 3,000 rpm at 4c for 10 min . to prevent its oxidation ,
gsh was immediately converted to a stable thioether by treating 100 l of plasma with 100 l of 50 mm iodoacetate in 10 mm ammonium bicarbonate , ph 10 , adjusted with concentrated ammonia .
aliquots were saved on liquid nitrogen and stored at 70c for lc - ms / ms processing .
glutathione species and ophthalmate concentrations and labeling were measured in plasma samples with mass spectrometry methods .
liquid chromatography - mass spectrometry ( lc - ms / ms ) processing details are described elsewhere .
( wood dale , il ) and ophthalmate from bachem ( torrance , ca ) .
acetonitrile and dmso were procured from fisher scientific ( pittsburgh , pa ) . in brief , a hypersil gold c18 column ( 2.1 150 mm , 5 m particle size ; thermo electron corp . )
mobile phase a was 0.15% formic acid in water - acetonitrile ( 99 : 1 , vol / vol ) , and mobile phase b was 0.15% formic acid in water - acetonitrile ( 5 : 95 vol / vol ) .
using a gradient elution , the compounds were eluted at a flow rate of 0.2 ml / min . the liquid chromatograph ( agilent 1100 ; agilent technologies inc .
, palo alto , ca ) was coupled to an api 4000 qtrap mass spectrometer ( applied biosystems , foster city , ca ) operated under positive ionization mode .
the mrm ion pairs were monitored to acquired data used to calculate isotopic enrichments from precursorproduct pairs .
the ion pairs monitored were ( i ) for carboxymethyl - gsh : 366.1237.2 , 367.2237.1 , and 367.2238.1 , ( ii ) for cyanomethyl - gsh derived from gssr : 347.2272.1 , 348.2218.1 , and 348.2219.1 , ( iii ) for carboxymethyl - homo - glutathione : 380.1233.1 , ( iv ) for cyanomethyl - homo - glutathione : 361.1232.1 , and ( v ) for ophthalmate : 290.3 161.1 , 291.3 161.1 , 291.3 162.1 . the m3 mol percent enrichment of the gsh derivative is calculated as m3/(m + m1 + m2 + m3 ) .
liver tissue was processed and submitted to gas chromatography - mass spectrometry ( gc - ms ) for measurement of cysteine .
powdered frozen tissue ( 25 mg ) spiked with 5 nmol of heptadecanoic acid ( c17 ) as internal standard was extracted with 2 ml of ch3cn / methanol ( 1 : 1 precooled at 12c and degassed with n2 flow ) using a polytron homogenizer .
derivatization was carried out in two steps : 30 l of 15 mg / ml of methoxyamine hydrochloride in dry pyridine was added to samples and incubated at 30c for 90 minutes .
after this 70 l of n - methyl - n - trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane ( mstfa + 1% tmsc ) was added and the mixture was incubated again at 37c for 40 min .
analyses were carried out on an agilent 5973 mass spectrometer , linked to a model 6890 gas chromatograph equipped with an autosampler .
a phenomenex zb-5 msi capillary column was used ( 30 m length , 0.25 mm i d , 0.25 m film thickness ) .
the carrier gas was helium ( 1.67 psig ) and injection was 1 l in splitless mode .
the gc temperature program was : initial temperature 60c , hold for 1 min , increase by 10c / min to 325c , and hold 10 min .
peak identification was carried out by matching retention time and mass spectra similarity against the metabolomic fiehn library ( agilent technologies inc , santa clara , ca ) .
for further quantification , the data was exported to the spectconnect server ( massachusetts institute of technology , cambridge , ma ) .
the relative concentration of cysteine was expressed as its relative area ( divided by the area of the internal standard in the same chromatogram ) .
paired students t - test was used to calculate significance of difference in the mean values from similar groups before and after tumor implantation ( spss 16.0 , windows version licensed to case western reserve university ) .
anova and one - sided independent students t - test were used to calculate significance of difference in the mean values between the experimental group and the control group .
tumor growth was found in all six animals ( 100% ) at the time of sacrifice two weeks after tumor implantation ( figure 2 ) .
the mean size of tumor growth ( n = 12 tumors in 6 animals ) was 8.4 5.96 mm ( mean sd of max .
rabbits from the control ( sham ) group had normal livers with no visible gelfoam on second laparotomy .
plasma concentrations of reduced glutathione ( gsh ) and oxidized - bound glutathione ( gssr ) were not significantly different in rabbits from the experimental group before and after tumor implantation ( p > .05 , paired t - test ) ( figure 3 ) .
glutathione plasma concentrations from rabbits in the experimental group , either before or after tumor implantation , were similar to the ones in the sham group ( p > .05 , one sided t - test ) ( figure 3 ) .
furthermore , the labeling of gsh and gssr in plasma was similar in experimental rabbits before and after tumor implantation ( p > .05 by anova and by independent student t - test at 24 , 48 , and 72 hours after deuterium enrichment ) ( figures 4 - 5 ) .
labeling of glutathione species in plasma , was also similar in experimental animals when compared to sham animals ( p > .05 ) .
ophthalmate plasma concentration before tumor implantation was similar in rabbits from the experimental group when compared to the control ( sham ) group ( p > .05 , one - sided independent t - test ) ( figure 6 ) .
in contrast , plasma concentrations of ophthalmate were significantly higher in rabbits from the experimental group when compared to the sham group , after tumor implantation at all time points ( p < .05 , anova and one - sided independent t - test ) .
furthermore , plasma concentrations of ophthalmate were significantly higher in rabbits from the experimental group in the state of tumor growth when compared to concentrations at their healthy state ( p < .05 , paired t - test ) . the plasma concentration of ophthalmate was similar in the control group before sham surgery when compared to the levels from the same group after sham surgery ( p > .05 , paired t - test ) .
plasma labeling of ophthalmate in experimental animals in their status of health was comparable to the labeling in their status of tumor growth and to sham animals ( p > .05 , by anova and independent student t - test at 24 , 48 , and 72 hours after deuterium enrichment ) ( figure 7 ) .
the relative concentration of cysteine , an amino acid precursor of gsh , was found to be significantly lower in liver tissue adjacent to the tumor when compared to liver tissue from the lobe not containing tumor ( p < .05 paired t - test , figure 8) .
liver tissue relative concentrations of cysteine were similar between the experimental group ( both liver adjacent to the tumor and liver away from tumor ) when compared to the sham group ( p > .05 , independent t - test ) .
we hypothesized that animals undergoing early tumor growth may be subject to an increase oxidative stress with disturbance of their gsh / gssg redox buffer system , and a parallel increase in the production of ophthalmate .
the present studies showed that both the concentrations as well as the labeling of glutathione species were similar in the state of health compared to the state of early tumor growth in the vx2 rabbit model .
in contrast , the concentration of oa increased significantly from animals in the state of early tumor growth when compared to their healthy state and to sham animals . the small size of the ophthalmate pool makes oa a potential sensitive index of oxidative stress linked to variations in the rate of gsh synthesis and of cysteine availability .
the turnover of the glutathione species pool in the liver occurs rapidly , 2 - 3% per minute in the basal rate , even though its large size . while the plasma pool of gsh : gssg is very small , its turnover is similar to that of the liver .
thus , the turnover of plasma gsh : gssg is a proxy of the turnover of the liver gsh : gssg . in this animal model ,
a secondary liver tumor grew for two weeks compared to a control ( sham ) group .
the concentrations of plasma gsh and gssg as well as the [ gsh]/[gssg ] ratio and their plasma labeling were similar in this model of early tumor growth compared to controls . using the turnover of glutathione species in plasma as a proxy of the liver
, the previous finding may suggest the strength of the glutathione redox buffer system in the nonaffected liver lobe in the early stage of tumor growth .
intracellular gsh oxidation in further developed to advanced and undifferentiated tumors is associated with an increase in glutathione peroxidase activity with further increase in its oxidized form gssg and a significant decrease in the [ gsh]/[gssg ] ratio in plasma [ 1216 ] .
the concentrations of plasma ophthalmate increased ~10-fold ( p < .05 ) over the concentrations assayed in the same animals before tumor implantation and over the concentrations assayed in the control group before and after the sham operation .
however , there was no difference in the profile of h - labeling of plasma ophthalmate . the first study to recognize ophthalmate as a biomarker for oxidative stress and hepatic gsh depletion used a metabolomic approach to detect the changes that occur following acetaminophen - induced hepatotoxicity in mice ; they found an ~5-fold increase in plasma and liver ophthalmate 1 hour after the administration of the drug , and this finding was associated with a depletion of gsh in liver tissue .
no previous study to our knowledge has assessed oxidative stress metabolites as a possible diagnostic biomarker for liver cancer .
our results suggest that during early liver tumor growth there is a significant amount of oxidative stress resulting in increased intracellular glutathione oxidation , producing gssg and depleting gsh in the affected part of the liver , suggested by the elevation of ophthalmate levels in plasma .
furthermore , analysis of liver tissue samples showed a decrease in the levels of cysteine , a precursor of gsh , in the immediate surroundings of the tumor when compared to the healthy side of the liver .
thus , we hypothesize that the gsh depletion associated to cysteine consumption described by soga et al . in 2006
is indeed a local phenomenon , in this case , associated with the early growth of a secondary liver tumor which may be causing oxidative stress in its immediate surroundings .
while most of plasma gsh / gssg comes from the liver , their total plasma concentrations and labeling were not affected in the experimental group .
it may suggest the mass of liver tissue under stress was smaller in proportion to the mass of liver with a more normal metabolism . this ratio may change as the tumor grows .
ophthalmate does not contain a thiol group , thus it does not participate in the many thiol - dependent reactions of glutathione . since the proportion of ophthalmate to glutathione is small , the concentration of ophthalmate should be reflected more rapidly than that of plasma gsh : gssg even though the turnover of ophthalmate remained constant .
this makes ophthalmate a good model to study the disturbances of the glutathione buffer system during oxidative stress .
the body redox systems , which include antioxidant enzymes and low molecular weight antioxidants , may be deregulated in cancer cells along with tnf- and il-6 . moreover
, excessive concentrations of free radicals may overcome normal defense mechanisms and leave dna at risk from oxidative modifications [ 5 , 25 ] .
higher rates of the oxidative stress metabolites appear to define the hallmark of early liver tumor growth which lends to the potential application for ophthalmate to be used as a surrogate for early liver growth .
the role of ophthalmate in a cirrhotic liver or in primary liver tumors remains to be determined in further studies .
increment of ophthalmate concentration was observed in a very early stage of secondary tumor growth . due to the nature of the animal model chosen
, we do not know if these findings will be similar in subsequent stages of tumor growth , that is , tumor invasion , spread or in cases of primary liver tumors .
we made an attempt to correlate the levels of glutathione species , and ophthalmate with the tumor mass ; however , due to the design of the study there were no significant differences in tumor size / volume in animals from the experimental group .
in addition , the oxidative stress status of an animal with a tumor growth may be a function not only of the tumor nature and its mass , but among other factors , their cytokine milieu , and nutritional status . in spite of these boundaries ,
the present studies showed that metabolic disturbances in animals with early liver tumor growth can be detected and , perhaps metabolic signatures of liver tumor growth , may overcome the limitations of current biomarkers used in the clinical setting .
a few of them recently reported include des - gamma carboxyprothrombin , lens culinaris agglutinin - reactive -fetoprotein , human hepatocyte growth factor , and insulin - like growth factor-1 .
the plasma concentration of ophthalmate significantly increased in rabbits after early liver tumor implantation and growth .
this finding reflects an increase in the oxidative stress placed on the local liver tissue during early tumor growth . | purpose .
available tumor markers have low sensitivity / specificity for the diagnosis of liver tumors .
the present study was designed to evaluate the oxidoreductive status of the liver as surrogates of tumor subsistence and growth .
methods .
glutathione species ( gsh : gssg ) , ophthalmate ( oa ) concentrations , and their turnover were measured in plasma of rabbits ( n = 6 ) in their healthy state and in the state of tumor growth after implantation of the vx2 carcinoma in their liver .
tumors were allowed to grow for a period of 14 days when rabbits were sacrificed .
livers were removed and cysteine concentration was measured in liver tissue . results . tumor growth was found in 100% of the rabbits . concentration and labeling of gsh / gssg were similar in experimental animals before and after tumor implantation and to sham animals .
in contrast , oa concentration increased significantly in experimental animals after tumor implantation when compared to same animals prior to tumor implantation and to sham animals ( p < .05 ) .
the concentration of cysteine , a precursor of gsh , was found to be significantly lower in the liver tissue adjacent to the tumor ( p < .05 ) . conclusion .
disturbances in the oxidoreductive state of livers appear to be a surrogate of early tumor growth . |
primary hyperparathyroidism ( phpt ) is one of the most common endocrine conditions particularly in postmenopausal women .
phpt is being diagnosed with increasing frequency mainly as a result of the introduction of routine serum calcium measurements .
many new clinical features , such as hypertension , mental disturbances , myopathy , peptic ulcer disease , pancreatitis , and cholelithiasis have been added to the clinical spectrum of phpt .
it has been reported that patients suffering from symptomatic phpt have increased mortality before and after parathyroidectomy .
this increase in mortality seems to be mainly due to an overrepresentation of cardiovascular death .
hypertension is common in hyperparathyroidism but the cause of this association is not well recognized .
since then various authors reported hypertension to be present in between 10% and 70% of patients with primary hyperparathyroidism .
the wide variation in the prevalence may be due to differences in methods of blood pressure measurement , diagnostic criteria for hypertension , and severity of hyperparathyroidism .
main sources of variability are related to the observer , the environment , and the device .
some studies show cure or improvement in a proportion of patiens [ 7 , 8 ] but others report no significant changes in blood pressure after surgery [ 9 , 10 ] .
the present study is a comparison study of the blood pressures of a large group of patients with phpt and of patients receiving health examination at outpatients ward .
we wished to determine whether hypertension occurs more frequently in phpt than in control group and whether the change in blood pressure after surgery is significant .
the whole series comprise 1020 patients ( 847 female and 173 males aged 2076 ) with biochemically , surgically , and histologically proved phpt during a period of 9 years ( 19982007 ) at third internal clinic medical school of charles university of prague the diagnosis of phpt was confirmed by histopathological diagnosis based on combination of different variables , including size and histological pattern of the excised glands .
off the 1020 patients who underwent parathyroidectomy 960 had an adenoma ( chief cells ) and 60 hyperplasia .
antihypertensive use in hyperparathyroid patients with hypertension was ace inhibitors ( 52% ) , beta blockers ( 24% ) , diuretics 25% , and calcium channel blockers ( 29% ) .
the control group was drawn from 2020 patients receiving periodic health examination at outpatient ward in third medical department of prague charles university medical school from january 2004 to december 2005 .
the control group was carefully selected so that each control was matched with an individual patient with regard to sex , similar age , bmi , and smoking status .
the following exclusion criteria were used : impaired renal function , malignant and secondary hypertension , and myocardial infarction .
all patients of the control group have been normocalcemic and with normal ipth . for comparison
also were used published data on the population prevalence awareness and control of hypertension in the czech population from 1985 to 2001 .
study protocolthe standardized baseline screening included complete history , physical examination , skeletal radiographs , sonography of the abdomen , electrocardiogram , and dexa .
serum concentrations of calcium , uric acid , and creatinine were determined by standard laboratory techniques in the same serum specimen in each patient .
normal reference values were calcium 2.152.65 mmol / l , creatinine 44105 umol / l , and uric acid 140340 umol / l .
the biochemical criteria for renal functional impairment consisted of a level of serum creatinine greater than 110 umol / l .
serum intact pth was assayed by a two - site immunochemiluminometric assay ( bayer corp chiron , halstead uk ) with mean values 1.66.9
the standardized baseline screening included complete history , physical examination , skeletal radiographs , sonography of the abdomen , electrocardiogram , and dexa .
serum concentrations of calcium , uric acid , and creatinine were determined by standard laboratory techniques in the same serum specimen in each patient .
normal reference values were calcium 2.152.65 mmol / l , creatinine 44105 umol / l , and uric acid 140340 umol / l .
the biochemical criteria for renal functional impairment consisted of a level of serum creatinine greater than 110 umol / l .
serum intact pth was assayed by a two - site immunochemiluminometric assay ( bayer corp chiron , halstead uk ) with mean values 1.66.9 pmol / l .
x - ray films were taken of the hands , skull , and kidneys to look for bone disease and renal calculi or nephrocalcinosis .
the examination consisted of a physician completed questionnaire , which included questions of whether at any time in the past the patient had received treatment for high blood pressure ( bp ) or had hypertension diagnosed and whether they were currently taking antihypertensive medication .
the names of currently prescribed medications were recorded and validated against medication containers when possible .
height and body weight were measured with participants standing without shoes and heavy outer garments .
body mass index ( bmi ) was calculated as weight divided by height squared ( kg / m ) as a measure of relative weight .
smoking was classified as current , ex-(not for at least 1 year ) , and nonsmoker .
bp was measured three times with the patients in sitting position following the recommendations of the current european guidelines for blood pressure measurement .
the average of the three measurements was taken as the reference values for each patients . in this study hypertension
was defined as a mean systolic bp ( sbp ) > 140 mmhg and or a mean diastolic bp ( dbp ) > 90 mmhg or current treatment with antihypertensive drugs .
blood pressure in phpt patients and controls was measured on the right arm with subject in the sitting position after at least 5 minutes at rest by standard mercury sphygmomanometers , and correctly sized cuffs were used . to withdraw antihypertensive treatment before the examination was considered hazardous .
antihypertensive drugs and doses were not changed throughout the study . none of the phpt patients complained from recent angina pectoris , dyspnea , dizziness , or syncope .
follow - up examinations 6 months after parathyroidectomy included questionnaire , physical examination , the same blood chemistries as before operation , and blood pressure measurement .
the study was done in accordance with the principles of the helsinki declaration , and the procedures followed were in accordance with institutional guidelines .
the study was approved by the hospital ethics committee , and all patients gave written informed consent .
statistical and discriminant analyses of the laboratory tests were performed by analysis of variance followed by the multiple range test .
a p value less than .05 ( two sided test ) was accepted as level of significance .
the differences between the preoperative and postoperative mean values were evaluated using the paired or unpaired student 's t - test .
the serum levels of calcium , ipth and uric acid normalized after parathyroidectomy ( table 2 ) .
the changes of blood pressure following surgical correction of phpt were based on blood pressure recordings 6 - 7 months postoperatively .
the decrease in blood pressure was seen not only in individuals never receiving antihypertensive therapy but also in individuals on medication for hypertension .
parathyroidectomy resulted in a substantial fall in both mean systolic ( 150 3.8 to 138 3.6 mmhg ) ( p < .01 ) and mean diastolic pressures ( 97 3 to 88 2.8 mmhg ) ( p <
.01 ) of the hypertensive subjects ( tables 2 and 3 ) . we did not observe the decrease of bp in phpt patients without hypertension .
the mean systolic ( p < .01 ) and diastolic bp ( p < .05 ) decreased also in hypertensive patiens on antihypertensive therapy ( table 3 ) .
hypertension was documented preoperatively in 726 patients with phpt ( 69.8% ) whilst 294 of the patients were normotensive .
the blood pressure recorded in 726 subjects with hypertension averaged 150 3.8 mmhg ( systolic ) and 97.0 3.0 ( diastolic ) in women and in men .
there were 610 women and 116 men ( table 1 ) . in the control group
489 patients of the entire group of 1020 patients ( 47.9% ) had hypertension whilst 531 of the patients were normotensive .
parathyroid adenomas occurred with similar frequences in the hypertensive and normotensive patients . in the patients with phpt no one had severe hypertension , diastolic pressure over 120 mmhg .
hypertension appeared to be significantly more common in the phpt ( 72.1% in the case of women and 67.4% in the case of men ) in comparison with our sex , age , bmi , and smoking status matched control group ( women 45.9% and men 49.9% ) ( p < .001 ) .
there is not statistically significant difference between bmi of all patients with phpt and our bmi - matched control group ( 30.4 2.6 kg / m versus 29.3 3.2 kg / m ) ( p > .05 ) .
however there is relationship between bmi and hypertension inside the group of patients suffering from phpt .
average bmi index for women and men with phpt and hypertension was ( 32.8 2.4 kg / m ) and in the present study is higher than bmi index for women and men with phpt and without hypertension ( 29.2 2.04 ) ( p < .01 ) table 4 .
after surgery there was a significant decrease in blood pressure however we did not see significant effect on bmi ( table 2 ) .
patients with phpt before operation had increased ipth and serum calcium in comparison with control subjects .
statistically significant differences between normotensive and hypertensive patients with phpt were evident preoperatively with respect to the serum ipth and uric acid ( p <
.01 ) ( table 4 ) . pth and calcium concentration normalized six months after parathyroidectomy and were not different from controls at the follow - up visit ( table 2 ) .
preoperative serum calcium levels were not significantly higher in the hypertensive than in the normotensive patients with phpt . no correlation could be found between serum calcium levels and systolic and diastolic blood pressure between patients with phpt and hypertension and phpt without hypertension before surgery .
serum uric acid levels were at baseline significantly higher in patients with phpt when compared to controls and were similar in the hypertensive and normotensive patients with phpt ( table 1 ) there were significant differences in mean serum uric acid levels between the whole group with phpt ( 368 54 umol / l ) and the whole control group ( 266 49 umol / l ) ; p < .01 . also significant differences were between the group normotensive ( 344 42
six months after parathyroidectomy serum uric acid fell significantly in hypertensive from 395 58 to 290 56 umol / l in patients with phpt ( p < .01 ) ( table 2 ) .
pmol / l ) than in the normotensive patients with phpt ( 12.2 2.8
kidney involvement due either to deposition of calcium in the renal parenchyma or to nephrolithiasis was present in 31.4% of our patients with phpt and only 6% in control group .
the frequency of renal calculi was similar in patients with phpt and hypertension ( 32% ) and patients with phpt without hypertension ( 29% ) .
preoperative serum creatinine levels were statistically higher in the hypertensive patients ( 93 6 umol / l ) than normotensive ones with phpt ( 74 6 umol / l ) and changed in the case of hypertensive patients significantly after operation ( 71 8 umol / l ) ( p < .01 ) , ( table 1 ) .
the patients suffering from chronic renal failure at the time of surgery , creatinine more than 120 umol / l were excluded from our analysis .
number of smoking patients with phpt ( 16.5% ) was similar to the matched control group ( 17.5% ) .
in this retrospective study , we have demonstrated that parathyroidectomy reduces blood pressure in hypertensive patiens with phpt . the decrease in blood pressure
was seen not only in individuals never receiving antihypertensive therapy but also in individuals on medication for hypertension indicating the pathogenetic participation of phpt on blood elevation . in the present large series of patients with clinically and biochemically proven primary hyperparathyrodism we found that 69.8% of patients have been suffering from hypertension .
it has been suggested that arterial hypertension is common in phpt , and our date confirm , this hypothesis . the 69.8% prevalence of hypertension between patients with phpt is higher as compared with 47% prevalance of hypertension in general population in czech republic and also from our sex , age , bmi control group ( 48% ) .
the mean age of all our patients with phpt at the time of diagnosis is 58.8 years which is almost the same like in general population ( 60 years ) where prevalence of hypertension is 47% .
several pathogenetic mechanisms could be responsible for higher prevalence of hypertension in phpt . suggested mediators have included hypercalcemia , high pth , plasma renin , renal functions , uric acid , and bmi .
clinical and experimental evidence has suggested a relation between the serum calcium level and blood pressure .
hypercalcemia induced in man by a variety of ways including administration of vitamin d or abrupt intravenous infusion of calcium led to acute elevation of blood pressure and its prompt return to normal values when normal levels of serum calcium are restored .
a close correlation has been demonstrated between parathyroid hormone and intracellular calcium , indicating that pth may act as an ionophore for calcium entry into the cells .
we did not find any correlation between serum calcium level and hypertension in patients suffering from phpt . raised concentration of parathormone
pth was higher in our hypertensive patients with phpt than in the normotensive patients with phpt .
however fall in hormone concentrations after surgery does not correspond to a fall in blood pressure in all our patients .
results of suggest that hypertension associated with clinical phpt results from either direct or indirect effects of pth excess .
some studies have shown that patients with essential hypertension have a higher serum concentration of pth than normotensive individuals .
the administration of parathyroid hormone stimulates the secretion of renin in dogs and in humans and is associated with an increase in plasma renin activity .
we have also shown raised plasma renin activity in healthy subjects without hypertension after administration of pth .
also the chronic elevation of parathormone in phpt was accompanied by high plasma renin activity .
a decrease in stretch of the afferent arterioles stimulates renin release from the juxtaglomerular apparatus .
there is a possibility that hypercalcemia and/or a chronic exposure to high pth levels might affect the arterial tone .
the patients with phpt exhibit an impaired endothelial vasodilatory function and parathyroidectomy can reverse this defect .
recent experimental and clinical evidence supports the possibility that an elevated uric acid level may lead to hypertension .
hyperuricemia carries an increased relative risk for hypertension developing within 5 years , independent of other risk factors .
both hyperuricemia and gout occur with increased frequency in hyperparathyroidism , and phpt causes a reduced clearance of uric acid and raises the serum uric levels . in our patients
there were significant differences in mean serum uric acid level between the group with phpt normotensive and hypertensive .
phpt is known to cause renal damage , and this might be blamed for the raised blood pressure . from our data
it does not seem very convincing that renal damage or renal calculi are playing an important role in etiology of hypertension in phpt .
the mean serum creatinine levels in the hypertensive and normotensive patients with phpt were in normal range indicating that the hypertension of hyperparathyroidism is not the consequence of advanced renal parenchymal damage .
there was no difference in the frequency of renal calculi between normotensive and hypertensive hyperparathyroid patients .
we did not find statistically significant changes in bmi between patients with phpt and control group .
however patients with phpt and hypertension are heavily reporting bmi than patients with phpt without hypertension .
after operation there was a significant decrease in blood pressure ; however we did not see significant effect on bmi .
secondary hyperparathyroidism appears to increase the risk of developing parathyroid adenoma . after adjusting for smoking status
we did not observe any connection between smoking and hypertension in our patiens with phpt .
there is increasing evidence that phpt is associated with an increased risk of cardiovascular event .
patients with phpt have been reported to have a greater prevalence of cardiovascular abnormalities than the normal population .
patients with phpt seem to have an increase in mortality , and this seems mainly due to an overrepresentation of cardiovascular death .
phpt is reported to be associated with hypertension , disturbances in the renin - angiotensin - aldosterone system , cardiac arrhythmias as well as structural and functional alterations in the vascular wall . in conclusion phpt
parathyroidectomy resulted in a substantial fall in both sbp and dbp in hypertensive patients . from our work
it is evident that phpt is accompanied by a variety of metabolic complications which are a risk factors for hypertension and that parathyroidectomy can improve these metabolic complications .
our data support the recommendation that parathyroidectomy should be performed in all patients with phpt because the procedure stops the progression of hypertension .
the present data also reveal new possibilities in the field of pathogenetic mechanism of hypertension in phpt .
the present study strengthens the view that cardiovascular derangements are important indications for surgery in phpt .
reducing blood pressure in patients with phpt may be beneficial for long - term cardiovascular health . | background . primary hyperparathyroidism ( phpt ) is one of the most common endocrine conditions and is accompanied by hypertension and increased cardiovascular mortality .
the purpose of this study was to evaluate the effect of parathyroidectomy on systolic and diastolic blood pressure ( bp ) in hypertensive patients with phpt and whether hypertension occurs more frequently in phpt than in control group .
methods . a total of 1020 patients with proved phpt who underwent surgery were compared with with 1020 age , sex , bmi , and smoking status matched controls .
we evaluated changes in serum calcium , parathyroid hormone ( pth ) , uric acid , and bp before and 6 months after surgery .
results .
parathyroidectomy corrected phpt and resulted in a substantial fall in both mean systolic ( 150 3.8 to 138 3.6 mmhg ) and mean diastolic pressures ( 97 3 to 88 2.8 mmhg ) of the hypertensive subjects ; p < .01 . in these patients ,
pth , calcium , and uric acid normalized .
726 patients from 1020 with phpt ( 69.8% ) were found to be hypertensive whilst only 489 ( 47.8% ) from 1020 of our control group .
conclusion .
parathyroidectomy in hypertensive patients reduces systolic and diastolic bp .
phpt is accompanied by a variety of metabolic complications , which are a risk factor for hypertension , and parathyroidectomy can improve these metabolic complications . |
forensic dentistry is a challenging and fascinating branch of forensic science that involves the application of dental sciences in the identification of deceased individuals through the comparison of ante- and post - mortem records . from ad 66 until date , dental identification has proved vital in identifying deceased individuals , the first case being accepted by the law in the year 1849 .
recently , forensic odontology has evolved as a new ray of hope in assisting forensic medicine , but this vital and integral field of forensic medicine is still in a state of infancy in india .
there are not many institutions offering formal training in forensic odontology as there is lack of job opportunities for qualified forensic odontologists who have obtained degrees abroad .
the important applications of forensic odontology include identification of human remains through dental records and assisting at the scene of crime ; in cases of suspected child or adult abuse through bite marks or physical injuries ; determination of age and gender of living or deceased and to testify as an expert witness in court to present forensic dental evidence . the big question and in the coming 10 years probably the most burning one will be whether the dental practitioners should know about forensic odontology ?
the reason being that dental identification provides an accurate source of identification of the victim or the suspect .
natural and man - made disasters occur frequently in india such as asian tsunami , earthquake at bhuj , gujarat and lot many goes on . under these conditions ,
the vital role of dental surgeons comes into the picture in the identification of such individuals . keeping this background in mind
the objective of this study was to conduct a survey in i.t.s cdsr muradnagar , to analyze and assess the knowledge and awareness level of forensic odontology among the individuals from the field of dentistry whether anything needs to be carried out regarding improving the state of affairs of forensic odontology in india .
the present study was conducted at i.t.s for dental studies and research , muradnagar , ghaziabad .
the study sample consisted of 200 individuals divided in four groups group 1 : undergraduate students group 3 : post - graduate students group 4 : practicing clinicians .
a questionnaire was prepared consists of 15 questions all related to the field of forensic odontology .
the comparison of the level of awareness was made within the group as well as across the groups .
most of the undergraduate students were only able to state that person 's occupation can be adjudged by fossilized teeth .
regarding the handling of cases related to forensic odontology , there was a mixed response .
even the post - graduates and practicing clinicians were not very confident about handling the cases .
the same held true for our study as tv serials like crime patrol and cid ( crime investigation department ) detectives etc .
all the undergraduate students , interns , and post - graduates students felt that their knowledge regarding the subject is inadequate .
none of the respondent was aware of the bite mark pattern of teeth and their application thereof .
none of the respondent was aware of the dentist appearing as an expert witness in the court of law .
dental records were maintained by practitioners and post - graduate students and the most valuable record that was maintained were the radiographs of the patient followed by the casts of the patients .
they claimed that informing all the others such as police and ngo 's ( non - governmental organization ) is inviting problem for them .
the awareness regarding the special courses being offered in india and abroad was minimal in the survey population .
most of the interns , post - graduates and practitioners were aware that the dentist have a role to play in mass disasters , but even they were not aware that all the methods can be used for estimation of age of a deceased person .
the most common method according to our survey was cementum annulations followed by deposition of secondary dentin .
forensic science is primarily concerned with the application of science in court or legal proceedings .
forensic odontology is an important branch of the study of dentistry that would assist in solving cases of abuses and deaths .
greater knowledge and awareness of forensic odontology among the dental practitioners would be required in the growing field of medicine .
the practice of forensic odontology has gained importance in a number of developed countries across the world . however , in developing countries like india , utilization of forensic odontology in the criminal justice system is minimal .
the death toll in india due to the tsunami in 2004 was more than 15,000 , but it is a question left unanswered , whether all victims were identified .
this could have been made possible if there were adequate forensic odontologists for identification of the victims .
it is vital that people who are interested in forensic odontology must be properly educated and trained .
this study was conducted among the individuals from the field of dentistry to assess their awareness about forensic odontology .
the results show that the knowledge of forensic odontology among the dental practitioners is not adequate .
the significance of forensic odontology can be attributed to the ability of the dental tissues to withstand environmental assaults and still retain some of its original structure .
even the few practitioners , who were aware of this , answered more by their knowledge that was gained through the media . forensic dentists who are associated with identification of the deceased and crime investigations are usually required to provide testimony in the court of law in the capacity of an
nearly one - third of the respondents were not aware that they could testify as an expert witness in court to present forensic evidence although , a few were not willing to testify even if called upon .
estimation of the human age is a procedure adopted by anthropologists , archaeologists , and forensic scientists .
this has helped forensic odontologists to solve cases in countries abroad , and could similarly play a very significant role in solving cases in india .
however , nearly half of the practitioners did not know how to estimate the dental age by examining the teeth .
the reasons for this could be multifactorial , either their ignorance / lack of basic knowledge or lack of confidence in answering this question , apart from not knowing the significance of dental age with regard to forensics .
the dental record serves a purpose of future reference for the practitioners when needed and is not always maintained for a forensic purpose .
the majority of the dental practitioners were aware of the significance of maintaining dental records .
the identification of a large number of casualties in mass disasters is complex and fraught with hazards , both physically and emotionally .
a forensic anthropologist may be called in when human remains are found during archaeological excavation , or when badly decomposed , burned , or skeletonised remains are found by law enforcement or members of the public .
most of the dental practitioners in the study were not aware of the methods to identify the age and gender of the deceased individuals , which is where the most vital role of forensic odontologists comes into play .
formal training institutes in forensic odontology are the media through which people can raise their knowledge and awareness level toward speciality forensic dentistry , ironically maximum of the dental practitioners lack their awareness toward these institutes .
another reason could be there are very few institutions offering formal training in the forensic odontology .
there are very few workshops or conferences that have been conducted in forensic odontology per year for dental surgeons , which could kindle an interest among the students to probe deeper into the subject .
journals or publications always remain one of the very important sources of information in every field , according to this study very few dental practitioners read forensic related journals or publications .
an effort should be made to cover the cases related too forensic odontology through mass media .
this study reveals that there is inadequate knowledge , poor attitude , and lack of awareness toward the branch of forensic dentistry .
this study reflects the current situation of our country in the field of forensic odontology .
this condition ; however , could be improved if necessary steps are taken to make forensic odontology a part of our undergraduate curriculum and the introduction of post - graduation in forensic odontology .
in addition , conducting periodic conferences , seminars , and publications of a major breakthrough cases would help the dental practitioners and students enrich their knowledge about forensic odontology .
we as dentists and experts in the field of dentistry are only not fully aware of the forensic odontology and its application .
the awareness has to be created among the dentists first and then the same can be reached out to the society . | background : forensic science is defined as a discipline concerned with the application of science and technology to the detection and investigation of crime and administration of justice , requiring the coordinated efforts of a multidisciplinary team .
dental identification remains one of the most reliable and frequently applied methods of identification .
hence , it can be defined as the science that deals with evidence from the dental and oral structures and is a specialty in itself.objectives:to analyze the level of awareness of forensic odontology amongst the individuals from the field of dentistry with the help of a survey.materials and methods : a questionnaire was prepared and a survey was conducted with a sample size of 200 divided in four groups.results:revealed inadequate knowledge , poor attitude , and lack of practice of forensic odontology prevailing among the dentists.conclusion:our study reflects the current situation of our country in the field of forensic odontology , which could be improved by introducing forensic odontology as a subject in the dental curriculum at both the undergraduate and the post - graduate levels . |
physicochemical gradients have long been documented , but only recently has environmental shotgun sequencing allowed the associated functional ( gene - based ) gradients of an ecosystems biota to be addressed .
macroscale functional gradients have been inferred from oceanic metagenomic data sets , both horizontally ( venter et al , 2004 ; johnson et al , 2006 ; rusch et al , 2007 ) and vertically ( delong et al , 2006 ) .
many structured microbial communities have been shown to produce steep physicochemical gradients on the scale of millimeters ( jorgensen et al , 1979 ; schmitt - wagner and brune , 1999 ; ludemann et al , 2000 ; ley et al , 2006 ) , but associated community - level functional gradients have not been demonstrated to date . here
, we investigate a complex , stratified , hypersaline microbial mat from guerrero negro , baja california sur , mexico , as a model for fine - scale functional variation ( ley et al , 2006 ) .
the dense , tofu - like texture of this mat allows intact cross - sections to be obtained down to 1 mm thickness .
the mat shows pronounced physicochemical variation both in space and time : oxygen is detected routinely in the top 2 mm during the day ( up to 700 m ) , and the mat is completely anoxic during the night . the permanently anoxic lower layers are characterized by micromolar levels of sulfide that increase with depth .
the mat , dominated by bacteria , was reported to be one of the world 's richest and most diverse microbial communities , comprising at least 752 observed species from 42 bacterial phyla , including 15 novel candidate phyla ( ley et al , 2006 ) . as the mat grows in hypersaline waters ( 3 the salinity of sea water ) , we were also interested to look for evidence of molecular adaptations to hypersalinity in the mat community .
to investigate millimeter - scale genetic and associated functional stratification , we performed a metagenomic analysis of 10 spatially successive layers of the guerrero negro mat .
mat core samples were collected during the day ( supplementary table s1 ) and upper layers were sectioned at a finer scale ( 1 mm slices ) than the lower layers ( 415 mm slices ) to capture variation associated with the steep oxygen gradient in the upper millimeters of the mat ( supplementary table s2 ) .
dna from each layer was cloned and shotgun - sequenced using capillary sequencing with an average of 13 000 reads per layer .
no significant assembly of the reads was possible , even when all data were combined ( largest contig was 8.4 kb from a combined assembly ) .
we therefore chose to analyze only the unassembled data ( average trimmed ( chou and holmes , 2001 ) read length 808 bp ) to avoid chimerism that has been reported to be frequent in contigs < 10 kb ( mavromatis et al , 2007 ) .
genes were predicted on vector and quality - trimmed reads with fgenesb ( http://www.softberry.com/ ) using a generic bacterial model , resulting in an average of 13 600 genes per layer ( supplementary table s2 ) .
these data have been deposited in genbank under accession numbers abpp00000000 through abpy00000000 and are available through the img / m system ( markowitz et al , 2006 ) ( see som for access information ) . using both bulk similarity matches and phylogenetic mapping of conserved marker genes ( von mering et al , 2007a ) , we found strong phylogenetic variation between layers .
cyanobacteria and alphaproteobacteria were the most abundant lineages in the top two layers ( supplementary figure s1 ) .
below the upper 2 mm , proteobacteria , bacteroidetes , chloroflexi and planctomycetes were the most represented phyla , with a notable peak in bacteroidetes at 3 mm ( supplementary figure s1 ) .
numerous traces of other bacterial phyla as well as some archaea and eukaryotes were also identified .
a large fraction of predicted proteins in layers below 2 mm did not have significant sequence similarity to any protein in public databases , reflecting the high degree of phylum - level novelty in the mat community ( ley et al , 2006 ) .
these metagenome - based findings are in broad agreement with single - marker gene surveys of the mat ( spear et al , 2003 ; ley et al , 2006 ) .
a rough measure of functional potential per organism can be made by estimating the average effective genome size ( raes et al , 2007 ) . using this method , we predicted an increased average bacterial genome size at the border of the oxic and anoxic zones ( 12 mm depth ) : 6 mb at the border versus 33.5 mb for the rest of the mat ( supplementary figure s2 ) .
this may reflect an increased functional complexity needed for survival in the constantly fluctuating conditions at this depth as was recently observed in the genome of a marine beggiotoa occupying a similar niche ( mussmann et al , 2007 ) . to investigate genetic gradients through the mat
, we determined the relative abundances of individual gene families and metabolic pathways between mat layers , and compared the mat data with external data sets for reference .
many gene families were highly abundant in the mat despite high overall functional diversity ( supplementary figure s3 ) and very low sequence coverage of individual species .
indeed , the mat data set roughly doubled existing inventories for some of the gene families described below ( table i ) .
this implies that multiple species and likely higher - level taxa contribute representatives of these families , and suggests that there has been a strong selection for a limited number of common functionalities in the mat .
the key aspect of this study was to use the metagenomic data to determine what , if any , millimeter - scale genetic gradients are detectable in this very complex and structured ecosystem . several gene families and pathways either directly ( figure 1a ) or inversely ( figure 1b ) tracked the steep oxygen gradient in the top 2 mm of the mat and sulfide gradient below 2 mm .
genes directly involved in photosynthesis ( kegg map 00195 ) were statistically over - represented in the top two layers relative to lower layers .
in addition , an uncharacterized protein domain ( pfam05685 ) highly paralogous in phototrophic lineages ( most cyanobacterial and some chloroflexi genomes ) showed a steep declining gradient in the top 6 mm ( figure 1a ) consistent with dominance of phototrophs in the same region .
chaperones similarly tracked the oxygen gradient when all gene families with chaperone activity are combined together .
the over - representation of chaperones in the top 2 mm relative to the rest of the mat may not be associated with oxygen concentration , but rather with heat stress caused by direct exposure to sunlight .
gene families and pathways that tracked inversely with oxygen concentration included ferredoxins , trimethylamine methyltransferase ( mttb ) , sulfatases and sugar degradation pathways ( figure 1b ) .
ferredoxins and associated proteins show a four - fold increase from the top layer down to a depth of 4 mm and thereafter are uniformly over - represented .
two cog families are chiefly responsible for this trend : cog1148 ( heterodisulfide reductase , subunit a and related polyferredoxins ) and cog2414 ( aldehyde : ferredoxin oxidoreductase ) .
the expansion of ferredoxins in the anoxic layers likely reflects the diversification of redox reactions required for anaerobic respiration .
mttb ( pfam06253 , cog5598 ) methyltransferase does not become significantly over - represented until at least 7 mm into the mat ( figure 1b ) , well below the anoxic boundary .
mttb was initially identified as a protein facilitating the first step of methanogenesis from trimethylamine in methanosarcinaceae ( paul et al , 2000 ) .
however , this gene family is also found in methylotrophic bacteria ( e.g. in rhodobacteraceae and rhizobiaceae ) , suggesting a more generalized role in c1 metabolism .
one of the most pronounced inverse gradients is observed for sulfatases ( cog3119 ) that are involved in the hydrolysis of sulfated organic compounds ( figure 1b ) . as sulfatases
can function in the presence of oxygen , the gradient is presumably a reflection of the availability of sulfated compounds in the mat .
although the concentration gradient of sulfated compounds is not known in the mat , they are produced by phototrophs ( kates , 1986 ) and are widespread in marine environments ( glockner et al , 2003 ) .
sulfatase genes obtained from the mat exhibited extensive sequence divergence , suggesting that a corresponding wide variety of sulfated organic substrates are present in the mat , with the highest concentrations below 2 mm .
the over - representation of this gene family may in part be due to an expansion of sulfatase genes in the genomes of planctomycetes , suggested to be involved particularly in the hydrolysis of sulfated glycopolymers ( glockner et al , 2003 ) .
sugar degradation pathways ( glycolysis and pentose and uronic acid degradation ) show a two - fold increase with depth through the top 3 mm and maintain high relative representation in the anoxic lower layers ( figure 1b ) .
this suggests that heterotrophic metabolism of sugars , particularly pentoses and uronic acids , is important in the lower layers .
organisms living at the boundary between the oxic and anoxic zones could potentially accumulate substrates with high reductive potential in the anoxic zone , and then move to the oxic zone to harvest this potential by oxidation ( mussmann et al , 2007 ) .
indeed , we find that chemotaxis signature genes peak sharply at the oxic anoxic boundary ( figure 1c ) .
flagella appear not to be the dominant source of motility in these chemotactic organisms as flagellar genes actually dip in this region ( figure 1c ) .
chemotactic gliding bacteria have been observed in fresh mat cores ( garcia - pichel et al , 1994 ; kruschel and castenholz , 1998 ) and our molecular data suggest they are most abundant in the boundary zone , bridging the oxic and anoxic layers . despite the pronounced phylogenetic and functional gradients in the mat , hypersalinity is a selective pressure common to the whole community .
a known adaptation to hypersalinity is enrichment of proteins with acidic amino acids , allowing proteins to function in high cytoplasmic salt concentrations ( soppa , 2006 ) .
the resulting acid - shifted protein isoelectric points have been documented in the genomes of only two lineages , the archaeal class halobacteria ( kennedy et al , 2001 ; soppa , 2006 ) and the bacterial species salinibacter ruber ( oren and mana , 2002 ; mongodin et al , 2005 ) , so it is unclear how widespread this mechanism is in halophilic communities .
the average isoelectric points of the mat layer communities are conspicuously acid - shifted when compared with most bacteria and microbiomes that are non - halophilic ( figure 2a ) .
we determined this to be due primarily to an enrichment in the acidic amino acid aspartate ( figure 2b ) .
furthermore , the isoelectric profiles of all 10 layers converge on a common acid - shifted profile ( figure 3a ) despite a significant variation in gc content between layers ( figure 3b ) , reflecting differing phylogenetic composition .
the latter is consistent with aspartate usage being gc - independent as it can be encoded by both gc - rich and gc - poor codons ( gac and gat , respectively ) . as each metagenomic read pair
is likely derived from different species and no single species dominates the mat community , we conclude that a significant fraction of the community has converged on the enrichment of low isoelectric point proteins . in summary , this study demonstrates that millimeter - scale genetic gradients can be readily discerned through a vertical cross - section of a highly structured and complex microbial community using low sequence coverage .
furthermore , we could directly and inversely correlate many of the genetic gradients to the physicochemical profile of the mat .
microbial biofilms are important in many habitats , including our own bodies ( kroes et al , 1999 ; eckburg et al , 2005 ) , and often display physicochemical gradients at millimeter to centimeter scales .
however , few biofilms are as robust as microbial mats and methods may need to be adapted to preserve spatial structure ( webster et al , 2006 ) and allow the relevant fine - scale genetic gradients to be resolved .
surprisingly , we found that adaptation to hypersalinity by enriching proteins with acidic amino acids is more widespread than previously appreciated .
although this is the first example of species - independent molecular convergence in a microbial community , we predict that similar convergence patterns will be observed in other communities adapted to similar or different environmental conditions , such as temperature ( gianese et al , 2001 ) or pressure ( simonato et al , 2006 ; lauro and bartlett , 2008 ) .
mat core samples were collected around 1400 hours from pond 4 near pond 5 at the exportadora de sal saltworks , guerrero negro , baja california sur , mexico .
the salinity of the bulk water above the mat was 9% ( 3 the salinity of sea water ) .
four replicate cores were collected , sectioned into layers with sterile scalpels and dna extracted , normalized , pooled and sequenced as described in supplementary information .
metagenome sequence data are available under the following genbank accession numbers : abpp00000000 , abpq00000000 , abpr00000000 , abps00000000 , abpt00000000 , abpu00000000 , abpv00000000 , abpw00000000 , abpx00000000 , abpy00000000 community composition analysis was performed using the consensus of ( i ) best blastp hits ( altschul et al , 1997 ) to the img / m database ( markowitz et al , 2006 ) and ( ii ) phylogenetic mapping of signature genes on a phylogenetic tree ( von mering et al , 2007a ) .
gene - based functional gradients were calculated as follows : genes were assigned to their cog families ( tatusov et al , 1997 ) and pfam domains ( bateman et al , 2002 ) based on rpsblast ( altschul et al , 1997 ) .
the gradients were examined for possible over - representation of groups or individual families or domains , and 1000 bootstrap iterations were used to assess the significance of over - representation .
the described gradients were independently confirmed using two databases : img / m ( markowitz et al , 2006 ) and the string database ( von mering et al , 2007b ) .
further details as well as groupings of families / domains are described in supplementary information .
isoelectric point distributions , amino - acid composition and gc content were computed using appropriate perl scripts and modules as described in supplementary information .
| to investigate the extent of genetic stratification in structured microbial communities , we compared the metagenomes of 10 successive layers of a phylogenetically complex hypersaline mat from guerrero negro , mexico .
we found pronounced millimeter - scale genetic gradients that were consistent with the physicochemical profile of the mat . despite these gradients , all layers displayed near - identical and acid - shifted isoelectric point profiles due to a molecular convergence of amino - acid usage , indicating that hypersalinity enforces an overriding selective pressure on the mat community . |
chronic inflammation induced by biological , chemical , and physical factors has been found to be associated with the increased risk of cancer in various organs [ 13 ] ( table 1 ) .
inflammation activates a variety of inflammatory cells , which trigger oxidant - generating enzymes such as inducible nitric oxide synthase ( inos ) , nadph oxidase , and myeloperoxidase to produce high concentrations of free radicals including reactive nitrogen species ( rns ) and reactive oxygen species ( ros ) .
overproduction of rns and ros can change the balance of oxidants and antioxidants and cause nitrative and oxidative stress which contributes to the damage of biomolecules such as dna , rna , lipid and proteins , leading to an increase in mutations , genomic instability , epigenetic changes , and protein dysfunction and play roles in the multistage carcinogenic process .
ros generate 8-oxo-7,8-dihydro-2-deoxyguanosine ( 8-oxodg , also known as 8-hydroxydg ( 8-ohdg ) ) , a marker of oxidative dna damage [ 4 , 5 ] .
8-oxodg , a potentially mutagenic dna lesion , leading to the transversion of g : c to t : a ( g t transversion ) , has been implicated in cancers triggered by infections .
carcinogenic chemicals and their metabolites as well as electron transport chains in mitochondria are able to generate ros . on the other hand , nitric oxide ( no ) , a primary initiator of rns , is generated specifically during inflammation via inos in inflammatory and epithelial cells [ 5 , 8 ] .
overproduction of no participates in the generation of peroxynitrite ( onoo ) , which can lead to the formation of 8-nitroguanine , an indicator of nitrative dna damage [ 9 , 10 ] .
8-nitroguanine undergoes spontaneous depurination in dna , resulting in the formation of an apurinic site .
incorporated adenine can form a pair with apurinic sites during dna replication , leading to the g t transversion ( figure 1 ) . moreover
, apurinic sites might represent major damage that requires error - prone dna polymerase for efficient trans - lesion dna synthesis .
it was reported that dna polymerase can efficiently bypass abasic sites by extending from nucleotides inserted opposite the lesion by other dna polymerases .
wu et al . suggested that cells deficient in subunits of dna polymerase were hypersensitive to nitrative stress , and trans - lesion dna synthesis mediated by this polymerase contributes to extensive point mutations .
additionally , dna polymerases and were also found to be involved in the incorporation of adenine opposite 8-nitroguanine during dna synthesis in a cell - free system associated with trans - lesion dna synthesis leading to the g t transversion .
therefore , 8-nitroguanine is a potential mutagenic dna lesion involved in inflammation - mediated carcinogenesis .
relevantly , systematic and comprehensive genome - scale approaches by using the immunoprecipitation - based technique combined with high - density microarrays may be useful to investigate roles of dna lesions in carcinogenesis .
we focus on the roles of nitrative and oxidative dna damage in infection- and inflammation - related carcinogenesis .
we produced a specific anti-8-nitroguanine antibody and examined the localization of dna lesions by immunohistochemical analysis in animal models and clinical samples ( table 1 ) .
here , we review the effects of rns-/ros - mediated dna damage on genomic instability and epigenetic change in relation to carcinogenesis .
liver fluke infections of opisthorchis viverrini ( o. viverrini ) are a risk factor for cholangiocarcinoma in southeast asia .
o. viverrini infestations are endemic in khon kaen province , northeastern thailand , and khon kaen has the highest incidence of cholangiocarcinoma in the world . o. viverrini infections induce inflammation in both animal models and humans .
our previous studies showed that 8-oxodg and 8-nitroguanine levels were increased in o. viverrini - infected hamsters compared with uninfected control groups [ 17 , 2224 ] .
in addition , dna damage was significantly increased in reinfected hamsters compared with animals infected just once .
notably , repeated infection increased inos expression and 8-nitroguanine production in the epithelium of bile ducts even after a decrease in inflammatory cells . to elucidate
the mechanism involved , we examined the expression of inos , nf-b , and toll - like receptor ( tlr ) 2 in mouse macrophage cell lines treated with o. viverrini crude antigens , suggesting that o. viverrini infection induced tlr2 activation with nf-b - dependent transcription and inos expression .
these findings in hamsters were confirmed by the observation that 8-oxodg and 8-nitroguanine accumulated more in cancerous areas than in intrahepatic areas adjacent to tumors in surgical specimens .
furthermore , an epidemiological study of o. viverrini - infected subjects and cholangiocarcinoma patients demonstrated that urinary 8-oxodg levels were significantly higher in cholangiocarcinoma patients than in o. viverrini - infected patients and healthy subjects and higher in o. viverrini - infected subjects than in healthy subjects .
the urinary 8-oxodg levels in o. viverrini - infected patients significantly decreased two months after praziquantel treatment and were comparable to levels in healthy subjects one year after treatment .
these results indicate that o. viverrini causes chronic and recurrent inflammation followed by the accumulation of oxidative and nitrative dna lesions , which may participate in the development of cholangiocarcinomas .
helicobacter pylori is the main cause of chronic gastritis and a potential risk factor for gastric carcinoma .
the molecular mechanisms behind h. pylori - induced production of ros / rns were wide ranging from activated neutrophils to h. pylori itself , as nicely reviewed by handa et al . .
h. pylori infections promote the secretion of various inflammatory cytokines , contributing directly to the pronounced inflammatory response .
lipopolysaccharide , a component of gram - negative bacteria such as h. pylori , is a tlr4 ligand that induces inflammatory responses via nf-b expression .
nf-b , which is involved in the regulation of inos , had been reported to function as a tumor promoter in inflammation - associated cancer [ 31 , 32 ] . in patients with h. pylori - induced gastritis or gastric ulcers ,
the expression of inos mrna and protein was significantly increased in the epithelial cells of h. pylori - positive gastritis patients compared to h. pylori - negative patients .
recently , it was also found that h. pylori in a korean isolate induced the expression of inos via ap-1 activation .
our previous study demonstrated that levels of 8-nitroguanine and 8-oxodg in gastric gland epithelium were significantly higher in gastritis patients with h. pylori infections than in those without infections .
a significant accumulation of proliferating cell nuclear antigen ( pcna ) was observed in gastric gland epithelial cells in patients infected with h. pylori in comparison to those not infected .
interestingly , the accumulation of pcna was closely correlated with the formation of 8-nitroguanine and 8-oxodg .
collectively , the host response to h. pylori mediated nf-b expression , resulting in inos expression accompanied by 8-nitroguanine and 8-oxodg production in the gastric epithelium .
8-nitroguanine could be not only a promising biomarker for inflammation but also a useful indicator of the risk of developing gastric cancer in response to chronic h. pylori infection .
cervical cancer is the second most common cancer among women worldwide and the most common cancer among women in many developing countries .
inflammation is proposed to play an integral role in the development of human papilloma virus ( hpv)-induced cervical cancer .
our previous study examined the formation of 8-nitroguanine and 8-oxodg in cells of cervical intraepithelial neoplasia ( cin , grades 13 ) and condyloma acuminatum samples and compared it with the expression of the cyclin - dependent kinase inhibitor p16 , considered a biomarker for cervical neoplasia [ 3942 ] .
there were no statistically significant differences in p16 expression between cin and condyloma acuminatum samples .
these results suggest that high - risk hpv types promote inos - dependent dna damage , which leads to dysplastic changes and carcinogenesis .
therefore , 8-nitroguanine is a more suitable and promising biomarker for evaluating the risk of inflammation - mediated cervical carcinogenesis than p16 .
nasopharyngeal carcinoma ( npc ) is strongly associated with epstein - barr virus ( ebv ) infections .
various transcription factors are known to participate in inos expression including signal transducers and activators of transcription ( stats ) , such as stat1 and stat3 [ 44 , 45 ] .
epidermal growth factor receptor ( egfr ) physically interacts with stat3 in the nucleus , leading to transcriptional activation of inos .
stat3 is repeatedly activated through phosphorylation via the expression of latent membrane protein 1 ( lmp1 ) as well as egfr [ 46 , 47 ] , and interleukin-6 ( il-6 ) is required for lmp1-mediated stat3 activation .
in addition , lmp1-mediated inos expression was reported in ebv - infected epithelium cell lines , which play a role in colonization independent of anchorage and tumorigenicity in nude mice . using biopsy and surgical specimens of nasopharyngeal tissues from npc patients in southern china , we performed double immunofluorescent staining to examine the formation of 8-nitroguanine and 8-oxodg [ 49 , 50 ] .
intensive immunoreactivity to inos was detected in the cytoplasm of 8-nitroguanine - positive cancer cells .
dna lesions and inos expression were also observed in epithelial cells of ebv - positive patients with chronic nasopharyngitis but weaker than those in npc patients .
egfr and phosphorylated stat3 were strongly expressed in cancer cells of npc patients , suggesting that the stat3-dependent mechanism is important to the carcinogenesis .
il-6 was expressed mainly in inflammatory cells of nasopharyngeal tissues of ebv - infected patients .
we also found that serum levels of 8-oxodg were significantly higher in npc patients than control subjects .
collectively , these findings indicate that the nuclear accumulation of egfr and activation of stat3 by il-6 play a key role in inos expression and resultant dna damage , leading to ebv - related npc .
hepatitis c virus ( hcv ) is a major cause of chronic hepatitis , liver cirrhosis , and hepatocellular carcinoma throughout the world .
hepatocellular carcinoma arises through genetic alterations in hepatocytes during a chronic hcv infection [ 5255 ] .
we investigated the extent of nucleic acid damage in hcv - infected individuals and its change after interferon treatment .
immunoreactivities of 8-nitroguanine and 8-oxodg were strongly detected in the liver of patients with chronic hepatitis c , but not control subjects .
8-nitroguanine was found to be accumulated in hepatocytes particularly in the periportal area . in the sustained virological responder group after interferon therapy , the accumulation of 8-nitroguanine and 8-oxodg was markedly decreased in the liver .
we observed a strong correlation between hepatic 8-oxodg staining and serum ferritin levels , suggesting the iron content to be a strong mediator of oxidative stress and iron reduction to reduce the incidence of hepatocellular carcinoma in patients with chronic hepatitis c [ 57 , 58 ] .
we also demonstrated that oxidative dna damage widely occurred in the livers of patients with chronic viral hepatitis especially chronic hepatitis c , and the iron load and 8-oxodg - positive hepatocytic count was significantly higher in hcv - infected than in hbv - infected livers .
it is plausible that ros production during chronic hcv infection is the result of high iron levels in hepatic tissues , which lead to progressive liver inflammation and an increased risk of developing liver cancer .
these findings indicate that 8-nitroguanine and 8-oxodg are useful as biomarkers for evaluating the severity of hcv - induced chronic inflammation leading to hepatocellular carcinoma and the efficacy of chronic hepatitis c treatment .
excessive and persistent production of ros / rns by inflammatory cells is considered as a hallmark of the secondary genotoxicity of nonfibrous and fibrous particles including asbestos .
asbestos is a carcinogen ( iarc group1 ) causing lung cancer and malignant mesothelioma of the pleura and peritoneum . among the different types of asbestos , crocidolite ( blue asbestos ) and amosite ( brown asbestos )
inflammation is a hallmark of the response to exposure to asbestos in both animal and human models [ 68 , 69 ] .
no and nitrative stress were reported to be involved in the asbestos - derived inflammatory response via myeloperoxidase , a major constituent of neutrophils which generates hypochlorous acid and rns [ 7073 ] .
we performed an immunohistochemical analysis to examine the formation of 8-nitroguanine and the expression of inos and its transcription factor ( nf-b ) in the lungs of mice intratracheally administered asbestos fibers , including crocidolite and chrysolite .
8-nitroguanine was significantly detected in bronchial epithelial cells of asbestos - exposed groups compared with the untreated group .
interestingly , the immunoreactivities of 8-nitroguanine , inos , and nf-b were significantly higher in the crocidolite - exposed group than in the chrysotile - exposed group
. therefore , the formation of nitrative dna damage could be one of the mechanisms responsible for the difference in carcinogenic potential between crocidolite and chrysotile .
ulcerative colitis and crohn 's disease , which are referred to as inflammatory bowel diseases ( ibds ) , are well known as chronic inflammatory diseases in the lower bowel .
epidemiological studies have shown that the incidence of colorectal cancer in ibd patients is greater than the expected incidence in the general population .
we hypothesized that an imbalance of helper and regulatory t - cell functions plays a key role in the pathogenesis of ibd .
therefore , we prepared a mouse model of ibd with an imbalance of th1 and th2 and , using double immunofluorescence labeling , revealed that both 8-nitroguanine and 8-oxodg were mainly formed in epithelial cells .
we observed by using clinical samples that 8-nitroguanine and 8-oxodg were formed in colon epithelium of patients with ulcerative colitis in the active stage ( figure 2 ) .
of relevance , several studies have shown that inos is expressed in epithelial cells in colitis patients [ 7678 ] .
in noncancerous colon tissues from patients with ulcerative colitis , inos protein levels were positively correlated with p53 serine 15 phosphorylation levels .
these results suggest that nitrative dna damage , as well as oxidative dna damage , participates in colon carcinogenesis in patients with ibd .
oral lichen planus ( olp ) is a chronic inflammatory mucosal disease and a risk factor for oral squamous cell carcinoma ( oscc ) .
oral leukoplakia is a precancerous lesion characterized by white plaques and hyperkeratosis [ 81 , 82 ] .
we demonstrated that 8-nitroguanine and 8-oxodg accumulated in oral epithelium of biopsy specimens from patients with olp , leukoplakia , and oscc , whereas no immunoreactivity was observed in normal oral mucosa [ 62 , 83 ] .
colocalization of 8-nitroguanine and inos was found in oral epithelium of patients with olp , leukoplakia , and oscc .
accumulation of p53 was observed in oral epithelium in olp and leukoplakia patients , and more prominent expression of this protein was observed in oscc patients .
in addition , the immunoreactivity to pcna was significantly higher in leukoplakia patients than that in normal mucosa , suggesting an increase in cell proliferation .
also reported that pcna and p53 were highly expressed in oral tissues in olp patients .
we conclude that inflammation - mediated dna damage and additional epithelial cell proliferation promote oral carcinogenesis .
malignant fibrous histiocytoma ( mfh ) is one of the most common soft tissue sarcomas [ 85 , 86 ] and has a poor prognosis [ 87 , 88 ] .
mfh has been proposed to be accompanied by inflammatory responses [ 89 , 90 ] . however , the mechanism of its inflammation - induced carcinogenesis is still unclear .
we investigated dna lesions and inflammatory - related molecules including inos , nf-b , and cox-2 .
immunohistochemical staining revealed that the formation of 8-nitroguanine and 8-oxodg occurred to a much greater extent in mfh tissue specimens from deceased patients than in live patients .
it is worth noting that a statistical analysis using the kaplan - meier method demonstrated strong 8-nitroguanine staining to be associated with a poor prognosis .
furthermore , our study demonstrated significantly higher levels of both 8-nitroguanine and hif-1 in the tissue specimens of deceased patients than in those of living subjects .
survival curves analyzed by the kaplan - meier method differed significantly between the groups with high and low staining of 8-nitroguanine as well as hif-1 .
these results suggest a significant role for the inos - dependent formation of 8-nitroguanine via hif-1 and nf-b in the progression of inflammation - related cancer .
these results indicate that 8-nitroguanine is involved in not only the initiation of carcinogenesis but also its progression and prognosis in cases of mfh .
genomic instability is a defining characteristic of most carcinogenesis through the accumulation of mutations in several tumor suppressor genes , oncogenes , and genes that are involved in maintaining genomic stability .
events resulting in chromosomal instability , such as amplification and deletions of large segments of dna , reciprocal and nonreciprocal translocations , aneuploidy , and polyploidy , constitute the large - scale genomic aberrations that characterize the majority of human cancer cells and are thought to accelerate carcinogenesis [ 91 , 92 ] .
degtyareva et al . demonstrated that chronic oxidative dna damage due to dna repair defects induced chromosome instability in a saccharomyces cerevisiae model .
trouiller et al . showed that titanium dioxide , a risk factor for lung cancer , induced oxidative dna damage , -h2ax foci , micronuclei , and dna deletions , suggesting a link between inflammation - associated dna damage and genomic instability .
the dna damage response ( ddr ) is essential for maintaining the integrity of the genome , and a failure of this response results in genomic instability and predisposition to malignancy .
phosphorylated atm ( ataxia telangiectasia mutated ) plays a role in ddr to dna double - stranded breaks .
impaired function of atm was reported to be involved in dna damage - induced genomic instability [ 94 , 95 ] .
tnf- is a proinflammatory cytokine and also acts as an inos regulator protein [ 96 , 97 ] .
reported that tnf- induced the formation of 8-oxodg and genomic instability in primary vascular endothelial cells .
therefore , tnf- and a dysfunction of atm could play key roles in the integration between inos - mediated dna damage and genomic instability .
recently , we observed that phosphorylated atm and -h2ax were colocalized with 8-oxodg and 8-nitroguanine in clinical samples of cholangiocarcinoma patients as shown in figure 3 , suggesting that dna base damage caused double - stranded breaks .
dna lesions were found in infiltrating inflammatory cells , hepatocyte cells of nontumor areas , and cancer cells , whereas -h2ax and phosphorylated atm were expressed in only cancer cells .
moreover , ddr proteins and dna lesions were detected only very weakly in normal liver tissues , suggesting that the dna double - stranded breaks were specific to cancer cells .
our observations also support the idea that highly inos - dependent dna damage causes dna double - stranded breaks and genomic instability , which play important roles in inflammation - induced carcinogenesis via tnf- signaling and ddr protein dysfunction .
diverse cellular functions including the regulation of inflammatory gene expression , dna repair , and cell proliferation are regulated by epigenetic changes .
an important proinflammatory cytokine il-6 has been reported to control dna methylation through il-6-mediated janus kinase ( jak)/stat3 pathways [ 101105 ] .
we demonstrated that il-6 modulated inos expression via stat3 and egfr in ebv - associated nasopharyngeal carcinoma .
accumulating evidence makes it increasingly clear that epigenetic silencing plays an important role in ebv - associated neoplasia .
we and our colleagues have found promoter hypermethylation in several candidate genes for tumor suppressor genes [ 107110 ] .
histone modifications play a role in the response to dna double - stranded breaks through atm signaling to activate -h2ax , resulting in histone ubiquitination and acetylation , and destabilization and conformational changes to nucleosomes lead to dna repair .
rns cause base lesions , abasic sites , and single - stranded breaks , which may be converted into double - strand breaks in cells by enzymatic processing , when the damage is in close proximity to or encountered by the replication fork .
collectively , nitrative and oxidative dna damage may activate epigenetic change via il-6 signaling and the expression of ddr proteins .
we investigated the formation of 8-nitroguanine and 8-oxodg at sites of carcinogenesis in various clinical specimens and animal models in relation to inflammation - related carcinogenesis .
we also observed that dna lesions were formed and significantly increased in s. haematobium - induced urinary bladder cancer compared with cancer without such an infection .
in addition , barrett 's esophagus , an inflammation - related disease caused by the reflux of gastric acid , also showed greater dna damage than normal esophageal tissues ( unpublished data ) . proposed roles of inflammation - related dna damage in carcinogenesis on the basis of our findings and studies in the literature [ 94 , 113 ] are summarized in figure 4 .
8-nitroguanine and 8-oxodg are formed in various inflammation - related cancers and precancerous regions in an inos - dependent manner . tnf- and il-6 are proinflammatory cytokines which play roles in the control of inos expression via the regulation of nf-b and stat3 signaling pathways .
8-nitroguanine and 8-oxodg are mutagenic lesions resulting in the g t transversion .
this type of mutation has been found to occur in vivo in the ras gene and the p53 tumor suppressor gene in various cancers .
nitrative and oxidative dna damage induce not only mutations but also genomic instability and epigenetic change via tnf- and il-6 activities and dna double - stranded breaks resulting in the activation of oncogenes and inactivation of tumor suppressor genes , which may lead to inflammation - related carcinogenesis . | chronic inflammation induced by biological , chemical , and physical factors has been found to be associated with the increased risk of cancer in various organs .
we revealed that infectious agents including liver fluke , helicobacter pylori , and human papilloma virus and noninfectious agents such as asbestos fiber induced inos - dependent formation of 8-nitroguanine and 8-oxo-7 , 8-dihydro-2-deoxyguanosine ( 8-oxodg ) in cancer tissues and precancerous regions .
our results with the colocalization of phosphorylated atm and -h2ax with 8-oxodg and 8-nitroguanine in inflammation - related cancer tissues suggest that dna base damage leads to double - stranded breaks .
it is interesting from the aspect of genetic instability .
we also demonstrated il-6-modulated inos expression via stat3 and egfr in epstein - barr - virus - associated nasopharyngeal carcinoma and found promoter hypermethylation in several tumor suppressor genes .
such epigenetic alteration may occur by controlling the dna methylation through il-6-mediated jak / stat3 pathways .
collectively , 8-nitroguanine would be a useful biomarker for predicting the risk of inflammation - related cancers . |
sudden cardiac arrest is linked more with structural heart disease ; however it is also associated with pulmonary embolism ( pe ) .
the conventional treatment of pe is anticoagulation but the risk of bleeding is high in the situations where patients undergo prolonged cardiac arrest and hypothermia management .
we hereby , present the unique case of pulmonary embolism diagnosed on the basis of clinics and bedside echocardiogram during a prolonged cardiopulmonary resuscitation ( cpr ) , needing hypothermia management , and associated with rapid and remarkable recovery after administration of a loading dose of tissue plasminogen activator ( tpa ) without any complication of bleeding .
a 52-year - old non - smoking caucasian male , who is allergic to shrimps , presented to the emergency room ( er ) after he was found unconscious in the bathroom . at 6 days before presentation ,
patient had symptoms of severe cough with streaks of blood and dyspnea on exertion and was treated with azithromycin antibiotic for presumed upper respiratory tract infection .
the day before presentation , patient 's symptoms of cough and dyspnea started getting worse .
patient reported taking benzonatate antitussive , which caused tingling and numbness around his mouth and cheeks , which resolved spontaneously after 30 min .
patient did not report of hives , swelling of the face or tongue and difficulty in swallowing .
subsequently , patient got extremely agitated and short of breath leading to state of unconsciousness .
emergency medical services were activated , 100% oxygen was initiated and patient was transferred to our er . in the er , patient presented with grey colored skin and symptoms of severe dyspnea .
as per the patient 's wife , he had no calf pain and/or swelling recently .
there were no recent hospitalizations , prolonged immobilization or history of pulmonary embolism ( pe ) and/or deep vein thrombus ( dvt ) .
patient 's father has a history of pe secondary to extensive airplane travel and stroke .
an electrocardiogram showed a right bundle branch block and st - segment elevations in the inferior leads with elevated troponins of 13.5 ng / ml ( normal < 0.03 ng / ml ) .
cardiac monitor showed pulseless electric activity and patient was intubated and cardiopulmonary resuscitation ( cpr ) was initiated immediately .
the cardiac arrest was presumed from st elevation myocardial infarction and the patient was transferred to cardiac catheterization laboratory .
patient intermittently remained in cardiac arrest requiring intra - aortic balloon pump and temporary pacemaker .
cardiac catheterization showed non - obstructive coronary arteries and a hyper - dynamic left ventricle .
patient 's blood pressure remained low and so patient was continued on epinephrine , dopamine drips .
patient was then transferred to the intensive care unit and he remained intubated with mechanical ventilation and ongoing cpr . on physical examination
, the patient was noted to have respiratory rate of 30 breaths / min , fixed and dilated pupils of 7 mm and endotracheal tube in place .
cardiac auscultation was tachycardia with no murmurs , gallops and rubs . on neurologic al examination ,
the patient 's glasgow coma scale was < 9 with no gag reflex and response to babinski .
laboratory data revealed white cell count of 11.7 10/l ( normal 4.3 - 10 10/l ) with the normal differentials , creatinine of 2.4 mg / dl ( normal 0.7 - 1.3 mg / dl ) , ionized calcium of 4.0 mg / dl ( normal 4.6 - 5.1 mg / dl ) bicarbonate of 15 mmol / l ( normal 22 - 30
mmol / l ) , serum osmolality of 322 mosm / kg ( 275 - 295 mosm / kg ) , anion gap of 21 mmol / l ( normal 8 - 16
mmol / l ( normal 0.7 - 2.1 mmol / l ) and d - dimer of 6.68 g / ml ( normal < 0.49 g / ml ) . other blood cell counts , liver function tests , alcohol , salicylate , methanol levels and urine toxicology screen were unremarkable .
an arterial blood gas showed a ph of 6.8 , pco2 of 70 mmhg , po2 of 90 mmhg on mechanical ventilation , consistent with mixed respiratory and metabolic acidosis .
patient 's clinical symptoms , laboratory investigations , negative cardiac catheterization of obstructive coronary arteries , electrocardiogram showing sinus tachycardia and echocardiogram proving hypo kinesis and enlargement of right ventricle suggested presumed diagnosis of pe causing cardiac arrest . at the same time ,
alteplase , tissue plasminogen activator ( tpa ) was administered immediately with the dose of 0.6 mg / kg over 2 min in a bolus form and heparin drip was started . during the course of the intensive care stay , patient was treated with hypothermic protocol for cardiac arrest with no bleeding complications . intravenous sodium bicarbonate and calcium chloride were given , cardiac arrest was eventually terminated and patient got extubated . the blood pressure got stabilized and dopamine , epinephrine drips were stopped .
repeated arterial blood gases within an hour were improved and revealed ph of 7.15 , pco2 of 47 mmhg and po2 of 404 mmhg .
venous doppler 's of the lower extremities showed dvt in the left distal femoral vein , gastrocnemius , peroneal vein and normal right lower extremity .
the inferior vena cava filter was placed to prevent further occurrence of life - threatening clots or pulmonary embolus and heparin drip was continued . the renal failure secondary to
the cardiogenic shock improved with 2 mg of bumetanide , oral diuretic therapy . during the hospital course , heparin was discontinued due to patient 's low platelet count and positive heparin induced thrombocytopenia panel .
rivaroxaban , the oral anticoagulant was initiated and patient was transferred to floor with oxygen saturation of 95% on room air . on the medical floor , patient was walking and moving around , could talk in full sentences , was able to feed himself .
within 3 days of the hospital stay , he showed remarkable clinical and functional improvement and was discharged to home in a stable condition .
sudden cardiac arrest ( sca ) and sudden cardiac death ( scd ) is defined as a sudden termination of cardiac activity with hemodynamic instability requiring immediate cpr .
it has become a serious clinical and public health issue . despite advancement in the clinical and research medicine , united states ( us ) vital statistics mortality data due to sca and scd
the published death data reports that 15% of the total mortality in the us and other industrialized countries is secondary to sca .
sudden death , in majority of the cases comprise of lethal coronary heart disease , which account for 70% of the total and approximately 10 - 15% of the cases are secondary to other structural heart disease including cardiomyopathies , arrhythmias and valvular abnormalities .
rest of the non - cardiac causes of sca are attributed to bleeding , infections and familial scd of uncertain cause .
pe is also a possible non - cardiac cause of sca associated with very high mortality and often revealed by autopsy .
cpr with skillful chest compressions and early defibrillation remains the cornerstone of basic and advanced cardiac life support .
the mechanism of sca and its outcome largely depends on the underlying cause , hypoxemia , severe acid base imbalance and the duration of resuscitation ( usually prolonged if it is more than 4 min ) .
sca mortality is largely associated with brain death and most of the reported data justifies the role of mild therapeutic hypothermia with its neuroprotective effect .
the risk of bleeding is highly associated with hypothermia management , especially if thrombolysis or cardiac intervention has to be done .
bedside echocardiogram is a useful diagnostic tool to determine heart valve and pericardium integrity , ventricular function and to differentiate kinds of shock .
coronary catheterization and emergency percutaneous coronary intervention remains the principal approach for the resuscitated patients presenting with st - segment elevation and high troponins .
important is to consider pulmonary emboli , which can be the underlying cause of the same presentation .
although , sca is linked more with structural heart disease , association with pe remain under high suspicion .
acute pe is an extremely fatal disease , if not early diagnosed and treated appropriately .
clinical presentation is highly variable and is often associated with sinus tachycardia in electrocardiogram and arterial blood gases showing hypoxemia , hypocapnia and respiratory alkalosis .
serum troponin i and troponin t are found elevated in 30 - 50% of patients with pe .
though , confirmed diagnosis is attained by angiography , chest computed tomography with contrast if not contraindicated or ventricular perfusion scan , bedside echocardiogram has a remarkable role in emergency cases .
there are several reported cases of favorable outcomes associated with thrombolysis in presumed or confirmed diagnosis of pe during cardiac arrest .
we hereby , present the unique case of pe diagnosed on the basis of clinics and bedside echocardiogram during a prolonged cpr , needing hypothermia management and associated with rapid and remarkable recovery after administration of a loading dose of tpa without any complication of bleeding .
in this patient , the presence of clinical signs of dyspnea and hemoptysis , sinus tachycardia on electrocardiogram , elevated troponins and bedside echocardiogram showing enlargement and hypokinesis of the right ventricle , suggested the diagnosis of pe as an underlying cause of prolonged cardiac arrest , which prompted to start tpa , despite the risk of bleeding associated with the hypothermia management .
this case illuminates the precedence of early initiation of tpa with the expeditious diagnosis of pe , along with prolonged cpr and hypothermia treatment . | a 52-year - old non - smoking caucasian male , who was admitted to our emergency room after he was found unconscious in the bathroom , went into cardiac arrest requiring prolonged cardiopulmonary resuscitation ( cpr ) and hypothermia therapy .
cardiac catheterization showed non - obstructive coronary arteries and further bedside echocardiogram suggested probable pulmonary embolism ( pe ) as an underlying cause of cardiac arrest .
although thrombolytic therapy is an effective therapy for pe , it is not routinely given during prolonged cpr for its life- threatening bleeding complications .
many reported cases have suggested a beneficial effect of empiric thrombolytic in cardiac arrest , but unrelated to duration of resuscitation and adjuvant treatments that imposes bleeding risk .
we suspect that tissue plasminogen activator ( tpa ) should be promptly given to prolonged cardiac arrest patients , even when bleeding risk is high with the concurrent hypothermia treatment , keeping the benefits over risk strategy .
our patient received thrombolytic , tpa and showed remarkable clinical , physiological and radiographical improvement . |
acute lymphoblastic leukemia ( all ) arises from immature hematopoietic progenitors that are destined to develop into lymphocytes but acquire somatic gene mutations , which results in altered proliferation and arrest of differentiation .
although regulation of growth and differentiation is altered in these cells , they retain many of the features of their normal lymphoid counterparts .
this includes rearrangement of their immunoglobulin ( ig ) and t - cell receptor ( tcr ) genes .
similarly , cell surface antigens characteristic of normal b and t lymphocytes are expressed on the cell surface of the malignant lymphoid blast , and the pattern of this antigen expression can help delineate where in the maturation sequence the malignant transformation occurred .
the clonal nature of the malignant lymphoblasts has been established by the demonstration of identical rearrangements of ig or tcr genes within the all cell population.1 all of b- or t - cell lineage can be further subcategorized immunophenotypically by the point in maturation when their development is interrupted and they become malignant .
most cases of b - cell all have an immature immunophenotype and are designated as precursor lymphoid neoplasms or lymphoblastic leukemia / lymphoma .
these cases can be identified by the cell surface expression of cluster of differentiation 19 ( cd19 ) and one other b - lineage - associated antigen , such as cd20 , cd21 , cd22 , cd24 , or cd79 .
early b - cell blasts lack this expression but are cd10-positive , whereas the most immature subtype , pro - b , are cd10-negative .
it is important to note that although leukemic lymphoblasts express antigens related to their stage of development , they may also have an aberrant immunophenotype with asynchronous gene expression related to their malignant transformation.1,2 similarly , an all of t - cell origin can be classified on the basis of the sequence of expression of t - cell - associated cell surface antigens that evolve during normal thymocyte development .
the earliest t - cell precursors lack expression of cd4 and cd8 and are referred to as double - negative thymocytes .
they progress through a series of stages of differentiation characterized by rearrangement of the tcr genes , lose expression of cd34 , and gain expression of cd1a.1 an early t - cell precursor phenotype has been identified that has a very high clinical risk and makes up 8%15% of t - all in children and a higher percentage in adults .
this subtype has been shown to express activating mutations of ras , il-7r , and flt3 , along with pten deletions.3 all can also frequently express antigens associated with cells of myeloid origin ( eg , cd13 , cd14 , or cd33 ) .
these patients were previously felt to have a poorer prognosis , but this has not been borne out with the use of chemotherapy regimens in the modern era.4 genetic abnormalities play a key pathogenic role in the origin and development of all .
these were first identified by conventional cytogenetics and can be found in up to 75% of patients with all .
recurring abnormalities have been identified , and the distribution of these abnormalities varies significantly between patients with pediatric all compared with those with adult all , with adult patients having a higher frequency of adverse cytogenetic abnormalities .
the main adverse cytogenetic changes include the presence of t(9;22 ) ( bcr - abl1 or the philadelphia chromosome ) , t(4;11 ) , a complex karyotype ( five or more chromosomal abnormalities ) , or low hypodiploidy / near triploidy .
in contrast , patients with a hyperdiploid karyotype or a t(12;21 ) ( tel - aml1 ) have a favorable prognosis and are much more frequently seen in pediatric all , where these latter two abnormalities make up more than 50% of cases.5 the molecular revolution has led to the ability to sequence the genome of patients with all and identified numerous recurring genetic mutations and other alterations in the genome of patients with all .
some of the more common genetic alterations have included mutations in the paired box 5 ( pax5 ) gene.6 however , this has not been shown to have any prognostic significance .
janus kinase ( jak ) 1 and 2 gene mutations are present in up to 35% of down syndrome - associated all and about 10% of bcr - abl1 all . in adults ,
jak1 mutations are more prevalent in t - cell all and are associated with a poor prognosis .
the ikaros family zinc finger protein 1 ( ikzf1 ) has been associated with high - risk all and poor outcomes .
mutations of ikzf1 are common in bcr - abl1-positive all and in the lymphoid blast phase of chronic myeloid leukemia .
the cytokine receptor - like factor 2 ( crlf2 ) has alterations in about 5% of adult all.7 abnormal expression of crlf2 can be detected by immunohistochemistry , and crlf2 rearranged all was associated with mutant jak2 in about 50% of cases . in pediatric all , elevated crlf2 expression
a new finding of great interest is the identification of a gene expression profile in bcr - abl1-negative all that is similar to that seen in patients with the bcr - abl1 translocation .
these cases also commonly harbor mutations of ikzf1 and have a poor prognosis.8,9 this phenotype is seen with increasing frequency in childhood all patients ( 10%14% , and up to 26% in young adults aged 2139 years).10 in vitro studies suggest that these cells may also be sensitive to tyrosine kinase inhibitors similar to their bcr - abl1-positive counterparts .
intrachromosomal amplification of chromosome 21 ( iamp-21 ) is defined as a gain of at least five copies of the runx1 region of chromosome 21 . in pediatrics ,
this abnormality has been associated with significantly inferior survival.11 increasing identification of genetic abnormalities in all brings the hope that these abnormalities can translate into new therapeutic targets.12 all represents a remarkable odyssey of success in the era of cancer treatment . from the first report by sidney farber13 of temporary remissions induced by aminopterin in five children with all
this was followed by reports in the 1960s of combination chemotherapy , including mercaptopurine and methotrexate , leading to 2-year survival rates of 20%.14 this led to the concept of using combination chemotherapy to treat malignancy .
a recognition that all also could frequently involve the central nervous system ( cns ) led to the recognition of a need for cns - directed therapy , including cranial radiation and intrathecal methotrexate .
, which was pioneered by donald pinkel and colleagues at st jude s research hospital in memphis , tennessee .
total therapy encompassed different phases of treatment , including remission induction , cns - directed therapy , intensification ( also referred to as consolidation ) therapy , and continuation ( or maintenance ) treatment.15 remarkably , these components of therapy remain the foundation of modern all therapy in both children and adults .
as new chemotherapy agents were found to have activity in all , including anthracyclines , cytarabine , and asparaginase , they were incorporated into the treatment regimens . during this same time , it became apparent that radiation - induced complications could be severe and led to the use of triple intrathecal therapy with methotrexate , cytarabine , and hydrocortisone , along with higher doses of intravenous methotrexate to effectively prophylax the cns and replace prophylactic cranial irradiation .
many of the advances in the treatment of childhood all during the 1980s and 1990s were related to optimizing the doses and schedules of existing agents , rather than simply the introduction of more new agents.14 these efforts led to remarkable improvement in survival for children with all , such that by the middle of the previous decade , 10-year survival estimates are at 91% ( figure 2).14 paralleling these advances in treatment were advances in the understanding of the biology of all , as outlined in the previous section .
these advances led to the ability to risk - stratify patients and alter treatment intensity on the basis of prognosis .
the identification of these cytogenetic and genetic markers has also begun to result in the development of new agents effective in the treatment of all , including the development of tyrosine kinase inhibitors such as imatinib , which in combination with chemotherapy , has significantly improved the outcome of children and adults with bcr - abl1 all ( philadelphia chromosome - positive).16,17 unfortunately , results of treatment in adults with all have not paralleled the success seen with children .
these poorer results can be attributed to multiple factors including the inability of older adults to tolerate the intensive chemotherapy given to pediatric patients ; the relative rarity of all in adults compared with children , which makes it more challenging for adult oncologists to follow the complex treatment regimens developed for adult patients ; and most important , the different biology of the disease in adults compared with in children.18 in particular , adults with all more frequently harbor adverse cytogenetic abnormalities , including the t(9;22 ) ( philadelphia chromosome ) , t(4;11 ) , a complex karyotype ( five or more chromosomal abnormalities ) , or low hypodiploidy / near triploidy , and less frequently have favorable cytogenetic abnormalities such as the t(12;21 ) ( tel - aml1 ) or hyperdiploidy.5 thus , adults have increased rates of death from complications and more risk of relapse than children .
survival rates in adults at 3 years are , therefore , only in the range of 30%40%.18 however , in the last 10 years , it has been increasingly recognized that adolescents and young adults ( aya ) fare differently if they are treated with a pediatric as opposed to an adult all chemotherapy regimen . this was first reported by stock et al19 in a retrospective comparison of outcome in 321 aya ( age , 1620 years ) who were treated on consecutive trials on either the children s cancer group or the cancer and leukemia group b from 19882001 .
although complete remission rates were identical in the two cohorts of patients , the children s cancer group aya had a 67% overall survival at 7 years in contrast to the cancer and leukemia group b aya , for whom overall survival was 46% ( p0.001).19 multiple subsequent similar comparisons from other countries comparing aya treated on adult versus pediatric regimens showed similar results.20 the reasons for these differences in outcome are likely multiple , but an important factor is that pediatric regimens include much higher doses of nonmyelosuppressive chemotherapy drugs including corticosteroids , vincristine , and asparaginase .
several studies have now prospectively assessed the use of pediatric - intensive regimens in adults .
this was first reported by huguet et al,21 for the french group for research on adult acute lymphoblastic leukemia , who gave a pediatric intensive regimen to 225 adults with a median age of 31 years but a range of 1560 years .
it was 95% in patients aged 1545 years and 87% in patients aged 4660 years .
the overall complete response rate of 93.5% was superior to a previous trial ( leucmies aigus lymphoblastiques de ladulte-94 [ lala-94 ] ) , which used a traditional adult regimen and had a complete response rate of 88% ( p=0.02 ) .
the overall survival rate was 66% in patients younger than 45 years , which compared favorably with the lala-94 trial , in which the overall survival rate was 44% at 42 months of follow - up .
patients older than 45 years did not tolerate this pediatric - intensive regimen as well as patients younger than 45 years , as there was a higher cumulative incidence of chemotherapy - related deaths ( 23% versus 5% , respectively ; p0.001 ) and deaths in first complete remission ( 22% versus 5% , respectively ; p0.01).21 a recently published meta - analysis of trials with adult - intensive regimens has suggested that incorporation of allogeneic stem cell transplantation ( sct ) into the treatment of adults with all in first remission results in superior outcomes compared with chemotherapy or autologous sct.22 thus , the question has arisen as to whether a younger adult with all should be treated with a pediatric intensive regimen or directed to allogeneic transplant once they achieve first remission .
many investigators feel that young adults without other high - risk features can be managed with a pediatric intensive chemotherapy regimen alone and only considered for transplant if they relapse.23 however , the therapy of older adults with all remains particularly challenging
. they do not tolerate pediatric intensive regimens as well as younger adults but also do not tolerate intensive therapies such as allogeneic sct either .
another option that is gaining increasing interest is the use of reduced - intensity conditioning allogenic sct .
recent studies have suggested that the outcomes with reduced - intensity conditioning allogeneic sct may be comparable to myeloablative conditioning allogeneic sct , even though the patients who received reduced - intensity conditioning were older and likely had more comorbidities.24,25 the management of older adults with all has recently been summarized.26
these were first identified by conventional cytogenetics and can be found in up to 75% of patients with all .
recurring abnormalities have been identified , and the distribution of these abnormalities varies significantly between patients with pediatric all compared with those with adult all , with adult patients having a higher frequency of adverse cytogenetic abnormalities .
the main adverse cytogenetic changes include the presence of t(9;22 ) ( bcr - abl1 or the philadelphia chromosome ) , t(4;11 ) , a complex karyotype ( five or more chromosomal abnormalities ) , or low hypodiploidy / near triploidy .
in contrast , patients with a hyperdiploid karyotype or a t(12;21 ) ( tel - aml1 ) have a favorable prognosis and are much more frequently seen in pediatric all , where these latter two abnormalities make up more than 50% of cases.5 the molecular revolution has led to the ability to sequence the genome of patients with all and identified numerous recurring genetic mutations and other alterations in the genome of patients with all .
some of the more common genetic alterations have included mutations in the paired box 5 ( pax5 ) gene.6 however , this has not been shown to have any prognostic significance .
janus kinase ( jak ) 1 and 2 gene mutations are present in up to 35% of down syndrome - associated all and about 10% of bcr - abl1 all . in adults ,
jak1 mutations are more prevalent in t - cell all and are associated with a poor prognosis .
the ikaros family zinc finger protein 1 ( ikzf1 ) has been associated with high - risk all and poor outcomes .
mutations of ikzf1 are common in bcr - abl1-positive all and in the lymphoid blast phase of chronic myeloid leukemia .
the cytokine receptor - like factor 2 ( crlf2 ) has alterations in about 5% of adult all.7 abnormal expression of crlf2 can be detected by immunohistochemistry , and crlf2 rearranged all was associated with mutant jak2 in about 50% of cases . in pediatric all , elevated crlf2 expression
a new finding of great interest is the identification of a gene expression profile in bcr - abl1-negative all that is similar to that seen in patients with the bcr - abl1 translocation .
these cases also commonly harbor mutations of ikzf1 and have a poor prognosis.8,9 this phenotype is seen with increasing frequency in childhood all patients ( 10%14% , and up to 26% in young adults aged 2139 years).10 in vitro studies suggest that these cells may also be sensitive to tyrosine kinase inhibitors similar to their bcr - abl1-positive counterparts .
intrachromosomal amplification of chromosome 21 ( iamp-21 ) is defined as a gain of at least five copies of the runx1 region of chromosome 21 . in pediatrics ,
this abnormality has been associated with significantly inferior survival.11 increasing identification of genetic abnormalities in all brings the hope that these abnormalities can translate into new therapeutic targets.12
all represents a remarkable odyssey of success in the era of cancer treatment . from the first report by sidney farber13 of temporary remissions induced by aminopterin in five children with all
this was followed by reports in the 1960s of combination chemotherapy , including mercaptopurine and methotrexate , leading to 2-year survival rates of 20%.14 this led to the concept of using combination chemotherapy to treat malignancy . a recognition that all also could frequently involve the central nervous system ( cns ) led to the recognition of a need for cns - directed therapy , including cranial radiation and intrathecal methotrexate .
, which was pioneered by donald pinkel and colleagues at st jude s research hospital in memphis , tennessee . their
total therapy encompassed different phases of treatment , including remission induction , cns - directed therapy , intensification ( also referred to as consolidation ) therapy , and continuation ( or maintenance ) treatment.15 remarkably , these components of therapy remain the foundation of modern all therapy in both children and adults . as new chemotherapy agents were found to have activity in all , including anthracyclines , cytarabine , and asparaginase , they were incorporated into the treatment regimens . during this same time
, it became apparent that radiation - induced complications could be severe and led to the use of triple intrathecal therapy with methotrexate , cytarabine , and hydrocortisone , along with higher doses of intravenous methotrexate to effectively prophylax the cns and replace prophylactic cranial irradiation .
many of the advances in the treatment of childhood all during the 1980s and 1990s were related to optimizing the doses and schedules of existing agents , rather than simply the introduction of more new agents.14 these efforts led to remarkable improvement in survival for children with all , such that by the middle of the previous decade , 10-year survival estimates are at 91% ( figure 2).14 paralleling these advances in treatment were advances in the understanding of the biology of all , as outlined in the previous section .
these advances led to the ability to risk - stratify patients and alter treatment intensity on the basis of prognosis .
the identification of these cytogenetic and genetic markers has also begun to result in the development of new agents effective in the treatment of all , including the development of tyrosine kinase inhibitors such as imatinib , which in combination with chemotherapy , has significantly improved the outcome of children and adults with bcr - abl1 all ( philadelphia chromosome - positive).16,17 unfortunately , results of treatment in adults with all have not paralleled the success seen with children .
these poorer results can be attributed to multiple factors including the inability of older adults to tolerate the intensive chemotherapy given to pediatric patients ; the relative rarity of all in adults compared with children , which makes it more challenging for adult oncologists to follow the complex treatment regimens developed for adult patients ; and most important , the different biology of the disease in adults compared with in children.18 in particular , adults with all more frequently harbor adverse cytogenetic abnormalities , including the t(9;22 ) ( philadelphia chromosome ) , t(4;11 ) , a complex karyotype ( five or more chromosomal abnormalities ) , or low hypodiploidy / near triploidy , and less frequently have favorable cytogenetic abnormalities such as the t(12;21 ) ( tel - aml1 ) or hyperdiploidy.5 thus , adults have increased rates of death from complications and more risk of relapse than children .
survival rates in adults at 3 years are , therefore , only in the range of 30%40%.18 however , in the last 10 years , it has been increasingly recognized that adolescents and young adults ( aya ) fare differently if they are treated with a pediatric as opposed to an adult all chemotherapy regimen . this was first reported by stock et al19 in a retrospective comparison of outcome in 321 aya ( age , 1620 years ) who were treated on consecutive trials on either the children s cancer group or the cancer and leukemia group b from 19882001 .
although complete remission rates were identical in the two cohorts of patients , the children s cancer group aya had a 67% overall survival at 7 years in contrast to the cancer and leukemia group b aya , for whom overall survival was 46% ( p0.001).19 multiple subsequent similar comparisons from other countries comparing aya treated on adult versus pediatric regimens showed similar results.20 the reasons for these differences in outcome are likely multiple , but an important factor is that pediatric regimens include much higher doses of nonmyelosuppressive chemotherapy drugs including corticosteroids , vincristine , and asparaginase .
several studies have now prospectively assessed the use of pediatric - intensive regimens in adults .
this was first reported by huguet et al,21 for the french group for research on adult acute lymphoblastic leukemia , who gave a pediatric intensive regimen to 225 adults with a median age of 31 years but a range of 1560 years .
it was 95% in patients aged 1545 years and 87% in patients aged 4660 years .
the overall complete response rate of 93.5% was superior to a previous trial ( leucmies aigus lymphoblastiques de ladulte-94 [ lala-94 ] ) , which used a traditional adult regimen and had a complete response rate of 88% ( p=0.02 ) .
the overall survival rate was 66% in patients younger than 45 years , which compared favorably with the lala-94 trial , in which the overall survival rate was 44% at 42 months of follow - up .
patients older than 45 years did not tolerate this pediatric - intensive regimen as well as patients younger than 45 years , as there was a higher cumulative incidence of chemotherapy - related deaths ( 23% versus 5% , respectively ; p0.001 ) and deaths in first complete remission ( 22% versus 5% , respectively ; p0.01).21 a recently published meta - analysis of trials with adult - intensive regimens has suggested that incorporation of allogeneic stem cell transplantation ( sct ) into the treatment of adults with all in first remission results in superior outcomes compared with chemotherapy or autologous sct.22 thus , the question has arisen as to whether a younger adult with all should be treated with a pediatric intensive regimen or directed to allogeneic transplant once they achieve first remission .
many investigators feel that young adults without other high - risk features can be managed with a pediatric intensive chemotherapy regimen alone and only considered for transplant if they relapse.23 however , the therapy of older adults with all remains particularly challenging .
they do not tolerate pediatric intensive regimens as well as younger adults but also do not tolerate intensive therapies such as allogeneic sct either .
another option that is gaining increasing interest is the use of reduced - intensity conditioning allogenic sct .
recent studies have suggested that the outcomes with reduced - intensity conditioning allogeneic sct may be comparable to myeloablative conditioning allogeneic sct , even though the patients who received reduced - intensity conditioning were older and likely had more comorbidities.24,25 the management of older adults with all has recently been summarized.26
the identification of the graft versus leukemia reaction after sct and the acknowledgment that it plays a key role in the cure of hematologic malignancies led to the recognition that the immune system could play a key role in the treatment of malignancy.27 this led to the increasing study of appropriate targets for immunotherapy , including tumor - specific and/or tumor - associated antigens .
these can be attacked by different cellular components of the immune system , including t - cells , natural killer cells , and dendritic cells .
the advent of the development of increasing sophisticated monoclonal antibodies has led to the approval of an ever - increasing number of such antibodies for the treatment of hematologic malignancies and solid tumors.28 conjugation of monoclonal antibodies with immunotoxins and chemotherapy drugs has also shown promise , as has the production of bispecific t - cell engaging antibodies .
there is increasing interest in engineering cells that combine components of monoclonal antibodies with the t - cell to promote target - killing .
examples include chimeric antigen receptors , modified t - cells that have shown recent promise in the treatment of all.29,30
during the course of b - cell ontogeny , multiple cell surface antigens are expressed , and several of them have become attractive targets for monoclonal antibody - directed therapy .
these include cd20 and cd22 , although these two antigens are expressed somewhat later in b - cell development .
cd19 has become one of the most attractive targets in the treatment of b - lineage all , as its surface expression on the cell begins around the time of ig gene rearrangement .
the human cd19 antigen is a member of the ig superfamily and is a 95 kda transmembrane glycoprotein .
the gene for cd19 is located on the short arm of chromosome 16 , contains 15 exons , and produces a protein composed of 556 amino acids .
the cd19 protein contains an extracellular n - terminus , a single transmembrane domain , and a cytoplasmic c - terminus .
it is categorized as a type 1 transmembrane protein without significant homology with any other known proteins ( figure 3).31 cd19 serves a vital function in establishing an effective immune response , as it takes part in antigen - independent development as well as in immunoglobulin - induced activation of b - cells .
intracellular downstream targets of cd19 activation include protein kinase members of the src family , the ras family , abl , btk , and pi3k , among others .
importantly , it functions as an adaptor protein by recruiting cytoplasmic signaling proteins to the cell membrane.31 mice that are deficient in cd19 have defects in the later stages of b - cell growth and maturation
. this deficiency does not affect the number of b - cell precursors in the marrow , but cd19 mice have marked reductions in the frequency and number of splenic and peripheral blood b cells .
humans have been described who have homozygous frame shift mutations of the cd19 gene , which produces truncation of three key cytoplasmic tyrosine residues .
these individuals have normal numbers of precursor and total b cells but decreased numbers of cd5 b cells and cd27 memory b cells .
the patients develop hypogammaglobulinemia and have poor antibody responses to rabies vaccination , and they are more prone to infection.32
as noted , cd19 is an attractive target for immunotherapy because of its restricted expression on b - lineage lymphomas and leukemias , as well as normal b cells , but not on other hematopoietic cells or normal tissues .
it has a broader expression profile through b - cell development compared with other antigens , such as cd20 , and is more efficiently internalized.33 despite these attractive features , conventional antibodies alone targeted against cd19 had limited activity in preclinical models , although these models had high cd19 expression and were able to internalize antibodies.34 thus , multiple different antibody constructs and conjugations have been developed with cd19 as the target .
these are summarized in table 1 and include cd19 antibodies conjugated to a maytansine derivative ; engineered anti - cd19 antibodies that enhance antibody - dependent cell - mediated cytotoxicity ; antibody conjugation to diphtheria toxin ; antibody conjugation to auristatin anti - cd19 ; the chimeric antigen receptor t - cells described earlier ; dual - affinity retargeting antibodies , which are encoded by two different polypeptide chains that contain a variable heavy chain domain fused to a variable light chain domain ; and a bispecific t - cell engager that comprises two single - chain antibodies ( scfvs ) that bind cd3 and cd19 , respectively .
these various cd19 immunotherapy approaches were recently summarized in a review.33 blinatumomab s name is derived from the fact that it is a b - lineage - specific antitumor mouse monoclonal antibody .
the basic characteristics of blinatumomab , including its structure , specificity , purification , and cytotoxicity , were first reported in 2000.35 blinatumomab is a construct of scfvs that forms a 55 kda fusion protein ( figure 4 ) .
recombinant dna technology is used and takes the respective cdnas , which encode the four variable domains , and three linker sequences .
a 5 amino acid linker sequence that is nonimmunogenic is used to recombinantly link the two scfvs in tandem .
this is thought to give the two scfvs a significant degree of rotational ability to enhance binding of epitopes on separate cells.36 blinatumomab is produced in chinese hamster ovary cells in a both a monomeric and dimeric form .
although both these forms are biologically active , only the monomeric form is purified for clinical use.36 in vitro , blinatumomab was found to be extremely potent , with a half - maximal concentration for redirected lysis of cd19-positive target cells by b cells in the range of 10100 pg / ml with t cells from healthy donors.37 all t - cell populations except naive t cells showed high - level redirected lysis .
this effect was seen with resting t cells that were not previously activated and was associated with upregulation of t - cell antigen expression , including cd69 , cd25 , and cd2 , along with transient release of multiple inflammatory cytokines including interleukins 2 , 6 , and 10 ; tumor necrosis factor , and interferon .38 the first clinical trials in humans began in 2001 ( table 2 ) .
phase i studies in patients with relapsed or refractory non - hodgkin lymphoma were carried out using doses ranging from 0.7513 g / m administered once , twice , or three times weekly as 2- or 4-hour intravenous infusions .
significant neurologic events included aphasia , ataxia , disorientation , and seizures and led to discontinuation of therapy in 6 of 22 patients .
cytokine release syndrome and infections were also observed.36 given the toxicity profile with shorter infusions , a continuous intravenous infusion over a period of 48 weeks was carried out in non - hodgkin lymphoma patients .
after an initial observation period from 37 days , the blinatumomab infusion could be continued as an outpatient .
all trials since this initial phase i study have administered blinatumomab as a continuous infusion for 4 weeks.36 the initial clinical experience with this infusion schedule was in patients with low - grade lymphoma and mantle cell lymphoma .
dose escalation started as low as 0.5 g / m per day but was escalated up to 90 g / m per day .
the trial was later amended to include patients with aggressive diffuse large b - cell lymphoma .
the most recent update on 70 patients , of whom 93% had had prior rituximab - based regimens , showed that most patients had mild adverse events of a constitutional nature , generally of grade 1 or 2 .
a transient release of inflammatory cytokines was noted in the first few days , along with a rapid decline in peripheral blood b cells . even with the continuous infusion , cns events were noted , again primarily during the first 3 days of treatment , and included encephalopathy , aphasia , tremor , disorientation , and convulsions .
the etiology of the cns events is not entirely clear but may be related to activated t - cells that release neurotoxic cytokines into the cns .
fortunately , these cns events have been reversible with discontinuation of treatment.39 the maximum tolerated dose in this study was 60 g / m per day . a step - wise approach to blinatumomab administration with lower doses given in the first week or 2 , followed by escalation to the full dose ,
has lessened the incidence of neurologic toxicity.39 complete remissions were noted with dose levels as low as 15 g / m per day , and it was noted that five of six patients at this dose had clearance of lymphomatous involvement of the marrow .
the overall response rate at the 60 g / m per day dose was 76% ( 16/21 patients ) , with seven patients having a complete remission or unconfirmed complete remission.36,39 there is still some uncertainty related to the long - term effects of depletion of normal cd19-positive b - cells .
patients do develop hypogammaglobulinemia as expected , but long - term infectious complications have not been prominent . in diffuse
large b - cell non - hodgkin lymphoma , experience is more limited , but of a group of 13 patients treated , eleven were evaluable , with a total of six responses and two patients with stable disease . of the six responders ,
patients with extranodal disease and those with prior autologous transplant also responded ; these responses overall appeared to be durable . in three of six responders ,
allogeneic transplant was able to be performed.40 given the activity seen in non - hodgkin lymphoma in clearing lymphomatous cells from the marrow , it was felt that blinatumomab might be efficacious in b - lineage all . because patients who are in hematologic remission , but have persistent minimal residual disease ( mrd ) by molecular or immunophenotypic evidence , have a poor prognosis , it was decided that a pilot study in patients in hematologic remission who were mrd - positive or who had experienced an mrd relapse would be initially carried out .
the dose chosen was 15 g / m per day by 4-week continuous intravenous infusion , as marrow clearing had been seen in lymphoma patients at this dose .
of 21 patients treated , 20 were evaluable and 16 ( 80% ) became mrd - negative during the first 4-week cycle of therapy .
no deaths were noted.41 longer - term follow - up from this study has been recently reported .
after a median follow - up of 33 months , the relapse - free survival was 61% .
nine patients were able to proceed to allogeneic sct and had a relapse - free survival of 65% .
of six patients with bcr - abl1 all who responded and had no further therapy after blinatumomab , four remain in ongoing hematologic and molecular remission.42 these encouraging results have led to a larger trial in patients who are mrd - positive across several countries in europe , which was initiated in the fall of 2010 .
these results have also led to a trial in patients with hematologic relapse or refractory b - lineage all .
three dosing regimens were explored , including initiation of therapy at 15 g / m per day , and continued at that dose for the entire 4-week cycle versus an initial dose of 5 g / m per day for the first week and then escalation to 15 g / m per day for the subsequent 3 weeks .
a third group initiated therapy at 5 g / m per day for the first week and then went to 15 g / m per day for the second week and to 30 g / m per day for the third and fourth weeks .
the most recent update included 36 patients who had been treated.43 on the basis of the lowest incidence of adverse effects , the schedule selected for treatment of 18 of the 36 patients in a final cohort was the dose of 5 g / m per day for the first week , followed by 15 g / m per day for the subsequent 3 weeks . of the entire cohort of patients , 26 of 36 achieved a complete remission or complete remission without hematologic recovery ( 72% ) .
of these 26 patients , 24 ( 92% ) achieved mrd negativity within the first two cycles .
twenty of 21 ( 95% ) patients in first relapse responded , whereas only 6 ( 40% ) of 15 of the remaining patients achieved a hematologic complete remission or complete remission without hematologic recovery .
two of these relapses were cd19-negative , three were cd19-positive , and three were unknown .
the median overall survival for all 36 treated patients is 9 months , with a median follow - up time for overall survival of 10.7 months .
for patients achieving a complete remission or complete remission without hematologic recovery , the median survival is 14.1 months , whereas for patients who failed blinatumomab , the median survival is 6.6 months .
as noted previously , cytokine release syndrome and cns events were the most significant toxicities .
three patients had seizures , and three patients had encephalopathy.43 an international phase ii trial of this regimen is currently ongoing .
further studies have also confirmed that body surface area - based dosing is not essential , as pharmacokinetic studies have not shown a significant difference in levels with weight - based versus flat dosing .
therefore , flat dosing with an initial dose of 9 g / day for the first week followed by 28 g / day is currently being used .
the exciting results achieved with blinatumomab in both the hematologic relapsed / refractory setting and in the mrd setting have led to the development of a us national intergroup trial , which will randomize patients with b - lineage all between the ages of 35 and 70 years to induction chemotherapy to achieve remission followed by four cycles of blinatumomab versus chemotherapy alone .
although more than 90% of children can now be cured of their all , these results have not been duplicated in adults .
the use of pediatric intensive regimens has improved the outcome of young adults with all , but further progress is needed . in older adults , the limits of conventional chemotherapy have been reached , and new approaches are needed .
the cd19 antigen is nearly universally expressed on b - lineage all and is an attractive target for therapy .
multiple immunotherapeutic approaches using modified monoclonal antibodies have been developed as outlined in this review .
one antibody construct , blinatumomab , a bispecific t - cell engager antibody , is in advanced stages of development and shows significant promise in improving outcomes of patients with b - lineage all . a large intergroup trial in the united states will test the efficacy of blinatumomab in newly diagnosed middle - aged and older adults with b - lineage all . | acute lymphoblastic leukemia ( all ) arises from immature b and t lymphoblasts .
an increasing array of cytogenetic and molecular markers have been identified in all , which allows for increasingly sophisticated prognostication , as well as identification of potential new targets for therapy .
the treatment of all in children has shown astounding success in the last 50 years , with more than 90% of children now able to be cured of their all . in adults ,
these success rates have not been duplicated .
however , the use of pediatric - intensive regimens in young adults has shown increasing success .
the use of monoclonal antibodies conjugated to drugs , immunotoxins , and cells also has shown early success and promises to enhance the outcome of newly diagnosed patients .
blinatumomab , a bispecific t - cell engager antibody , brings a malignant b cell in proximity to a t cell with redirected lysis .
this antibody construct has shown promising results in patients with relapsed and refractory disease and is entering randomized clinical trials in newly diagnosed patients .
the addition of monoclonal antibody therapy to chemotherapy in adults promises to enhance outcomes while hopefully not increasing toxicity .
after many years of stagnation , it appears that the therapy of adults with all is showing significant improvement . |
a 39 year - old female patient with ovarian cancer ( stage iii ) underwent tah with bso ( total abdominal hysterectomy and bilateral salpingo - oophorectomy ) at another hospital . during chemotherapy with paclitaxel and carboplatin ( day 9 , pod 16 ) , she showed melena followed by hematochezia .
she was diagnosed with neutropenic / septic shock due to ascending colon perforation and was transferred to our hospital .
emergent total colectomy was successfully conducted , and the patient was moved to the icu .
the patient experienced difficulty in weaning from mechanical ventilation due to severe tachypnea and labored breathing .
neutropenia did not improve in spite of granulocyte colony - stimulating factor ( g - csf ) injection
chemotherapy induced neutropenia and sepsis was suspected , thus g - csf and antibiotics ( piperacillin / tazobactam ) were administered .
the patient was extubated but she complained of dyspnea and showed deteriorating levels of consciousness .
after reintubation , brain ct and electroencephalography ( eeg ) were performed which showed no abnormal findings ( fig .
her neurologic status did not show improvement and on the next day , she suddenly developed partial seizure which progressed to generalized tonic - clonic ( gtc ) seizure .
arterial blood gas analysis showed respiratory alkalosis with metabolic alkalosis ( ph : 7.604 , paco2 : 24.2 mmhg , hco3 : 27.4 mmol / l ) , while electrolytes and liver panel were unremarkable .
continuous renal replacement therapy ( crrt ) for the treatment of hyperammonemia was not effective ( follow - up ammonia level was 1,356 g / dl ) .
the patient showed recurrent episodes of gtc type seizure requiring management of status epilepticus . midazolam and phenytoin
fluctuating level of consciousness is common in icu patients and it has been associated with increased mortality . when serious neurological insults such as stroke or seizure affect a patient , it is often too late to attempt for a significant alteration in the outcome of the patient
. therefore , it seems best to identify the underlying risk factors and prevent / attenuate such critical conditions .
however , given the multi - factorial and unpredictable nature of hyperammonemia , critical events can occur unexpectedly .
common symptoms of hyperammonemia include hypotonia , vomiting , lethargy , seizures , coma , ataxia , anorexia , abnormal behavior patterns , dysarthria , weakness , liver enlargement , and dementia .
ammonia , along with inflammation , has been consistently shown to play a central role in hepatic encephalopathy .
hepatic causes of hyperammonemia are well documented and include hepatotoxins , reye syndrome , or carnitine deficiency . however , hyperammonemia in the context of unremarkable liver function tests is a challenge for physicians - the differential diagnosis becomes more difficult . causes worth considering in patients with non - hepatic hyperammonemia include inborn errors of metabolism ( defects of the urea cycle , fatty acid oxidation , organic acid disorders ) , circulatory shock with or without portosystemic shunt , hematological malignancies , urinary infection with urease - producing bacteria , anticonvulsants or chemotherapeutic drugs , and excessive amino acid load / increased catabolism .
laboratory tests pertaining to enzyme deficiencies were not conducted in the present case because it was considered less worthwhile given the rapid clinical deterioration of the patient .
hyperammonemia after chemotherapy has also been reported in the literature , mostly with hematological malignancies but also in colorectal cancer patients .
it has also been described in patients with multiple myeloma in those receiving chemotherapy with aspraginase , 5-fluorouracil , and in those receiving rituximab .
however , there have been no reports on chemotherapy agents ( taxanes and platinum agents ) used in the treatment of ovarian cancer , as the case in our patient .
surgical procedures or interventions reported to be associated with hyperammonemia include lung transplantation , bone marrow transplantation , and bariatric surgery .
although the most common cause of hyperammonemia seems to be hepatic dysfunction , this is unlikely to be the cause in our patient given the normal liver function test results .
we believe that the cause may have been infection , bleeding , chemotherapy or the sum of the factors listed .
the goal for the treatment of acute hyperammonemia should be rapid reduction of serum ammonia , regardless of the cause . whenever possible , protein intake should be discontinued and hypercaloric glucose - based solution should be provided to enhance anabolism .
supportive treatment and correction of hydration , nutritional status , mineral ( calcium , potassium ) , and electrolyte imbalances should be addressed .
benzoate binds glycerine and forms hippurate while phenylacetate binds glutamine to form phenyl - acetylglutamine .
when ammonia production exceeds removal , the role of dialysis becomes significant . on the other hand , dialysis may cause rebound increases in ammonia by removing nutrients from plasma and creating a catabolic state .
orthotopic liver transplantation may be necessary in patients who display poor response to conservative management with refractory / recurrent hyperammonemia .
one report showed that liver transplantation resulted in a 3-year survival of 93% and improved quality of life , including a normal - protein diet .
given the high level of ammonia in our patient , crrt and sodium benzoate were administered .
some advocate the use of hemodialysis which may have been more beneficial in our patient , but the substantial hemodynamic instability of our patient hindered its use .
severe hyperammonemia is associated with high mortality and morbidity . when this is not primarily due to liver failure , prompt and early diagnosis followed by appropriate intervention is pivotal but challenging .
with regard to our case , there were several possible causes of non - hepatic hyperammonemia that are unlikely when considered separately , but potentially possible when considered altogether .
the possible causes that may have contributed to increased ammonia production include underlying infection , recent history of chemotherapy , gi bleeding , total parenteral nutrition . in hindsight , serial levels of ammonia , including the baseline level , would have been helpful in managing the patient . whether it would have altered
the outcome remains uncertain . from the lessons of our case , we recommend that serum levels of ammonia should be included in the initial diagnostic work - up of patients with risk factors for hyperammonemia , especially if they show altered consciousness and convulsion / seizure in the icu . | there are various causes to a low level of consciousness in patients in the intensive care unit . neurological injury , infection , and metabolic disarray
are considered as some of the causes .
a 39 year - old female patient was transferred to our hospital with septic shock due to ascending colon perforation .
the patient had previously received ovarian cancer surgery and a cycle of chemotherapy at another hospital .
emergent operation for colon perforation was successful .
after the operation , she was treated in the intensive care unit for infectious and pulmonary complications .
she suddenly showed deterioration in her level of consciousness and had a generalized seizure . at the time of her seizure , she had severe hyperammonemia .
brain ct showed severe cerebral edema that was absent in the ct scan taken 2 days before .
continuous renal replacement therapy was conducted but was ineffective in lowering the level of serum ammonia and the patient subsequently died . |
the most common indication for hysterectomy is uterine fibroids , followed by dysfunctional uterine bleeding . regarding the procedure
traditionally , abdominal hysterectomy ( ah ) has been used for gynecological malignancy or if the uterus is enlarged . vaginal hysterectomy ( vh )
was originally used only for prolapse , but it is now also used for dysfunctional uterine bleeding when the uterus is of fairly normal size .
laparoscopic hysterectomy ( lh ) was introduced in 1988 and published in 1989 by harry reich as an alternative to abdominal hysterectomy .
the first lh was set up as lh , as both uterine arteries were ligated laparoscopically , and most of the vagina opened laparoscopically . in 1992 , already reich described his foremost total laparoscopic hysterectomy ( tlh ) .
however , in the 1990s , most gynecologists adopted the alternative laparoscopic - assisted vaginal hysterectomy ( lavh ) , an operation in which the upper blood supply to the uterus was ligated laparoscopically followed by a vaginal hysterectomy .
significantly improved outcomes already confirmed that vh should be performed in preference to ah whenever possible .
lh ( in general ) can avoid the abdominal approach and shows benefits in lower intraoperative blood loss , smaller drop in hemoglobin level , shorter duration of hospital stay , speedier return to normal activities , fewer wound , or abdominal wall infections , fewer unspecified infections , however , at the cost of longer operating time and more urinary tract ( bladder or ureter ) injuries [ 3 , 610 ] .
when it comes to laparoscopic hysterectomy , a variety of associated operations can be distinguished .
garry et al . delineated this evolution of different lh procedures in table 1 .
whereas several prospective studies already thoroughly compared the lh in general versus conventional hysterectomy methods , unfortunately , no proper randomized controlled trial comparing lavh versus tlh has been set up yet .
therefore , this retrospective study aims to compare recorded data on two types of lh , i.e. , lavh and tlh , with respect to indication , operative characteristics , and adverse outcomes . the results could indicate whether a prospective study should be designed or not .
table 1lh classification laparoscopic associated hysterectomy classification1diagnostic laparoscopy with vaginal hysterectomy2laparoscopic - assisted vaginal hysterectomy3laparoscopic hysterectomy4total laparoscopic hysterectomy5laparoscopic supracervical hysterectomy including classical interstitial semm hysterectomy6vaginal hysterectomy with laparoscopic vault suspension or laparoscopic pelvic reconstruction7laparoscopic hysterectomy with lymphadenectomy8laparoscopic hysterectomy with lymphadenectomy and omentectomy9laparoscopic radical hysterectomy with lymphadenectomy lh classification lavh , introduced as a prototype of laparoscopic hysterectomy in the early 1990s of the last century , has a reputation for its easy implementation into daily practice as well as being an often overused expensive procedure .
the latter can be explained as skilled vaginal surgeons rarely find the addition of a laparoscope necessary .
tlh , on the other hand , faces a slow implementation rate in many clinics due to required new and complex laparoscopic skills and extensive length of surgery . especially in the netherlands
, lh knows a slow implementation rate ( 4% of all hysterectomies ) possibly because of a tradition in vaginal hysterectomy . since the introduction of lh in the netherlands , ah shows a declining trend .
both lh and vh are practiced more often , the latter demonstrating a steeper implementation curve . with the slow but significant move from lavh to tlh , this study aims to analyze these two procedures in order to highlight possible differences .
three teaching hospitals ( of which one is a university hospital ) in the west urban area of the netherlands , which introduced lh in the same era , participated in this retrospective study .
each teaching hospital practiced identical techniques ( regarding lavh , tlh , and supracervical laparoscopic subtotal hysterectomy ( slh ) ) . from the beginning ,
harmonic scalpel hook and bipolar forceps were used for ligation . except for closure and suspension of the vaginal cuff ,
no sutures were applied . in lavh , the vaginal cuff was closed vaginally with interrupted sutures . in tlh
, the vaginal cuff was closed laparoscopically with interrupted figures - of - eight , herewith suspending the sacro - uterine ligaments .
participating gynecologists were thoroughly trained vaginal surgeons with special interests in advanced laparoscopic gynecological surgery .
one hundred and four consecutive cases of women who underwent a laparoscopic hysterectomy between march 1995 and march 2005 were analyzed .
slhs were excluded in order to compare the remaining two groups . as a frame of reference , the majority ( 90% ) of hysterectomies performed during this study period were either vaginal or abdominal ( equally distributed ) .
the case history notes were manually reviewed , and epidemiological data were extracted including age , parity , estimated uterus size , and main indication .
blood loss was invariably estimated by subtracting the applied irrigation fluid from the postoperative fluid level in the suction bottle .
possible vaginal blood loss was estimated and added to the total blood loss . the time taken to complete the procedure ( skin - to - skin )
complication rates were extracted from medical charts and the weekly post surgery conferences , in which eventual adverse outcomes were discussed .
major complications ( i.e. , adverse outcomes demanding further treatment ) were defined as blood loss exceeding 1,000 ml , a blood transfusion due to a postoperative clinical relevant drop in hemoglobin or bladder / ureteric injury .
minor complications ( i.e. , adverse outcomes recovering in absence of further treatment ) were defined as occurrence of postoperative vault abscess or hematoma , urinary tract infection , or fever .
analysis was performed using spss 16.0 statistical software ( chicago , il , usa ) . differences between groups were assessed with the chi - square test for proportions in independent samples and t tests for continuous variables , nonparametric kolmogorov
smirnov z tests and wilcoxon rank sum tests were used to asses normal distribution and to assess differences if parameters lacked a normal distribution ( e.g. , blood loss ) , 95% confidence intervals ( 95% ci ) were calculated , p < 0.05 were considered statistically significant .
women in the tlh group were statistically significant younger and had a lower parity compared to the women in the lavh group ( table 2 ) . in the latter group
the main indication for hysterectomy was significantly more frequently the existence of a ( pre ) malignancy , whereas in the tlh group statistically significant more frequently the main indication was dysfunctional uterine bleeding .
table 2patient characteristics : in the tlh group a significantly younger age , lower parity and higher estimated uterus size was observed lavh ( n = 37)tlh ( n = 67)p valuemeansd(range)npercentage ( % ) meansd(range)npercentage ( % ) age ( years)50.510.3(30.277.8)45.75.8(32.664.8)<0.05parity2.21.1(05)1.41.3(05)<0.05estimated uterus size ( weeks)9.53.5(616)11.73.6(616)<0.05main indicationdysfunctional uterine bleeding1951.45582.1<0.05- ( pre)malignancy/ prophylaxis1437.8710.4<0.05- pelvic discomfort25.457.5n.s.- prolapse25.400n.s .
patient characteristics : in the tlh group a significantly younger age , lower parity and higher estimated uterus size was observed table 3 details the intraoperative and postoperative parameters in the lavh and tlh groups .
mean estimated blood loss ( sd ) was 456.8 ml ( 893.7 ) and 173.1 ml ( 188.2 ) in lavh and tlh groups , respectively ( p < 0.05 ) . in the lavh and tlh groups , mean length of surgery was 144.3 min ( 40.0 ; range 90255 ) and 150.7 min ( 47.7 ; range 60320 ) , respectively .
mean uterus weight was 165.3 g ( 120.7 ) and 207.2 g ( 120.7 ) , respectively .
length of patient stay was 6.1 days ( 2.1 ) and 4.3 days ( 2.0 ) , respectively ( p < 0.05 ) .
as a frame of reference , in the netherlands , as in many neighboring countries , overnight stay for a l(av)h is highly unusual .
table 3intraoperative and postoperative parameters lavh ( n = 37)tlh ( n = 67)p valuemeansd(range)meansd(range)blood loss ( ml)456.8893.7(1005,650)173.1188.2(01,200)<0.05length of surgery ( min)144.340.0(90255)150.747.7(60320)n.s.uterus weight ( g)165.3120.7(40560)207.2120.7(50620)n.s.length of patient stay ( days)6.12.1(312)4.42.1(212)<0.05the lavh group shows a significantly higher blood loss , with comparable length of surgery and uterus weight intraoperative and postoperative parameters the lavh group shows a significantly higher blood loss , with comparable length of surgery and uterus weight one woman in the lavh group as well as one woman in the tlh group sustained a blood loss in excess of 1,000 ml .
three women in the lavh group and two women in the tlh group needed a blood transfusion due to a postoperative clinical relevant drop in hemoglobin . after excluding the patients with blood loss in excess of 1,000 ml , analysis still yielded a significantly higher mean estimated blood loss in the lavh group ( 312.5 171.7 ml ) versus the tlh group ( 157.6 139.6 ml ; p < 0.05 ) .
linear regression revealed no statistically significant association between uterine weight and estimated blood loss or length of surgery in both groups .
major and minor complications are detailed in table 4 . almost 22% of lavh cases were associated with a complication compared to 28% of tlh cases
10.8% of lavh cases were complicated compared to 7.5% of tlh cases . regarding minor complications exclusively ,
table 4major and minor complications : complication rates are comparable between the two groups lavh ( n = 37)tlh ( n = 67)p valueparameters ( n)percentage ( % ) parameters ( n)percentage ( % ) major complicationsblood loss > 1,000 ml12.711.5n.s.blood transfusion38.123.0n.s.ureteric injury0023.0n.s.minor complicationsvault abcess / haematoma12.734.5n.s.urinary tract infection12.746.0n.s.fever25.446.0n.s.technical failure0034.5n.s.total821.61928.4n.s.with blood loss < 1,000 mlunable to ligate the uterine laparoscopically ( 1 ) , needle lost and found ( 2 ) major and minor complications : complication rates are comparable between the two groups with blood loss < 1,000 ml unable to ligate the uterine laparoscopically ( 1 ) , needle lost and found ( 2 ) three laparoscopic hysterectomies were converted intraoperatively due to a complication ( twice due to insufficient hemostasis , once due to a profuse bleeding of the uterine artery which failed to be sutured laparoscopically ) . without exception ,
in this study , tlh shows considerable advantages over lavh with respect to blood loss , with comparable length of surgery and complication rates . several possible explanations for these differences should be stated .
first of all , it must be considered that participating surgeons during this study period were still in their learning curve .
furthermore , during the transition period from lavh to tlh ( range period of lavh expertise , 28106 months ) laparoscopic skills of the surgeons were already more refined , which may contribute to more favorable outcomes in the tlh group .
however , the initial experience with tlh was achieved with a major adjustment to technique and , thus , represents a learning curve of its own , as has been verified in similar studies [ 14 , 15 ] .
in contrast with the general opinion that tlh is characterized as a procedure rather challenging to acquire , several studies show a reasonable learning curve not seldom similar to conventional open methods [ 1619 ] . concerning the evolvement of instrumentation
, we would like to notify that every lh in this study was performed with the use of ultrasonic and bipolar energy .
in contrast with other publications , no suture ligation ( except for vaginal cuff closure ) was applied .
moreover , it is recognized that the groups vary in terms of patient characteristics and main indication .
women who underwent lavh were prone to be older and above all , more multiparous at the time of the intervention compared to women who underwent tlh . taking into account the extension of indications in the field of laparoscopic hysterectomy during this study period , in which time for example fewer enlarged uteri were removed conventionally , meanwhile a decline in age ( accompanied with an on average bigger uterus ) is shown .
in addition , the most remarkable finding in this study is the striking higher mean blood loss in the lavh group , which is confirmed by other studies [ 14 , 15 ] .
as stated above , position of the surgeon in her / his learning curve and ongoing technical innovations do partially explain this difference .
however , in addition to this , we would like to mention the possible influence of the altered anatomy of the corpus uteri and surroundings in the vaginal stage of the lavh procedure , inflicting the surgeon s familiar sight of anatomical landmarks . on the other hand , when it comes to uteri without descensus , some surgeons claim to create descensus by applying lavh .
however , their line of thought that disconnecting the pedicles of the round ligament as well as the cardinal ligament will facilitate descensus laparoscopically does not hold . in our opinion , descensus is directly related to the firmness of the uterosacral ligaments [ 2123 ] . in the classical lavh ,
therefore , being developed as an alternative to abdominal hysterectomy the laparovaginal approach should be regarded as rather illogical .
the arguments stated above contribute to our opinion that lavh nowadays knows fewer indications compared to the era of its introduction .
in fact , in presence of sufficient descensus and an introitus wide enough to have the operation field exposed , both needed to perform lavh , a vaginal hysterectomy is proved to be preferable regardless of estimated uterus size [ 3 , 20 , 24 ] . the lavh ( levels 13 in the garry classification , table 1 ) remains solely indicated in case of vaginal hysterectomy , with expected adhesions or endometriosis hindering vaginal surgery or planned accompanying adnexal surgery . at this point in history ,
at which every comparison study concerning the putative advantages of one form of surgery over another preferably is designed as a randomized clinical trial , we strongly recommend to keep in mind the outcomes of retrospective studies like this [ 10 , 25 , 26 ] .
although we confirm the advantages of a prospective comparison between these two types of surgery , we must be taken aware of distinct differences as observed in this study .
of course , the improved global experience with lh in general does add to better outcomes in the tlh group in comparison with the historical lavh group .
however , as tlh now proves to be a safe procedure that can be achieved with low blood loss , lavh still happens to know a higher mean blood loss due to the earlier mentioned altered anatomy [ 14 , 15 ] .
concerning observed complications , even with improved techniques , this study shows a ureteric injury rate of 3% in the tlh group , which is comparable with other complication studies [ 7 , 8 ] .
however , as is confirmed by a recent study , we expect this rate to decline to a rate comparable with the abdominal approach after completing the learning curve for this procedure .
both ureter lesions during this study were recognized postoperatively and before discharge . both patients required repair by laparotomy . in conclusion , the results from our study show that lavh should not be regarded as the novice s laparoscopic hysterectomy .
the lavh should be considered as an specific surgical approach with its own distinctive indication .
1 in the domain the gynecological surgeon . vh should , therefore , remain incorporated in the arsenal of the gynecologist - in - training , apart from training in laparoscopy .
expert vaginal surgeons need to train laparoscopic skills in a safe environment ( skills lab , assisting salpingo ophorectomies , etc . ) before one can start doing the incidental lavh .
surgeons who are well trained in vh and consider acquiring skills in lh should keep in mind the flow chart as depicted in fig
. 1 . if gynaecologists receive appropriate surgical training in laparoscopic techniques , tlh is a recommended option in case of a vaginally inapproachable uterus . in our opinion
laparoscopic hysterectomy should not assist vaginal surgery when no additional ( adnexal ) pathology is present .
( vh vaginal hysterectomy ; tlh total laparoscopic hysterectomy ; lavh laparoscopic assisted vaginal hysterectomy ) flowchart indicating method of choice in laparovaginal hysterectomy . * additional surgery = expected adhesions , endometriosis or adnexal pathology .
( vh vaginal hysterectomy ; tlh total laparoscopic hysterectomy ; lavh laparoscopic assisted vaginal hysterectomy ) | the objective of this study was to compare surgical outcomes for laparoscopically assisted vaginal hysterectomy ( lavh ) with total laparoscopic hysterectomy ( tlh ) in three teaching hospitals in the netherlands .
this study is a multicenter cohort retrospective analysis of consecutive cases ( canadian task force classification ii-2 ) .
one hundred and four women underwent a laparoscopic hysterectomy between march 1995 and march 2005 at one of three teaching hospitals .
this included 37 women who underwent lavh and 67 who underwent tlh .
blood loss , operating time , and intraoperative complications such as bladder or ureteric injury as well as conversion to an open procedure were recorded . in the tlh group ,
average age was statistically significant lower , as well as the mean parity , whereas estimated uterus size was statistically significant larger , compared to the lavh group .
main indication in both groups was dysfunctional uterine bleeding . in the tlh group ,
mean blood loss ( 173 ml ) was significant lower compared to the lavh group ( 457 ml ) , whereas length of surgery , uterus weight , and complication rates were comparable between the two groups .
the method of choice at the start of the study period was lavh , and by the end of the study period , it had been superceded by tlh .
lavh should not be regarded as the novice s laparoscopic hysterectomy . moreover , with regard blood loss , tlh shows advantages above lavh .
this might be due to the influence of the altered anatomy in the vaginal stage of the lavh procedure .
therefore , when a vaginal hysterectomy is contraindicated , tlh is the procedure of choice .
lavh remains indicated in case of vaginal hysterectomy with accompanying adnexal surgery . |
such a condition is also termed malignant or pathologic myopia when accompanied by choroid retinal degeneration and a series of pathological changes in the macular region .
high myopia is very common , found in 921% of asian adults , and its incidence is increasing worldwide . with the advent of optical coherence tomography ( oct ) , abnormal structures in the posterior pole of the retina are now readily detectable and various oct - driven treatments have been developed .
panozzo and mercanti proposed unifying all pathological features generated by traction in the context of myopia under a condition termed myopic traction maculopathy ( mtm ) .
this is a form of degenerative disease reported in 934% of highly myopic eyes with posterior staphylomas [ 3 , 4 ] . the various clinical manifestations impact patient vision and function , eventually affecting the quality of life .
neither the pathogenesis nor the triggers of mtm development are well understood . tangential traction of the vitreous cortex , development of an epiretinal membrane , inflexibility of retinal vessels , and development of a posterior staphyloma are all thought to play a role .
there are few reports pertaining to the natural history of mtm and treatment responses to this condition .
indeed , much debate remains regarding whether treatments seeking to reduce mtm are appropriate and , if so , which treatment is optimal .
the visual acuity required for reading usually remains compromised for an extended period of time after surgery ; therefore , prophylactic measures for the fellow eye should be considered .
few long - term follow - up studies on the fellow eyes of patients undergoing mtm surgery have been published .
we thus explored the fellow eyes of such patients , describing the visual changes noted in several cases undergoing spontaneous resolution and the potential mechanisms involved .
ninety - nine consecutive patients underwent unilateral surgery to treat mtm at the first people 's hospital affiliated to shanghai jiaotong university .
we recorded age , gender , duration of follow - up , refraction , axial length , intraocular pressure , lens status , presence / absence of a staphyloma , and best - corrected visual acuity ( bcva ) .
fundus photographs and sd - oct images ( spectralis , heidelberg engineering , germany ) were obtained . when feasible , mp-1 microperimetry ( padua , nidek technologies , italy ) was performed to evaluate macular sensitivity and fixation stability .
patients were divided into five groups according to baseline macular structure on oct [ 6 , 7 ] : ( 1 ) group 1 ( n = 38 ) normal : the macula was normal in terms of structure and thickness , with no evident change in the foveal contour of the underlying retinal tissues ; ( 2 ) group 2 ( n = 42 ) macular retinoschisis : presence of macular distortion ( e.g. , retinal thickening , a lamellar macular hole , and macular retinoschisis ) , often associated with vitreomacular traction or the presence of an epiretinal membrane ; ( 3 ) group 3 ( n = 10 ) foveal detachment : presence of photoreceptors detachment from the retinal pigment epithelium in the region of the fovea , with or without retinoschisis ; ( 4 ) group 4 ( n = 5 ) full - thickness macular hole : presence of interruption of all retinal layers from the internal limiting membrane to the retinal pigment epithelium , with or without retinal detachment ; ( 5 ) group 5 ( n = 4 ) other : macular degeneration group featuring macular atrophy and neovascularization .
statistical analysis was performed using commercial software ( spss version 19.0 ; spss inc . ,
continuous values were expressed as means standard deviation ( sd ) or as medians .
the significance of differences among continuous variables was assessed using the kruskal - wallis test .
the significance of differences among noncontinuous variables was analyzed using and fisher exact tests .
baseline demographic and clinical information on the 99 patients are summarized in tables 1 and 2 .
sixty - one patients ( 62% ) exhibited pathological changes in both eyes on initial examination . at an average follow - up time of 24.7 months , 7 out of 99 fellow eyes ( 7% ) exhibited partial or complete mtm resolution and 3 were from spontaneous release of retinal traction evident on oct .
of all followed up eyes , 67 out of 99 eyes ( 68% ) stabilized and 25 ( 25% ) exhibited progression of myopic macular maculopathy .
thirteen eyes required vitrectomy for clinically significant vision decrease and/or metamorphopsia . of the 38 eyes with normal macular structure on initial examination , 11% exhibited disease progression .
the progression rates in groups 2 , 3 , and 4 were 24% , 60% , and 60% , respectively .
the difference was statistically significant ( fisher exact probability test , p = 0.005 ) .
refraction , axial length , the frequency of a posterior staphyloma , chorioretinal atrophy , initial bcva , final bcva , and retinal sensitivity all differed significantly among groups 14 ( p = 0.015 , 0.016 , 0.004 , < 0.001 , < 0.001 , < 0.001 , and 0.003 , resp . ) .
separation caused by anterior retinal traction was detected by oct in three of the seven cases exhibiting spontaneous resolution or improvement .
they were of great interest in terms of the mechanisms of spontaneous resolution ( which have been very rarely studied ) and the visual outcomes achieved .
a 66-year - old female with high myopia complained of decreased vision in her right eye ( od ) . on initial examination ,
the bcva was 20/133 and the retinal sensitivity was 6.85 db with stable fixation od ( figure 1(a ) ) .
oct revealed foveal detachment with partial posterior vitreous detachment ( the vitreous remained attached at the parafoveal area , figures 1(c1 ) and 1(c2 ) ) .
two months later , oct revealed a mild decrease in retinal thickness and the presence of subfoveal fluid .
retinoschisis was apparent inferior to the macula ( figures 1(d1 ) and 1(d2 ) ) . at 11 months
, the retina was largely reattached but the intralayer retinoschisis had increased ( figure 1(e ) ) .
vitreous traction was still evident ( with no change on oct ) . at 33 months , both the foveal detachment and
the retinoschisis had decreased ( figure 1(f ) ) . at the final visit ( 66 months after initial presentation ) , the retinal structure was reattached but with a discontinuous band in the photoreceptor layer ( figure 1(h ) ) .
and the posterior scleral curvature on final oct images was flatter than that on initial visit , with its radius changing from 123.0231 ( blue line ) to 121.7396 ( red line ) ( figure 2 ) .
the bcva remained at 20/200 and retinal sensitivity was 2.45 db with stable fixation on final examination . on her last follow - up visit , vision had not yet improved .
a 64-year - old female with high myopia initially presented for consideration of binocular cataract surgery .
initial oct revealed od foveal detachment and retinoschisis ( figures 3(a1 ) and 3(a2 ) ) .
eleven months later , retinoschisis was evident , as was a lamellar hole , with improved foveal detachment ( figures 3(b1 ) and 3(b2 ) ) .
however , such detachment recurred and a small macular hole developed over the next 14 months of follow - up ( figure 3(c ) ) , accompanied by bcva deterioration from 20/80 to 20/200 . at 35 months , oct revealed incomplete spontaneous resolution of the foveal detachment , the retinoschisis , and the retinal thickness ( figure 3(d ) ) .
no pvd was evident , but a membrane adherent to the parafovea persisted during long - term follow - up .
the photoreceptor layer disappeared , likely due to long - term detachment from the retinal pigment epithelium layer , and bcva was at the counting fingers level .
the last oct examination performed 65 months postoperatively revealed retinal reattachment and a macular hole ( figure 3(e ) ) .
fundus photography revealed patchy retinochoroidal atrophy in the posterior pole ( figure 3(f ) ) .
oct revealed an od macular hole with retinal detachment and foveal detachment in the left eye ( os , figures 4(a1 ) and 4(a2 ) ) .
od pars plana vitrectomy , membrane peel , and gas were performed and close follow - up was scheduled for the left eye .
one month later , oct revealed reduced foveal detachment and a discontinuous photoreceptor layer ; the outer layer had begun to attach to the retinal pigment epithelial layer and retinoschisis had developed superior to the fovea ( figures 4(b1 ) and 4(b2 ) ) . at 44 months
, the lesion had spontaneously resolved but the photoreceptor layer was absent ( figures 4(c)4(e ) ) .
the final bcva was 20/200 and the macular sensitivity was 6.30 db with unstable fixation on microperimetry .
unfortunately , the patient continued with a subjective complaint of a central fixed shadow which persisted throughout his long - term follow - up .
a 64-year - old female with high myopia underwent successful surgical repair of od foveal detachment .
the left eye was treated conservatively for minimal foveoschisis and epiretinal membrane evident on initial oct ( figure 5(a ) ) .
nineteen months later , oct revealed progression of myopic maculopathy ( figure 5(b ) ) evidenced by increased thickness and extension of retinoschisis , with an apparent foveal detachment . a small , highly reflective dome - like elevation of the retinal pigment epithelium , reaching the parafovea , was present , suggestive of myopic choroidal neovascularization ( cnv ) .
oct revealed improvements in terms of both retinoschisis and foveal detachment ( figure 5(c ) ) . at 39 months ( figures 5(d)5(f ) ) , there was further improvement on oct . the cnv - like highly reflective elevation persisted .
bcva remained at 20/100 and microperimetry demonstrated that macular sensitivity was 5.10 db with unstable fixation .
the prevalence of mtm is 934% [ 3 , 4 ] in highly myopic eyes with posterior staphylomas .
mtm can present with vitreoretinal traction , schisis - like thickening , a lamellar or full - thickness macular hole , foveal detachment , or a macular hole associated with retinal detachment .
given the range of mtm manifestations and pathogenesis , the resulting retinal impairment is also variable and surgical timing and choice of intervention remain controversial . in the present study ,
57 patients ( 57.6% ) exhibited fellow eye mtm on initial examination after surgical repair of mtm on the contralateral eye ; this prevalence was thus greater than that reported previously .
the prevalence of mtm progression was 23.2% in the fellow eyes in the present study over an average follow - up of 24.7 months ( range of 6 to 64 months ) .
these differences in prevalence and the extent of progression may be attributable to subject selection . in other words , a patient with mtm in one eye may be more likely to have mtm in the other eye . similarly , tsujikawa et al . observed that high myopic patients , in whom one eye develops a macular hole with retinal detachment , would be expected to be at an increased risk of retinal detachment in the fellow eye .
severe macular maculopathy evident on baseline oct images of fellow eyes was notably progressive during follow - up , especially in eyes exhibiting extensive foveal traction or clinical significant posterior staphylomas .
the risk of deterioration of group 2 eyes with macular retinoschisis was lower than that of eyes exhibiting foveal detachment and/or a macular hole but remained higher than that of the normal group .
thus , the more severe the mtm on baseline exam , the more progressive the condition .
. showed that myopic foveoschisis with a change in premacular structure seemed to develop more frequently in patients exhibiting foveal detachment with or without a macular hole , with progression evident in 20 of 29 eyes .
several studies [ 1012 ] have found that foveal detachment and/or abnormal traction in the anterior retina were risk factors for mtm progression and could trigger rapid loss of vision .
[ 13 , 14 ] suggested that preservation of meaningful residual vision necessitates that the photoreceptor and external limiting membrane layers remain intact .
we found that outer retinal lesions were common in mtm eyes , especially those of groups 3 and 4 . in patients undergoing frequent oct ,
the status of the photoreceptor layer ( intact , disrupted , or disappeared ) was carefully noted during long - term follow - up .
we also found that refraction , axial length , posterior staphyloma status , and the extent of choroidoretinal atrophy differed significantly among the four subgroups .
a few reports [ 4 , 1518 ] found that axial length , atrophy , and a posterior staphyloma were associated with an increased risk of mtm in high myopic eyes and influenced the natural course of mtm .
large - scale studies featuring multiple regression analyses are needed to determine whether these variables independently predict mtm development .
we found that 67.7% of fellow eyes were stable after mtm surgery , whereas 23.2% deteriorated during long - term follow - up .
. found that the natural progression of macular retinoschisis was from initial retinoschisis to foveal detachment and finally to a macular hole with retinal detachment .
we found that several of our progressive cases followed certain patterns , but in most cases there was minimal progression .
within the extent of our follow - up , 7 cases fortunately underwent spontaneous reduction or complete resolution of mtm . since the pathology of mtm remains largely unelucidated , as the mechanisms of spontaneous resolution .
of the seven cases exhibiting spontaneous resolution , elimination of anterior retinal traction was evident in three , resulting in anatomic restoration of the retina .
reported that 8 of 207 mtm eyes exhibited partial or complete resolution after posterior vitreous detachment or spontaneous internal limiting membrane disruption , during a mean follow - up time of 36.2 months .
described four instances of spontaneous resolution in mtm eyes in which the vitreofoveal anterior traction was released .
the pharmacological agents used to treat persistent pathological vitreomacular adhesions are also of great interest [ 20 , 21 ] . in the other four cases we described above , we observed persistent vitreoretinal adhesion over the macula , which appeared to remain unchanged on oct during long - term follow - up .
this is consistent with the suggestion by goldman and duker that a spontaneous improvement in the macular contour may be attributable to spontaneous release of an anterior vitreous adhesion lying outside of the imaging field .
some rare cases exhibit progressive development of damage after the vitreoretinal interface traction is released .
this suggests that vitreoretinal traction over the macula is not the only ( or not the major ) pathophysiological mechanism in play ; therefore , further research is required .
furthermore , the images of case 2 revealed retinal reattachment , accompanied by formation of a macular hole . this may be due to tissue dehiscence as an adaptive response in order to release the tractional force exerted from both the vitreoretinal interface anteriorly and the staphyloma posteriorly that results in the retinal thickening in retinoschisis .
if the resulting macular hole is small , subretinal fluid would theoretically be absorbed by the retinal pigment epithelium pump , restoring the retinal anatomy .
li et al . and yu et al . found that even a myopic macular hole with retinal detachment could resolve spontaneously without release of vitreoretinal traction ; however , the mechanism remained unclear .
curtin divided posterior staphylomas into ten types and concluded that the posterior pole ( type i ) and macular ( type ii ) staphylomas were the most common .
a posterior staphyloma in a high myopic eye has been shown not only to deepen with age but also to change in shape over time .
we can see the posterior scleral curvature on final oct images was flatter than that on initial visit in case 1 .
we thus postulate that an anatomical or structural change within the sclera can flatten a posterior scleral , eventually restoring the retina .
this may imply that posterior scleral shape plays a role in the progression . in recent years , the research on dome - shaped macula demonstrated that the bulge in eyes with a dome - shaped macula may act as a macular buckle - like mechanism , indenting the fovea similar to a macular exoplant or ando plomb device , and thus may prevent or alleviate tractional forces over the fovea , thereby preventing retinoschisis or detachment .
although findings in this case were different from a typical dome - shaped macula , the mechanism they acted may be similar . although this requires confirmation and needs further objective measures of tracking posterior scleral curvature , it is interesting to note that posterior scleral buckling might be a valuable alternative or adjunctive treatment for such a condition .
notably , the outer retina , not the entire retina , began to adhere to the retinal pigment epithelium with retinoschisis progression .
we therefore hypothesize that , in addition to the ( probable ) partial release of anterior traction , factors external to the retina are also involved .
liquid accumulation in the retina , caused by disturbance of choroid retinal vascular fluid flow or inflammation , may also be involved . as inflammation lessens
mtm and cnv coexisted in case 4 , and it is unclear whether the cnv influenced foveal detachment or the course of spontaneous improvement .
recently , it has become clear that visual function requires outer retinal integrity [ 2830 ] .
photoreceptor cells are irreversibly impaired when they are detached from the retinal pigment epithelial layer for a long time , seriously compromising visual functional recovery .
currently , no consensus on mtm classification ( which would facilitate further research ) has been attained .
not all fellow eyes exhibited high myopia ; some were even emmetropic ( 10/99 ) .
we engaged in long - term follow - up of the fellow eyes of eyes in patients that previously underwent unilateral surgical repair of mtm and found these fellow eyes were at an increased risk of mtm development and progression .
we suggest that a long axial length , chorioretinal atrophy , a posterior staphyloma , and anterior traction contribute to mtm development .
patients with high myopia and unilateral mtm require regular oct monitoring of the fellow eye to assess progression to myopic pre - mtm . for cases exhibiting one or more potential risk factors | objective . to observe the fellow eye in patients undergoing surgery on one eye for treating myopic traction maculopathy
. methods .
99 fellow eyes of consecutive patients who underwent unilateral surgery to treat mtm were retrospectively evaluated .
all patients underwent thorough ophthalmologic examinations , including age , gender , duration of follow - up , refraction , axial length , intraocular pressure , lens status , presence / absence of a staphyloma , and best - corrected visual acuity ( bcva ) .
fundus photographs and sd - oct images were obtained . when feasible , mp-1 microperimetry was performed to evaluate macular sensitivity and fixation stability . results . at an average follow - up time of 24.7 months ,
7% fellow eyes exhibited partial or complete mtm resolution , 68% stabilized , and 25% exhibited progression of mtm .
of the 38 eyes with normal macular structure on initial examination , 11% exhibited disease progression .
the difference in progression rates in groups 2 , 3 , and 4 was statistically significant .
refraction , axial length , the frequency of a posterior staphyloma , chorioretinal atrophy , initial bcva , final bcva , and retinal sensitivity all differed significantly among groups 14 .
conclusions .
long axial length , chorioretinal atrophy , a posterior staphyloma , and anterior traction contribute to mtm development .
patients with high myopia and unilateral mtm require regular oct monitoring of the fellow eye to assess progression to myopic pre - mtm . for cases exhibiting one or more potential risk factors
, early surgical intervention may maximize the visual outcomes . |
thirteen patients with php type 1 visited the department of pediatrics at chiba university
hospital between 1995 and 2004 .
the diagnosis of php was based on the following criteria:(1 )
the presence of hypocalcemia ( serum calcium less than 8.5 mg / dl ) with elevated serum pth
levels ( above twice the upper normal limit);(2 ) normal renal function ( normal levels of
serum urea nitrogen and creatinine);(3 ) lack of urinary camp response to exogenous pth
infusion ( less than 10-fold increase ) .
all patients were treated with vitamin d. four cases
with php1a ( 2 males and 2 females ) and six cases with php1b ( 3 males and 3 females ) who
reached adult height were enrolled in this study ( table
1table 1 the heights of the cases with php at diagnosis and in adulthood ) , and three patients who did nt reach adult height ( growth velocity < 2 cm
per 12 mo at the time of this study ) were excluded .
the diagnosis of php1a was based on the
presence of either brachydactyly or heterotopic ossification in the soft tissue .
the
diagnosis of php1b was based on the absence of these features of aho .
the clinical diagnosis of php1b was confirmed by the methylation - specific
southern blot analysis , according to previously described methods ( 2 ) ( data not shown ) .
all cases with php1a had subclinical hypothyroidism
and received levo - thyroxine supplementation to maintain normal tsh levels .
we observed poor
gh response in provocative tests in cases 1 , 9 and 10 in this study .
cases 1 and 4 were siblings and their mother had
pseudopseudohypoparathyroidism ( pphp ) .
table 1 shows the height and height sd score
( sds ) of php cases at the age of diagnosis and in adulthood . the adult heights of all php1a
cases were less than 2.0 sd and those of all php1b cases were within the normal range ( >
2.0 sd ) .
although the adult heights of female cases with php1b were completely normal ,
( ranging between 0.21 and + 0.08 sd ) , those of male cases with php1b were relatively low ,
( ranging between 0.74 and 1.74 sd ) . in php1a cases
the adult height sds was obviously
lower than the height sds at diagnosis , and similar trends were observed in php1b cases .
open circles and closed circles indicate the
heights of cases 1 and 2 , respectively .
although case 2 lacks informative data for prepubertal
growth , case 1 had mild growth reduction in the prepubertal period .
open circles and closed circles indicate the
heights of cases 3 and 4 , respectively .
reduced growth velocity in childhood
and a blunted growth spurt caused abnormally reduced adult height . taking these findings
together ,
at least three out of four cases with php1a showed progressive deviation from the
standard curve because of the reduction in growth velocity in childhood .
open circles , closed circles and open squares
indicate the heights of cases 5 , 6 and 7 , respectively .
prepubertal growth showed a normal
pattern , however , a relatively early growth spurt was observed in cases 6 and 7 and resulted
in mildly reduced adult height .
open circles , closed circles and open squares
indicate the height of cases 8 , 9 and 10 , respectively .
shows the growth charts of female php1b cases and all show completely normal growth
patterns .
cases 2 and 3
( sporadic php1a ) were very much shorter than their mid - parental heights ( 18.3 and 15.5 cm
compared with their mid - parental heights ) .
all the male php1b cases had shorter adult height
than their mid - parental height ( 8.8 to 0 cm ) but female php1b cases had almost the same
height as their mid - parental height ( 2.3 to + 3.0 cm ) .
open circles and closed circles indicate the
heights of cases 1 and 2 , respectively .
open circles and closed circles indicate the
heights of cases 3 and 4 , respectively .
open circles , closed circles and open squares
indicate the heights of cases 5 , 6 and 7 , respectively .
open circles , closed circles and open squares
indicate the height of cases 8 , 9 and 10 , respectively .
we evaluated growth charts of php patients and analyzed the differences between php1a and
php1b .
short stature is considered to be one of the features of aho , however , in most cases
with php1a , short stature was not evident in childhood ; it developed in adolescence and was
evident in adults in this study .
cases of php1a had quite specific growth patterns and the
adult height of php1a cases may be affected by at least three factors : gh status , the
severity of bone disease caused by heterozygous loss - of - function mutation of the gnas1 gene ,
and onset and progression of sexual maturation .
secretion of gh requires binding of ghrh to specific receptors on pituitary somatotrophs
that are coupled via gs to activation of adenylyl cyclase .
gh deficiency in php1a occurs in
about 70% of cases ( 6 , 7 ) , but the relevancy of gh deficiency on adult height in php1a is unknown at
present .
patients with pphp , although not displaying any endocrine abnormality , are
characterized by short stature as are their relatives with php1a ; therefore , a crucial role
for gh deficiency in the determination of short stature in these patients seems unlikely
( 1 ) .
reported that among php1a
patients gh deficient adults were shorter than gh sufficient adults , although gh deficient
children are not shorter than gh sufficient children ( 6 ) . in our study , patients with php1a , except for case 2 who did nt have a growth
record before the age of 11 yr 11 mo , showed increasing deviation from the mean height with
age during prepubertal growth .
the expression of the gnas1 gene is biallelic in most tissues ; however , genomic imprinting
occurs in particular tissues ( 2 , 4 , 5 )
. the inactivating mutations of
the gnas1 gene on the paternal allele have no effect on hormone resistance .
maternal allele
dominant or exclusive expression has been reported in human endocrine organs including the
pituitary , thyroid , and ovarian cells ( 4 , 5 ) .
although this imprinting mechanism is not well
understood , differentially methylated regions in the regulatory sequences of the gnas1 gene
is reported to be necessary for maternal allele specific expression of gs protein ( 2 ) .
the methylation of cytokine residues of cpgs in the
exon 1a ( also referred to as exon a / b ) region upstream of the gnas1 gene is critical but not
sufficient for the expression of gs protein in imprinted tissues .
loss of this methylation
on the maternal allele ( i.e. , both alleles are demethylated ) is associated with php1b . in
this context
, the gs protein level may be decreased in the pituitary gland of patients with
php1b although gh status in php1b has not been reported in the literature .
we observed poor
gh response in provocative tests in some cases in this study , but the growth charts of all
php1b cases showed normal growth patterns in the prepubertal period . in this study , we found
no evident relationship between gh secretion and growth patterns in php1b patients .
gh
status and growth patterns in php1b must be studied in large numbers of patients to
determine whether or not gh deficiency affects the growth of php1b .
the bone age of patients with aho is advanced 2 to 3 yr in the majority of patients with
php1a ( 8) .
unfortunately , we were not able to present
the data related to bone maturation in this study because the availability of hand x - rays
was insufficient . reduced height gain and premature cessation of growth after the beginning
of the growth spurt in php1a in our study were concordant with previous studies ( 3 , 8) .
active gs
protein is reduced in bone cells with aho because both paternally and maternally inherited
inactivating mutations in gnas1 cause aho .
genomic imprinting is not shown in bone cells ,
therefore , the amount of active gs protein in bone cells of php1b patients must be normal .
haploinsufficiency of the gnas1 gene may be responsible for the advanced bone maturation and
poor growth potential in the growth spurt because reduced height gain and premature
cessation of growth after the beginning of the growth spurt was not observed in the php1b
patients .
php1a patients often have reproductive dysfunction because of partial resistance to
gonadotropins ( 9 ) .
one report suggests that early
puberty and advanced bone maturation cause the blunted growth spurt in php1a ( 3 ) , however , the growth pattern of php1a cases in this
study was not suggestive of early puberty in php1a . early puberty in php1a seems to be
unlikely because of these facts , but further investigation is required .
it is very important that in such studies the diagnosis of
php1b must be based on the molecular analysis because some php1a patients with mutations in
gs often lack physical features of aho .
the reason why php1b females showed a completely normal growth pattern which
was different from php1b males is unclear .
a possible explanation for this sex difference is
that cell - specific imprinting of gnas1 expression may affect the maturation of the
hypothalamic - pituitary - gonadal axis in different ways between males and females .
the growth of php1a cases was
characterized by mild growth impairment in the prepubertal period , a blunted growth spurt
and premature cessation of the growth spurt .
an early growth spurt was observed only in male
patients with php1b , and it may reduce the adult height of male patients with php1b . this
warrants further investigation into the growth and pubertal development of php1b
patients . | pseudohypoparathyroidism ( php ) is a metabolic disorder characterized by organ resistance
to the action of parathyroid hormone .
php type 1 is subclassified into two apparent
disorders , type 1a ( php1a ) and type 1b ( php1b ) .
patients with php1a show albright
hereditary osteodystrophy including short stature .
patients with php1b have no such
skeletal defects , however , literature regarding the growth of php1b is not currently
available .
we evaluated growth charts of php patients , including four php1a patients and
six php1b patients .
growth patterns were different between php type 1a and 1b .
adult
height was abnormally low in all php1a patients .
the growth pattern of php1a was
characterized by mild growth impairment in the prepubertal period , a blunted growth spurt
and premature cessation of the growth spurt .
the adult height of male php1b was slightly
lower than average .
an early growth spurt was observed only in male patients with php1b
and it may reduce the adult height of male patients with php1b . this warrants further
investigation into the growth and pubertal development of php1b patients . |
use of three to four psychoactive medicines concurrently doubled the risk of falls resulting in hospitalization , while concurrent use of five or more tripled the riskuse of psychoactive medicines at any dose increased the risk of hospitalization for falls .
there was a fourfold increased risk of hospitalization for falls on days when patients were taking three or more defined daily dosesstrategies to reduce the psychoactive medicine burden are likely to translate into significant health benefits
falls are a major public health problem and are responsible for considerable morbidity and mortality among the elderly population [ 13 ]
. more than 30 % of community - dwelling older people have at least one fall each year .
for some , the fall results in hospitalization due to injury or leads to institutional care as a result of post - fall immobility , anxiety and depression [ 1 , 2 , 58 ] . falls and fall - related complications are the fifth leading cause of death in the developed world . in australia
, falls accounted for 55 % of injury deaths and 73 % of all hospitalized injuries among older people in 20012002 . by 2011 ,
the total cost associated with fall injuries in persons aged 65 years and over in australia was estimated to be au$604 million .
as the proportion of elderly people in the australian population is expected to rise to 20 % by 2050 , there is likely to be an increased health burden from falls in the future .
given the increasing public health concern about falls and their consequences , a substantial body of research has identified the risk factors for falls and opportunities for prevention . the contributing factors for falls may be divided into intrinsic factors ( e.g. cognitive impairment , balance problems , vision problems , gait problems or muscle strength problems ) and extrinsic risk factors or environmental hazards ( e.g. slippery flooring or poor lighting ) [ 8 , 13 , 14 ] . medication use , which can be categorized as either an intrinsic factor or an extrinsic factor , is an important risk factor for falls in elderly people .
medication use is also considered one of the most easily modifiable risk factors for falls , and medicines review is recommended in most guidelines for the prevention of falls in the elderly [ 8 , 1517 ] . among many medicines with the potential to increase the risk of falls , psychoactive medicines are most commonly prescribed for older people [ 18 , 19 ] . while some psychoactive medicines , such as antidepressants and anticonvulsants , are sometimes clinically essential , others ( e.g. benzodiazepines and other sedatives )
many psychoactive medicines , including antipsychotics , anxiolytics , hypnotics and antidepressants , have been found to be associated with a 5070 % increased risk of falls .
use of multiple psychoactive medicines , however , is common among the elderly , and few studies have investigated the effect of the total burden of psychoactive medicines on the risk of falls . a prospective longitudinal study , involving annual data collection , assessed the effect of the number and dosage of psychoactive medicines on recurrent falls in community - dwelling older people and found that use of multiple central nervous system medicines doubled or trebled the risk of falls .
self - reported falls were analysed in association with medicine use during the prior data collection period , which was a year earlier .
two limitations of this method are that medicines used at baseline may have been discontinued or changed by the time of falling , and the outcome measure may be affected by patient recall .
our current study used administrative health claims data to determine psychoactive medicine use across the entire study period and the association between multiple medicine use and hospitalization where a fall was recorded as contributing to the admission .
the australian government department of veterans affairs ( dva ) claims database was used for this study .
the database contains details of all prescription medications , medical services , allied health services and hospitalizations provided to veterans for which dva pays a subsidy . in the dataset
, medications are coded according to the anatomic , therapeutic and chemical classification ( atc ) and the pharmaceutical benefits schedule ( pbs ) item codes .
hospitalizations are coded according to the international classification of diseases , version 10 , australian modification ( icd-10-am ) .
dva also maintains a client file , which contains information on sex , date of birth , date of death and family status for the treatment population , which in september 2011 was 242,000 people .
a retrospective cohort study was conducted between 1 july 2011 and 30 june 2012 to identify the effect of the psychoactive medicine burden on hospitalizations for falls .
eligible subjects were community - dwelling veterans who were alive and aged 65 years or over at study entry , were eligible for all dva - subsidized services for at least 12 months prior to study entry , had at least one chronic condition at baseline and had been dispensed at least one psychoactive medicine with sedative properties in the previous year .
veterans receiving palliative care in the 6 months prior to the study were excluded ; this was defined as any dispensing of palliative care medicines subsidized under the australian pharmaceutical benefit scheme or a palliative care service claim under the australian medicare benefits scheme .
psychoactive medicines with sedative properties included in the study were antipsychotics ( atc code n05a ) , anxiolytics ( n05b ) , hypnotics and sedatives ( n05c ) , antidepressants ( n06a ) , opioids ( n02a ) , anti - epileptics ( n03 ) , anti - parkinson medicines ( n04 ) and medicines for migraine ( n02c ) .
patients on anti - dementia medicines ( n06da ) were excluded , as dementia is an independent risk factor for falling .
the total burden of psychoactive medicines taken was defined in two ways : ( 1 ) the total number ; and ( 2 ) the cumulative daily dose standardized to the international defined daily dose ( ddd ) per day . using the waiting time distribution approach , which has been described elsewhere , the duration of each prescription was calculated from the data and was defined by the time within which 75 % of individuals obtained a refill prescription .
subjects were considered exposed during this time , and at other times they were treated as unexposed .
the dose on each day was calculated by the formula:\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{dose } } = \left ( { { \text{strength } } \times { \text { quantity}}/{\text{duration estimate } } } \right)/{\text{ddd}}. $ $ \end{document } the cumulative daily dose ( in ddd / day ) was the sum of all individual standardized medicine doses .
the effect of the psychoactive medicine burden on fall risk was examined by stratifying the total number and cumulative ddd / day of all psychoactive medicines taken on each day of the study and the risk of falling on the subsequent day .
fall risk was determined on the subsequent day to avoid exposure misclassification for medicines that were started on the day of hospital admission and were started as a consequence of the fall .
the estimated daily number of medicines and ddd / day for psychoactive medicines were expressed in the following categories in the analyses : 0 ( no medicine ) , 1 , 2 , 34 , and 5 or more medicines ; and 0 ( 0 ddd ) , 0.10.9 , 11.9 , 22.9 , and 3 or more ddd / day
. periods of time when subjects were not taking any psychoactive medicines ( i.e. 0 medicine and 0 ddd / day ) were used as the reference period . given that falls were only recorded in the database as a secondary diagnosis for hospitalization , the primary end - point for the study was any hospitalization with a secondary diagnosis of a fall from the same level ( icd-10-am : w18 , w19 , w0 ) . to ensure that the hospitalization was associated with the fall and to reduce the chance that these were within - hospital falls
, the fall code was only included where it was the second code in the series ( i.e. immediately after the primary diagnosis , indicating that the fall was a contributing factor to the cause of admission ) .
subjects were followed up until the primary end - point or the end of the study period ( 30 june 2012 ) , whichever occurred first .
subjects were censored at their first hospitalization event for any reason other than the outcome of interest , upon entering residential aged care facilities , upon receiving their first prescription of palliative care medicines or making a palliative care service claim , or if they died during the study period .
hospitalization rates were calculated as the cumulative number of hospitalizations in each exposure category divided by the number of days at risk .
incidence rate ratios ( irrs ) were calculated using poisson regression with a robust error variance adjusting for age at study entry , sex , socioeconomic index for area , number of medicines used , number of prescribers and specialist visits ( assessed quarterly in the 12 months prior to the study ) , number of hospitalizations ( for any diagnosis ) in the 3 months prior to the study , and number of co - morbidities ( as measured by the australian adaption of rx - risk - v ) . a sensitivity analysis was undertaken , which excluded patients who were prescribed an anti - parkinson medicine ( atc code n04 ) within the 12 months prior to the study , given that patients with parkinson disease are twice as likely to fall as patients with other neurological conditions .
all analyses were performed using sas version 9.1.2 software ( sas institute , cary , nc , usa ) .
the australian government department of veterans affairs ( dva ) claims database was used for this study .
the database contains details of all prescription medications , medical services , allied health services and hospitalizations provided to veterans for which dva pays a subsidy . in the dataset
, medications are coded according to the anatomic , therapeutic and chemical classification ( atc ) and the pharmaceutical benefits schedule ( pbs ) item codes .
hospitalizations are coded according to the international classification of diseases , version 10 , australian modification ( icd-10-am ) .
dva also maintains a client file , which contains information on sex , date of birth , date of death and family status for the treatment population , which in september 2011 was 242,000 people .
a retrospective cohort study was conducted between 1 july 2011 and 30 june 2012 to identify the effect of the psychoactive medicine burden on hospitalizations for falls .
eligible subjects were community - dwelling veterans who were alive and aged 65 years or over at study entry , were eligible for all dva - subsidized services for at least 12 months prior to study entry , had at least one chronic condition at baseline and had been dispensed at least one psychoactive medicine with sedative properties in the previous year .
veterans receiving palliative care in the 6 months prior to the study were excluded ; this was defined as any dispensing of palliative care medicines subsidized under the australian pharmaceutical benefit scheme or a palliative care service claim under the australian medicare benefits scheme .
psychoactive medicines with sedative properties included in the study were antipsychotics ( atc code n05a ) , anxiolytics ( n05b ) , hypnotics and sedatives ( n05c ) , antidepressants ( n06a ) , opioids ( n02a ) , anti - epileptics ( n03 ) , anti - parkinson medicines ( n04 ) and medicines for migraine ( n02c ) .
patients on anti - dementia medicines ( n06da ) were excluded , as dementia is an independent risk factor for falling .
the total burden of psychoactive medicines taken was defined in two ways : ( 1 ) the total number ; and ( 2 ) the cumulative daily dose standardized to the international defined daily dose ( ddd ) per day . using the waiting time distribution approach , which has been described elsewhere , the duration of each prescription was calculated from the data and was defined by the time within which 75 % of individuals obtained a refill prescription .
subjects were considered exposed during this time , and at other times they were treated as unexposed .
the dose on each day was calculated by the formula:\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{dose } } = \left ( { { \text{strength } } \times { \text { quantity}}/{\text{duration estimate } } } \right)/{\text{ddd}}. $ $ \end{document } the cumulative daily dose ( in ddd / day ) was the sum of all individual standardized medicine doses .
the effect of the psychoactive medicine burden on fall risk was examined by stratifying the total number and cumulative ddd / day of all psychoactive medicines taken on each day of the study and the risk of falling on the subsequent day .
fall risk was determined on the subsequent day to avoid exposure misclassification for medicines that were started on the day of hospital admission and were started as a consequence of the fall .
the estimated daily number of medicines and ddd / day for psychoactive medicines were expressed in the following categories in the analyses : 0 ( no medicine ) , 1 , 2 , 34 , and 5 or more medicines ; and 0 ( 0 ddd ) , 0.10.9 , 11.9 , 22.9 , and 3 or more ddd / day
. periods of time when subjects were not taking any psychoactive medicines ( i.e. 0 medicine and 0 ddd / day ) were used as the reference period .
given that falls were only recorded in the database as a secondary diagnosis for hospitalization , the primary end - point for the study was any hospitalization with a secondary diagnosis of a fall from the same level ( icd-10-am : w18 , w19 , w0 ) . to ensure that the hospitalization was associated with the fall and to reduce the chance that these were within - hospital falls
, the fall code was only included where it was the second code in the series ( i.e. immediately after the primary diagnosis , indicating that the fall was a contributing factor to the cause of admission ) .
subjects were followed up until the primary end - point or the end of the study period ( 30 june 2012 ) , whichever occurred first .
subjects were censored at their first hospitalization event for any reason other than the outcome of interest , upon entering residential aged care facilities , upon receiving their first prescription of palliative care medicines or making a palliative care service claim , or if they died during the study period .
hospitalization rates were calculated as the cumulative number of hospitalizations in each exposure category divided by the number of days at risk .
incidence rate ratios ( irrs ) were calculated using poisson regression with a robust error variance adjusting for age at study entry , sex , socioeconomic index for area , number of medicines used , number of prescribers and specialist visits ( assessed quarterly in the 12 months prior to the study ) , number of hospitalizations ( for any diagnosis ) in the 3 months prior to the study , and number of co - morbidities ( as measured by the australian adaption of rx - risk - v ) .
a sensitivity analysis was undertaken , which excluded patients who were prescribed an anti - parkinson medicine ( atc code n04 ) within the 12 months prior to the study , given that patients with parkinson disease are twice as likely to fall as patients with other neurological conditions .
all analyses were performed using sas version 9.1.2 software ( sas institute , cary , nc , usa ) .
patient characteristics are reported in table 1 . at the time of study entry ,
the average age of the patients was 83 years , and 46 % were male.table 1baseline demographic characteristics of the study cohortcharacteristiccohort [ n = 73,690]age [ years ; mean ( sd)]82.6 ( 7.8)male sex [ n ( % ) ] 33,501 ( 45.5)number of medicines used [ median ( iqr ) ]
9 ( 612)number of prescribers [ median ( iqr ) ]
2 ( 13)number of specialist visits [ median ( iqr ) ]
1 ( 03)number of prior hospitalizations [ median ( iqr ) ]
0 ( 01)number of co - morbidities [ median ( iqr ) ]
5 ( 47)patients receiving anti - parkinson medicines [ n ( % ) ]
2,691 ( 3.7 )
iqr interquartile range , sd standard deviation
values for 12 months prior to study entry
values for 3 months prior to study entry
values for time - varying every 4 months baseline demographic characteristics of the study cohort
iqr interquartile range , sd standard deviation
values for 12 months prior to study entry
values for 3 months prior to study entry
values for time - varying every 4 months table 2 presents the effect of the total number of psychoactive medicines on fall risk . in comparison with hospitalization for
falls that occurred when no psychoactive medicine was used , the risk of hospitalization for falls was slightly increased when one psychoactive medicine was used , increasing to a threefold increased risk when five or more psychoactive medicines were taken concurrently . sensitivity analysis with exclusion of patients who were prescribed anti - parkinson medicines within the year prior to
the study showed a similar trend ( table 2).table 2effect of total number of psychoactive medicines taken on fall riskcohortscript categorynumber of fallsperson - yearsrate per 10 years ( 95 % ci)irr ( 95 % ci )
p valuewhole cohort unadjusted051820,4480.25 ( 0.230.28)1.00 ( 1.001.00)152716,9450.31 ( 0.290.34)1.23 ( 1.091.39)0.00122465,2310.47 ( 0.410.53)1.85 ( 1.592.16)<0.001341081,9460.55 ( 0.460.67)2.18 ( 1.782.69)<0.0015161890.84 ( 0.511.37)3.32 ( 2.025.47)<0.001 adjusted
051820,4480.17 ( 0.130.23)1.00 ( 1.001.00)152716,9450.21 ( 0.160.28)1.22 ( 1.081.38)0.00222465,2310.29 ( 0.220.40)1.70 ( 1.451.99)<0.001341081,9460.34 ( 0.240.48)1.96 ( 1.582.43)<0.0015161890.55 ( 0.310.96)3.15 ( 1.905.23)<0.001cohort after exclusion of patients with anti - parkinson medicines in the previous year unadjusted051420,2580.25 ( 0.230.28)1.00 ( 1.001.00)150016,4240.30 ( 0.280.33)1.20 ( 1.061.36)0.00422194,8490.45 ( 0.390.51)1.78 ( 1.522.08)<0.00134901,6730.54 ( 0.440.66)2.11 ( 1.692.65)<0.001591470.61 ( 0.321.17)2.41 ( 1.244.66)0.009 adjusted
051420,2580.17 ( 0.130.23)1.00 ( 1.001.00)150016,4240.21 ( 0.150.28)1.19 ( 1.051.35)0.00622194,8490.29 ( 0.210.39)1.63 ( 1.391.93)<0.00134901,6730.33 ( 0.230.47)1.89 ( 1.502.39)<0.001591470.40 ( 0.200.82)2.30 ( 1.184.47)0.01
ci confidence interval , irr incidence rate ratio
adjusted for age , sex , socioeconomic index for area , time - varying co - morbidities , and numbers of medicines , prescribers , specialist visits and prior hospitalizations effect of total number of psychoactive medicines taken on fall risk
ci confidence interval , irr incidence rate ratio
adjusted for age , sex , socioeconomic index for area , time - varying co - morbidities , and numbers of medicines , prescribers , specialist visits and prior hospitalizations when the data were analysed by dose ( table 3 ) , a similar trend between the cumulative combined dose of psychoactive medicines and the fall risk was observed .
patients on three or more ddd per day had a fourfold increased risk ( table 3 ) .
a similar trend was observed when patients on anti - parkinson medicines were excluded from the analysis ( table 3).table 3effect of cumulative defined daily doses of psychoactive medicines on fall riskcohortddd categorynumber of fallsperson - yearsrate per 10 years ( 95 % ci)irr ( 95 % ci )
p valuewhole cohort unadjusted052420,5380.25 ( 0.230.28)1.00 ( 1.001.00)0.10.961317,7450.35 ( 0.320.37)1.35 ( 1.201.52)<0.00111.91985,4090.37 ( 0.320.42)1.43 ( 1.221.69)<0.00122.9581,1360.51 ( 0.390.66)2.00 ( 1.522.62)<0.0013222740.80 ( 0.531.22)3.15 ( 2.054.82)<0.001 adjusted
052420,5380.17 ( 0.120.22)1.00 ( 1.001.00)0.10.961317,7450.21 ( 0.150.28)1.24 ( 1.101.39)<0.00111.91985,4090.26 ( 0.190.36)1.58 ( 1.331.86)<0.00122.9581,1360.38 ( 0.260.56)2.29 ( 1.743.02)<0.0013222740.71 ( 0.431.17)4.26 ( 2.756.58)<0.001cohort after exclusion of patients with anti - parkinson medicines in the previous year unadjusted051920,3210.26 ( 0.230.28)1.00 ( 1.001.00)0.10.957017,0480.33 ( 0.310.36)1.31 ( 1.161.47)<0.00111.91745,0330.35 ( 0.300.40)1.35 ( 1.141.61)<0.00122.9521,0250.51 ( 0.390.66)1.98 ( 1.492.64)<0.0013172390.71 ( 0.441.14)2.78 ( 1.724.50)<0.001 adjusted
051920,3210.17 ( 0.130.22)1.00 ( 1.001.00)0.10.957017,0480.20 ( 0.150.27)1.20 ( 1.061.35)0.00411.91745,0330.25 ( 0.180.35)1.51 ( 1.271.80)<0.00122.9521,0250.39 ( 0.260.57)2.30 ( 1.723.08)<0.0013172390.65 ( 0.381.14)3.90 ( 2.396.35)<0.001
ci confidence interval , ddd defined daily dose , irr incidence rate ratio
adjusted for age , sex , socioeconomic index for area , time - varying co - morbidities and numbers of medicines , prescribers , specialist visits and prior hospitalizations effect of cumulative defined daily doses of psychoactive medicines on fall risk
ci confidence interval , ddd defined daily dose , irr incidence rate ratio
adjusted for age , sex , socioeconomic index for area , time - varying co - morbidities and numbers of medicines , prescribers , specialist visits and prior hospitalizations
this study examined time - varying use of psychoactive medications in older patients and found that concurrent use of multiple psychoactive medicines was associated with an increased risk of hospitalization for falls . additionally , the total daily dosage of psychoactive medicines was a risk factor for falls .
we observed a significantly increased risk of falls when people were on one or more psychoactive medicines or were on a dose of 0.10.9 ddd or more per day .
the strong dose - relationship observed in our study suggests that increased exposure , either by increased numbers of medicines or increased dose , does contribute to the fall risk .
systematic reviews and meta - analyses of observational and randomized controlled trials have found significant associations between use of psychoactive medicines and falls [ 9 , 35 , 36 ] .
higher doses of psychoactive medicines ( e.g. diazepam , benzodiazepines , neuroleptics ) were also found to be associated with an increased risk of falls [ 3740 ] .
using the drug burden index ( dbi ) to measure the burden of medicines with sedative and anticholinergic effects , a number of studies have found that the higher the dbi , the greater the risk of functional impairment and falls [ 4143 ] .
prior research ( using a different method ) on multiple psychoactive medicine use and falls found that patients taking two or more psychoactive medicines were at increased risk of falls , compared with those taking only one medicine . using direct comparison of pairwise estimates ,
another study found an increased risk of recurrent falls in patients taking psychoactive medicines with high combined doses ( i.e. more than three standard daily doses [ sdd ] ) , compared with those taking medium doses ( 13 sdd ) or low doses ( < 1 sdd ) .
previous research in other settings , such as nursing facilities , has also showed evidence of an association between the psychoactive load and an increased risk of falls . our study had a number of strengths , including a large sample size and assessment of day - to - day medication exposure .
use of hospitalizations for falls as an outcome was potentially more reliable than self - reported falls because it avoided bias due to inconsistent recording and differential recall of community events that did not result in hospitalization .
it also focused on possibly more serious falls ( i.e. falls resulting in hospitalization ) , which may have been more important to study , given the substantial morbidity associated with these events compared with minor falls that did not require hospitalization .
however , community events would also result in significant injury , and research focused on community events is also needed .
additionally , our ascertainment of medicine use on each day of the study and the risk of falling on the subsequent day ensured that the medicines were taken before the fall occurred , which is an important concept in the assessment of adverse drug reactions , particularly when many of these medicines may be dispensed in hospital to treat the pain associated with a fall .
although a large number of potential confounders were controlled for in our study , we were unable to control for all potential confounders .
the absence of diagnostic information in the dataset meant that disease severity could not be taken into account , nor did we control for all clinical conditions for which the psychoactive medicines might have been prescribed , although we did try to reduce the impact of indication bias by excluding dementia medicines ( as a proxy for dementia disease ) and patients receiving palliative care , and by undertaking a sensitivity analysis where we excluded patients who were dispensed anti - parkinson medicines .
although only 3.7 % of our patients received anti - parkinson medicines in the year before the study , the exclusion of these patients resulted in a slight reduction in the risk estimates .
it should also be noted that we used dementia medicines as a proxy to exclude dementia patients , but many patients with dementia may not be treated with specific medicines and thus would not have been excluded on that basis .
other potential confounders may have included concomitant use of some cardiovascular medicines ( such as antihypertensives or diuretics ) that have been found to be associated with a modest increase in the fall risk .
while some unmeasured confounding may remain , an unknown confounding factor with a prevalence of 20 % would need to have large associations with both the outcome and the exposure ( by factors of 45 ) to reduce a relative risk from 1.57 down to 1 .
therefore , the moderate to strong increased risks found in our current study are unlikely to have been due to unknown or unmeasured confounding .
the primary disadvantage of using the waiting time distribution approach to assign exposure duration to single prescriptions is that the approach is more relevant for medicines with predominantly chronic use patterns .
our study included medicines that are used short term or as required , including pain relievers and medicines ( such as prochlorperazine ) for dizziness , nausea and vomiting . as we were unable to determine actual consumption , it is possible that some patients who were classified as being exposed only took the medicine for a few days or did not consume the medicine at all
. the use of the veteran population in this study may also be seen as a limitation for generalization of our findings .
however , previous research has reported that there was no difference in use of practitioners , health services and treatment between veteran and non - veteran patients in both the primary and tertiary australian care sectors after adjustment for age , service - related disability and marital status .
the results of our study demonstrate that an increased number and increased doses of psychoactive medicines are significantly associated with an increased risk of hospitalization for falls in older adults . with up to a third of the elderly on psychoactive medicines , strategies to reduce the psychoactive medicine burden
nicole l. pratt , emmae n. ramsay , lisa m. kalisch ellett , tuan a. nguyen , john d. barratt and elizabeth e. roughead have no conflicts of interest that are directly relevant to the content of this study . | backgroundlittle is known about the impact of taking multiple psychoactive medicines on the risk of hospitalization for falls.objectiveto identify the association between multiple psychoactive medicine use and hospitalization for falls.methodsa retrospective cohort study was conducted between july 2011 and june 2012 in the australian veteran population who had been dispensed at least one psychoactive medicine within the previous year .
psychoactive medicines with sedative properties included antipsychotics , anxiolytics , hypnotics , antidepressants , opioids , anti - epileptics , anti - parkinson medicines and medicines for migraine .
the associations between falls and the number of psychoactive medicines used or the number of doses were analysed in comparison with falls that occurred when no psychoactive medicine was used.resultsthe adjusted results showed a significantly increased risk of falls when patients were on one or more psychoactive medicines or were receiving 0.10.9 defined daily dose ( ddd ) or more per day .
the incident rate ratios ( irrs ) were 1.22 ( 95 % confidence interval [ ci ] 1.081.38 ) for those on one psychoactive medicine , 1.70 ( 95 % ci 1.451.99 ) for those on two , 1.96 ( 95 % ci 1.582.43 ) for those on three or four , and 3.15 ( 95 % ci 1.905.23 ) for those on five or more . a similar result was observed when the data were analysed by dose , with the highest risk being found for those taking three or more ddd per day ( adjusted irr 4.26 , 95 % ci 2.756.58).conclusionincreased numbers or increased doses of psychoactive medicines are associated with an increased risk of hospitalization for falls in older adults .
strategies to reduce the psychoactive medicine burden are likely to translate into significant health benefits . |
although ovarian cancer is usually diagnosed in postmenopausal women , 12% of ovarian cancer cases occur in women of child - bearing age .
several reports have estimated that 3% to 17% of all eocas occur in woman younger than 40 years of age .
ovarian germ cell tumors ( gcts ) account for 20% to 25% of all ovarian neoplasms ; however , only 3% are malignant .
the peak incidence of gcts is in young women or adolescent girls , accounting for 58% of all ovarian tumors in women younger than 20 years of age ; one - third of these tumors are malignant . traditionally , treatment consisted of complete surgical staging in the form of total abdominal hysterectomy , bilateral salpingo - oopherectomy , omentectomy , and pelvic and para - aortic lymphadenectomy .
a more conservative approach is now being used with preservation of the uterus and contralateral ovary in patients with early - stage cancer who want to remain fertile .
although several authors have reported their experiences with laparoscopic fertility - sparing surgery , to our knowledge , there have been no reported cases of robotic - assisted fertility - sparing surgery .
we present two cases of robotic - assisted fertility - sparing surgery in reproductive - aged women : one for eoca and the other for gct .
both surgeries were performed at a university - affiliated teaching hospital by a board - certified gynecologist - oncologist proficient in robotic surgery and assisted by a surgical fellow specializing in minimally invasive gynecological surgery , as well as a resident .
a 29-year - old woman ( gravida 0 para 0)5 feet 2 inches tall and weighing 120 lbs , with a body mass index of 21.95without any significant past medical or surgical history presented for evaluation of infertility , at which time a left ovarian cyst was found . in november 2008
, she underwent a laparoscopic left ovarian cystectomy , ablation of endometriosis , hysteroscopic polypectomy , and endometrial biopsy .
findings were significant for pelvic endometriosis and a left ovary adhered to the sidewall with a dermoid - appearing cyst , as well as an endometrial polyp . during separation of the cyst , inadvertent rupture occurred .
the pathology of the cyst revealed a well - differentiated endometrioid adenocarcinoma with foci of squamous metaplasia , and the endometrial pathology showed proliferative endometrium and polypoid fragments of endometrium with complex endometrial hyperplasia with marked atypia .
subsequently , she was referred to our center for evaluation . a positron emission tomography computed tomography scan revealed a focus of activity corresponding to the uterus and increased activity in the ovaries bilaterally , however , with low standard uptake value ( suv ) of 2 on the left and 2.1 on the right .
after consultation with the patient and based on her desire for future fertility , in december 2008 she underwent fertility - sparing surgery in the form of an examination under anesthesia , exploratory laparoscopy , peritoneal washings , omentectomy , robotic - assisted laparoscopic left salpingo - oopherectomy , left extensive pelvic side wall dissection , ureterolysis , bilateral pelvic and para - aortic lymphadenectomy , multiple peritoneal biopsies , hysteroscopy , and dilation and curettage . specifically because the ovary was severely attached to the side wall , to be certain that no metastatic disease remained , extensive resection of the left pelvic side wall , pararectal area , and left uterosacral ligament was performed .
operative findings revealed an 8-cm uterus and no obvious signs of peritoneal carcinomatosis or ascites .
total operative time was 5 hours 43 minutes , and estimated blood loss was 100 ml .
there were 17 peritoneal and diaphragmatic biopsy specimens , 18 pelvic lymph nodes , and 13 para - aortic nodes and omentum , all of which were found to be benign .
endometrial curettings revealed complex hyperplasia with tubal metaplasia , no atypia , and follicular cysts and small foci of endometriosis of the left ovary .
based on recommendations from our hospital multidisciplinary tumor conference , she received 3 cycles of carboplatin and paclitaxel .
in addition , because of the diagnosis of atypical hyperplasia , she also received medroxyprogesterone acetate for the duration of her chemotherapy .
she has conceived twice spontaneously since her surgery and had two successful pregnancies . at the time of this writing , she is currently without evidence of disease ( 46 months ) .
a 31-year - old woman ( para 0)5 feet 4 inches tall and weighing 162 lbs , with a body mass index of 27.8with no significant past medical history presented to her gynecologist with left lower quadrant pain and a palpable mass on examination .
transvaginal ultrasonography revealed a complex cystic and solid lesion in the left adnexa measuring 7.4 7.3 9.7 cm .
ca-125 marker reading was 6.7 u / ml , ca-199 was 8.2 u / ml , carcinoembryonic antigen ( cea ) was 1.6 ng / ml , inhibin a was 24.7 pg / ml , and human chorionic gonadotropin was < 0.5 miu / ml . in february 2010 , she underwent a laparoscopic cystectomy for presumed benign dermoid cyst ; however , pathologic findings revealed an immature grade 1 teratoma . during the procedure
, the cyst was inadvertently ruptured , and she was sent to our center for consultation . a positron emission tomography computed tomography scan was performed and demonstrated no evidence of intraperitoneal or retroperitoneal metastatic disease . based on recommendations from our hospital multidisciplinary tumor conferences , she underwent robotic - assisted surgical staging in april 2010 .
operative findings revealed an 8-cm uterus with disseminated suspicious peritoneal lesions in different parts of the pelvic cavity ranging from 1 mm to 2 cm .
the mid and upper abdomen was normal except for a 2-mm lesion on the surface of the right diaphragm .
peritoneal washings were obtained , and the robotic - assisted laparoscopic approach included resection of all peritoneal lesions and left salpingo - oopherectomy , with the infracolic omentectomy performed via conventional laparoscopy .
a frozen section of one of the peritoneal lesions was positive for metastatic immature teratoma ; based on that finding and also the low probability of the lymph nodes being affected , no lymphadenectomy was performed .
total operative time was 2 hours 52 minutes , and estimated blood loss was 200 ml .
pathology findings revealed teratomatous disease in the left ovary and 4 biopsy sites ( rectum , cul - de - sac , pelvic side wall , and right broad ligament ) with focally immature - appearing cartilage .
the omentum was negative , endometrial currettings showed proliferative endometrium , and peritoneal washings were negative for malignancy . because her stage was ic , recommendation from a multidisciplinary tumor conference was that she be treated with three cycles of adjuvant chemotherapy in the form of bleomycin , etoposide , and cisplatin .
the patient conceived spontaneously and had a normal spontaneous vaginal delivery in march 2011 . at 19 months ' follow - up , she had no evidence of disease .
using general endotracheal anesthesia , the patients were placed in the dorsal lithotomy position using allen stirrups with venodyne boots . in both cases , a standard intuitive robotic platform ( intuitive surgical , sunnyvale , ca ) was used .
port placement included a 12-mm primary , 4 cm above the umbilicus , 2 robotic 8-mm midlateral , and 10-mm and 5-mm ports in the right and left upper abdomen for introduction of ancillary instruments .
after the robotic apparatus was docked , robotic bipolar and electrosurgical scissors are inserted and used for desiccation and cutting the tissues .
after thorough laparoscopic evaluation of the abdominal and pelvic cavity and after obtaining peritoneal washings , the robot was docked and the robotic portion of the surgery proceeded .
the left ovary was mobilized from the pelvic sidewall , and a left pelvic wall dissection was performed . after identifying the ureter ,
the infundibulopelvic ligament was electrodesiccated and the left tube and ovary were confined to a laparoscopy bag and removed from the abdominal cavity .
an extensive resection of the left pelvic sidewall to the pararectal area and the left uterosacral ligament was performed , and all areas were inspected for possible metastatic disease . in both cases , all peritoneal lesions were removed . multiple biopsies from different parts of the anterior , posterior , left , right , pelvic , and abdominal wall were performed . in the first case ,
lymphadenectomy was performed . for pelvic lymphadenectomy , after the pelvic side wall on each side was opened , the paravesical and pararectal spaces were developed and pelvic nodes were sampled from the external iliac vessels ( from the mid common iliac artery to the deep circumflex vein ) , obturator fossa , and hypogastric vessels .
for the para - aortic lymphadenectomy , the posterior parietal peritoneum was incised over the right common iliac artery .
the incision was extended all the way up to the gonadal vein on the right side and the renal vein on the left side .
the ureters were identified , and the para - aortic nodes over the vena cava on the right side and on the left side from below and above the inferior mesenteric artery were sampled .
the inferior mesenteric artery was electrodessictaed and cut to allow complete removal of all of the lymph nodes .
using general endotracheal anesthesia , the patients were placed in the dorsal lithotomy position using allen stirrups with venodyne boots . in both cases , a standard intuitive robotic platform ( intuitive surgical , sunnyvale , ca ) was used .
port placement included a 12-mm primary , 4 cm above the umbilicus , 2 robotic 8-mm midlateral , and 10-mm and 5-mm ports in the right and left upper abdomen for introduction of ancillary instruments .
after the robotic apparatus was docked , robotic bipolar and electrosurgical scissors are inserted and used for desiccation and cutting the tissues .
after thorough laparoscopic evaluation of the abdominal and pelvic cavity and after obtaining peritoneal washings , the robot was docked and the robotic portion of the surgery proceeded .
the left ovary was mobilized from the pelvic sidewall , and a left pelvic wall dissection was performed . after identifying the ureter ,
the infundibulopelvic ligament was electrodesiccated and the left tube and ovary were confined to a laparoscopy bag and removed from the abdominal cavity .
an extensive resection of the left pelvic sidewall to the pararectal area and the left uterosacral ligament was performed , and all areas were inspected for possible metastatic disease . in both cases , all peritoneal lesions were removed . multiple biopsies from different parts of the anterior , posterior , left , right , pelvic , and abdominal wall were performed . in the first case ,
after the pelvic side wall on each side was opened , the paravesical and pararectal spaces were developed and pelvic nodes were sampled from the external iliac vessels ( from the mid common iliac artery to the deep circumflex vein ) , obturator fossa , and hypogastric vessels .
the incision was extended all the way up to the gonadal vein on the right side and the renal vein on the left side .
the ureters were identified , and the para - aortic nodes over the vena cava on the right side and on the left side from below and above the inferior mesenteric artery were sampled .
the inferior mesenteric artery was electrodessictaed and cut to allow complete removal of all of the lymph nodes .
we present two successful cases of robotic - assisted laparoscopic fertility - sparing surgery for stage ic well - differentiated endometrioid adenocarcinoma and stage ic immature teratoma .
both patients were successfully treated , conceived spontaneously , and currently have no evidence of disease . in both cases ,
surgical restaging was important , both to remove the affected ovary and to correctly stage the patients .
this played a role in predicting future prognosis and in altering the decision for postoperative chemotherapy .
published one of the earlier reports on fertility - sparing surgery for reproductive age women with epithelial ovarian cancer .
they showed that this is an appropriate treatment option for early - stage patients with an acceptable oncological safety profile .
since then , several authors have published their results . in 2002 , schilder et al .
published a multi - institutional retrospective investigation on patients with stage ia and ic epithelial ovarian cancer who were treated with fertility - sparing surgery ( in the form of unilateral adnexectomy ) .
fifty - two patients with stage i epithelial ovarian cancer treated from 1965 to 2000 at 8 participating institutions were identified .
forty - two patients had stage ia disease , and 10 had stage ic cancers . cell type included 25 mucinous , 10 serous , 10 endometrioid , 5 clear cell , and 2 mixed histology ; 38 were grade 1 , 9 were grade 2 , and 5 were grade 3 .
duration of follow - up ranged from 6 to 426 months ( median , 68months ) .
twenty - four patients attempted to become pregnant , and 17 ( 71% ) conceived .
these 17 patients had 26 term deliveries ( no congenital anomalies noted ) and 5 spontaneous abortions .
they concluded that fertility - sparing surgery should be considered as a treatment option in women with stage i epithelial ovarian cancer who desire future child - bearing .
satoh et al . , in 2010 , attempted to systematically determine selection criteria for fertility - sparing surgery in stage i epithelial cancer .
a relapse of 8.5% was reported , with 27% of the relapsed patients presenting recurrence exclusively in the remaining ovary without any distant or peritoneal metastases .
the authors concluded that with favorable histology ( mucinous , serous , endometrioid , or mixed histology ) and low grade ( 1 or 2 ) , patients can safely undergo fertility - sparing surgery , even without postoperative chemotherapy .
however , in cases of stage ia disease with clear cell histology or stage ic with unilateral ovarian involvement and unfavorable histology , the authors emphasized the need for adjuvant platinum - based chemotherapy . on the basis of these and other studies
, fertility - sparing surgery may be an option in patients with early - stage epithelial ovarian cancer ; however , it should not be an option for patients with higher than stage i , synchronous endometrial cancer , grade 3 disease , hereditary syndromes , and poor histology ( clear cell , anaplastic , and small cell ) .
germ cell tumors arise from primordial germ cells and comprise dysgerminomatous and nondysgerminomatous tumors , including yolk sac tumors ( endodermal sinus tumors ) , immature teratomas , mixed germ cell tumors , pure embryonal carcinomas , and nongestational choriocarcinomas .
they differ from epithelial ovarian cancers in that they predominantly involve one ovary and usually affect girls and women of reproductive age .
they are usually also chemosensitive and have specific tumor markers , which can aid in their diagnosis and management . before more advanced chemotherapies were available , complete surgical removal and staging was the gold standard in treatment of gcts .
more recently , however , the management of these tumors in reproductive age women typically includes fertility - sparing surgery ( preservation of the uterus and unaffected ovary ) whenever appropriate , with a thorough staging procedure , followed by adjuvant chemotherapy consisting of bleomycin , etoposide , and cisplatin ( except for stage ia or ib pure dysgerminoma and stage ia grade 1 immature teratoma ) . with the addition of postoperative chemotherapy , 90% to 95% of malignant gcts are curable . in a review of the literature , eskander et al . reported that of 515 patients with malignant gcts treated conservatively , there were 185 pregnancies and 148 live births .
only 9 patients had disease recurrence with a death rate of 3% . in recent years
, several authors have suggested that laparoscopic surgery is a feasible , safe , and adequate technique for surgical staging and debulking in ovarian cancer when compared with laparotomy .
furthermore , various advantages have been attributed to minimally invasive surgery , such as decreased hospital stay , quicker recovery times , and faster return to daily living without compromising oncological outcomes reports in the literature on laparoscopic fertility - sparing surgery for ovarian cancer are scant .
performed a prospective study involving 27 patients who had already been operated on elsewhere for a presumably benign ovarian cyst .
pathology after the initial surgery revealed 12 low - malignant - potential neoplasms , 11 invasive epithelial ovarian carcinomas , 1 sex - cord stromal cell neoplasm , and 3 germ cell neoplasms .
patients underwent subsequent laparoscopic fertility - sparing surgery in the form of exploration of the peritoneal cavity , peritoneal washings , multiple peritoneal biopsies , unilateral adnexectomy ( except in borderline tumors ) , omentectomy , unilateral or bilateral pelvic and para - aortic lymph node sampling ( except in borderline tumors , well - differentiated , mucinous , and granulosa cell tumors ) , endometrial biopsy , and appendectomy in mucinous tumors .
seven patients ( 26% ) were upstaged and 6 received adjuvant platinum - based chemotherapy .
all patients were alive at that time ; however , one patient with international federation of gynecology and obstetrics stage ic clear cell carcinoma had a recurrence 8 months after surgery .
the authors concluded that laparoscopy is acceptable in surgical staging of patients with early - stage ovarian cancer undergoing conservative surgery with preservation of the uterus and contralateral ovary .
performed a retrospective study on 19 patients with borderline ovarian tumors who underwent laparoscopy over a 3-year period , all of whom desired preservation of fertility .
of the 19 patients , 10 attempted pregnancy and 6 conceived spontaneously and carried to term without the disease interfering with gestation or follow - up period after surgery .
they concluded that laparoscopic fertility - sparing surgery for borderline ovarian tumors is a safe option in women who desire future fertility without interfering with fertility and pregnancy outcomes .
more recently , hu et al . performed a retrospective study of young patients with epithelial ovarian cancer stage i , grade 1 in 8 institutions from january 1994 to december 2010 .
ninety - four patients were treated with fertility - sparing surgery : 72 had laparotomies , 22 had laparoscopies , and 5 had laparoscopy that was converted to laparotomy intraoperatively .
median follow - up time was 58.7 months , and mean follow - up time was 58.7 months .
overall survival and disease - free survival rates declined in patients undergoing fertility - sparing surgery with increased histologic grade . in patients with early - stage disease ,
on the other hand , overall survival and disease - free survival were not affected by staging method . at the end of the follow - up , 7 of 12 patients had conceived .
they concluded that fertility - sparing surgery could be considered for young patients with epithelial ovarian cancer stage i , grade 1 and that the surgical method may not significantly influence the prognosis .
computer - enhanced telesurgery , known as robotic - assisted surgery , is the latest innovation in videoendoscopy , which profoundly revolutionized the concept of minimally invasive surgery in the past 3 decades .
operative laparoscopy has several advantages over laparotomy , including faster postoperative recuperation , shorter hospitalization course , cosmetic benefits , improved visualization , decreased blood loss , and fewer postoperative complications . despite these advantages ,
there are several drawbacks to conventional videolaparoscopy , including 2-dimensional views , a slower learning curve , operator fatigue , counterintuitive hand movements , and tremor amplification . with the advent of computer - enhanced surgery ,
some of these limitations can be overcome , allowing for improved visualization , coordination , and dexterity .
furthermore , robotic surgery can be viewed as an extension of conventional laparoscopy , making the procedure more reproducible , especially in lengthy , complicated cases such as para - arotic and pelvic lymphadenectomy , as well as in obese patients .
furthermore , the surgeon is able to sit for the surgery , which is another advantage because this can decrease physician fatigue and long - term physical impairment .
in 2002 , schilder et al . published a multi - institutional retrospective investigation on patients with stage ia and ic epithelial ovarian cancer who were treated with fertility - sparing surgery ( in the form of unilateral adnexectomy ) .
fifty - two patients with stage i epithelial ovarian cancer treated from 1965 to 2000 at 8 participating institutions were identified .
forty - two patients had stage ia disease , and 10 had stage ic cancers . cell type included 25 mucinous , 10 serous , 10 endometrioid , 5 clear cell , and 2 mixed histology ; 38 were grade 1 , 9 were grade 2 , and 5 were grade 3 .
duration of follow - up ranged from 6 to 426 months ( median , 68months ) .
twenty - four patients attempted to become pregnant , and 17 ( 71% ) conceived .
these 17 patients had 26 term deliveries ( no congenital anomalies noted ) and 5 spontaneous abortions .
they concluded that fertility - sparing surgery should be considered as a treatment option in women with stage i epithelial ovarian cancer who desire future child - bearing .
satoh et al . , in 2010 , attempted to systematically determine selection criteria for fertility - sparing surgery in stage i epithelial cancer .
a relapse of 8.5% was reported , with 27% of the relapsed patients presenting recurrence exclusively in the remaining ovary without any distant or peritoneal metastases .
the authors concluded that with favorable histology ( mucinous , serous , endometrioid , or mixed histology ) and low grade ( 1 or 2 ) , patients can safely undergo fertility - sparing surgery , even without postoperative chemotherapy .
however , in cases of stage ia disease with clear cell histology or stage ic with unilateral ovarian involvement and unfavorable histology , the authors emphasized the need for adjuvant platinum - based chemotherapy . on the basis of these and other studies
, fertility - sparing surgery may be an option in patients with early - stage epithelial ovarian cancer ; however , it should not be an option for patients with higher than stage i , synchronous endometrial cancer , grade 3 disease , hereditary syndromes , and poor histology ( clear cell , anaplastic , and small cell ) .
germ cell tumors arise from primordial germ cells and comprise dysgerminomatous and nondysgerminomatous tumors , including yolk sac tumors ( endodermal sinus tumors ) , immature teratomas , mixed germ cell tumors , pure embryonal carcinomas , and nongestational choriocarcinomas .
they differ from epithelial ovarian cancers in that they predominantly involve one ovary and usually affect girls and women of reproductive age .
they are usually also chemosensitive and have specific tumor markers , which can aid in their diagnosis and management . before more advanced chemotherapies were available , complete surgical removal and staging was the gold standard in treatment of gcts .
more recently , however , the management of these tumors in reproductive age women typically includes fertility - sparing surgery ( preservation of the uterus and unaffected ovary ) whenever appropriate , with a thorough staging procedure , followed by adjuvant chemotherapy consisting of bleomycin , etoposide , and cisplatin ( except for stage ia or ib pure dysgerminoma and stage ia grade 1 immature teratoma ) . with the addition of postoperative chemotherapy , 90% to 95% of malignant gcts are curable . in a review of the literature , eskander et al . reported that of 515 patients with malignant gcts treated conservatively , there were 185 pregnancies and 148 live births .
in recent years , several authors have suggested that laparoscopic surgery is a feasible , safe , and adequate technique for surgical staging and debulking in ovarian cancer when compared with laparotomy .
furthermore , various advantages have been attributed to minimally invasive surgery , such as decreased hospital stay , quicker recovery times , and faster return to daily living without compromising oncological outcomes reports in the literature on laparoscopic fertility - sparing surgery for ovarian cancer are scant .
performed a prospective study involving 27 patients who had already been operated on elsewhere for a presumably benign ovarian cyst .
pathology after the initial surgery revealed 12 low - malignant - potential neoplasms , 11 invasive epithelial ovarian carcinomas , 1 sex - cord stromal cell neoplasm , and 3 germ cell neoplasms .
patients underwent subsequent laparoscopic fertility - sparing surgery in the form of exploration of the peritoneal cavity , peritoneal washings , multiple peritoneal biopsies , unilateral adnexectomy ( except in borderline tumors ) , omentectomy , unilateral or bilateral pelvic and para - aortic lymph node sampling ( except in borderline tumors , well - differentiated , mucinous , and granulosa cell tumors ) , endometrial biopsy , and appendectomy in mucinous tumors .
seven patients ( 26% ) were upstaged and 6 received adjuvant platinum - based chemotherapy .
all patients were alive at that time ; however , one patient with international federation of gynecology and obstetrics stage ic clear cell carcinoma had a recurrence 8 months after surgery .
the authors concluded that laparoscopy is acceptable in surgical staging of patients with early - stage ovarian cancer undergoing conservative surgery with preservation of the uterus and contralateral ovary .
performed a retrospective study on 19 patients with borderline ovarian tumors who underwent laparoscopy over a 3-year period , all of whom desired preservation of fertility .
of the 19 patients , 10 attempted pregnancy and 6 conceived spontaneously and carried to term without the disease interfering with gestation or follow - up period after surgery .
they concluded that laparoscopic fertility - sparing surgery for borderline ovarian tumors is a safe option in women who desire future fertility without interfering with fertility and pregnancy outcomes .
more recently , hu et al . performed a retrospective study of young patients with epithelial ovarian cancer stage i , grade 1 in 8 institutions from january 1994 to december 2010 .
ninety - four patients were treated with fertility - sparing surgery : 72 had laparotomies , 22 had laparoscopies , and 5 had laparoscopy that was converted to laparotomy intraoperatively .
median follow - up time was 58.7 months , and mean follow - up time was 58.7 months .
overall survival and disease - free survival rates declined in patients undergoing fertility - sparing surgery with increased histologic grade . in patients with early - stage disease , on the other hand , overall survival and disease - free survival were not affected by staging method . at the end of the follow - up ,
they concluded that fertility - sparing surgery could be considered for young patients with epithelial ovarian cancer stage i , grade 1 and that the surgical method may not significantly influence the prognosis .
computer - enhanced telesurgery , known as robotic - assisted surgery , is the latest innovation in videoendoscopy , which profoundly revolutionized the concept of minimally invasive surgery in the past 3 decades .
operative laparoscopy has several advantages over laparotomy , including faster postoperative recuperation , shorter hospitalization course , cosmetic benefits , improved visualization , decreased blood loss , and fewer postoperative complications . despite these advantages , there are several drawbacks to conventional videolaparoscopy , including 2-dimensional views , a slower learning curve , operator fatigue , counterintuitive hand movements , and tremor amplification . with the advent of computer - enhanced surgery ,
some of these limitations can be overcome , allowing for improved visualization , coordination , and dexterity .
furthermore , robotic surgery can be viewed as an extension of conventional laparoscopy , making the procedure more reproducible , especially in lengthy , complicated cases such as para - arotic and pelvic lymphadenectomy , as well as in obese patients .
furthermore , the surgeon is able to sit for the surgery , which is another advantage because this can decrease physician fatigue and long - term physical impairment .
robotic - assisted surgery provides a 3-dimensional view , magnified stereovision , 7 degrees of freedom , tremor filtering , and improvement of the surgeons ' ergonomic position during the surgery .
to our knowledge , there have been no published reports on robotic - assisted laparoscopy for fertility - sparing surgery in ovarian cancer .
the two patients in this report were treated with conservative surgery via robotic - assisted laparoscopy , and both resulted in favorable outcomes . from this , it appears that robotic - assisted laparoscopic fertility - sparing surgery is both a feasible and acceptable option for low - grade and low - stage ovarian cancer in patients desiring future fertility . | objective : to show the feasibility and safety of robotic - assisted laparoscopic fertility - sparing surgery for early - stage ovarian cancer in women of reproductive age.methods and design : the first patient was a 29-year - old para 0 woman with well - differentiated endometrioid adenocarcinoma of the ovary and complex endometrial hyperplasia with marked atypia .
the second patient was a 31-year - old para 0 woman with an immature grade 1 teratoma .
both patients underwent robotic - assisted laparoscopic surgical staging.results:in the first patient , there were no intra- or postoperative complications .
operative time was 5 hours 43 minutes and estimated blood loss was 100 ml .
she was discharged home on postoperative day 1 .
she received 3 cycles of carboplatin and paclitaxel , as well as medroxyprogesterone acetate for the duration of chemotherapy .
she conceived twice spontaneously since surgery and had two successful deliveries .
she currently has no evidence of disease.in the second patient , there were no intra- or postoperative complications .
operative time was 2 hours 52 minutes and estimated blood loss was 200 ml .
she was discharged home on postoperative day 1 .
she declined adjuvant chemotherapy with bleomycin , etoposide , and cisplatin .
she conceived spontaneously 4 months later and had a normal vaginal delivery .
she currently has no evidence of disease.conclusions:because fertility - sparing surgery is now accepted as a viable option in young women with early - stage ovarian cancer , less invasive techniques are being used . with the advent of robotic - assisted surgery and its advantages over conventional laparoscopy , we show that it is a safe and feasible approach in select patients .
this is the first reported series on robotic fertility - sparing surgery , but more research is needed . |
thyroid cancer is the most common endocrine cancer ( approximately 1.0%1.5% of all new cancers diagnosed each year in the usa ) , and its incidence has continuously increased in the last three decades all over the world .
this trend is present on every continent ( table 1 ) except africa , where detection is possibly insufficient .
the increasing incidence is indicated by the annual percent change ( apc ) that in the usa was 2.4% from 1980 to 1997 and 6.6% from 1997 to 2009 ( both genders ) ( cancer of the thyroid - seer stat fact sheets , available at http://seer.cancer.gov/statfacts/html/thyro.html accessed on december 10 , 2012 ) .
based on recent data , thyroid cancer is the fifth most common cancer in women , and in italy , it is the second most frequent cancer in women below 45 years of age . only in few countries ( norvay , sweden ) thyroid cancer incidence is decreased .
genetic factors , environmental influences , and access to medical care can easily explain the high variability ( up to nearly tenfold ) in the thyroid cancer incidence by geographic area and ethnicity .
although the lowest rates of thyroid cancer are observed in blacks , the greatest rate of papillary thyroid cancer acceleration occurs in black females .
male and female annual percent change was 6.3% and 7.1% for white patients , 4.3% and 8.4% for black , 4.2% and 6.7% for hispanic and 3.4% and 6.4% for asian / pi ( pacific islander ) patients respectively . in any case , the continuously increasing rate of thyroid cancer is independent of the underlying incidence rates .
the increase is nearly exclusively due to increases in the incidence of the papillary histotype , with no significant change for the follicular , medullary , or anaplastic histotypes ( figure 1 ) .
the increase mainly regards small tumors , although large tumors have also increased [ 6 , 7 ] . in spite of the steadily increased incidence , thyroid cancer mortality
is reported stable at approximately 0.5 cases per 100,000 persons . at variance with most tumors ( including breast , colon - rectum , lung , and prostate cancer )
whose mortality has decreased in the last two decades , thyroid cancer mortality rate is not decreased , but rather slightly increased .
indeed , the jointpoint trend reported by seer for the period 19882009 ( cancer of the thyroid - seer stat fact sheets , available at http://seer.cancer.gov/statfacts/html/thyro.html , accessed on december 10 , 2012 ) indicates a significant increase of thyroid cancer mortality ( + 0.8% annual percent change , apc ) , primarily in males .
this increase in mortality rate occurred in spite of early diagnosis and better treatment of high risk thyroid cancers .
the divergence between the sharp increase in incidence and mortality , therefore , is probably less relevant than first recognized also considering that the indolent behavior of most thyroid cancers would affect mortality only many years after the increase in incidence .
some experts believe that the increased number of new cancers is due to the increased diagnostic intensity [ 8 , 9 ] .
other experts believe that a true increase , due to environment and lifestyle changes , is also a likely possibility [ 6 , 7 , 1013 ] .
since most individuals with differentiated thyroid cancer will do well , the risk of overdiagnosis has been hypothesized .
not only will confer little benefit to the patient ( pseudodisease ) but may also cause potential damage in terms of avoidable distress , possible adverse consequences of unnecessary treatment , and increasing economic cost .
thyroid cancer can easily fall within the condition of overdiagnosis because it progresses slowly , causes symptoms only when advanced , and rarely causes death .
the economic cost of overdiagnosis in a thyroid cancer patient can range from hundreds to thousands dollars , depending on the extent of the examinations performed and the complexity of the intervention and followup . to prevent these costs and the inconveninences of unnecessary treatment many proposals
have been recently advanced , including not submitting to cytological examination nodules 1.0 cm that do not have additional risk factors ( revised american thyroid association management guidelines for patients with thyroid nodules and differentiated thyroid cancer , available at http://thyroidguidelines.net/revised/nodules , accessed on december 12 , 2012 ) and the wait and see approach without treatment for microcarcinomas .
recent studies suggest that the treatment and follow - up costs can be reduced in low - risk tumors by selective , simplified procedures [ 17 , 18 ] . at present
this is the most rational approach , based on the judgment of various prognostic factors that affect the patient outcome .
risk stratification , however , is based on clinical characteristics that leave a margin of uncertainty , not only for recurrent disease but also for the possibility of metastatic and deadly evolution .
although very low , this possibility provides the physician and the patient with a difficult dilemma .
in fact , even when considering only microcarcinomas , extracapsular extension , lymph node metastases , and/or extrathyroid extension are found at presentation in a percentage variable from 15% to 30% ( cancer of the thyroid - seer stat fact sheets , available at http://seer.cancer.gov/statfacts/html/thyro.html accessed on december 10 , 2012 ) .
we should also consider that the large majority of patients with a microcarcinoma ( 78% ) , when offered observation without surgery , opted for immediate surgery .
therefore , a better understanding of the cause(s ) of increased thyroid cancer incidence rate and improved risk stratification , using specific biological and molecular markers to accurately estimate whether a subclinical thyroid malignancy will remain stationary or will progress to an adverse outcome , is a priority to avoid overtreatment .
the more frequent use of sensitive diagnostic procedures , including ultrasound , doppler examination , imaging techniques like ct scan , mri or pet scanning , and biochemical markers , has increased the detection of many types of cancer .
as far as the thyroid is concerned , ultrasound and cytology examinations have identified an increasing number of small , asymptomatic thyroid cancers .
ultrasound use , in particular , has boosted the detection of small thyroid nodules that would have gone undetected in clinical practice ( only 40% of thyroid nodules
smaller than 1.5 cm in maximum diameter are discovered during a physical examination ) .
the high prevalence of thyroid nodules , affecting up to 30%50% of the population in late adulthood , constitutes an enormous reservoir of potential cancer lesions to be investigated .
moreover , incidental thyroid nodules ( including malignant nodules ) today are frequently identified after diagnostic procedures for different primary diseases .
doppler examination of the neck vessels and other imaging procedures like pet scan , for instance , have increased the detection of incidental thyroid tumors [ 22 , 23 ] .
finally , the incidental discovery of preclinical thyroid tumors at pathology examination may be more frequent because of the increased use of enlarged surgical excision ( total or subtotal thyroidectomy ) for nonmalignant thyroid diseases . in support of an increased screening effect
is also the observation that thyroid cancer is positively associated with high levels of income , education , and other socioeconomic indicators of healthcare access .
this factor , however , should have also increased the detection of other tumors whose incidence has not increased .
the diffuse use of sensitive diagnostic procedures may have affected the incidence of cancers in the thyroid more than in other sites because thyroid cancer has an indolent progression and may remain unrecognized in the preclinical stage for years or decades , as confirmed by the observation of a high frequency ( 2.8%39% ) of small thyroid cancers during autopsies [ 25 , 26 ] .
the observation that most thyroid cancers ( over 80% ) are smaller than two centimeters at the time of diagnosis is consistent with the possibility that increased surveillance and more sensitive diagnostic procedures are detecting cancers that were also present in the past but went undiscovered ( table 2 ) .
when improved detection is the only cause , the increase of small , early stage tumors should be accompanied by a progressive decline of larger and more advanced tumors .
the thyroid cancer increase , while most prominent for small tumors , occurred across all tumor sizes and stages , suggesting that increased detection is not the only cause [ 6 , 10 ] . from 1992 to 1995 , in the usa , approximately 50% of the thyroid cancer incidence increase was due to tumors 1.0 cm , 30% to tumors 1.12.0 cm , and 20% to tumors > 2.0 cm . in another study ,
the incidence rate increased for tumors < 2.0 cm and > 4.0 cm in size but not for tumors of medium size ( 2.04.0 cm ) . in spain , from 1978 to 2001 , the thyroid cancer incidence increased equally in microcarcinomas and in larger tumors .
recently , an increased incidence for thyroid cancers of all stages ( localized , regional , and distant staged disease ) has been confirmed ( figure 1 ) .
the increased incidence of thyroid cancers of large volume and advanced stages , usually clinically apparent , can hardly be explained by increased detection .
moreover , the thyroid cancer increase almost exclusively occurred for papillary tumors ( figure 1 ) , while improved detection should have affected all histotypes . recently , analysing the incidence patterns in seer data in the united states during 19802009 , aschebrook - kilfoy et al .
described a modest increase in age - adjusted follicular thyroid cancer rates ( figure 1 ) .
although improved detection can more effectively favor the identification of small , nonaggressive ptc which are the most indolent tumors , the small difference in cancer - related mortality between the papillary ( approximately 7% at 10 years ) and the follicular ( approximately 15% ) histotypes indicates that increased detection should have also affected the incidence of the follicular histotype .
we can not exclude , therefore , that specific carcinogens might have favored the molecular abnormalities typical of papillary cancer , a hypothesis supported by the increasing incidence of braf - positive papillary tumors over time [ 32 , 33 ] ( table 3 ) .
finally , when increased detection is the only cause , the cancer increase is expected to occur in all age and gender categories .
indeed , the age - adjusted incidence rates of thyroid cancer have increased among females more than males ( 158% versus 106% , resp . ) with a clear birth cohort pattern , possibly reflecting changes in risk factors .
although a different screening intensity according to age and gender can not be excluded , the different secular trend in the two genders and the birth cohort effect suggest that increased detection is not the only cause of the increased incidence of thyroid cancer ( table 3 ) .
also the age - specific trends by race do not support a detection effect as the reason for the increasing incidence .
the thyroid may be irradiated more than other tissues because of its position in the body and its ability to concentrate iodine . during the last 25 years
, the individual radiation dose has doubled in the usa , from approximately 3 msv / year in 1980 to 6 msv / year in 2006 .
medical and dental diagnostic examinations have specifically increased thyroid exposure to x - rays . ct scans , although accounting for only 15% of all radiological diagnostic procedures in the usa , provide more than 50% of the radiation dose absorbed by patients . because one - third of all ct scans are performed in the head / neck region ,
, the use of iodinated contrast agents increases the radiation absorbed by the thyroid by up to 35% because iodine blocks photons , increasing the local radiation energy .
children exposed to radiation frequently develop papillary thyroid cancer ( ptc ) as shown by the peak of thyroid cancers observed after the chernobyl accident , when approximately 1.7 10 bq of i were released into the atmosphere . on that occasion ,
the thyroid received a dose 500- to 1000-times higher than the rest of the body , and approximately 4,000 thyroid cancer cases were reported .
the role of ct scans in increasing the risk of cancer in children is already documented : ct scans delivering a cumulative dose of 5060 mgy almost triple the risk of leukaemia and brain cancer .
direct evidence of ct radiation effect on the incidence of thyroid cancer in children is not available .
however , risk projections can be used to estimate the potential cancer burden from ct scans on the basis of the age at scan and the type of scan .
the increasing number of ct scans during childhood was hypothesized to increase the number of thyroid malignancies by up to 390 per million exposed individuals and ct scans carried out in the usa in 2007 have been estimated to potentially cause about 1000 future thyroid cancers .
a recent analysis indicated that thyroid cancer risk in children exposed to head and neck radiation is inversely correlated to the age , decreasing to a nonstatistically significant level by age 15 . however , a carcinogenic effect of radiation on the adult thyroid population can not be excluded , as indicated by the increased incidence of thyroid cancer among female survivors of the atomic bomb that were older than 20 years at the time of the explosion .
moreover , a recent report indicates that dental x - rays may increase thyroid cancer risk also in adults . as a consequence ,
thyroid shielding has been recently recommended by the american thyroid association during diagnostic dental x - rays both in children and adults ( american thyroid association ( ata ) issues policy statement on minimizing radiation exposure from medical , dental diagnostics , available at http://www.thyroid.org/american-thyroid-association-ata-issues-policy-statement-on-minimizing radiation - exposure - from - medical - dental - diagnostics/ accessed on december 10 , 2012 ) .
another specific source of thyroid irradiation is thyroid imaging with i that has been largely used for the diagnosis of thyroid diseases .
thyroid scans reached 13% of all nuclear medicine examinations in 1973 and thereafter decreased to the present rate of less than 1% with i substituted by the less - dangerous tc .
the therapeutic use of i for hyperthyroidism , however , has continued or even increased , and a small increase in thyroid cancer has been observed in these adult patients . other cancer types ( stomach , kidney , and breast ) are also increased in patients treated with rai for hyperthyroidism .
a recent meta - analysis concluded that the use of rai for hyperthyroidism effectively increases the risk of thyroid ( rr 1.99 , 95% ci : 0.921.33 ) , kidney ( rr 1.70 , 95% ci : 1.152.51 ) , and stomach cancer ( rr 1.11 , 95% ci : 0.921.33 ) and a dose effect was also observed for the thyroid at diagnostic doses > 1 gy .
finally , radiotherapy for head and neck malignancies is an additional source of thyroid irradiation .
indeed , in a cohort of childhood cancer survivors , 7.5% of all secondary malignancies were thyroid cancers .
increased exposure to radiation , therefore , may have contributed to the increased incidence of thyroid cancer .
iodine deficiency causes an increase of thyroid - stimulating hormone ( tsh ) , a major growth factor for thyroid follicular cells .
animal experiments demonstrated a clear increase of thyroid cancer after prolonged iodine deficiency leading to increased tsh .
however , this effect is not demonstrated in human residents of iodine - deficient areas [ 51 , 52 ] .
iodine intake is known to influence the thyroid cancer histotype distribution , rather than the overall incidence , with more follicular and fewer papillary carcinomas in iodine - deficient areas .
when iodine prophylaxis is introduced , average serum tsh decreases and the papillary : follicular ratio increases [ 54 , 55 ] . the iodine - associated shift from a follicular to a papillary histotype may be due to the frequency of the braf mutation , a typical molecular alteration in ptc .
braf - positive ptcs were significantly more frequent in chinese regions with a high iodine intake than in control areas .
although a causal relationship between iodine intake and braf mutation is not proven , the worldwide increase of iodine intake and the parallel increase in the prevalence of braf - positive ptcs is in agreement with a possible role of increased iodine intake in the increased ptc incidence .
a major role of tsh in thyroid cancer progression is indicated by the decreased recurrence rate and improved survival in thyroid cancer patients treated with tsh - suppressive l - t4 . however , a role of tsh in inducing thyroid cancer , documented in rodents , is controversial in humans .
a recent study indicates that , at both univariate and multivariate analyses , the risk to have a thyroid cancer and also to have a cancer in an advanced stage is increased in patients with higher tsh serum level .
this correlation was confirmed in fine needle aspiration biopsies in a large series of more than 10,000 patients with thyroid nodules : the risk of malignancy was higher in patients with a higher tsh serum level .
conversely , the risk of cancer was reduced in hyperthyroid patients with autonomous thyroid nodules and a low serum tsh .
a similar correlation was observed also in l - t4-treated patients having serum tsh lower than untreated patients .
these data suggest that tsh levels , indepedently of the underlying mechanism , are positively correlated with thyroid cancer risk .
there is no evidence that serum tsh levels have increased in the population in the last decades .
however , the frequency of chronic autoimmune hashimoto 's thyroiditis , the most common cause of primary hypothyroidism in the westernized world , has increased in the last two decades , paralleling the increased iodine intake .
autoimmune thyroiditis might influence cancer risk not only by increasing tsh levels but also because the autoimmune process per se , via the production of proinflammatory cytokines and oxidative stress , might enhance thyroid tumorigenesis .
however , the ptc frequency in patients with autoimmune thyroiditis is related to serum tsh but not to the presence of antithyroid antibodies , and when these patients are treated with lt-4 to prevent a tsh increase , the risk of thyroid cancer is no longer increased .
whether the prevalence of thyroid cancer is different in thyroid glands with a single nodule ( sn ) versus multinodular goiter ( mng ) remains uncertain .
the prevalence of malignancy in sn has been estimated at 5% . as indicated in the recent guidelines for the management of thyroid nodules patients with multiple thyroid nodules
individual studies , however , provide cancer prevalence in patients with mng that are lower ( 4.1% ) or higher ( 18% ) . a recent meta - analysis supported the inference that thyroid cancer is less frequent in mng than in sn ,
although this finding appears to hold true mostly outside the united states , in iodine - deficient populations .
a strong correlation between obesity and cancer risk and mortality has been demonstrated for several malignancies .
a pooled analysis of five prospective studies indicated that also the risk of thyroid cancer is greater in obese subjects .
as obesity is a multifactorial syndrome , the contribution to cancerogenesis of each single obesity feature ( type of adiposity , metabolic derangement , insulin resistance , etc . )
a recent study supports the possibility that insulin resistance and hyperinsulinemia ( a typical feature of obesity ) rather than metabolic derangement may be a risk factor for thyroid cancer .
insulin resistance was present in 50% of ptc patients versus 10% of matched controls , and bmi at the time of diagnosis was directly related to thyroid cancer risk in females .
hyperinsulinemia , therefore , may be a risk factor for thyroid cancer , but its effect on the thyroid should be similar to that observed on other organs where cancer incidence has not increased .
the pandemia of obesity that characterizes the last decades , therefore , may have contributed to thyroid cancer increase but whether a specific effect on the thyroid is present and what is the underlying mechanism is unknown .
the influences of diet , lifestyle , and pollution on thyroid cancer initiation have never been studied carefully .
the evidences of a possible effect of nutrient / food or environmental pollutants on thyroid cancer are weak and not confirmed .
studies aimed at identifying cancer risk factors belonging to diet and lifestyle have provided controversial results because food and drinks have a great number of different constituents ( many unmeasured or highly variable ) and also because dietary intake and lifestyle may significantly change in the same individual over time .
in addition to iodine itself , dietetic factors that interfere with iodine organification and thyroid hormone synthesis , such as cruciferous vegetables , could also affect thyroid cancer risk .
some industrialized food contaminants , for instance nitrates , can compete with iodine uptake by the thyroid and can behave as potential thyroid function disruptors and carcinogens .
nitrate is a frequent contaminant of drinking water in areas of intense agricultural industry and is found at high levels in some vegetables and processed food .
a high average nitrate level in water supplies is associated with an increased risk of thyroid cancer ( highest versus lowest quartile , rr = 2.9 [ 1.08.1 ] . in the last decades
, the population has been more exposed to environmental pollutants like asbestos , benzene , formaldehyde , pesticides , bisphenol a ( bpa ) , polychlorinated biphenyls ( pcb ) , and polyhalogenated aromatic hydrocarbons ( phahs ) , all compounds that may act as either genotoxic or nongenotoxic carcinogens .
particularly polybrominated diphenyl ethers ( pbdes ) may induce abnormal thyroid cell proliferation , favoring a precancerous state . at present , however , no causal correlation has been established between enviromental pollutants and thyroid cancer in humans .
out of 80,000 chemicals present in products on the us market , only a few hundred have been tested for carcinogenicity , and their possible combinations provide an indefinite number of potential carcinogens .
it is possible that some products have a specific carcinogenic effect on the thyroid , either directly or acting as endocrine disruptors .
we and others [ 52 , 82 , 83 ] observed that the volcanic environment may be associated with an increase in thyroid cancer incidence . in the mt .
etna volcanic area , where thyroid cancer incidence rate is more than doubled in respect to the rest of sicily , only the papillary histotype is increased and both micro- and macrocarcinomas are augmented , reflecting the worldwide pattern of thyroid cancer increase .
nonanthropogenic pollutants are increased in drinking water derived from the volcanic aquifer and in the urine of the local population , confirming the increased population exposure to the pollutants , mainly heavy metals ( r.v . , unpublished data ) .
a possible cause - effect relationship between these compounds and thyroid cancer is under study .
if this relationship is present , it may help to unravel some of the environmental factors that favor the worldwide increase of papillary thyroid cancer .
the cause is most likely multifactorial and the increased detection rate certainly represents part of the phenomenon , since small tumors are predominately increased . a true increase , however , is also likely as indicated by the increase also of large tumors , the exclusive increase of the papillary histotype only , and the differences in gender and age cohort increase .
also the lack of mortality decrease , in spite of earlier diagnosis and more efficacious treatment , supports the possibility that an increasing number thyroid cancers occurs at present . increased exposure to radiation is the most likely contributing factor but
although at present we have no solid evidence of a carcinogenic effect of diet and lifestyle changes and/or of environmental pollutants on the thyroid , the possibility that undiscovered environmental carcinogens might be responsible for an increased thyroid cancer incidence can not be excluded . in particular
, exposure to some chemicals during intrauterine life and early childhood , with possible epigenetic changes , might affect thyroid cell propension to mutagenesis .
further studies are warranted to investigate the potential carcinogens and their mechanism of action in order to introduce preventive measures and control the continuous increase of thyroid cancer . | background . in the last decades
, thyroid cancer incidence has continuously and sharply increased all over the world .
this review analyzes the possible reasons of this increase . summary .
many experts believe that the increased incidence of thyroid cancer is apparent , because of the increased detection of small cancers in the preclinical stage
. however , a true increase is also possible , as suggested by the observation that large tumors have also increased and gender differences and birth cohort effects are present .
moreover , thyroid cancer mortality , in spite of earlier diagnosis and better treatment , has not decreased but is rather increasing .
therefore , some environmental carcinogens in the industrialized lifestyle may have specifically affected the thyroid . among potential carcinogens ,
the increased exposure to medical radiations is the most likely risk factor .
other factors specific for the thyroid like increased iodine intake and increased prevalence of chronic autoimmune thyroiditis can not be excluded , while other factors like the increasing prevalence of obesity are not specific for the thyroid .
conclusions .
the increased incidence of thyroid cancer is most likely due to a combination of an apparent increase due to more sensitive diagnostic procedures and of a true increase , a possible consequence of increased population exposure to radiation and to other still unrecognized carcinogens . |
a 27-year - old pregnant g4p2 ( 28th gw ) , born in western africa but living in italy since 2012 , presented to the emergency department ( ed ) of our institution with headache , vomiting , diarrhea , and pelvic and low back pain .
she contracted malaria in 2007 in western africa , but did not mention this on admission .
ed laboratory tests were within the normal range , except for a slight increase in lactic dehydrogenase ( ldh ; 310 mg / dl ) and mild anemia ( hemoglobin [ hb ] ; 9.9 g / dl , table 1 ) .
she was admitted to the obstetric ward and prophylactic ceftriaxone ( 2 g / day ) was administered .
almost 24 h after admission , peak hyperthermia ( 39.4 ) was reached , with concomitant loss of consciousness .
she recovered in approximately 15 min ; residual aphasia and evident cognitive impairment improved slowly over a few hours .
no pathological abnormalities of the central nervous system were found during an urgent head computed tomography scan .
respiratory and hemodynamic parameters remained stable ( spo2 99% in room air , blood pressure [ bp ] = 135/70 mmhg , heart rate [ hr ] = 95 beats per minute [ bpm ] ) .
blood samples were drawn again ( table 1 ) and exhibited increased c - reactive protein ( crp ; 218.68 mg / l ) , bilirubin ( 2.95 mg / dl , direct = 1.18 mg / dl ) and ldh ( 466 mg / dl ) levels .
notably , hb decreased to 7.8 g / dl and malaria parasites were found on examination of the peripheral blood smear ( blood parasites , 7% )
. infectious disease ( i.d . ) specialist prescribed quinine ( 600 mg ) for 2 h ( bolus ) followed by 2 g in 24 h , plus clindamycin ( 600 mg ) every 8 h to achieve tight control of glycemia , bp and electrocardiography.because fetal parasitemia and hemolysis were strongly suspected , a cd was planned .
the patient 's general condition was stable ; no coagulation abnormalities were present and the platelet count was slightly lower than normal ( plt 98.000 /ml ) .
therefore , 1000 ml of lactated ringer 's solution and ranitidine ( 100 mg ) were administered intravenously . in a sitting position ,
spinal anesthesia was performed at the l3-l4 interspace . using a 25-gauge whitacre needle , hyperbaric bupivacaine 0.5% ( 10 mg ) with sufentanil ( 5 g )
the patient was left in a supine position with left uterine displacement ; the surgery was initiated when the anesthetic block reached the t4 level .
bp decreased slightly ( from 134/85 mmhg to 120/68 mmhg ) , then remained stable throughout surgery . at birth ,
the baby had slight respiratory depression ( apgar score of 8 at 1 and 5 min ) , and a bloodless umbilical cord on inspection .
her weight was 1.77 kg and she required immediate oxygen support with a nasal cannula for hypoxemia ( spo2 rapidly decreased to < 80% in room air after aspiration ) .
oxytocin ( 20 iu ) in 5% dextrose ( 500 ml at 125 ml / h ) was started immediately after birth .
postoperative analgesia was obtained with a patient - controlled analgesia pump that delivered 1 mg / h of morphine for 24 h , with boluses of 2 mg possible on patient request every hour .
plasmodium falciparum was identified only 4 days later by real - time polymerase chain reaction .
blood parasites decreased over time ( 1% in the final blood sample , after 5 days ) .
the patient 's antibiotic therapy continued and her symptoms were completely resolved two days after childbirth ; 24 h after birth , oxygen therapy for the baby was discontinued .
blood samples drawn from the baby and the umbilical cord revealed no parasites , nor any signs of fetal hemolysis .
among infectious diseases , malaria is most frequently imported into developed countries due to its wide diffusion in africa , india and southeast asia .
plasmodium falciparum is the most - common etiologic agent in africa ; p. vivax , ovale , malariae and knowlesi ( recently identified ) represent causes of infection in asia and other endemic regions .
infection is transmitted by the bite of female anopheline mosquitoes , which inoculates sporozoites that are taken up by hepatocytes ; maturation then occurs over 710 days to produce schizonts . during the next stage of development ,
merozoites are released into the blood , which invade red blood cells and mature into gametocytes or schizonts over a period of 2472 h ( depending on the species ) .
mature schizonts rupture erythrocytes and cause hemolysis and further release of merozoites into the bloodstream .
the characteristic clinical manifestations of disease are both caused by hemolysis : hyperpyrexia occurring every 4872 h and global organ hypoperfusion caused by adhesion of schizonts to the lining of small blood vessels and resulting occlusion of capillary beds . during their maturation cycle , p.vivax and ovale
also pass through a hypnozoite stage that allows the parasite to hide in hepatocytes for long periods before recrudescence .
the clinical manifestations of malaria can vary from no symptoms to mild - to - severe systemic involvement .
manifestations may include hematological compromise with anemia , thrombocytopenia , coagulopathy with possible disseminated intravascular coagulation ( in the worst cases ) , shock , respiratory insufficiency that frequently requires supportive therapies in intensive care , neurological involvement , ranging from mild cognitive impairment to coma ; acute kidney injury , and hypoglycemic crisis .
in africa , 25% of pregnant women experience malarial infection in regions of stable transmission , compared to 13.7% of pregnancies in areas of low transmission .
pregnancy increases susceptibility to severe infection and complications ( such as anemia , hypoglycemia , and pulmonary edema ) because of pregnancy - associated alterations in acquired immune responses and the tendency of falciparum species to become sequestered in the placenta . therefore , death rates from severe malaria in pregnancy are two- to ten - fold higher compared to the non - pregnant population ; moreover , malaria doubles the risk of low birth weight and stillbirth .
furthermore , the risk of transplacental transmission of the parasite is not negligible : in one study , more than half ( 57% ) of women with peripheral parasitemia had placental malaria , 3.8% of whom had parasites in their umbilical cord blood .
the main risk factor for malaria transmission is the severity of infection at the time of delivery ( high - density peripheral and placental parasitemia ) .
if fetal transmission occurs , the baby has a higher risk of anemia with congenital malaria , as seen in 833% of births . in our case ,
i.d . specialist consulted after the patient 's hyperpyrexia and loss of consciousness suspected malaria , so peripheral blood film was screened for parasites , even though the patient had not recently traveled to endemic areas .
the literature contains no information concerning possible plasmodium falciparum infection relapse in non - endemic areas ; therefore , we speculate that increasing estrogen and progesterone concentrations , commensurate with advances in pregnancy , decrease the mother 's immunity by reducing natural killer t - cell activity , and possibly also b - cell activity , thus causing a relapse of dormant plasmodium . in our case
, although it is unlikely that plasmodium falciparum reactivation occurred more than two years after possible contact with the parasite , a clear diagnosis of malaria was possible because parasites were identified in the peripheral blood smear .
the infection responded to antimalarial therapy ; after the first episode of neurologic impairment , our patient showed no signs of cerebral malaria .
her bp and breathing were stable throughout the cd , while the platelet count was slightly lower than normal ( plt 98.000 /ml ) .
though few studies have evaluated neuraxial anesthesia in parturients with malaria , we selected spinal anesthesia for the cd due to the absence of significant thrombocytopenia , coagulopathy , secondary bacterial sepsis , or cerebral malaria with raised intracranial pressure ( icp ) . in two other recent cases , cd was performed under general anesthesia due to severe systemic sepsis , which required a subsequent admission to the intensive care unit for mechanical ventilation due to respiratory failure or multiorgan failure caused by leptospira co - infection . in our case , the mother 's parasitemia was severe ( 7% ) , but there was no worsening of her general condition after the loss of consciousness episode .
accordingly , after initial support with an oxygen cannula , the baby was weaned rapidly ; her general condition was stable , with no malarial parasites identified in peripheral blood smears . in conclusion ,
fortunately , transplacental transmission is uncommon , but the baby may suffer due to anemia in the mother , with low birth weight or stillbirth occurring in the worst scenarios . it remains unclear whether pregnancy itself can stimulate an infection relapse in people from endemic areas .
however , in the absence of signs of sepsis , coagulation abnormalities or raised icp , spinal anesthesia can be used as an alternative to general anesthesia . | malaria is associated with high rates of morbidity and mortality worldwide , particularly in africa , southeast asia and south america .
nonetheless , several cases of malaria have been reported in western countries involving travelers from endemic areas , though very few involve pregnant women . in this article
, we report a case of a young woman born in sierra leone who had been living in italy for two years .
she was admitted to our hospital with malaise ; worsening of her condition led to plasmodium falciparum infection diagnosis early during her hospital stay , as well as an urgent cesarean delivery .
we briefly discuss the features of malaria in pregnancy , the difficulties associated with early diagnosis , and the possible fetal and maternal implications , and also consider how the disease may affect anesthetic management . |
a common characteristic of these enzymes is that they are normally tightly regulated in unstimulated cells .
stimulation ( e.g. , by binding of a growth factor to the extracellular domain of a receptor tyrosine kinase ) leads to a rapid , transient increase in tyrosine kinase activity .
most oncogenic tyrosine kinases contain activating mutations and are dominant at the cellular level [ 2 , 3 ] .
the human insulin - like growth factor 1 receptor ( igf1r ) is a heterotetramer containing two extracellular alpha subunits and two transmembrane beta subunits .
binding of the ligand ( igf1 ) to the alpha subunits triggers a conformational change that leads to autophosphorylation of the intracellular kinase domains in the beta subunits .
the signal is propagated through the pi 3-kinase and map kinase pathways to promote proliferation and cell survival . in the unstimulated state ,
the basal activity of the igf1r receptor is suppressed by autoinhibitory interactions between the activation loop and other residues in the kinase domain [ 68 ] and between the kinase domain and the juxtamembrane region .
studies in cell culture systems have shown that overexpression of igf1r can lead to morphological transformation , while interference with igf1r reverses the transformed phenotype .
igf1r is overexpressed in numerous solid tumors as well as in multiple myeloma [ 11 , 12 ] .
the cell survival function of igf1r appears to be critical in these tumors , as inhibition of igf1r can induce apoptosis .
a number of therapeutic approaches are currently being explored to interfere with igf1r signaling in cancer cells , including rna interference , receptor antibodies , and small molecule kinase inhibitors [ 11 , 12 ] .
increased transcription of the igf1r gene has been shown to result from loss of tumor suppressor genes , such as , p53 or from the action of other oncogenes .
loss of imprinting ( loi ) of igf2 is an epigenetic alteration found in many colorectal and other tumors . to date , no activating igf1r mutations have been identified in cancers .
recent gene sequencing efforts have catalogued hundreds of somatic mutations in the coding regions of potential cancer genes .
these mutations comprise both driver mutations ( which confer a growth advantage and are causally connected to the development of cancer ) and passenger
mutations , which do not contribute to the development of cancer . screening for somatic mutations in kinase genes identified two mutations in the gene encoding igf1r that led to aminoacid changes
: a1347v ( from lung squamous cell carcinoma ) and an in - frame deletion of s1278 ( from renal clear cell carcinoma ) .
the effect of these mutations , if any , on the biological function of igf1r has not been tested .
m1255 falls in the c - terminal lobe of the tyrosine kinase catalytic domain , while s1278 and a1347 lie in the c - terminal portion of the receptor .
we report the effects of the mutations on the in vitro biochemical activity of igf1r , as well as on the major igf1r signaling pathways in mammalian cells .
mutant forms of igf1r were generated by site - directed mutagenesis ( quikchange kit , stratagene ) on the expression vector pbpv - igf1r .
one million r - cells were plated onto 10 cm tissue culture dishes and grown to 50% confluency in dmem plus 4500 mg / l glucose ( fisher / cellgro ) , 10% heat inactivated fetal bovine serum ( vwr ) , 1x antibiotic / antimycotic ( fisher / cellgro ) and 50 ug / ml g418 ( sigma ) .
r - cells were transfected with the pbpv - igf1r constructs using transit polyamine transfection reagent ( mirus ) according to the manufacturer 's instructions . after 24 hours , the transfection mixture was replaced with starvation media containing dmem , 1000 mg / l glucose ( invitrogen ) , 1x antibiotic / antimycotic ( fisher / cellgro ) , 0.5% bsa , 50 ug / ml g418 , and 50 ug / ml holotransferrin ( sigma ) .
after 16 hours of starvation at 37c and 5% co2 , the cells were stimulated for 10 minutes at 37c with 40 ng / ml igf1 ( calbiochem ) .
the cells were washed with 4c pbs ( sigma ) and lysed in 1 ml of lysis buffer containing 25 mm tris - hcl ( ph 8) , 2 mm edta , 140 mm nacl , 1% np40 , 0.5 ug / ml leupeptin , 0.5 ug / ml aprotinin , and 2 mm activated sodium orthovanadate . after clearing the lysates by centrifugation , 2 g of anti - igf1r antibody ( clone jbw902 , millipore ) was added to the lysates for 1 hour at 4c , followed by the addition of 60 l protein - a - conjugated agarose beads ( sigma ) .
the precipitated proteins were analyzed on 10% sds polyacrylamide gels and transferred to pvdf membranes ( millipore ) .
the blots were probed with anti igf1r antibody ( millipore ) , then stripped and reprobed with anti - igf1r ( pypy1135/1136 ) ( biosource ) .
the blots were visualized using the supersignal west femto maximum sensitivity substrate system ( pierce ) .
densitometry and analysis were performed using imagej version 1.42 and prism version 4 . in a separate set of experiments ,
the irs-1 receptor was immunoprecipitated in a similar manner using anti irs-1 ( millipore ) .
cells were stimulated with 10 ng / ml igf1 ( the lower concentration was used to eliminate any contribution from insulin receptor ) .
the blots were probed with antiphosphotyrosine ( 4g10 ) antibody . to analyze akt and map kinase activation , 50 ug of lysates
was analyzed on 10% sds polyacrylamide gels , transferred to pvdf membranes and probed with antiphospho - akt and antiphospho - map kinase antibodies .
membranes were stripped and reprobed with akt and map kinase antibodies for normalization ( cell signaling ) . to analyze the association of igf1r and rack1 , lysates ( 2 mg )
were immunoprecipitated with 4 g of anti igf1r c20 antibody ( santa cruz ) and 60 l protein - a - conjugated agarose beads .
after analysis on 10% sds polyacrylamide gels and transfer to pvdf membranes , the blots were probed with anti rack1 ( bd transduction ) and anti igf1r ( clone jbw902 ) antibodies .
dna sequences encoding igf1r residues 9301337 ( the complete cytoplasmic domain of igf1r ) had previously been subcloned into pfastbac htb ( life technologies , inc . ) .
site directed mutagenesis was performed to generate the m1255i , s1278 , and a1347v mutants . after confirming the mutations by dna sequencing , recombinant virus
was generated using the bac - to - bac system ( life technologies , inc . ) .
the virus was then used to produce protein by infection of spodoptera frugiperda ( sf9 ) cells .
one billion sf9 cells were infected with high - titer virus and harvested after 72 hours .
the cells were lysed in a french pressure cell in lysis buffer containing 50 mm tris - hcl ( ph 8.5 ) , 5 mm edta , 1% triton - x 100 , 5 mm 2-mercaptoethanol , 0.5 ug / ml aprotinin , 0.5 ug / ml leupeptin , 2 mm pmsf , and 2 mm activated sodium orthovanadate .
the clarified lysate was loaded onto a 5 ml column of ni - nta resin ( qiagen ) which had been preequilibrated with buffer a ( 20 mm tris - hcl ph 8.5 , 500 mm kcl , 10% glycerol ) .
imidazole ( 20 mm ) and 2-mercaptoethanol ( 5 mm ) were added to buffer a after the column had been equilibrated .
the column was washed with 10 column volumes of buffer a containing imidazole ( 20 mm ) and 2-mercaptoethanol ( 5 mm ) , followed by 2 column volumes of buffer b ( 20 mm tris - hcl ph 8.5 , 1 m kcl , 5 mm 2-mercaptoethanol , 10% glycerol ) , then 10 column volumes of buffer a. the igf1r cytoplasmic domain was eluted with buffer c ( 20 mm tris - hcl ph 8.5 , 100 mm kcl , 100 mm imidazole , 5 mm 2-mercaptoethanol , 10% glycerol ) .
the fractions were analyzed on 10% sds - polyacrylamide gels , and the peak fractions were pooled and stored in aliquots at 80c in 40% glycerol .
the experiments were performed at 30c in buffer containing 100 mm tris - hcl ( ph 7.5 ) , 10 mm mgcl2 , 1.5 mm phosphoenolpyruvate , 201 u / ml pyruvate kinase , 230 u / ml lactate dehydrogenase , and 0.5 mm nadh .
the concentration of the enzyme was 2 m and the concentration of atp was 1 mm .
for peptide phosphorylation experiments , the enzymes were prephosphorylated by incubation with 5 mm atp for 15 minutes at room temperature prior to the assays .
the final concentration of the enzymes in these assays was 800 nm , the concentration of the atp was 1 mm , and the concentration of the peptide was 1 mm .
we expressed full - length igf1r harboring the m1255i , s1278 , or a1347v mutations in fibroblasts derived from igf1r - deficient mice ( r - cells ) . for comparison
as an initial check of the activity of the receptors , we measured autophosphorylation at y1135/y1136 .
tris - phosphorylation of igf1r at y1131/y1135/y1136 in the activation loop produces a large increase in kinase activity .
we immunoprecipitated igf1r from the r - cells , separated proteins by sds - page and analyzed them by western blotting with a phospho - specific antibody to py1135/py1136 ( figure 1 ) .
membranes were stripped and reprobed with an anti - igf1r antibody ; normalization of the py1135/py1136 signal with respect to total igf1r revealed no significant change in levels of autophosphorylation .
thus , the mutations did not drastically affect the intrinsic tyrosine kinase activity of igf1r .
we previously reported the expression and purification of the entire cytoplasmic portion of igf1r ( i.e. , juxtamembrane , kinase , and c - terminal domains ) from insect cells using a baculovirus expression vector .
we generated recombinant baculoviruses encoding the m1255i , s1278 , and a1347v mutant forms of igf1r .
we infected spodoptera frugiperda cells with mutant or wild - type igf1r baculoviruses , harvested cells after three days of infection , and purified the proteins ( supplemental figure 1 ) supplementary materials are available online at doi:10.1155/2012/804801 .
all forms of igf1r tested were active in the in vitro autophosphorylation assay ( figure 2 ) .
as observed previously for wild - type igf1r , the enzyme progress curves were biphasic , due to the fact that autophosphorylation increases the enzymatic rate .
the rates of wild - type and a1347v igf1r were comparable , while the rates of the s1278 and m1255i mutant forms were somewhat slower .
next , we examined the ability of the purified receptors to phosphorylate an exogenous substrate . in these experiments
, we used a synthetic peptide substrate previously shown to be phosphorylated by igf1r with good kinetic parameters [ 6 , 20 ] . to eliminate the effect of autophosphorylation
, we first prephosphorylated the proteins by treatment with atp [ 9 , 21 ] .
the wild - type and mutant forms of igf1r were all active in this assay ( figure 3 ) .
the m1255i mutation , which occurs toward the c - terminal end of the kinase catalytic domain , showed a small reduction in peptide phosphorylation . taken together , the receptor phosphorylation assays ( figure 1 ) and the autophosphorylation and peptide phosphorylation assays ( figures 2 and 3 ) showed that the mutant kinase domains were active but were not hyperactivated relative to wild type .
the insulin receptor substrate ( irs ) family adaptor proteins are important proximal substrates for the activated insulin and igf1 receptors [ 22 , 23 ] .
irs-1 contains n - terminal ph and ptb domains which play important roles in directing the adaptor protein to ir / igf1r .
these phosphorylated sequences provide binding sites for grb2 , phosphoinositide 3-kinase , nck , shp2 , and other cellular signaling proteins containing sh2 domains .
we expressed wild - type and mutant forms of igf1r in r - cells and analyzed the overall tyrosine phosphorylation of endogenous irs-1 by immunoprecipitation and western blotting with anti - ptyr antibodies .
these results showed that the mutant forms of igf1r were capable of phosphorylating irs-1 ( figure 4 ) .
after transfection with igf1r expression plasmids , r - cells were serum starved , then stimulated with igf1 or left unstimulated .
we measured akt activation in cell lysates using an activation state - specific antibody ( figure 5 ) .
figure 5 shows a representative western blot , along with a bar graph depicting a summary of all the experiments .
akt activation in the presence of igf1 was similar for the various forms of igf1r tested ( figure 5 ) .
the basal , unstimulated levels of akt activity were 1.52-fold higher for the s1278 , a1347v , and m1255i forms of igf1r , and the fold increases ( stimulated / unstimulated ) were consequently lower .
as an attempt to gain insight into the basis for increased levels of phospho - akt in the absence of igf1 , we analyzed the association between igf1r and the rack1 adaptor protein .
the association between igf1r and rack1 is independent of receptor activation , but a ser - to - ala mutation at s1278 of igf1r was reported to block rack1 binding . because one of the cancer - associated mutations involved the same residue ( s1278 ) , we measured the coimmunoprecipitation of endogenous rack1 with wild - type and mutant forms of igf1r in r - minus cells .
association with rack1 was unaffected by the s1278 and other mutations ( figure 6 ) .
next , we carried out similar experiments to measure activation of map kinase in r - cells expressing wild - type or mutant forms of igf1r .
mapk activity was measured by western blotting with a phosphospecific antibody , and total mapk levels were assessed by reprobing with a mapk antibody . as expected , igf1 stimulation led to an increase in map kinase activation in r - cells expressing wild - type igf1r . hormone stimulation of r - cells expressing mutant forms of igf1r led to levels of map kinase activation that were not significantly different from wild type . on the other hand , the basal ( unstimulated )
levels of map kinase activation were 2.5 - 3-fold higher for the mutants that for wild type ( figure 7 ) .
thus , the fold increases ( stimulated / unstimulated ) for the m1255i , s1278 , and a1347v mutants were 2.1 , 2.0 , and 2.8 , respectively , compared to 4.8 for wild type .
these results , and the similar findings for akt signaling ( figure 5 ) , suggest that the regulatory interactions that normally keep igf1r activity in check were partially disrupted in the case of the cancer - associated mutants .
for several receptor tyrosine kinases , biochemical and structural studies have implicated the c - terminal portion of the cytoplasmic domain of several rtks in kinase signaling .
the deletion of the c - terminal residues of erbb2 increased receptor kinase activity as well as transforming ability . a peptide containing the c - terminus of pdgfr receptor inhibited its kinase activity .
the crystal structure of the tie2 rtk has been solved with an intact c - terminal tail .
the tie2 c - terminal tail interacts with the c - lobe of the kinase catalytic domain and ends near the substrate binding site .
deletion of the tie2 c - terminal tail increased receptor autophosphorylation and kinase activity , lending support to a model in which the tail is involved in kinase regulation .
current evidence suggests that the c - termini of ir and igf1r do not play a direct role in controlling the activation kinetics of the catalytic domains [ 30 , 31 ] . on the other hand ,
a chimeric igf1r containing the c - terminal domain of ir was more potent in stimulating glycogen synthesis than wild - type igf1r , suggesting that biological specificity resides ( at least in part ) in the c - terminus .
this idea has been reinforced by studies demonstrating differential binding and phosphorylation of cellular proteins mediated by the c - termini of igf1r and ir .
ceacam1 is an example of a protein that binds specifically to the c - terminus of ir , 14 - 3 - 3 proteins and iip-1 bind selectively to the igf1r c - terminus [ 34 , 35 ] , and rack1 interacts with both c - termini .
protein - protein interactions mediated by the c - terminus play a role in downstream igf1r signaling . in particular , deletion of the igf1r c - terminus increased the ability of the receptor to promote cell survival , suggesting that the c - terminus has a negative regulatory role .
consistent with this idea , tumor cell apoptosis was increased by stable expression of a myristoylated igf1r c - terminus or by introduction of a synthetic 17-aminoacid peptide from the c - terminus .
point mutations in the igf1r c - terminus inhibit cell survival and anchorage - independent growth , while deletion of the c - terminus blocks receptor ubiquitination .
two of the cancer - associated igf1r mutations studied in this paper ( s1278 and a1347v ) fall in the c - terminus and one ( m1255i ) is in the c - terminal lobe of the catalytic domain .
consistent with prior mutational analyses of the igf1r c - terminus , the cancer - associated mutations did not significantly affect full - length receptor autophosphorylation in cells ( figure 1 ) .
similarly , the purified cytoplasmic domains retained their autophosphorylation activity in vitro and their ability to phosphorylate exogenous peptide substrates ( figures 2 and 3 ) .
phosphorylation of the receptor - proximal substrate irs-1 also appeared to be unaffected by the mutations ( figure 4 ) . for comparison ,
a mutagenic analysis of the igf1r / ir juxtamembrane regions showed that these residues exert direct negative control over receptor phosphorylation and activity .
because previous studies suggested both positive and negative roles of the igf1r c - terminus in cell signaling , it was not clear what the predicted effects of the cancer - associated mutations would be . while the mutant forms of igf1r showed no difference from wild - type with respect to the maximal levels of map kinase and akt activation , basal levels of activity were higher ( figures 5 and 7 ) .
these results are consistent with a model in which the igf1r c - terminus plays an inhibitory role in signal transduction , and the mutations partially destabilize the inhibited conformation , leading to enhanced activity .
although the effects observed were modest , these mutations represent the first activating mutations of igf1r identified in human cancers .
the mutations studied here do not fall within the sequence ( 13121328 ) included in the inhibitory synthetic peptide which was previously shown to promote tumor cell apoptosis .
the alterations in map kinase and akt signaling are likely due to changes in protein - protein interactions with the igf1r c - terminus . in principle
, the mutations might increase binding of a positive mediator of igf1r signaling or block binding of an inhibitory protein factor .
rack1 binding requires s1278 in the igf1r c - terminus , since a ser - to - ala mutation eliminates binding .
although one of the cancer - associated mutations is a deletion of this same residue , rack1 binding was unaffected in our experiments .
future experiments will be aimed at identifying igf1r - interacting partners that are altered in the cancer - associated variants . | the insulin - like growth factor i receptor ( igf1r ) is overexpressed in several forms of human cancer , and it has emerged as an important target for anticancer drug design .
cancer genome sequencing efforts have recently identified three somatic mutations in igf1r : a1374v , a deletion of s1278 in the c - terminal tail region of the receptor , and m1255i in the c - terminal lobe of the kinase catalytic domain .
the possible effects of these mutations on igf1r activity and biological function have not previously been tested . here , we tested the effects of the mutations on the in vitro biochemical activity of igf1r and on major igf1r signaling pathways in mammalian cells .
while the mutations do not affect the intrinsic tyrosine kinase activity of the receptor , we demonstrate that the basal ( unstimulated ) levels of map kinase and akt activation are increased in the mutants ( relative to wild - type igf1r ) .
we hypothesize that the enhanced signaling potential of these mutants is due to changes in protein - protein interactions between the igf1r c - terminus and cellular substrates or modulators . |
at present , tuberculosis ( tb ) remains to be one of the world 's most serious health concerns . in 2014 , the who reported 9 million new tb cases and about 1.5 million deaths .
the increasing incidence of infection with antibiotic - resistant strains of mycobacterium tuberculosis is an alarming trend of recent years [ 13 ] .
this is indicated by an increasing incidence of acutely progressing forms of drug - resistant tb with severe clinical manifestations and a widespread occurrence of the pathological process in the organism [ 24 ] . in 2014 , 480,000 new cases of with multiple drug resistance were diagnosed , of which only 48% recovered . at present , there is the only anti - tb vaccine called the bacillus calmette - gurin ( bcg ) prepared from an attenuated live strain of m. bovis , a pathogen in cattle .
the bcg vaccine is considered to be only effective against disseminated forms of tb in children , but why it does not protect adults against pulmonary tb is not yet known [ 5 , 6 ] .
pulmonary macrophages entrap mycobacteria by phagocytosis and destroy them in phagolysosomes using active forms of oxygen and nitrogen , lysosomal hydrolases , and toxic peptides in a low - ph medium .
the proinflammatory cytokines ifn , il-1 , and gm - csf secreted by activated cells of different types exert regulation on immune processes and inflammation in response to invasion by pathogens , controlling the development of infection in the organism by enhancing the microbicidal activity of the cells of the immune system [ 4 , 6 ] .
the uncontrollable replication of mycobacteria in the human organism normally results in acute tb ; however , activation of the innate and adaptive immune responses in the human organism most often leads to latent , asymptomatic infection . according to the who , one - third of the world 's population is a latent carrier of m. tuberculosis in chronic granulomatous inflammatory lesions largely composed of macrophages [ 2 , 5 , 6 ] .
low bcg - mycobacterial loads in animal organs and tissues at different time points of chronic infection had previously been established by bacteriological methods in a model of latent tuberculous infection under which mice were infected with bcg - mycobacteria in vivo [ 710 ] .
using our original model of mouse granulomas in ex vivo culture , we have , for the first time , determined the bacterial load in macrophages , dendritic cells , and multinucleate langhans giant cells in separate granulomas obtained from mice with latent tuberculous infection after in vivo exposure to bcg vaccine [ 11 , 12 ] .
in some host cells , not only did bcg - mycobacteria survive , but also they were actively reproducing and formed cording colonies , cording being the indication of their virulence .
interestingly , there was a difference in behavior between mycobacteria of virulent and nonvirulent strains in in vitro cultures of infected human , mouse , and cow cells [ 1318 ] .
mycobacteria of virulent strains were actively reproducing in cells infected in vitro , while attenuated mycobacteria of the bcg vaccine and m. tuberculosis of nonvirulent strains were basically found in vacuoles before they were destroyed there within 27 days of observation in vitro .
however , there are very few comparative studies of relationships between mycobacteria of different strains and host cells in animals infected in vivo or following acute infection in vitro [ 19 , 20 ] . and very few are the studies researching relationships between bcg - mycobacteria and host cells [ 11 , 12 , 19 , 21 ] .
as is known , bcg vaccines can occasionally cause severe disease in children with inborn errors of immunity often referred to as bcg - osis [ 22 , 23 ] .
importantly , clinical observations of bcg infection ( including bcg adenitis ) in aids patients after as many as 30 years following bcg vaccination are still being discussed .
therefore , understanding relationships between bcg - mycobacteria and host cells both after infection in vivo and after acute infection in vitro is important for studying the development of bcg - induced anti - tb immunity , developing better bcg - based vaccines [ 5 , 6 ] , and testing vaccine candidates in animal models , including mouse models of tuberculous and nontuberculous mycobacterial infections [ 24 , 25 ] . in the present work
, we conducted a comparative study of the mycobacterial loads in granuloma cells from the bone marrow and spleens of mice with latent tuberculous infection following infection with bcg in vivo and several days of ex vivo culture and in the cultures of bone marrow cells and peritoneal macrophages obtained from intact mice and infected with bcg in vitro . as a result
, we observed a considerable increase in the number of mycobacteria in the macrophages of bone marrow cell cultures and peritoneal macrophages within 120 h following bcg infection in vitro and the death of cells having increased bcg loads . throughout 48120 h of ex vivo culture ,
mouse granuloma macrophages each basically remained to contain a single bcg organism , and increased numbers of such microorganisms in some macrophages did not cause the host cells to die .
analysis of the levels of the proinflammatory cytokines ifn and il-1 , the growth factor gm - csf , and various cell - surface markers in bcg - containing macrophages in ex vivo and in vitro cultures suggested that although the active production of these molecules in mouse granuloma cells did not help in eliminating all mycobacteria in the host cells , it helped in restricting mycobacterial reproduction in granuloma macrophages .
by contrast , a considerable increase in the number of bcg - mycobacteria was observed in those in vitro infected mouse bone marrow and peritoneal macrophages , whether alive or dead by apoptosis / necrosis , in which no active synthesis of these markers was going on .
two - month - old balb / c male mice were obtained from the animal breeding facility of the institute of cytology and genetics of the siberian branch of the russian academy of sciences ( novosibirsk , russia ) .
mice were bred and maintained under standard vivarium conditions , with water and food provided ad libitum .
animal experiments were conducted in accordance with the guidelines for manipulations with experimental animals issued by the russian ministry of health ( guideline 755 ) .
all experimental procedures were approved by the local ethical committee of the research institute of biochemistry ( novosibirsk , russia ) .
mice were infected with a vaccine prepared from an attenuated live strain of m. bovis ( the bacillus calmette - gurin vaccine , bcg-1 , the institute of microbiology and epidemiology , moscow , russia ) at a dose of 0.5 mg per mouse , which amounted to 3 10 viable bcg - mycobacteria in 0.9% nacl solution .
twenty - four mice were each infected via tail vein injection with 100 l of the suspension and four mice were each infected intraperitoneally with 200 l of the suspension .
isolation of granulomas from the spleens and bone marrow of mice after 20 days , one month , and two months following infection was performed as previously described [ 11 , 12 ] .
the spleens collected from the animals were cut into small pieces in 5 ml of rpmi 1640 medium with 50 g / ml gentamicin .
granulomas were isolated from the organ homogenates by centrifugation at 150 g at room temperature .
granulomas were washed three times in 10 ml of rpmi 1640 medium with 50 g / ml gentamicin by centrifugation .
the granuloma pellets were resuspended in the complete rpmi 1640 growth medium containing 10% heat - inactivated fetal bovine serum ( fbs ) , 2 mm glutamine , and 50 g / ml gentamicin ( biolot , st .
petersburg , russia ) , placed at low - medium density to 24-well tissue culture plates ( orange scientific , belgium ) with glass coverslips at the bottom and cultured in 0.5 ml medium for several days at + 37c in an atmosphere containing 5% co2 .
granulomas were isolated from mice 1 and 2 on day 20 following intraperitoneal infection ; from mice 1 and 2 5 after one month following intraperitoneal and intravenous infection , respectively ; from mice 1 16 and 21 24 after two months following intravenous infection ; and from mouse 25 after two months following intraperitoneal infection .
peritoneal macrophages were isolated from mice 1 and 2 after 20 days and mouse 25 after two months following intraperitoneal infection and cultured under the same conditions as the granuloma cells .
after isolation of granulomas from the bones of mice 1 and 2 after 20 days following infection , the other bone marrow cells from supernatants were cultured under the same conditions as the granuloma cells .
peritoneal and bone marrow cells were isolated from four intact mice and used as separate mixtures of each cell culture .
peritoneal cells were isolated from peritoneal cavities in 7 ml of the complete rpmi 1640 growth medium .
bone marrow was flushed out with 5 ml of rpmi 1640 medium containing 10% heat - inactivated fbs , 2 mm glutamine , and 50 g / ml gentamicin using a 22-gauge needle .
peritoneal macrophages and bone marrow cells ( 3 10 mononuclear cells / well ) were placed in 24-well tissue culture plates with glass coverslips at the bottom and cultured without stimulation in 0.5 ml of the complete growth medium for 24 h under the same conditions as the granuloma cells .
after removal of growth medium with nonadherent cells , the monolayer cultures of bone marrow and peritoneal cells were washed twice with rpmi 1640 medium to prepare them for infection .
dry bcg vaccine was diluted in rpmi 1640 medium , passed several times through a 26-gauge needle to obtain stand - alone bacterial cells , and was added to the cells in some of the plate wells in the amount of 0.04 mg / well ( 2.4 10 mycobacteria / well ) in 200 l of the complete growth medium without antibiotics and incubated for 1 h at + 37c in an atmosphere containing 5% co2 .
the cells were further washed twice with rpmi 1640 medium to remove extracellular bacteria and were cultured for various time periods under the same conditions as the granuloma cells . at hour 4 following bcg infection , more than 97% of peritoneal cells were found to be macrophages . at that time point , bone marrow cells were found to be precursor cells of different size , neutrophils , lymphocytes , and a few megakaryocytes . at hour 24 following bcg infection , the precursor cells differentiated into bone marrow macrophages both in the control ( uninfected ) cultures and in cell monolayers after 24 h of acute bcg infection in vitro . on day 3 after isolation of bone marrow cells , macrophages and some fibroblasts with only a few neutrophils were observed in these cultures .
all macrophages in the cell cultures were cd14-positive after immunofluorescent staining for the cd marker ( bd biosciences , usa , 557896 , data not shown ) .
the control fibroblasts were obtained through spontaneous cell migration from fragments of the splenic capsule from intact mice in the wells of 24-well plates with cover glasses at the bottom with a minimal amount of complete growth medium at + 37c in an atmosphere containing 5% co2 . after removing tissue fragments ,
the migrant fibroblasts on the cover glasses were further cultured for an optimal density in 0.5 ml medium for several weeks .
three independent experiments on obtaining and studying fibroblasts , cells in the mouse bone marrow and peritoneal cultures have been conducted . at hours 48120 of ex vivo culture , granuloma cells on coverslips
were fixed with 4% formaldehyde solution in phosphate - buffered saline ( pbs , ph 7.4 ) for 10 minutes at room temperature .
the same procedure was applied to cells in bone marrow cell cultures and peritoneal macrophage cultures at hours 4 , 24 , 48 , 72 , 96 , and 120 following infection with bcg in vitro and in control cell cultures . to visualize acid - fast mycobacteria within host cells and analyze their intracellular reproduction ,
the preparations were washed with pbs and stained by the ziehl - neelsen method , mycobacteria were counted under a microscope , and their mean number per macrophage was determined .
the cells stained by the ziehl - neelsen method were further counterstained with 1% methylene blue .
the antibodies and reagents used for immunocytochemical and immunofluorescent staining were as follows : rabbit polyclonal primary antibodies to mycobacteria ( abcam , england , ab20832 ) diluted 1 : 200 ; rat monoclonal primary antibodies to mouse cd1d , cd25 , cd31 , cd35 , cd86 , gm - csf , ifn , and cd11b ( bd biosciences , usa , 553843 , 550529 , 550274 , 553816 , 560582 , 554404 , 559065 , and ebioscience , usa , 17 - 0112 , resp . ) diluted 1 : 50 , 1 : 25 , 1 : 50 , 1 : 50 , 1 : 100 , 1 : 25 , 1 : 100 , and 1 : 250 , respectively ; hamster monoclonal primary antibodies to mouse cd80 and il-1 ( bd biosciences , usa , 560526 and 550604 , resp . ) diluted 1 : 100 and 1 : 50 , respectively ; rabbit polyclonal primary antibodies to mouse fibronectin , vimentin , type i collagen ( abcam , england , ab23750 , ab45939 , millipore , usa , ab765 , resp . ) diluted 1 : 500 , 1 : 100 , and 1 : 500 , respectively , and to s100 proteins ( courtesy of s. m. sviridov of the institute of cytology and genetics , novosibirsk , russia ) diluted 1 : 50 ; biotin - conjugated goat polyclonal secondary antibodies to rat igg ( bd biosciences , usa , 559286 ) diluted 1 : 50 and to rabbit igg ( sigma , usa , b7389 ) diluted 1 : 100 ; mouse monoclonal biotin - conjugated secondary antibodies to hamster igg ( bd biosciences , usa , 550335 ) diluted 1 : 50 ; fitc - labeled goat anti - rat igg polyclonal secondary antibody ( abcam , england , ab6266 ) diluted 1 : 400 ; goat alexa 488-conjugated anti - rabbit igg secondary antibody ( invitrogen , usa , a11034 ) diluted 1 : 400 ; horseradish peroxidase - conjugated streptavidin ( sigma , usa , s5512 ) ; diaminobenzidine ( sigma , usa , d3939 ) ; cy3-conjugated streptavidin ( sigma , usa , s6402 ) diluted 1 : 100 ; tritc - labeled phalloidin to stain filamentous actin ( sigma , usa , p1951 ) diluted 1 : 100 ; and the acidotropic lysotracker dye red dnd-99 ( invitrogen , usa , l7528 ) .
in the experiments using lysotracker red dnd-99 , the cell preparations were incubated with 50 nm of the acidotropic dye for 5 minutes at + 37c in 5% co2 before fixation .
the cell preparations were fixed as described above , washed with pbs , permeabilized for 2 minutes with 0.3% triton - x100 solution , blocked in pbs containing 2% bsa , and finally incubated first with rabbit polyclonal primary antibodies to mycobacteria and then with alexa 488-conjugated goat polyclonal secondary antibodies to rabbit igg .
some of the fixed cell preparations were washed with pbs , blocked in pbs solution containing 2% bsa , and incubated first with rat monoclonal primary antibodies to mouse cd1d , cd25 , cd31 , and cd35 , then with biotin - conjugated goat polyclonal secondary antibody to rat igg , and finally with horseradish peroxidase - conjugated streptavidin in diaminobenzidine solution containing 0.05% h2o2 .
some of the fixed cell preparations were washed with pbs , treated for 2 minutes with 0.3% triton - x100 solution , blocked in pbs solution containing 2% bsa , and incubated with rat monoclonal primary antibodies to mouse ifn or rabbit polyclonal primary antibodies to mouse fibronectin , type i collagen , and s100 proteins .
the cell preparations were further incubated with goat polyclonal biotin - conjugated secondary antibodies to rat igg or rabbit igg .
specific staining of the cell preparations was visualized using horseradish peroxidase - conjugated streptavidin in diaminobenzidine solution containing 0.05% h2o2 .
some of the fixed cell preparations were washed with pbs , blocked in pbs solution containing 2% bsa , and incubated with apc - conjugated rat monoclonal primary antibodies to mouse cd11b . after staining for cd
, the cell preparations were washed with pbs , treated for 2 minutes with 0.3% triton - x100 solution , and incubated with rabbit polyclonal primary antibodies to mouse vimentin , fibronectin , type i collagen , or s100 proteins . fluorescent visualization of the proteins
some of the fixed cell preparations were washed with pbs , blocked in pbs solution containing 2% bsa , and incubated with rat monoclonal primary antibodies to mouse cd31 , gm - csf , or ifn. fluorescent visualization of the proteins was achieved using fitc - labeled goat anti - rat igg polyclonal secondary antibody .
after visualization , the cell preparations were washed with pbs and incubated with rat monoclonal primary antibodies to mouse cd86 , cd35 , and cd11b , respectively .
the antibodies against cd86 , cd35 , and cd11b were labeled with pe - cy7 , biotin , and apc , respectively .
some of the fixed cell preparations were washed with pbs , treated for 2 minutes with 0.3% triton - x100 solution , blocked in pbs solution containing 2% bsa , and incubated with tritc - labeled phalloidin , to stain filamentous actin , and with rabbit polyclonal primary antibodies to mouse fibronectin or type i collagen .
fluorescent visualization of fibronectin and type i collagen was achieved using alexa 488-conjugated goat polyclonal secondary antibody to rabbit igg .
some of the fixed cell preparations were washed with pbs , blocked in pbs solution containing 2% bsa , and incubated with hamster monoclonal primary antibody to mouse il-1 and rat monoclonal primary antibodies to mouse cd1d or ifn. fluorescent visualization of the proteins was achieved using fitc - labeled goat anti - rat igg polyclonal secondary antibodies and biotin - conjugated mouse monoclonal secondary antibodies to hamster igg and cy3-conjugated streptavidin .
some of the fixed cell preparations were washed with pbs , blocked in pbs solution containing 2% bsa , and incubated with percp - cy5.5-conjugated hamster monoclonal primary antibodies to mouse cd80 . after staining for cd ,
the cell preparations were washed with pbs , treated for 2 minutes with 0.3% triton - x100 solution , and incubated with rat monoclonal primary antibodies to mouse ifn. fluorescent visualization of cytokine was achieved using goat polyclonal fitc - labeled secondary antibody to rat igg .
the cell preparations were incubated with the appropriate antibodies and streptavidin for 60 minutes at room temperature .
the preparations of peritoneal macrophages obtained from normal uninfected balb / c mice and cultured and fixed in the same manner as granuloma cells were used as the control groups .
fluorescent staining was analyzed using the vectashield mounting medium with dapi ( 4,6-diamidino-2-phenylindole ) ( vector laboratories , usa , h-1200 ) .
confocal images of the cells were recorded ; the preparations were washed in pbs for 20 minutes to remove the vectashield mounting medium and restained for acid - fast mycobacteria by the ziehl - neelsen method .
the cytological preparations were examined at the shared center for microscopic analysis of biological objects of the institute of cytology and genetics , sb ras , using an axioskop 2 plus microscope ( zeiss ) and objectives with various magnifications ( zeiss ) , and photographed using an axiocam hrc camera ( zeiss ) ; the images were analyzed using the axiovision 4.7 microscopy software ( zeiss ) .
cell preparations were stained with fluorescent dyes and examined under an lsm 780 laser scanning confocal microscope ( zeiss ) using the lsm image browser and zen 2010 software ( zeiss ) .
granuloma cells were counted separately on each coverslip for each mouse in each test . in each experiment with bone marrow and peritoneal cell cultures ,
more than 1000 cells in 30 fields of view were analyzed at each time point .
granulomas from mouse bone marrow ( bm/ ) and spleens ( s/ ) were isolated on day 20 ( /20 d ) after infection with bcg in vivo , and splenic granulomas were isolated one month ( /1 m ) and two months ( /2 m ) following infection .
the granulomas isolated after 20 days ( this is how long it takes mice to develop adaptive immunity to bcg ) , one month , and two months following infection were denoted as gran/20 d , gran/1 m , and gran/2 m , respectively .
because none of the mice had been observed to have acute tuberculous infection at the time of granuloma isolation , it was concluded that these granulomas were isolated at the latent stage of bcg infection .
any of the monolayer cultures of granuloma cells that may or may not retain cell clusters in the center of granulomatous lesions will be referred to as the granuloma throughout .
the cellular composition of each granuloma and the relationships between bcg - mycobacteria and host cells in granulomas isolated from mice after 20 days , one month , and two months following infection had been characterized previously [ 11 , 12 ] .
analysis of acid - fast bcg - mycobacterial loads in mouse granuloma cells throughout 48120 h of ex vivo culture demonstrated that the mouse granuloma cells each basically contained a single bcg organism at all times following bcg infection in vivo and at any time point of ex vivo culture ( figure 1(a ) ) .
the acid - fast bcg loads in the cultures of bone marrow cells and peritoneal macrophages were analyzed throughout 4120 h following bcg infection in vitro ( figures 1(b)-1(c ) and 2(a)-2(b ) ) . while up to 60% of macrophage precursor cells of bone marrow
each contained as few as two mycobacteria on average at hour 4 following bcg infection , we thereafter observed a decrease in the number of cells as those with a gradual increase in the occurrence of macrophages each containing more than 20 bcg - mycobacteria ( figure 1(b ) ) . at hour 120 following infection , a considerable number of macrophages in the bone marrow cell population had increased mycobacterial loads ( figures 1(b ) and 2(a ) ) . in parallel , we observed a decrease in the number of macrophages containing a single bcg organism ( figure 1(b ) ) . in bone marrow cell cultures ,
a large number of neutrophils were observed to contain acid - fast bcg - mycobacteria at hour 4 following infection ( figure 2(a ) ) .
36.52 4.76% , 15.28 4.75% , and 3.37 0.43% of neutrophils were observed to contain 1_4 , 5_9 , and 10_20 bcg - mycobacteria , respectively . from hour 24 following bcg infection on , very few neutrophils were observed in bone marrow cell cultures , and those observed had no acid - fast mycobacteria in them . throughout 24120 h following bcg infection , bone marrow cell populations
were largely composed of macrophages with diverse numbers of mycobacteria in them , a limited number of fibroblasts , some of which contained a single bcg organism , and a few dendritic cells without bcg - mycobacteria . in
the mouse peritoneal macrophage cultures infected with bcg in vitro , increased acid - fast bcg - mycobacterial loads in a large number of cells were first observed at hour 4 following infection ( figures 1(c ) and 2(b ) ) . however , at hour 24 following infection , the number of cells as those was dramatically reduced , probably due to necrotic cell death , which had been indicated by the typical morphology of some cells in this population at hour 4 following infection . throughout 4896
h following infection , we observed a gradual increase in the number of viable macrophages with increased bcg loads in them and a decrease in the number of cells with one bacterium in each ( figures 1(c ) and 2(b ) ) .
some fibroblasts found in low numbers in the populations of peritoneal macrophages at hour 96 and 120 following infection each contained a single bcg organism .
no bcg - mycobacteria were found in the dendritic cells identified in the peritoneal macrophage cultures .
overall , our data suggest an active increase in the number of acid - fast mycobacteria in the macrophages of mouse bone marrow cell populations and mouse peritoneal macrophages within 4120 h after bcg infection in vitro , while granuloma macrophages from the bone marrow and spleens of mice with latent tuberculous infection restricted bcg - mycobacterial reproduction in ex vivo culture .
macrophages with morphological signs of cell death ( nuclei with intense chromatin condensation , nuclear fragmentation , the presence of apoptotic bodies with or without bcg - mycobacteria in them , compromised cytoplasmic membranes , leakage of cell components with or without bcg - mycobacteria in them , and the occurrence of nucleus - free cells and chromatolysis ( figures 3(a)-3(b ) ) ) were observed in the cultures of bone marrow cells and peritoneal macrophages since the onset of acute bcg infection in vitro ( figures 3(a)-3(b ) and 4 ) ; however , none of the peritoneal or bone marrow macrophages were apoptotic or necrotic in the control ( uninfected ) cultures in vitro at any time point .
the number of dead macrophages in the cultures of bone marrow cells increased considerably starting from hour 72 following infection ( figures 3(a ) and 4 ) .
this result was in agreement with the increase in the number of bcg - mycobacteria in these macrophages ( figures 1(b ) and 2(a ) ) . at hour 96 following infection , the number of dead macrophages exceeded 35% of the bone marrow cell population ( figure 4 ) .
the cultures of peritoneal macrophages had quite a different pattern of cell death after infection with bcg in vitro ( figures 3(b ) and 4 ) .
at hour 4 following infection , more than 20% of macrophages showed morphological evidence of being dead ( figure 3(b ) ) .
the dead cells ( peritoneal macrophages ) normally contained a large number of ingested bcg - mycobacteria .
however , as the culture went on , there was a decrease in the number of dead macrophages : at hour 72 following infection , they made up 10% of the then current cell population at that point .
however , at hour 96 following infection , dead cells made up 30% of the then current cell population ( figures 3(b ) and 4 ) , which was in correlation with the increase in the number of bcg - mycobacteria in the peritoneal macrophages ( figures 1(c ) and 2(b ) ) . at hour 120 following infection , dead macrophages made up 50% of the then current cell population ( figure 4 ) .
each dead peritoneal macrophage contained more than one bcg organism in it as many as each bone marrow macrophage did .
notably , some peritoneal and bone marrow macrophages with increasing mycobacterial load had the capability for phagocytosis and destruction of damaged cells , mainly lymphocytes , throughout 72120 h following bcg infection in vitro .
phagosomes with engulfed lymphocytes at various stages of degradation existed side by side with large numbers of acid - fast bcg - mycobacteria in the bone marrow ( figure 2(a ) ) and peritoneal macrophages ( figure 2(b ) ) .
in mouse granulomas at all times following bcg infection in vivo and of ex vivo culture , macrophages with large numbers of bcg - mycobacteria , including those in cording colonies , exhibited no morphological signs of cell death and retained their capacity for phagocytosis and disposal of damaged granuloma cells , mainly lymphocytes and platelets ( figure 3(c ) ) .
no colocalization of the acidophilic lysotracker probe and bcg - mycobacteria detected by antibodies reacting with the major mycobacterial cell wall component glycolipid lipoarabinomannan ( lam ) was observed in granuloma macrophages , whether with single or multiple bcg - mycobacteria in them ( figure 5(a ) ) .
the lam - labeled bcg - mycobacteria that had avoided host killing in lysosomes and survived and reproduced within the granuloma macrophages were largely acid - fast , with the integrity of their cell walls preserved and , therefore , viable ( figure 5(a ) ) .
note that no colocalization of lam - labeled bcg - mycobacteria with the acidotropic lysotracker dye in the macrophages or neutrophils was observed in the cultures of bone marrow cells and peritoneal macrophages throughout 424 h following bcg infection in vitro either ( figure 5(b ) ) .
thus , increased death rates were revealed , throughout 72120 h following bcg infection in vitro in the cultures of bone marrow and peritoneal macrophages , for macrophages heavily loaded with bcg - mycobacteria , while in ex vivo cultures granuloma macrophages with large numbers of bcg - mycobacteria in them were still viable and had neither apoptotic nor necrotic morphology .
it is well established that the cytokines ifn , il-1 , and gm - csf are inflammatory mediators , which activate and differentiate immune cells , increasing their microbicidal potential in response to infection with intracellular pathogens and thus playing an important role in initiating / regulating inflammation and controlling infection [ 7 , 13 , 18 , 26 , 27 ] .
an immunocytochemical and an immunofluorescence assay of ifn , cell - associated il-1 , and gm - csf demonstrated their active production in granuloma cells ( macrophages , multinucleate langhans giant cells , and fibroblasts ) from the spleens of mice after 20 days , one month , and two months following infection with the bcg vaccine in vivo and after ex vivo culture for 4896 h ( see table 1 , figures 6(a)-6(b ) , 7(b)-7(c ) and 10(c ) ) .
noteworthy , cytokine - producing granuloma macrophages with increased microbicidal potential contained replicating acid - fast bcg - mycobacteria too ( figures 6(a ) , 7(c ) , and 10(c ) ) . however , neither peritoneal nor bone marrow macrophages whether after bcg infection in vitro or in the control group were observed to synthesize these cytokines ( see table 1 , figures 6(b)-6(c ) ) .
interestingly , there was one - fifth as many ifn-synthesizing cells in the mouse 14/2 m granulomas assayed at hour 120 of ex vivo culture ( see table 1 , figure 6(b ) ) as there was in the mouse granulomas assayed throughout 4896 h of ex vivo culture .
there was no difference in bcg load in granuloma macrophages or dendritic cells between mouse 14/2 m and any of mice 3/2 m , 4/2 m , 5/2 m , 9/2 m , and 22/2 m assayed for ifn production throughout 4896 h of ex vivo culture . to answer the question as to whether this considerable reduction in the number of ifn-producing cells in mouse 14/2 m granulomas was due to the longer time of ex vivo culture or some individual features ( whatever they are ) of mouse 14/2 m were factors , further research is required .
thus , a considerable production of proinflammatory cytokines has been observed in the mouse granuloma macrophages that largely had a single bcg organism in each of them , while peritoneal and bone marrow macrophages with high bacterial loads following bcg infection in vitro have not been observed to induce the synthesis of such cytokines .
the bacterial lipid- and the glycolipid - presenting molecule cd1d participates in t - cell development , nkt - cell activation , and regulation of immunity in response to invasion by mycobacteria [ 2729 ] .
cd1d molecules were found on the surface of most macrophages ( both with and without acid - fast bcg - mycobacteria in them ) , dendritic cells , and fibroblasts within the granulomas examined ( figures 7(a)7(c ) and 11 ) .
neither control fibroblasts obtained from the intact mice , nor the peritoneal macrophages from mice after 20 days following intraperitoneal infection with the bcg vaccine , nor the bone marrow macrophages from mice after 2448 h following bcg infection in vitro stained for cd1d ( figures 7(a ) , 7(d ) , and 11 ) .
few granuloma lymphocytes ( 11.13 0.1% and 9.27 1.14% in the granulomas from the spleens of the mice after one month and two months following infection with the bcg vaccine in vivo , resp . ) stained for cd1d ( figure 7(a ) ) .
d25 is a marker of cell activation and the chain of the receptor for il-2 participating in the development of the inflammatory response to alien antigens and activating antigen - presenting functions of cells of the immune system .
il-2r can combine with the other two chains of the receptor to form high - affinity signaling receptor complexes for il-2 when macrophages and t cells are activated .
the antibodies reacted with cd25 in 2025% of macrophages , 4 - 5% of dendritic cells , and 612% of lymphocytes in the mouse granulomas ( figures 8 and 11 ) .
note that the number of lymphocytes containing d25 was on average higher in granulomas from the mice after two months than one month following bcg infection in vivo ( figure 11 ) .
cd25 was not found in peritoneal macrophages from the control mice , peritoneal macrophages from mice after 20 days following intraperitoneal infection with the bcg vaccine , or bone marrow macrophages at hour 48 following bcg infection in vitro ( figures 8 and 11 ) .
cd31 , also known as pecam-1 ( platelet endothelial cell adhesion molecule 1 ) , is a transmembrane glycoprotein , one of the adhesion molecules in the immunoglobulin superfamily .
its primary function is the mediation of leukocyte - endothelial cell adhesion and signal transduction in various inflammatory disorders .
cd31 was found on the surface of 1727% of macrophages , both with and without acid - fast bcg - mycobacteria in them , and on the surface of 3040% of dendritic cells in granulomas from all mice infected with the bcg vaccine in vivo ( figures 9 and 11 ) .
cd31 was not detected on fibroblasts from the spleens of the control mice , nor was it found on mouse granuloma fibroblasts ( figure 9(a ) ) .
the peritoneal macrophages obtained from the intact mice or the mice after 20 days following intraperitoneal infection with the bcg vaccine stained little for cd31 ( figures 9 and 11 ) .
cd35 , also known as the complement receptor type 1 ( cr1 ) , participates in phagocytosis of 3b - opsonized mycobacteria and promotes microbial death in the phagosomes of host cells [ 32 , 33 ] .
cr1 was found on the surface of 2239% of the macrophages , both with and without acid - fast bcg - mycobacteria , and 913% of the dendritic cells in mouse granulomas ( figures 10(a ) , 10(c ) , and 11 ) .
the peritoneal macrophages obtained from the intact mice or the mice after 20 days and after two months following intraperitoneal infection with the bcg vaccine did not stain for cd35 ( figures 10(a ) and 11 ) .
cd35 was not detected on fibroblasts from the spleens of the control mice or mouse granulomas .
also , bone marrow macrophages stained little for cd35 throughout 2448 h after bcg infection in vitro ( figures 10(c ) and 11 ) .
thus , this study of the cell - surface markers demonstrates significant activation of granuloma cells through the expression of various receptors in the mouse granulomas with low mycobacterial loads ; however , bone marrow macrophages that had been infected with bcg in vitro and had very high bacterial loads were not observed to produce any of those activation - related molecules .
it has been established that mycobacteria have evolved a wide range of molecules , known as adhesions , to enable binding with fibronectin , a protein of the host extracellular matrix , and type i collagen fibers and , eventually , to invade host cells .
the cytoskeletal filamentous proteins actin and vimentin are responsible for cell migration , attachment to the substrate , maintaining cell shape , integrity of the cytoplasm , phagocytosis of bacterial agents , and elimination of intracellular pathogens .
according to preliminary results of the immunocytochemical and the immunofluorescence assay , the production rates for fibronectin , type i collagen , filamentous actin , and vimentin in granuloma macrophages were not affected by mycobacterial loads , nor were those in granuloma fibroblasts from mice following infection with bcg vaccine in vivo or in peritoneal macrophages and splenic fibroblasts from the control group of intact mice ( figures 12(a)12(e ) and 13 ) .
no colocalization of bcg - mycobacteria with filamentous actin in granuloma macrophages was observed either ( data not shown ) .
the s100 proteins are a large family of cytoplasmic and extracellular ca - binding molecules regulating enzyme activities , the dynamics of cytoskeletal constituents , ca homeostasis , and the inflammatory response .
the s100 proteins regulate intermediate filaments , microfilaments and other cytoskeletal proteins , cell morphology and motility , and the reciprocal relationships of cytoskeletal elements .
mouse granuloma macrophages stained much stronger with polyclonal antibodies reactive with the s100 proteins than peritoneal macrophages from the control mice ( figure 14 ) .
thus , a high expression of cytokines and other activation - related cd markers , the unchanged synthesis of constitutive cytoskeletal and extracellular matrix proteins , was observed in granuloma cells with low mycobacterial loads from mice with latent tuberculous infection . by contrast , no expression of the cytokines or cd markers was detected in the control cultures of uninfected cells or peritoneal and bone marrow macrophages with high bacterial loads following acute bcg infection in vitro .
in the present study , we have for the first time compared mycobacterium - host cell relationships in individual granuloma cells from the bone marrow and spleens of mice with latent tuberculous infection and in the cells from mouse bone marrow and peritoneal cultures after bcg infection in vitro .
the study of bcg loads in mouse granuloma macrophages at the latent stage of tuberculous infection demonstrated that , although there was individual variation in the number of bacteria across the cells of granulomas from different mice , those cells each normally contained a single bcg organism throughout 48120 h of ex vivo culture .
by contrast , a considerable increase in the number of bcg - mycobacteria was observed in the cultures of bone marrow cells and peritoneal macrophages infected with bcg in vitro throughout 4120 h following infection .
therefore , mouse granuloma macrophages could control mycobacterial reproduction in cells , while the intact mice 's macrophages infected in vitro could not do as much . in a study by jordao and the coworkers ,
bcg - mycobacteria were killed very efficiently by mouse bone marrow - derived macrophages , but not by human monocyte - derived macrophages , in which bcg - mycobacteria actively replicated for 27 days after bcg infection in vitro . as is known
, the proinflammatory cytokines ifn , tnf , and il-1 synthesized by macrophages , lymphocytes , and other cells of the immune system in animals control tuberculous infection [ 3739 ] .
it has been demonstrated that the action of ifn on cells infected with mycobacteria in vitro leads to activation of inducible no synthase and necrotic / apoptotic death of infected cells [ 21 , 26 , 40 ] . in our work , analysis of the production of the proinflammatory cytokines ifn , il-1 , and gm - csf demonstrated significant activation of their synthesis in mouse granuloma cells after 20 days , one month , and two months following infection with the bcg vaccine in vivo and at different times of ex vivo culture , while mouse bone marrow cells and peritoneal macrophages infected with the bcg vaccine in vitro were not observed to induce their synthesis . as a result , we observed a considerable increase in the number of bcg - mycobacteria in acutely infected bone marrow and peritoneal macrophages in mice , causing increased death rates for host cells .
in contrast to the cultures of cells infected with the bcg vaccine in vitro , mouse granuloma macrophages were not observed to have a burst - like increase in bcg - mycobacterial population during ex vivo culture or to die because of increased bcg - mycobacterial loads .
our results are not consistent with those reported by lee and kornfeld , who had added recombinant cytokine ifn to the growth medium with mouse bone marrow macrophages infected with bcg - mycobacteria and m. tuberculosis in vitro and observed increased death rates for the cells that were heavily loaded with mycobacteria
. however , our results are consistent with the conclusion made by the same authors that ifn promotes survival of macrophages with a low intracellular bacterial load in them by inhibiting mycobacterial reproduction .
zhang and the coworkers demonstrated that one of the mechanisms that contribute to the restriction of m. tuberculosis reproduction in host cells could be depletion of tryptophan in activated macrophages through ifn-mediated upregulation of expression of the host enzyme that degrades tryptophan in mouse cells , which reduces the amount of tryptophan required for intracellular mycobacteria to reproduce actively .
curiously , we revealed that host cells containing large numbers of bcg - mycobacteria in the bone marrow cell cultures and peritoneal macrophage cultures had been dying out at increased rates without whatever external factor , not with , for example , recombinant ifn used by lee and kornfeld or jordao and the coworkers . in our study , the observed pattern of the death of peritoneal macrophages infected with bcg - mycobacteria in vitro demonstrated that macrophages are able to ingest large enough numbers of mycobacteria ; however , some contained too many to deal with , and so they died in the first hours following infection .
the remaining macrophages , which had ingested few mycobacteria , were viable until the growing bacterial populations reached the size at which host cells could not carry on , which , again , resulted in more dead macrophages . a similar pattern of macrophage death was observed in bcg - infected bone marrow cell cultures with the difference that the infected bone marrow macrophage precursor cells each normally ingested no more than two bcg - mycobacteria , which had no adverse effect on their viability in vitro .
the subsequent active reproduction of bcg - mycobacteria in the bone marrow macrophages differentiated from the precursor cells resulted in above - critical bcg - mycobacterial loads in host cells , and so those host cells died within 96120 h of culture following bcg infection in vitro .
lee and the coworkers found no morphological or biochemical evidence of the apoptotic death of host cells following in vitro infection of mouse bone marrow cells with bcg and m. tuberculosis .
we , by contrast , observed dead bcg - infected peritoneal and bone marrow macrophages with nuclear chromatin condensation , nuclear fragmentation , and the formation of apoptotic vesicles with and without bcg - mycobacteria , which was indicative of apoptosis .
some cells had plasma membrane disruptions and no nuclei in them , which was indicative of necrosis ; however , acid - fast bcg - mycobacteria were normally located in the pieces of the cytoplasm of dead cells , just as they were in the previously studied mouse granulomas , in which bcg - mycobacteria had occasionally been found in apoptotic bodies and in the fragments of the cell cytoplasm located in the phagosomes of macrophages or outside cells .
the apoptotic death of invaded cells is perhaps the best option for the host organism , because this leads to the elimination of the pathogen , as apoptotic bodies are ingested by nearby macrophages , and prevents the extracellular spread of mycobacteria and the development of inflammatory responses in the surrounding tissues [ 37 , 4345 ] . in this work , we compared the production rates for cytokines and activation - related cd markers in granuloma macrophages from mouse spleens at different time points of latent tuberculous infection following infection with the bcg vaccine in vivo and in mouse bone marrow and peritoneal macrophages following infection with the bcg vaccine in vitro and after culture for several hours . as a result
, we revealed a considerable production of proinflammatory cytokines in the mouse granuloma macrophages that largely had a single bcg organism in each of them , while peritoneal and bone marrow macrophages with high bacterial loads following bcg infection in vitro were not observed to induce the synthesis of such cytokines .
note that literature data on the induction of expression of proinflammatory cytokines in animal and human cells infected with pathogenic , nonpathogenic , and attenuated mycobacterial strains in vitro are quite controversial .
for example , beltan and the coworkers revealed a considerable induction of the synthesis of the proinflammatory cytokines il-1 , il-6 , gm - csf , and tnf after in vitro infection of human macrophages with only nonpathogenic mycobacteria .
aldwell and the coworkers , by contrast , observed enhanced expression of genes for the proinflammatory cytokines il-1 , il-6 , and tnf only after in vitro infection of bovine macrophages in bronchoalveolar fluid with pathogenic m. bovis , but not with attenuated bcg - mycobacteria .
similarly , in vitro infection of mouse bone marrow cells with highly pathogenic m. tuberculosis beijing led to a stronger induction of expression of genes for the proinflammatory cytokines il-1 , il-12 , and tnf than did infection of cells with less virulent mycobacterial strains . in a work by rajaram and the coworkers , human monocyte - derived macrophages infected in vitro with virulent m. tuberculosis h37rv and attenuated bcg - mycobacteria followed a similar pattern of activation of the production of the proinflammatory cytokine il-8 .
however , in a work by brooks and the coworkers , bcg - mycobacteria induced a stronger activation of the synthesis of the proinflammatory cytokine il-1 in mouse bone marrow macrophages than in cells of the same type infected with m. tuberculosis h37rv in vitro . as a result , these researchers observed a stronger reproduction of the mycobacteria of the virulent strain than bcg - mycobacteria throughout 24168 h following infection .
interestingly , the in vitro infection of mammalian cells with bcg - mycobacteria led to a rapid elimination of bcg - mycobacteria in the phagosomes of infected cells in some cases , while in others a considerable increase in the number of bcg - mycobacteria was observed during in vitro culture of infected cells [ 26 , 49 ] .
it should be noted that sanarico and the coworkers also described the bcg strain - specific modulation of the bacterium - host cell interactions in human monocyte - derived dendritic cells after acute infection with bcg japan or bcg aventis pasteur in in vitro culture . as is known , bcg japan belongs to the early strains of bcg as does bcg russia used in our study . on the other hand ,
bcg japan was incapable of intracellular replication , while bcg aventis pasteur belonging to the later strains enlarged the bacterial population in dendritic cells .
nevertheless , the differences in the gene profile were not observed in dendritic cells infected with various bcg strains , when the highest levels of mrna for the proinflammatory cytokines il-1 , il-1 , il-6 , il-12 , and tnf were detected .
analysis of ifn gene expression did not show any significant modulation of the production of this cytokine in dendritic cells after bcg infection . in our study ,
relationships between mycobacteria of the vaccine strain bcg and host cells were quite different in splenic granulomas from mice with latent tuberculous infection and in mouse cells acutely infected with bcg - mycobacteria in vitro .
we observed , as brooks and the coworkers did , a stronger reproduction of bcg - mycobacteria in the macrophages of those cultures , whose cells were not producing proinflammatory cytokines or cd markers of cell activation .
thus , our study demonstrated that the in vitro infection of mouse cells in culture and the in vivo infection of animals cause macrophages to produce different responses and entail different relationships between host cells and mycobacteria .
the reasons for the inconsistent results and large variation in the intracellular growth rate of mycobacteria among different research groups are unclear ; however , as reviewed by rivero - lezcano , mycobacterial strains , cell models , infection protocols , assays of mycobacterial growth , and cytokines for activation of host cells were different and so were the experimental settings .
in addition , the observed differences should be taken into account whenever experimental cell models are used for testing and validation of antimycobacterial drugs and vaccines .
overall , although the differences in mycobacterium - host cell relationships are actively studied by many researchers , more information is required for a better understanding of pathogen - host cell interactions .
therefore , as reviewed in , the development of more complex cell models that can involve most types of immune cells and many humoral immunological factors may help discover new antimycobacterial mechanisms .
consequently , we have developed a new ex vivo granuloma cell model from mice with latent tuberculous infection that is very similar to in vivo conditions , both for research into mycobacterium - host cell relationships in the short term and for testing new vaccines and antimycobacterial drugs in a long term .
we have observed induction of expression of the activation markers cd1d , cd25 , cd31 , and cd35 on mouse granuloma macrophages at different time points of latent tuberculous infection , and not on bone marrow macrophages after infection with the bcg vaccine in vitro . as is known [ 29 , 53 ] , cd1d is an antigen - presenting receptor of nonprotein , lipid , and glycolipid molecules to a variety of t cells .
it is possible that some cd1d - positive mouse granuloma lymphocytes were the so - called invariant natural killer t cells , which respond very rapidly to mycobacterial infection .
activation of cd25 on mouse granuloma macrophages demonstrated an increased responsiveness of the macrophages to the powerful immunoregulatory lymphokine il-2 , which stimulates macrophages and other cells of the immune system for the treatment of infectious diseases .
it is possible that the lymphocytes with cd25 in mouse granulomas are in the class of regulatory t cells involved in suppression of activation of the microbicidal functions of macrophages and dendritic cells with the development of immune tolerance , so much so that cd25-positive lymphocytes were observed to increase in number as chronic tuberculous infection in mice was progressing .
the increased number of cd31 and cd35 receptors on granuloma macrophages was indicative of activation of the proinflammatory response of cells to mycobacterial infection in mice .
elevated s100 protein concentrations in mouse granuloma cells were probably due to activation of the production of algranulins , because these three proteins , s100a8 , s100a9 , and s100a12 , are inducible in macrophages and are largely expressed by activated macrophages as important mediators of inflammation and microbial infections , suggesting a key role for these proteins in the innate immune response .
nevertheless , although the cells of the immune system in the mice were activated , bcg - mycobacterial reproduction in mouse granuloma macrophages was observed to go on . as is known , mycobacteria possess a large number of bacterial proteins that operate as bacterial adhesions for binding with proteins of the extracellular matrix , followed by infection of host cells through activation of phagocytosis - related processes .
preliminary results suggested that there was no difference in the production of the extracellular matrix proteins fibronectin and type i collagen between mouse granuloma cells , whether containing bcg - mycobacteria or not , and the control mouse macrophages .
furthermore , no differences were observed in the expression of the cytoskeletal proteins vimentin and filamentous actin .
studies of the proteins that are involved in cell - to - cell interactions and phagocytosis of bacteria in the cells operating within inflammatory foci such as granulomas will go on , because they are important for understanding the mechanisms underlying mycobacterial persistence in host cells in the settings of latent tuberculous infection in animals and man .
consequently , the search for factors that influence the reproduction and survival of mycobacteria , including vaccine strains , in host cells and the study of relationships between cells and their intracellular pathogens , both following acute infection in in vitro culture and in foci of latent tuberculous infection , are the priority in investigating the role of the cells of the immune system in the protection of man and animals against mycobacterial infections caused by pathogenic or nonpathogenic mycobacteria .
bcg has been used as a vaccine for immunization of many people worldwide ; however , the results are varying .
considering the situation , research into the host cell response to bcg - mycobacteria during acute and latent chronic infection of animal cells is very important for developing a more rational approach to the improvement of the bcg vaccine . in the present study ,
we compared mycobacterium - host cell relationships in individual granuloma cells from mice with latent tuberculous infection and cells from mouse bone marrow and peritoneal cultures infected with bcg in vitro .
this comparison showed different specific cellular responses to latent chronic and acute bcg infection in vitro .
we have demonstrated that mouse granuloma macrophages with an increased production of proinflammatory cytokines , growth factors , and cd receptors for cell activation can not eliminate intracellular bcg - mycobacteria .
nevertheless , these macrophages can control mycobacterial reproduction in host cells both in vivo and in ex vivo culture , while those not activated after acute bcg infection in vitro can not .
we expect that our results will add to the understanding of bcg - mycobacterium - host cell interactions and may facilitate the design and improvement of vaccines against tuberculosis . | the search for factors that account for the reproduction and survival of mycobacteria , including vaccine strains , in host cells is the priority for studies on tuberculosis . a comparison of bcg - mycobacterial loads in granuloma cells obtained from bone marrow and spleens of mice with latent tuberculous infection and cells from mouse bone marrow and peritoneal macrophage cultures infected with the bcg vaccine in vitro has demonstrated that granuloma macrophages each normally contained a single bcg - mycobacterium , while those acutely infected in vitro had increased mycobacterial loads and death rates .
mouse granuloma cells were observed to produce the ifn , il-1 , gm - csf , cd1d , cd25 , cd31 , d35 , and s100 proteins .
none of these activation markers were found in mouse cell cultures infected in vitro or in intact macrophages .
lack of colocalization of lipoarabinomannan - labeled bcg - mycobacteria with the lysosomotropic lysotracker dye in activated granuloma macrophages suggests that these macrophages were unable to destroy bcg - mycobacteria . however , activated mouse granuloma macrophages could control mycobacterial reproduction in cells both in vivo and in ex vivo culture .
by contrast , a considerable increase in the number of bcg - mycobacteria was observed in mouse bone marrow and peritoneal macrophages after bcg infection in vitro , when no expression of the activation - related molecules was detected in these cells . |
lipid - rich carcinoma is a very rare histological variant of breast cancer that accounts for less than 1% of all breast cancers .
it is composed of clear to vacuolated cytoplasm with abundant neutral lipid present within 90% of the tumor cells .
lipid - rich carcinomas are considered to behave aggressively and have a worse prognosis than other types of breast cancer .
gene expression profiling studies have refined breast cancer classification and identified distinct subgroups that have an independent association with patient outcome [ 3 , 4 ] , and findings can be surrogated by immunohistochemical markers that match the gene expression patterns [ 5 , 6 , 7 ] . here , a case of lipid - rich carcinoma previously included as case 1 in a series of 13 breast cancer patients who received long - term treatment with neuroleptics was re - evaluated to determine the intrinsic immunohistochemical ( ihc ) subtype .
the present report describes the histological characteristics and intrinsic subtype profile of this case of lipid - rich carcinoma of the breast .
a 57-year - old japanese woman who had received long - term neuroleptic treatment for schizophrenia noticed a painless , pea - sized lump in her right breast , and she was admitted to our hospital .
the tumor size was 2.5 1.5 cm in diameter , and an excisional biopsy confirmed malignancy ( t1n0m0 ) .
the excised tissue specimens were routinely processed for histological , histochemical , and ihc examinations .
briefly , formalin - fixed , paraffin - embedded tissues were deparaffinized and stained with hematoxylin and eosin ( he ) and periodic acid - schiff ( pas ) with or without diastase digestion .
immunohistochemistry was performed with the primary antibodies listed in table 1 and a labeled streptavidin biotin staining kit ( dako , carpinteria , calif . ,
frozen sections cut on a cryostat were prepared from the formalin - fixed wet tissues and stained with oil red o. macroscopically , the excised tumor measured 2.0 1.2 1.1 cm in diameter , and its cut surface was grayish - white .
histologically , tumor cells were large with clear to foamy cytoplasm , accompanied by cellular pleomorphism and nuclear atypia .
1a ) or formed atypical epithelial tufts that protruded into the lumen with desquamated cells within the lumen ( fig .
2a ) but the tumor cell cytoplasm was negative for basal cytokeratins ( ck5 , ck6 , and ck14 ) .
however , basal ( myoepithelial ) cells surrounding the glandular lumen composed of apocrine extrusion of the nuclei were positive for ck5 ( fig .
cancer cells were prolactin ( prl)-negative , whereas the prolactin receptor ( prlr ) showed cytoplasmic staining ( fig . 2c ) .
cancer cells were invariably negative for estrogen receptor ( er ) , progesterone receptor ( pgr ) , epidermal growth factor receptor 1 ( her1 ) , and her2 .
cancer cell invasion was seen in the mammary fat pad , but vessel invasion was not seen .
all 16 right axillary lymph nodes were free of metastasis . the patient has remained cancer - free for 20 years without any evidence of recurrence .
long - term neuroleptic usage produces a persistent and marked elevation of serum prl levels , which results in secretory activity in the breast .
prlr is a transmembrane protein that consists of extracellular , transmembrane , and intracellular domains , and prl acts through the prlr .
monoclonal antibody b6.2 is directed against the extracellular domain of human prlr . although cancer cells were prl - negative ,
they were positive for prlr , which indicates that prl might have played an important role in the development of the lipid - rich carcinoma of the breast mediated through the prlr pathway .
the lipid - rich carcinoma contained a large amount of neutral lipid but did not contain glycogen or mucin .
secretory carcinomas , apocrine carcinomas and glycogen - rich carcinomas are also composed of clear to vacuolated cancer cells .
a pas - negative reaction can differentiate lipid - rich carcinomas from these other histological types of carcinomas .
additionally , in the present case , -lactalbumin was diffusely positive in the cytoplasm of cancer cells lining the glandular lumina .
histologically , lipid - rich carcinomas contain in situ areas and invasive areas . in situ areas contain cells arranged in an alveolar pattern with a hobnail appearance , in which the luminal borders exhibit apocrine - type cytoplasmic blebs and extrusion of hyperchromatic pleomorphic nuclei .
invasive areas contain cells with clear and foamy cytoplasm arranged in sheets , nests , and cords [ 1 , 10 , 11 ] .
basal cells in the breast express high - molecular - weight basal cks including ck5/6 and ck14 [ 12 , 13 ] , and -sma is a marker of myoepithelial differentiation .
foci surrounded by basal ( myoepithelial ) cells indicate an in situ portion , while the lack of these cells indicates an invasive portion .
breast cancer can be distinguished as ductal or lobular in nature , and lipid - rich carcinoma can be associated with either ductal or lobular carcinoma in situ .
e - cadherin , a transmembrane glycoprotein that binds similar types of cells together , exists in the membranes of cells in ductal lesions while it is lacking in lobular lesions . in the present case , the tumor was e - cadherin positive , which suggests that the carcinoma is ductal in nature .
lipid - rich carcinomas in the form of ductal carcinoma in situ ( dcis ) or in the form of an invasive component accompanied with dcis have been reported .
ihc intrinsic subtypes can be defined by using markers as follows : luminal a ( er+ and/or pgr+ , her2 ) , luminal b ( er+ and/or pgr+ , her2 + ) , her2-enriched ( er , pgr , her2 + ) , and triple negative ( er , pgr , her2 ) .
the triple - negative subtype can be further divided into basal - like ( er , pgr , her2 , ck5/6 + , and/or her1 + ) and unclassified ( negative for all five markers ) [ 5 , 6 , 7 ] . according to this system , the present case is the unclassified subtype . due to the rarity of lipid - rich carcinomas ,
the association between intrinsic subtypes and aggressiveness has not been extensively studied . in one study , 5 of 6 ( 83.3% )
lipid - rich carcinomas were er+ and/or pgr+ , while 3 of 6 ( 50% ) lipid - rich carcinomas were her2 + . in a study of 17 lipid - rich carcinomas , 1 tumor was er+ and/or pgr+ , and all 17 carcinomas were her2 + . in a third study , 5 of 49 ( 10.2% ) lipid - rich carcinomas were er+ and/or pgr+ and 35 of 49 ( 71.4% ) lipid - rich carcinomas were her2 + .
thus , the positive rate of er and/or pgr tended to be low , and her2 expression tended to be high in these studies of lipid - rich carcinomas . according to ihc intrinsic subtype analysis ,
patients who have her2-enriched and triple - negative subtype cancers have a significantly shorter disease - free survival period than patients with other subtypes .
the poor prognosis among triple - negative cases is conferred almost entirely in basal - like breast cancer .
breast carcinoma with basal differentiation can be defined based on the expression of basal ck , such as ck5 , ck6 , and ck14 , and lipid - rich carcinoma with a basal cell phenotype ( er , pgr , her2 , high molecular weight ck+ , her1 + ) has been reported .
although the lipid - rich carcinoma in the present case report was er- and pgr - negative , it was also negative for her2 and basal cell cks , and the patient remains disease - free 20 years after the surgery .
therefore , in lipid - rich carcinoma , like in other histologic types of breast carcinomas , her2 and basal - like subtypes may indicate the aggressive behavior of the neoplasm .
| a 57-year - old japanese woman with schizophrenia , who had received long - term treatment with neuroleptics , noticed a painless , pea - sized lump in her right breast .
she was admitted to our hospital and a malignant tumor was diagnosed .
the patient underwent a conservative radical mastectomy ( patey 's operation ) .
the excised tumor measured 2.0 1.2 1.1 cm in diameter , and its cut surface was grayish - white .
histologically , tumor cells with clear to foamy cytoplasm were invariably oil red o - positive and periodic acid schiff - negative with or without diastase digestion .
the tumor was diagnosed as a lipid - rich carcinoma accompanied by an in situ component .
neuroleptics increase serum prolactin levels by interfering with dopaminergic inhibition of prolactin secretion .
immunohistochemical analysis revealed that , although prolactin was not detected , the tumor cells expressed prolactin receptor , indicating prolactin as the genesis of this neoplasm . in immunohistochemical intrinsic subtype analysis ,
the tumor was negative for estrogen receptor , progesterone receptor , human epidermal growth factor receptor 1 and 2 , and basal cytokeratins ( ck5 , ck6 , and ck14 ) , indicating an unclassified ( all - marker negative ) subtype .
axillary lymph nodes were free of metastasis ( stage i ) , and the patient has been well for 20 years without any evidence of recurrence . |
health profession schools use interviews during the admissions process to identify certain non - cognitive skills that are needed for success in diverse , inter - professional settings .
this study aimed to assess the use of interviews during the student admissions process across health disciplines at schools in the united states of america in 2014 . the type and frequency of non - cognitive skills assessed were also evaluated .
descriptive methods were used to analyze a sample of interview rubrics collected as part of a national survey on admissions in the health professions , which surveyed 228 schools of medicine , dentistry , pharmacy , nursing , and public health . of the 228 schools ,
130 used interviews .
the most desirable non - cognitive skills from 34 schools were identified as follows : communication skills ( 30 ) , motivation ( 22 ) , readiness for the profession ( 17 ) , service ( 12 ) , and problem - solving ( 12 ) . ten schools reported using the multiple mini - interview format , which may indicate potential for expanding this practice .
disparities in the use of interviewing across health professions should be verified to help schools adopt interviews during student admissions processes . | |
stent assisted coiling ( sac ) has been increasingly performed in patients with wide necked complex aneurysm.1)15)18)27)28 ) however , the risk of complications increases with the use of stent assistance.14)22)25)30 ) these complications include thromboembolism , such as parent artery occlusion , distal embolic infarction , aneurysm rupture , and , less frequently , vessel rupture .
however , carotid - cavernous fistula ( ccf ) after sac has never been reported . in this report
, the authors describe a case of direct ccf after a sac procedure for treatment of a complex posterior communicating artery ( pcoa ) aneurysm regrowth , which was treated by clip ligation 12 years before .
the patient , a 67-year - old woman with a history of spontaneous subarachnoid hemorrhage ( sah ) due to a left pcoa aneurysm rupture treated by clip ligation 12 years ago , presented at the emergency department with a sudden severe headache .
a computed tomography ( ct ) scan of the brain showed evidence of a fisher grade 3 sah within the basal cisterns and both sylvian fissures .
a cerebral angiogram revealed a posteromedially regrowing , irregularly shaped pcoa aneurysm , with a neck size of 7.22 mm and a dome size of 7.3 5.2 mm ( fig .
allcock test revealed that the flow to the left posterior cerebral artery was sufficiently maintained from the vertebrobasilar system .
we planned a stent - assisted coil embolization to prevent coil loop herniation into the internal carotid artery ( ica ) lumen . under general endotracheal anesthesia ,
a 6 french short arterial sheath was placed in the right femoral artery and a 6 french envoy guiding catheter ( cordis endovascular , miami lakes , fl , usa ) was placed at the level of the distal cervical ica . a prowler select plus microcatheter ( cordis endovascular , miami lakes , fl , usa ) and agility 14 microwire were navigated into the left middle cerebral artery ( mca ) .
then , we selected the aneurysm sac using a headway-17 90 degree microcatheter ( microvention inc . , tustin , ca , usa ) .
we deployed the enterprise stent 4.5 mm 28 mm ( cordis , miami lakes , fl , usa ) through the prowler select plus microcatheter and did coil packing through a headway-17 microcatheter .
after packing eight coils , it became difficult to verify whether the ica lumen was compromised by coils ( fig .
therefore , bailout stenting was performed using a solitaire stent of 5 mm 30 mm ( ev3 inc . , irvine , ca , usa ) .
therefore , we decided to perform thrombolysis . in order to advance the microcatheter to a1 through the stent lumen
however , using a contralateral ica angiogram through another femoral puncture , we determined that it was not a thrombotic occlusion , but a simple flow direction change due to the deployed double overlapping stent across the aca orifice .
the control angiogram showed a small amount of contrast leaking into the cavernous sinus and right inferior petrosal sinus from the cavernous ica .
the proximal tip of the solitaire stent was visible beyond the confines of the ica lumen ( fig 2b , c ) .
after packing four more coils , complete obliteration of the aneurysm was achieved without compromising ica and mca flow .
after the procedure , the patient was alert and her hospital course was uneventful . a follow - up angiogram seven days after the procedure showed the complete obliteration of the aneurysmal sac and no evidence of vasospasm .
however , a high - flow ccf was still visible without the cortical venous reflux , probably due to the perforation of cavernous ica by the solitaire stent proximal marker during the procedures ( fig .
3a ) . the fistula was drained in an antegrade fashion to the inferior petrosal sinus , and the amount of fistulous flow was minimal and localized in the extracranial ica portion .
furthermore , she had no clinical symptoms of ccf , thus we decided to manage the patient conservatively .
angiograms performed three months after the procedure showed the complete obliteration of the left pcoa aneurysm and the spontaneous disappearance of ccf ( fig .
treatment of aneurysm regrowth after surgical clipping or endovascular coiling is challenging , especially if the shape of the aneurysm is complex or irregular , and the neck is wide .
surgical clipping of previously clipped regrowing aneurysms is challenging because the microsurgical trajectory adheres to the adjacent neurovascular structure , and final clip placement is hindered by the previous clip.2)8)22 ) thus , endovascular coiling is a preferable alternative treatment rather than a repeated microsurgical clipping.7)19 ) in our case , endovascular coiling was selected as an ideal treatment because of the aneurysm 's directionality and its irregular shape .
the aneurysm projected to the posteromedial direction of the ica , not to the usual posterolateral direction of pcoa aneurysms .
if surgical clipping had been selected for this patient , clip placement over the previous clip might be very difficult and identification of pcoa and its perforators could have been impossible . during the sac of the pcoa
aneurysm , sudden non - visualization of ipsilateral aca occurred . at that time , we suspected aca occlusion due to thrombus .
however , a contralateral ica angiogram through another femoral puncture confirmed that it was simply a change in flow direction caused by the stent overlapping the aca orifice . the cavernous ica injury developed from the proximal tip of a solitaire stent while we attempted to advance the microcatheter through the stent lumen .
fortunately , the injured portion of the ica was the cavernous portion instead of a supraclinoid portion , which could provoke a massive sah or even intracerebral hemorrhage ( ich ) .
direct ccf is usually managed by occlusion of the fistulous portion via a transvenous or transarterial approach.4)5)9 ) however , in our case , iatrogenic ccf was not treated because the fistula was only drained in an antegrade fashion to the inferior petrosal sinus , and the amount of fistulous flow was estimated to be minimal .
even though it was not a low - flow fistula , we thought there was a high chance of spontaneous occlusion .
furthermore , we expected that the consequences of persistent ccf would be benign because of the absence of intracranial or orbital reflux , even if spontaneous occlusion did not occur within a short term period.6)9 ) the solitaire stent is a new , self - expandable , laser - cut , and fully retrievable split - designed nitinol device which is useful in the treatment of aneurysms with wide necks or unfavorable geometric features.12 ) many recent studies have reported on the feasibility and efficacy of the solitaire stent in treatment of aneurysms at parent vessel bifurcations.10)16)20)23)29 ) the solitaire stent system consists of an attached firm push wire that enables the deployment and retrieval of the device ( fig .
although the solitaire stent is known to be highly flexible , the proximal tip component can not be flexible due to its structural nature .
if this point sticks against the vessel 's wall , or if it is pushed against the wall with other devices , the vessel can be injured due to the inflexibility of the proximal tip . in our case ,
the most common cause of direct ccf is trauma such as blunt head trauma , optic nerve injury and iatrogenic injury during transsphenoidal surgery.3)11 ) this type of ccf disrupts all layers of the vessel wall exteriorly and extensively , so that is less likely to resolve spontaneously and will require rapid treatment if symptoms occur.24 ) vessel wall perforation by a microcatheter or microwire is a rare complication during endovascular treatment .
kwon and jin reported two cases of direct ccf during microcatheter / microwire navigation that healed spontaneously.13 ) to the best of our knowledge , this is the first case of ccf provoked by an intraluminal stent .
this type of injury disrupts the vascular wall interiorly from the intima to the adventitia .
although the mechanism of spontaneous regression has not yet been elucidated , there is a hypothesis that the iodinated contrast media aggregation promotes clot formation in the focal injured vessel walls , causing spontaneous regression.17)21)26 ) we believe that iatrogenic ccf can be managed conservatively , especially if the fistulous flow does not involve intracranial and orbital circulation in retrograde fashion .
navigation of solitaire stent lumen with microcatheter can cause unexpected arterial injury , especially when the proximal tip is placed in the curved portion .
it seems to be desirable to place the proximal tip of solitaire stent in the straight portion whenever possible to reduce the risk of inadvertent arterial injury which might be caused by future navigation of stent lumen . | stent assisted coiling ( sac ) is a useful technique for the treatment of wide necked complex aneurysm . as the frequency of sac increases , stent - related complications such as thromboembolism , aneurysm rupture , and vessel rupture have been reported .
however , to the best of our knowledge , carotid - cavernous fistula ( ccf ) after sac has never been reported .
the authors experienced a case of direct ccf after a sac procedure for treatment of a complex posterior communicating artery ( pcoa ) aneurysm regrowth , which was treated by clip ligation 12 years before .
the patient was managed conservatively and angiograms performed three months after the procedure showed the complete obliteration of the left pcoa aneurysm and the spontaneous disappearance of ccf .
navigation of solitaire stent lumen with microcatheter can cause unexpected arterial injury , especially when the proximal tip is placed in the curved portion .
it seems to be desirable to place the proximal tip of solitaire stent in the straight portion whenever possible to reduce the risk of inadvertent arterial injury which might be caused by future navigation of stent lumen . |
these voiding problems may result from medication , cognitive changes ,
physical impairments , or neurological etiologies1 .
patients with spinal cord injury in the thoracic region were
selected for this study , and we monitored changes in their bowel function after performing
manual therapy along the colon . at the early stage of injury ,
the internal layer of the
rectum and the anal sphincter muscle are in a stage of complete incontinence2 .
the reflex of the voiding function is
restored by recovery of the central lumbar - sacral spinal cord after the acute stage3 .
peristalsis of the intestine and right side
colon are maintained by innervation from the vagus nerve so that feces are transported to
the large intestine .
after spinal cord injury , patients suffer from many kinds of problems
such as decreased muscle power and sensation , and impairment of the respiratory system and
other functions .
especially , spinal cord injury causes paralysis and high spasticity of the
anal sphincter , or results in problems of voiding dysfunction4 . in this study , we selected patients with thoracic and lumbar spinal
cord injury for treatment with manual therapy , as an intervention for defecation function .
our objective was to improve and enhance bowel function , to achieve the goal of patients
independence in activity of daily living ( adl ) .
twenty in - patients with spinal cord injury were selected at a hospital . there were 13 males
and 7 females ( mean age 39.70 5.25 ) .
the content of therapy included exercise therapy , setting up the habit of defecation ( i.e.
have a bowel movement at a regular time every day ) , maintaining a stable psychological
status of patients , drinking a certain quantity of water , having food fiber , mechanical
stimulation and combination medication .
manual therapy was applied to the patients abdomen
to modulate tension and improve peristalsis of the colon .
a secondary goal was to exercise
the pelvic floor muscles to help the patients to excrete .
each patient was positioned in
supine lying , with the hip and knee flexed at 90 degrees , with both legs on the therapist s
thigh to completely relax the patient s abdomen .
then , the therapist pressed down and pushed
along the colon ascendens , transverse colon , colon descendens and colon sigmoidem on the
surface of the abdomen .
vibration stimulus was applied to the small intestine through the abdomen . if
tension or spasm appeared in the abdomen , the therapist inhibited two key points , one point
being 2 fingers above the patient s umbilicus , and the other point being to the right and
below , 1/3 of the distance between the umbilicus and anterior superior iliac spine ( asis ) .
the fingers were pressed down on two points until the tension or spasm in the abdomen was
released .
, the dietary habit
did not change and the amounts of food and water taken were the same as before .
the paired
t - test was used to compare excretion timing and dosages of glycerine enema before and after
treatment .
all the subjects enrolled in the study receiving manual therapy 5 times a week for 12
weeks .
all the subjects
seemed to be very comfortable after manual therapy for the abdomen after 2 days to 1 week .
some patients reported their feces could be excreted in 2 hours after manual therapy was
implemented .
the statistical analyses found significant differences in both timing of bowel
movement and dosage of glycerine enema .
a statistically significant improvement was found in
the mean time of bowel movement ; it decreased from 94.00 16.35 minutes to 60.50 10.50
minutes after receiving manual therapy for 3 months .
the dosage of glycerine enema was
decreased from 68.05 8.90 ml to 31.50 11.82 ml ( table 2 , p<0.01 ) .
therefore , the methods of manual therapy and stimulation of
key points on the abdomen effectively improved the bowel function .
the main purpose
of the excretion therapy was to evacuate fecal matter from the colon in a regular interval
time . for spinal cord injury patients ,
the spinal reflex recovers gradually , so therapy for
bowel function is necessary during this period .
the large intestine serves to desiccate the
fecal matter as it is transported from the ileum to the rectum5 .
therefore , methods should be used to stimulate the colon sigmoideum
at a certain time for the patient .
besides this , in order to stimulate the stomach and the colon , patients
drank a hot drink slowly before recieving manual therapy for the abdomen .
if the rectum
reflex was areflexic due to upper motor neuron injury , lubricant oil was applied inside the
anus to stimulate the rectum with a finger .
the kind of food and water content has great influence on bowel frequency and the hardness
of fecal matter .
some foods that are rich in vitamins , raw vegetables , fruit , cold water and
milk soften fecal matter and promote peristalsis of the gut .
the quantity of food and the
meal time play very important roles in establishment of the habit of defecation6 .
for example , it is necessary to teach patients to
establish regular habits , to control their bowel function , and to keep good habits in adl ,
they must maintain a certain exercise regime or do some exercises when they are sitting in a
wheelchair .
we emphasize that plenty of water in the food must be taken by patients in each
meal everyday , otherwise there will be difficulty in defecation if the fecal matter becomes
over desiccated . although spinal cord injury patients want to have bowel movement everyday , they will
exhaust much energy and time , and also they will feel fatigue easily after they have
defecated .
it becomes
difficult to defecate if fecal matter is kept in the colon over 3 days .
it is dangerous to
cause paralytic ileus if fecal matter is kept in the colon for a long time .
the best timing
for evacuation is after breakfast , it can stimulate gastro - intestinal reflex hyperthyroid
activities to make evacuation easy .
moreover , a training plan for defecation should be set
according to the lifestyle habits of the patient and implementation of the plan for
defecation management7 .
several kinds of ability for defecation free of joint motion , residual muscle power and
sensation ( patient can look from mirror if no sensation around anus ) , sitting balance , hand
function ( ability to use auxiliary device ) and transfer ability , are needed for spinal cord
injury patients . if patients need to succeed at defecation independently , they must make
flexible use of the abilities mentioned above , as well as exercise rolling and taking off
and putting on clothes .
in addition , patients should be trained to look in a mirror and
insert a turunda into the anus with an auxiliary device while lying on their sides .
if
patients need to transfer to a sitting toilet , they must have the ability to take off their
trousers and transfer on the toilet pedestal within five minutes of inserting a turunda into
the anus .
after the training process for the above , patients can achieve this independence
goal gradually , and they can check their bowel movements themselves as well as cleaning the
anus with an auxiliary device after a bowel movement . | [ purpose ] the purpose of this study was to observe the effects of manual therapy on
bowel function of patients with spinal cord injury . [ subjects ]
the participants were 20
patients with spinal cord injury .
[ methods ] manual therapy was applied to the intestine
and along the colon ascendens , transverse colon , colon descendens and colon sigmoidem on
the surface of abdomen .
the results before and after 60 sessions ( 5 times / week , continued
for 12 weeks ) of manual therapy were compared .
[ results ] it was found that there were
significant effects both on shortening of bowel time and decreasing dosage of glycerine
enema every time patients needed to excrete . [ conclusion ] manual therapy had significant
effects on bowel function of patients with spinal cord injury . |
cataract surgery with intraocular lens ( iol ) implantation is a successful surgical procedure which has dramatically improved because of development in new techniques and devices , making it safer than it was two decades ago .
sutureless clear corneal incision , continuous curvilinear capsulorhexis ( ccc ) , phacoemulsification , and in - the - bag placement of a foldable iol represent the gold standard for routine cataract surgery .
although the surgical complication rate is low , anterior or posterior capsule opacification ( pco ) , capsule shrinkage or rupture , vitreous loss , and cystoid macular edema ( cme ) are some well - known complications of state - of - the - art cataract surgery .
posterior chamber iol subluxation or dislocation is uncommon but represents one of the most serious complications following cataract surgery .
these dislocations are divided into early and late cases ( table 1 ) .
early iol dislocation .
this early complication often occurs due to improper iol fixation within the secure capsular bag .
although zonular rupture may also be present preoperatively ( e.g. , in traumatic cataracts ) , dislocation is usually caused by tearing of the posterior capsule or rupture of the equatorial capsule and is often referred to as the sunset or sunrise syndrome [ 5 , 6 ] .
furthermore , a zonular rupture is also believed to be a main cause of early iol dislocation .
the zonules may be damaged during cataract surgery due to posterior pressure on the lens , either during a can - opener style
finally , zonular rupture can occur even during iol implantation . since the introduction of ccc with phacoemulsification the overall rate of iol dislocation during the early postoperative period has decreased , as ccc gives 360 optic support and allows for better iol fixation .
in contrast to early lens dislocation , bag dislocation generally occurs as a result of progressive zonular weakness many years after even uncomplicated cataract surgery , not from inadequate fixation of the iol [ 5 , 9 ] .
thus , the iol is dislocated within an intact capsular bag many years after uneventful surgery in eyes that have had capsulorhexis [ 3 , 4 , 1014 ] .
iol subluxation or dislocation within the capsular bag ( in - the - bag iol dislocation ) differs from out - of - the - bag dislocation in the period of time between original cataract surgery and iol dislocation , predisposing factors , and management .
retrospectively analyzed all the patients who were treated for late iol dislocation requiring surgical management after routine cataract surgery was performed .
they found that late iol dislocation after phacoemulsification was mostly of the in - the - bag type , with late out - of - the - bag dislocation in only 12.1% of the cases .
even though the rate of posterior chamber iol dislocation has been reported as 0.2% to 3% [ 1517 ] , late spontaneous dislocation is a small subset of this group .
the first case of late spontaneous in - the - bag iol dislocation was described in 1993 by davison as a result of the capsule contraction syndrome . since then , numerous isolated cases have been reported [ 3 , 11 , 19 ] .
there are several reports of series of patients with spontaneous late iol dislocation [ 3 , 4 , 911 , 19 , 20 ] .
although the exact incidence of this complication is not known , a survey of 2663 iols explanted between 1988 and 2001 demonstrated that
nevertheless , this relatively small number represents only the tip of the iceberg , and 20% to 30% of cataract surgeons surveyed at the beginning of the 21st century reported this late - onset complication .
furthermore , the incidence of late in - the - bag iol dislocation has been rising since the popularization of the capsulorhexis and is most likely caused by factors such as zonular weakness and zonular stress that can occur during surgery or postoperatively in association with a moderate increase in postoperative anterior capsular fibrosis [ 3 , 4 , 914 , 23 ] . in recent years , late in - the - bag
iol subluxation or dislocation has been reported with increasing frequency [ 3 , 4 , 912 , 23 , 24 ] , leading to concerns of a pending large increase in iol dislocations needing surgical intervention [ 3 , 4 , 11 , 25 , 26 ] .
it is not clear if it is secondary to an increased rate of incidence of iol dislocations or simply a larger community of at risk pseudophakic patients . in 2009 and 2010 , two population - based studies in sweden estimated that the incidence of late iol dislocation is low after phacoemulsification , but the authors were unable to significantly demonstrate an increased rate of incidence [ 14 , 20 ] .
more recently , a large retrospective , observational population - based cohort study identified a cumulative risk of iol dislocation following cataract extraction of 0.1% after 10 years , 0.2% after 15 years , 0.7% after 20 years , and 1.7% after 25 years . according to this study ,
the incidence of surgery specifically due to late dislocated iol is 0.0320.28% [ 20 , 28 ] .
however , the pseudophakic population in the western world is growing rapidly as a result of the improvement in the quality and safety of phacoemulsification surgery , its expanded indications , the new phacorefractive procedures , and a longer lifespan . therefore
, the incidence of late iol dislocation may still increase in the future [ 20 , 29 ] .
late in - the - bag iol subluxation or dislocation is a rare but serious complication due to progressive zonular dehiscence and contraction of the capsular bag many years after uneventful surgery .
it is characterized by an iol which is adequately fixed within the capsular bag . the entire lens - bag complex decenters with late dislocations .
zonular instability is the final common cause leading to within - the - bag dislocations .
in fact , two - thirds of the reported cases occurred in the following two years , and the mean time interval between cataract extraction and repositioning surgery ranges from 6.9 to 8.5 years [ 4 , 9 , 11 , 19 , 20 , 30 , 31 ] . in pseudoexfoliation ( pex ) cases the mean interval between cataract surgery and iol dislocation is usually of 5.58.5 years [ 1 , 3 , 4 , 7 , 9 , 10 , 23 , 29 , 32 ] , but some authors have treated cases presenting as late as 18 years after surgery .
found a significantly shorter interval in the eyes with a history of zonular laxity , cataract surgery complications , uveitis , and advanced or mature cataracts .
other authors observed that older age at cataract surgery and zonular dehiscence were significantly associated with a shorter time . because of the relatively long time frame for the presentation of this complication
, an epidemic may occur in the future [ 1 , 3 ] . according to fernndez - buenaga et al .
the mean age of the patients at explantation surgery was 71.2 years ( range 4197 ) .
likewise , patients in the high - myopia group were younger at time of explantation surgery than patients from the pex group .
most of the patients who underwent explantation due to late iol dislocation were males ( 68.9% ) .
this surprising result has also been found by other authors [ 9 , 10 , 14 ] and is difficult to explain because more women than men undergo cataract surgery and have pex .
thus , it has been suggested that there may be a gender - related difference that results in weaker zonulae in men with pex .
nevertheless , it is not clear because not all papers which this review is based on found a gender difference .
stern et al . reported that 9.1% of the patients had bilateral late in - the - bag iol dislocation , with a short period of time between both incidents .
these findings suggest that , in patients with pex , following iol dislocation in one eye , it is important to pay particular attention to the unaffected eye [ 9 , 12 , 35 ] .
several mechanisms have been involved in postoperative capsule dislocation : preoperative trauma or zonular weakness , capsule contraction syndrome , and surgical or postoperative trauma to the zonules . the exact role and relative importance of each mechanism
have not been widely agreed on and probably vary on a case - by - case basis .
it often develops slowly over a long postoperative period because surgeons rarely report intraoperative phacodonesis .
zonules are anchored by integrating in a mat - like fashion within the intrinsic fibers of the anterior and posterior capsules , approximately 2 mm anterior or posterior to the equator .
a small subset of zonules inserts into the equator of the lens capsule , but they seem to bear a much smaller force load .
zonules become more friable as patients age , especially in eyes with pex , where there is a severe epithelial atrophy compared to non - pex eyes of patients of the same age .
zonular disruption anywhere along the course could cause zonulysis .
it may be present to some degree after cataract surgery .
it happens as early as three months following phacoemulsification , but in the presence of solid zonule support does not lead to significant iol displacement .
when capsular shrinkage is extreme , it is called capsular contraction syndrome . such contraction results in additional stress on the potentially weakened zonules .
although the advent of ccc made secure in - the - bag fixation popular , it can induce capsular fibrosis [ 3 , 9 ] .
then , the sphincter effect of fibrosis around an intact ccc appears to be a factor in the development of significant capsule shrinkage . in the presence of a very small ccc
thus , ccc , particularly if its diameter is small , may be a significant risk factor for capsular contraction syndrome . some degree of capsular phimosis is frequent in most eyes following cataract surgery , but intense capsule shrinkage has only been described in cases with pex [ 18 , 39 , 40 ] , diabetes mellitus [ 10 , 38 ] , uveitis , pigmentary retinal degeneration , and myotonic dystrophy . in patients with late iol dislocation , the progressive weakening of already compromised zonules may make them vulnerable to continuous centripetal forces and cause their rupture . although some reports consider that either preoperative or surgical trauma might be a cause of luxation [ 17 , 42 ] , no pseudophacodonesis is noted immediately after surgery in any reported case .
furthermore , the contribution of neodymium : yag ( nd : yag ) laser posterior capsulotomy to the late in - the - bag iol dislocation syndrome is another obscure point .
although it has not been clarified yet , the impact of laser energy for treating posterior capsular opacification might be the triggering event for the subluxation [ 3 , 4 ] .
likewise , the need for capsulotomy is an indicator of significant cell proliferation and of increased capsular bag weight . because of this
, it is reasonable to assume that , in eyes with fragile zonules , nd : yag capsulotomy could produce further loosening and should therefore , in these situations , either be carefully performed or be delayed until after secondary surgery .
finally , major or minor postoperative trauma to the zonules ( e.g. , repeated eye rubbing ) may contribute to bag dislocation [ 9 , 43 ] .
indeed , gimbel et al . reported a known traumatic incident in 11.1% of patients .
although there are multiple predisposing factors , including aging , high myopia [ 25 , 45 ] , uveitis [ 4 , 9 , 18 , 25 , 46 ] , trauma [ 4 , 9 , 43 , 45 , 47 ] , previous vitreoretinal surgery [ 4 , 7 , 9 , 46 ] , retinitis pigmentosa [ 3 , 911 ] , diabetes mellitus , atopic dermatitis , previous acute angle - closure glaucoma attack , and connective tissue disorders , such as marfan 's syndrome , homocystinuria , hyperlysinemia , ehler - danlos syndrome , scleroderma , and weill - marchesani syndrome , pxf is the most common risk factor , accounting for more than 50% of cases [ 1 , 3 , 4 , 7 , 912 , 20 , 27 , 29 , 32 , 35 , 4951 ] .
all these factors seem to increase the risk of zonular weakness and capsular contraction [ 911 ] .
we have reviewed the main risk factors predisposing to zonular instability and capsular contraction : pex and high myopia .
pex syndrome is a pathological condition consisting of a meshwork of abnormal fibrillar material , deposited on the lens surface and into all structures in the anterior chamber .
these accumulations may both mechanically and enzymatically damage the zonules , weaken their points of anchorage to the ciliary body and lens [ 52 , 53 ] , and facilitate the anterior capsule contraction syndrome that , if left untreated , usually leads to zonular failure [ 18 , 40 ] .
pex has always been the most recognized predisposing factor for late dislocation [ 4 , 11 , 35 ] .
pex is also thought to have a genetic basis associated with lysyl oxidase - like 1 ( loxl1 ) allelic variants .
loxl1 is a member of a gene family that plays an important role in elastin metabolism .
have recently provided a complete histopathologic analysis of explanted capsular bags that are spontaneously dislocated in the late postoperative period .
these authors demonstrated that pxf material is present in a larger proportion of late in - the - bag iol subluxations and dislocations than the number currently detected clinically , as a result of significant clinical underdiagnosis .
indeed , pex can be a difficult clinical diagnosis , with many subclinical cases going unnoticed until well advanced [ 5658 ] .
the incidence of pex varies widely according to geographical location and ethnicity [ 5961 ] ; therefore , the incidence of in - the - bag dislocation is expected to vary accordingly .
certain studies have evaluated the rate of pxf in specific populations , finding a higher incidence ( 25% to 30% ) in some ethnic groups , such as northern scandinavians [ 62 , 63 ] , saudi arabians , and navajo indians .
liu et al . demonstrated a nearly 2 : 1 female predilection .
stern et al . demonstrated that long after phacoemulsification surgery ( 6 - 7 years ) , iols were positioned significantly lower in pex patients than in controls , suggesting zonular weakness in at least some of them .
high myopia is a well - known risk factor for late iol dislocation [ 45 , 65 , 66 ] .
nevertheless , only one article presented this condition as the main risk factor for late spontaneous in - the - bag iol dislocation , finding it in 19.7% of the cases .
high - myopic eyes show some typical alterations due to thinning and degeneration of several eye layers as lacquer cracks , chorioretinal atrophy , or posterior staphyloma .
it has been hypothesized that , as well as the previously mentioned alterations , these eyes may be also more prone to zonular failure due to excessive elongation of the zonular fibers , which have to support greater stress than in emmetropic eyes [ 68 , 69 ] .
the recognition of risk factors for this complication suggests a modified approach in cases at risk .
thus , ccc diameter should be smaller than the optic , but a particularly small opening should be avoided , because it increases capsule fibrosis and shrinkage . if capsulorhexis fibrosis and contracture are detected , relaxing cuts with nd : yag laser should be performed . during phacoemulsification , caution should be given to keeping the integrity of zonules .
aspiration of cortex directed in a tangential fashion rather than perpendicular to the zonules may decrease the incidence of zonular rupture .
this may be technically difficult in eyes with pex due to the small pupil , poor resistance by the zonules , and possible lens subluxation .
particular attention should be paid to implanting a posterior chamber iol in the capsular bag in eyes with weakened zonules when progressive zonular disruption is anticipated .
we plan haptics in the sulcus and iol capture through an anterior capsulorhexis preoperatively in eyes with risk factors such as pex , retinitis pigmentosa , uveitis , and long axial length without a capsule tear and vitreous loss .
single - piece poly(methyl methacrylate ) ( pmma ) iols may counteract capsule contraction better than 3-piece pmma iols [ 9 , 25 ] . it has also been suggested that a 3-piece hydrophobic acrylic iol may reduce ccc shrinkage through a combination of decreased anterior capsule fibrosis and greater haptic rigidity [ 22 , 35 ] .
several authors consider that 1-piece acrylic iols may produce greater capsular contraction or offer less haptic resistance to contraction than 3-piece acrylic lenses .
it is well known that silicone induces much more capsular fibrosis and risk of iol dislocation .
there is no doubt that plate - haptic silicone iols induce the most capsulorhexis contracture , suggesting they may be contraindicated in high - risk cases .
although there is no proof of the use of ctrs to prevent iol dislocation , theoretically , the routine use of capsular tension rings ( ctrs ) seems to provide a reasonable preventive measure , since there is evidence on its role in preventing zonular loss during surgery [ 8 , 11 , 70 ] .
they would be indicated when there is zonular instability following surgical or postoperative trauma or in cases of inherently weak zonules , as in pex syndrome [ 7173 ]
. moreover , ctrs may prevent intraoperative zonular dehiscence and decrease but not avoid [ 7678 ] postoperative capsule shrinkage .
ctrs may also prevent capsular folds and , in that way , reduce the rate of posterior capsular opacification [ 2 , 71 ] . in the absence of significant zonular rupture , routine ctr implantation in cases at risk
may diminish the incidence of postoperative iol decentration due to the resistance to capsular contraction .
finally , nd : yag laser posterior capsulotomy should be carefully performed in pex eyes before any visible capsular contraction . | posterior chamber intraocular lens ( pc - iol ) subluxation is uncommon but represents one of the most serious complications following phacoemulsification .
late spontaneous iol - capsular bag complex dislocation is defined as occurring three months or later following cataract surgery . unlike early iol dislocation ,
late spontaneous iol dislocation is due to a progressive zonular dehiscence and contraction of the capsular bag many years what seemed to be uneventful surgery . in recent years , late in - the - bag
iol subluxation or dislocation has been reported with increasing frequency , having a cumulative risk of iol dislocation following cataract extraction of 0.1% after 10 years and 1.7% after 25 years .
a predisposition to zonular insufficiency and capsular contraction is identified in 90% of reviewed cases .
multiple conditions likely play a role in contributing to this zonular weakness and capsular contraction .
pseudoexfoliation is the most common risk factor , accounting for more than 50% of cases .
other associated conditions predisposing to zonular dehiscence are aging , high myopia , uveitis , trauma , previous vitreoretinal surgery , retinitis pigmentosa , diabetes mellitus , atopic dermatitis , previous acute angle - closure glaucoma attack , and connective tissue disorders .
the recognition of these predisposing factors suggests a modified approach in cases at risk .
we review certain measures to prevent iol - bag complex luxation that have been proposed . |
tumor necrosis factor- ( tnf- ) is a pleiotropic cytokine which plays a major role in the development , homeostasis , and adaptive responses of the immune system .
in fact , it is central to the initiation and maintenance of inflammation in multiple autoimmune and nonautoimmune disorders .
tnf- , which is released by macrophages , monocytes , and t lymphocytes , as well as other types of cells , can be found both in its soluble form and bound to the cellular membrane [ 13 ] .
the better understanding of the pathogenesis of autoimmune disorders has led to the search of new targets for its treatment . in this way , biological therapies , which are synthesized from living organisms ,
can be designed to specifically act on certain inflammatory mediators , among them , tnf-. thus , reinforcement or even substitution of usual immunosuppressive therapies has now been made possible [ 1 , 3 ] .
currently , five anti - tnf agents are commercially available : infliximab , etanercept , adalimumab , certolizumab pegol , and golimumab ( table 1 ) .
( a ) infliximab ( inx ) is an igg1 chimeric monoclonal antibody with a constant human region and a variable murine one .
this agent binds both the soluble and the cell - bound tnf- but not tnf-. it is administered intravenously on an outpatient basis , and even though serious infusion reactions are rare , development of antibodies against inx has been reported ( incidence varying between 15% and 50% ) .
the latter has been associated with a lower efficacy and a higher rate of infusion reactions . in order to avoid the formation of these antibodies , low - dose methotrexate ( usually 7.5 mg weekly )
it is obtained by means of recombinant dna technology , by fusion of the extracellular region of two type ii tnf receptors and the fc region of human immunoglobulin g1 [ 1 , 3 ] .
skin reactions at the site of injection have been reported in up to 40% of cases , and although antibodies against etp are present in less than 10% , a lower efficacy has not been observed [ 1 , 3 ] .
( c ) adalimumab ( adb ) is a fully humanized igg1 monoclonal antibody , specifically directed against tnf- , which binds both its soluble and cell - bound forms .
due to its more recent release , data regarding safety , as well as the incidence of antibodies directed against adb and their possible effect on its efficacy , are insufficient .
( d ) certolizumab pegol ( czp ) is a pegylated humanized antibody fab ' fragment of a monoclonal antibody specifically directed against tnf- , which binds both its soluble and the cell - bound forms .
( e ) golimumab ( glb ) is a fully humanized igg1 monoclonal antibody , specifically directed against tnf- , which binds both its soluble and cell - bound forms .
these five tnf - blocking agents are currently licensed for the treatment of a variety of disorders , namely , ra ( inx , etp , adb , czp , and glb ) , juvenile idiopathic arthritis ( jia ) ( etp and adb ) , ankylosing spondylitis ( as ) ( inx , etp , adb , and glb ) , psoriasis ( inx , etp , and adb ) , psoriatic arthritis ( psa ) ( inx , etp , adb , and glb ) , crohn 's disease ( cd ) ( inx , adb , and czp ) and ulcerative colitis ( uc ) ( inx and adb ) [ 35 , 79 ] . nonetheless , the tnf - blocking agents are being used in an increasing number of autoimmune disorders , in those cases which are severe and resistant , or intolerant , to standard immunosuppressive therapies .
the aim of this paper is to discuss the available data regarding the off - label uses of the anti - tnf agents in three specific frequent disorders : behet 's disease , sarcoidosis , and noninfectious uveitis . at present , there is no published literature with regard to the use of czp in these three conditions , while that concerning the use of glb is limited to a few cases of uveitis or retinal vasculitis with dissimilar results .
behet 's disease ( bd ) is a systemic vasculitis involving arteries and veins of any size , with a chronic - relapsing course , of unknown cause and with hla - b51 as an admitted predisposing factor .
the main manifestation of bd is recurrent oral ulcers , to which genital ulcers and systemic manifestations may be associated .
thus , bd may also involve the eyes , skin , nervous system , joints , kidneys , and arteries and veins of all sizes .
since sensitive or specific laboratory tests or specific pathologic findings are currently absent , the diagnosis is based on clinical criteria .
topical treatment is initially used for oral ulcer and mild ocular involvement . in the rest of cases ,
other therapies have been employed , such as colchicine , steroids , dapsone , thalidomide , methotrexate , azathioprine , cyclosporine a , cyclophosphamide , and mycophenolate .
notably , the main issue is the lack of controlled evidence regarding therapeutic options , especially in cases of neurological , vascular , and gastrointestinal manifestations .
tnf- is believed to be a central inflammation mediator in bd , and , consequently , the tnf - blocking agents have been used in this disorder with different results .
as it will be detailed later on , existing evidence on anti - tnf therapy in bd suggests that inx seems to be effective in ocular inflammation ( mainly in posterior uveitis with serious risk of view loss ) , as well as extraocular manifestations . on the contrary
, etp has apparently shown better results in mucocutaneous lesions , even though enough data regarding its efficacy in ocular and articular involvement are insufficient , chiefly based on a few single case reports [ 1113 ] .
, in a 4-week randomized , double - blind , placebo - controlled trial , observed that patients treated with etp achieved sustained remission for oral ulcers and nodular lesions , whereas no significant differences could be found regarding genital ulcers and papulopustular lesions .
patients receiving etp showed a lower number of arthritis episodes , although the difference was not significant .
conversely , two patients with neuro - bd have been reported to respond to etp [ 15 , 16 ] .
a panel expert meeting on bd held in may 2006 recommended considering the use of inx in patients with two or more relapses of posterior uveitis or panuveitis per year , loss of visual acuity secondary to chronic macular cystoids edema , refractory parenchymal central nervous system disease , selected patients with intestinal inflammation , or in those with articular or mucocutaneous involvement which significantly affects their quality of life ( in whom etp might also be considered ) . in cases of bilateral posterior uveitis with serious risk of view loss
, a single dose of inx could be administered in order to prevent irreversible damage of the retina with permanent visual acuity loss .
after that , the usual immunosuppressive therapy would follow ( cyclosporine a or azathioprine , or even interferon - alpha , combined with low - dose corticosteroid ) .
subsequent to the publication of these recommendations , several case series have been published regarding eye , central nervous system , and bowel involvement , which further support the role of inx in the treatment of bd , usually being well tolerated and with hardly any side effects ( except for one case of cytomegalovirus colitis ) [ 1723 ] .
inx has subsequently been approved in japan for the use of bd - related uveoretinitis not responding to conventional treatments . before and after the aforementioned recommendations
, several prospective studies on the therapeutic use of inx for posterior uveitis reported a sustained response , with improvement of visual acuity and reduction of eye inflammation , either complete ( 65% ) or partial ( 24% ) .
this ocular remission was better maintained if combination with immunosuppressive agents was employed ( azathioprine , cyclosporine a , and/or methotrexate ) , although it was only statistically significant for combination with cyclosporine a . in another prospective study , the authors found that the effects of inx on reducing ocular inflammation were significantly faster than those of intravenous methylprednisolone or intravitreal triamcinolone acetonide , while the effect on visual acuity did not differ among them .
besides , the efficacy of inx on bd uveitis seems to be maintained in the long term . on the other hand ,
the intravitreal use of a single dose of ifx has been tested on a 15-patient pilot study with bd - associated relapsing posterior uveitis at the beginning of a unilateral attack .
the outcomes of this study were significantly positive , while no side effects were noticed , either ocular or extraocular .
however , despite the good results reported in all these studies , uveitis may recur .
, in a retrospective study , observed that 13 of 23 patients presented with recurring uveitis following treatment with inx , with a variable timing .
the authors gave three possible explanations : ( 1 ) it might be a rebound effect due to a quick discontinuation of the patients ' previous immunosuppressants ; ( 2 ) it might be the result of too long interval between infusions after the fourth one ; ( 3 ) it might be the consequence of neutralization of inx by antibodies directed against it .
furthermore , small prospective studies and some case series and isolated patients have shown excellent response to inx in gastrointestinal involvement , central nervous system manifestations , pulmonary aneurysms , and other vascular involvements but not in hepatic vein thrombosis [ 12 , 2830 ] .
, 10 patients with severe gastrointestinal involvement and who were irresponsive or intolerant to corticosteroids responded rapidly and dramatically to inx monotherapy
. moreover , improvement of abdominal computed tomography and colonoscopy in the long - term evaluation was noted . in another study ,
five patients with neuro - behet 's disease and resistant to methotrexate and steroids received inx as add - on therapy .
they all showed clinical amelioration , along with regression of parenchymal lesions in magnetic resonance imaging and decrease of il-6 levels in cerebrospinal fluid .
however , not only has the clinical response of inx in bd been analyzed but also its effects on health - related and vision - related quality of life , with significant improvement of the scores .
nonetheless , since it shares a similar mechanism of action with inx , the results were therefore expected to be comparable to those of the latter .
in fact , a good number of the cases reported in the literature refer to patients who were switched from inx to adb due to intolerance or failure to treatment compliance in cases of eye involvement , with no loss of efficacy [ 34 , 35 ] .
a subsequent observational study reported either sustained remission or good response in 17 bd patients ( including mucocutaneous and neurological manifestations , as well as retinal vasculitis ) , who had to be switched to adb due to lack or loss of efficacy , or else , infusion reactions .
a more recent case series observed a clinical improvement following treatment with adb in 17 out of 19 patients , mainly with ocular , gastrointestinal , mucocutaneous , and peripheral nervous system involvement .
five of them had previously received inx and 2 etp , both of which had proved ineffective .
further case reports or small case series have shown good results with adb in patients with different manifestations ( gastrointestinal , mucocutaneous , neurological , articular , ocular , and vascular ) , either in anti - tnf nave patients or following failure of inx [ 3840 ] .
sarcoidosis is a chronic , multisystemic disorder of unknown etiology , whose main characteristic is the development of noncaseating granulomas .
these lesions may involve any part of the body , mostly the lungs and the thoracic lymphatic nodes .
granulomas can also affect the nodes of other parts of the body , skin , and eyes .
the fact of tnf- being one of the participating cytokines in the formation of the sarcoid granuloma , along with the successful use of immunomodulators inhibiting the tnf- such as pentoxiphylline and thalidomide , has led to the utilization of anti - tnf agents in numerous patients .
most of them have received treatment with inx , and while skin involvement seems to show better results , those regarding pulmonary involvement tend to be less positive . likewise , a good response to inx in other locations , such as ocular , neurologic , articular , cardiac , hepatic , renal , vertebral , and parotid gland , has also been reported [ 3 , 38 , 4159 ] .
a multicentre , double - blind , randomized , placebo - controlled trial on the efficacy of inx in 138 patients affected with extrapulmonary sarcoidosis was recently published .
severity of extrapulmonary sarcoidosis decreased in over 40% of patients compared to placebo after 24 weeks of treatment , even though this difference disappeared once inx was discontinued .
in addition , a retrospective study involving 54 patients with lupus pernio found that inx seemed to be superior to systemic steroids in achieving resolution or near resolution of lesions , with or without other additional medications . a subsequent double - blind , placebo - controlled trial with 134 patients with chronic pulmonary sarcoidosis found a modest though significant increase of forced vital capacity following inx therapy .
the clinical response was stronger in those patients with an important baseline systemic inflammatory profile ( which included different chemokines , neutrophil - associated proteins , acute - phase proteins , and metabolism - associated proteins ) , and it correlated with the decrease of inflammatory serum proteins , namely , mip-1 and tnf - rii .
also , in a small case series , 9 patients with pulmonary involvement experienced an improvement in lung functions tests after treatment with inx , even though only one patient normalized chest radiograph .
finally , two small , retrospective studies have assessed the long - term efficacy of inx in sarcoidosis with pulmonary and extrapulmonary involvement . in one of them , with 16 patients
only one patient had inx discontinued due to adverse events . in the other one , with 26 patients , a sustained remission or improvement in almost 59% of the organs evaluated was achieved .
inx had to be withdrawn because of adverse events in 3 patients , namely , severe pneumonia , positive purified protein derivative tuberculosis skin test , and recurrent sinusitis . on the contrary ,
results with etp are discouraging , similarly to other granulomatous disorders [ 3 , 42 , 43 ] . in two small studies , one with patients with pulmonary sarcoidosis and another with patients with ocular sarcoidosis ,
in addition , the first trial had to be terminated due to excessive treatment failures [ 65 , 66 ] .
this lack of efficacy of etp in granulomatous conditions has been attributed to its different mechanism of action , compared to that of inx and adb .
several case reports have shown adb to be efficacious in patients with different involvements ( systemic , cutaneous , lymphadenopathies , inner ear , neurological , pulmonary , ocular , vertebrae and bone marrow ) , in one of them after etp failure [ 56 , 59 , 6773 ] .
more recently , a double - blind , placebo - controlled trial assessing the effect of adb in 16 patients with cutaneous sarcoidosis was published .
adb proved to be effective in improving both clinical lesions ( physician global assessment , target lesion area and target lesion volume ) and dermatology life quality index score , even though this effectiveness partially wore off after an 8-week period of adb withdrawal .
another recent prospective study with 26 patients with refractory posterior uveitis revealed improvement or stabilization of intraocular inflammatory signs in 85% and 15% of patients , respectively .
other indicator of disease activity ( pulmonary lung tests , laboratory tests ) also improved . finally , the report of the onset of new sarcoid granulomas following treatment with anti - tnf agents for another reason ( ra , as , psa , and sapho syndromes ) is but paradoxical .
the locations affected vary ( lungs , central nervous system , bone marrow , skin , eyes , lymph nodes , liver , kidneys , joints , and parotid gland ) , and all the three tnf - blocking agents have been associated with this unexpected adverse event .
the sarcoid granulomas usually resolved upon cessation of tnf- blockade and/or increase or initiation of oral steroids [ 7689 ] .
even more shocking are the cases reported in which sarcoid granulomas disappeared after switching from etp to adb ( since the initial patient 's conditions so required ) or did not relapse after reintroducing the same agent [ 90 , 91 ] .
the mechanism by which anti - tnf agents could induce sarcoidosis remains unclear . on the one hand ,
the role of tnf- in sarcoidosis seems to be partial and to change as the disease evolves .
on the other hand , there is evidence that tnf- and interferon- ( ifn- ) show cross - regulation in vitro and in vivo .
thus , suppression of tnf- levels would lead to an increase in those of ifn-. and ifn- has been reported to induce sarcoidosis and other autoimmune diseases .
the results from experimental models in animals as well as studies in humans suggest that tnf may play a central role in promoting ocular inflammation .
thus , intravitreal injection of tnf in rabbits and lewis rats has shown to induce the development of uveitis [ 9597 ] . likewise , increased levels of tnf have been detected in serum and/or aqueous humor of uveitis patients when compared with controls . based on these observations ,
therapy with tnf blockade has been utilized in ocular inflammatory disorders , either isolated or associated with systemic conditions .
even if limited , the existing evidence implies that inx seems to be more effective than etp in the treatment of ocular inflammation .
the reported cases and case - series regarding inx suggest its efficacy in treating noninfectious uveitis and other ocular inflammatory disorders .
as far as uveitis associated with other disorders , such as jia , as , cd , psoriasis and takayasu arteritis , is concerned , inx has revealed equally effective [ 7 , 42 , 55 , 98107 ] .
braun et al . reviewed the outcomes of different open studies and placebo - controlled trials with as patients treated with either inx or etp .
they found that attacks of anterior uveitis ( au ) had become less frequent ( 15.6 per 100 patient - years in the placebo group versus 6.8 per 100 patient - years in the patients treated with anti - tnf agents [ p = 0.01 ] ) .
this reduction in frequency was more marked , though not significant , in the patients receiving inx than in those treated with etp ( 3.4 per 100 patient - years and 7.9 per 100 patient - years , resp . ) .
more recently , cantini et al . observed that inx was effective and safe in the long term in 14 patients with idiopathic posterior uveitis .
treated 10 eyes of 7 patients with chronic persistent noninfectious uveitis with a single intravitreal injection of ifx , resulting in a significant improvement of visual acuity and reduction of central macular thickness .
additionally , adb was found to be effective in 16 out of 18 children with uveitis treated by biester et al .
( 17 jia associated and 1 idiopathic ) , and gallagher et al . observed an inflammation decrease in 50% of the 10 eyes of the 5 patients receiving adb . since adb possesses a similar mechanism of action to that of inx , comparable results to those of the latter
in fact , a retrospective study with 43 spondyloarthropathies treated with anti - tnf agents , noted that those receiving inx or adb presented a lower rate of uveitis relapses than those treated with etp ( number of uveitis flares/100 patient - years before and during etp treatment : 54.6 versus 58.5 [ p = 0.92 ] , number of uveitis flares/100 patient - years before and during inx or adb treatment 50.6 versus 6.8 [ p = 0.001 ] ) . a european multinational , open - label , nonplacebo - controlled trial with 1250 as patients treated with adb was recently published .
in this study , it was observed that the au attack rate was reduced by 51% in all patients , by 58% in the 274 patients with a previous history of au , by 68% in the 106 patients with a recent history of au , by a 50% in the 28 patients with active au at the beginning of the trial , and by 45% in the 43 patients with chronic uveitis .
furthermore , au attacks during adb treatment were generally mild . in another study by daz - llopis
after one year of follow - up , visual acuity had improved in 31% of eyes , control of intraocular inflammation had been achieved in 63% of patients , the cystoid macular edema present in 86% of eyes at baseline had disappeared in 55% of eyes , and all patients had been able to have their dosage of baseline immunosuppressants reduced at the end of follow - up in at least a 50% .
uveitis relapsed in 42% , but it was easily controlled with a single intraocular injection of steroids . further increasing evidence in recent years supports the benefits of adb in the treatment of uveitis .
thus , a case interventional study with 17 children with chronic uveitis ( 9 of whom had previously received another anti - tnf blocker ) found that adb improved visual acuity .
one patient had adb discontinued due to the development of varicella zoster infection . in a larger case series study ( 131 adults with idiopathic or secondary refractory uveitis ) ,
the authors observed a significant improvement of visual acuity as well as intraocular inflammation parameters after a 6-month period of treatment with adb .
additionally , patients could significantly reduce their baseline immunosuppression load ( 8.81 [ 5.05 ] versus 5.40 [ 4.43 ] ; p = 0.001 ) .
in fact , 85% of patients had been able to reduce at least 50% of their baseline immunosuppression load at the end of the study .
three further case series with 31 ( prospective ) , 60 ( retrospective ) , and 21 patients ( prospective ) , respectively , have shown equally positive outcomes when treating refractory uveitis with adb [ 118120 ] . finally , two studies have compared adb with inx in the treatment of uveitis . in one of them ,
48 pediatric patients with jia - associated au from the national italian registry were treated with ifx , while 43 received adb for the same reason .
after at least one year of follow - up , remission rate was significantly higher with adb ( 67% ) than with ifx ( 43% ) . in the other one , an open - label prospective study with 33 children with chronic uveitis from different etiologies ( 16 received ada and 17 inx ) , authors observed a significantly higher probability of remission with adb than with infx after 40 months of follow - up .
in contrast to these results , there exist multiple cases in the literature reporting the occurrence of uveitis following anti - tnf therapy . in this regard ,
a study based on a registry of uveitis cases developed under treatment with ifx , adb , or etp in the usa found a significantly higher number of cases related to the use of etp than to the other two agents ( 43 with etp , 14 with inx , and 2 with adb ) , even when the patients whose underlying disorder was associated with uveitis had been excluded .
the authors concluded that these results suggest a relationship with the development of agent - specific uveitis rather than with the anti - tnf blockers on the whole .
nonetheless , they admitted the lack of enough evidence to discourage the use of etp in the treatment of uveitis . in another subsequent study based on a french survey
, 31 cases of new onset of uveitis during treatment with anti - tnf blockers were reported .
again , etp was the agent most frequently associated with this event , 23 cases as opposed to 5 with inx and 3 with adb .
in addition , the author performed a review of the english literature , which produced comparable results : 121 cases ( including those of the aforementioned study ) , 103 of which were on etp at the time of apparition of the uveitis .
no specific adverse effects of anti - tnf therapy when treating bd , sarcoidosis , and noninfectious uveitis have been reported , other than those already known to these agents .
these adverse effects include infections ( especially tuberculosis ) , demyelinating diseases , malignancies ( lymphomas ) , allergic reactions , development of autoimmunity , hepatitis , and new onset or worsening of existing congestive heart failure . as to safety during pregnancy , anti - tnf agents are classified in category b .
tnf blockade has widely been used off - label , even though there is not any trial - based evidence to support it , except for the experience provided by cases and case series .
this experience , which is continuously increasing , has yielded encouraging results , especially regarding ocular , cutaneous , and articular involvement , both in the disorders for which this therapy is licensed and in those for which they are not , such as bd .
as far as individual agents are concerned , the largest available experience and the best outcomes on the whole are with inx , particularly in ocular , neurological , and gastrointestinal involvement in bd , skin lesions in sarcoidosis , and noninfectious uveitis , associated or not to another disorder . instead
, etp has not proved effective in granulomatous diseases , as it had already been observed in conditions for which the tnf blockade is approved , such as cd , which could be the consequence of a different composition and mechanism of action . as to adb ,
nowadays , however , the growing evidence suggests that adb may be more effective than inx in certain cases , such as noninfectious uveitis .
besides , its subcutaneous administration , which allows the patient to self - administer it at home , along with a similar mechanism of action to that of inx , makes the future of adb most promising . finally , the safety profile of these agents needs to be more specifically established .
nonetheless , it seems clear from the published literature that incidence of opportunistic infections ( mostly tuberculosis ) is increased and so does the development of autoimmunity . on the contrary ,
aspects like the association with demyelinating diseases and the occurrence of lymphomas need additional clarification . in sum , further randomized , controlled trials are required to adequately assess the actual benefits and safety profile in the long term of anti - tnf agents in bd , sarcoidosis , and noninfectious uveitis . | tumoral necrosis factor plays a central role in both the inflammatory response and that of the immune system .
thus , its blockade with the so - called anti - tnf agents ( infliximab , etanercept , adalimumab , certolizumab pegol , and golimumab ) has turned into the most important tool in the management of a variety of disorders , such as rheumatoid arthritis , spondyloarthropatties , inflammatory bowel disease , and psoriasis . nonetheless ,
theoretically , some other autoimmune disorders may benefit from these agents .
our aim is to review these off - label uses of anti - tnf blockers in three common conditions : behet 's disease , sarcoidosis , and noninfectious uveitis . due to the insufficient number of adequate clinical trials and
consequently to their lower prevalence compared to other immune disorders , this review is mainly based on case reports and case series . |
the natural homeostatic processes in the human body often result in a physical decline with age .
we lose bone mineral density ( bmd ) , muscle mass , and strength and we have an increase in fat mass , ultimately resulting in reduced physical performance [ 14 ] . as such , with aging there is generally an increased risk of acute and chronic conditions including greater frequency of bone fractures , obesity , diabetes , coronary heart disease , and cancers .
however , by performing resistance training ( rt ) a person can improve their strength , muscle size , cardiovascular fitness , metabolic health , and bmd . as a result , people can decrease the potential for injuries through strengthening their joints , tendons , and ligaments [ 11 , 12 ] .
hurley and roth comment that the data suggests that ~2 decades of age - associated strength loss can be regained in ~2 months of resistance exercise . indeed , reduced strength has been shown to be a strong risk factor for all - cause mortality independently of muscle mass .
reported reversal in mitochondrial deterioration to the extent that participants with an average age of 68 years showed mitochondrial characteristics similar to those of persons with a mean age of 24 years following 6 months of resistance exercise .
indeed , the evidence supports that resistance exercise reduces the risk of all - cause mortality [ 1417 ] .
previous publications have suggested that greater loads result in greater increases in strength for older adults [ 1821 ] .
previous reviews in asymptomatic individuals of younger and middle age people have suggested that when intensity of effort is controlled , research does not support the superiority of a particular load and/or repetition range for increasing muscular strength and size .
other publications have discussed that differences in low and high loads can be equated in intensity of effort and thus negated by increasing repetition duration of low load training groups .
research in young adults has supported this proposition showing similar strength and hypertrophic increases when using low loads ( 5060% 1-repetition maximum ( 1 rm ) ) for longer repetition duration ( 3 seconds concentric : 1 second isometric : 3 seconds eccentric ( 3 : 1 : 3 ) ) compared to higher loads ( 8090% 1 rm ) at shorter repetition durations ( 1 second concentric : 1 second eccentric ( 1 : 1 ) ) [ 23 , 24 ] . more recently van roie et al .
have also reported nonsignificant differences in strength increases between low ( 2040% 1 rm ) and high ( 80% 1 rm ) training loads in older adults when exercise is taken to a point of muscular failure .
certainly this is of important consideration since exercise ~1 rm produced an orthopaedic injury prevalence of ~20% in older adults .
in addition heavy loads / shorter repetition duration appear more likely to cause muscle soreness which appears counterintuitive to persons wishing to improve their quality of life .
we should also consider that near maximal loads are simply not representative of normal daily function .
previous research has concluded that single sets of an exercise , performed to momentary muscular failure , produce similar strength gains to multiple sets [ 6 , 28 , 29 ] . this remains a contentious issue in the field ;
however , there is limited research which has implemented and evaluated a single set approach with older adults .
indeed , a recent meta - analysis of resistance exercise in older adults reported that all included studies used a multiple - set method .
in fact , westcott et al . assessed a single set approach using 13 resistance exercises , 2 - 3/week with older adults and reported significant strength increases favouring a group training at long repetition duration ( 10 seconds concentric : 4 seconds eccentric ) compared to a group training at a more moderate repetition duration ( 2 seconds concentric : 1 second isometric : 4 seconds eccentric ) .
theoretically , moving a load more slowly ( for a longer repetition duration ) decreases the potential for external forces such as momentum to interact , thus maintaining muscular tension and likely increasing intensity of effort .
evidence supports that fewer repetitions are possible when moving a load at a longer - compared to shorter - repetition duration [ 3335 ] .
van roie et al . also considered the use of a single set protocol with older adults but limited training and testing to lower body exercises only . in an aging population with only 1015% of persons over 55 years of age performing any strengthening activities it is important to consider time - efficient methods which might encourage exercise adherence .
the present authors have previously recommended single sets of an exercise , performed infrequently ( 1 - 2/week ) , to a high intensity of effort , using resistance machines through a full range of motion , at a repetition duration that maintains muscular tension as being optimal for increasing strength whilst efficiently using time and minimising risk of injury [ 6 , 37 ] . whilst data from westcott et al
. supports this approach , the present study represents a further decreased volume of training .
the authors have worked closely with a uk exercise facility which uses these recommendations , categorically clarifying that all exercise sessions will be completed in < 15 minutes , whilst stringently recording all workout data . as such , the present study aims to retrospectively present the data from the members of that facility emphasizing the ecological validity of real people in a real gym , rather than a laboratory gym in which most research is undertaken and restricted by specific protocols and research questions .
this study was a retrospective analysis of strength outcomes of a cohort of members from a private uk based exercise facility .
the facility uses standardised training protocols with members with all sessions being supervised by the same trainers who make meticulous records of every session allowing for analysis of load progression as a measurement of strength gains as a result of the training protocol administered .
participants training records were examined from the period beginning from january 2013 through to april 2014 .
the study design was approved by the relevant ethics committee at the author 's institution .
participants were required to have no medical condition for which rt is contraindicated to participate .
participants were existing members at the facility who provided written informed consent for their training data from their first session until their most recent to be released for analysis in this study .
power analysis of research using low volume rt in untrained participants was conducted to determine participant numbers ( n ) using an effect size ( es ) , calculated using cohen 's d of ~1.0 for the improvements in strength .
participant numbers were calculated using equations from whitley and ball revealing a required 16 participants to meet required power of 0.8 at an alpha value of p 0.05 for detecting changes .
strength was measured using medx ( usa ) torso arm ( pull down ) , chest press , seated row , overhead press , and leg press resistance machines .
these were also used for the rt intervention in addition to medx ( usa ) leg extension , leg curl , bicep curl , torso flexion , hip extension , chest fly , seated dip , abdominal isolator , and lumbar extension resistance machines , as well as a pull - over ( nautilus , usa ) . throughout the time period
all participants performed a single set of torso arm ( pull down ) , chest press , seated row , overhead press , and leg press exercises in this order throughout their training period and some occasionally performed 1 - 2 additional exercises using the other resistance machines noted .
each exercise was completed using a load that allowed the participants to perform a self - determined 6 rm ( meaning that they determined inability to complete further repetitions if attempted , i.e. , predicted momentary muscular failure on the next repetition ) through a full range of motion using repetition duration of 10 seconds concentric and 10 seconds eccentric .
this equated to total repetition duration of 20 seconds and a total time under load of ~120 seconds .
the trainer monitored participants repetition duration throughout each exercise using a stopwatch and advised participants to either speed up or slow down as appropriate to maintain this repetition duration .
load progression was provided based on the following characteristics as assessed by the trainer ; ( 1 ) the ability to maintain the prescribed repetition duration of 10 : 10 within a margin of 2 seconds error ( i.e. , 812 : 812 ) , ( 2 ) the ability to maintain interrepetition consistency to this repetition duration within the set , ( 3 ) and the quality of the participants form for the exercise .
once the trainer was confident the participant could exceed a 6 rm whilst meeting these criteria with their current load , a further 25 lbs was added in their next training session .
the trainers throughout this intervention encouraged very strict form during exercise ; for example , controlled and continuous breathing frequency ( without a valsalva manoeuvre ) and attempting to keep muscles which are not the target of the exercise as relaxed as possible . as a time efficient training approach participants were also encouraged to move from one exercise to the next without significant rest , generally < 30 seconds .
all machines were prepared for the clients prior to beginning each exercise session to make this possible . with an average of 5 exercises per session , at ~120 seconds per exercise , total workout time is approximately 12 minutes . indeed
the trainers and the exercise facility specifically advertise that sessions will not exceed 15 minutes in total time commitment per training session .
this represents an ecologically valid approach to applying the aforementioned recommendations with stringent , yet practical methods of increasing load .
mean ( sd ) numbers of training sessions are presented in table 2 which equate to study duration of m = 12 6.7 weeks for males and m = 19 10.9 weeks for females .
the sds suggest large differences in actual duration between participants . however , this is likely representative of real people , where some people train for extended periods whilst others cease exercise intermittently as a result of other commitments .
strength gains as progression in load used during exercise was the primary outcome for this study .
as all participants had completed torso arm ( pull down ) , chest press , seated row , overhead press , and leg press , load progression was examined for these exercises only .
as participants continuously performed a standardised intervention , whereby the exercises were performed in the same order and used a self - determined 6 rm load ( meaning that they determined inability to complete further repetitions if attempted that is , predicted momentary muscular failure on the next repetition ) through a full range of motion using a repetition duration of 10 seconds concentric and 10 seconds eccentric throughout the training period , the increase in training load was considered to be adequate to determine strength gains as a result of the training completed .
this was calculated as the training load in the most recent exercise session available for analysis minus the training load for the participants first training session .
training record data was available from 33 participants ( male , n = 14 ; female , n = 19 ) .
descriptive statistics including means and standard deviations were calculated for number of exercises performed each session , number of sessions completed for chest press , leg press , torso arm ( pull down ) , seated row , and overhead press exercises , and load progression for these exercises .
gender comparisons were performed for demographic characteristics , number of exercises performed each session , number of sessions completed per exercise , and strength outcomes , including both absolute and relative change in training load and strength change relative to body mass , using an independent samples t - test .
95% confidence intervals ( ci ) were calculated in addition to es using cohen 's d for each absolute strength outcome to examine the significance and magnitude of effects where an outcome was considered to be significantly improved if the ci did not cross zero .
effect sizes ( ess ) of 0.200.49 were considered as small , 0.500.79 as moderate and 0.80 as large .
males had a significantly higher stature ( t(31 ) = 5.106 , p < 0.001 ) and body mass ( t(29 ) = 2.983 , p = 0.005 ) than females .
training session data including number of training sessions per exercise and exercises per sessions are presented in table 2 .
females had performed significantly more sessions than males for torso arm ( t(31 ) = 2.301 , p = 0.028 ) , seated row ( t(31 ) = 2.238 , p = 0.033 ) , and leg press ( t(30 ) = 2.126 , p = 0.026 ) exercises .
there was no difference in number of exercises performed per session between males and females .
males had a significantly higher absolute training load at baseline than females for torso arm ( t(31 ) = 3.488 , p = 0.002 ) , chest press ( t(31 ) = 4.215 , p < 0.001 ) , seated row ( t(30 ) = 2.603 , p = 0.014 ) , overhead press ( t(30 ) = 4.087 , p < 0.001 ) , and leg press ( t(30 ) = 3.898 , p = 0.001 ) exercises .
strength relative to body mass did not differ at baseline between males and females for any exercise .
figure 1 presents changes in absolute training load from first to last training sessions for each exercise for males and females .
change in absolute training load did not significantly differ between males and females for any exercise .
95% cis suggest significant improvements in absolute strength for every exercise with large ess for both males and females , respectively , of 2.14 and 3.31 for torso arm , 1.59 and 1.59 for chest press , 2.67 and 2.84 for seated row , 2.01 and 2.20 for overhead press , and 2.19 and 2.36 for leg press exercises .
relative increases in training load did not differ between males and females , respectively , for torso arm ( 68.7 40.1% versus 90.8 38.1% ) , chest press ( 55.8 39.4% versus 59.0 39.9% ) , seated row ( 65.0 29.3 versus 81.2 40.3% ) , and overhead press ( 39.0 20.4% versus 58.0 30.0% ) exercises but was significantly greater for females for the leg press exercise ( 38.4 18.2% versus 59.0 28.6% ; t(30 ) = 2.297 , p = 0.018 ) .
figure 2 presents changes in training load relative to body mass from first to last training sessions for each exercise for males and females .
changes in training load relative to body mass did not differ between genders for torso arm , chest press , seated row , or overhead press ; however , they were significantly greater for females for the leg press exercise ( t(30 ) = 2.091 , p = 0.045 ) .
this study presents data from a retrospective single arm trial of resistance training in older adults .
previous recommendations ( e.g. ) have suggested single sets of an exercise to a high intensity of effort performed 1 - 2/week as producing the same strength adaptations as larger training volumes / frequencies and yet presenting far greater time efficiency .
training interventions of similar methodology in a similar population sample have reported significant strength gains . however , the present study examined an approach which used an average of two training sessions per week consisting of ~5 exercises to activate most muscle groups , equating to a total time commitment of approximately 30 minutes per week , a significantly lower volume of exercise than westcott et al . .
previous research has suggested that the addition of single - joint ( sj ) to multijoint ( mj ) exercises does not increase muscle hypertrophy beyond that of mj exercises alone .
further research has reported similar strength and hypertrophy increases when comparing sj and mj exercises independently .
the efficiency of performing only 5 exercises compared to larger volumes suggests practical benefits if the same adaptations are obtainable .
participants within the present study showed significant meaningful increases in both absolute and relative to body mass strength ( 6 rm ) as evidenced by 95% cis ( figures 1 and 2 ) and large ess for all exercises tested .
female participants reported similar increases in absolute load to male participants albeit with a greater number of training sessions , for example , a longer training duration .
however , female participants also showed a significantly greater relative increase in strength , and increase relative to body mass , for the leg press exercise than males and qualitatively greater relative increases for all other exercises .
evidence has supported a greater magnitude of improvement in upper body compared to lower body strength between males and females and also a potentially smaller age related decline in lower body strength and muscle quality in females compared to males
. however , there appears no prior evidence supporting the present data that females show greater relative increases in lower - body strength than males .
we suggest these differences in relative strength increase may be a result of the significant strength differences at baseline between males and females and also that females engaged in a longer duration of training than males in the present study .
we have previously discussed that intensity of effort , and intent to maximally recruit muscle fibres appears to be the most significant variable affecting strength and hypertrophic increases ( e.g. , training to momentary muscular failure ( mmf ) ) [ 6 , 7 ] .
however , the present data suggests that untrained older adults can make significant increases in strength by training to rm , which might best be thought of as volitional fatigue .
self - determined rm does not represent a quantifiable measure of intensity of effort as is evidenced by trained participants providing poor estimates at the number of repetitions possible before mmf .
as such , rm might not be scientifically meaningful regarding intensity of effort compared to mmf . however , training to volitional fatigue represents a very pragmatic approach , especially in the present population group .
the data herein represents real people , doing real resistance exercise from which they are intending to acquire the aforementioned health and fitness benefits .
we might surmise that their aims are to function more efficiently and for greater longevity in their day - to - day life . as the discomfort and debilitation associated with delayed onset muscle soreness ( doms ) which might arise as a result of high volume and/or very high intensity of effort ( e.g. , mmf ) resistance exercise seems counterintuitive to a person wishing to have a more functional life .
previous research suggests that perceived difficulty and misinformation about expected outcomes are barriers to older persons performing resistance exercise .
this study presents data from a uk based exercise facility where sessions are performed on a 1 : 1 basis ( client : trainer ) .
the study shows that resistance training need not be time consuming , dauntingly complex , or overly difficult , and that considerable increases in strength can be achieved .
a potential limitation to this approach might be the financial expense and practicality of a 1 : 1 ( trainer to client ) session . certainly the significant improvements seen within this intervention and other resistance training research might be a result of the individual coaching and motivation received by each participant . in considering transference from research to practical application , improvements to the same degree might not be possible in most health clubs / gyms and so forth , where this ratio is expensive / inappropriate .
however , future research might consider the efficacy of small group resistance exercise sessions ( e.g. , 25 participants : 1 trainer ) .
previous research has shown significant improvements in function as a result of group exercise ( n = ~23 and n = 1620 persons ) in studies where mean age = 65 years and 74 years . however , gentil and bottaro reported greater increases in upper and lower body strength in high supervision ( 1 : 5 ; trainer to athlete ratio ) compared to a low supervision ( 1 : 25 ) group .
certainly improvements to the magnitude shown within the present study are possible from such a low frequency and volume of training suggests that there is scope to further evaluate this approach . in the interests of transparency
we have previously discussed that publishing data which does not identify control / clarity of variables potentially offers little to trainers or trainees with regard to how they might optimise training adaptations .
however , the protocol reported herein is highly standardised between participants and we offer the present findings to highlight the concept of undertaking this protocol and similar ones given the ecological validity of the study . in summary our data
suggests that when training to rm significant strength increases are possible from brief ( < 15 minutes/~5 exercises per workout ) , infrequent 1 - 2/week , resistance exercise sessions . as previous research
has indicated that strength is an independent risk factor for all - cause mortality , these results are meaningful for reducing this risk in the population examined .
previous research has shown that resistance exercise in older adults can significantly increase strength , muscle mass , and bone mineral density , improve gene expression and mitochondrial characteristics , and reduce the risk of falls , obesity , and type 2 diabetes and , as noted , reduce the risk of all - cause mortality . since the present data suggest that strength can be significantly increased by following the aforementioned protocol , future research should consider whether other health markers such as blood pressure and glycemic control respond to the same low volume stimulus . | chronological aging is associated with a decrease in skeletal muscle mass and bone mineral density , an increase in fat mass , frequency of falls and fractures , and the likelihood of obesity , diabetes , and coronary heart disease .
resistance exercise has been shown to counter all of these effects of aging and , in turn , reduce the risk of all - cause mortality .
however , variables such as volume and frequency have become contentious issues , with recent publications suggesting that similar physiological adaptations are possible with both high- and low - volume approaches .
the aim of this research was to consider strength increases as a result of brief , infrequent resistance exercise .
the present study offers data from 33 ( 14 male and 19 female ) older adults ( m = 55 years ) who underwent brief ( < 15 minutes per exercise session ) , infrequent ( 2/week ) , resistance exercise to a high intensity of effort ( 6-repetition maximum ) at a controlled repetition duration ( 10 seconds concentric : 10 seconds eccentric ) on 5 resistance machines ( chest press , leg press , pull - down , seated row , and overhead press ) .
data is presented for training interventions of 12 weeks ( male ) and 19 weeks ( female ) .
significant strength increases were identified for all exercises . with the detailed health benefits obtainable
, the present study suggests that resistance exercise can be efficacious in much smaller volumes than previously considered . |
poland 's syndrome is characterised by unilateral chest wall and upper limb abnormalities , with an incidence of 1:30,000 - 100,000 live births .
the thoracic manifestations may vary from mild hypoplasia to complete absence of the pectoralis major muscle and/or costal cartilages , breast and nipple hypoplasia or aplasia and ipsilateral upper limb anomalies .
reconstructive procedures such as use of tissue expanders and silicone implants , pedicle flaps , autologous fat graft and free microvascular flaps have been previously described .
deep inferior epigastric perforator ( diep ) flap has become the workhorse for breast reconstruction , but its use for poland 's syndrome has rarely been reported in the literature .
poland 's syndrome , although frequently presents with thoracic deformities , is rarely associated with pectus excavatum .
indications for surgical reconstruction of pectus excavatum deformities is based on classification systems and include more commonly aesthetic considerations and rarely chest wall reconstruction or cardiovascular insufficiency .
a 57-year - old female patient presented with a painful right breast in a previously implant based right breast reconstruction for correction of poland syndrome [ figure 1 ] .
a 57-year - old female poland 's syndrome patient with a baker iii capsular contracture on her previously implant based right breast reconstruction clinical examination revealed hypoplasia of the right breast , absence of the right pectoralis major muscle , ipsilateral upper limb anomalies and pectus excavatum chest wall deformity without cardiac or respiratory impairment [ figure 2 ] .
a baker iii capsular contracture was observed in the right reconstructed breast and a volume deficit over the inner and lower poles , compared with the left side , was also noted .
volume deficits at the inner and lower poles of the right breast , and at the sternum are observed in association with ipsilateral upper limb anomalies the patient was seeking treatment of the painful breast and aesthetic improvement of both the breast symmetry and the sternal depression .
ct angiography imaging of the chest and abdomen showed a 2a1 pectus excavatum chest wall deformity according to park 's classification [ figure 3 ] , as well as a hypoplastic appearance and a substernal displacement of the internal mammary vessels .
computed tomography angiography of the chest shows a 2a1 pectus excavatum chest wall deformity according to park 's classification , as well as a hypoplastic appearance and a substernal displacement of the internal mammary vessels after the implant and capsule removal , a new subglandular pocket was prepared , extending from the mid - axillary line to the left border of the sternum and from the manubrium to the xiphoid process .
thoracodorsal artery and vein were prepared to accommodate the flap . at the same time a pre - shaped diep flap based on the size of the contralateral breast was raised and anastomosed to the thoracodorsal vessels [ figure 4 ] .
almost the whole flap was de - epithelialised , sutures were placed to maintain the pre - shaped breast mound and buried into the prepared skin pocket to reconstruct the breast , providing both breast projection and pendulous appearance , and also forming the anterior axillary line in the area of the pectoralis major tendon and filling the depressed chest and sternum area . a small 2
cm 1 cm skin island was left intact and placed at the inframammary fold for flap monitoring .
nylon bolster sutures were placed through the skin to the adipose tissue of the flap and remained for 2 weeks to secure the flap position and avoid any flap displacement .
a new subglandular pocket was prepared , and the flap vessels were anastomosed to the thoracodorsal artery and vein in an end - to - end fashion post - operative period was uneventful and at 24 months follow - up the patient was free of pain over the right breast and highly satisfied with the aesthetic breast and chest wall appearance [ figures 5 and 6 ] .
the patient remains free of pain and aesthetically pleased at 24 months follow - up reconstruction of the depressed sternum and of the inner breast pole was achieved
a number of surgical interventions for aesthetic correction of congenital breast and chest wall deformities have been described in the literature , such as tissue expansion , silicone implant and customized silicone prosthesis , pedicle flaps , autologous fat graft and free microvascular flaps .
presented a series of 29 poland 's syndrome cases , including 8 male and 21 female patients ; tissue expanders and/or implants were most commonly used in the female subgroup , a latissimus dorsi ( ld ) muscle flap with breast implant was performed in 4 cases and a custom - made chest wall implant in 1 case .
latissimus dorsi muscle flap was mainly used in papadopulos et al . study looking for changes in quality of life of the operated poland syndrome patients .
satisfactory outcome was achieved ; concluding that the patients were satisfied or highly satisfied with their appearance and would recommend the same surgery to others under similar circumstances .
fat grafting procedures have also been used by yang and lee for breast reconstruction in poland 's syndrome patients .
although they are simple procedures , fat grafting breast reconstructions have two main drawbacks ; first , their results are largely inconsistent , mainly due to the variable amount of fat resorption after a lipo - filling session and second , the need for multiple fat grafting surgeries to achieve a satisfying outcome .
deep inferior epigastric perforator flap is described in the literature as one of the microvascular options for correcting chest wall and breast deformities in poland 's syndrome .
liao presented a case report of a 52-year - old woman with severe chest wall deformity and breast hypoplasia who was treated with a free diep flap anastomosed to the internal mammary vessels .
the use of free tissue transfer tends to become the modern workhorse for reconstructing congenital chest wall abnormalities .
gautam et al . , presented a series of 8 poland 's syndrome cases , who were treated using microvascular perforator flaps ; 4 superior gluteal artery perforator , 2 inferior gluteal artery perforator , 1 superficial inferior epigastric artery and 1 diep flap .
although all flaps survived , a relatively high complication rate was reported by the authors .
however , donor - site morbidity is lower , functional compromise is less and recovery time is faster , as compared to ld muscle flap transfer procedures . in our case , the reconstructive challenge was not only the replacement of the missing breast volume in order to achieve symmetry , but also the correction of both the anterior axillary fold due to the absence of the pectoralis major tendon , and the sternal depression due to funnel chest deformity .
the free diep flap should be considered a valuable reconstructive option for simultaneous correction of poland 's syndrome deformities and pectus excavatum depression ; it provides adequate adipose tissue to replace both the missing breast volume and the sternal deficit ; its long pedicle allows microvascular anastomoses either in the internal mammary or the thoracodorsal vessels .
the need for larger tissue volume in female poland 's syndrome patients also makes diep flaps preferable to other autologous tissue . | this study aims to present the case of a female patient with poland 's syndrome and pectus excavatum deformity who underwent breast and chest wall reconstruction with a pre - shaped free deep inferior epigastric perforator flap . a 57-year - old female patient with poland 's syndrome and pectus excavatum presented with a baker iii capsular contracture following a previously performed implant - based right breast reconstruction . after a chest and abdominal ct angiography ,
she was staged as 2a1 chest wall deformity according to park 's classification and underwent implant removal and capsulectomy , followed by a pre - shaped free abdominal flap transfer , providing both breast reconstruction and chest wall deformity correction in a single stage operation .
post - operative course was uneventful , and the aesthetic result remains highly satisfactory 24 months after surgery .
deep inferior epigastric free flap represents an interesting reconstructive solution when treating poland 's syndrome female patients with chest wall and breast deformities . |
hospital care utilization increases directly with age : the population aged 75 years or older spends , on average , 2.6 days per year in the hospital compared with 0.6 days for all other age groups.1 this can be a concern as the hospital setting is an immobilizing environment where patients may have multiple tethers for example , intravenous lines , urinary catheters , and monitoring devices . a recent observational study reported that more than 70% of hospital stay was spent in bed , even among ambulatory seniors.2 hospitalized older adults who are immobilized are particularly vulnerable to functional decline.3 there is evidence that such decline is prevalent in this population : one study showed hospital - associated functional decline in approximately one - third of a population aged 70 years and older.3 this decline can lead to adverse outcomes such as extended recovery periods and enrollment in nursing home facilities.35 another issue related to hospitalization is disability ; hospitalization has been implicated as the strongest predictor of long - term disability in community - dwelling older persons.6 a potential solution to this problem is physical therapy .
it has been shown to have a greater impact on patients at higher risk of functional decline at hospital admission than those at lower risk.710 however , very few studies have examined the benefits of physical therapy for hospitalized older adults,710 and to our knowledge , no study so far has examined means of enhancing the benefits of physical therapy in hospitalized older adults .
one possible means is shared mental models , which allow participants to predict information , organize task knowledge , and improve processes and performances.11 these models facilitate communication between hospital care providers and improve the outcomes in hospital care.1214 although initially introduced in the aviation industry,11 shared mental models have also been used in the health care industry.1214 similar care models , known as either interdisciplinary or multidisciplinary care models , for caring for older adults have been reported to improve inter - professional collaboration and to result in reducing adverse health outcomes and improving quality of care.1517 heart failure is one of the most common acute illnesses in hospitalized older adults.18 hospital performance indicators such as 30-day readmission rate in heart failure are higher than those of other common acute illnesses ( acute myocardial infarction and pneumonia).19,20 therefore , we selected hospitalized older adults with heart failure who need urgent quality improvement . considering the evidence of their benefits , we hypothesized that shared mental models in the form of shared situational awareness ( ssa ) intervention can increase the benefits of physical therapy and improve functional and hospital outcomes of hospitalized older adults .
hence , we examined the effects of ssa intervention on 1 ) functional outcomes ( as measured by developing disability as well as hospital discharge to a skilled nursing facility [ snf ] ) and 2 ) hospital outcome ( as measured by 30-day hospital readmission rate ) in this population .
the study site was a teaching metropolitan hospital in cleveland , oh , usa ( 350 beds ) .
the study period was from july 2007 to june 2008 . before enrolling study participants ,
priori analysis was performed to determine sample size as follows : disability with intervention = 25% , disability with control = 30% , alpha = 5% , beta = 50% , two - sided analysis , 10% extra data for possible follow - up loss , and estimated sample size in each group = 475 .
inclusion criteria were 1 ) community - dwelling age 65 years or older ; 2 ) hospital admission to the general medicine floor under hospitalist service for principal diagnosis of heart failure ( international classification of diseases , ninth revision , clinical modification : 402.01 , 402.11 , 402.91 , 404.01 , 404.03 , 404.11 , 404.13 , 404.91 , 404.93 , and 428.0428.9 ) ; 3 ) hospital length of stay ( los ) 3 days or longer ( required to meet the 3-day inpatient rule to receive post - acute care at an snf for 20 days without copayment under medicare part a);21 and 4 ) physical functional decline from 2 weeks prior to hospital admission , as indicated by changes in activities of daily living ( adl ) from stage 0 at pre - hospital admission to adl stage i at hospital admission .
adl stage has been validated and used as a well - established functional hierarchy tool.22,23 adl stage 0 refers to the most independent , and stage iv refers to the most dependent .
participants were excluded when they declined study participation ( n=104 ) or had either coexisting acute myocardial infarction or isolation precaution ( n=39 ) .
the number of allocated participants was 543 in the intervention and 589 in the control group .
due to incomplete data , 49 and 42 participants were withdrawn from the intervention and control groups , respectively . in the intervention group , 21 participants were lost due to in - hospital death ( n=8 ) or referral to another hospital ( n=13 ) . in the control group ,
72 participants were lost due to in - hospital death ( n=8 ) , referral to another hospital ( n=8 ) , or contamination from control to intervention group due to required urgent intervention ( n=56 ) .
the final number of analyzed participants was 473 in the intervention group and 475 in the control group .
figure 1 outlines the flow chart of sample enrollment , allocation , follow - up , and analysis based on the consolidated standards of reporting trials ( consort ) statement.24 the study was approved by the institutional review board ( equivalent to ethics committee ) at cleveland clinic health system .
individual subject consent was obtained from either patients or their caregivers when patients were mentally incapacitated .
an intervention group was composed of both 1 ) physical therapy 0.5 hour / day and 2 ) ssa care management .
study participants in both intervention and control groups received physical therapy for at least 3 days .
we examined the hospital los across the sum of physical therapy hours.8,25,26 for example , we divided the sum of the physical therapy hours by the los .
physical therapy had specific modalities of ambulation ( with or without device ) , muscle strengthening , gait transfer , and obstacle negotiation .
multidisciplinary meetings were held at the conference rooms of the general medicine floors during weekdays ( monday through friday ) .
attendees of the ssa meetings were not aware of the group assignment and collaborated on assessment and management of diet compliance ( sodium and fluid restrictions ) , medication compliance , and resource utilization compliance ( clinic or home care visit ) , where they were updated on each health professional s opinions and shared approaches to solving problems in complicated situations .
attendees of the ssa meetings also discussed the progress of physical therapy and were able to modify specific therapy modality , duration , frequency , and intensity .
all patients were discussed at these meetings , and the average time for each patient was approximately 2 minutes .
all disciplinary health care professionals ( physicians , nurses , case managers , social workers , physical therapists , speech / language therapists , pharmacists , and dietitians ) were responsible for attending these meetings .
the study coordinator , who did not participate in patient care , randomly assigned patients to the intervention group using medical record number finishing either 1 or 5 when patients were admitted to hospital .
the study coordinator derived control group participants using matching covariates ( age , sex , ethnicity , all patient refined diagnostic related group [ apr - drg ] classification , cognitive impairment , and charlson comorbidity index [ cci ] ) with the intervention group . when ssa meetings were necessary for the control group , we regarded contamination and excluded the participant from the study .
hospital nursing staff examined physical function using adl stage at three different times ( pre - admission , hospital admission , and hospital discharge ) .
disability was defined as adl stage i iv at the date of hospital discharge .
transition to snf was defined as patient discharge to post - acute care settings ( either snf or inpatient rehabilitation facility ) .
referral to a facility where rehabilitation was not the primary purpose , such as a psychiatric facility , hospice , assisted - living facility , or adult foster home , was not considered as a transition to snf .
thirty - day hospital readmission rate was defined as hospital readmission for heart failure within 30 days since hospital discharge .
covariates included age , sex , ethnicity , severity of illness , cognitive impairment , and cci .
the apr - drg severity of illness classification system was used to estimate the severity of illness .
the apr - drg data were gathered based on the 3 m health information systems ( salt lake city , ut , usa ) tools .
the apr - drg has been used elsewhere for adjusting severity of illness in hospitalized patients with heart failure.27 hospital nursing staff collected cognitive data using the mini - cog screen ( university of washington , seattle , wa , usa ) , which had the highest sensitivity ( 99% ) and correctly classified the greatest percentage ( 96% ) of subjects.28 cci has been validated for measuring comorbidity for hospitalized patients with heart failure.29,30 due to incomplete data ( less than 50% completion ) , the nyha ( new york heart association ) heart failure classification was not used .
bivariate comparisons of covariates between subjects of the intervention and control groups were examined using the chi - square test ( categorical data ) and mann whitney u test ( continuous , not normally distributed data ) as appropriate . all
reported p - values were two - tailed , and p<0.05 was considered statistically significant .
multivariate log - binomial regressions were performed to compute relative risks ( rrs ) along with the corresponding 95% confidence intervals ( cis ) after adjusting for all covariates .
rr > 1 indicated that the outcome probability was higher in the intervention group than in the control group .
lemeshow statistic.31 all statistics were performed using sas statistical software version 9.3 ( sas institute inc . , cary , nc , usa ) .
the study site was a teaching metropolitan hospital in cleveland , oh , usa ( 350 beds ) .
the study period was from july 2007 to june 2008 . before enrolling study participants ,
priori analysis was performed to determine sample size as follows : disability with intervention = 25% , disability with control = 30% , alpha = 5% , beta = 50% , two - sided analysis , 10% extra data for possible follow - up loss , and estimated sample size in each group = 475 .
inclusion criteria were 1 ) community - dwelling age 65 years or older ; 2 ) hospital admission to the general medicine floor under hospitalist service for principal diagnosis of heart failure ( international classification of diseases , ninth revision , clinical modification : 402.01 , 402.11 , 402.91 , 404.01 , 404.03 , 404.11 , 404.13 , 404.91 , 404.93 , and 428.0428.9 ) ; 3 ) hospital length of stay ( los ) 3 days or longer ( required to meet the 3-day inpatient rule to receive post - acute care at an snf for 20 days without copayment under medicare part a);21 and 4 ) physical functional decline from 2 weeks prior to hospital admission , as indicated by changes in activities of daily living ( adl ) from stage 0 at pre - hospital admission to adl stage i at hospital admission .
adl stage has been validated and used as a well - established functional hierarchy tool.22,23 adl stage 0 refers to the most independent , and stage iv refers to the most dependent .
participants were excluded when they declined study participation ( n=104 ) or had either coexisting acute myocardial infarction or isolation precaution ( n=39 ) .
the number of allocated participants was 543 in the intervention and 589 in the control group . due to incomplete data , 49 and 42
participants were withdrawn from the intervention and control groups , respectively . in the intervention group ,
21 participants were lost due to in - hospital death ( n=8 ) or referral to another hospital ( n=13 ) . in the control group ,
72 participants were lost due to in - hospital death ( n=8 ) , referral to another hospital ( n=8 ) , or contamination from control to intervention group due to required urgent intervention ( n=56 ) .
the final number of analyzed participants was 473 in the intervention group and 475 in the control group .
figure 1 outlines the flow chart of sample enrollment , allocation , follow - up , and analysis based on the consolidated standards of reporting trials ( consort ) statement.24 the study was approved by the institutional review board ( equivalent to ethics committee ) at cleveland clinic health system .
individual subject consent was obtained from either patients or their caregivers when patients were mentally incapacitated .
an intervention group was composed of both 1 ) physical therapy 0.5 hour / day and 2 ) ssa care management .
study participants in both intervention and control groups received physical therapy for at least 3 days .
we examined the hospital los across the sum of physical therapy hours.8,25,26 for example , we divided the sum of the physical therapy hours by the los .
physical therapy had specific modalities of ambulation ( with or without device ) , muscle strengthening , gait transfer , and obstacle negotiation .
multidisciplinary meetings were held at the conference rooms of the general medicine floors during weekdays ( monday through friday ) .
attendees of the ssa meetings were not aware of the group assignment and collaborated on assessment and management of diet compliance ( sodium and fluid restrictions ) , medication compliance , and resource utilization compliance ( clinic or home care visit ) , where they were updated on each health professional s opinions and shared approaches to solving problems in complicated situations .
attendees of the ssa meetings also discussed the progress of physical therapy and were able to modify specific therapy modality , duration , frequency , and intensity .
all patients were discussed at these meetings , and the average time for each patient was approximately 2 minutes .
all disciplinary health care professionals ( physicians , nurses , case managers , social workers , physical therapists , speech / language therapists , pharmacists , and dietitians ) were responsible for attending these meetings . the study coordinator , who did not participate in patient care , randomly assigned patients to the intervention group using medical record number finishing either 1 or 5 when patients were admitted to hospital .
the study coordinator derived control group participants using matching covariates ( age , sex , ethnicity , all patient refined diagnostic related group [ apr - drg ] classification , cognitive impairment , and charlson comorbidity index [ cci ] ) with the intervention group .
when ssa meetings were necessary for the control group , we regarded contamination and excluded the participant from the study .
hospital nursing staff examined physical function using adl stage at three different times ( pre - admission , hospital admission , and hospital discharge ) .
disability was defined as adl stage i iv at the date of hospital discharge .
transition to snf was defined as patient discharge to post - acute care settings ( either snf or inpatient rehabilitation facility ) .
referral to a facility where rehabilitation was not the primary purpose , such as a psychiatric facility , hospice , assisted - living facility , or adult foster home , was not considered as a transition to snf .
thirty - day hospital readmission rate was defined as hospital readmission for heart failure within 30 days since hospital discharge .
covariates included age , sex , ethnicity , severity of illness , cognitive impairment , and cci .
the apr - drg severity of illness classification system was used to estimate the severity of illness .
the apr - drg data were gathered based on the 3 m health information systems ( salt lake city , ut , usa ) tools .
the apr - drg has been used elsewhere for adjusting severity of illness in hospitalized patients with heart failure.27 hospital nursing staff collected cognitive data using the mini - cog screen ( university of washington , seattle , wa , usa ) , which had the highest sensitivity ( 99% ) and correctly classified the greatest percentage ( 96% ) of subjects.28 cci has been validated for measuring comorbidity for hospitalized patients with heart failure.29,30 due to incomplete data ( less than 50% completion ) , the nyha ( new york heart association ) heart failure classification was not used .
bivariate comparisons of covariates between subjects of the intervention and control groups were examined using the chi - square test ( categorical data ) and mann whitney u test ( continuous , not normally distributed data ) as appropriate . all
reported p - values were two - tailed , and p<0.05 was considered statistically significant .
multivariate log - binomial regressions were performed to compute relative risks ( rrs ) along with the corresponding 95% confidence intervals ( cis ) after adjusting for all covariates .
rr > 1 indicated that the outcome probability was higher in the intervention group than in the control group .
lemeshow statistic.31 all statistics were performed using sas statistical software version 9.3 ( sas institute inc . , cary , nc , usa ) .
table 1 presents characteristics between intervention ( n=473 ) and control group ( n=475 ) .
multivariate regression results of disability , transition to snf , and 30-day readmission rate are shown in table 2 .
disability at hospital discharge was lower in the intervention group ( 28% ) than in the control group ( 37% ; rr = 0.74 ; 95% ci , 0.350.97 ; p=0.026 ) .
transition to snf was lower in the intervention group ( 22% ) than in the control group ( 30% ; rr = 0.77 ; 95% ci , 0.390.98 ; p=0.032 ) .
thirty - day readmission rate was not statistically different between the groups ( intervention group , 22% ; control group , 20% ; p=0.27 ) .
results for using physical therapy threshold 0.66 hour / day were similar to results from the original category ( physical therapy threshold 0.5 hour / day ) , and were not included here .
for example , the intervention group was associated with reduced disability and less transition to snf , but there was no association between intervention and 30-day readmission rate .
the maximum variation inflation factor was less than 10 ( 9.82 between age and cognitive impairment ) , and all covariates were included in logistic regressions.32 all logistic regressions fitted well as determined by hosmer
lemeshow test results ( p=0.40 , disability ; p=0.58 , transition to snf ; p=0.81 , 30-day readmission rate).31
table 1 presents characteristics between intervention ( n=473 ) and control group ( n=475 ) .
multivariate regression results of disability , transition to snf , and 30-day readmission rate are shown in table 2 .
disability at hospital discharge was lower in the intervention group ( 28% ) than in the control group ( 37% ; rr = 0.74 ; 95% ci , 0.350.97 ; p=0.026 ) .
transition to snf was lower in the intervention group ( 22% ) than in the control group ( 30% ; rr = 0.77 ; 95% ci , 0.390.98 ; p=0.032 ) .
thirty - day readmission rate was not statistically different between the groups ( intervention group , 22% ; control group , 20% ; p=0.27 ) .
results for using physical therapy threshold 0.66 hour / day were similar to results from the original category ( physical therapy threshold 0.5 hour / day ) , and were not included here .
for example , the intervention group was associated with reduced disability and less transition to snf , but there was no association between intervention and 30-day readmission rate .
the maximum variation inflation factor was less than 10 ( 9.82 between age and cognitive impairment ) , and all covariates were included in logistic regressions.32 all logistic regressions fitted well as determined by hosmer
lemeshow test results ( p=0.40 , disability ; p=0.58 , transition to snf ; p=0.81 , 30-day readmission rate).31
the present study examined whether ssa intervention in functionally declining older adults with heart failure is associated with functional and hospital outcomes .
our results showed that ssa intervention was associated with a lower occurrence of disability and fewer transitions to snfs but was not associated with 30-day readmission rate .
our observations on the disability rate during hospitalization were similar to previous reports on hospital - associated disability rate approximately one - third of total subjects ( 28% of intervention group and 37% of control group).3,7,8 the consequence of interactions between the effects of hospitalization and aging leads to additional tiers in the cascade toward dysfunction and disability.33 by viewing functional decline as a multi - physiological systems dysregulation , instead of a single system failure , the traction effects crosses functional domains and leads to greater vulnerability to acute illness and early hospital readmission.34 the main benefits of physical therapy for hospitalized older adults when their physical function begins to decline are prevention and delay of traction effect of functional decline .
these benefits of hospital - based physical therapy would be more effectively delivered through ssa intervention ( ie , more organized care process , facilitated communication , and inter - professional collaboration as shown in previous multidisciplinary and interdisciplinary care for older adults).1517 the present study makes a valuable contribution to the field considering the issue of excessive utilization of snfs resulting from medicare s controversial three - night rule ( ie , medicare covers snf stay once older adults spend three nights or longer in hospital35,36 regardless of physical disability or illness severity ) .
in fact , a review of approaches to reduce this excessive utilization is urgently required.37 reducing transition to snfs through ssa intervention may shed light on reductions in medicare expenditures related to older persons post - acute care .
strategies of diet - control , medication adherence , and appropriate resource utilization are universally provided for older persons with heart failure at any acute care hospitals.37 the benefits of ssa intervention in this study can apply to innovations in health care processes , transforming fragmented to integrative care , during the management of the care of these hospitalized older adults with heart failure .
ssa interventions through securing and maintaining the benefits of physical therapy after hospital care can improve functional outcomes , as suggested by health outcome assessment experts.38 heart failure s 30-day readmission rate of the medicare population has increased ( known as the revolving door effect ) over the recent decade due to a decreasing trend of hospital los.17 heart failure is the most common cause of hospital care in the medicare population .
medicare attempts to reduce the 30-day readmission rate of heart failure.39 no effect of ssa intervention on 30-day readmission rate can be interpreted that early hospital admission for heart failure may be more closely related to post - hospital care such as early clinic or home visit care .
post - hospital care , recent changes in medications , and care instructions may raise barriers to older adults with complex comorbidity , lack of transportation , and cognitive decline .
future research should compare the effects of ssa interventions ( hospital and post - hospital care ) on early readmission rate of older adults with heart failure . despite these important findings ,
the first limitation is that in determining physical therapy intensity , we relied on the sum of physical therapy hours divided by hospital los .
however , jette et al40 observed that there was no clear pattern in rehabilitation therapy for specific diagnoses among patients receiving acute care in hospitals and that , eventually , the fundamental goal of rehabilitation therapy is functional recovery .
second , limited demographics in this study ( older adults , predominant female , and metropolitan area in the unites states ) may not represent the outcomes of the whole heart - failure population .
further analysis should determine whether ssa intervention would save more unnecessary costs of snf utilizations or whether hospital revenue would shrink more if personnel attended ssa intervention meetings .
therefore , our analysis is preliminary until further , more representative , data are analyzed to confirm our findings .
ssa intervention enhanced the benefits of physical therapy for functionally declining older adults . when applied to older adults with heart failure in the form of daily multidisciplinary meetings , | backgroundfunctional decline of hospitalized older adults is common and triggers health care expenditures .
physical therapy can retard the functional decline that occurs during hospitalization .
this study aims to examine whether shared situational awareness ( ssa ) intervention may enhance the benefits of physical therapy for hospitalized older persons with a common diagnosis , heart failure.methodan ssa intervention that involved daily multidisciplinary meetings was applied to the care of functionally declining older adults admitted to the medicine floor for heart failure .
covariates were matched between the intervention group ( n=473 ) and control group ( n=475 ) .
both intervention and control groups received physical therapy for 0.5 hours per day .
the following three outcomes were compared between groups : 1 ) disability , 2 ) transition to skilled nursing facility ( snf , post - acute care setting ) , and 3 ) 30-day readmission rate.resultsdisability was lower in the intervention group ( 28% ) than in the control group ( 37% ) ( relative risk [ rr ] = 0.74 ; 95% confidence interval [ ci ] , 0.350.97 ; p=0.026 ) , and transition to snf was lower in the intervention group ( 22% ) than in the control group ( 30% ) ( rr = 0.77 ; 95% ci , 0.390.98 ; p=0.032 ) .
the 30-day readmission rate did not significantly differ between the two groups.conclusionssa intervention enhanced the benefits of physical therapy for functionally declining older adults .
when applied to older adults with heart failure in the form of daily multidisciplinary meetings , ssa intervention improved functional outcomes and reduced transfer to snfs after hospitalization . |
prurigo nodularis ( pn ) of hyde , also known as nodular prurigo , is a chronic skin disease of unknown etiology .
the hyperkeratotic lesions tend to be symmetrical and occur over the extensor surfaces of the extremities .
pn has been associated with a range of systemic conditions such as hiv / aids , depression , gastrointestinal disorders , hypothyroidism , and hematologic malignancies . in most cases , however , the etiology is unclear [ 14 ] .
first - line therapy for pn is comprised of topical antipruritics or corticosteroids , oral steroids , antihistamines , or certain antidepressants such as doxepin .
recently , novel agents such as tumor necrosis factor ( tnf ) inhibitors alfacept and etanercept have also been prescribed . most of these therapies , however , are ineffective or only provide temporary relief . thus , alternative treatments are needed for refractory cases . in 1965 , sheskin was the first to report on the use of thalidomide to treat a patient with pn .
thalidomide is a drug with numerous proposed mechanisms of action and effects , ranging from acting as a prostaglandin / histamine antagonist to being an inhibitor of fibroblast growth factor and a immunomodulatory agent . as an immunomodulatory drug ,
tnf- induces pain by increasing the production of interleukin ( il)-1b and il-6 , which then increases the production of il-8 , a known mediator of sympathetic pain [ 810 ] .
more recently , thalidomide has also been shown to inhibit the peripheral vanilloid receptor 1 ( trvp1 ) channel , which is also involved in pain sensation .
thalidomide became well known for its teratogenic effects leading to severe fetal malformations when taken by pregnant women before the third trimester .
this medication has other known side effects , which include peripheral neuropathy , somnolence , altered mood , thrombosis , and gastrointestinal symptoms .
lenalidomide , a more potent analogue of thalidomide , has been most commonly used to treat multiple myeloma and myelodysplastic syndromes .
lenalidomide s molecular structure varies by one less carbonyl group but one additional amine compared to thalidomide .
this change confers a different toxicity profile and , as such , lenalidomide has a much lower frequency of peripheral neuropathy .
while some studies report the use of thalidomide and lenalidomide to be beneficial for the treatment of pn , their use in the management of pn remains controversial .
thus , this review aims to explore and review the efficacy and safety of thalidomide and lenalidomide for the treatment of refractory pn .
a systematic literature review was performed to identify articles between january 1 , 1970 and february 15 , 2016 relevant to the treatment of prurigo nodularis with thalidomide or lenalidomide .
the terms prurigo nodularis or nodular prurigo or picker s nodules or lichen corneus obtusus or atypical nodular form of neurodermatitis circumscripta were searched in the national library of medicine s pubmed database and returned 350 articles .
exclusion criteria included articles that were not written in english and those that were not original clinical trials , case series or case reports .
thirty manuscripts with relevant titles and abstracts were included for further review , based on case reports / series due to lack of controlled studies . if a study with a cohort or group did not distinguish patients with pn from other patients with different dermatological conditions within the same group , it was excluded .
in addition , the scopus database was crosschecked , but no additional articles were found . as a result , a total of 18 articles were selected for inclusion in this review ( fig . 1 ) .
this article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors.fig .
in the first reported case , van de broek et al . described a 57-year - old man with refractory pn admitted for an infection superimposed on nodules that had previously failed both topical and oral steroids as well as antihistamines .
thalidomide 100 mg bis in die ( bid ) was used for 3 months and discontinued after resolution of the pruritis and lesions .
of these , 60% of patients showed clinical improvement , but 9.5% of patients showed no effect .
the average daily dose was 100 mg , though a few patients received 50 mg due to gastrointestinal - related side effects .
the mean duration of treatment was 105 weeks , and 59.5% of patients developed peripheral neuropathy ranging from 1 week to 7.5 years after initiation of treatment , prompting discontinuation of therapy at the time of symptom development .
none of the subjects with neuropathy showed evidence of this adverse effect during follow - up .
. started thalidomide 100 mg bid in a hepatitis b patient who developed major depressive disorder and suicidal risk following a 5-year history of pn refractory to therapy .
after 3 weeks of treatment , the pruritus had mildly decreased without improvement in skin lesions .
subsequently , the dose was increased to 300 mg daily . by the 8th month , the pruritus had ceased , the majority of lesions had cleared , and mild sensory loss developed .
the patient was then placed on a maintenance dose of 50 mg every other day for 3 months . at the 4-month follow - up ,
they received thalidomide 100 mg per day and were randomized after 1 month to receive either 100 or 200 mg daily .
doses were adjusted if adverse events appeared , thus daily dosing ranged from 33 to 200 mg .
eight patients ( 80% ) continued the trial longer than 1 month , and all had a greater than 50% reduction in itch , while 7 ( 70% ) had a greater than 50% reduction in lesions .
pruritic reduction occurred within 13 months of treatment , while decreases in erythema and nodule size occurred between 36 months .
three patients ( 30% ) developed peripheral neuropathy ; however , no association with neuropathy was found between treatment duration , daily dose , or cumulative dose .
also treated a case of aids - associated pn in a 35-year - old white male with a cd4 count of 8 cells / mm . following a failed trial of topical corticosteroids and antihistamines , he was placed on thalidomide 100 mg daily for 6 weeks ,
the patient had a relapse of tuberculosis after 1 month of discontinuing thalidomide , which was postulated to have been due to the inhibitory effect of thalidomide on tnf - a .
conducted a prospective trial to evaluate combination therapy using thalidomide and ultraviolet - b ( uvb ) irradiation on four patients with pn .
thalidomide was started at 100 mg daily and was discontinued once significant clinical improvement was achieved , ranging from 8 to 16 weeks .
uvb phototherapy was then initiated for three sessions per week until complete clearance of the nodules was achieved , with a maximum of 70 exposures allowed .
most symptoms resolved after 612 uvb treatments , at which point thalidomide was also discontinued .
the follow - up period ranged from 418 months , in which one patient experienced a relapse at 5 months , which was then successfully managed with 35 treatments of uvb irradiation .
she was first treated with thalidomide 200 mg daily and had a dramatic improvement , but she developed neuropathy after 18 months and treatment was stopped .
after thalidomide , she also was treated with oral naltrexone , minocycline , gabapentin , alafecept , and etanercept with no sucess .
thereafter , she was started on lenalidomide 5 mg a day and by the second week she noted a significant decrease in pruritus , sleep , and concentration ability . by the first month , she exhibited healing of nodules and disappearance of itching .
two attempts were made to taper her dose and both resulted in disease flare - ups , thus she was maintained on 5 mg / day for a total of 24 months .
she was previously treated with steroids , antihistamines , and underwent psoralen + uva therapy for 6 months with no relief .
furthermore , the latter treatment resulted in the development of squamous cell carcinomas on her lower extremities .
after discontinuation of the photochemotherapy , she was started on 100 mg of thalidomide daily . by month 3 , she developed tingling and numbness in all of her limb extremities and thalidomide was discontinued .
after 1 month , she resumed thalidomide at 50 mg but her neuropathy returned and the medication was discontinued .
four months later , she was started orally on lenalidomide 10 mg / day with a marked reduction in nodules and itching intensity after only 1 month .
she continued taking lenalidomide and achieved almost complete clearance until right leg weakness prompted termination of the current treatment after 3 months of lenalidomide .
a total of 18 studies with 106 patients treated with thalidomide or lenalidomide for pn were reviewed ( see tables 1 , 2 ) .
it should be noted that these trends were based on case reports / series or retrospective literature due to lack of controlled studies , especially in regards to lenalidomide treatment , as only a few case reports exist . in the earlier studies ,
patients were started on higher doses of thalidomide of 200 mg or more daily [ 5 , 12 ] . in the majority of studies since then , however , patients were started on an initial dose ranging from 50 to 200 mg thalidomide per day and then tailored according to response or development of side effects .
length of treatment for thalidomide ranged from 1 month to almost 12 years depending on remission of disease or discontinuation due to development of toxicity .
in the study by ferrandiz et al . , patients were treated with combination therapy of thrice weekly narrow - band uvb phototherapy and thalidomide at 100 mg daily for 2.55 months .
excellent responses were achieved after an average of 3 months on thalidomide and 32 uvb courses .
one patient that was taking lenalidomide was kept on 5 mg for over 2 years , while the other took 10 mg daily for 3 months [ 11 , 13 ] . for lenalidomide ,
lenalidomide offered a relatively low toxicity treatment to patients who had toxicity to thalidomide.table 1studies utilizing thalidomide
for treatment of prurigo nodularisstudypatientsm : fage ( years)dose per day ( mg)duration ( months)resultsadverse effectsfollow - up ( months)van de broek 11:054200 mg3lesions gradually flattened and pruritus disappearednone clemmensen et al .
31:22969200 mg200 mg with maintenance dose of 50 mg300 mg622two patients reported pruritus resolved and all lesions healed .
one patient showed no improvement in symptomstwo developed paresthesias in hands after 1118 months , one had adverse effects persist > 1 year after discontinuation .
mg then tapered to 100 mg100 mg then increased to 200 mg .
after relapse , second course was maintained at 200 mg39all showed marked reduction in pruritus by 1 month and flattening of lesions by 2 months .
two remained in remission at 2 and 3 years follow - up , two relapsed within 2 weeks and required a second courseno significant adverse effects .
11:049200 mg then ranged from 100 to 150 mg for 9 months14at 2 months , a dramatic decrease in number of active lesionsat 5 months , the pruritus disappearedmild peripheral neuropathy of legs that may be due to either pn or hiv medications2.75herranz et al .
11:035100 mg1.5dramatic improvement of cutaneous lesions and disappearance of the pruritusnone reported1crouch et al .
51:42371100 mg13.5three showed improvement of lesions , two had no changethree patients ceased treatment due to adverse events , two from peripheral neurotoxicity and one from dizziness , angina , and worsening diabetes4alfadley et al .
11:037100 mg b.i.d , for 3 weeks increased to 300 mg q daily for 8 months , then tapered to maintenance of 50 mg q 48 h for 3 months19after 8 months , most of the lesions and pruritus resolvedat 8 months , developed mild sensory loss , then developed total peripheral neuropathy which prompted discontinuation . at 4-month
8100 mg then randomized to 100 or 200 mg ( range from 33 to 200 mg)123 ( avg .
8)eight had > 50% response in reduction of pruritus over 3.4 months ( average ) .
seven had > 50% reduction of skin involvement over 5 months ( average ) .
four patients were followed up for 1.59.5 months after treatment and three maintained a > 50% response and the last relapsedthree developed thalidomide peripheral neuropathy ( one at 1 month , two at 7 months ) .
weight gain , constipation , sedation , cognitive , and mood changes were also noted1.59.5sharma et al .
11:044100 mg for 2 weeks increased to 200 mg for 2 months2.5complete resolution of lesionssedation lan et al .
64:24086100 mg then tapered1.515all reported prominent reduction in pruritus and reduced excoriation of skin lesions .
one had recurrence and was treated with a second course , which proved successfultwo had sedation , one had generalized erythema with lower leg edema that resolved without intervention after 3 weeks020doherty and hsu 12100 mg tapered to 50 mg if early clinical improvementover 1one had mild ( no worsening and < 25% ) improvement , six had moderate ( 2590% ) improvement , and one had complete ( > 90% ) improvementnumbness , constipation , and sedation orlando et al .
10:152100 mg for 1 month , 50 mg for 2 months , then dosage increased to 100 mg for 1 month , and reduced again to maintenance of 50 or 100 mg orally alternate days6after 1 month , pruritus decreased and skin examination revealed that most lesions had disappeared or flattened .
after 4 month , s dose was increased back to 100 mg and leg nodules showed significant decrease in size and numberno significant side effects reported6andersen et al .
100 mg dailyfour patients decreased to 50 mg due to gastrointestinal side effectsavg .
26.2525 patients had significant improvement , six had mild improvement , and one had complete clearing .
six had no affect and four were lost to follow - up25 reported transient peripheral neuropathy ( at 89 weeks average ) , nine had sedation , seven had dizziness , and five described a rash
49.7)50100 mg for 12 patients150200 mg for 1 patient3142seven showed complete improvement after 3 months ( average ) with four on maintenance treatment at last follow - up .
four showed slight improvement and treatment for two was judged to be unsuccessfulfour patients discontinued treatment due to peripheral neuropathy ) , renal toxicity , or sedation and dizziness .
10:14550 mg daily initial then increased to 100 mg and then 150 mg significant reduction in pruritus that allowed for discontinuation of corticosteroidsexperienced peripheral neuropathy at higher doses requiring reduction to 50 mg daily
avg average , hx history , pts patients , y / o years old , b.i.d .
bis in dietable 2studies utilizing thalidomide with uvb or lenalidomide for treatment of prurigo nodularisstudypatientsm : fage ( years)treatmentdose per day ( mg)duration ( months)resultsadverse effectsfollow - up ( months)ferrandiz et al
of 3 months on thalidomide , pruritus was greatly reduced and lesions flattened . then , after an avg . of 8 uvb sessions
of 32 uvb treatmentsone patient had reversible peripheral neuropathy and one had nausea418kanavy et al .
10:145lenalidomide5 mg for 4 months , decreased to every other day , then every 4th day , then increased back to 5 mg due to flare upsover 24 monthswithin 2 weeks , noticed significant reduction in pruritus and improvement in sleep , mood , and ability to concentrate .
after 1 month , had near complete resolution of pruritus and visible healing of the prurigo nodules .
when dose was lowered , the patient developed worsening pruritusinitially somnolence and fatigue , but this resolved after changing to bedtime dosing24liu et al .
10:164lenalidomide10 mg3 monthsafter 1 month , had significant reduction in number of nodules and pruritus , continued to improve over the next 2 months , but relapsed after discontinuationmild side effects ( nausea , vomiting , malaise , arthralgia ) , and after 3 months , weakness in right leg prompted discontinuation studies utilizing thalidomide
for treatment of prurigo nodularis
avg average , hx history , pts patients , y / o years old , b.i.d .
a total of 106 patients were included in this review , 76 ( 71.7% ) of whom showed significant improvement in reduction of pruritus and disappearance of nodules [ 1 , 2 , 4 , 1428 ] .
only slight or mild improvement was seen in 11 ( 10.3% ) patients [ 23 , 25 , 26 ] , while 15 ( 13.3% ) patients showed no improvement at all [ 19 , 23 , 25 , 26 , 29 ] .
pruritus typically was the first to decrease with a noticeable clinical difference by 24 weeks followed by flattening of lesions and decreased excoriation which occurred at an average of 2 months . for patients who achieved complete or almost complete remission , time until that endpoint varied from as little as 1 month to as long as 8 months .
overall , there were a reported 39 ( 36.8% ) cases of peripheral neuropathy [ 1 , 4 , 15 , 16 , 1820 , 2528 ] not including the additional patients affected in doherty and hsu s study , as the exact amount was unable to be obtained .
thalidomide - induced neuropathy developed after 1 week to 7.5 years of treatment . in most cases , the peripheral neuropathy was reversible and took up several months to resolve .
some patients with hiv / aids experienced peripheral neuropathy , but it was unclear if it was due to thalidomide or the hiv infection .
had one patient who still experienced neuropathy over a year after discontinuation ; however , it should be noted that the patient used the drug for 18 months .
although no studies directly or extensively addressed the subject , there appears to be increased toxicity at higher doses of thalidomide [ 14 , 20 , 22 , 26 ] .
sedation , gastrointestinal symptoms , and dizziness were the other most - often reported adverse effects .
lenalidomide was used in two patients after they failed thalidomide therapy [ 14 , 27 ] .
the other patient also developed tingling and decreased sensation with thalidomide ; however , she eventually re - developed neuropathy after a trial of lenalidomide .
more studies are needed to determine the outcomes of thalidomide compared to lenalidomide , and whether this could be a preferred treatment option with less side effects .
seven patients relapsed after thalidomide - induced improvement of pn symptoms and cessation of therapy [ 14 , 15 , 17 , 22 , 27 ] .
four achieved remission after a second course of completed therapy [ 15 , 17 , 22 ] , and one continued to have disease flare - ups with multiple attempts at tapering the dose , and thus was maintained on 5 mg / day of lenalidomide .
the last one had to stop treatment after courses of both thalidomide and lenalidomide due to neuropathy , and relapsed without further resolution .
prurigo nodularis is a severely pruritic skin disease and standard therapy often yields unsatisfactory results .
thalidomide and lenalidomide can be effective alternative treatments for refractory pn , though optimal dosage and treatment time varied in the reviewed studies .
clinical data compiled in this review show that individuals with severe disease experienced the most significant reduction in pruritus and improvement in the appearance of skin . historically , thalidomide has been used with reluctance due to toxicity ; however , the incidence and persistence of adverse effects including neuropathy is highly variable among patients , in the majority of whom clinical improvement preceded the development of permanent deficit .
ideal treatment length and dosing regimens may help abate most side effects . to further avoid adverse effects
, thalidomide could be used in sequential combination therapy with uvb or followed by its analogue lenalidomide .
both options shorten the treatment length for thalidomide and may limit adverse reactions ; however , most studies are limited by virtue of being case reports and their low power . in the contemporary era of targeted therapy , an enhanced understanding of the biology and related physiology of pn
additionally , understanding of the molecular mechanisms of thalidomide and lenalidomide may also further elucidate their role in the treatment of pn . given the findings in the aforementioned studies , thalidomide and its analogues
should be further evaluated in a prospective manner with the aim of improving efficacy and reducing treatment - related toxicity by determining the most effective dosing and treatment time . | prurigo nodularis ( pn ) is a chronic dermatoses characterized by intensely pruritic , excoriated , or lichenified nodules .
standard therapy includes corticosteroids , antihistamines , and phototherapy ; however , treatment results are often inadequate or transient .
thalidomide and its analogue lenalidomide are immunomodulatory drugs that have successfully been used to treat refractory cases of pn .
a systematic review was performed evaluating the use of thalidomide and lenalidomide for pn .
eighteen articles were included in this study in which a total of 106 patients were evaluated , of whom 76 ( 71.7% ) had moderate to significant improvement of pn with the use of thalidomide , lenalidomide , or both .
patients given thalidomide were treated with doses of 50300 mg daily for 1142 months , with the majority being treated for less than 1 year .
patients treated with lenalidomide were given a daily dose of 510 mg from 3 to 24 months .
the most common side effects observed were sedation , gastrointestinal symptoms , and transient peripheral neuropathy . while thalidomide and lenalidomide are drugs that have shown promising results in these studies , caution should be taken in prescribing these medications and patients should be informed about the potential side effects .
as such , large - scale randomized controlled trials with long - term follow - up are needed to determine appropriate dosing , efficacy , and toxicity profiles . |
hepatic sinusoidal obstruction syndrome ( sos ) , also known as veno - occlusive disease ( vod ) , is a serious , life - threatening complication that is sometimes observed after hematopoietic - stem cell transplantation ( hsct ) ( 1,2 ) .
pathophysiologically , sos results from the activation of the sinusoidal endothelial cells ( secs ) , leading to the damage of these cells and the obstruction of the hepatic sinusoids in the acinar zone 3 ( 3 ) .
secs are activated by chemotherapy and radiotherapy , resulting in the sustained and intense production of cytokines , which induces endothelial damage and sinusoidal endothelial swelling ( 3 ) .
the progression of sos involves the depletion of glutathione and nitric oxide from the secs , the increased expression of intrahepatic matrix metalloproteinases and vascular endothelial growth factor , and the activation of clotting factors ( 4 ) .
these alterations induce the egress of red blood cells , leucocytes and cellular debris into the space of disse , leading to the obstruction of the sinusoid ( 1 ) .
for example , patients with metastatic colorectal cancer who receive oxaliplatin - based neo - adjuvant chemotherapy frequently experience sos , resulting from toxic injury to the secs ( 5 ) .
moreover , a significant correlation was observed between the administration of oxaliplatin and the development of sos , suggesting the importance of the functional liver reserve in patients undergoing major hepatectomy for colorectal metastasis ( 6 ) .
these reports suggested that chemotherapies that are toxic to endothelial cells may induce sos , especially in patients with liver damage .
we herein describe the case of a patient who developed hepatic sos after non - hsct chemotherapy for non - hodgkin lymphoma .
the patient was a 58-year - old japanese man who had previously undergone splenectomy with red blood cell transfusion for autoimmune hemolytic anemia . prior to his presentation at our hospital ,
he had experienced a fever of 38c , night sweats , and fatigue for several days . at admission , he had systemic lymphadenopathy .
the laboratory data showed a white blood cell count of 9,100 /l with normal fractions , hemoglobin , 10.7 g / dl , lactate dehydrogenase ( ldh )
the patient 's liver enzyme levels were within normal limits , and he was negative for hepatitis b surface antigen , anti - hepatitis c virus ( hcv ) antibody , and anti - human immunodeficiency virus antibody .
serum antibodies to epstein - barr virus ( ebv ) demonstrated a past infection pattern .
an esophagogastroduodenal endoscopy showed an irregular ulcer in the body of the stomach and multiple flat - elevated lesions in the duodenum ( fig .
computed tomography ( ct ) showed multiple adenopathy of the lymph nodes of the neck , axilla , mesentery , and paraaorta ( fig .
1c - e ) , with the uptake of fluorodeoxyglucose . following a cervical lymph node biopsy ,
biopsies were performed from < 1-<2 and < 4-<6 , and all of the samples revealed diffuse large b - cell lymphoma .
c ) a ct image showing the enlargement of multiple lymph nodes from the neck .
e ) a ct image showing the ascites on the surface of the liver . a cytological analysis of the ascites revealed class v. the patient was started on treatment for dlbcl , which consisted of rituximab , cyclophosphamide ( cpa ) , doxorubicin ( dxr ) , vincristine ( vcr ) and prednisolone ( r - chop ) .
however , fluorescence in situ hybridization revealed that his lymphoma tissue was positive for both myc and bcl2 rearrangements .
thus , he was re - diagnosed with double - hit lymphoma ( dhl ) , an aggressive disease that is associated with poor clinical outcomes ( 7 ) .
although r - chop has been associated with inferior outcomes in patients with dhl ( 7 ) , at the present time , there is no standard treatment for dhl . data from retrospective studies suggest that more intensive chemotherapy , such as r - codox - m / ivac , which consists of rituximab , cpa , vcr , dxr and methotrexate ( r - codox - m ) alternated by ifosfamide , etposide and high - dose cytarabine ( ivac ) , may achieve better outcomes in patients with dhl ( 8) . after 2 cycles of r - chop , he was started on r - codox - m / ivac .
after the first cycle of r - codox - m , the patient 's hepatobiliary enzyme levels were transiently elevated , dropping to normal levels in the absence of treatment .
his hepatobiliary enzyme levels were elevated again after the second cycle of r - codox - m / ivac ( fig .
2a ) ; for example , the concentrations of aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) were 516
iu / l and 288 iu / l , respectively , and the concentrations of total and direct bilirubin were 5.5 mg / dl and 3.9 mg / dl , respectively .
a blood test revealed a white blood cell count of 800 /l , a hemoglobin level of 6.3 g / dl and a platelet count of 3,000 /l because of the myelosuppressive effect of the chemotherapy .
a physical examination showed body weight gain ( + 2 kg / week ) , jaundice , lower leg edema and abdominal distention .
serum antibodies to herpes simplex virus , cytomegalovirus ( cmv ) and ebv indicated their past infection . although the serum transaminase concentration was slightly decreased without any specific treatment , the serum bilirubin concentration gradually increased .
abdominal ultrasonography showed a normal hepatobiliary tract with hepatomegaly and mild ascites on the surface of the liver .
these findings were suggestive of severe drug - induced liver injury ; thus , all possibly causative drugs , including the antibiotics that were initiated after admission , were discontinued .
nevertheless , the serum concentrations of liver enzymes remained high . the bilirubin level to rise until it peaked at 34.4 mg / dl ( fig .
ct showed hepatomegaly with a geographic low density area at the posterior segment of the liver ( fig .
a liver biopsy specimen showed bile congestion of the bile capillaries and hepatocytes , as well as sinusoidal dilatation , but the structure of the bile duct was preserved and there was no evidence of central vein stenosis or obstruction ( fig .
the patient was therefore diagnosed with severe cholestatic - type drug - induced liver injury .
he was treated with nafamostat mesilate in addition to glycyrrhizic acid and ursodeoxycholic acid and was observed carefully . however , his severe jaundice persisted and his liver function did not recover . follow - up ct showed progressive atrophy of the liver and an increase in ascites ( fig .
2c - e ) , followed by cmv pneumonia . despite being admitted to the intensive care unit and receiving ventilator support , there was an exacerbation of the patient 's pneumonia and he died of respiratory failure .
a ) the clinical course of the present patient , including the timing of ct ( as shown as b - e ) .
b ) a contrast - enhanced ct image shows hepatomegaly and geographic low density area at the posterior segment of the liver .
c)-e ) ct images showing the increase of ascites and the progression of liver atrophy .
e ) h&e staining ( 200 ) the arrowhead shows dilatation of the sinusoid and congestion caused by erythrocytes .
his liver weighted 1,175 g , and its surface division resembled nutmeg liver ( fig .
4a ) . microscopically , torn hepatic cords were visible , along with fibrosis of the sinusoids , bile congestion , and stenosis of the central vein .
4b - f ) . inflammatory cell infiltration was less apparent , and there was no evidence of thrombosis .
we also observed congestion of the central vein due to the occlusion of venules , ischemic necrosis of the hepatocytes , the growth of connective tissue under secs by the dilatation of the sinusoids , along with the narrowing and occlusion of the sinusoids ( fig .
the autopsy also revealed that there were no identifiable lymphoma cells in any of the organs or lymph nodes .
b ) h&e staining ( 400 ) showing the dilation of the sinusoid due to erythrocytes ( arrowhead ) and a bile plug ( arrow ) .
c ) azan staining ( 400 ) showing the growth of connective tissue under the sinusoidal endothelial cells ( arrowhead ) .
e ) h&e staining ( 400 ) showing stenosis of the central vein ( arrowhead ) and ischemic necrosis of the hepatocytes .
f ) azan staining ( 400 ) showing the deposition of connective tissue around the central vein , which caused stenosis of the central vein ( arrowhead ) .
hepatic sos is a life - threatening complication that is usually observed after hsct ; however , some patients experience hepatic sos outside the transplantation setting ( 4 ) .
clinical diagnostic criteria have been proposed for the diagnosis of hepatic sos ( 9,10 ) .
these are based on the presence of the following clinical findings within the first three weeks after hsct : 1 ) jaundice ( bilirubin > 2 mg / dl ) ; 2 ) hepatomegaly or right upper quadrant pain ; and 3 ) weight gain ( 11 ) . in hepatic sos ,
non - thrombotic fibrous occlusion of the terminal hepatic vein is a characteristic finding of hepatic sos ( 4 ) . in this case , sos had been suspected due to jaundice , ascites and body weight gain ; however , the diagnosis of sos was not confirmed by liver biopsy findings .
liver biopsies are almost never obtained during the acute phase of hepatic sos and the failure to recognize the centrilobular venopathy may lead to the misinterpretation of the histologic findings ( 4 ) .
thus , clinicians should carefully consider the possibility of hepatic sos if clinical manifestations indicating hepatic sos are observed after chemotherapy .
the risk factors for sos include older age , female gender , specific types of conditioning regimen ( e.g. myeloablative ) , preexisting liver diseases , atiii defects , and thalassemia ( 4 ) .
in particular , patients with a serum transaminase level of > 2.5 times the upper limit of normal ( uln ) , a serum bilirubin level of > 1.5 times the uln , liver cirrhosis , hepatic irradiation , and active viral hepatitis are considered to be at risk of sos ( 12,13 ) .
this patient experienced a serum transaminase concentration of 10 times the uln after the first cycle of r - codox , suggesting that this treatment regimen may have been responsible for the induction of hepatic sos .
the drugs administered to our patient may have also influenced liver dysfunction leading to hepatic sos .
the intensity of the transplant conditioning regimen has been reported to be the greatest risk factor for sos ( 14 ) . in r - codox - m /
for example , in r - chop for dlbcl , the dose of cpa is 750 mg / m ( 15 ) .
in contrast , in r - codox - m / ivac for dhl , the dose of cpa is 1,600 mg / m ( 8) , or approximately two - fold higher .
cpa metabolites have been shown to deplete hepatic glutathione levels , inducing oxidative stress and hepatotoxicity ( 16 ) , which may lead to sos .
genetic polymorphisms of glutathione s - transferase ( gst ) m1 , which are associated with glutathione depletion have recently been shown to be a risk factor for the development of sos in patients undergoing hsct and those receiving oxaliplatin - based chemotherapy ( 17,18 ) .
although we could not investigate the presence of possible genetic polymorphisms of gst m1 in our patient , caution should be exercised in treating patients with high - dose cpa or chemotherapy regimens that contain agents that are toxic to the secs . despite our best efforts , we did not reach the diagnosis of sos while the patient was alive . although we performed a liver biopsy to assess the cause of liver injury , the liver parenchyma showed only sinusoidal dilatation and congestion . the absence of sinusoidal obstruction or central vein stenosis in the biopsy specimen prevented us from reaching a diagnosis of hepatic sos while the patient was alive .
a liver biopsy is essential in diagnosing liver injury ; however biopsy samples are limited , as they only evaluate 0.002% of the area of the liver ( 19 ) .
ct findings , such as hepatomegaly , abdominal effusion and geographic low density changes , have been recently reported as characteristics of hepatic sos ( 20 ) .
although additional patients with hepatic sos should be assessed by ct , hepatic sos should be considered when ct shows hepatomegaly , abdominal effusion and a geographic low density area or when a liver biopsy shows sinusoidal dilatation and congestion after the administration of a chemotherapy regimen that is toxic to the secs .
there are no established therapies for this condition other than for defibrotide ( df ) , a polydisperse mixture of single - stranded oligonucleotides with antithrombotic and fibrinolytic effects ( 2,14 ) .
df has been shown to be effective both in the treatment of severe sos accompanied by multiple organ failure ( 21,22 ) , and in preventing the development of sos ( 23 ) .
although the patient of the present study may have benefited from df , this agent has not yet been approved in japan .
hepatic sos occurs in patients after hsct and in those receiving chemotherapy regimens that are especially toxic to the secs . identifying patients who are at risk of developing sos , and the awareness of the possibility of sos in patients who experience refractory liver injury after chemotherapy are important .
ct findings , such as hepatomegaly , abdominal effusion and geographic low density changes , and liver biopsy findings , such as sinusoidal dilatation and congestion , that occur after chemotherapy should be considered to be highly suggestive of hepatic sos .
| hepatic sinusoidal obstruction syndrome ( sos ) , a serious complication that mainly occurs after hematopoietic - stem cell transplantation ( hsct ) , is caused by damage to the sinusoidal endothelial cells after the obstruction of the sinusoid .
recently , hepatic sos was reported to occur after non - hsct chemotherapies .
this report describes a patient who experienced hepatic sos after non - hsct chemotherapy for non - hodgkin lymphoma .
a liver biopsy showed the slight dilatation of the hepatic sinusoid , which may be indicative of hepatic sos .
hepatic sos should be included in the differential diagnosis of patients with severe liver injury following the administration of chemotherapy regimens that are toxic to the vascular endothelial cells . |
o objetivo deste estudo foi avaliar , in vitro , a qualidade do preenchimento de canais radiculares curvos com a pasta de hidrxido de clcio [ ca(oh)2 ] ultracal ( ultradent ) , associada ou no a cones de guta - percha contendo hidrxido de clcio ( calcium hydroxide plus points , roeko ) .
cento e vinte razes de dentes humanos extrados , aleatoriamente distribudas em 3 faixas de curvatura ( leve - 0 a 14 ; moderada - 15 a 29 ; severa > 30 ) foram utilizadas .
aps o preparo qumico - mecnico , as razes foram divididas em 4 grupos ( n=30 ) de acordo com o mtodo de aplicao da medicao intracanal : grupo 1 aplicao da pasta de ca(oh)2 com espiral de lentulo ; grupo 2 aplicao da pasta de ca(oh)2 com espiral de lentulo , seguida da introduo de um cone de ca(oh)2 ; grupo 3 aplicao da pasta de ca(oh)2 com a ponta navitip ( fornecida com o sistema ultracal ) ; grupo 4 aplicao da pasta de ca(oh)2 com a ponta navitip seguida da introduo de um cone de ca(oh)2 .
as razes foram diafanizadas e avaliadas quanto qualidade do preenchimento do tero apical dos canais por um examinador calibrado .
os espcimes foram examinados em lupa estereoscpica e classificadas por escores de 1 a 4 ( desde preenchimento inadequado at preenchimento total dos canais ) .
os resultados foram comparados atravs da anlise de varincia e teste post hoc de duncan com nvel de significncia de 5% .
no se observaram diferenas estatisticamente significantes ( p>0.05 ) entre os graus de curvatura dos grupos 1 , 3 e 4 quanto ao preenchimento dos canais .
os grupos que associaram pasta e cones de ca(oh)2 ( 2 e 4 ) apresentaram melhor preenchimento apical em relao aos demais grupos , porm essa diferena foi estatisticamente significante ( p<0,001 ) somente para as razes com curvatura severa .
de acordo com os resultados deste estudo , o grau de curvatura no influenciou na qualidade do preenchimento . as tcnicas que utilizaram cones de guta percha contendo ca(oh)2 promoveram um melhor preenchimento
the disinfection of the root canal system is one of the most important aspects that account for the success of endodontic therapy .
the use of a calcium hydroxide [ ca(oh)2]-based intracanal dressing between sessions has a major role in decreasing the microbial population within the root canals6 . for optimal effect , ca(oh)2 should be in intimate contact with the dentinal walls , along the whole canal extension5,6,7 .
nevertheless , three - dimensional filling is not easily obtained , especially in curved canals , in which failures occur mostly in the apical third4,15,17,18 .
the similarity between ca(oh)2 and conventional gutta - percha points facilitates their placement into root canals up to the working length2,11,13,14 .
there are no studies in the literature that associate the use of ca(oh)2 paste and points .
therefore , this in vitro study evaluated the quality of ca(oh)2 paste filling , associated or not with ca(oh)2-containing gutta - percha points in curved root canals .
the research project was submitted to review by research ethics committee of lutheran university of brazil and the designed methodology was approved ( process # 2004 - 138h ) .
one hundred and twenty roots were selected from extracted human first molars and single - rooted teeth .
buccolingual and mesiodistal radiographs were taken to confirm absence of anomalies of form and size , full development of roots and presence of a single canal per root .
maxillary first molars with more than one canal in the mesiobuccal root were included in the study , but only the main canal was used .
the length of the roots was standardized between 14 and 18 mm by sectioning the crowns at the cementoenamel junction .
the roots were classified according to their degree of curvature as mild ( 0 to 14 ) , moderate ( 15 to 29 ) and severe ( above 30 ) , as proposed by fontanella , et al.8 ( 2004 ) .
forty roots were selected for each of the three ranges of curvature degree . a size
10 k - type file was introduced into the canal until the tip of the instrument was visualized at the apical foramen .
working length ( wl ) was calculated by subtracting 1 mm from this measurement . before shaping ,
the cervical third was prepared with sizes 1 , 2 and 3 laxxess instruments at 650 rpm .
the middle and apical thirds were shaped according to the step - back technique up to a size 50 k - type file , the size 30 k - type file being the memory file . at each change of instrument ,
the canals were alternately irrigated with 2 ml of 1% sodium hypochlorite and 2 ml of 17% trisodium edta .
, south jordan , ut , usa ) and size 30 ca(oh)2-containing gutta - percha points ( calcium hydroxide plus points ; roeko , langenau , germany ) , which were delivered to root canals following different protocols .
prior to the placement of intracanal dressings , the sample received a stratified randomization to guarantee uniform distribution of the different curvature degrees in each group of treatment .
group 1 : a size 25 lentulo spiral ( maillefer instruments sa , ballaigues , switzerland ) carrying small portions of ca(oh)2 paste was placed into the canals at 2 mm from the working length and powered at low speed until paste reflow was observed .
petrpolis , rj , brazil ) was used at canal entrance to condense the intracanal dressing towards the root apex .
group 2 : root canals were filled in the same way as described for group 1 . however , after the paste was condensed , a size 30 ca(oh)2-containing gutta - percha point was introduced into the canal up to the working length .
group 3 : root canals were filled using a navitip tip ( supplied with ultracal kit ) .
the navitip tip was attached to ultracal syringe and introduced into the canals up to 2 mm from the working length .
the syringe embolus was then pushed and the syringe was pulled backwards slowly , until paste reflow was observed .
ltda ) was used at canal entrance to condense the intracanal dressing towards the apex .
group 4 : root canals were filled in the same way as described for group 3 .
however , after the paste was condensed , a size 30 ca(oh)2-containing gutta - percha point was introduced into the canal up to the working length .
both areas were sealed with conventional glass ionomer cement ( ketac - fill plus , espe , seefeld , germany ) , light - cured composite resin ( heraeus- kulzer , hanau , germany ) and araldite resin handled according to the manufacturers ' instructions .
the teeth went through a clearing process3,10 by immersion in 5% nitric acid ( qumica delaware , porto alegre , rs , brazil ) for 72 h ( the solution being changed every 24 h ) , washing in running water for 4 h and successive dehydration in 80% alcohol for 12 h , 90% alcohol for 1 h and 99% alcohol for 3 h ( changed every hour ) .
the teeth were then placed in methyl salicylate ( qumica delaware ltda . , porto alegre , rs , brazil ) , which rendered them transparent .
the cleared roots were examined under a stereomicroscope ( gsz , zeiss , germany ) at 16x magnification and the quality of canal filling was assessed .
a calibrated experienced examiner , blinded to curvature degrees and groups of treatment , examined all surfaces of the apical third of each root and attributed scores to the specimens according to the following ranking scale : score 1 : inadequate root canal filling 0 - 50% of intracanal space was filled ( figure 1 ) ; score 2 : root canal filling with great failures 51 - 70% of intracanal space was filled ( figure 2 ) ; score 3 : root canal filling with minor failures
71 - 85% of intracanal space was filled ( figure 3 ) ; score 4 : complete root canal filling 86 - 100% of intracanal space was filled ( figure 4 ) .
intra - examiner reliability was assessed by intraclass correlation coefficient ( icc ) after reexamination of 15 specimens .
data referring to the quality of filling obtained with the different techniques , as a function of curvature degree , were described as means and standard deviations .
analysis of variance compared the results of the groups at curvature levels and duncan 's post hoc test identified the differences .
data were assessed using spss software , version 11 ( statistical package for the social sciences , adobe systems inc .
, san jose , ca , usa ) and sigma plot ( sigma - aldrich corp .
during clearing procedures , 5 specimens were lost because of infiltration of liquids used in the process .
means and standard deviations of the scores attributed to each group are shown table 1 .
regarding the degree of curvature , it was observed that in groups 1 ( lentulo ) , 3 ( navitip ) and 4 ( navitip + point ) there were no statistically significant differences ( p>0.05 ) among the curvature ranges . in group 2 ( lentulo + point )
there was bordering statistical significance ( p=0.05 ) for severe curvature in comparison to the other curvature degrees . regarding the filling techniques , the groups that associated the use of ca(oh)2 paste and points ( 2 and 4 ) showed better filling of the apical third than the groups that received ca(oh)2 paste alone as intracanal dressing ( 1 and 3 ) .
however , this difference was statistically significant ( p<0.001 ) only for the roots with severe curvature .
this study evaluated the quality of intracanal dressing placement in root canals filled with ultracal ca(oh)2 paste .
this paste has a new injectable application system , navitip , which was developed for use in curved canals .
lentulo spirals , which are still the most indicated instruments for this purpose , were also used in comparison to the manufacturer - supplied tips4,5,12,15,17,18 . the hypothesis that the placement of ca(oh)2 points into canals filled with ca(oh)2 paste would produce an embolus effect and improve apical filling quality
the roots used in this study were classified in each of the curvature ranges not only by their angulation .
the initial position of curvature was also considered because both parameters determine the severity of root curvature1,11 .
apical foramen was provisionally sealed with wax prior to application of intracanal dressing to prevent air escape from the canal .
foramen patency could produce a falsely adequate filling that would not reflect the clinical situation18 .
the findings of this study indicate that , under the investigated conditions , the quality of root canal filling was not influenced by curvature degree in the groups filled using lentulo spiral , navitip and navitip + point . there were no statistically significant differences ( p>0.05 ) among the three curvature ranges ( mild , moderate and severe ) for these groups .
these results are not consistent with those of torres and luft17 ( 2003 ) , who reported better root filling quality in teeth with mild curvature than in severely curved roots , regardless of the technique used .
this discrepancy of results may stem from the variability of root anatomy . far more than curvature ,
the complexity of the root canal systems , with its numerous ramifications , is a variable difficult to control and may either facilitate or impair the filling of the canals . bordering statistical significance ( p=0.05 ) was observed in group 2 ( lentulo + point ) when degree of curvature was compared . in this case , the action of the ca(oh)2 point seemed to be beneficial for filling severely curved canals but did not affect the quality of filling in the other curvature ranges . regarding the filling technique , groups 2 and 4 presented higher scores than the other groups in mild and moderate curvature ranges , but this difference was not significant statistically ( p>0.05 ) .
the superiority of the techniques employing ca(oh)2 points was established in roots with severe curvature . in this range ,
groups 2 and 4 presented better root canal filling ( p<0.001 ) than the other groups in which ca(oh)2 paste alone was used .
the results of this study are in agreement with those of estrela , et al.5 ( 2002 ) , who reported an adequate root canal filling when a ca(oh)2 paste prepared with an aqueous vehicle was used as an intracanal dressing . in the present study , in all groups ,
ca(oh)2 paste was condensed at canal entrance towards the apex using a paper point of great diameter . in the groups where ca(oh)2 points were used , condensation of the intracanal dressing occurred in apical third .
these findings suggest that the physical embolus action of the ca(oh)2 point resulted in better filling quality , pushing the paste into an intimate contact with root canal walls .
therefore , a similar effect may be expected if conventional gutta - percha points are used in the same way .
the filling obtained with use of ultracal paste alone corroborates the findings of previous studies .
this system seems to be inadequate for use in curved canals because the diameter of the tip supplied with the kit ( 0.76 mm ) is not compatible with that of severely curved root canals . according to staehle , et al.16 ( 1997 )
, needles with diameters greater than 0.6 mm can be employed only for straight canals enlarged apically at least up to a size 50 file , which did not occur in the present study . in view of these findings
, it seems clear that the quality of curved root canal filling with an aqueous calcium hydroxide paste is considerably improved when ca(oh)2 points are also used .
the association of paste and points seemed to make the difference , mainly in canals with more accentuated curvatures .
according to the methodology proposed and based on the results of this study , the following conclusions may be drawn :
all techniques were unable to fill root canal apical third completely.when lentulo spiral , navitip tip and navitip + ca(oh)2 points were employed , the curvature range did not influence the quality of apical third filling.when lentulo spiral was associated with ca(oh)2 point , canals with severe curvature presented better filling than those with mild to moderate curvatures.the techniques that associated ca(oh)2 paste and point ( lentulo + point and navitip + point ) yielded better filling quality at root canal apical third in roots with severe curvature .
when lentulo spiral , navitip tip and navitip + ca(oh)2 points were employed , the curvature range did not influence the quality of apical third filling . when lentulo spiral was associated with ca(oh)2 point , canals with severe curvature presented better filling than those with mild to moderate curvatures .
the techniques that associated ca(oh)2 paste and point ( lentulo + point and navitip + point ) yielded better filling quality at root canal apical third in roots with severe curvature . | purposethe aim of this study was to evaluate , in vitro , the quality of calcium hydroxide [ ca(oh)2 ] paste filling ( ultracal , ultradent ) associated or not with ca(oh)2-containing gutta - percha points ( calcium hydroxide plus points , roeko ) in curved root canals.material and methodsone hundred and twenty roots of extracted human teeth , randomly divided into three curvature ranges ( mild - 0 to 14 ; moderate - 15 to 29 ; severe - > 30 ) were used .
after chemomechanical preparation , the roots were assigned to 4 groups ( n=30 ) , according to the technique of intracanal dressing placement : group 1 - ca(oh)2 paste was applied with a lentulo spiral ; group 2 - ca(oh)2 paste was applied with a lentulo spiral and a ca(oh)2 point was inserted into the canal ; group 3 - ca(oh)2 paste was applied with a navitip tip ( supplied with ultracal system ) ; group 4 - ca(oh)2 paste was applied with a navitip tip and a ca(oh)2 point was inserted into the canal .
the roots were cleared and the quality of apical third filling was assessed by a calibrated experienced examiner .
the specimens were examined under stereomicroscopy and scored 1 to 4 ( i.e. , from inadequate to complete root canal filling ) .
the results were analyzed statistically by anova and duncan 's post hoc test at 5% significance level.resultsthere were no statistically significant differences ( p>0.05 ) among the curvature degrees in groups 1 , 3 and 4 .
severely curved roots in group 2 presented bordering significance ( p=0.05 ) .
the groups that associated the use of ca(oh)2 paste and points ( 2 and 4 ) showed better apical filling than the other groups , but this difference was statistically significant ( p<0.001 ) only for roots with severe curvature.conclusionaccording to the results of this study , the curvature degree did not influence the quality of filling .
the techniques that used ca(oh)2-containing gutta - percha points yielded better filling of the apical third in roots with severe curvature . |
the proteins pspa , im30 ( vipp1 ) , liah and yjfj belong to the pspa / im30 protein family .
structurally , all family members are predicted to be mainly helical , and pspa , im30 and liah form high - molecular weight homo - oligomeric ring structures .
solely yjfj is reported to not form such complexes , and , in fact , yjfj is the most distant and least studied protein in this family .
the tendency of purified pspa , liah and im30 to form ring structures or other higher order oligomers is extremely pronounced and monomers represent a minor fraction in solution .
the observed homo - oligomeric rings are strikingly similar : pspa has been calculated to form 36-mers , and liah also forms ring structures of that size range . im30
has the intrinsic propensity to form varying ring sizes containing ( at least ) 4868 monomers . nevertheless , besides a common phylogenic origin and obvious structural similarities , pspa , im30 and liah have different physiological functions .
the phage shock protein ( psp ) system represents a conserved stress response system of bacteria and archaea . in enterobacteria , psp response proteins are encoded by the pspabcde operon and monocistronic pspf and pspg genes .
thus far , the enterobacterial psp system is the best characterized representative involving a member of the pspa / im30 family . in the absence of stress
one model suggests that the psp system is activated when pspa itself senses membrane defects or stress , resulting in liberation of pspf . as a result ,
transcription of the psp genes is enhanced and the pspa level increases , which triggers the formation of membrane - protecting pspa assemblies . in agreement with this hypothesis ,
alternatively , the main sensory role is attributed to the membrane components pspb and pspc . in this model , membrane stress results in recruitment of pspa to pspc , and a concomitant release of pspf activates the psp response .
indeed , sensing of mistargeted secretins or membrane - destabilizing proteins requires pspb and pspc , which may function in conjunction with pspa . in non - enterobacteria , pspbc may be replaced by other sensory systems .
recent analyses of the pspa - pspf interaction suggest that the pspaf complex does not necessarily need to dissociate to modulate psp gene expression . in summary
, the function of pspa appears to be dual : ( i ) membrane binding and membrane protection as well as ( ii ) upregulation of corresponding genes .
im30 ( inner membrane - associated protein of 30 kda ) , alternatively named vipp1 ( vesicle - inducing protein in plastids ) , is conserved in all organisms harboring thylakoid membranes ( tms ) , i.e. cyanobacteria ( except several prochlorococcus marinus strains ) , algae and higher plants .
thus , while membrane binding and membrane protection appears to be conserved , im30 must have gained extra functions .
although many im30-specific functions have been proposed in the past ( for a recent review , see ref .
21 ) , a recent report suggests that im30 can trigger membrane fusion upon membrane binding , a process crucial for tm biogenesis and maintenance .
the lia system is highly conserved in bacillus and listeria species ( low gc gram - positive bacteria ) .
its expression is controlled by the liafsr three - component system . in the absence of stress conditions ,
the bifunctional histidine kinase lias is kept in its phosphatase state by the inhibitor protein liaf , thereby repressing the activity of the transcriptional factor liar . under stress conditions , liaf presumably releases lias , which switches its activity from phosphatase to kinase state . once activated by phosphorylation
liai is the membrane anchor of liah , which dynamically scans the membrane and recruits liah to the site of envelope damages .
it is postulated that oligomeric liai / liah complexes stabilize a perturbed envelope at the sites of membrane damage .
while all studied members of the pspa / im30 family have acquired specific functions during the course of evolution , pspa and im30 have been shown to directly bind to membrane surfaces and thereby to alter the structure and organization of membranes eventually resulting in membrane stabilization .
liah is suggested to have the same activity , but experimental verification is still missing .
pspa and im30 preferentially bind to negatively charged membranes or to surface curvature - stressed membranes .
surface attachment of im30 or pspa increases the packing density of individual lipids , i.e. , the lipid bilayer becomes more ordered .
increasing the lipid packing density might be a vital repair strategy if stress - induced defects occur in lipid bilayers .
membrane stress resulting in membrane reorganization and eventually in membrane defects might be induced by heat or osmotic stress , by membrane remodeling agents , such as alcohols , as well as by external forces .
importantly , the major lipid species of bacterial as well as tms are non - bilayer forming lipids ( such as pe ( phosphatidylethanolamine ) in e. coli and mgdg ( monogalactosyldiacylglycerol ) in cyanobacterial / chloroplasts ' tms ) . while mgdg is crucial for tm organization , excess of mgdg severely decreases the membrane stability .
in fact , under prolonged stress affecting membrane integrity or fluidity , the mgdg content is adjusted .
membrane binding of pspa or im30 proteins might therefore simply spatiotemporally stabilize short - living protein - free ( instable ) lipid patches by insertion of the hydrophobic side - chains of a membrane - binding amphipathic helix between the lipid acyl - chains of the cytoplasmic lipid bilayer leaflet .
such membrane stabilizing mechanism is discussed for many membrane - active proteins or peptides that contain amphipathic helices , such as antimicrobial peptides or bar ( bin / amphiphysin / rvs)-domain proteins . in case of negative curvature stress or other defects in lipid bilayer structures ,
binding of pspa or im30 proteins to membrane surfaces might stabilize the bilayer structure by the discussed hydrophobic insertion mechanism .
the ability of selected proteins to bind and to protect stressed membranes is important for the fitness and survival of microorganisms and plants , which are constantly exposed to different stresses , like cold , heat , reactive oxygen species ( generated , among other , by an intense photosynthetic activity ) , acid or organic solvents .
membrane binding and protection has already been described for oligomeric proteins belonging to the small heat shock protein ( shsp ) family .
shsps are low - molecular weight proteins ( 1542kda ) that form dynamic 9- to 50-mers . however , the shsps active unit is most certainly a dimer .
hence , dimer formation requires dissociation of the oligomeric structure . under heat stress conditions , the cyanobacterial shsp hspa ( also named hsp17 )
delocalizes from the cytoplasm and binds to tms to protect the membrane ultrastructure by increasing the lipid order and reducing membrane fluidity .
lo18 , a shsp from oenococcus oeni , forms 16-mer spherical complexes . under ethanol - induced membrane stress ,
furthermore , expression of the o. oeni lo18 in lactococcus lactis improved acid stress tolerance of l. lactis , and heterologous expression of hsp17 from caenorhabditis elegans enabled e. coli to grow at temperatures that are normally lethal for the wild - type strain .
it is tempting to postulate a similar role for members of the pspa / im30 family , that is , that the oligomers dissociate on membrane surfaces upon membrane binding to stabilize defined membrane patches .
in fact , for pspa and im30 dissociation of their large ring assemblies is indicated .
im30 lmwo ( lower molecular weight oligomers ) bind with an about 5-fold higher affinity to pg liposomes than im30 rings , which argues for binding of monomers rather than high molecular mass oligomers to membrane surfaces and/or im30 ring disassembly upon membrane binding .
increased membrane affinity of lmwo ( lower molecular weight oligomers ) im30 is discussed to originate from exposure of amphiphilic helices , which are otherwise involved in formation of coiled - coil - type interactions within im30 rings . since lmwo ( lower molecular weight oligomers ) appear to not be stable in solution , formation of the ring structures might simply be vital for shielding the amphiphilic helices .
binding of an im30 ring to tms requires a free lipid area of about 380 nm ( total surface of the ring considered as a disc with an assumed ring diameter of 22 nm ) . in synechocystis pcc 6803 tms , the proportion of proteins ( weight / weight ) is 68% and in spinach tms , the proteins area occupancy has been estimated to be 75% .
thus , binding of im30 rings seems barely probable in vivo within the crowded environment of a tm , unless stressed membrane areas are protein depleted or an unknown mechanism creates such large protein - free lipid domains .
in fact , crowding is not homogeneous in cyanobacterial and plant tms that possess lateral heterogeneity with densely packed and more fluid areas .
however , while a single im30 ring covers an area of 380 nm , the center of a ring is open leaving a free area of 80 nm .
binding of smaller units ( such as monomers ) or flexibly rearranging scaffolds to damaged membranes could completely cover and protect damaged and/or stressed membranes by stabilizing the order of the lipid bilayer via filling the gaps between lipid head groups .
functional characterization of pspa / im30 proteins has been notoriously difficult . but combining the lessons learned from its best studied members the pspa from enterobacteria , im30 ( vipp1 ) from cyanobacteria and plants , and liah from firmicutes allowed extracting a first set of common features with respect to their oligomerization , membrane binding and putative membrane protecting function , as discussed here .
we propose that membrane protection of members of the pspa / im30 protein family is mediated by ( 1 . )
binding of oligomeric / multimeric assemblies or ring structures to stressed membrane areas followed ( 2 . ) by ring dissociation , which results in exposure of membrane - binding amphiphilic helices and finally in coverage of a stressed membrane area by monomers or flexible scaffolds ( fig . 1 ) .
notably , membrane attachment of oligomeric proteins and subsequent local disassembly results in a high monomer concentration that is confined to a selected membrane area .
likely , membrane protection is mediated by binding of oligomeric / multimeric ( ring ) assemblies to stressed membrane area followed by ring dissociation and coverage of a stressed membrane area by monomers or flexible scaffolds .
pspa / im30 membrane binding and ring dissociation
likely , membrane protection is mediated by binding of oligomeric / multimeric ( ring ) assemblies to stressed membrane area followed by ring dissociation and coverage of a stressed membrane area by monomers or flexible scaffolds . clearly , besides the proposed membrane - protective activity of pspa / im30 proteins ,
they have gained more specific functions in their special systems , and these activities are likely differently regulated .
however , the here described insights can now serve as a starting point for more detailed functional and biochemical analyses that will ultimately unravel both general and organism - specific features of the ubiquitously distributed pspa / im30 protein family .
this work was supported by the university of mainz ; and the ernst & margarete wagemann foundation . | abstractpspa , im30 ( vipp1 ) and liah , which all belong to the pspa / im30 protein family , form high molecular weight oligomeric structures . for all proteins membrane
binding and protection of the membrane structure and integrity has been shown or postulated . here
we discuss the possible membrane chaperoning activity of pspa , im30 and liah and propose that larger oligomeric structures bind to stressed membrane regions , followed by oligomer disassembly and membrane stabilization by protein monomers or smaller / different oligomeric scaffolds . |
the risks of systemic inflammation measured by distinct profiles of inflammatory proteins in newborn blood associated with placental colonization by specific groups of bacteria are presented as odds ratios in tables 1 and 2 .
the number of samples that tested positive for each organism or group of organisms is stated in the bottom row of each column .
the odd ratios indicate the relationship of culture - positive cases with those whose placentas did not harbor any culturable microorganism rather than with all cases studied .
risk of neonate systemic inflammatory response associated with placental colonization by specific types of microorganisms all were coagulase negative .
odds ratios ( 95% confidence intervals ) of blood protein concentrations in the top quartile comparing elgans whose placentas harbored a specific type of bacteria ( numbers stated in the bottom row of each column ) with those whose placentas did not harbor any culturable microorganism ( n = 313 )
. values in red indicate statistically significant elevations and values in blue indicate significantly reduced odds ratios .
risk of neonate systemic inflammatory response associated with placental colonization by lactobacillus species alone or mixed with others in contrast to that by bv - associated species significant odds ratio ; p < 0.05 . odds ratios ( 95% confidence intervals ) of blood protein concentrations in the top quartile comparing elgans whose placentas harbored a specific type of bacteria ( numbers stated in the bottom row of each column ) with those whose placentas did not harbor any culturable microorganism ( n = 313 ) .
values in red indicate statistically significant elevations and values in blue indicate significantly reduced odds ratios .
of the 527 placentas studied , 313 were culture negative , and 214 were culture positive for one or more microorganisms of the groups shown in table 1 .
lactobacilli ( detected alone or mixed with other microorganisms in 21 cases or in 9.8% of all culture - positive placentas ) were associated with a prominently low risk of systemic inflammatory reaction in the preterm newborn in contrast to the groups of pathogenic microorganisms and organisms characteristic of bacterial vaginosis ( bv ) , which were all associated with increased risks of specific sets of elevated proteins compared to placentas that did not harbor any microorganisms ( table 1 ) .
the group of bv organisms was most frequently detected , with gardnerella vaginalis , prevotella bivia , anaerobic streptococcus , and peptostreptococcus present alone or in mixed culture in 47% or 22% of all culture - positive placentas , respectively .
the bv organisms were associated with a heightened proinflammatory pattern similar to those of the infectious facultative anaerobes escherichia coli and alpha streptococcus ( each detectable in 28% or 13% of the culture - positive placentas , respectively ) and distinct from those of the various genital mycoplasma species ( collectively detected in 38% or 18% of the culture - positive placentas , respectively ) . the mixed bv microorganisms and
the infectious facultative anaerobes shared an identical pattern of highest odds of elevated levels of interleukin-1 ( il-1 ) , e - selectin , and serum amyloid a ( saa ) .
in addition , the organisms within these two groups variably shared odds for elevated levels of il-6 , tumor necrosis factor alpha ( tnf- ) , tnf receptors , il-8 , intercellular adhesion molecule 1 ( icam-1 ) , icam-3 , c - reactive protein ( crp ) , myeloperoxidase ( mpo ) , vascular endothelial growth factor ( vegf ) , and vegf receptor 2 ( vegf - r2 ) . in total , the proinflammatory protein profile of the cases of mixed bv culture included 9 of the 25 proteins studied and was not duplicated by any single bv microorganism , suggesting that the proinflammatory effect should be attributable to the cumulative effects of the bv community rather than that of an individual microbial species . when bv - associated microorganisms were evaluated separately , each had its own profile of elevated concentrations of proteins in the newborn blood samples ( table 1 ) .
this analysis included all cases with a specific microorganism recovered ( including monocultures and mixed cultures ) versus those that did not have any microorganism recovered . while the presence of prevotella was associated with a relatively low risk of inflammatory response , gardnerella was marked by an increased risk of tnf- , il-8 , icam-1 , and vegf - r2 , anaerobic streptococcus was associated with a pattern of elevated il-1 , il-6 , tnf receptor type 1 ( tnf - r1 ) , tnf - r2 , and e - selectin , and peptostreptococcus was characterized by a high risk of elevated macrophage inflammatory protein 1 ( mip-1 ) , icam-3 , matrix metalloproteinase 9 ( mmp-9 ) , mpo , and vegf and undetectable insulin growth factor binding protein 1 ( igf - bp-1 ) .
cases with cultured genital mycoplasma species ( including ureaplasma urealyticum and other mycoplasma spp . ) showed a reproducible inflammatory protein pattern that closely resembled only that of peptostreptococcus and was dominated by increased odds of elevated mip-1 , i - tac ( interferon - inducible t cell alpha - chemoattractant ) , icam-3 , mmp-9 , mpo , and vegf and decreased odds of elevated vegf - r1 and igf - bp-1 .
interestingly , in contrast to the bv - mixed group and the facultative anaerobes e. coli and alpha streptococcus , they were not associated with elevated proinflammatory cytokines or the hepatic markers of systemic inflammation crp and saa .
skin - associated organisms ( staphylococcus and propionibacterium species ) , detectable in 13 to 17% of the culture - positive placentas , were not associated with elevated or reduced concentrations of inflammatory proteins in the newborn blood samples .
the levels of il-6 receptor ( il-6r ) , monocyte chemotactic protein 1 ( mcp-1 ) , mcp-4 , rantes ( regulated upon activation , normal t cell expressed and [ presumably ] secreted ) , and mmp-1 in the newborns blood samples did not appear to be significantly affected by the presence of any type of cultural bacteria in their placentas ( table 1 ) .
because of the distinct low inflammatory profile of the lactobacillus - positive cases ( table 1 ) and because most of them ( 62% ) represented mixed cultures , we broke down the group into monoculture and mixed - culture lactobacillus - positive subgroups , and we further contrasted those two subgroups with cases where bv organisms were found alone or in combination with non - bv organisms ( table 2 ) .
again , odds ratios of having top - quartile protein concentrations were calculated by comparison to those of cases with no microorganisms recovered . although the number of placentas colonized by lactobacillus alone was relatively small ( n = 8) , resulting in lack of statistical power , it was striking that most inflammatory proteins , including those associated with individual or mixed bv microorganisms ( il-1 , il-6 , tnf - r1 , tnf - r2 , il-8 , mip-1 , icam-1 , icam-3 , e - selectin , mmp-9 , crp , saa , and vegf ) , were completely undetectable in placentas that harbored lactobacillus alone ( table 2 ) .
in addition , even when mixed with others ( n = 13 ) , lactobacilli continued to be associated with undetectable icam-1 and vegf , and despite the wide confidence intervals due to the overall low prevalence of lactobacillus in the elgan placentas , the mixed lactobacillus cultures remained at low odds for all studied proteins .
the cases that were exclusively bv organism positive ( n = 18 ) represented 38% of the group .
when these cases were separately analyzed , they showed an even higher risk of elevated protein concentrations , including il-1 , il-6 , tnf- , il-8 , icam-1 , icam-3 , vascular cell adhesion molecule 1 ( vcam-1 ) , vegf - r2 , and both hepatic markers of systemic inflammation , crp and saa ( table 2 ) .
in contrast , the group harboring bv mixed with other microorganisms ( n = 29 ) , of which a significant part ( 24% ) was mixed with lactobacillus , showed lower odds for top - quartile concentrations of all cytokines , chemokines , and hepatic markers of inflammation ( table 2 , last column ) , possibly due to the modulatory effect of lactobacillus in the mixed cultures .
the difference between the groups of lactobacillus - positive and -negative cases is illustrated in fig . 1 by concentration distributions for selected proteins representing the cytokines ( il-6 ) , chemokines ( il-8 ) , and hepatic inflammatory markers ( crp and saa ) .
although the analysis of raw concentration values could not have the nominal statistical value of the percentile odds ratio analysis ( tables 1 and 2 ) due to the overall low prevalence of lactobacillus species cultured from the elgan placentas , the data demonstrate the contrast between the observed narrow distribution and lower levels of proteins in the lactobacillus - positive cases .
comparison of risks of systemic inflammatory response measured by selected proteins in blood specimens obtained from newborns with lactobacillus species versus other organisms detected in their placentas .
box plots represent logarithmically transformed interquartile ranges showing the number of pg of specific protein per mg of total protein distributed in four groups by the presence of lactobacilli and/or other microorganisms , as follows : + / ( n = 8) , + /+ ( n = 13 ) , /+ ( n = 193 ) , and / ( n = 313 ) .
the upper adjacent value is equal to the following : the largest data point that is less than or equal to the upper quartile + 1.5 ( upper quartile lower quartile ) .
the lower adjacent value is equal to the following : the smallest data point that is greater than or equal to the lower quartile + 1.5 ( upper quartile lower quartile ) ( 51 ) .
our study supports the concept that the placental colonization with vaginal microorganisms can induce a systemic inflammatory response in the fetus and newborn and that the dominating molecular features of this response can be dependent on the type of bacteria .
we report molecular patterns distinguishing the groups of lactobacillus species , bv - associated species , infectious facultative anaerobes , genital mycoplasmas , and skin organisms . in agreement with a widely accepted belief that bv - associated bacteria are capable of inducing preterm labor
, we found that mixed bv microorganisms are associated with elevated concentrations of primary proinflammatory cytokines ( il-1 , il-6 , and tnf- ) , capable of inducing acute phase reactants ( crp and saa ) , chemokines ( il-8 ) , and adhesion molecules ( e - selectin , icam-1 , and icam-3 ) .
il-1 , il-6 , and tnf- , as innate immunity mediators , play protective roles at local sites of bacterial invasion ; however , when simultaneously and significantly elevated in the systemic circulation , these primary cytokines can induce chemokines , adhesion molecules , and further leukocyte activation , promoting extravasation and tissue damage of noninfected tissues as shown in studies of the central nervous system ( 15 ) .
the mixed bv - associated blood protein patterns were similar to those of infectious facultative anaerobes , e.g. , e. coli and alpha streptococcus , confirming the pathogenic potential of the bv microorganisms . like e. coli and alpha streptococcus , placental colonization with mixed bv microorganisms was associated with high odds of crp , saa , and mpo .
in contrast to bv , genital mycoplasmas did not induce primary cytokines and acute phase reactants but were associated with an invasive pattern of cytolytic activities mediated by mpo and mip-1 , which increase nitric oxide production ( 16 ) , and extracellular matrix degradation enzymes ( mmp-9 ) , which are major mediators of inflammatory tissue destruction .
mmp-9 has a well - established role in parturition and is significantly increased in the amniotic fluid in preterm delivery ( 17 ) .
mycoplasmas also showed increased levels of i - tac , a chemokine for nk and t cells , which may be induced via nod-1 activation by mycoplasma lipopeptides ( 18 ) .
nod-1 activation selectively induces immune activation while avoiding upregulation of proinflammatory cytokines ( 18 ) .
the lack of primary cytokine upregulation may also be a result of some active suppressive properties of these microorganisms , since decreased expression of il-1 and il-8 characterizes mycoplasma - infected cells ( 19 ) .
ureaplasma urealyticum and mycoplasma species were analyzed separately because numerous studies , including ours , have implicated them in preterm birth ( 2027 ) .
they seemed to contribute differently to the group pattern of elevated proteins , with ureaplasma urealyticum being the major contributor to chemokine responses , while mixed mycoplasma colonization seemed needed for increased mmp-9 levels .
in addition to group - specific responses , this study also unveiled unique features of some individual bv - associated microorganisms . among the bv - associated species
, prevotella is frequently found in preterm placentas with high - grade chorionic plate inflammation ( 28 ) , and it was among the most prevalent bv - associated microorganisms colonizing the elgan placenta in our study . in vitro work has shown that some prevotella strains can exhibit a strong invasive but weak cytokine - inducing capacity , and this combination of properties may lead to higher colonization rates and survival in the host ( 29 ) . in agreement with these findings ,
gardnerella , the most common bv organism ( 30 , 31 ) , appeared to be the most inflammation - provoking organism and was associated with the highest odds of elevated tnf- , il-8 , and icam-1 .
peptostreptococcus , also frequently associated with high - grade chorionic plate inflammation ( 28 ) and linked to tissue destruction in the gut and oral mucosa ( 32 , 33 ) , showed a mycoplasma - like inflammatory protein pattern and was associated with the highest odds of tissue destructive enzymes , e.g. , mmp-9 and mpo as well as mip-1 and icam-3 .
thus , each of the individual bv - associated microorganisms contributed uniquely to the pattern of mixed bv colonization , which demonstrated the biggest variety of elevated inflammatory proteins compared to any other group pattern .
the mixed bv colonization conferred a risk of newborn inflammatory response higher than that of any of the individual bv - associated microorganisms alone , thus supporting the concept of bv as a polymicrobial pathogenic state .
this study suggests that lactobacillus alone or in mixed placental colonization may suppress inflammatory responses in extremely preterm newborns .
our observations add to a growing body of experimental evidence indicating that lactobacilli have anti - inflammatory properties .
lactobacilli have been found to suppress pathogen attachment and proliferation in the vaginal epithelium ( 9 ) .
findings from in vitro studies with nonvaginal lactobacillus strains have suggested that lactobacilli are active modulators of signaling pathways , leading to a strain - specific repertoire of cytokine release and immune tolerance as well as downregulation of proinflammatory signaling ( 3437 ) .
intestinal lactobacilli also inhibit epithelial inflammatory responses to salmonella lipopolysaccharide ( 38 ) . in combination or independently of placental microbial colonization , a number of other prenatal or postnatal factors may influence the inflammatory protein levels in a newborn s blood . since most of the blood specimens used for the analysis reported here were obtained on the day of birth , the blood protein concentrations in our analysis were not adjusted for postnatal phenomena and exposures ( e.g. , nutrition , therapeutic interventions , postnatal onset of anemia , sepsis , etc . )
; however , postnatal exposures and clinical outcomes have been analyzed in longitudinal samples from the same babies collected within the first two postnatal weeks and published elsewhere ( 13 , 14 ; mcelrath et al . , submitted ) .
the wide variance of protein concentrations in elgans with culture - negative placentas ( illustrated for some proteins in fig .
1 ) that exceed by logs those found in elgans with lactobacillus - positive placentas and are sometimes close to those of other microorganism - positive cases raises the possibilities that part of the inflammation evident in preterm newborns may be attributable to noncultured microorganisms or noninfectious factors not addressed in this paper .
previous publications from our group have shown that the organisms recovered from the placenta are unlikely to be contaminants ( 28 , 39 ) and that recovery of these organisms provides information about the risk of preterm delivery ( 40 ) as well as structural and functional consequences of brain damage ( 23 , 41 ) .
we have also reported that inflammation of the placental tissue , often a consequence of bacteria in the placenta , provides information about the probability of elevated concentrations of inflammation - related proteins in the newborn s blood ( 13 , 14 ) . moreover ,
elevated concentrations of the same inflammation - related proteins provide information about the risk of sonographically defined brain damage ( 42 ) .
thus , the present study provides glue to the existing construct of clinical evidence linking the organisms in the placenta to the risk of brain damage attributable to elevated systemic inflammatory proteins in the neonate .
evidence that intrauterine inflammatory phenomena contribute to neonatal disorders ( 43 ) prompts us to consider what we found to be biologically and not just statistically significant .
although we have found some evidence for the specificity of organism - cytokine relationships , we prefer to emphasize that no inflammatory stimulus affects only a small set of proteins . indeed , an inflammatory stimulus is capable of influencing the expression of more than a thousand genes ( 44 ) .
our neonatal blood specimens were collected in the intensive care nursery , almost invariably within 24 h of delivery .
because many inflammatory mediators , e.g. , interleukins ( 45 , 46 ) and tnf- ( 47 ) , have relatively short half - lives , we are reluctant to view what we measured after birth to be limited to intrauterine phenomena . how much of what we measured should be considered evidence of neonatal rather than fetal inflammation remains to be determined .
nevertheless , our data clearly demonstrate that maternal microorganisms are associated with systemic inflammatory patterns detectable after birth . in conclusion
although in addition to or independently of placental microorganisms , other prenatal as well as postnatal factors may contribute to the inflammatory condition and its perpetuation after birth .
our data suggest that placental colonization by specific groups of organisms can increase or decrease the risk of a systemic inflammatory condition independently from other factors , and moreover , colonization by specific groups of organisms can define the pattern of circulating inflammatory proteins after birth .
our findings also suggest that placenta - derived lactobacillus diminishes the risk of heightened inflammatory responses in extremely low - gestation - age newborns .
although more research is needed to elucidate the molecular mechanisms and health consequences of priming the fetal and newborn systemic inflammatory responses with specific bacterial constituents of the placenta , our data suggest that the targeting of placental colonization by specific drugs or probiotics during early pregnancy may hold promise for preventing not only preterm birth but also the devastating and far - reaching inflammatory consequences in premature newborns .
during 2002 to 2004 , the elgan study enrolled mothers ( n = 1,249 ) and their babies ( n = 1,506 ) delivered before 28 weeks of gestation at 14 institutions located in 11 cities of five states .
the primary goal of the study was to identify parameters and exposures increasing the risk of brain disorders in elgans ( 48 ) .
the enrollment and consent procedures were approved by the human subject research review boards of the individual institutions .
this nested study was limited to 527 of the elgans delivered by caesarean section for whom blood samples were available for protein measurements closest to birth ( 69% within 24 h and all within 72 h of birth ) and whose placenta was biopsied within 1 h after delivery .
demographic characteristics of mothers and infants in the study of placental microbiology and systemic inflammatory response in the elgan study the gestational age was hierarchically estimated based on the quality of available information and the following sequence of reliance : ( i ) known dates of embryo retrieval , intrauterine insemination , or fetal ultrasound before the 14th week ( 62% ) ; ( ii ) fetal ultrasound at 14 weeks ( 29% ) ; ( iii ) last menstrual period with no fetal ultrasound ( 7% ) ; and ( iv ) a record of the gestation age made in the neonatal intensive care unit log ( 1% ) .
the placentas were biopsied under sterile conditions as soon as possible after delivery ( 82% within 1 h ) and further microbiologically processed in an anaerobic chamber as described ( 39 ) . in brief , a ~1-cm tissue sample was homogenized in 1:10 ( wt / vol ) phosphate - buffered saline ( pbs ) .
aliquots of each homogenate were seeded on selective and nonselective media , as follows : ( i ) prereduced brucella base agar containing sheep blood ( 5% ) , vitamin k1 , and hemin ; ( ii ) tryptic soy agar with sheep blood ( 5% ) ; ( iii ) chocolate agar ; and ( iv ) a-7 agar .
established criteria were used to enumerate , isolate , and identify the different colony types at the brigham and women s microbiology laboratory ( 49 ) .
since we have determined that constituents of the chorion parenchyma prevent the reliable detection of bacterial dna by pcr techniques , this study assessed only placental colonization patterns obtained by culture techniques ( 8) . in order to establish the elgan inflammatory response associated with placental microbiology while avoiding as much as possible the potentially independent inflammatory impact of later events related to the clinical management of the elgans , we analyzed the first blood sample available closest to birth ( postnatal days 1 to 3 ) .
the study was limited to specimens that remained after blood samples were drawn for clinical care .
a blood drop was collected on filter paper ( schleicher & schuell 903 ) , exposed to air at room temperature in dark containment until dried , and stored with desiccators in thermo - sealed plastic bags at 70c .
all dried blood specimens were eluted and analyzed in the laboratory of genital tract biology ( brigham and women s hospital ) , which is accredited by the college of american pathologists for immunoassays and cytokine measurement .
disposable 12-mm biopsy punches were used to excise the blood spot specimens , which were then placed in 0.3 ml pbs with 0.1% triton x-100 ( sigma - aldrich , st .
louis , mo ) and 0.03% tween 20 ( fisher , hampton , nh ) , vortexed , and placed on a shaker for 1 h at 4c .
the buffer was transferred along with the paper to a spinx dual - chamber filter tube ( fisher ) and spun down at 2,000 g , followed by collection of the filtered eluted blood specimens .
an additional wash of the punch was performed in 0.1 ml for a final elution volume of 0.4 ml .
protein biomarker levels in the eluted blood specimens were quantified using meso scale discovery ( msd ; gaithersburg , md ) electrochemiluminescence ( ecl ) multiplex immunoassays and sector imager 2400 , validated by comparison with traditional enzyme - linked immunosorbent assay ( elisa ) ( 50 ) .
each assay was optimized for the simultaneous detection of up to 10 proteins within the linearity range of the dry blood spot elution matrix .
the ecl readouts were converted to numbers of pg / milliliters by msd workbench software via interpolation from calibrator curves stretching over at least 4 logs . the interassay coefficient of variation [ cv = 100 standard deviation ( sd)/mean ] was < 10 to 20% , as assessed by quality control sample aliquots tested on each plate .
the average of two measurements of each analyte was normalized to the number of mg total protein , measured by the pierce bicinchoninic acid ( bca ) assay ( thermo scientific , rockford , il ) and victor reader ( perkinelmer , boston , ma ) .
the following 25 protein biomarkers were measured : il-1 , il-6 , il-6r , tnf- , tnf - r1 , tnf - r2 , il-8 ( cxcl8 ) , mcp-1 ( ccl2 ) , mcp-4 ( ccl13 ) , mip-1 ( macrophage inflammatory protein 1 ) ( ccl4 ) , rantes ( regulated upon activation , normal t cell expressed and [ presumably ] secreted ) ( ccl5 ) , i - tac ( interferon - inducible t cell alpha - chemoattractant ) ( cxcl11 ) , icam-1 ( cd54 ) , icam-3 ( cd50 ) , vcam-1 ( cd106 ) , e - sel ( e - selectin ) ( cd62e ) , mmp-1 , mmp-9 , crp , saa , mpo ( myeloperoxidase ) , vegf ( vascular endothelial growth factor ) , vegf - r1 , vegf - r2 , and igf - bp-1 . the generalized null hypothesis evaluated in this study was that the risk of a blood protein concentration in the highest quartile for newborns of a particular gestational age is not associated with the recovery of an organism from their placentas .
the focus on the top - quartile concentrations was supported by the concept that the highest concentrations would be most biologically significant and by the observed nonlinear distribution of the concentrations of most proteins among the elgan children classified by the presence / absence of each placenta organism . because protein concentrations varied with gestational age at delivery , as described for the elgan study elsewhere ( 14 ) , we divided our samples into three groups defined by the gestational age category ( 23 to 24 , 25 to 26 , and 27 weeks ) and defined the highest quartile of each protein among newborns in each of these gestational age categories .
our unit of measurement is the odds ratio ( and 95% confidence interval ) that children whose placenta yielded an organism were more likely to have a protein measurement in the top quartile than children whose placenta did not harbor that organism ( or group of organisms ) .
during 2002 to 2004 , the elgan study enrolled mothers ( n = 1,249 ) and their babies ( n = 1,506 ) delivered before 28 weeks of gestation at 14 institutions located in 11 cities of five states .
the primary goal of the study was to identify parameters and exposures increasing the risk of brain disorders in elgans ( 48 ) .
the enrollment and consent procedures were approved by the human subject research review boards of the individual institutions .
this nested study was limited to 527 of the elgans delivered by caesarean section for whom blood samples were available for protein measurements closest to birth ( 69% within 24 h and all within 72 h of birth ) and whose placenta was biopsied within 1 h after delivery .
demographic characteristics of mothers and infants in the study of placental microbiology and systemic inflammatory response in the elgan study the gestational age was hierarchically estimated based on the quality of available information and the following sequence of reliance : ( i ) known dates of embryo retrieval , intrauterine insemination , or fetal ultrasound before the 14th week ( 62% ) ; ( ii ) fetal ultrasound at 14 weeks ( 29% ) ; ( iii ) last menstrual period with no fetal ultrasound ( 7% ) ; and ( iv ) a record of the gestation age made in the neonatal intensive care unit log ( 1% ) .
the placentas were biopsied under sterile conditions as soon as possible after delivery ( 82% within 1 h ) and further microbiologically processed in an anaerobic chamber as described ( 39 ) . in brief , a ~1-cm tissue sample was homogenized in 1:10 ( wt / vol ) phosphate - buffered saline ( pbs ) .
aliquots of each homogenate were seeded on selective and nonselective media , as follows : ( i ) prereduced brucella base agar containing sheep blood ( 5% ) , vitamin k1 , and hemin ; ( ii ) tryptic soy agar with sheep blood ( 5% ) ; ( iii ) chocolate agar ; and ( iv ) a-7 agar .
established criteria were used to enumerate , isolate , and identify the different colony types at the brigham and women s microbiology laboratory ( 49 ) . since we have determined that constituents of the chorion parenchyma prevent the reliable detection of bacterial dna by pcr techniques , this study assessed only placental colonization patterns obtained by culture techniques ( 8) .
in order to establish the elgan inflammatory response associated with placental microbiology while avoiding as much as possible the potentially independent inflammatory impact of later events related to the clinical management of the elgans , we analyzed the first blood sample available closest to birth ( postnatal days 1 to 3 ) .
the study was limited to specimens that remained after blood samples were drawn for clinical care .
a blood drop was collected on filter paper ( schleicher & schuell 903 ) , exposed to air at room temperature in dark containment until dried , and stored with desiccators in thermo - sealed plastic bags at 70c .
all dried blood specimens were eluted and analyzed in the laboratory of genital tract biology ( brigham and women s hospital ) , which is accredited by the college of american pathologists for immunoassays and cytokine measurement .
disposable 12-mm biopsy punches were used to excise the blood spot specimens , which were then placed in 0.3 ml pbs with 0.1% triton x-100 ( sigma - aldrich , st .
louis , mo ) and 0.03% tween 20 ( fisher , hampton , nh ) , vortexed , and placed on a shaker for 1 h at 4c .
the buffer was transferred along with the paper to a spinx dual - chamber filter tube ( fisher ) and spun down at 2,000 g , followed by collection of the filtered eluted blood specimens .
an additional wash of the punch was performed in 0.1 ml for a final elution volume of 0.4 ml .
protein biomarker levels in the eluted blood specimens were quantified using meso scale discovery ( msd ; gaithersburg , md ) electrochemiluminescence ( ecl ) multiplex immunoassays and sector imager 2400 , validated by comparison with traditional enzyme - linked immunosorbent assay ( elisa ) ( 50 ) .
each assay was optimized for the simultaneous detection of up to 10 proteins within the linearity range of the dry blood spot elution matrix .
the ecl readouts were converted to numbers of pg / milliliters by msd workbench software via interpolation from calibrator curves stretching over at least 4 logs . the interassay coefficient of variation [ cv = 100 standard deviation ( sd)/mean ] was < 10 to 20% , as assessed by quality control sample aliquots tested on each plate .
the average of two measurements of each analyte was normalized to the number of mg total protein , measured by the pierce bicinchoninic acid ( bca ) assay ( thermo scientific , rockford , il ) and victor reader ( perkinelmer , boston , ma ) .
the following 25 protein biomarkers were measured : il-1 , il-6 , il-6r , tnf- , tnf - r1 , tnf - r2 , il-8 ( cxcl8 ) , mcp-1 ( ccl2 ) , mcp-4 ( ccl13 ) , mip-1 ( macrophage inflammatory protein 1 ) ( ccl4 ) , rantes ( regulated upon activation , normal t cell expressed and [ presumably ] secreted ) ( ccl5 ) , i - tac ( interferon - inducible t cell alpha - chemoattractant ) ( cxcl11 ) , icam-1 ( cd54 ) , icam-3 ( cd50 ) , vcam-1 ( cd106 ) , e - sel ( e - selectin ) ( cd62e ) , mmp-1 , mmp-9 , crp , saa , mpo ( myeloperoxidase ) , vegf ( vascular endothelial growth factor ) , vegf - r1 , vegf - r2 , and igf - bp-1 .
the generalized null hypothesis evaluated in this study was that the risk of a blood protein concentration in the highest quartile for newborns of a particular gestational age is not associated with the recovery of an organism from their placentas .
the focus on the top - quartile concentrations was supported by the concept that the highest concentrations would be most biologically significant and by the observed nonlinear distribution of the concentrations of most proteins among the elgan children classified by the presence / absence of each placenta organism . because protein concentrations varied with gestational age at delivery , as described for the elgan study elsewhere ( 14 ) , we divided our samples into three groups defined by the gestational age category ( 23 to 24 , 25 to 26 , and 27 weeks ) and defined the highest quartile of each protein among newborns in each of these gestational age categories .
our unit of measurement is the odds ratio ( and 95% confidence interval ) that children whose placenta yielded an organism were more likely to have a protein measurement in the top quartile than children whose placenta did not harbor that organism ( or group of organisms ) . | the fetal response to intrauterine inflammatory stimuli appears to contribute to the onset of preterm labor as well as fetal injury , especially affecting newborns of extremely low gestational age . to investigate the role of placental colonization by specific groups of microorganisms in the development of inflammatory responses present at birth
, we analyzed 25 protein biomarkers in dry blood spots obtained from 527 newborns delivered by caesarean section in the 23rd to 27th gestation weeks .
bacteria were detected in placentas and characterized by culture techniques .
odds ratios for having protein concentrations in the top quartile for gestation age for individual and groups of microorganisms were calculated .
mixed bacterial vaginosis ( bv ) organisms were associated with a proinflammatory pattern similar to those of infectious facultative anaerobes .
prevotella and gardnerella species , anaerobic streptococci , peptostreptococci , and genital mycoplasmas each appeared to be associated with a different pattern of elevated blood levels of inflammation - related proteins .
lactobacillus was associated with low odds of an inflammatory response .
this study provides evidence that microorganisms colonizing the placenta provoke distinctive newborn inflammatory responses and that lactobacillus may suppress these responses . |
increases for population have been observed in almost every country due to recent medical and technological advances . it is expected that an increase from 11% to 22% in the number of individuals that are 60 + between the years of 2000 and 2050 will occur in the world .
the population rate of individuals who were 65 + in turkey was 7.7% in 2013 . based on population projections ,
this rate is estimated to increase to 10.2% in 2023 and 20.8% in 2050 ( 1 ) .
old age is a developmental process with chronological , social , biological and psychological dimensions .
the physical , mental , psychological and social changes experienced during this period require the individual to adapt by making new adjustments ( 2 ) .
as people enter the old age period , they may experience age specific problems and handicaps such as regressions in cognitive and physical health , lead less productive roles and experience changes in social status , declines in interpersonal support and loss of health and this process may bring loneliness ( 3 , 4 ) . loneliness is an important research and practice field in old age . it is well known that loneliness and quality of life significantly affect psychological wellbeing .
individual differences such as level of education , marital status , learned behaviors , social skills / hobbies and social support could affect loneliness ( 5 , 6 ) .
prevalence of loneliness in the aged may change from 7% ( 7 ) to 49% ( 8) .
43.6% of older people experienced medium level of loneliness while 10.9% experienced high levels ( 9 ) .
similar results were found in studies , which utilized ucla loneliness scale in turkey . a study ( 10 ) found loneliness mean score as 41.878.43 and nal and bilge s ( 11 ) .
the study identified the loneliness mean score as 37.109.09 and the rate of feelings of loneliness in both studies was found to be 40 - 50% . from the literature in this area it can be seen that the most important factors that cause loneliness in the elderly were being female , advanced age , low level of education , being unmarried , widow , poor health , genetic characteristics ( studies on twins and siblings showed similar chromosomal linkage and supported heritability of loneliness ) , loss of a partner , unemployment , low income levels and living alone ( 9 , 1218 ) .
the outcomes of loneliness , such as negative physiological changes along with negative cognitive effects , are observed in this period .
the most important outcomes of loneliness in old age such as depression , suicide / alcohol abuse have been examined in various studies .
these negative effects related to loneliness also negatively influence quality of life . considering the biological changes that occur with advanced age ,
increases in health problems , functional incompetence and dependence in daily life activities can negatively affect the quality of life ( 7 , 9 , 12 , 13 , 1921 ) .
understanding these demographic variables is crucial in order to deal with the problems of older people to ensure that they receive sufficient support .
the aim of this study was to investigate loneliness in elderly people , associated factors and its correlation with quality of life .
the study was conducted in incirliova , a district that is 10 km from aydn city center , a western city of turkey .
the research area does not receive migration from other regions and there is a large older population .
a total of 4170 ( 2372 females ; 1798 males ) older individuals were living in the district .
the inclusion criteria were that the individuals were aged 65 years or older , with no communication problems , psychotic diseases , diseases such as alzheimer , dementia or parkinson s and no secondary problems such as substance abuse .
the study population was determined as 190 using the g - power program by taking impact size 0.362 ( based on a similar study result ) , =0.05 , power ( 1- ) = 0.80 at a confidence level of 95 % and a substitute group composing of 10 individuals was added .
a total of 174 ( 83.2% ) individuals were reached . multi - stage sampling method including cluster and simple random method was used .
as there are four neighborhoods in the district center , sample selection was carried out based on weighing the older population rate of each neighborhood and the targeted number of women was decided from each neighborhood . in each neighborhood , streets , which were regarded as clusters , were numbered and from each neighborhood , a street was selected by simple random sampling method .
if the targeted number of older people was not reached in the selected street , the next street was selected to complete the required sample size .
after the participants had been in formed about the study , their informed consent was obtained .
questionnaires were filled in the participants homes by nursing students who had received 3 hours of education for this study in face - to - face interview techniques . when individuals were not found at home at the first time , a second home visit was carried out . in cases when they were not found , the individual was replaced with a substitute .
the first part was designed to investigate the participants demographic characteristics and health status of the participants such as age , gender , marital status , education status , income , occupation , handicaps , dependency level , medically diagnosed chronic diseases , and hobbies .
the second part was planned to determine the loneliness level and life quality of the aged population by applying related scales .
( 22 ) turkish validity and reliability was undertaken by demir ( 23 ) ( cronbach alpha=0.96 ) .
the lowest total score is 20 ; highest total score is 80 while a high score indicates that the individual experiences greater levels of loneliness .
quality of life scale ( qol ) short form 36 ( sf-36 ) : the form was developed by ware and sherbourne ( 24 ) .
it is composed of 36 items that measure eight dimensions : physical functioning , social functioning , limitations of role functioning based on physical problems ( rf - pp ) , limitations of role functioning based on emotional problems ( rf - ep ) , mental health , energy / vitality , body pain and general health perceptions ( ghp ) .
individuals who were unable to independently take baths , feed themselves , shop , walk , use the restroom and do housework were defined as
world health organization international classification of functioning , disability , and health ( who icf ) check list was used for handicap evaluation .
the variables were investigated using visual ( histograms , probability plots ) and analytical methods ( kolmogorov - smir - now / shapiro - wilk s test ) to determine whether they are normally distributed .
descriptive analyses were presented using medians ( mdn ) and 25 - 75 percentiles values for the non - normally distributed variables while means standard deviation was used for normally distributed variables .
since the ucla loneliness scale results were not normally distributed , non - parametric - tests ( the mann - whitney u test ) were conducted to compare these parameters .
the study was conducted in incirliova , a district that is 10 km from aydn city center , a western city of turkey .
the research area does not receive migration from other regions and there is a large older population .
a total of 4170 ( 2372 females ; 1798 males ) older individuals were living in the district .
the inclusion criteria were that the individuals were aged 65 years or older , with no communication problems , psychotic diseases , diseases such as alzheimer , dementia or parkinson s and no secondary problems such as substance abuse .
the study population was determined as 190 using the g - power program by taking impact size 0.362 ( based on a similar study result ) , =0.05 , power ( 1- ) = 0.80 at a confidence level of 95 % and a substitute group composing of 10 individuals was added .
as there are four neighborhoods in the district center , sample selection was carried out based on weighing the older population rate of each neighborhood and the targeted number of women was decided from each neighborhood . in each neighborhood , streets , which were regarded as clusters , were numbered and from each neighborhood , a street was selected by simple random sampling method .
if the targeted number of older people was not reached in the selected street , the next street was selected to complete the required sample size .
after the participants had been in formed about the study , their informed consent was obtained .
questionnaires were filled in the participants homes by nursing students who had received 3 hours of education for this study in face - to - face interview techniques . when individuals were not found at home at the first time , a second home visit was carried out . in cases when they were not found , the individual was replaced with a substitute .
the first part was designed to investigate the participants demographic characteristics and health status of the participants such as age , gender , marital status , education status , income , occupation , handicaps , dependency level , medically diagnosed chronic diseases , and hobbies .
the second part was planned to determine the loneliness level and life quality of the aged population by applying related scales .
( 22 ) turkish validity and reliability was undertaken by demir ( 23 ) ( cronbach alpha=0.96 ) .
the lowest total score is 20 ; highest total score is 80 while a high score indicates that the individual experiences greater levels of loneliness .
quality of life scale ( qol ) short form 36 ( sf-36 ) : the form was developed by ware and sherbourne ( 24 ) .
it is composed of 36 items that measure eight dimensions : physical functioning , social functioning , limitations of role functioning based on physical problems ( rf - pp ) , limitations of role functioning based on emotional problems ( rf - ep ) , mental health , energy / vitality , body pain and general health perceptions ( ghp ) .
individuals who were unable to independently take baths , feed themselves , shop , walk , use the restroom and do housework were defined as dependent .
world health organization international classification of functioning , disability , and health ( who icf ) check list was used for handicap evaluation .
the variables were investigated using visual ( histograms , probability plots ) and analytical methods ( kolmogorov - smir - now / shapiro - wilk s test ) to determine whether they are normally distributed .
descriptive analyses were presented using medians ( mdn ) and 25 - 75 percentiles values for the non - normally distributed variables while means standard deviation was used for normally distributed variables .
since the ucla loneliness scale results were not normally distributed , non - parametric - tests ( the mann - whitney u test ) were conducted to compare these parameters .
54.0% did not work , 24.7% did not have social insurance , 32.8% had spouses and 97.7% had children .
18.4% of the older people expressed that they lived alone.66.1% of the participants stated that their income was sufficient , 54.6% stated that they had salaries and4.6% received income from rent.79.3% of the older people had chronic diseases ; 49.1% had high blood pressure , 26.4% heart disorders , 21.3% had diabetes , 9.8% had asthma and 2.3% had cancer .
ucla loneliness median score of the participants was 33 ( 25p= 27 , 75p= 40 ) .
gender , marital status , level of education , life style , problems with hearing , speaking and vision , having children , dependence in daily activities , sleep patterns and having sufficient income were not associated with greater loneliness scores ( p>0.05 ) . however , existence of chronic diseases or physical handicaps , regular use of medication , lack of hobbies and living with a spouse were associated with increased feelings of loneliness ( p<0.05 ) .
physically handicapped participants ( mdn=44.0 ) felt more loneliness than non - physically handicapped participants ( mdn=32.0 ) , u=509.0 , z=-3.079 , p<0.01 .
likewise , participants with chronic diseases , those using regular medication , those living with a spouse or those with no hobbies felt more lonely ( p<0.05 ) ( table 1 ) . some characteristics of the participants and its relation with the ucla loneliness scores in order to compare loneliness levels for participants living with a spouse in terms of gender differences , a subgroup analysis according to gender was performed . in both of the gender groups ,
gender differences in living with a spouse and its relation with the ucla loneliness it was found that loneliness was associated with quality of life . there was a negative and significant relationship between loneliness and all sub - scales of quality of life ( p<0.05 ) ( table 3 ) .
it is known that feelings of loneliness and life quality closely affect psycho - social well - being .
ucla loneliness median score of the participants was 33 ( 25p= 27 , 75 p= 40 ) . some studies on older people living in nursing homes found loneliness scores as 41.878.43 and 37.109.09 respectively ( 10 , 11 ) .
approximately one third of the older people in finland experienced loneliness ( 26 ) and social studies from england reported the loneliness rate to be between 5 - 16% ( 27 , 28 ) .
the dublin healthy ageing study reported that 10% of the older individual soften or at all times felt lonely ( 29 ) .
7.5% of older people lived alone and 11.9% experienced feelings of loneliness in singapore ( 21 ) .
liu and guo s ( 12 ) study found the loneliness score of older people to be 34.089.30 and identified that 38.1% experienced medium levels of loneliness and 6.3% experienced high levels .
many of the results of studies in our country are similar to the findings of this study although they were undertaken in various regions and with different groups .
this may be related to the fact that social activities in the framework of active aging programs and opportunities to use autonomy are restricted in developing countries like those that turkey compared to developed countries .
the world health organization defines active ageing as a process that uses security , participation and sustainable health opportunities in a manner to improve life quality of individuals ( 30 ) .
supportive physical and social environments and health care needs of the older people should be provided to improve life quality .
loneliness is experienced subjectively and may result from dissatisfaction in human relationships and unmet close relationships or social needs .
therefore , it is rather hard to provide comparisons between societies about specific factors that cause loneliness .
it is observed that loneliness is expressed to a lesser extent in societies where social relationships and traditional structures are preserved but individuals perceptions of the quality of their relationships may cause the existence of loneliness in different dimensions . in our study
, we found that gender , marital status , level of education , life style , hearing , speaking and visual handicaps , having children , dependence in daily activities , sleep patterns and having sufficient income did not affect loneliness .
there were different research findings for these variables in the literature . due to the similar socio - demographics of the participants
older people have trouble in adapting to the process of ageing due to physiological changes experienced in this period .
it is known that there is a negative relationship between loneliness and physical health and psychosocial well - being ( 6 , 31 ) .
it has been reported that individuals with physical insufficiencies such as visual , audio and physical handicaps and health problems such as chronic diseases experience more loneliness ( 32 ) .
we found that the existence of chronic diseases and physical handicaps affected loneliness but in contrast , problems related to vision , hearing and speech did not have effects on feelings of loneliness . this may be related to the fact that the number of individuals with these disorders was small in the research group and the individuals with these problems solved their problems with the help of social support systems found in their environments .
chronic diseases bring many problems such as being insufficient in self - care , pain , lack of sleep , restrictions in social life and adaptation / maladjustment to regular use of medication .
older people may have difficulties in coping with these situations due to the restrictions experienced physically or socially and may feel loneliness .
literature findings also supported the current results ( 8 , 31 , 33 , 34 ) . having hobbies increases communication with the social environment .
in addition , occupying one with tasks may be contributing to feeling busy , feeling less lonely and feeling useful .
the reason why having a spouse is a factor that prevents individuals from loneliness can be explained by weiss s attachment theory .
lack of a secure attachment figure in one s life such as a spouse may cause emotional loneliness ( 3 , 5 , 9 , 35 ) .
the fact that our finding is different from the literature results may be explained in several ways . having a spouse in a traditionally eastern culture such as turkey ,
another reason may be related to the fact that spouses may not have as many feelings and thoughts to share in their advanced age .
this is often observed in females , who despite spending much more time at home , they share less along with old age . in this study there was a negative relationship between loneliness and all sub scales of qol .
this finding points to the fact that the qol decreases along with increased feelings of loneliness .
based on the findings obtained from qol scale , the older people with feelings of loneliness were found to experience problems at work or in daily life because of restrictions in physical roles and regression in physical health .
low energy levels cause them to be continually tired and exhausted . having low health perceptions point to the belief that the older people feel that their health condition is poor and will get even worse .
these results show that loneliness negatively affects qol in old age , their daily lives and perceptions about their health and causes emotional grievances .
poor physical and social functioning show that the older people restricted in undertaking physical activities , face problems in social activities and can not cope with these problems .
loneliness negatively affects qol in old ageand that the existence of chronic health problems and lack of hobbies are strong predictors forloneliness .
elderly people living alone must be evaluated as a high - risk group and thus policy makers and health personnel should be aware of the factors that can affect loneliness . in order to increase qol of the aged population and psychological well - being of the elderly ,
social support systems must be taken into account and the elderly should be encouraged to participate in social activities .
it is crucial to benefit from the experiences of older people , to have them as role models and to provide opportunities for them to develop their potential by allowing them to participate in social activities instead of excluding them from society .
along with the increase of the older population in our country , maintaining their qol should be one of the priorities of health services at present and in the future .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . | abstractbackgroundthis study examined the factors that affect loneliness of older people and their relationship with quality of life.methodsdata in this cross - sectional study were collected through survey form , ucla loneliness scale and quality of life ( qol ) short form ( sf-36 ) scale .
the total number of elderly people over the age of 65 yr from whom the study population was chosen was 4,170 .
the study population was determined as 190 with g - power program by taking impact size 0.362 , =0.05 , power ( 1- ) = 0.80 at a confidence level of 95% and a substitute group composing of 10 individuals was added . in total ,
83.2% ( n=174 ) of the target population was reached via multi - stage sampling methods.resultsucla loneliness median score of the participants was 33 ( 25thp= 27 , 75thp= 40 ) .
it was found that the existence of chronic diseases and physical handicaps , regular use of medication , lack of hobbies and living with spouse increased loneliness ( p<0.05 ) .
a negative relationship was identified between all sub - scales in the qol scale and loneliness.conclusionloneliness negatively affects qol in old age and that the existence of chronic health problems and lack of hobbies are strong predictors for loneliness .
elderly people living alone must be evaluated as a high - risk group and thus policy makers and health personnel should be aware of the factors that can affect loneliness . in order to increase life quality of the aged population and psychological well - being of the elderly ,
social support systems must be taken into account and the elderly should be encouraged to participate in social activities . |
the ability and efficiency of mastication is the first step in the digestion of food , and this ability declines with age ( locker , 2002 ; morley , 2001 ; takata et al . , 2006 ) .
masticatory ability is closely associated with maintaining adequate nutrition in older populations ( de morais et al . , 2013 ; kwon , suzuki , kumagai , shinkai , & yukawa , 2006 ; walls , steele , sheiham , marcenes , & moynihan , 2000 ) .
lower masticatory ability reduces the variety in a person s diet , leading to malnutrition , weight loss , and a low body mass index ( bmi ) among the older adults ( nordenram , ljunggren , & cederholm , 2001 ; tamura , bell , masaki , & amella , 2013 ) .
it is also reported that impairment of mastication is associated with general health status ( miura et al . , 1998 ; miura , araki , & umenai , 1997 ; miura , kariyasu , yamasaki , arai , & sumi , 2005 ; sun et al . , 2007 ) , quality of life ( qol ; brennan , spencer , & roberts - thomson , 2008 ; kimura et al . ,
2009 ; takata et al . , 2006 ) , and cognitive function ( elsig et al . , 2015 ; mummolo , ortu , necozione , monaco , & marzo , 2014 ; teixeira et al . ,
active life expectancy also related chewing ability ( nasu & saito , 2006 ) . impaired masticatory ability often leads to frailty and institutionalization .
maintenance or recovery of sufficient chewing ability for older adults is related to a longer active life expectancy .
this study investigated whether self - rated masticatory ability is associated with a self - reliant life with adequate subjective health conditions in a community - dwelling older population .
the older population in japan is expanding over time and accounts for more than 25% of the population ( i.e. , 32 million ) .
the percentage of long - term care recipients above 65 years of age was 17.9% in may 2014 .
the gap between life expectancy and active life expectancy is 9.13 years in females and 12.68 years in males , respectively , and this is a pressing issue in japan with increasing older populations , despite the fact that society has achieved the highest level of life expectancy .
the extension of active life expectancy constitutes a pivotal issue for not only the well - being of the older population but also the demographics and socioeconomic of the society .
this study population consists of participants in survey , which is a prospective and population - based study , and is designed to identify factors for self - reliant life in community - dwelling older adults in japan ( kayama , hironaka , & tani , 2014 ) .
this study recruited 1,706 individuals who were 65 years and above , living in kumamoto city , and obtained informed consent from 1,554 of those subjects .
those subjects had involvement with regional welfare commission volunteers and community comprehensive care center staffs .
the study excluded subjects who died , moved , or were hospitalized during the study , and thus , 1,377 individuals participated ( 459 men and 910 women , mean age 79.8 6.6 years ) .
this structured questionnaire survey was conducted in conjunction with regional welfare commission volunteers and community comprehensive care center staffs .
the methods for data collection were described previously ( kayama et al . , 2014 ) .
subjective health status was established by questionnaire with four levels of choice ; queried items included very healthy , moderately healthy , not very healthy , and not healthy .
instrumental activity of daily living ( iadl ) was evaluated using an eight - item questionnaire that included walking for 15 min with or without a cane ; going out at least once a week , answering the telephone ; and using home electronic appliances , daily shopping activity , taking trash out , managing money , and ventilating rooms .
forgetfulness was queried by the question item : have you been horribly forgetful lately .
daily shopping activity was compared among those living with their family / caregiver and those who did not .
daily shopping activity was categorized as supermarket store , convenience store , home delivery , and no shopping .
the level of social activity evaluation included attending culture lessons or pursuing a hobby and interacting with neighborhoods .
the level of neighborly ties as social capital were evaluated using a questionnaire that asked whether subjects shared any gifts ; had frequent conversations ; usually exchanged greetings ; and rarely interacted with their neighbors .
family composition was characterized as living alone , living with spouses , living with family , and spending alone in the daytime .
self - rated masticatory ability was measured on a 5-point scale from being able to eat whatever subjects wanted to eat , able to eat most foods except some hard ones , limited foods because of inadequate chewing , unable to eat few foods because of insufficient chewing , and a fluid diet . in this survey ,
this study was approved by the ethical committee of kumamoto health science university , kumamoto , japan ( no .
23 - 12 for epidemiology ) , and informed content was obtained from all participants .
a logistic regression analysis was used to determine which categorical factors were independent predictors of having self - perceived health without requiring long - term care services .
a multivariate logistic regression analysis was used to calculate the odds ratios ( ors ) and 95% confidence intervals ( cis ) after controlling simultaneously for potential confounders .
all statistical analyses were performed using ibm spss statics for japan version 19.0 for windows ( ibm , japan ) . a value of p < .05 was considered to be statistically significant .
this study population consists of participants in survey , which is a prospective and population - based study , and is designed to identify factors for self - reliant life in community - dwelling older adults in japan ( kayama , hironaka , & tani , 2014 ) .
this study recruited 1,706 individuals who were 65 years and above , living in kumamoto city , and obtained informed consent from 1,554 of those subjects .
those subjects had involvement with regional welfare commission volunteers and community comprehensive care center staffs .
the study excluded subjects who died , moved , or were hospitalized during the study , and thus , 1,377 individuals participated ( 459 men and 910 women , mean age 79.8 6.6 years ) .
this structured questionnaire survey was conducted in conjunction with regional welfare commission volunteers and community comprehensive care center staffs .
the methods for data collection were described previously ( kayama et al . , 2014 ) .
subjective health status was established by questionnaire with four levels of choice ; queried items included very healthy , moderately healthy , not very healthy , and not healthy .
instrumental activity of daily living ( iadl ) was evaluated using an eight - item questionnaire that included walking for 15 min with or without a cane ; going out at least once a week , answering the telephone ; and using home electronic appliances , daily shopping activity , taking trash out , managing money , and ventilating rooms .
forgetfulness was queried by the question item : have you been horribly forgetful lately .
daily shopping activity was compared among those living with their family / caregiver and those who did not .
daily shopping activity was categorized as supermarket store , convenience store , home delivery , and no shopping .
the level of social activity evaluation included attending culture lessons or pursuing a hobby and interacting with neighborhoods .
the level of neighborly ties as social capital were evaluated using a questionnaire that asked whether subjects shared any gifts ; had frequent conversations ; usually exchanged greetings ; and rarely interacted with their neighbors .
family composition was characterized as living alone , living with spouses , living with family , and spending alone in the daytime .
self - rated masticatory ability was measured on a 5-point scale from being able to eat whatever subjects wanted to eat , able to eat most foods except some hard ones , limited foods because of inadequate chewing , unable to eat few foods because of insufficient chewing , and a fluid diet . in this survey ,
this study was approved by the ethical committee of kumamoto health science university , kumamoto , japan ( no .
23 - 12 for epidemiology ) , and informed content was obtained from all participants .
a logistic regression analysis was used to determine which categorical factors were independent predictors of having self - perceived health without requiring long - term care services .
a multivariate logistic regression analysis was used to calculate the odds ratios ( ors ) and 95% confidence intervals ( cis ) after controlling simultaneously for potential confounders .
all statistical analyses were performed using ibm spss statics for japan version 19.0 for windows ( ibm , japan ) . a value of p < .05 was considered to be statistically significant .
the initial evaluation of the participants ( 1,377 individuals ) in the present study showed that 578 subjects could eat whatever they wanted to eat , 686 could eat most foods except a few that were difficult , 83 could eat a limited number of foods because of insufficient chewing ability , 6 could eat few foods because most were too difficult to chew , and 3 were on a fluid diet . participants who answered unknown ( 21 persons ) were excluded from the current statistical analysis .
the association between the subjects self - rated masticatory ability with having good self - perceived health without requiring long - term care as a self - reliant life among the older adults is shown in table 1 .
the population that could chew whatever they wanted to eat included the highest proportion ( 68.6% ) of those having good self - rated health without requiring long - term care ( p < .001 , test ) , and only 6.2% of those with poor self - rated health and requiring long - term care insurance were found in this population .
in contrast , the population that could eat a limited number of foods because of insufficient chewing ability accounted for 56.6% of those with poor self - rated health and requiring long - term care .
association of self - rated masticatory ability with self - reliant life in older adults . note .
category numbers of mastication are as follows : 1 = whatever wanting to eat , 2 = most foods expect some hard ones , 3 = limited foods because of chewing not well , 4 = few foods because of the difficulty of chewing or fluid diet .
the association between self - rated masticatory ability with other characteristics of the participants is shown in table 2 .
the group with adequate self - rated masticatory ability included a younger population ( 65 - 74 , 53.2% ) than the other groups ( 75 - 84 , 43.0% ; above 85 , 32.7% ) .
the group having a bmi < 18.5 included a significantly lower proportion of those with good mastication .
the characteristics associated with mastication were walking for 15 min ; anxiety about falling ; going out once or more per week ; becoming forgetful ; using the telephone availing electronic appliance ; daily shopping ; taking the trash out ; managing money ; having a hobby ; interacting with neighbors ; and sharing with neighbors .
in addition , having good self - rated health and not requiring long - term care with good subjective health was also significantly associated with the subjects self - rated masticatory ability ( p < .001 , test ) .
association between self - rated masticatory ability with demographic , nutritional , status , iadl items , and self - reliant life in elderly . note .
data was analyzed by chi - square test ( having good self - rated masticatory ability vs. rest of all ) .
self - reliant life with good subjective health : having good self - perceived health without receiving long - term care insurance .
the ors and 95% cis for having good self - rated health without receiving long - term care insurance were calculated using a logistic regression analysis adjusted for multiple confounding factors , such as demographics , iadl , social capital , cognitive function , and self - rated masticatory ability ( table 3 ) .
an unadjusted univariate analysis revealed that better mastication , younger age , better iadl ( walking for 15 min , going out once and over a week , using the telephone , using home electronic appliances , going to shopping daily , taking the trash out , managing money , and ventilating rooms ) , good social capital ( having a hobby , interaction with neighbors ) , and better cognitive function ( not forgetful ) were associated with good self - rated health without receiving long - term care .
the crude or for mastication was 3.47 ( 95% ci = [ 2.76 , 4.38 ] ) .
model 1 adjusted for age and gender attenuated the or for mastication but remained statistically significant ( or = 3.26 , 95% ci = [ 2.58 , 4.13 ] ) .
model 2 , adjusted for iadl , social capital , and cognitive function , and the or for mastication , was still statistically significant ( or = 2.16 , 95% ci = [ 1.64 , 2.83 ] ) .
association of self - reliant later life with self - rated masticatory ability determined by multilevel logistic regression . note . or = odds ratio ; ci = confidence interval .
the participants were divided into four groups based on their self - rated masticatory ability and self - reliant life , and the number of iadl items ( eight items maximum ) in each group were analyzed ( figure 1 ) . a multiple anova adjusted for gender and age revealed that there were significantly more iadl items in individuals having good mastication ( 7.64 0.84 ) than those without good mastication ( 7.32 1.28 ) even among those with self - rated good health who were not receiving long - term care .
similarly , there were significantly more iadl items in the individuals having good mastication ( 6.55 1.71 ) than in those who did not ( 5.44 2.19 ) , even in the group that did not have good self - rated health and were not receiving long - term care .
comparison of number of iadl items for the four groups by self - perceived masticatory ability and health .
the word , in figure , health indicates self - perceived health without receiving long - term care insurance , and mastication
the current study found that self - rated masticatory ability was significantly associated with the self - perceived good health in those not receiving long - term care insurance in community - dwelling age of 65 and above .
the self - perceived good health in subjects who were not receiving long - term care insurance defined those with a self - reliant later life .
the present study is the first report on the relationship between a self - reliant later life with positive self - perceived health and self - rated masticatory ability .
the significant association between the subjects self - rated masticatory ability and their self - perceived good health without receiving long - term care insurance indicated that satisfactory masticatory ability could be an independent predictor of a self - reliant later life . rising a rate of long - term institutionalization of older adults damages both the sustainability of social security and the aged own qol .
health , labour , and welfare ministry in japan estimated a reduction in health care cost would be 8.9 billion dollar per year in 2020 , if increase in active life expectancy would exceed increase in total life expectancy . to maintain their active life and to live in their familiar environment until the end of the life without institutionalization or hospitalization , it is critical to expand active life expectancy .
in addition , multiple lines of evidences demonstrated that life expectancy crucially related with the self - perceived health ( kaplan & camacho , 1983 ; larue , bank , jarvik , & hetland , 1979 ; rakowski , mor , & hiris , 1994 ) .
taken together , we defined the aged self - reliant status as self - perceived adequate health without long - term care - required certification .
the current findings are consistent with those of previous studies reporting the relationship between patients qol and their masticatory ability .
a previous study found that poor chewing ability based on the number of chewable foods was significantly associated with poor qol status in 80-year - old subjects ( takata et al . , 2006 ) .
miura et al . ( 2000 ) reported that satisfactory chewing status is correlated with qol evaluated by the total score of the philadelphia geriatric center ( pcg ) morale . a report on
older brazilians showed that those satisfied with their ability to chew food was closely correlated with the score of each domain ( physical , psychological , environment , and social relations ) on the world health organization quality of life questionnaire - brief version ( hugo , hilgert , de sousa mda , & cury , 2009 ) .
another recent study reported a relationship between certification of long - term care insurance and self - rated chewing ability .
the result of the kaplan meier analysis for individuals aged 65 to 79 years clearly demonstrated that the proportion of individuals not certified for long - term care insurance significantly declines in those with self - rated fair or poor masticatory ability compared with those having good mastication ( moriya , notani , murata , inoue , & miura , 2014 ) .
a cox proportional hazard analysis also shows that the certification for long - term care insurance was 1.87-fold ( ci = [ 1.07 , 3.27 ] ) higher in the individuals with fair or poor masticatory ability in comparison with those with adequate ability ( moriya et al . , 2014 ) .
a 6-year follow - up study on rural community dwelling older adults in japan by shinkai et al .
( 2003 ) demonstrated that depression of basic activity of daily living ( adl ) and iadl were 1.88-fold ( ci = [ 1.26 , 2.82 ] ) and 2.22-fold ( ci = [ 1.50 , 3.27 ] ) , respectively , higher in individuals with poor chewing ability in comparison with those with better ability . taken together , maintaining the chewing ability in later life would advantage self - reliant life through keeping well both mentally and physically .
these evidences suggest that masticatory ability should be the concern in gerontological research . to ensure sustainability of social security system , it is important to close the gap between life expectancy and active life expectancy .
( 2011 ) conducted a study of 882 individuals aged 65 and above , and a multivariate logistic regression demonstrated that severely impaired masticatory ability is significantly related to higher hospitalization costs .
kimura et al . ( 2013 ) assessed masticatory efficiency using color - changing chewing gum in 269 community - dwelling japanese older adults above the age of 75 , and concluded that lower masticatory efficiency is significantly associated with lower adl , lower cognitive function , and depression .
the result of panel interview surveys for age of 65 and above in japan indicated that active life expectancy of individuals who could chew relatively hard foods was 2 to 3 years longer than people who could chew only relatively soft foods in daily diet ( nasu & saito , 2006 ) .
these evidences , including our findings , strongly suggested that maintenance of adequate chewing ability in older adults is closely related to expansion of the active life expectancy , leading to the sustainability of social security system .
the participants of the current study were armed with a regional welfare commission volunteer or community comprehensive care center .
therefore , the proportion of participants receiving long - term care insurance in the present study was 33.8% , higher than the average proportion in japan ( 17.9% in aged 65 and above ) .
the proportion of participants whose health was perceived to be well was 67.2% , slightly lower than a population based on a recent survey on health consciousness by the ministry of health , labour , and welfare in japan ( 77.9% in aged 65 years and above in 2014 ) .
this study conducted a structured - questionnaire interview - based investigation in conjunction with the regional commission volunteers or public nurses on the staffs of community comprehensive care center , closely interacting with community - dwelling older adults through regular home visits . therefore , the volunteers or the public nurses commissioned this investigation had built a good rapport with the participants in the study , allowing them to collect true - to - life data .
the self - rated masticatory ability was closely correlated with neighborhood social capital , such as interacting with neighbors and sharing something with neighbors , as shown in table 2 .
results from a prospective cohort study based on the aichi gerontological evaluation study indicated that both community and individual levels of horizontal social capital ( such as volunteer group , sports clubs , and hobby clubs ) are significantly associated with retaining 20 or more teeth in individuals aged 65 and above ( aida et al . , 2009 ) .
conducted another study based on a survey in ohsaki city and demonstrated that neighborhood social capital , accomplished by four kinds of networks ( civic , sports and hobby , volunteer , and friendship networks ) , is closely correlated with dentate status in older adults ( aida et al . ,
in contrast , social capital is not correlated with the use of oral prosthesis , such as a denture or dental bridge ( yamamoto et al . , 2014 ) .
there were few questionnaire items to measure social capital in the current study ; thus , conclusions based on the relationship between social capital and masticatory ability were limited . further study on the association between social capital and masticatory ability is needed .
first , self - rated masticatory ability has not correlated with any objective masticatory function such as bite force .
this may weaken our argument , although there are multiple evidences on good correlation between subjective and objective chewing ability .
second , participants of this study were selected by regional welfare commission volunteers and community comprehensive care center staffs , suggesting to have bias .
further study is needed to assess the community - dwelling elderly people who have no relation with regional welfare commission volunteers or community comprehensive care center staffs .
third , we did not have any socioeconomic status , such as income and length of educations , of participants .
although society in kumamoto area narrowed the gap between the rich and the poor in older adults , subjective masticatory ability may be related with socioeconomic status in japanese older adults .
fourth , there is a geographic limitation , as the participants were all from one city .
some clinical data , such as serum albumin level for nutrition condition or blood pressure for general condition , might strengthen our findings .
sixth , to ensure this mechanism , effect of clinical intervention on masticatory ability , such as denture wearing , dental implant , and muscle training , would be a considerable research task . in conclusion
, there was a significant association between self - rated masticatory ability and having self - perceived good health in older adults who were not receiving long - term care insurance , suggesting that a satisfactory level of chewing could be an independent predictor for self - reliant living in the community - dwelling older population .
the result of our study demonstrated that asking the self - rated masticatory ability could be an easier and a useful tool for non - healthcare professionals to assess the health status of regional older adults .
first , self - rated masticatory ability has not correlated with any objective masticatory function such as bite force .
this may weaken our argument , although there are multiple evidences on good correlation between subjective and objective chewing ability .
second , participants of this study were selected by regional welfare commission volunteers and community comprehensive care center staffs , suggesting to have bias .
further study is needed to assess the community - dwelling elderly people who have no relation with regional welfare commission volunteers or community comprehensive care center staffs .
third , we did not have any socioeconomic status , such as income and length of educations , of participants .
although society in kumamoto area narrowed the gap between the rich and the poor in older adults , subjective masticatory ability may be related with socioeconomic status in japanese older adults .
fourth , there is a geographic limitation , as the participants were all from one city .
some clinical data , such as serum albumin level for nutrition condition or blood pressure for general condition , might strengthen our findings .
sixth , to ensure this mechanism , effect of clinical intervention on masticatory ability , such as denture wearing , dental implant , and muscle training , would be a considerable research task . in conclusion
, there was a significant association between self - rated masticatory ability and having self - perceived good health in older adults who were not receiving long - term care insurance , suggesting that a satisfactory level of chewing could be an independent predictor for self - reliant living in the community - dwelling older population .
the result of our study demonstrated that asking the self - rated masticatory ability could be an easier and a useful tool for non - healthcare professionals to assess the health status of regional older adults . | objective : the aim of the present study was to elucidate the influence of self - rated masticatory ability on independent living in community - dwelling older adults . method : a total of 1,377 subjects aged 65 and over who lived in kumamoto city , japan were participated in a survey to investigate critical factors for self - reliance in older adults . in this study , we defined independent life in older adults as self - perceived adequate health without long - term care certification .
logistic regression analysis was used to assess self - perceived masticatory ability in relation to the independent life .
results : the population with adequate self - rated masticatory ability included a significantly higher proportion of subjects with good self - perceived health without long - term care ( 72.7% ) than the remaining subjects ( 27.3% ) .
a logistic regression analysis revealed that there was significant relationship between subjective adequate mastication and living a self - reliant healthy life ( p < .001 ) .
conclusion : our results showed that satisfactory masticatory function was positively related to a self - reliant life with subjective healthy conditions in community - dwelling older adults , which was associated with an extended active life expectancy . |
since the emergence of electroporation ( ep ) in the early 1980s , it has received appreciable attention in both chemotherapy and gene therapy . with this method , reversible perturbation of the lipid membrane
the ep could be induced by a large variety of pulses : high - voltage pulses which are typically short , low - voltage pulses which are typically longer , or a combination of high- and low - voltage pulses.1,2 electrochemotherapy involves ep of intratumorally or intravenously ( iv ) administered cytotoxic drugs , and serves as an excellent alternative for the therapy of cutaneous and subcutaneous metastases.36 furthermore , the delivery of gene - based drugs and dna vaccines by ep enhances the transgene expression in the muscle by two to three orders of magnitude.7 ep also seems to be suitable for extended transdermal drug delivery , modifying the multilamellar lipid bilayers of the stratum corneum.810 the morphology and the special composition of the stratum corneum make it an impermeable barrier for water - soluble compounds .
the stratum corneum consists of keratin - rich enucleate nonviable cells ( corneocytes ) embedded in an intercellular matrix of multilamellar lipid bilayers .
only a few drugs are able to pass through the skin without the aid of a penetration enhancer.11 transdermal delivery of drugs by ep was first suggested by prausnitz et al12 to enhance their bioavailability .
drugs administered transdermally have higher bioavailability than when they are used orally , thanks to their avoidance of the hepatic first - pass metabolism and gastric acid . on the other hand
transdermal ep is currently one of the most promising modes of physical enhancement for the noninvasive transdermal delivery of lipophilic , hydrophilic , and charged or neutral molecules or macromolecules .
the transdermal transport of drugs with molecular weight up to 40 kda across the skin can thereby be increased by several orders of magnitude.8,13 appropriate transdermal transport necessitates the adjustment of the voltage , pulse duration , and number of series of impulses.14 in the present study , the model drug chosen for ep was neostigmine methylsulfate , a reversible acetylcholinesterase inhibitor and an inducer of gastrointestinal motility .
neostigmine has only poor bioavailability after oral administration ; its effective parenteral dose for humans is 0.5 to 2.0 mg , while the equivalent oral dose should be 30 mg or more , but large oral doses may cause toxic effects.15 neostigmine methylsulfate ( molecular weight : 334.39 g / mol , log p : 2.2 ) is not able to permeate through the skin because of its low penetration through the stratum corneum .
we set out to investigate the gastrointestinal effects of repeated transdermal administration of neostigmine by ep and compare the systemic effects of ep - delivered and iv - administered neostigmine .
all animals were treated in full accordance with the european communities council directives ( 86/609/ecc ) and the hungarian act for the protection of animals in research ( xxviii.tv.32. ) .
all experiments involving animal subjects were carried out under sterile conditions with the approval of the hungarian ethical committee for animal research ( registration number : iv/198/2013 ) .
all animal - handling procedures were performed according to the guide for the care and use of laboratory animals of the national institutes of health and followed the guidelines of the animal welfare act .
sprague - dawley rats ( charles - river laboratories , budapest , hungary ) were housed at 22c3c in a relative humidity of 30%70% under a 12-hour light / dark cycle .
pellet food ( charles - river laboratories ) and tap water were provided ad libitum . the experimental design is represented in figure 1 .
male sprague - dawley rats ( 67 weeks old , body weight : 190220 g ) participated either in repeated iv ( n=10 ) or transdermal ep treatment ( n=8 ) with neostigmine methylsulfate ( teva pharmaceutical industries ltd . , gdll , hungary ) . throughout the experiment ,
the animals were kept under deep anesthesia with a combination of intraperitoneal ketamine and xylazine ( 36 and 4 mg / kg , respectively ) .
the jugular vein was cannulated for drug administration and the carotid artery for blood collection .
the abdominal cavity was opened and an implantable force / displacement transducer or strain gauge ( egg-01 sg ; experimetria , budapest , hungary ) was sutured onto the surface of the cecum . the animals were then placed onto a 37c heated operating table ( exp - d - tc / ma-02 ; experimetria ) in order to maintain the body temperature . the strain gauge converted the cecal mechanical contractions to electrical signals .
the amplified signals were recorded and analyzed with an online computer by the s.p.e.l . advanced isosys data acquisition system ( experimetria ) .
the basal contractions were detected for at least 10 minutes before the first dose of neostigmine .
the area under the curve of these 10 minutes was used as the control , and the stimulation was calculated as a percentage of this initial period .
following the addition of each concentration of neostigmine , the area under the curve of a 10-minute period was evaluated .
the ed50 values , that is , the doses that provoke a response half way between the basal and the maximal response , were calculated and the unpaired t - test was applied for statistical analysis with the prism 5.0 computer program ( graphpad software , inc . , la jolla , ca , usa ) . before ep , the rats were shaved on the abdominal surface and the remaining hair was removed with veet depilatory cream ( reckit benckiser , bristol , uk ) .
neostigmine was administered in cumulative doses of 0.2 , 0.67 , 2.0 , 6.7 , 20.0 , and 66.7 g / kg . for ep
, neostigmine methylsulfate was dissolved in a 2.5% hydroxyethylcellulose - containing hydrogel ( natrosol hec , ashland inc . ,
the final volume of the neostigmine - containing hydrogel was 25 l and the ph of the hydrogel was 6.95 .
the mezoforte duo ep device ( serial number mez 120905-d ) , produced by dr derm equipment ltd .
( budapest , hungary ) , was provided by the derm clinic of anti - aging dermatology , aesthetic laser and plastic surgery ( budapest , hungary ) .
the polypropylene - covered treating headpiece contains a plate electrode 25 mm in diameter indirectly contacting with the treated surface .
modulation was achieved with 1,800 vpp ( peak - to - peak voltage ) pulses with a duration of 5 milliseconds , followed by a 20 milliseconds break .
this pulse treatment was utilized on the abdominal surface for 2 minutes ( 2,200 periods / min ) , during which period the applied neostigmine - containing hydrogel was absorbed through the skin , with only a dry film layer remaining on the surface of the skin . a 10-minute waiting period ensued before the next ep - delivered neostigmine dose . for iv administration , a neostigmine methylsulfate injection ( stigmosan , pharmamagist , budapest , hungary ) was diluted in physiological saline solution . the cumulative neostigmine doses and
the period for iv administration was ~2030 seconds , and the recording of contractions was started 2 minutes after the start of the neostigmine administration .
analytical grade sodium dihydrogenphosphate and disodium hydrogenphosphate dodecahydrate were obtained from sigma - aldrich ( budapest , hungary ) .
high - performance liquid chromatography ( hplc ) grade glacial acetic acid , acetonitrile , and methanol were purchased from merck ( darmstadt , germany ) .
benzyltri - n - propylammonium chloride ( internal standard ) and neostigmine methylsulfate were from sigma - aldrich .
the water used was purified and deionized with the milli - q system ( millipore , milford , ma , usa ) .
the hplc apparatus consisted of a shimadzu system ( shimadzu corporation , kyoto , japan ) equipped with a solvent delivery system ( lc-20ad ) , a dgu-20a3 on - line degasser , a sil 20a ht autoinjector , a cto-20a column oven , an spd - m20a photodiode - array detector , and a cbm-20a system controller .
the chromatographic system was equipped with a rheodyne model 7125 injector ( rheodyne corp . , cotati , ca , usa ) with a 20 l loop .
the system control and data acquisition were performed with shimadzu lc solution software ( shimadzu corporation ) .
the chromatographic separations were performed on a phenosphere scx ( 5 m , 1504.6 mm ) analytical column ( phenomenex inc . ,
separations were performed in isocratic mode . the mobile phase used for the separation consisted of 0.5 m nah2po4 buffer ( ph = 3.5):acetonitrile = 45:55 ( v / v ) pumped at a flow rate of 1 ml / min .
the mobile phase was filtered by a millipore vacuum filtration system equipped with a 0.45 m pore size filter and degassed by ultrasonication .
the detection wavelength was 200 nm . a stock solution of neostigmine methylsulfate ( 1 mg / ml ) was prepared in the hplc mobile phase and diluted with mobile phase to obtain a series of working standard solutions with concentrations ranging from 3 to 50 g / ml . the internal standard stock solution ( 1 mg / ml in methanol ) was further diluted to 50 g / ml with water .
stock solutions were stored at 20c , and working solutions were kept refrigerated at 2c6c .
the working solutions were used to prepare seven calibration samples in blank plasma ( 0.3 , 1 , 3 , 5 , 10 , 30 , and 50 g / ml ) .
the blood samples were collected via the previously inserted polyethylene cannula 2 minutes after each ep or iv neostigmine treatment .
an aliquot of plasma ( 200 l ) was combined with 20 l of internal standard working solution .
the mixture was loaded into a strata - x - cw 33u solid - phase extraction tube ( phenomenex inc . )
previously conditioned with 0.5 ml 5% glacial acetic acid in methanol , 0.5 ml methanol , and 0.5 ml 0.2 m na2hpo4 ( ph = 9 ) .
the cartridge was washed with 1 ml of a 0.2 m na2hpo4 ( ph = 9):methanol = 90:10 mixture ( v / v ) .
the neostigmine methylsulfate retained in the cartridge was eluted with 1 ml 5% glacial acetic acid in methanol into a glass tube .
the eluate was evaporated to dryness under a stream of nitrogen at 40c and reconstituted with 100 l mobile phase , and 20 l was then injected into the hplc system .
the seven - point calibration curves , prepared in triplicate , exhibited good linearity ( r=0.9984 ) in the concentration range 0.350 g / ml for neostigmine methylsulfate .
the limits of quantification and detection were 0.05 and 0.1 g / ml , respectively .
all animals were treated in full accordance with the european communities council directives ( 86/609/ecc ) and the hungarian act for the protection of animals in research ( xxviii.tv.32. ) .
all experiments involving animal subjects were carried out under sterile conditions with the approval of the hungarian ethical committee for animal research ( registration number : iv/198/2013 ) .
all animal - handling procedures were performed according to the guide for the care and use of laboratory animals of the national institutes of health and followed the guidelines of the animal welfare act .
sprague - dawley rats ( charles - river laboratories , budapest , hungary ) were housed at 22c3c in a relative humidity of 30%70% under a 12-hour light / dark cycle .
pellet food ( charles - river laboratories ) and tap water were provided ad libitum .
male sprague - dawley rats ( 67 weeks old , body weight : 190220 g ) participated either in repeated iv ( n=10 ) or transdermal ep treatment ( n=8 ) with neostigmine methylsulfate ( teva pharmaceutical industries ltd .
the animals were kept under deep anesthesia with a combination of intraperitoneal ketamine and xylazine ( 36 and 4 mg / kg , respectively ) .
the jugular vein was cannulated for drug administration and the carotid artery for blood collection .
the abdominal cavity was opened and an implantable force / displacement transducer or strain gauge ( egg-01 sg ; experimetria , budapest , hungary ) was sutured onto the surface of the cecum . the animals were then placed onto a 37c heated operating table ( exp - d - tc / ma-02 ; experimetria ) in order to maintain the body temperature . the strain gauge converted the cecal mechanical contractions to electrical signals .
the amplified signals were recorded and analyzed with an online computer by the s.p.e.l . advanced isosys data acquisition system ( experimetria ) .
the basal contractions were detected for at least 10 minutes before the first dose of neostigmine .
the area under the curve of these 10 minutes was used as the control , and the stimulation was calculated as a percentage of this initial period . following the addition of each concentration of neostigmine
three - parameter , symmetrical sigmoidal concentration response curves were fitted . the ed50 values , that is , the doses that provoke a response half way between the basal and the maximal response , were calculated and the unpaired t - test was applied for statistical analysis with the prism 5.0 computer program ( graphpad software , inc . , la jolla , ca , usa ) .
before ep , the rats were shaved on the abdominal surface and the remaining hair was removed with veet depilatory cream ( reckit benckiser , bristol , uk ) .
neostigmine was administered in cumulative doses of 0.2 , 0.67 , 2.0 , 6.7 , 20.0 , and 66.7 g / kg . for ep ,
neostigmine methylsulfate was dissolved in a 2.5% hydroxyethylcellulose - containing hydrogel ( natrosol hec , ashland inc . ,
the final volume of the neostigmine - containing hydrogel was 25 l and the ph of the hydrogel was 6.95 .
the mezoforte duo ep device ( serial number mez 120905-d ) , produced by dr derm equipment ltd .
( budapest , hungary ) , was provided by the derm clinic of anti - aging dermatology , aesthetic laser and plastic surgery ( budapest , hungary ) .
the polypropylene - covered treating headpiece contains a plate electrode 25 mm in diameter indirectly contacting with the treated surface .
modulation was achieved with 1,800 vpp ( peak - to - peak voltage ) pulses with a duration of 5 milliseconds , followed by a 20 milliseconds break .
this pulse treatment was utilized on the abdominal surface for 2 minutes ( 2,200 periods / min ) , during which period the applied neostigmine - containing hydrogel was absorbed through the skin , with only a dry film layer remaining on the surface of the skin . a 10-minute waiting period ensued before the next ep - delivered neostigmine dose . for iv administration , a neostigmine methylsulfate injection ( stigmosan , pharmamagist , budapest , hungary )
the cumulative neostigmine doses and recording protocol were the same as in the ep protocol .
the period for iv administration was ~2030 seconds , and the recording of contractions was started 2 minutes after the start of the neostigmine administration .
analytical grade sodium dihydrogenphosphate and disodium hydrogenphosphate dodecahydrate were obtained from sigma - aldrich ( budapest , hungary ) .
high - performance liquid chromatography ( hplc ) grade glacial acetic acid , acetonitrile , and methanol were purchased from merck ( darmstadt , germany ) .
benzyltri - n - propylammonium chloride ( internal standard ) and neostigmine methylsulfate were from sigma - aldrich .
the water used was purified and deionized with the milli - q system ( millipore , milford , ma , usa ) .
the hplc apparatus consisted of a shimadzu system ( shimadzu corporation , kyoto , japan ) equipped with a solvent delivery system ( lc-20ad ) , a dgu-20a3 on - line degasser , a sil 20a ht autoinjector , a cto-20a column oven , an spd - m20a photodiode - array detector , and a cbm-20a system controller .
the chromatographic system was equipped with a rheodyne model 7125 injector ( rheodyne corp . , cotati , ca , usa ) with a 20 l loop .
the system control and data acquisition were performed with shimadzu lc solution software ( shimadzu corporation ) .
the chromatographic separations were performed on a phenosphere scx ( 5 m , 1504.6 mm ) analytical column ( phenomenex inc . ,
separations were performed in isocratic mode . the mobile phase used for the separation consisted of 0.5 m nah2po4 buffer ( ph = 3.5):acetonitrile = 45:55 ( v / v ) pumped at a flow rate of 1 ml / min .
the mobile phase was filtered by a millipore vacuum filtration system equipped with a 0.45 m pore size filter and degassed by ultrasonication .
the detection wavelength was 200 nm . a stock solution of neostigmine methylsulfate ( 1 mg / ml ) was prepared in the hplc mobile phase and diluted with mobile phase to obtain a series of working standard solutions with concentrations ranging from 3 to 50 g / ml . the internal standard stock solution ( 1 mg / ml in methanol ) was further diluted to 50 g / ml with water .
stock solutions were stored at 20c , and working solutions were kept refrigerated at 2c6c .
the working solutions were used to prepare seven calibration samples in blank plasma ( 0.3 , 1 , 3 , 5 , 10 , 30 , and 50 g / ml ) .
the blood samples were collected via the previously inserted polyethylene cannula 2 minutes after each ep or iv neostigmine treatment .
an aliquot of plasma ( 200 l ) was combined with 20 l of internal standard working solution .
the mixture was loaded into a strata - x - cw 33u solid - phase extraction tube ( phenomenex inc . )
previously conditioned with 0.5 ml 5% glacial acetic acid in methanol , 0.5 ml methanol , and 0.5 ml 0.2 m na2hpo4 ( ph = 9 ) . the cartridge was washed with 1 ml of a 0.2 m na2hpo4 ( ph = 9):methanol = 90:10 mixture ( v / v ) .
the neostigmine methylsulfate retained in the cartridge was eluted with 1 ml 5% glacial acetic acid in methanol into a glass tube .
the eluate was evaporated to dryness under a stream of nitrogen at 40c and reconstituted with 100 l mobile phase , and 20 l was then injected into the hplc system .
the seven - point calibration curves , prepared in triplicate , exhibited good linearity ( r=0.9984 ) in the concentration range 0.350 g / ml for neostigmine methylsulfate .
the limits of quantification and detection were 0.05 and 0.1 g / ml , respectively .
analytical grade sodium dihydrogenphosphate and disodium hydrogenphosphate dodecahydrate were obtained from sigma - aldrich ( budapest , hungary ) .
high - performance liquid chromatography ( hplc ) grade glacial acetic acid , acetonitrile , and methanol were purchased from merck ( darmstadt , germany ) .
benzyltri - n - propylammonium chloride ( internal standard ) and neostigmine methylsulfate were from sigma - aldrich .
the water used was purified and deionized with the milli - q system ( millipore , milford , ma , usa ) .
the hplc apparatus consisted of a shimadzu system ( shimadzu corporation , kyoto , japan ) equipped with a solvent delivery system ( lc-20ad ) , a dgu-20a3 on - line degasser , a sil 20a ht autoinjector , a cto-20a column oven , an spd - m20a photodiode - array detector , and a cbm-20a system controller .
the chromatographic system was equipped with a rheodyne model 7125 injector ( rheodyne corp . ,
the system control and data acquisition were performed with shimadzu lc solution software ( shimadzu corporation ) .
the chromatographic separations were performed on a phenosphere scx ( 5 m , 1504.6 mm ) analytical column ( phenomenex inc . ,
separations were performed in isocratic mode . the mobile phase used for the separation consisted of 0.5 m nah2po4 buffer ( ph = 3.5):acetonitrile = 45:55 ( v / v ) pumped at a flow rate of 1 ml / min .
the mobile phase was filtered by a millipore vacuum filtration system equipped with a 0.45 m pore size filter and degassed by ultrasonication .
a stock solution of neostigmine methylsulfate ( 1 mg / ml ) was prepared in the hplc mobile phase and diluted with mobile phase to obtain a series of working standard solutions with concentrations ranging from 3 to 50 g / ml . the internal standard stock solution ( 1 mg / ml in methanol ) was further diluted to 50 g / ml with water
. stock solutions were stored at 20c , and working solutions were kept refrigerated at 2c6c .
the working solutions were used to prepare seven calibration samples in blank plasma ( 0.3 , 1 , 3 , 5 , 10 , 30 , and 50 g / ml ) .
the blood samples were collected via the previously inserted polyethylene cannula 2 minutes after each ep or iv neostigmine treatment .
an aliquot of plasma ( 200 l ) was combined with 20 l of internal standard working solution .
the mixture was loaded into a strata - x - cw 33u solid - phase extraction tube ( phenomenex inc . )
previously conditioned with 0.5 ml 5% glacial acetic acid in methanol , 0.5 ml methanol , and 0.5 ml 0.2 m na2hpo4 ( ph = 9 ) .
the cartridge was washed with 1 ml of a 0.2 m na2hpo4 ( ph = 9):methanol = 90:10 mixture ( v / v ) .
the neostigmine methylsulfate retained in the cartridge was eluted with 1 ml 5% glacial acetic acid in methanol into a glass tube .
the eluate was evaporated to dryness under a stream of nitrogen at 40c and reconstituted with 100 l mobile phase , and 20 l was then injected into the hplc system .
the seven - point calibration curves , prepared in triplicate , exhibited good linearity ( r=0.9984 ) in the concentration range 0.350 g / ml for neostigmine methylsulfate .
the limits of quantification and detection were 0.05 and 0.1 g / ml , respectively .
neostigmine increased the cecal contractions after both iv and transdermal ep administration ( figure 2a ) .
the calculated ed50 value for neostigmine was approximately twice as high after iv administration as compared with the ep route .
however , this difference is statistically not significant . the calculated maximum increase in contractions was only 20% lower after ep administration than that after iv treatment ( table 1 ) .
the cecal contractile responses to iv- or ep - administered neostigmine did not differ significantly in the investigated dose interval ( 0.266.7 g / kg ) .
the cecal smooth muscle did not show any response to ep stimulation without neostigmine ( figure 2b ) .
the chromatogram of blank rat plasma spiked with 10 g / ml neostigmine gave a clear neostigmine peak with a retention time of 7.730.31 minutes ( figure 3a ) .
in neostigmine - treated rats , a smaller but identifiable peak was found at the same retention time as that of the neostigmine - spiked blank rat plasma ( figure 3b ) .
the magnitudes of the peak of the internal standard were the same in both cases , indicating the reliability of the method .
the hplc analysis of the neostigmine plasma levels revealed that the two routes of administration resulted in very similar drug concentrations .
the neostigmine plasma concentrations were the same after both iv and ep administrations ; statistically there was no difference between the two plasma curves ( figure 4 ) . when the cecal contractions were represented as a function of the plasma concentration of neostigmine , the concentration response curves were similar to the dose response curves ( figure 5 ) .
there is an increasing need for new and noninvasive routes of drug administration in clinical practice .
moreover , there is a demand for fast and safe drug administration for acute care and even chronic treatment .
the increasing numbers of peptide drugs have also given rise to a requirement for noninvasive therapy.16 novel biological therapies involve peptide compounds , mainly monoclonal antibodies , and the antidiabetic or ovulation induction therapies also apply peptide hormones .
these peptide drugs are not applicable via oral administration because of their sensitivity to peptidases in the gastrointestinal tract .
the most frequent route of administration of such compounds is subcutaneous administration , but many patients fear the needles , especially in self - treatment .
ep is a method of noninvasive drug administration which is widely used for cosmetic interventions,17,18 delivery of genes into cells19 and experimental animals,20,21 or the delivery of anticancer agents into tumor cells.22 attempts have been made to apply ep for transdermal drug delivery in systemic therapies.9 a number of papers have described the local action of ep - delivered drugs,23 but only a few reports can be found concerning the systemic applicability of this method for drug delivery.9,10,12 the electrodes and the electric pulse parameters are the key information in ep applications .
iontophoresis applies a low intensity ( < 0.5 ma / cm ) electric field for a period of minutes or hours with low voltage ( 510 v or less ) .
direct current is usually used , but pulsed direct current can enhance the efficacy of iontophoresis if the pulse frequency is not too high.24 ep makes use of short ( < 1 second ) and high - voltage pulses ( > 50 v ) , creating an aqueous pathway for transport through lipid bilayers of the skin.25 in our ep method , an amplitude - modulated sine wave radiofrequency current was utilized as the source of pulses for ep .
the high voltage ( 1,800 vpp ) and the high pulse frequency ( 2,200/min ) applied exclude the possibility of neostigmine being delivered by iontophoretic processes in our system .
we detected the systemic action of ep - delivered neostigmine methylsulfate with plasma drug level control .
neostigmine methylsulfate is a highly water - soluble compound that is unable to penetrate through the barriers of the dermal lipid layers .
since neostigmine exerts a well expressed contracting effect on the gastrointestinal smooth muscle , we selected a part of the large intestine ( the cecum ) as the target organ of our measurements , and the contraction - increasing effects and plasma levels of ep - delivered neostigmine were compared with its effects after iv administration . for the detection of plasma levels of neostigmine , an hplc setup was employed .
although the plasma concentration of neostigmine was relatively low , the sensitivity of the method was sufficient for qualitative determination .
somewhat surprisingly , no difference in cecal - contracting effect or plasma level of neostigmine was observed after 2 minutes of ep and iv administration .
ep may therefore be considered to be equivalent to iv administration for systemic drug delivery . moreover
, the action of neostigmine could be adjusted through the use of relatively small doses , which suggests that distinguished dosages can be applied via ep .
we also proved that the plasma concentrations of neostigmine correlate with the increases in cecal contractions after both iv and ep administrations .
this correlation is further evidence that ep - administered neostigmine reaches the circulation and is solely responsible for the measured physiological response .
however , in our system , the ep did not have any direct contracting effect on the smooth muscle , and thus all the registered changes in the cecal contractions were consequences of the drug action .
the period for iv administration was ~2030 seconds , and the recording of contractions was therefore started 2 minutes after the start of the injection in order to make the time frame similar to that of ep .
the plasma concentration of an iv - administered drug is highest immediately after the injection , but the blood sample was collected after 2 minutes of iv delivery .
this means that we missed the highest plasma peaks after iv administration , which may explain why the plasma curves are similar after iv and ep drug delivery . for the contractions ,
the neostigmine should be distributed in the large intestine tissue ; this is not an immediate action , and we therefore suppose that any difference between the maximum effects of iv and ep drug delivery is not significant , or the distribution process equilibrates the difference .
another limitation is that the impulse of the applied ep parameters was constant ; we did not test the effects of different voltages or pulse durations on the bowel action and plasma level of neostigmine .
further studies are necessary to reveal the threshold voltage needed to induce the systemic absorption of the drugs . however , with regard to the earlier and present findings , we have a good reason to suspect that ep works on the principle of all or nothing , opening all the biological barriers in the tissues or cell membranes at once.26 additionally , we do not know what size of plate electrode should be used in humans . a diameter proportional to that used in rats
on the other hand , the drug concentration of the hydrogel and the area of the treated surface can be modified easily to find the optimal setup for human therapy .
drugs with different chemical properties should also be tested with this delivery system in order to assess the applicability of this method .
the potential clinical application of ep may involve the rapid therapy of a life - threatening condition to replace iv treatment ( eg , epileptic seizure or a cardiac arrest ) and may make protein drug delivery ( eg , insulin or low molecular weight heparin ) easy and painless during self - administration by the patients .
we conclude that transdermal ep - delivered neostigmine elicits action equivalent to that of intravenous administration both in time and intensity . through ep , even low doses of water - soluble compounds
although our findings are potentially promising for the clinical application of ep for drug delivery , a number of questions remain to be clarified before human therapy can be initiated . | purposetransdermal electroporation has become one of the most promising noninvasive methods for drug administration , with greatly increased transport of macromolecules through the skin .
the cecal - contracting effects of repeated transdermal electroporation delivery and intravenous administration of neostigmine were compared in anesthetized rats.methodsthe cecal contractions were detected with implantable strain gauge sensors , and the plasma levels of neostigmine were followed by high - performance liquid chromatography.resultsboth intravenously and ep - administered neostigmine ( 0.266.7 g / kg ) increased the cecal contractions in a dose - dependent manner . for both the low doses and the highest dose , the neostigmine plasma concentrations were the same after the two modes of administration , while an insignificantly higher level was observed at a dose of 20 g / kg after intravenous administration as compared with the electroporation route .
the contractile responses did not differ significantly after the two administration routes.conclusionthe results suggest that electroporation - delivered neostigmine elicits action equivalent to that observed after intravenous administration as concerning both time and intensity .
electroporation permits the delivery of even lower doses of water - soluble compounds through the skin , which is very promising for clinical practice . |
while a great deal of attention has been given to the factors that determine cholesterol homeostasis , cholesterol excretion via bile in patients with cad has not been thoroughly examined [ 13 ] .
clinically , it became obvious that , despite effective cholesterol - modulating treatment ( e.g. , statins ) , the development of atherosclerosis can not be stopped in a significant number of patients .
it is known that cholesterol is mainly eliminated from the body via the liver in the form of bile acids [ 2 , 4 , 5 ] .
therefore , in addition to statins , low - density lipoprotein cholesterol ( ldl - c ) can be reduced by increasing the fecal bile acid waste and by compensatory hepatic upregulation of bile acid synthesis [ 2 , 4 ] .
it is reasonable to speculate that a reduced ability to convert cholesterol to bile acids would lead to body cholesterol overload , with the subsequent development of atherosclerosis [ 610 ] .
the aim of this paper is to emphasize the effect of bile acid disposal on coronary artery atherosclerosis .
studies in animals have revealed that rodents do not develop experimental atherosclerosis , despite ingestion of a cholesterol - rich diet [ 2 , 1113 ] . they were able to react to the overload of cholesterol intake by excreting large amounts of bile acids .
the same results were obtained in a study on new zealand white rabbits and primates which were also fed a cholesterol - rich diet .
animals that excreted large amounts of cholesterol did not develop hypercholesterolemia , whereas those with a less efficient excretion had increased plasma level of cholesterol .
furthermore , the degree of hypercholesterolemia was inversely correlated to the rate of bile acid elimination .
these animal experiments suggest that the atherogenic effect of the cholesterol - rich diet closely depends on the animal 's ability to eliminate cholesterol in the form of bile acids [ 12 , 13 ] .
it is therefore reasonable to speculate that reduced ability to convert cholesterol to bile acids would lead to cholesterol overload , with the possibility of subsequent enhanced development of atherosclerosis [ 610 ] .
a similar correlation between the elimination of cholesterol in bile and the development of atherosclerosis was suggested for humans . in an earlier investigation
the elimination of bile acid in the feces of patients who had ischemic heart disease was compared with that of healthy controls on the same diet .
it was reported that the patients excreted much fewer bile acids than the controls .
several new studies had shown an inverse relationship between cad and bile acid excretion [ 610 , 16 , 17 ] .
there are few human studies dealing with disturbed metabolism of plant sterols ( which reflects cholesterol ) in postmenopausal cad women who showed disturbed synthesis and disturbed secretion of bile acids [ 15 , 16 ] .
these findings support the hypothesis that cad patients produce fewer bile acids than individuals without cad and that reduced production of bile acids could lead to advanced atherosclerosis .
these findings are in line with those of the several human studies that showed increased fecal excretion of bile acids to have protective effect on cad development [ 610 , 1517 ] .
most of those investigations were done on selected populations using the method described by grundy et al . for determination of total bile acids .
for example , simonen and miettinen showed that males with heterozygous familial hypercholesterolemia ( fh ) and cad excreted less bile acids than control males with fh and normal coronaries .
we recently published a study on a general adult population with and without cad and found that cad patients eliminated subnormal amounts of fecal bile acids .
cad patients excreted 358 156 mg of total bile acids in comparison to healthy patients 617 293 mg ; p < 0.01 .
the differences in excretion were mainly due to lower excretion of deoxycholic ( 188.29 98.12 mg versus 325.96 198.57 mg ; p < 0.0001 ) and less lithocholic acid ( 115.43 71.89 mg versus 197.27 126.87 mg ; p < 0.01 ) . findings of this study based on 36 cad patients and 37 non - cad patients with a follow - up period of up to 13 years supported earlier ones and allowed for the reaching of more firm conclusions on the role of the elimination of fecal bile acids in cad development .
hdl - c has been proposed to serve as preferential precursor for bile acid biosynthesis in the liver .
furthermore , a negative relationship between plasma levels of hdl cholesterol and biliary saturation with cholesterol has been reported in healthy females .
in contrast to total cholesterol , ldl - c and hdl - c , there was a correlation between plasma triglycerides and bile acid excretion , but only in the non - cad group .
this can be explained by a rapid and more complete intestinal absorption of triglycerides due to an excess of bile acids which are necessary for the emulsification of fats .
cad patients did not exhibit this effect because the amount of excreted bile acids was significantly lower .
atherosclerosis is a disease characterized by lipid accumulation in the vascular wall leading to myocardial infarction or stroke [ 2022 ] . in spite of proven efficacy of the existing drugs , like statins ,
cardiovascular diseases still remain the most important causes of morbidity and mortality in industrialized countries .
a cholesterol - lowering effect can be achieved by reducing cholesterol synthesis or by increasing fecal excretion of bile acids ( ileal sodium - dependent bile acid transporter inhibitors ) .
it is important to emphasize that the ability to excrete large amounts of bile acids not only prevents cad development but also may also prevent atherosclerosis in the cerebral arteries as well [ 3 , 21 , 22 ] .
the results of the recent study after a long followup pointed out to a 6-fold higher incidence of ischemic stroke among the cad patients compared to the non - cad patients , 7 patients ( 19% ) versus 1 patient ( 2.7% ) , and three - fold greater mortality in the cad group , 9 patients ( 25% ) versus 3 patient ( 8% ) .
the 7- hydroxylase is the key enzyme in the conversion of cholesterol to bile acids [ 12 , 13 , 21 , 23 , 24 ] .
it mediates the elimination of cholesterol from the plasma and the intracellular compartment , and it facilitates the excretion of bile acids .
thus , enhanced excretion of bile acids in non - cad individuals can possibly be explained mainly by increased activity and concentration of 7--hydroxylase [ 12 , 13 , 21 , 23 , 24 ] .
in contrast to it , cad patients are unable to effectively increase the activity and concentration of 7--hydroxylase .
a significant percentage of patients develop atherosclerosis despite statin treatment and suppressed levels of cholesterol .
we reason that , by decreasing cholesterol synthesis and increasing the utility of cholesterol , an additive antiatherosclerosis effect might be achieved .
to date it is established that these patients require aggressive lipid - lowering therapy . by combining a statin with drugs affecting bile acid and cholesterol absorption an optimal management of dyslipidemia may potentially be ensured .
reviewing of several human studies revealed significantly lower excretion of bile acid in adult patients with cad compared to non - cad individuals .
the diminished excretion of bile acids might be an independent risk factor for cad and a potential target for cholesterol lowering treatment . | the impact of cholesterol and different classes of lipoproteins on the development of coronary artery disease ( cad ) has been investigated in extensively during the past 50 years .
the cholesterol metabolism is dependent on numerous factors , including dietary fat , fractional absorption of dietary cholesterol , tissue stores of cholesterol , endogenous cholesterol synthesis , and fecal bile excretion .
several studies showed significantly lower amounts of bile acid secretion in adult patients with cad compared to non - cad patients .
could it be that the inability to efficiently excrete bile acids may lead to cad development ? |
dental implantation is considered as one of the most widely employed procedures in dental practice . even though biocompatible osseointegrated dental materials are used for fabrication of dental implant
moreover , placement of dental implants in the maxilla may be complicated by certain anatomical landmarks such as the nasopalatine duct , maxillary sinus , and nasal cavity .
nasopalatine duct cyst ( npdc ) is an intraosseous developmental nonodontogenic cyst in the midline of the anterior palate .
the etiology of npdc is unknown , but the possible causes may include local trauma , infection , and spontaneous proliferation .
the cone beam computerized tomography ( cbct ) with its potential for 3d ct - based surgical planning and measurement helps in the evaluation of the nasopalatine canal dimensions before any surgical procedures in this region .
it has been reported that cbct is superior to the conventional ct in that it reduces the size of the irradiated area of the patient and it has higher image accuracy .
the aim of this study was to highlight the development of npdc after the placement of dental implants .
a literature search was carried out in march 2015 using medline , accessed via the national library of medicine pubmed interface , embase , and cochrane library databases , searching for articles , published in english , relating the development of npdc after the placement of dental implants .
we used a combination of the following keywords : nasopalatine duct cyst , nonodontogenic cyst , developmental cyst , and dental implants .
we also used the related article feature of pubmed to identify further references of interest within the primary search .
these references were obtained , and their bibliographies and pertinent secondary references were also identified and acquired .
all evaluated studies should involve the occurrence of npdc in relation to the dental implant placement .
all studies that do not support the occurrence of npdc after the placement of dental implants should be excluded .
all evaluated studies should involve the occurrence of npdc in relation to the dental implant placement .
all studies that do not support the occurrence of npdc after the placement of dental implants should be excluded .
only four articles were identified related to the occurrence of npdc after the placement of dental implants in the literature published in english .
all of these articles were case reports [ table 1 ] . table 1 demonstrates some details about each case that included preoperative radiographs , preoperative condition of the site of implant placement , type of the implant used ( either immediate or delayed ) , the period from placement of implant till discovery of the lesion , cyst treatment , and the postoperative clinical outcomes .
although the etiology of npdc is not clear as per yet , it may result from spontaneous proliferation of embryonic tissues remnants .
also , it has been attributed to some factors including local trauma , poorly fitting dentures , and local infection .
npdc is usually asymptomatic and it appears radiographically as a heart - shaped radiolucency due to the superimposition of the nasal spine and the resistance of the adjacent roots . as a treatment protocol , marsupialization alone may be sufficient in small lesions , but in case of large lesions marsupialization should be followed by cystectomy and autogenous bone grafting . to our knowledge , this is the first review reporting npdc cases after the placement of dental implants .
the bone on the implant surface was not lost due to infection , but as a by - product of the expansive nature of the npdc in that area .
the author proposed that with the removal of this expansive force induced by the npdc , the bone - implant contact could be restored , though he did not explain clearly the possible relation between the formation of npdc in reference to the placement of dental implant .
reported a case of a 45-year - old male patient , who received an implant in the maxillary left central incisor due to root fracture .
unfortunately , an asymptomatic oval - shaped radiolucency surrounding the apical area of the implant was revealed , even though there was no special finding in the physical condition of the patient .
the authors suggested that the nasopalatine duct was traumatized or at least part of the canal was anteriorly positioned during the osteotomy procedures for dental implant .
they postulated that the previously mentioned trauma stimulated the development of the npdc as indicated by brode and araiche .
the immediate implant was placed after extraction of a tooth in an alveolus contaminated by prior endodontic infection , following careful curettage and debridement .
they suggested that the placement of dental implant in the area with a preexisting infection could have facilitated the secondary bone infection .
reported a case of npdc that occurred following the placement of two dental implants positioned 4 years after the teeth extraction without any previous local endodontic pathology or radiolucency .
they concluded that the occurrence of npdc maybe correlated with implant surgery , because surgery is considered a possible irritant cause .
from the literature , the development of npdc following the placement of dental implant maybe related to some factors , such as local trauma during surgical procedures , which may traumatize the nasopalatine duct and the presence of infection at the time of implantation . therefore , critical selection of appropriate cases as well as the use of cbct views to visualize the exact position of the nasopalatine duct is of great importance in order to avoid the development of such complications .
the authors declare that there is no conflict of interests regarding the publication of this paper .
the authors declare that there is no conflict of interests regarding the publication of this paper . | background : dental implantation is considered as one of the most widely employed procedures in dental practice .
nasopalatine duct cyst ( npdc ) is one of the most common developmental cysts in the oral cavity that develops from the proliferation of embryological epithelial remnants of nasopalatine duct.aim:the aim of this study was to highlight the development of npdc after the placement of dental implants.materials and methods : a literature search was carried out in march 2015 using pubmed , embase , and cochrane library databases , searching for articles relating the development of npdc after placement of dental implants.results:our search identified only four case reports of npdc related to dental implants as reported in the literature published in english.conclusion:placement of dental implants can induce development of npdcs , indicating that placement of dental implants requires well - trained specialists with perfect skills in dental implantology . additionally , critical selection of appropriate cases is of great importance in order to avoid the development of such complications . |
details of the design and methods for the select study and the selection extension study have been described previously . briefly , select was a double - blind parallel - group trial in which 621 male and female patients with rrms were randomized 1:1:1 to treatment with once - monthly subcutaneous injections of dac hyp 150 mg , dac hyp 300 mg , or placebo for 52 weeks .
patients who were treated with dac hyp in select were randomized to continue on dac hyp in the selection extension study or to a 24-week treatment interruption followed by reinitiation .
cranial mri was performed in all patients at baseline and at weeks 24 , 52 , 72 , and 104 .
all study center personnel except the pharmacist were blinded to treatment assignment for each study ( select and selection ) .
all mris were read and interpreted at a central facility ( basel , switzerland ) .
cd56 nk cells were measured in all study patients at baseline ( screening visit and study entry visit at week 0 ) as well as before dosing on weeks 4 , 8 , 16 , 24 , 32 , 48 , 52 , 56 , 60 , 64 , 68 , 72 , and 104 .
anticoagulated whole blood samples for lymphocyte quantification were collected in acid citrate dextrose vacutainer tubes ( bd biosciences , san jose , ca ) and shipped at ambient temperature for next - day analysis .
fluorescence - activated cell sorting was performed using validated assays at esoterix clinical trials services ( mechlen , belgium ) .
absolute lymphocyte , t , b , and nk cell counts were determined using whole blood samples , multitest antibody cocktail reagents , and trucount technology ( bd biosciences ) .
percentages of cd56 nk cells were determined using the following antibodies ( bd biosciences ) : anti - cd3-percp ( clone sk7 ) , anti - cd16-fitc ( clone nkp15 ) , and anti - cd56-apc ( clone ncam16.2 ) . the cd56 nk cell assay included staining of 100 l of whole blood for 20 minutes with the antibody conjugates described above , followed by the addition of 4 ml whole blood lysing solution ( bd biosciences ) , centrifugation , washing with phosphate - buffered saline containing 2% calf serum , and resuspension in 500 l 1% paraformaldehyde solution .
percentages of cd122 ( clone tu27)positive cells were determined by setting gates for positive staining when compared with levels observed for an isotype control antibody ( clone mopc21 ) using antibodies from bd biosciences .
intensity levels of cd122 were determined using mean fluorescence intensity ( mfi ) and converted to mean equivalents of soluble fluorescence using quantibrite phycoerythrin beads ( bd biosciences ) .
a representative cd122 mfi determination for cd3cd16cd56 and cd56 nk cells is shown in figure e-1 at neurology.org/nn .
analyses were performed using winlist analysis software ( verity software house , topsham , me ) . to assess the relationship between cd56 nk cells and dac hyp efficacy , a prespecified analysis plan was developed to determine whether cd56 nk cells could identify dac hyp - treated patients who would have the largest reductions in ms disease activity .
the following ms - related endpoints were used to measure ms activity : new or newly enlarging t2-hyperintense lesions between weeks 0 and 52 , new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 ( to assess predictive value for lesions known to be forming after measurement of the cd56 nk cells ) , new or newly enlarging t2-hyperintense lesions between weeks 52 and 104 , and the annualized relapse rate ( arr ) . based on analyses of a previous phase 2 trial ,
the primary predictor for analyses of efficacy response was the absolute number of cd56 nk cells measured at the week 4 and week 8 time points . in sensitivity analyses ,
change from baseline and percent change from baseline in the absolute number of cd56 nk cells were also considered predictors of efficacy .
relationships between treatment response and cd56 nk cell measurements made at later time points were also estimated .
for the primary prespecified analysis , negative binomial regression was used to test whether the absolute number of cd56 nk cells at week 4 ( and in a separate model at week 8) was a significant predictor of new or newly enlarging t2-hyperintense lesions in dac hyp treated patients after adjustment for the baseline number of new t2-hyperintense lesions and gadolinium - enhancing lesions . because 2 hypotheses were tested ( week 4 and week 8 counts ) , the predetermined significance value to declare a positive prediction was 0.025 . to describe the relationships and account for potential nonlinearity between cd56 nk cells and new or newly enlarging t2-hyperintense lesions , effects by quartile of cd56 nk cells defined at the specified time points
were also estimated . unless otherwise stated , p values shown are the likelihood ratio statistic . analyses of data from year 1 were performed in the subset of the intention - to - treat ( itt ) population of the select trial ( all patients who had been randomized except for 21 patients from one study center who were excluded due to systematic misdosing at that center ) with available data for cd56 nk cells .
analyses of data from year 2 were performed on the subset of the itt population of selection with available data for cd56 nk cells , excluding patients who either were randomized to treatment interruption or had a delay of more than 55 days between the final dose of dac hyp in select and the first dose in selection .
anticoagulated whole blood samples for lymphocyte quantification were collected in acid citrate dextrose vacutainer tubes ( bd biosciences , san jose , ca ) and shipped at ambient temperature for next - day analysis .
fluorescence - activated cell sorting was performed using validated assays at esoterix clinical trials services ( mechlen , belgium ) .
absolute lymphocyte , t , b , and nk cell counts were determined using whole blood samples , multitest antibody cocktail reagents , and trucount technology ( bd biosciences ) .
percentages of cd56 nk cells were determined using the following antibodies ( bd biosciences ) : anti - cd3-percp ( clone sk7 ) , anti - cd16-fitc ( clone nkp15 ) , and anti - cd56-apc ( clone ncam16.2 ) . the cd56 nk cell assay included staining of 100 l of whole blood for 20 minutes with the antibody conjugates described above , followed by the addition of 4 ml whole blood lysing solution ( bd biosciences ) , centrifugation , washing with phosphate - buffered saline containing 2% calf serum , and resuspension in 500 l 1% paraformaldehyde solution .
percentages of cd122 ( clone tu27)positive cells were determined by setting gates for positive staining when compared with levels observed for an isotype control antibody ( clone mopc21 ) using antibodies from bd biosciences . intensity levels of cd122 were determined using mean fluorescence intensity ( mfi ) and converted to mean equivalents of soluble fluorescence using quantibrite phycoerythrin beads ( bd biosciences ) .
a representative cd122 mfi determination for cd3cd16cd56 and cd56 nk cells is shown in figure e-1 at neurology.org/nn .
analyses were performed using winlist analysis software ( verity software house , topsham , me ) .
to assess the relationship between cd56 nk cells and dac hyp efficacy , a prespecified analysis plan was developed to determine whether cd56 nk cells could identify dac hyp - treated patients who would have the largest reductions in ms disease activity .
the following ms - related endpoints were used to measure ms activity : new or newly enlarging t2-hyperintense lesions between weeks 0 and 52 , new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 ( to assess predictive value for lesions known to be forming after measurement of the cd56 nk cells ) , new or newly enlarging t2-hyperintense lesions between weeks 52 and 104 , and the annualized relapse rate ( arr ) . based on analyses of a previous phase 2 trial ,
the primary predictor for analyses of efficacy response was the absolute number of cd56 nk cells measured at the week 4 and week 8 time points . in sensitivity analyses ,
change from baseline and percent change from baseline in the absolute number of cd56 nk cells were also considered predictors of efficacy .
relationships between treatment response and cd56 nk cell measurements made at later time points were also estimated .
for the primary prespecified analysis , negative binomial regression was used to test whether the absolute number of cd56 nk cells at week 4 ( and in a separate model at week 8) was a significant predictor of new or newly enlarging t2-hyperintense lesions in dac hyp treated patients after adjustment for the baseline number of new t2-hyperintense lesions and gadolinium - enhancing lesions . because 2 hypotheses were tested ( week 4 and week 8 counts ) , the predetermined significance value to declare a positive prediction was 0.025 . to describe the relationships and account for potential nonlinearity between cd56 nk cells and new or newly enlarging t2-hyperintense lesions ,
effects by quartile of cd56 nk cells defined at the specified time points were also estimated . unless otherwise stated , p values shown are the likelihood ratio statistic . analyses of data from year 1 were performed in the subset of the intention - to - treat ( itt ) population of the select trial ( all patients who had been randomized except for 21 patients from one study center who were excluded due to systematic misdosing at that center ) with available data for cd56 nk cells .
analyses of data from year 2 were performed on the subset of the itt population of selection with available data for cd56 nk cells , excluding patients who either were randomized to treatment interruption or had a delay of more than 55 days between the final dose of dac hyp in select and the first dose in selection .
among the demographic factors and baseline markers of ms disease activity analyzed at study entry in relationship to cd56 nk cell counts , there was no association at baseline between cd56 nk cell numbers and either markers of ms activity ( e.g. , baseline t2-hyperintense lesions , p = 0.652 ; baseline gadolinium - enhancing lesions , p = 0.649 ; relapses in the 12 months before randomization , p = 0.315 ) or weight ( p = 0.226 ) .
there was a trend for lower baseline cd56 nk cell counts with older age , but it did not reach statistical significance ( p = 0.073 ) . to assess longitudinal stability of cd56 nk cell counts in untreated patients with rrms , we analyzed visit - to - visit correlations in placebo - treated patients at weeks 0 and 52 .
although large variability in cd56 nk cell counts was observed between patients , cd56 nk cell counts for individual patients demonstrated a high degree of longitudinal stability over a 1-year period ( spearman r = 0.758 between baseline and week 52 ; figure 1 , table e-1 ) . in placebo - treated patients , cd56 nk cell counts
were not associated with the number of new or newly enlarging t2-hyperintense lesions at baseline or at any postbaseline time point ( table 1 ) .
p values for association of cd56 nk cell counts with new or newly enlarging t2-hyperintense lesions ( between both weeks 24 and 52 and weeks 0 and 52 ) or with arr in dac hyp treated patients , the median cd56 nk cell count was higher than the median count in the placebo group at all postbaseline time points during the first year of treatment . by week 52 , the numbers of cd56 nk cells in dac hyp treated patients had stabilized and remained relatively constant thereafter ( figure 2 , table e-1 ) . at the dose levels evaluated in the select trial , there was no evidence of a dose - dependent effect , as the median cd56 nk cell count was similar between the dac hyp 150-mg and 300-mg groups at all time points . by week 52 , cd56 nk cell counts in dac hyp treated patients were approximately 5-fold higher than at baseline ( median 4.9x increase ; interquartile range [ iqr ] 2.68.8x ) .
as a percentage of total lymphocytes , the number of cd56 nk cells increased from a median of 0.6% ( iqr 0.4%0.9% ) at baseline to a median of 3.6% ( iqr 2.2%5.7% ) at week 52 . in patients switched to dac hyp at week 52 , the initial expansion of cd56 nk cells resembled that observed in the continuous treatment group , and numbers at week 104 were similar between those groups ( figure 2 )
data are medians with 25th and 75th percentiles in samples from dac hyp treated patients over 2 years ( pooled 150-mg and 300-mg groups ) or patients switched from placebo to dac hyp ( pooled 150-mg and 300-mg groups ) . at the patient level , relative differences in cd56 nk cell counts between dac hyp treated patients were relatively stable longitudinally even while the absolute numbers of these cells were expanding ( baseline week 52 cd56 nk cell counts : spearman r = 0.506 , p < 0.001 ; week 4week 52 cd56 nk cell counts : spearman r = 0.511 , p < 0.001 ) .
when expansion of cd56 nk cells was defined by the upper 95% confidence interval ( ci ) for the maximum increase from baseline over 1 year in the placebo - treated patients ( an increase of 19 cd56 nk cells/l ) , 90% of dac hyp treated patients could be classified as expanders .
in contrast to placebo - treated patients , higher numbers of cd56 nk cells measured at week 4 predicted fewer new or newly enlarging t2-hyperintense lesions between weeks 0 and 52 in dac hyp treated patients ( p < 0.001 ) . when considering all postbaseline time points between weeks 4 and 24 , cd56 nk cell counts at week 4 had the strongest predictive association with new or newly enlarging t2-hyperintense lesions occurring between weeks 24 and 52 ( table 1 ) . in sensitivity analyses using the predicted number of cd56 nk cells ( from a random - effects model ) ,
cd56 nk cell counts predicted new or newly enlarging t2-hyperintense lesions ( weeks 052 and weeks 2452 ) at all time points .
a similar directional relationship was present for prediction of the arr , but it was not statistically significant ( table 1 ) .
quartile analysis was used to describe the magnitude of the statistical associations . among patients treated with dac hyp during the first year ,
those patients in the highest quartile of cd56 nk cell counts at week 8 had 62% fewer new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 than dac hyp treated patients who were in the lowest quartile of cd56 nk cell counts at week 8 ( p < 0.001 ; figure 3a ) .
analyses of cd56 nk cell numbers at other time points between weeks 4 and 24 yielded similar results as at week 8 ( table e-2 and data not shown ) .
similar trends were seen across quartiles of dac hyp treated patients using the arr as the outcome measure , but the results were not statistically significant ( figure 3b ) .
all data are mean and upper 95% confidence interval . ( a ) numbers of new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 in daclizumab high - yield process ( dac hyp)-treated patients and placebo - treated patients .
( b ) annualized relapse rates ( arrs ) between weeks 0 and 52 in dac hyp treated patients and placebo - treated patients .
( c ) numbers of new or newly enlarging t2-hyperintense lesions between weeks 52 and 104 in dac hyp treated patients .
data were estimated from a negative binomial regression model adjusted for baseline t2-hyperintense lesions , baseline gadolinium - enhancing lesions , and week 8 cd56 quartile .
in contrast to the associations between cd56 nk cell counts and t2-hyperintense lesions seen in the first year of dac hyp therapy , there was no evidence that the differences in cd56 nk cell counts early during dac hyp treatment had longer - term predictive value . during the second year of dac hyp treatment , quartiles of cd56 nk cell counts at week 4 or week 8 showed no trend to indicate an association with the numbers of new or newly enlarging t2-hyperintense lesions between weeks 72 and 104 ( week 8 , p = 0.913 for trend ; figure 3c ) . similarly ,
no trend was apparent for the association of quartiles of cd56 nk cell counts with the arr ( quartile 1 : 0.06 vs quartile 4 : 0.09 ; p = 0.938 for trend ; data not shown ) . despite the stronger mri - defined response during the first year of treatment among dac hyp treated patients in the highest quartile of cd56 nk cell counts , patients in the lowest quartile of cd56 nk cell counts still showed evidence of a robust treatment effect from dac hyp when compared with the placebo group .
dac hyp treated patients in the lowest quartile of cd56 nk cell counts at week 8 showed a 63% reduction in new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 compared with placebo - treated patients ( p < 0.0001 ) , as opposed to an 86% reduction in dac hyp treated patients in the highest quartile at week 8 ( p < 0.0001 ; figure 3a ) .
even among the 10% ( n = 37 ) of dac hyp treated patients who could not be classified as having more expanded cd56 nk cells than the placebo group , there was still evidence of treatment efficacy , as there was a 54.2% reduction ( 95% ci 20.3%73.7% ) in the number of new t2-hyperintense lesions over 52 weeks compared with the placebo group ( p = 0.010 ) .
to assess longitudinal stability of cd56 nk cell counts in untreated patients with rrms , we analyzed visit - to - visit correlations in placebo - treated patients at weeks 0 and 52 .
although large variability in cd56 nk cell counts was observed between patients , cd56 nk cell counts for individual patients demonstrated a high degree of longitudinal stability over a 1-year period ( spearman r = 0.758 between baseline and week 52 ; figure 1 , table e-1 ) . in placebo - treated patients , cd56 nk cell counts
were not associated with the number of new or newly enlarging t2-hyperintense lesions at baseline or at any postbaseline time point ( table 1 ) .
p values for association of cd56 nk cell counts with new or newly enlarging t2-hyperintense lesions ( between both weeks 24 and 52 and weeks 0 and 52 ) or with arr
in dac hyp treated patients , the median cd56 nk cell count was higher than the median count in the placebo group at all postbaseline time points during the first year of treatment . by week 52 , the numbers of cd56 nk cells in dac hyp treated patients had stabilized and remained relatively constant thereafter ( figure 2 , table e-1 ) . at the dose levels evaluated in the select trial , there was no evidence of a dose - dependent effect , as the median cd56 nk cell count was similar between the dac hyp 150-mg and 300-mg groups at all time points . by week 52 , cd56 nk cell counts in dac hyp treated patients were approximately 5-fold higher than at baseline ( median 4.9x increase ; interquartile range [ iqr ] 2.68.8x ) .
as a percentage of total lymphocytes , the number of cd56 nk cells increased from a median of 0.6% ( iqr 0.4%0.9% ) at baseline to a median of 3.6% ( iqr 2.2%5.7% ) at week 52 . in patients switched to dac hyp at week 52 , the initial expansion of cd56 nk cells resembled
that observed in the continuous treatment group , and numbers at week 104 were similar between those groups ( figure 2 ) .
data are medians with 25th and 75th percentiles in samples from dac hyp treated patients over 2 years ( pooled 150-mg and 300-mg groups ) or patients switched from placebo to dac hyp ( pooled 150-mg and 300-mg groups ) . at the patient level , relative differences in cd56 nk cell counts between dac hyp treated patients were relatively stable longitudinally even while the absolute numbers of these cells were expanding ( baseline week 52 cd56 nk cell counts : spearman r = 0.506 , p < 0.001 ; week 4week 52 cd56 nk cell counts : spearman r = 0.511 , p < 0.001 ) . when expansion of cd56 nk cells was defined by the upper 95% confidence interval ( ci ) for the maximum increase from baseline over 1 year in the placebo - treated patients ( an increase of 19 cd56 nk cells/l ) , 90% of dac hyp treated patients could be classified as expanders .
in contrast to placebo - treated patients , higher numbers of cd56 nk cells measured at week 4 predicted fewer new or newly enlarging t2-hyperintense lesions between weeks 0 and 52 in dac hyp treated patients ( p < 0.001 ) .
when considering all postbaseline time points between weeks 4 and 24 , cd56 nk cell counts at week 4 had the strongest predictive association with new or newly enlarging t2-hyperintense lesions occurring between weeks 24 and 52 ( table 1 ) . in sensitivity analyses using the predicted number of cd56 nk cells ( from a random - effects model ) ,
cd56 nk cell counts predicted new or newly enlarging t2-hyperintense lesions ( weeks 052 and weeks 2452 ) at all time points .
a similar directional relationship was present for prediction of the arr , but it was not statistically significant ( table 1 ) . quartile analysis was used to describe the magnitude of the statistical associations . among patients treated with dac hyp during the first year ,
those patients in the highest quartile of cd56 nk cell counts at week 8 had 62% fewer new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 than dac hyp treated patients who were in the lowest quartile of cd56 nk cell counts at week 8 ( p < 0.001 ; figure 3a ) .
analyses of cd56 nk cell numbers at other time points between weeks 4 and 24 yielded similar results as at week 8 ( table e-2 and data not shown ) .
similar trends were seen across quartiles of dac hyp treated patients using the arr as the outcome measure , but the results were not statistically significant ( figure 3b ) .
( a ) numbers of new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 in daclizumab high - yield process ( dac hyp)-treated patients and placebo - treated patients .
( b ) annualized relapse rates ( arrs ) between weeks 0 and 52 in dac hyp treated patients and placebo - treated patients .
( c ) numbers of new or newly enlarging t2-hyperintense lesions between weeks 52 and 104 in dac hyp treated patients .
data were estimated from a negative binomial regression model adjusted for baseline t2-hyperintense lesions , baseline gadolinium - enhancing lesions , and week 8 cd56 quartile .
in contrast to the associations between cd56 nk cell counts and t2-hyperintense lesions seen in the first year of dac hyp therapy , there was no evidence that the differences in cd56 nk cell counts early during dac hyp treatment had longer - term predictive value . during the second year of dac hyp treatment , quartiles of cd56 nk cell counts at week 4 or week 8 showed no trend to indicate an association with the numbers of new or newly enlarging t2-hyperintense lesions between weeks 72 and 104 ( week 8 , p = 0.913 for trend ; figure 3c ) .
similarly , no trend was apparent for the association of quartiles of cd56 nk cell counts with the arr ( quartile 1 : 0.06 vs quartile 4 : 0.09 ; p = 0.938 for trend ; data not shown ) . despite the stronger mri - defined response during the first year of treatment among dac hyp treated patients in the highest quartile of cd56 nk cell counts , patients in the lowest quartile of cd56 nk cell counts still showed evidence of a robust treatment effect from dac hyp when compared with the placebo group .
dac hyp treated patients in the lowest quartile of cd56 nk cell counts at week 8 showed a 63% reduction in new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 compared with placebo - treated patients ( p < 0.0001 ) , as opposed to an 86% reduction in dac hyp treated patients in the highest quartile at week 8 ( p < 0.0001 ; figure 3a ) .
even among the 10% ( n = 37 ) of dac hyp treated patients who could not be classified as having more expanded cd56 nk cells than the placebo group , there was still evidence of treatment efficacy , as there was a 54.2% reduction ( 95% ci 20.3%73.7% ) in the number of new t2-hyperintense lesions over 52 weeks compared with the placebo group ( p = 0.010 ) .
these analyses provide an independent prospective assessment of a potential treatment response biomarker for rrms within the setting of a randomized placebo - controlled trial .
consistent with smaller published studies examining the relationship between cd56 nk cell counts and dac response , we observed a statistically significant inverse relationship between cd56 nk cell counts measured after dac hyp treatment and numbers of new or newly enlarging t2-hyperintense lesions developing post treatment .
although these differences in mri lesion formation were potentially meaningful , dac hyp treated patients with the lowest cd56 nk cell counts and those whose cd56 nk cells did not expand more than placebo - treated patients still had substantially fewer new t2-hyperintense lesions than placebo - treated patients .
furthermore , cd56 nk cell counts measured early during the dac hyp treatment period were not predictive of ms activity after the first year , a finding that may be related to the dynamic process of expansion of these cells over time .
finally , the current study provides a large longitudinal dataset indicating that cd56 nk cell counts are not related to the natural history of ms in untreated patients with rrms .
the current findings support an important role of cd56 nk cells in the therapeutic effects of dac in ms .
for example , depletion of nk cells exacerbates symptoms of experimental autoimmune encephalitis in mice , whereas treatment with cd122-directing anti - il-2 antibody ( to stimulate nk cells in a manner similar to dac in humans ) attenuates the severity of symptoms in this murine disease model .
this may reflect a direct cytotoxic effect of nk cells on autoantigen - specific encephalitic t cells . in humans , reduced nk cytolytic activity
has been observed in patients with ms , and reductions in nk cell function have been reported to accompany the development of large asymptomatic lesions .
the expansion of cd56 nk cells during dac hyp treatment is believed to be due to increased il-2 bioavailability after cd25 blockade and the high concentration of intermediate - affinity il-2 receptors expressed on these cells .
our results indicate that this expansion occurs most rapidly during the first 6 months of treatment and then reaches a new equilibrium approximately 12 months after initiation of treatment .
the temporal dynamics of the cd56 nk cell expansion , establishment of new equilibrium of the expanded nk cells , and their contraction after dac hyp withdrawal are consistent with in vitro modeling indicating that cd56 nk cells compete with t cells for limited il-2 .
although a correlation between cd56 nk cell numbers and ms activity was seen in dac - treated and not placebo - treated patients , this difference may have been due to changes in cd56 nk cell effector function induced by dac treatment that affect the ability of these cells to influence ms - related inflammation . however , given the treatment effects observed in patients without expansion of cd56 nk cells , the current study results are consistent with the hypothesis that other immunologic effects observed with dac , such as the reduction in lymphoid tissue inducer cells , may be important to the therapeutic effects of dac hyp .
there are limitations to the current analysis . because the cd56 nk cell counts predictive of year 1 outcomes were measured after randomization , it is possible that as - yet - unidentified baseline differences in ms prognosis might have contributed to differences in outcomes among dac hyp treated patients .
however , the finding that cd56 nk cell counts were not predictive of outcome in the placebo group during the first year supports the interpretation that cd56 nk cells are not a marker of ms prognosis overall but rather reflect biologically relevant variability in dac hyp treatment response .
given that cd56 nk cell expansion is a dynamic process over time , there are multiple potential ways to assess its predictive utility ( e.g. , measurements at different time points , relative changes vs absolute counts , etc . ) .
in this analysis , the absolute numbers of cd56 nk cells measured at early time points after treatment initiation were the prespecified predictors of response based on findings from previous studies and their potential for having greater clinical utility than measurements made at later time points .
additional analyses may identify other longitudinally defined predictors related to changes in cd56 nk cells that could be informative of dac hyp response over longer time periods .
finally , the results of these analyses and the relationship of cd56 nk cell numbers to clinical outcomes should be confirmed prospectively in larger datasets with sufficient power to provide definitive evidence .
personalizing treatment decisions in rrms based on biologic differences in disease and/or treatment response requires independent validation of a clinically meaningful relationship between biomarker(s ) and outcomes .
while this analysis confirms that individual variability in cd56 nk cell counts after treatment with dac hyp contains some prognostic information , their relationship to dac hyp response is complex and does not appear to translate directly into simple classifications such as responders and nonresponders . nevertheless , these findings support the biological relevance of these cells to the effects of dac hyp on ms , and additional phenotypic characterization of cd56 nk cells should be considered as a way to better understand individual variation in the treatment response to dac hyp .
j. elkins , j. sheridan , l. amaravadi , k. riester , k. selmaj , b. bielekova , and g. giovannoni participated in the conception / design of the study and analysis / interpretation of the data , revised the manuscript , and approved the final version .
biogen idec and abbvie biotherapeutics inc . provided funding for editorial support in the development of this manuscript .
e. parr wrote the first draft of the manuscript with direction from coauthors and approved the final version .
the authors had full editorial control of the manuscript and provided their final approval of all content .
l. amaravadi has received travel funding from the american association of pharmaceutical scientists , holds a patent for evaluating immune responses to a therapeutic agent , and is an employee of biogen idec .
k. selmaj is on the scientific advisory board for genzyme , biogen idec , novartis , synthon , and roche ; has received funding from biogen idec , novartis , teva , bayer , and roche ; is on the editorial board for journal of neuroimmunology ; is a consultant for genzyme , novartis , biogen idec , roche , synthon , and merck serono ; and is on the speakers ' bureau for novartis , merck serono , biogen idec , bayer , and genzyme .
b. bielekova holds nih patents related to daclizumab and receives royalty payments from nih and receives research support from national institute of neurological disorders and stroke , biogen , abbvie , and santhera pharmaceuticals .
g. giovannoni is on the scientific advisory board for biogen idec , fiveprime , genzyme , gw pharma , ironwood , merck serono , novartis , roche , sanofi - aventis , synthon bv , teva , vertex pharmaceuticals , abbvie , and canbex ; receives speaker honoraria from biogen idec , genzyme , gw pharma , merck serono , novartis , roche , and teva ; is on the editorial board for multiple sclerosis and related disorders ; has consulted for biogen idec , fiveprime , genzyme , gw pharma , ironwood , merck serono , novartis , roche , sanofi - aventis , synthon bv , teva , vertex pharmaceuticals , abbvie , and canbex ; is on the speakers ' bureau for novartis and teva ; and receives research support from genzyme and merck . | objective : to assess the relationship between cd56bright natural killer ( nk ) cells and multiple sclerosis ( ms ) disease activity in patients with relapsing - remitting ms treated with daclizumab high - yield process ( dac hyp).methods : data were from patients enrolled in a 52-week randomized , double - blind , placebo - controlled study of dac hyp and its extension study .
assessments included relationships of cd56bright nk cell numbers ( identified using fluorescence - activated cell sorting ) at weeks 4 and 8 with the numbers of new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 and the annualized relapse rate.results:in dac hyp treated patients but not placebo - treated patients , the numbers of cd56bright nk cells increased over 52 weeks of treatment , and their numbers at weeks 4 and 8 predicted the number of new or newly enlarging t2-hyperintense lesions between weeks 24 and 52 of treatment ( p 0.005 for each comparison ) .
similar but nonsignificant trends were observed between cd56bright nk cell counts and the annualized relapse rate in dac hyp treated patients .
dac hyp treated patients who showed lower levels of expansion of cd56bright nk cells still developed fewer new or newly enlarging t2-hyperintense lesions than placebo - treated patients during the first year of treatment.conclusions:cd56bright nk cells appear to mediate some of the treatment - related effects of dac hyp , but their numbers do not account for the full effect of dac hyp on ms - related outcomes . |
central pontine myelinolysis ( cpm ) is a demyelinating condition affecting the pons characterized by an acute progressive quadriplegia , dysarthria , dysphagia , and alterations of consciousness .
pathologic features include prominent demyelination in the central pons with sparing of axons and neurons .
this condition is usually associated with systemic disorders such as hyponatremia , chronic alcoholism , liver failure , severe burns , malignant neoplasms , hemorrhagic pancreatitis , hemodialysis , and sepsis . in about 10% cases ,
cpm is associated with extrapontine myelinolysis ( epm ) leading to the appearance of parkinsonian symptoms such as rigidity of limbs , bradykinesia , tremors , and decreased blinking .
studies on cpm have mainly focussed on its etiology , neurological manifestations , radiological appearance , and outcome.[35 ] there is limited literature available on neuropsychiatric complications of central pontine / extrapontine myelinolysis ( cpem ) . some of the behavioral manifestations that have been described so far are - personality change , inappropriate affect , emotional lability or incontinence , disinhibition , poor judgment , and delirium .
a few reports have also described occurrence of catatonic syndrome as a rare manifestation due to epm.[810 ] however , there are limited reports of psychosis in patients with cpem .
we have described a case of cpem with psychosis as a complication which recovered completely with treatment given for short duration using low dose atypical antipsychotic ( quetiapine ) .
a 53-year - old male presented to emergency department with complaints of acute onset , generalized rigidity and tremors of all limbs , difficulty speaking and swallowing along with slowness of movements , masked facies , and decreased blinking .
he was recently discharged from medical icu after being managed for episodes of vomiting and decreased food intake associated with confusion , lethargy , disorientation to time and place .
his serum na was found to be very low ( 102 meq / ml ) .
he was also put on tab levetiracetam 1000 mg for seizure prophylaxis . at the time of discharge after 6 days of hospitalization
his hyponatremia had been corrected rapidly ( by 13 meq / ml in initial 8 h ) .
he also underwent magnetic resonance imaging ( mri ) of the brain which did not reveal any abnormality except for chronic ischemic changes in the bilateral centrum semiovale .
detailed assessment did not reveal psychiatric symptoms or any previous psychiatric illness nor was there any history of substance abuse .
there was no family history of any psychiatric illness as well . from the history and review of medical records ,
neuroleptic malignant syndrome was ruled out as patient was not subjected to any antipsychotics in previous hospital as per records .
he was started on oral trihexyphenidyl ( centrally acting anticholinergic ) 1 mg tds along with supportive treatment .
mri brain was repeated on day 4 of admission ( after 5 days of onset of symptoms ) which showed pontine hyperintensities and bilateral basal ganglia ( caudate and putamen ) hyperintensities on t2w1 and flair sequences confirming the diagnosis of cpem ( secondary to rapid correction of hyponatremia ) [ figures 1 and 2 ] .
pontine hyperintensities and bilateral basal ganglia ( caudate and putamen ) hyperintensities on t2w1 and flair sequences bilateral basal ganglia ( caudate and putamen ) hyperintensities on t2w1 and flair sequences confirming the diagnosis of central pontine / extrapontine myelinolysis patient 's symptoms started improving dramatically after the treatment was started .
hormone supplementation was started following reports of low adrinocorticotrophic hormone ( acth ) , thyroid stimulating hormone ( tsh ) , follicle stimulating hormone ( fsh ) and leutinising hormone ( lh ) levels .
after 3 days of hospitalization , he developed behavioral symptoms for which psychiatric consultation was again taken .
he was found to have disturbed sleep , irritability , suspiciousness toward a fellow patients in the ward and aggression toward treating resident doctors .
he developed delusion of persecution and reference , claiming that a female patient on neighboring bed was passing insulting remarks to him indirectly when talking to others and was also teasing him through her gestures .
he was started on quetiapine 50 mg and dose was increased to 100 mg over a period of 3 days .
he tolerated it well and his psychotic symptoms started improving over a period of 4 weeks .
he was discharged from the ward after his extrapyramidal symptoms got completely resolved . during follow - up visits
, trihexyphenidyl was tapered off over next 1 month and quetiapine was gradually tapered off over next 6 months without any new symptoms .
in this case , diagnosis of cpem could be established both clinically ( presence of dysphagia and dysarthria suggested pontine involvement and presence of generalized rigidity , bradykinesia , tremors , and related parkinsonian symptoms indicated extrapontine lesion ) as well as radiologically .
we did consider the possibility of levetiracetam - induced psychosis but ruled it out given the fact that this drug was used in a low dose ( 1000 mg / day ; approximately 166 mg / kg ) and patient 's psychotic symptoms subsided with quetiapine without the need to stop levetiracetam .
however , it was used at very low dose in the present case ( 3 mg / day ) . additionally , the nature of trihexyphenidyl psychosis , as described in literature , is toxic psychosis .
thus , the psychotic symptoms that appeared could be attributed to brain lesions that are associated with cpem .
this case highlights that psychotic symptoms could occur as a complication of cpem and can be managed effectively .
these features subside shortly with resolution of neurological signs and symptoms associated with the brain lesions .
the case in study hints at the possible role of basal ganglia in etiopathogenesis of psychotic symptoms given the fact that huntington , wilson , and parkinson disease , which all have basal ganglia involvement are also associated with psychotic symptoms , at times .
the present case also reiterates the fact that in cpem , the outcome is not always dismal . additionally ,
correction of hyponatremia should be paced appropriately and should be limited to about 25 mmol / l during the initial 24 - 48 h. | central pontine myelinolysis is a demyelinating condition affecting the pons characterized by an acute progressive quadriplegia , dysarthria , dysphagia , and alterations of consciousness .
pathologic features include prominent demyelination in the central pons with sparing of axons and neurons .
this condition is usually associated with systemic disorders such as hyponatremia , chronic alcoholism , liver failure , severe burns , malignant neoplasms , hemorrhagic pancreatitis , hemodialysis , and sepsis .
there are limited reports of psychosis in patients with central pontine / extrapontine myelinolysis ( cpem ) .
we have described a case of cpem with psychosis as a complication which recovered completely with treatment given for short duration using low dose atypical antipsychotic ( quetiapine ) .
we also discuss etiopathology and clinical outcome of psychosis in this rare neurological disorder . |
perilymphatic fistula ( plf ) is an abnormal communication between the middle ear and the perilymphatic space , mostly due to laceration of the oval and/or round window , or congenital defects in the area of fissula ante fenestram or fossula post fenestram .
plf may be caused by external injury such as head trauma , barotrauma , physical exertion such as straining , nose blowing , sneezing , among others .
some diseases such as mondini malformation , large cochlear aqueduct syndrome , and middle ear abnormalities are linked to plf , among others . when no obvious reasons for plf exists , it is called spontaneous .
this does not mean that spontaneous plf would occur without trauma , but the trauma may be so minute that it is not recognised .
idiopathic plf has been implicated as one of the etiological factors associated with idiopathic sudden or fluctuating sensorineural hearing loss and vertigo , which occurs in defined diseases such as meniere 's disease , otosclerosis , and sudden deafness , among others .
so far , there are no objective tests that can exclude or verify a plf .
clinically , plf is suspected when the patient complains of the tullio 's phenomenon [ 7 , 8 ] .
most commonly the hennebert 's sign is evaluated , in which test the posture and eye movements are inspected when the ear canal pressure is slowly increased or decreased .
the test has been modified and performed with impedance tympanometry in eng , or on posturography [ 1012 ] .
. early diagnosis may preserve the hearing and prevent vestibular function loss of patients with plf .
nevertheless , direct inspection of the middle ear by elevating the tympanomeatal flap may lead to erroneous conclusions when plf is suspected .
poe et al . demonstrated that middle ear processes can be imaged endoscopically by introducing a small - diameter rigid endoscope through the tympanic membrane .
the windows and mucosal membranes can be inspected to exclude perilymphatic leaks [ 14 , 16 ] .
the purpose of the present study was to evaluate various vestibular and cochlear disorders in order to determine the presence of plf .
we also wanted to study the relevance of sound and pressure loading on posturography in assessing of plf .
we investigated altogether 264 subjects out of patients with various inner ear diseases clinically susceptible to plf .
for this study , we studied the middle ear by transtympanic endoscopy and by evaluation of tullio 's phenomenon .
the age of the subjects varied from 22 to 80 years ( mean age 48 years ) .
audiometry was done in all cases before examination , and one month after tympanoscopy . in connection to tympanoscopy
, we evaluated the electrocochleography by using round window electrodes and also cochlear blood flow by using a laser doppler flux meter placed on the promontorium .
the investigation started with evaluation of the vestibule - spinal responses when loading the ear with low - frequency sound ( lfs ) .
the low - frequency sound ( lfs ) test was used to evoke abnormal body sway which was measured on posturography .
the lfs was generated with a piston type air sampling pump ( msa , usa ) , which has an adjustable stroke frequency ranging from 6 to 80 hz . the frequencies used in the test were 25 , 50 , and 63 hz at a sound pressure level of 130 , 132 , and 135 db , respectively .
a part of the tympanic membrane ( about a 1 mm wide area extending from the annulus to the umbo ) was anaesthetized with 90% phenol solution . after a radial paracentesis of about 5 mm in length we had a bloodless view into the posterior tympanic cavity .
an endoscope ( 1.7 mm in diameter , 120 mm in length ) with an angle of 5 deg ( wolff gmbh , germany ) was inserted into the tympanic cavity .
thereafter , the round window was examined . a forceful valsalva maneuver and the queckerstedt test
the 25 degree tympanoscope was introduced and the oval window area was examined paying special attention to the fissula ante fenestram . the valsalva maneuver and
the tympanic cavity could be visualized in all except seven subjects . in one subject who had undergone stapes surgery ,
scar tissue formation was so prominent that the oval window and prosthesis area could not be identified .
in one subject , the anatomy of the middle ear was changed so that the oval window was situated more inferior than usual and the bone rim of the round window niche was flattened , obstructing vision through the window . in two patients , the tympanic cavity could not be visualized because of retraction of the tympanic membrane . in three subjects , the exostoses and bleeding from the bony canal hindered the inspection .
in most subjects , there was folding in the round window that occluded direct viewing of the window membrane . in about 35% of the cases , we could identify the whole round window membrane .
usually the best way to visualize the round window was to examine it with a 5 deg endoscope .
although the angle of the endoscope was not optimal , the best area visualized by this scope was the round window area .
sometimes the round window could be examined with a 25 degree scope , but usually the round window niche and hypotympanic space were too narrow to allow insertion of the 25 degree scope into the area .
the visibility in the posterior part of the stapes footplate was limited , and especially the posterior crus - facial nerve rim limited visual inspection .
inspection of the patient in a recumbent position with head down ( trendelenburg position ) was used to provoke an increase in the perilymph flow through an eventual plf .
these examinations were carried out twice , once for examination of the round window and once for that of the oval window .
it was covered with fibrinous membrane and caused by a diving accident . in one case , there was abnormal mucosal shining in the round window niche and oval window area that could signify a plf .
three cases with abnormal shining around the round window probably exhibited reactive changes to tympanoscopy . in two cases , we applied tissue glue to the area , but the symptom was not relieved .
figure 1 shows the outcome of the fistula test at different stimulation frequencies in four categories of the patients . in the analysis of variance ,
thus , 24 of the 149 patients with meniere 's disease had abnormal lfs responses .
the corresponding numbers for vestibulopathy were 5 out of 53 , cochleopathy 3 out of 32 , sudden deafness 2 out of 14 .
in those 34 patients in whom the lfs stimulation provoked unsteadiness in posturography analogous to the tullio 's phenomenon , no presence of plf in tympanoscopy could be verified .
all endoscopies were well tolerated by the patients , except in 3 cases , in whom the exostoses of the bony canal caused difficulties with bleeding and discomfort so that the examination has to be interrupted .
these patients found the procedure painful when the endoscope was in contact with the skin of the ear canal .
all myringotomies were fully healed at the time of followup . in one patient , healing of
five patients experienced a reduction in their ability to taste , but the symptom subsided 2 to 4 weeks after endoscopy .
endoscopy has had a rather limited success in otology when compared with the advances in endoscopy techniques in rhinology or other disciplines of surgery .
otoendoscopy was introduced by nomura and takahashi et al . for documentation purposes .
in otosurgery , it has been proposed for second look mastoidectomy , in middle ear surgery , in the verification of middle ear recesses in conjunction with cholesteatoma surgery , [ 21 , 22 ] in hearing preservation surgery of vestibular schwannomas , and in inspection of the tympanic cavity .
the use of endoscopy in the detection of plf has been promoted by poe et al .
they demonstrated that , after the use of local anesthetics for elevation of a tympanomeatal flap , oozing of exudate occurred in the middle ear , leading to a false diagnosis of plf in a patient who had normal structures in tympanoscopy [ 15 , 24 ] .
furthermore , they demonstrated that in three cases with experimental plf , the findings could be verified in middle ear microscopy as well as in tympanoscopy [ 15 , 16 ] .
provocation maneuvers , such as queckerstedt 's manoeuvre and the forced valsalva test are easier to perform in tympanoscopy than in otomicrosopy .
nevertheless , it has been suggested that the accuracy of endoscopy is not sufficient for detecting minute
this holds for all present examination methods , where nonopen fistulas can not be verified .
we demonstrated in guinea pig with artificial fistula that the optic resolution was satisfactory whereas on the video screen resolution was not satisfactory ( unpublished observation ) .
ogawa et al . demonstrated that , in one patient finally diagnosed with idiopathic plf , tympanoscopy could not reveal the fistula . in spite of this event ,
is more accurate : the middle ear mucosa is elevated and coagulated with a ktp laser .
so far , without any relevant objective test for plf , it is difficult to know which patient should be operated on .
hitherto tympanoscopy seemed to be the golden rule for the detection of plf on which all diagnostic tests or operative findings should be benchmark .
tympanoscopy is an ambulatory procedure with very few complications and it seems to have high diagnostic accuracy for plf .
one of the most disturbing things in assessing diagnosis of plf is that there are no characteristic signs , symptoms , or a golden rule for verifying of plf .
, the symptoms of plf coincide with those present in a majority of cases with meniere 's disease .
the observation of endolympahic hydrops in cases with plf may in fact be the reason for meniere - like symptoms that may be secondary to plf .
fluorescein applied intrathecally may assist to reveal a fistula better than fluorescein applied intravenously as this has not proved to be reliable for the detection of plf . during surgery , for the detection of plf mineral , oil droplets have recently been advocated to trap the perilymph and to visualize the leak .
also , beta2-transferrin has been advocated [ 30 , 31 ] a two - dimensional polyacrylamide gel electrophoresis has been studied in the verification of a plf .
it is possible that in these instances flexible endoscopes can be utilized [ 15 , 33 ] .
there is general consensus that a trauma to the ear , either explosive or implosive , is the most important factor in the etiology of plf .
it has been debated whether a disease called idiopathic or spontaneous plf actually exists .
shea criticised the occurrence of idiopathic plf and could not verify an idiopathic plf in his large series of otologic patients . in a randomised , retrospective study ,
these were sudden or fluctuate hearing loss or slowly progressive hearing loss and the vestibular symptoms were equivalent to positional vertigo or constant disequilibrium .
a cornerstone in the diagnosis was a positive fistula test ( hennebert 's sign or symptom or equivalent ) . with blind assessment of the temporal bones
, they could verify with high specificity ( 91% ) and moderate sensitivity ( 59% ) a plf .
it was noteworthy that a majority of the patients had a symptom entity equivalent to meniere 's disease .
their clinical approach was much the same as ours , in which we examined with tympanoscopy all those patients with unconfirmed diagnosis having a high suspicion of plf during a four - year course .
we were able to confirm the presence of one plf in the round window after a diving accident .
in three additional cases , abnormal mucosal shining with slight oozing was observed in the fossula post fenestra area .
these cases were considered possible candidates for a plf , but closer examination and absence of fluid oozing during provocation prompted rejection of the diagnosis of plf .
the slow accumulation of fluid was probably due to mechanical irritation of the middle ear mucosa .
kohut et al . demonstrated the histopathologic findings of a temporal bone in idiopathic plf , as fissure tracts in fissula ante fenestram which contained loose connective tissue , and which are composed of fibroblasts that are not densely packed , and between them are large intercellular spaces .
they also reported that the submucosa of the fissure of the round window niche was composed of dense collagen next to bone , and extended over the orifice , with components extending into the lumen of the fissure .
it remains to be documented whether these tiny openings are able to cause the various , prominent symptoms in the patients , and also by which mechanism the symptoms arise .
risks associated with the tympanoscopy procedure are minimal , and can be as slight as inconvenience caused by dizziness due to thermal heating of the lateral semicircular canal or may result in postoperative infection , lesion to chorda tympani , or permanent ear drum perforation .
the postoperative infection rate was about 2% but with a careful technique it can be reduced , by avoiding the endoscope from contacting the ear canal wall .
subjects with a history of chronic middle ear infection with thin secondary tympanic membrane were the most susceptible to infection in the present study .
perhaps patients with a large secondary membrane should not be examined by endoscopy through the tympanic membrane .
five patients had a temporary reduction in taste that was probably linked to the phenol used for the anesthesia of the ear drum .
other alternative topical anesthetics are tetracaine base powder dissolved in isopropyl alcohol or racemised lidocain - prilocain emulsion ( emla , astra , sweden ) applied for 15 minutes to the ear drum , or use of iontophoresis with 4% lidocaine solution with 1 : 1000 epinephrine .
these anesthetics may lack effect on the chorda , but do not provide as bloodless entry into the tympanic cavity as does phenol .
furthermore , by using phenol , only the paracentesis streak must be anesthetized , not the whole ear drums , as with the other drugs .
we are aware that permanent perforations do occur after tympanoscopy , but the probability seems to be rather low , since in our 264 cases no permanent perforation has occurred .
the vestibulespinal responses during lfs stimulation in the present study are similar to the vestibular responses found in tullio 's phenomenon . in tullio 's phenomenon ,
the sound pressure induces electrical potentials equivalent to cochlear microphonics from different receptors of the vestibular labyrinth .
we could not relate the tullio 's phenomenon to any pathology except endolymphatic hydrops , that could provoke tullio 's phenomenon with a similar mechanism as the hennebert 's sign , that is , anatomical connections between utriculus and the stapedial footplate .
nevertheless , minor et al . observed tullio 's phenomenon in a patient with a dehiscence of the superior semicircular canal , first observed in computerized tomography and later verified in surgery .
in the present stimulation mode , the pump also generated an underpressure in the ear canal that was pulling the ear drum and stapes laterally . in this respect
hennebert observed that an underpressure and overpressure of the ear canal is able to cause nystagmus and instability in patients who have luetic softening of the bony capsule .
both tullio 's phenomenon and the hennebert sign were originally thought to be an indication of a fistula in the bony labyrinth .
later , it was concluded that also patients with plf often show a positive hennebert 's sign , and the test has at present been commonly advocated to detect plf [ 6 , 8 ] . by using fluctuate air pressure loading in the outer ear canal , wall and casselbrant demonstrated in animal model that , in plf , pressure caused eye deviations and nystagmus .
the number of positive test results in the lfs loading test on posturography in patients with meniere 's disease or vestibulopathy was unacceptably high , although the magnitude of the positive responses was significantly lower than in plf patients .
. performed by posturography a pressure loading test , and compared the outcome of the test in surgery conducted by two teams .
the sensitivity between the teams varied from 53 to 100% and specificity from 56 to 89% for the verification of plf .
black et al . used posturography and reported a high hit rate of positive fistula tests ( 97% ) in the vestibulospinal responses of 64 patients .
even with the present plf method , the lack of specificity may not totally disqualify the value of the test .
the accuracy of the fistula test varies even more in most of the tests used to detect a plf .
supance and bluestone reported a positive fistula test in 54% of their surgically confirmed fistula cases .
healy et al . reported positive fistula test rate in 37% of their surgically confirmed cases .
seltzer and mccabe reported a positive fistula test rate of 36% among 91 surgically confirmed fistulas .
finally , we found that tullio 's phenomenon test was not specific for plf , thus tympanocopy is recommended as the first choice to perform when the plf is suspected , especially during the acute phase of the disease before the fibirinous reaction can occur . | this study was designed to verify an eventual perilymphatic fistula ( plf ) in 264 patients with sensorineural hearing loss ( snhl ) and/or vertigo .
the patients were exposed to a low - frequency sound stimulation ( lfs ) on posturography to objectively test tullio 's phenomenon and hennebert 's sign .
endoscopes with 5 degree and 25 degree of visual angle and an outer diameter of 1.7 mm were used .
the round window niche , with its foldings , oval window with stapes superstructure , a part of the facial recess and the area in the fissula ante fenestram were examined and video recorded . in one patient , we endoscopically verified a fistula in the round window membrane ( resulting from a diving accident ) that was covered with a fibrinous layer . in 4 cases , there was abnormal mucosal shining in the round window but without plf . in 7 cases
, the tympanic cavity could not be visualized because of the adhesive middle ear process , the abnormal anatomy , or the prominent exostoses of the ear canal prohibited vision . in 34 patients ,
lfs provoked unsteadiness on posturography without plf . in 6 cases ,
a postoperative middle ear infection was recorded .
no permanent tympanic membrane perforation occurred .
it is unlikely that disease entity of spontaneous plf exists .
tympanoscopy should be regarded as the first choice when a plf is suspected . |
during september 2003 through may 2004 , serum samples were collected from 512 adult blood donors 1864 years old ( median 42 years ) and 188 children 24 years old .
the blood donors were unpaid voluntary donors ; the children were hospitalized in toulouse for surgery or trauma .
the prevalence of hev igg was determined by using the wantai hev igg enzyme immunoassay ( wantai biologic pharmacy enterprise , beijing , people s republic of china ) , according to the manufacturer s instructions .
details of baseline demographic data and putative risk factors were collected from blood donors by using a structured questionnaire .
in addition , to assess the risk for foodborne infection , we tested 18 local pig - liver sausages for hev rna using a quantitative real - time pcr based on the open reading frame 2 region of the hev genome ( 6 ) .
hev igg was detected in 268 ( 52.5% ) of 512 ( 95% confidence interval [ ci ] 48.2%56.8% ) of the blood donors .
the ranges of optical density / cutoff ratios for positive and negative samples showed a clear bimodal distribution ( figure 2 ) .
of 244 rural donors , 63.1% ( 95% ci 57%69.2% ) were anti - hev positive compared with 42.9% ( 95% ci 3748.8 ) of 268 urban donors ( p<0.01 ) . for children , seroprevalence was 3.7% ( 95% ci 1.0%6.5% ) .
the mean sd optical density / cutoff ratio of the positive samples was 5.43 3.93 for children and 5.99 3.52 for adults .
although several factors were associated with the presence of hev igg after univariate analysis , multivariate analysis identified only age , rural residence , hunting , and contact with cats as factors independently associated with hev igg positivity ( table 1 ) .
prevalence of hepatitis e virus ( hev ) igg in 512 blood donors by age group , midi - pyrnes region , france , 20032004 .
distribution of optical density / cut off ratios for hepatitis e virus igg in positive and negative samples from 512 blood donors , midi - pyrnes region , france , 20032004 .
* hev , hepatitis e virus ; ci , confidence interval ; ns , not significant .
hev rna was found in 8 ( 44% ) of the 18 sausages tested by real - time pcr ( table 2 ) .
the virus load ranged from 100 ( the limit of detection for this assay ) to 668,520 copies / g .
positive samples by sequencing a 189-nt fragment of the open reading frame 2 gene ( 7 ) .
hev , hepatitis e virus ; na , no pcr amplification with primers used for genotyping .
we determined that the hev igg prevalence among blood donors in midi - pyrnes is 52.5% , the highest seroprevalence reported in an industrialized country .
this rate is 3.1 times higher than our previous estimate ( 16.6% ) for the same population ( 2 ) .
although surprising , we believe these results are valid for several reasons . first , the wantai assay used to assess hev seroprevalence has been validated for this purpose in the united kingdom , another region where hev-3 predominates ( 5 ) .
the greater proportion of reactive serum seen with this assay is unlikely to have resulted from nonspecific reactivity because the assay produced a clear distinction between negative and positive samples , and only a small proportion of young children tested positive .
our findings agree with those of another study that found a much increased hev seroprevalence when the more accurate test was used ( 5 ) .
. the estimated rate of acquisition of hev infection in organ transplant recipients in toulouse is 3.2 per 100 person - years ( 8) .
this figure is derived from regular monitoring by using sensitive molecular techniques and does not depend on serologic assays . as noted in other countries ( 9,10 ) ,
the percentage of hev - positive serum increased with age , which is consistent with cumulative exposure to infection over time .
hev is usually transmitted orally , and foodborne transmission of zoonotic strains has been demonstrated .
hunting of wild boar and deer is popular in midi - pyrnes , particularly in rural areas .
the consumption of uncooked game meat , which is traditional in this area , could explain the high hev antibody prevalence in 20 ( 80% ) of 25 hunters .
further evidence comes from a case control study among organ transplant recipients in midi - pyrnes that demonstrated that the only factor independently associated with hev infection was consumption of game meat ( 6 ) .
some of these foods have been shown to contain hev rna , and phylogenetic analysis demonstrated that these strains were closely related to human strains ( 8) .
another suspected zoonotic source of hev genotype 3 infection is the domestic pig ( 12 ) .
hepatitis e cases have been linked to eating uncooked pork - liver sausage in southeastern france ( 13 ) .
we found that a high proportion ( 44% ) of pig - liver sausages purchased in toulouse contained hev rna .
these air - dried sausages are popular in midi - pyrnes and are usually eaten raw .
their infectivity is unknown , but cell - culture experiments have demonstrated that high virus loads correlate with high infectivity ( 14 ) .
in addition to direct foodborne transmission , the growing boar population in midi - pyrnes and the spreading of pig manure on land may pose indirect risks through fecal contamination of soil and watercourses . these 2 factors and the 2 foodborne sources of hev might explain the high hev antibody prevalence in midi - pyrnes and the statistical association of hev seropositivity with rural residence and hunting , but they can not explain the association with cat contact . hev rna has not yet been detected in domestic cats .
the high percentage of donors with hev antibodies in our area contrasts with the low recorded incidence of autochthonous hepatitis e in france and other industrialized countries ( 1,15 ) .
even though we documented dozens of hepatitis e cases in midi - pyrnes during the past decade , the remarkably high seroprevalence in this area suggests that most infections must be subclinical or unrecognized
. however , in susceptible persons , such as organ transplant recipients and patients with chronic liver disease , the consequences of hev infection are grave and raise public health , as well as food and environmental safety , concerns .
we showed that seroprevalence increases with age and is associated with rural residence , hunting , and exposure to cats .
these associations became apparent only when we used a sensitive assay to detect hev igg .
the reasons for the high hev prevalence in this population are uncertain but may be due , at least partially , to the culinary culture of the local community .
thorough cooking of game meat and pork products would help minimize the risk for hev infection and could form part of a public health initiative in this area . | using a validated sensitive assay , we found hepatitis e virus ( hev ) igg in 52.5% of voluntary blood donors in southwestern france .
this finding suggests hev is highly endemic to this region
. the high hev prevalence may reflect local dietary practices , such as eating uncooked pork and game products . |
in this issue of critical care , thiel and colleagues present a new method for tracking the changes in cardiac output in response to passive leg raising ( plr ) , one of the tests recently proposed to predict volume responsiveness in critically ill patients .
recent review articles have emphasised the relevance of using dynamic indices such as pulse pressure variation and stroke volume variation for that purpose [ 3 - 5 ] .
nevertheless , the respiratory variation of stroke volume can not be used in cases of spontaneous breathing or low tidal volume ventilation . in such problematic cases , plr , by acting as an endogenous volume challenge , represents a helpful tool for predicting fluid responsiveness .
compared with the classical fluid challenge , it has the advantage of being rapidly and totally reversible .
the potential risks of fluid infusion are thus expected to be minimised , which is important to consider in critically ill patients in whom multiple challenges are often necessary . confirming previous reports , thiel and colleagues have shown that plr is a reliable test for predicting volume responsiveness in mechanically ventilated patients , even in those with spontaneous breathing activity .
for tracking the changes in cardiac output during the postural manoeuvre , they used a transcutaneous continuous - wave doppler ultrasound device able to measure blood flow across the aortic or the pulmonary valve .
this totally non - invasive method is assumed to be less user - dependent than the classical doppler echocardiography . unlike the oesophageal doppler technique , this device can be applied in non - intubated patients . as predicting volume responsiveness using such a simple method is very attractive , further confirmation studies are necessary .
another interesting finding of the study by thiel and colleagues was the high rate ( 54% ) of patients who did not respond to fluid administration , confirming recent reports .
this issue must be discussed in line with the recent evolution of ideas and policies in terms of fluid administration in critically ill patients .
the concept of increasing cardiac output to correct an occult oxygen debt in critically ill patients was developed during the ' 90s .
although it did not lead to improved outcome of intensive care unit ( icu ) patients enrolled in randomised studies , this concept promoted the idea that critically ill patients are often under - resuscitated , even in the absence of hypotension or of any sign of blood volume deficit .
the study by rivers and colleagues emphasised the importance of increasing cardiac output by using aggressive fluid administration in the early phase of severe sepsis .
this concept has been well adopted by pre - hospital , emergency care and critical care physicians as witnessed by the fact that more than 50% of icu patients are volume - unresponsive in recent studies .
however , volume unresponsiveness is an abnormal state since it indicates that the patient 's heart operates on the flat part of the frank - starling curve , as does a failing heart . in this condition
, further fluid administration should dramatically increase cardiac filling pressures with inherent high risks of pulmonary oedema development , in particular in cases of altered pulmonary vascular permeability . in this regard , there is now increasing evidence that fluid overload negatively impacts the outcome of critically ill patients .
we can schematically distinguish between two opposite situations that are frequently encountered in the icu .
the first one is represented by the management of patients in the early phase of sepsis .
the surviving sepsis campaign recommends that fluid be administered until the central venous pressure ( cvp ) reaches 8 to 12 mm hg ( or more in mechanically ventilated patients ) provided that the central venous oxygen saturation is less than 70% .
as the cvp can not identify volume - unresponsive patients , such an attitude could result in fluid overload of most of those patients .
a test capable of reliably detecting volume unresponsiveness at any moment of fluid resuscitation would help to better assess the benefit / risk ratio of continuing such a strategy .
the second situation is represented by the management of patients with lung injury after the early stage has passed .
however , an uncontrolled fluid restriction attitude ( diuretics or ultrafiltration ) could result in marked volume depletion and subsequent organ hypoperfusion .
a test capable of reliably detecting when the degree of volume responsiveness at any moment of fluid restriction is too high would help to assess the benefit / risk ratio of continuing such a strategy .
fortunately , the tests developed to detect volume responsiveness can also serve to detect volume unresponsiveness . among different tests ,
plr is probably one of the most valuable since it can be used in icu patients with spontaneous breathing activity .
cvp : central venous pressure ; icu : intensive care unit ; plr : passive leg raising .
j - lt and xm are members of the medical advisory board of pulsion medical systems ag ( munich , germany ) . | policies of fluid administration / restriction in critically ill patients have evolved over recent years .
abundant fluid resuscitation is encouraged during the early stage of severe sepsis . but a conservative fluid strategy is recommended in later stages , in particular when lungs are injured . both strategies are risky if uncontrolled .
tests detecting volume unresponsiveness at any moment of fluid resuscitation or detecting volume unresponsiveness at any moment of fluid restriction would help to better assess the benefit / risk ratio of continuing such strategies .
measuring the short - term hemodynamic changes during passive leg raising can be reliably used for that purpose in both situations , even when patients are breathing spontaneously . |
metabolic syndrome ( mets ) , a collection of cardiometabolic risk factors that includes obesity , insulin resistance , hypertension , and dyslipidemia , confers increased risks of coronary heart disease and cardiovascular disease ( cvd ) [ 15 ] . in terms of mechanism , both adipocytokine and vitamin d
a low adiponectin level has been reported to be correlated with obesity , mets , and cvd [ 713 ] , while a high leptin level has been indicated to be associated with cvd that has close relation to obesity [ 6 , 1416 ] . to be integrated , adiponectin /
leptin ratio ( a / l ratio ) has been identified to be highly associated with insulin resistance , mets , and cvd and even is able to predict cv outcome [ 1721 ] .
in addition , vitamin d deficiency has also been reported to be highly associated with mets [ 6 , 2225 ] and to increase the risk of developing cvd , including hypertension , heart failure , and ischemic heart disease .
vitamin d3 has been found to be highly associated with adiponectin [ 2729 ] , while leptin has been reported to suppress the synthesis of renal 1,25(oh)2d3 . in the formation of an active form of vitamin d3 , 1,25(oh)2d3 , two key enzymes of the cytochrome p450 superfamily , sterol 27-hydoxylase ( cyp27a1 ) in the liver and 25-hydroxyvitamin d3 1-alpha - hydroxylase ( cyp27b1 ) in the kidney , are needed .
however , in the view of genetics , little about these two vitamin d3 metabolic genes with adipocytokines and mets is studied .
therefore , our purpose was to explore the potential associations of vitamin d3 metabolism genes , cyp27a1 and cyp27b1 , with adiponectin and leptin and , subsequently , with mets .
in this cross - sectional study , 694 taiwanese males ( age : 4477 years ) living in kaohsiung city were recruited from a free health screening program held by our institution [ 1 , 32 ] .
ethical approval following the declaration of helsinki was authorized by the institutional research ethics committee of kaohsiung medical university hospital .
the men who had a previous diagnosis of hypertension , diabetes mellitus ( dm ) , or hyperlipidemia controlled by regular medication were included in this study , but those who were diagnosed with labile hypertension , labile dm , and advanced liver and/or renal disease were excluded .
entire records of medical , surgical , and psychosexual history , as well as the results of physical examinations including measurements of body weight , height , and blood pressure for each participant , were collected ( figure 1 ) .
the subjects were classified as alcohol drinkers , cigarette smokers , or betel nut chewers if they had regularly consumed any alcoholic beverage 1 time per week , smoked 10 cigarettes per week , or chewed 7 betel quids per week for at least the last 6 months [ 33 , 34 ] .
hypertension was defined as a systolic blood pressure of 140 mmhg or diastolic blood pressure of 90 mmhg .
hyperlipidemia was defined as a total cholesterol level of 200 mg / dl or triglyceride level of 200 mg / dl [ 1 , 35 ] .
dm was diagnosed when the fasting blood glucose ( fbg ) was 126 mg / dl . in accordance with the modified criteria proposed by the bureau of health promotion in taiwan ,
mets was diagnosed once meeting at least three of the following criteria : ( 1 ) waist circumference ( wc ) 90 cm ; ( 2 ) triglycerides ( tg ) 150 mg / dl ; ( 3 ) high density lipoprotein ( hdl ) cholesterol < 40 mg / dl ; ( 4 ) blood pressure ( bp ) 130/85 mmhg or current use of antihypertensive medications ; ( 5 ) fbg > 100 mg / dl , previously diagnosed as dm , or current use of oral hypoglycemic agents or insulin [ 1 , 5 , 36 ] . for
further biochemical analysis and hormone profiling , each peripheral venous blood sample was drawn after more than 8 hours of fasting overnight into pyrogen - free tube .
diasorin radioimmunoassay kits ( northwestern avenue stillwater , usa ; intra - assay cv : 6.8%~11.3% ; interassay cv : 12.3%~15.3% ) were used to determine the expression of 1,25(oh)2d3 .
millipore radioimmunoassay kits ( missouri , usa ) were used to measure the leptin and adiponectin ( intra - assay cv : 3.4%~8.3% and 1.78%~6.21% , resp . ; interassay cv : 3.0%~6.2% and 6.90%~9.25% , resp . ) .
tag single nucleotide polymorphisms ( snps ) were selected by searching data on han chinese in the hapmap project ( http://www.hapmap.org/ ) using haploview software .
afterward the tag snps were identified by the following criteria : ( 1 ) snps located in the cyp27a1 and cyp27b1 genes or within the flanking 5 kb regions ; ( 2 ) a minor allele frequency of 0.10 ; and ( 3 ) other unselected snps that could be captured by one of the tag snps with a linkage disequilibrium of r 0.80 .
selection of snps had been completed in march 2006 , and only 1 tag snp had been identified for each of the cyp27a1 and cyp27b1 genes , namely , rs4675344 on the intron 1 region and rs10877012 on the promoter region ( figure 1 ) .
dna was extracted from the peripheral whole blood using a puregene dna isolation kit ( gentra systems inc . ,
the two snps were determined using a taqman 5 allelic discrimination assay performed on an assays - on - demand snp genotyping kit ( applied biosystems , foster city , ca ) .
snp amplification assays including 10 ng of sample dna in 25 l of reaction solution contained in 12.5 l of 2x taqman universal pcr mix ( applied biosystems ) and 1.25 l of predeveloped assay reagent from the snp genotyping product ( applied biosystems ) contained in two primers and two mgb - taqman probes were performed according to the manufacturer 's instructions .
reaction conditions consisted of preincubation at 50c for 2 min and 95c for 10 min , followed by 40 cycles at 92c for 15 s and 60c for 1 min .
amplifications were performed in an abi prism 7500 sequence detection system ( applied biosystems ) .
our genotyping results were also validated in accordance with the identical results from the 25 patients and 25 controls ( about 10% of our participants ) who were randomly selected for regenotyping by direct sequencing .
the demographic and laboratory data are presented as mean standard deviation ( sd ) . for the controls ,
the categorical variables and continuous variables were examined by the contingency tables ( pearson chi - square test ) and the student 's t - test , respectively .
the ancova test was used to evaluate the associations between the cyp27a1 rs4675344 and adiponectin / leptin ratio ( a / l ratio ) controlling for other covariates .
multiple linear regression analysis was used to examine the associations between the a / l ratio and mets score for the cyp27a1 rs4675344 . since the established cardiovascular risk factors including hypertension and dm
are the components of mets , we were only adjusted for sex , age , coronary artery disease ( cad ) , stroke , alcohol consumption , and smoking status .
all statistical analyses were performed by spss 18.0 software ( chicago , il , usa ) with significance levels of = 0.05 .
the baseline characteristics and biochemical data of our subjects with respect to cyp27a1 rs4675344 were summarized in table 1 .
a total of 649 patients had adequate qualities for analysis , of whom 447 ( 68.9% ) , 179 ( 27.6% ) , and 23 ( 3.5% ) patients had the aa , at , and tt genotypes , respectively . due to the low minor allele frequency , the patients with tt and patients with at were united into the t - carriers for analysis . compared with the patients with the aa genotype , the t - carriers had significantly higher wc ( 87.1 6.9 versus 85.7 7.2 cm , p = 0.003 ) , positive history of dyslipidemia , total and hdl cholesterol ( 4.3 1.0 versus 4.1 1.0 , p = 0.006 ) , leptin ( 6.5 28.2 versus 4.0 3.3 , p = 0.005 ) , and a / l ratio ( 3.7 4.0 versus 5.1 6.0 , p = 0.001 ) .
the t - carriers showed nominal significant number of mets components ( 2.1 1.4 versus 1.9 1.4 , p = 0.04 ) , lower hdl ( 46.5 11.3 versus 48.5 11.0 mg / dl , p = 0.04 ) , adiponectin ( 10.9 6.2 versus 12.1 7.2 ng / ml , p = 0.03 ) , and increased number of mets components and greater percentages of each mets component were also noted in the t - carriers compared to those with the aa genotype ( table 2 ) .
four models were established for our regression analysis , namely , model 1 that was adjusted for baseline characteristics including age , bmi , wc , hip circumference , systolic blood pressure , and diastolic blood pressure ; model 2 that was then adjusted for exsmoker , current smoker , ex - betel nut chewer , current betel nut chewer , exdrinker , and current drinker ; model 3 that was further adjusted for comorbidities including dm , hypertension , dyslipidemia , cad , and stroke ; and model 4 that was farther adjusted for biochemistry data including fasting glucose , total cholesterol , low density lipoprotein ( ldl ) , hdl , and triglycerides ( tg ) .
negative associations between the cyp27a1 rs4675344 snp and the a / l ratio were found consistently from model 1 to model 4 .
in addition , obesity and the parameters related to mets , including bmi and wc , were also negatively related to the a / l ratio . in model 4 ,
ldl and fasting glucose were also significantly , negatively associated with the a / l ratio ( table 3 ) .
the a / l ratio showed greatest association with the cyp27a1 rs4674344 snp , and the mets also had significant association , too .
therefore , we further examined the influence of mets and its components on the associations between the cyp27a1 rs4674344 snp and a / l ratio . greater association between a / l ratio and the cyp27a1 rs4674344 snp was noted in the low mets score group when compared to the high mets score group ( figure 2 ) .
significant a / l ratio was only found when most of the mets components were in the preclinical stage ( not meeting individual criteria ) .
however , there was no significant association with the bp component after adjusting for age , bmi , smoking , alcohol drinking , betel nut chewing , cad , total cholesterol , ldl , hdl , and the other 4 components for the cyp27a1 rs4674344 snp ( table 4 , figure 3 ) .
this study selected the snps by searching han chinese data from the hapmap project ( http://www.hapmap.org/ ) using haploview software .
these snps were located in the cyp27a1 genes and cyp27b1 genes or within the flanking 5 kb regions with a minor allele frequency 0.10 .
accordingly , the other unselected snps could be captured by one of the tag snps with a linkage disequilibrium of r 0.80 . as a result
, only 1 tag snp was obtained for each of the cyp27a1 and cyp27b1 genes , namely , the rs4675344 on intron 1 region and the rs10877012 on the promoter region ( figure 1 ) . the mets and its hdl component are significantly associated with the cyp27a1 rs4674344 snp .
the hdl cholesterol has been reported to have a strong correlation with the adiponectin and to affect the adipocyte metabolism and adiponectin expression [ 39 , 40 ] . and it is known that mutations in cyp27a1 are associated with cerebrotendinous xanthomatosis , a rare lipid storage disease with the deposition of a form of cholesterol ( cholestanol ) in the brain and other tissues [ 4144 ] .
our study provides further novel information of the impact of cyp27a1 rs4674344 snp on both of them .
however , like previous document , no cyp27 snps in our study were associated with 1,25(oh)(2)d levels .
a / l ratio is the best surrogate for inflammatory burden and insulin resistance [ 46 , 47 ] .
adiponectin acts as an insulin - sensitizing adipocytokine and an anti - inflammatory factor especially with regard to atherosclerosis .
leptin is known to be a satiety factor regulating body weight by suppressing appetite and stimulating energy expenditure .
leptin is also a proinflammatory adipocytokine , which induces the development of t helper 1 cells that contribute to the progress of inflammation [ 4951 ] . for in - depth analysis in our study , a / l ratio was not only significantly higher in the cyp27a1 rs4674344 snp t - carriers than in those with the aa genotype ( 3.7 4.0 versus 5.1 6.0 , p = 0.001 ) , but was also most correlated with this snp . against other study parameters for the a / l ratio ,
the cyp27a1 rs4675344 snp consistently had significantly negative association with the a / l ratio from model 1 to model 4 after adjusting for baseline characteristics , life habits , comorbidities , and biochemistry profiles .
in addition , obesity and mets - related parameters including bmi , wc , and hip circumference were also negatively associated with the a / l ratio . in model 4 ,
ldl and fasting glucose were significantly negatively associated with the a / l ratio , too ( table 3 ) . these results
all indicated that the cyp27a1 rs4675344 snp , a / l ratio , and mets are closely associated with each other .
another set of novel in - depth information provided by our study related to the cyp27a1 rs4674344 snp was that the a / l ratio was only significantly different in the preclinical stage of most individual mets criteria , except for the bp component , but not in the clinical stage of mets .
the snps of genes are imprinted in the germ - cell stage and one previous investigation had also reported that the changes of a / l ratio and development of the mets partly accorded with one 's own genetics .
therefore , our novel findings indicated that those t - carriers with the cyp27a1 rs4674344 snp tend to have a higher risk of developing mets , owing to an adipocytokine imbalance
. however , the cyp27a1 rs4674344 snp did not seem to play a role in the development of bp component . based on our findings and the previous evidence ,
the cyp27a1 rs4674344 might participate in lipid and adipocytokine homeostasis and in the crosstalk of hdl with adiponectin .
however , unequal number of subjects with the polymorphism of cyp27a1 rs4674344 was the main limitation in this study , which might lead to bias in the results .
a large - scale cohort study with equal numbers of subjects may be dedicated to investigate the refined causality , including the snp of cyp27a1 rs4674344 for the major cardiovascular events . in vitro studies
this study reported the novel finding that vitamin d3 metabolism gene cyp27a1 rs4674344 was closely associated with a / l ratio and mets .
in addition , for the cyp27a1 rs4674344 snp , the a / l ratio was only significantly different in the preclinical stage of the most individual mets criteria except the bp component .
this finding indicated that the t - carriers were at a higher risk of developing mets . | metabolic syndrome ( mets ) confers increased risks of cardiovascular disease ( cvd ) .
both vitamin d3 and adipocytokines ( especially adiponectin and leptin ) have a great impact on cvd and mets . in vitamin d3 metabolism ,
the vitamin d3 25-hydroxylase ( cyp27a1 ) and 25-hydroxyvitamin d3 1-alpha - hydroxylase ( cyp27b1 ) are two key enzymes .
this study aimed to examine the influence of vitamin d3 cyp27 single nucleotide polymorphisms ( snps ) on adipocytokines and mets .
cross - sectional data and dna samples were collected from male volunteers ( n = 649 , age : 55.7 4.7 years ) .
two tagging snps , cyp27a1 rs4674344 and cyp27b1 rs10877012 , were selected from the hapmap project .
mets was significantly associated with the cyp27a1 rs4674344 snp ( p = 0.04 ) and the ratio of adiponectin / leptin ( a / l ratio ) was most correlated to the cyp27a1 rs4674344 snp , appearing to be significantly lower in t - carriers than in aa subjects ( 3.7 4.0 versus 5.1 6.0 , p = 0.001 ) and significantly negatively associated after adjustment . for each mets component associated with the cyp27a1 rs4674344 snp ,
the a / l ratios were significantly negative in preclinical stage ( condition not meeting the individual criteria ) , except the blood pressure . in conclusion ,
cyp27a1 rs4674344 snp , a / l ratio , and mets are significantly associated and t - carriers might have a higher risk of developing mets due to low a / l ratios in the preclinical stage . |
this type of examination has been considered an important tool for diagnosis since its discovery .
however , awareness of the risks of using ionizing radiation for diagnostic purposes emerged soon after its discovery .
therefore , methods that selectively expose a patient to x - rays have been proposed , such as a protection apparatus , faster films , and most appropriate technique.1 in addition , using good quality images to acquire information is important in x - ray protection , and appropriate image quality is fundamental in the conservation of medical records as well as resolving legal issues.2 in dental radiology , quality control has been wrongly focused on only the control / development of equipment , such as the development of the x - ray apparatus and processors.3 however , another fundamental factor influencing the quality of dental radiology is the training that professionals who perform radiographs receive ; this training must be maintained at a satisfactory level to ensure safety during examinations.4 radiographic examination is commonly performed by dentists and is important in supplementing diagnoses of oral problems .
in addition , a collection of dental radiographs can provide important technical , scientific , and legal data.2 thus , dental professionals who perform radiographs are responsible for ensuring the level of quality for a proper diagnosis .
these professionals must competently execute techniques and manage film processing while also supervising all steps of the examination to minimize unnecessary exposure to x - ray radiation .
these efforts can prevent low quality images used to potentially misdiagnose a patient as well as errors in treatment allocation.5 panoramic radiography is an extraoral examination .
the development of this radiographic equipment improved the image quality using low radiation dose with low cost to the patient .
however , in this radiographic technique , the patient 's position is critical to ensure the acceptable final image focusing on the teeth and surrounding alveolar bone structure.6 therefore , a successful panoramic radiograph requires careful positioning of the patient and proper technique.7 the appropriate technical procedure requires the patient 's upright position with an elongated neck , shoulders down , straight back , and feet together . in addition , the frankfort plane parallel to the ground and the median sagittal plane perpendicular to the ground should be established with chin support in the frontal chin cup with the tongue resting against the palate.8 thus , proper positioning of the patient in the equipment is the most important factor in preventing a cascade of errors in diagnosis and treatment allocation .
given the importance of this type of error , we reviewed the current literature to evaluate common positioning errors associated with panoramic radiographs and suggest correct methods from these results to minimize these errors and patient exposure .
the pubmed database search ( http://www.ncbi.nlm.nih.gov/pubmed ) was performed to identify all literature reviews and case reports related to " radiographic positioning errors " and " panoramic radiographs . " in a single examination , panoramic radiograph allows good visualization of all dental elements and their anatomical structures in the maxillo - mandibular complex.9,10 in addition , the patient is exposed to a low dose of radiation.11 for excellent visualizations of an anatomical structural , panoramic radiography should be performed with high technical standards and the image should be reviewed carefully.12 panoramic radiographs taken with high technical standards can provide good radiographic finding in diagnosing pathologies in the jaws.13 panoramic radiography should be performed in accordance with the manufacturer 's recommendations , and patients should remain perfectly positioned while the x - ray tube and image receptor ( film or digital sensor ) simultaneously revolve around the patient 's head.14 the exposure time is set to allow for the image capture of one full rotation around the patient.5 during extraoral radiography , the image receptor is a combination of two intensifying screens surrounding a film .
each intensifying screen is coated with a layer of phosphor that fluoresces when activated by x - ray radiation that penetrates both the patient and the cassette .
cassette is the compartment accommodating a radiographic film during the radiography.15 this fluorescent glow sensitizes the film .
the film used in panoramic radiography is 10 - 60 fold more sensitive than the film used in fluorescence x - ray radiation .
thus , these highly sensitive screens allow for a reduced amount of radiation exposure while also producing high quality images . as the x - ray tube and image receptor circle the patient
, the image is recorded on the film and can be restricted by narrowing the x - ray tube or collimator.16 the quality of the final result is related to both the position of the patient during the exposure and the accuracy of the jaw position in the focal trough . image quality can also be influenced by the proximity of the orofacial region to the desired focal trough , the mechanical area located between the radiation source , and the image receptor , which is designed for a medium - sized jaw.17 there are four basic anatomical planes used to properly position a patient : the ala - tragus plane , orbital / meatus plane ( the frankfort plane ) , canine / meatus plane , and median sagittal plane .
devices for positioning the head and supporting the chin are also important for precise positioning .
the purpose and type of equipment being used with respect to proper positioning for image capture should be carefully explained to patients .
most importantly , patients should be instructed to bite on the bite block , close their lips , and push their tongue against the roof of their mouth.18 moreover , a lead apron should be placed over the parts of the patient 's body under the head and neck area .
panoramic radiography is already a routine procedure for prosthetic planning , diagnosing pathologic changes in the maxilla , identifying the presence of root fragments and foreign bodies , and determining the height of the alveolar ridge .
it can also be used to evaluate systemic conditions19 since a significant correlation exists between changes in the trabecular bone on panoramic radiographs and wrist radiographs ( carpal ) due to osteoporosis in the spine and femur as detected by bone densitometry.20 this additional information may encourage early disease diagnosis , prior to the onset of complications that could debilitate the patient 's quality of life.21 nonetheless , disadvantages in using this imaging modality exist , such as the limitations of a two - dimensional image and the incidence of image distortions that may interfere with surgical planning.22 at present , panoramic radiography is not only widely available but also important to diagnose alterations in the oral condition .
they provide evidence that can be used with clinical examination to improve the diagnostic process .
thus , panoramic radiography is a useful and practical complement during the clinical examination of teeth to diagnose caries , pulp origin diseases , and diseases of the facial bones.23 in addition , panoramic radiograph allows a dentist to exam all of the teeth at once , including those still below the gum line ; therefore , caries , tooth fractures , infections , or other diseases of the bones that support the teeth can be viewed and diagnosed.24 moreover , situations of bone resorption as well as radicular cysts , tumors , inflammation , post - accident fractures , temporomandibular joint disorders , and sinusitis can be identified .
panoramic radiography is commonly requested preoperatively ; however , ohman et al25 stated that panoramic examination was not sufficient for pre - operative inspection . in pediatric patients ,
panoramic radiography can be used to monitor teeth before they emerge and analyze their location , shape , and angles as well as the presence of a supernumerary tooth or the absence of a tooth germ , thus preventing or preparing for future esthetic problems.26 overall , panoramic radiography can be used in the following situations ; for general surveys of oral health , to determine the best radiographic supplements for surgical procedures , for initial and progressive evaluations of orthodontic treatment , for information about pediatric growth and development , to review chronological dental eruptions and the axes of permanent tooth eruptions , to evaluate cystic or or neoplastic lesions , to measure the dimensions for implantology , for historical documentation , to evaluate the temporomandibular joint , and to detect the presence of foreign bodies.27 professionals should perform radiography in an environment conducive to the interpretation of the results beginning with radiographic film storage followed by a proper examination and adequate interpretation of the results . failure to perform any of these steps properly during the examination
may lead to erroneous conclusions and unnecessary patient exposure to repetitive radiographs.28 the interpretation of panoramic radiographs requires prior knowledge of the human anatomy .
moreover , a number of variations that fall within the normal range can be noted and should be examined carefully to avoid erroneous conclusions.29 to this end , radiographic images should be carefully evaluated by a trained professional .
radiographs that are sharp or detailed and have minimal distortion , correct film framing in the region , a lack of artifacts , good density , and adequate contrast are considered to be of good quality.30 radiographs that do not meet these criteria indicate that a mistake occurred during radiographic imaging and/or processing .
technical or processing errors are the main errors that occur during panoramic radiographs . therefore , care must be taken while positioning the patient and during the execution of the entire process .
studies from oral radiology institutes have indicate that positioning,7 exposure factors , artifact appearance , and technical performance are the most commonly observed errors in decreasing order .
the most common error , patient positioning , is dependent on the operator communicating and controlling the patient 's position.6 thus , positioning errors should be reduced to minimize the number of unsatisfactory radiographs and avoid unnecessary exposure of the patient to x - ray radiation .
another common error occurs when the patient 's head is positioned in front of the focus , which leads to an image with dental arches , particularly the front teeth , with a blurred , shortened , and narrowed appearance . furthermore , the proximal area around the premolars and the column of the ramus can overlap.31 in this context , the cause of most repeated examinations was found to be due to incorrect positioning of the patient 's head . in 21.15% , 24.84% , 21.21% , and 20.30% of cases requiring re - examination , the reason for re - examination was that the patient 's head was in front of the focal trough , turned to the right or left , tilted forward , or positioned behind the focal trough , respectively .
when the patient 's head is positioned behind the plane of focus , the dental arches , especially in the anterior teeth , appear blurred and expanded in the horizontal direction .
in addition , the condyles appear at the lateral edges of the film.6,7 when the patient 's head is tilted back , the occlusal plane becomes flattened or reversely curved as the apexes of the upper incisors appear out of focus .
in addition , the condyles were projected out of the imaged area due to an increase in the intercondylar distance . when the patient 's head is tilted forward
in addition , overlapping images of the hyoid bone in the anterior mandible can be apparent .
however , this may be because the upper regions of the condyles may not be visible and the intercondylar distance could be narrowing.6,7 during radiographic examination , patients commonly tilt or turn their head to the right or left.6 when patients tilt their head , the structures imaged become asymmetrical ( the side toward the slope appears reduced in size compared with the opposite side ) , and the proximal surfaces become substantially overlapped .
when patients turn their head to one side , the teeth appear to be extended on one side of the midline and the sharp proximal surfaces appear overlapped , whereas the teeth on the opposite side appear shortened .
furthermore , the ascending mandible on one side appears much larger than that of the other , and the condyles appear to be different sizes .
the patient 's chin and the occlusal plane must be positioned correctly to avoid distortions.6 the occlusal plane should be angled at -20 to -30 from the horizontal plane .
one way to position the chin is to set as the line connecting the tragus of the ear to the outer corner of the eye is parallel to the ground .
if the chin was elevated , the occlusal plane on the radiograph will appear flat or inverted , and the image would be distorted .
furthermore , the shadow of the radiopaque palate bone can overlap the roots of the maxillary teeth .
conversely , if the chin is tilted down , the teeth will overlap and the symphysis of the jaw may not be visible .
in addition , both mandibular condyles may appear to be projecting out of the upper edge of the image.6 the position of the tongue also greatly influences the radiographic image quality.32 in the radiograph , the presence of a radiolucent band at the apex of the upper teeth is an indication that tongue contact with the upper palate was not sufficient .
in addition , if the tongue is not placed on the palate or the lips remain open , the incisal area on the crowns may become obscured by the air space . a dark air space between the dorsum of the tongue and the hard and soft palates ( palatoglossal air spaces ) obscure the apical region of the maxillary teeth .
to avoid this error - prone situation , which would cause the central incisor apex to be misdiagnosed , the patient should be asked to position their tongue so that it adheres to the palate ( roof of the mouth ) and to not swallow saliva to prevent tongue movement during radiography.33 incorrect patient posture and movement during radiography can produce a " ghost image " that appears as blurred areas in the image and forms large step defects in the inferior border of the mandible.6 radiographic image distortions due to the presence of anatomical structures or objects positioned outside the focal trough are known by several names including reverse shadows or shadows , secondary images , attached pictures , double images , triple pictures , ghost earrings ( cysts ) , and contralateral and ghosting images.34 these images , which are found on rotational panoramic radiographs only , are usually anatomical structures such as the vertebrae , rami , or hyoid bone , but can also be artificial objects such as metallic materials , dental crowns , wires , containment plates , earrings , necklaces , or machine parts . the presence of anatomical objects or artificial structures can create multiple images and ghost images .
in a single examination , panoramic radiograph allows good visualization of all dental elements and their anatomical structures in the maxillo - mandibular complex.9,10 in addition , the patient is exposed to a low dose of radiation.11 for excellent visualizations of an anatomical structural , panoramic radiography should be performed with high technical standards and the image should be reviewed carefully.12 panoramic radiographs taken with high technical standards can provide good radiographic finding in diagnosing pathologies in the jaws.13 panoramic radiography should be performed in accordance with the manufacturer 's recommendations , and patients should remain perfectly positioned while the x - ray tube and image receptor ( film or digital sensor ) simultaneously revolve around the patient 's head.14 the exposure time is set to allow for the image capture of one full rotation around the patient.5 during extraoral radiography , the image receptor is a combination of two intensifying screens surrounding a film .
each intensifying screen is coated with a layer of phosphor that fluoresces when activated by x - ray radiation that penetrates both the patient and the cassette .
cassette is the compartment accommodating a radiographic film during the radiography.15 this fluorescent glow sensitizes the film . the film used in panoramic radiography is 10 - 60 fold more sensitive than the film used in fluorescence x - ray radiation .
thus , these highly sensitive screens allow for a reduced amount of radiation exposure while also producing high quality images .
as the x - ray tube and image receptor circle the patient , the image is recorded on the film and can be restricted by narrowing the x - ray tube or collimator.16 the quality of the final result is related to both the position of the patient during the exposure and the accuracy of the jaw position in the focal trough . image quality can also be influenced by the proximity of the orofacial region to the desired focal trough , the mechanical area located between the radiation source , and the image receptor , which is designed for a medium - sized jaw.17 there are four basic anatomical planes used to properly position a patient : the ala - tragus plane , orbital / meatus plane ( the frankfort plane ) , canine / meatus plane , and median sagittal plane .
devices for positioning the head and supporting the chin are also important for precise positioning .
the purpose and type of equipment being used with respect to proper positioning for image capture should be carefully explained to patients .
most importantly , patients should be instructed to bite on the bite block , close their lips , and push their tongue against the roof of their mouth.18 moreover , a lead apron should be placed over the parts of the patient 's body under the head and neck area .
panoramic radiography is already a routine procedure for prosthetic planning , diagnosing pathologic changes in the maxilla , identifying the presence of root fragments and foreign bodies , and determining the height of the alveolar ridge .
it can also be used to evaluate systemic conditions19 since a significant correlation exists between changes in the trabecular bone on panoramic radiographs and wrist radiographs ( carpal ) due to osteoporosis in the spine and femur as detected by bone densitometry.20 this additional information may encourage early disease diagnosis , prior to the onset of complications that could debilitate the patient 's quality of life.21 nonetheless , disadvantages in using this imaging modality exist , such as the limitations of a two - dimensional image and the incidence of image distortions that may interfere with surgical planning.22 at present , panoramic radiography is not only widely available but also important to diagnose alterations in the oral condition .
they provide evidence that can be used with clinical examination to improve the diagnostic process .
thus , panoramic radiography is a useful and practical complement during the clinical examination of teeth to diagnose caries , pulp origin diseases , and diseases of the facial bones.23 in addition , panoramic radiograph allows a dentist to exam all of the teeth at once , including those still below the gum line ; therefore , caries , tooth fractures , infections , or other diseases of the bones that support the teeth can be viewed and diagnosed.24 moreover , situations of bone resorption as well as radicular cysts , tumors , inflammation , post - accident fractures , temporomandibular joint disorders , and sinusitis can be identified .
panoramic radiography is commonly requested preoperatively ; however , ohman et al25 stated that panoramic examination was not sufficient for pre - operative inspection . in pediatric patients ,
panoramic radiography can be used to monitor teeth before they emerge and analyze their location , shape , and angles as well as the presence of a supernumerary tooth or the absence of a tooth germ , thus preventing or preparing for future esthetic problems.26 overall , panoramic radiography can be used in the following situations ; for general surveys of oral health , to determine the best radiographic supplements for surgical procedures , for initial and progressive evaluations of orthodontic treatment , for information about pediatric growth and development , to review chronological dental eruptions and the axes of permanent tooth eruptions , to evaluate cystic or or neoplastic lesions , to measure the dimensions for implantology , for historical documentation , to evaluate the temporomandibular joint , and to detect the presence of foreign bodies.27 professionals should perform radiography in an environment conducive to the interpretation of the results beginning with radiographic film storage followed by a proper examination and adequate interpretation of the results .
failure to perform any of these steps properly during the examination may lead to erroneous conclusions and unnecessary patient exposure to repetitive radiographs.28 the interpretation of panoramic radiographs requires prior knowledge of the human anatomy .
moreover , a number of variations that fall within the normal range can be noted and should be examined carefully to avoid erroneous conclusions.29 to this end , radiographic images should be carefully evaluated by a trained professional .
radiographs that are sharp or detailed and have minimal distortion , correct film framing in the region , a lack of artifacts , good density , and adequate contrast are considered to be of good quality.30 radiographs that do not meet these criteria indicate that a mistake occurred during radiographic imaging and/or processing .
technical or processing errors are the main errors that occur during panoramic radiographs . therefore , care must be taken while positioning the patient and during the execution of the entire process .
studies from oral radiology institutes have indicate that positioning,7 exposure factors , artifact appearance , and technical performance are the most commonly observed errors in decreasing order .
the most common error , patient positioning , is dependent on the operator communicating and controlling the patient 's position.6 thus , positioning errors should be reduced to minimize the number of unsatisfactory radiographs and avoid unnecessary exposure of the patient to x - ray radiation .
another common error occurs when the patient 's head is positioned in front of the focus , which leads to an image with dental arches , particularly the front teeth , with a blurred , shortened , and narrowed appearance .
furthermore , the proximal area around the premolars and the column of the ramus can overlap.31 in this context , the cause of most repeated examinations was found to be due to incorrect positioning of the patient 's head . in 21.15% , 24.84% , 21.21% , and 20.30% of cases requiring re - examination , the reason for re - examination was that the patient 's head was in front of the focal trough , turned to the right or left , tilted forward , or positioned behind the focal trough , respectively .
when the patient 's head is positioned behind the plane of focus , the dental arches , especially in the anterior teeth , appear blurred and expanded in the horizontal direction .
in addition , the condyles appear at the lateral edges of the film.6,7 when the patient 's head is tilted back , the occlusal plane becomes flattened or reversely curved as the apexes of the upper incisors appear out of focus .
in addition , the condyles were projected out of the imaged area due to an increase in the intercondylar distance . when the patient 's head is tilted forward
in addition , overlapping images of the hyoid bone in the anterior mandible can be apparent
. however , this may be because the upper regions of the condyles may not be visible and the intercondylar distance could be narrowing.6,7 during radiographic examination , patients commonly tilt or turn their head to the right or left.6 when patients tilt their head , the structures imaged become asymmetrical ( the side toward the slope appears reduced in size compared with the opposite side ) , and the proximal surfaces become substantially overlapped .
when patients turn their head to one side , the teeth appear to be extended on one side of the midline and the sharp proximal surfaces appear overlapped , whereas the teeth on the opposite side appear shortened .
furthermore , the ascending mandible on one side appears much larger than that of the other , and the condyles appear to be different sizes . the patient 's chin and the occlusal plane must be positioned correctly to avoid distortions.6 the occlusal plane should be angled at -20 to -30 from the horizontal plane .
one way to position the chin is to set as the line connecting the tragus of the ear to the outer corner of the eye is parallel to the ground . if the chin was elevated , the occlusal plane on the radiograph will appear flat or inverted , and the image would be distorted .
furthermore , the shadow of the radiopaque palate bone can overlap the roots of the maxillary teeth .
conversely , if the chin is tilted down , the teeth will overlap and the symphysis of the jaw may not be visible .
in addition , both mandibular condyles may appear to be projecting out of the upper edge of the image.6 the position of the tongue also greatly influences the radiographic image quality.32 in the radiograph , the presence of a radiolucent band at the apex of the upper teeth is an indication that tongue contact with the upper palate was not sufficient .
in addition , if the tongue is not placed on the palate or the lips remain open , the incisal area on the crowns may become obscured by the air space . a dark air space between the dorsum of the tongue and the hard and soft palates ( palatoglossal air spaces ) obscure the apical region of the maxillary teeth .
to avoid this error - prone situation , which would cause the central incisor apex to be misdiagnosed , the patient should be asked to position their tongue so that it adheres to the palate ( roof of the mouth ) and to not swallow saliva to prevent tongue movement during radiography.33 incorrect patient posture and movement during radiography can produce a " ghost image " that appears as blurred areas in the image and forms large step defects in the inferior border of the mandible.6 radiographic image distortions due to the presence of anatomical structures or objects positioned outside the focal trough are known by several names including reverse shadows or shadows , secondary images , attached pictures , double images , triple pictures , ghost earrings ( cysts ) , and contralateral and ghosting images.34 these images , which are found on rotational panoramic radiographs only , are usually anatomical structures such as the vertebrae , rami , or hyoid bone , but can also be artificial objects such as metallic materials , dental crowns , wires , containment plates , earrings , necklaces , or machine parts .
the presence of anatomical objects or artificial structures can create multiple images and ghost images .
radiographic examinations complement the diagnoses of soft and hard tissue lesions and sometimes become the sole method for the detection of possible residual changes .
however , radiographic interpretations may be impaired if errors are introduced during radiographic imaging or film processing.35 to avoid unnecessary radiation exposure , the repetitive use radiography should be avoided in practice . moreover ,
unnecessary exposure can be eliminated by protecting the other areas of the body from x - ray radiation.36 positioning errors commonly occur in panoramic radiography .
the focal plane ( image layer ) in panoramic radiography has limited dimensions ; therefore , minor positioning errors can cause image distortions such as unequal vertical and horizontal magnification , the appearance of overlapping of teeth , and the loss of image sharpness . despite added efforts to avoid errors , some errors are inevitable due to the patient 's physical stature , facial asymmetry , or inability to adhere to the instructions.37 according to ono et al,37 anatomical variations might produce different radiographic images .
additionally , gianni et al38 stated that professionals who would use this radiography for treatment planning should understand those errors and account for these changes to the best of their ability , using their expertise and experience to ensure treatment success .
image discrepancies can be recognized by comparing the image sharpness and distortion of anatomical structures between the images .
considering the specific anatomical relationships in radiography , the horizontal and vertical positioning errors can be recognized .
regarding the positioning errors , focal point positioning posterior to the maxilla is easily recognizable . with vertical positioning errors , it is possible to observe blurring and a widening of structures posterior to the stern , while the structures anterior to the sternum appears shortened and slightly blurred .
moreover , the maxilla and the upper part of the ascending branch of the mandible are distorted more than the mandible .
this distortional discrepancy between maxilla and mandible became larger when the chin is elevated than lowered .
this reflects the differences in the anatomical arrangement to the focal plan and the direction of x - rays to the maxilla and mandible .
thus , the relation between anatomical position of maxillofacial structure and the distortional ratio on radiographs provide a guide for differentiating between horizontal and vertical positioning errors.32 in conclusion , panoramic radiography is a routine examination in dental clinics .
therefore , the image taking and processing procedure should be performed appropriately in order to acquire the acceptable image quality for diagnosis .
in addition , repetitive examinations and consequent patient exposure to unnecessary radiation should be minimized with technical care .
patient positioning errors are the most frequent type of error in panoramic radiography ; thus , an understanding of these errors and their consequence is required to minimize unnecessary x - ray exposure . | professionals performing radiographic examinations are responsible for maintaining optimal image quality for accurate diagnoses .
these professionals must competently execute techniques such as film manipulation and processing to minimize patient exposure to radiation .
improper performance by the professional and/or patient may result in a radiographic image of unsatisfactory quality that can also lead to a misdiagnosis and the development of an inadequate treatment plan . currently , the most commonly performed extraoral examination is panoramic radiography .
the invention of panoramic radiography has resulted in improvements in image quality with decreased exposure to radiation and at a low cost .
however , this technique requires careful , accurate positioning of the patient 's teeth and surrounding maxillofacial bone structure within the focal trough .
therefore , we reviewed the literature for the most common types of positioning errors in panoramic radiography to suggest the correct techniques .
we would also discuss how to determine if the most common positioning errors occurred in panoramic radiography , such as in the positioning of the patient 's head , tongue , chin , or body . |
type 2 diabetes mellitus is a metabolic disorder characterized by chronic hyperglycemia in association with insulin resistance , impaired relative and/or absolute insulin production , and altered glucagon secretion [ 1 , 2 ] . at the onset of diabetes
two main processes are involved in its pathogenesis : progressive decline in pancreatic islets function and reduced insulin sensitivity in peripheral tissues . in particular ,
insulin resistance ( ir ) occurs when insulin effect on muscle and fat tissues glucose uptake is defective and is not capable of inhibiting endogenous glucose production by the liver .
because skeletal muscle is responsible for 70%80% of total insulin - stimulated glucose uptake , skeletal muscle ir is a major determinant of type 2 diabetes .
interactions between genetic and environmental factors , overnutrition , and sedentary behavior promote the progression and pathogenesis of ir .
in particular , the modifications that occurred in the global food system during the past 3 - 4 decades have created an
obesogenic environment contributing to the increase of the obesity epidemic and consequent ir incidence increase .
unhealthy diet and physical inactivity are considered among leading causes of the same diseases characterized by ir .
currently , alleviating this condition is still one of the key strategies to treat [ 2 , 6 ] .
metf , a widely prescribed drug in type 2 diabetes , is being increasingly considered for treatment and prevention of sedentariness damages , as well as for the extension of healthy lifespan .
recent data showed that long - term diet supplementation with metf extends healthy lifespan in c. elegans and in middle - aged male mice [ 8 , 9 ] .
in addition , our group demonstrated how acute metf treatment may induce the generation of neohypertrophic myotubes , by using an in vitro model of satellite cells ( c2c12 cells line ) .
regular practice of physical exercise plays a very important role in maintaining a good state of health and physical well - being .
in particular , recent publications showed the active function of exercise in the reduction and counteraction of the mechanisms underlying muscle atrophy and degeneration related to the onset of peripheral ir [ 12 , 13 ] . in exercising muscle , increased energy metabolism and atp production is obtained by an increased glucose utilization .
one of the most relevant metabolic effects of exercise is the enhancement of insulin action .
many factors may contribute to increasing insulin sensitivity induced by exercise : a reduction in fat mass , an increase in muscle mass , and the increase of membrane - bond glucose transporters ( glut4 ) in muscle cells .
the effects of physical exercise may have relevant implications in the prevention and treatment of metabolic diseases .
in fact , by increasing insulin sensitivity , physical activity can reduce the risk of pathological conditions such as type 2 diabetes and metabolic syndrome . understanding the complex mechanisms that regulate insulin response and the onset of peripheral insulin resistance represents a primary goal in the treatment of diabetes and obesity complications , particularly by targeting skeletal muscle .
given the growing prevalence of the disease and the conditions of relative sarcopenia related to it , new therapeutic interventions are able not only to reduce the loss of skeletal muscle mass but also to stimulate muscle regeneration while preserving the physiology of viable muscle satellite cells become necessary . in order to determine if metformin could relieve the sedentariness damages , we studied metf effects in sedentary adult young mice , focusing our attention on metf ability to maintain mouse physical performance during submaximal incremental test .
mouse c2c12 myoblasts were purchased from the european collection of animal cell cultures ( ecacc ) .
reagents were purchased from sigma chemical co. ( saint louis , mo , usa ) .
primary antibodies against akt ( c-20 ) , camkii ( m-176 ) , calnexin ( h-70 ) , erk1 ( k-23 ) , erk2 ( c-14 ) , gapdh ( fl-335 ) , myod ( c-20 ) myogenin ( d-10 ) , myhc ( h-300 ) , myf5 ( c-20 ) , n - cadherin ( h-63 ) , p70s6 ( c-18 ) , sod2 ( fl-222 ) , perk1/2 ( e-4 - 4 ) pp70s6 ( sc-7984 ) , peroxidase - conjugated secondary antibodies for western blot analysis , and rhodamine - conjugated antibodies for immunofluorescence analysis were purchased from santa cruz biotechnology ( santa cruz , ca , usa ) .
primary antibodies phospho - akt ( ser473 ) ( d9e ) xp and phospho - ampk alpha ( thr172 ) ( 40h9 ) were purchased from cell signaling technology ( danvers , ma , usa ) .
male c57bl/6 mice ( n = 10 ) , purchased from charles river laboratories ( boston , ma , usa ) , were used for the study at 12 weeks of age .
all animals were kept on a 12 h/12 h light / dark cycle with unlimited access to standard rodent chow food and water .
mice were divided into two paired groups : one treated with metf and the other not treated ( contr ) .
blood glucose was measured in blood collected from the tip of the tail with a portable glucose measuring device ( bayer , basel , switzerland ) .
metf ( sigma chemical co. , saint louis , mo , usa ) was added to the drinking water at dose of 250 mg / kg body weight per day , for 60 days .
our pilot study confirmed that c57bl/6 mice consumed 7 ml water per day ; metf addition did not influence water consumption .
water and metf were changed daily and the dose adjusted to weight gain each week ( figures 1(a ) and 1(b ) ) .
muscular performance exercise was evaluated by a submaximal incremental test prior to and upon completion of the study .
briefly , mice were placed in adapted treadmill ( columbus instruments ) for 5 min at a 0 incline , and then treadmill speed was increased according to the scheme shown in figure 1(a ) with 1.5-min intervals at a 15 incline ( figure 1(a ) ) .
animals run until exhaustion , which is defined as remaining on the shocker plate for more than 5 seconds .
at the end of experiment , mice were sacrificed and tissues were harvested , frozen in liquid nitrogen , and stored at 80c for further analyses .
this study was conducted in compliance with approved institutional animal care of the university of milan .
c2c12 cells were maintained at 37c in humidified 5% co2 atmosphere in a growth medium ( gm ) containing dmem ( dulbecco modified eagle medium ) supplemented with 20% ( v / v ) fetal bovine serum ( fbs ) , 1% penicillin streptomycin , and 1% l - glutamine up to 70% confluence .
cell differentiation was initiated by placing 70% confluent cell cultures in differentiation medium ( dm ) , containing dmem supplemented with 1% horse serum ( hs ) , antibiotics , and 1% l - glutamine . in our in vitro differentiation model , early myotubes appeared 2448 hours ( h ) after serum starvation and neomyotubes formation was completed after 72 h .
proliferating cells , myoblasts during differentiation process , and neomyotubes were treated with 400 m metf . in the control cells metf was not added to medium .
figure 2 explains experimental study design in each phase of the protocol , with cell confluence percentage , treatments start time , and duration . to study metf action on c2c12 myoblast proliferation , we performed growth curve assay as described .
briefly , c2c12 myoblasts were plated in 60 mm 15 mm culture dishes at 40% confluence and grown in gm with or without metf and in dm .
medium was changed every 24 h and the experiment lasted until control cells achieved 70% of confluence ( 3 days ) . every day , the cells were trypsinized , stained with trypan blue , and were counted using a hemocytometer and the average values for each single day were used to plot a growth curve .
cell viability was calculated by dividing the nonstained viable cell count by the total cell count .
protein extracts , performed as described elsewhere , were obtained from mouse tissues or cell cultures by using the following lysis buffer containing : 50 mm tris / hcl , ph 7.4 , 150 mm nacl , 1% triton x-100 , 1 mm sodium orthovanadate ( na3vo4 ) , 1 mm edta , 1 mm pmsf , 1 mg / ml aprotinin , 1 mg / ml leupeptin , and 1 mg / ml pepstatin . aliquots of 30 g supernatant proteins , quantified using bradford method , were resolved on sds - page gel and transferred onto nitrocellulose membrane ( protran , whatman schleicher & schuell ) .
the membranes were incubated with specific primary antibodies and then with hrp conjugated anti - species - specific secondary antibodies . to confirm equal protein loading per sample , we used antibody anti - calnexin or anti - gadph .
quantitative measurement of immunoreactive bands intensities , visualized by an enhanced chemiluminescence method ( amersham pharmacia biotech , piscataway , nj , usa ) , was performed by densitometric analysis using the scion image software ( scion corporation , frederick , md , usa ) .
data were then converted into fold - changes ( fc ) of the controls . for tissues analysis ,
after that , slides were washed in pbs and incubated for 1 hour at room temperature with 10% horse serum in pbs with 0.05% triton x-100 to block nonspecific binding sites , while c2c12 cells , fixed and permeabilized as described , were blocked with pbs containing 1% bovine serum albumin .
slides or cells were then immunostained with specific antibodies rhodamine - conjugated and nuclei revealed with dapi staining .
cells were observed using nikon eclipse 50i microscopy and images were captured using nis - elements d 4.00 software ( nikon instruments europe bv , netherlands ) . data were displayed and analyzed using adobe photoshop cs4 .
live c2c12 cells were examined and images were acquired by phase contrast microscopy using the same microscope and digital system described above .
previous data [ 8 , 9 ] suggested the capacity of metf to extend lifespan in the nematode c. elegans and in middle - aged male c57bl/6 mice , improving healthspan mice .
we aimed to investigate the possible role of metf in the prevention of sedentariness induced damages . to achieve this scope , 12-week - old male c57bl/6 mice
were chosen , maintained in a condition of total absence of exercise , and treated for 60 days with metf , added in water at the dose of 250 mg / kg body weight per day ( figure 1(a ) ) .
we did not observe a significant modification in body weight between mice randomized to receive metf and those that did not receive metf ( figure 1(b ) ) .
a weight reduction was observed in both groups , comparing the beginning and the end of the experiment .
in contrast , we did not observe significant effect in glycemia levels ( figure 1(b ) ) .
metf effect on muscle performance evaluation revealed that metf treatment increased speed , time , work , and estimated maximal oxygen consumption ( vo2max ) of acute submaximal incremental exercise in the metf group as compared to their baseline values ( figure 1(c ) ) .
overall , muscular performance capacity was therefore increased in the metf group with respect to the pretreatment condition , despite aging and despite the lack of previous exercise training performed whatsoever .
the akt / mtor pathway , crucial regulator of skeletal muscle mass , is upregulated during hypertrophy and downregulated during muscle atrophy [ 23 , 24 ] . in gastrocnemius muscle of
metf treated animals , akt activation improved compared with controls ( figure 1(d ) ) . in addition , a trend of an akt activation was detected in quadriceps femoris muscle in metf treated mice ( figure 1(d ) ) .
liver erks activation is associated with oxidative stress and metabolic dysfunctions , main features of obesity and diabetes .
interestingly , erks activation was significantly decreased in liver of metf treated mice ( figure 1(e ) ) . immunofluorescence analysis ( figure 1(f ) ) showed how metf positively modulates ca / calmodulin dependent protein kinase ( camkii ) protein levels in liver tissue with respect to controls , suggesting an important role of metf in cellular calcium homeostasis . all together , our in vivo data indicated that metf could ameliorate not only age induced damage but also sedentariness induced injury .
we also tested metf action on skeletal muscle proliferation , differentiation , and hypertrophic process , using a c2c12 cell lines ( figure 2 ) .
c2c12 murine immortalized cell line provides a good in vitro model for the study of the major steps of myoblasts proliferation and differentiation [ 27 , 28 ] . during c2c12
myogenic phenotype achievement , myogenic regulator factors ( mrfs ) are expressed in a defined sequence ; myod and myf5 are primarily expressed , while myogenin expression is only induced upon muscle differentiation [ 27 , 28 ] .
400 m metf did not alter c2c12 proliferative potential and did not induce cytotoxic effects , as shown in figure 3(a ) and confirmed in phase contrast images in figure 3(b ) .
metf led to a significant rise in myod content , similarly to dm , compared with control ( figure 3(b ) ) .
immunofluorescence analysis during proliferation phase revealed that metf increased the protein expression of two key markers of early differentiation : myf5 and myod , suggesting an important role in differentiation induction and promotion of the myoblast commitment to myotube ( figure 3(d ) ) . to confirm this , phalloidin assay ( figure 3(e ) ) showed that the cells lost their characteristic circular shape , typical of the active proliferation phase , to achieve a new elongated morphology .
we analyzed metf action on differentiation ( figure 2 ) , from the first phase of differentiation induction ( 24 h ) , middle phase ( 48 h ) , and to the end of the process ( 72 h ) , when all fusion - competent myocytes can form multinucleated myotubes .
as shown in figure 4(b ) , metf treated cells were characterized by a significant rise in principal marker of myotube maturation , myosin heavy chain ( myhc ) protein levels with respect to control cells .
the similar metf positive action was observed for n - cadherin , a central cytoskeletal protein involved in cytoskeletal rearrangement , required to the fusion of myoblast in new myotubes . to corroborate our results , which indicated the active role of metf in differentiation progression
metf enhanced myogenin protein content and , in particular , its expression peak at 48 h ( figure 4(b ) ) .
protein level of superoxide dismutase ( sod2 ) , an enzyme that efficiently converts superoxide to the less reactive hydrogen peroxide , was significantly increased in metf cells compared to control cells ( figure 4(b ) ) .
this result suggests that metf could counteract the damage caused by a sedentary lifestyle by strengthening the antioxidants mitochondrial functions . finally , we investigated metf action on the principal signaling cascades involved in skeletal muscle formation : erks and p70s6 kinase pathways .
metf enhanced differentiation process through erks activation , while it decreased p70s6 kinase pathway ( figure 4(b ) ) .
after 48 h from differentiation induction , immunofluorescence analysis revealed that camkii protein expression was increased in neoformed myotubes treated with metf ( figure 4(d ) ) .
based on our previous data on effect of short time metf stimulation on the hypertrophic process , we studied the effect of long time metf treatment on neoformed myotubes ( figure 4(c ) ) .
24 h of metf stimuli significantly increased myhc protein levels ( figure 4(e ) ) .
as observed in all differentiation phases , metf effects were mediated by erks signaling pathways activation ( figure 4(e ) ) .
also in immunofluorescence images , we observed an important increase in myhc and n - cadherin protein content after metf treatment on neoformed myotubes .
furthermore , metf treatment caused important morphological changes in terms of morphological parameters ( myotubes length and diameter as shown in figure 4(f ) ) .
the effects of physical exercise have relevant implications in the prevention and treatment of damage induced by obesogenic environment characterized by a positive balance between energy intake and energy expenditure . moreover
, physical activity represents a primary goal in the treatment of diabetes and obesity complications , in particular in skeletal muscle system . to corroborate the fundamental role of physical activity ,
the world health organization has identified physical inactivity as the fourth - leading risk factor for global mortality .
we investigated the potential effects of in vivo treatment with metf , currently candidate drug for lifespan extension , on the prevention of sedentariness induced damages .
the study of a protocol of exercise training in mice ( figure 1(c ) ) indicated that metf could have positive effects on muscular performance .
our results , obtained from studying a model of sedentary healthy mice , confirm the positive metf action on skeletal muscle function previously obtained in older mice models .
several recent works suggest how this biguanide drug could be used in the prevention of aging induced damages [ 8 , 9 , 31 ] . in this perspective
akt signaling is central in the regulation of muscle function and , in particular , akt inactivation is associated with muscle damages induced by aging [ 23 , 33 ] .
we observed that metf increased the activation of akt in gastrocnemius and quadriceps femoris muscles ( figure 1(d ) ) , suggesting a hypothetical novel use of this drug not only in aging - related conditions , but also in sedentary - related damaged muscle conditions .
precisely , for the first time , our work showed how the beneficial effects of metf occur not only in groups already characterized by pathological conditions ( e.g. , obesity , diabetes , and aging - related disorders ) but also in healthy sedentary populations .
an additional positive action was observed in metf treated mouse liver ; metf deactivates erk and promotes camkii signaling .
erk activation is crucial in favoring the development of several liver dysfunctions , such as liver fibrosis and hepatocellular cancer , while camkii pathways activation is fundamental to preserve liver functions . from these data ,
it is reasonable to conclude that metf supplementation could be utilized to keep liver healthy .
we demonstrated in healthy humans that constant aerobic physical exercise is the clue to avoid lipid steatosis . to further clarify metf cellular mechanisms underlying the effects obtained in the mouse model , we studied metf action using an in vitro model of myoblasts , c2c12 cell line [ 27 , 28 ] .
this cell line represents the gold standard of immortalized cells to study not only myogenesis but also the hypertrophy process and its use has allowed us to investigate metf action on cellular pathways involved in muscle training , characteristic process of healthy subject .
first , we observed that metf did not modify c2c12 proliferation rate and viability ( figure 3(a ) ) , confirming the possible use of this biguanide drug without side effects on skeletal muscle .
those results have important implications since several tumors are associated with sarcopenia and cachexia , which might benefit from metf treatment .
after 24 h of metf stimuli on neomyotubes , we observed an increment in morphological parameters ( figure 4(f ) ) , similar to our previous work where on acute metf treatment was administered .
our data indicate that metf should not be considered not only a drug capable of inactivating the cellular mechanisms related to muscle injury , but also a drug capable of activating cellular processes related to muscle strengthening and hypertrophy .
we speculate that this metf capacity to enhance myotubes formation and hypertrophy could represent a possible explanation of data obtained , in vivo , in mice .
finally , our results obtained during differentiation phases showed that sod2 protein content is increased after metf stimuli ( figure 4(b ) ) .
the intracellular enzymes of the sod family act as a primary line of defense to cope with the deleterious effects of ros , thereby contributing to an overall decrease in oxidative damage .
lower sod activity is associated with sedentary lifestyle , characterized by insulin resistance , suggesting that reduced capacities of antioxidant enzymes lead to increased oxidative stress in diabetes and obesity .
in conclusion , our study reports several novel findings regarding the use of metf in a condition of absence of physical activity and specifically : ( 1 ) it improves mice physical aerobic performance ; ( 2 ) it ameliorates myotubes formation , regulating the principal molecular mediators of skeletal muscle hypertrophy and atrophy ; ( 3 ) it prevents oxidative stress damage , modulating erk and sod signaling .
the relevance of our results resides in a potential use of metf ( or drugs with similar biological proprieties ) to counteract the damages consequent to sedentariness either directly ( acting on molecular targets involved in stress condition ) or indirectly , by enhancing the known beneficial physical activity effects . in this framework ,
additional research is necessary , also in humans , to test combined therapeutical use of metf , exercise , and diet to prevent damages of sedentariness . | metformin ( metf ) , historical antihyperglycemic drug , is a likely candidate for lifespan extension , treatment and prevention of sedentariness damages , insulin resistance , and obesity .
skeletal muscle is a highly adaptable tissue , capable of hypertrophy response to resistance training and of regeneration after damage .
aims of this work were to investigate metf ability to prevent sedentariness damage and to enhance skeletal muscle function .
sedentary 12-week - old c57bl/6 mice were treated with metf ( 250 mg / kg per day , in drinking water ) for 60 days .
metf role on skeletal muscle differentiation was studied in vitro using murine c2c12 myoblasts .
muscular performance evaluation revealed that metf enhanced mice physical performance ( estimated vo2max ) .
biochemical analyses of hepatic and muscular tissues indicated that in liver metf increased ampk and camkii signaling .
in contrast , metf inactivated erks , the principal kinases involved in hepatic stress . in skeletal muscle ,
metf activated akt , key kinase in skeletal muscle mass maintenance . in in vitro studies , metf did not modify the c2c12 proliferation capacity , while it positively influenced the differentiation process and myotube maturation . in conclusion
, our novel results suggest that metf has a positive action not only on the promotion of healthy aging but also on the prevention of sedentariness damages . |
the specialty of family medicine emphasizes the importance of assessing the patient 's health , illness and disease within the context of family and community .
providing family - oriented primary care is one of the distinguishing features of this specialty .
conventionally , physician training focuses on an encounter between two people : the patient and the physician . in practice ,
the companion may provide valuable information about the patients psychological and socio - cultural dimensions .
family members as companions have important role in improving the understanding of patient during consultation .
a united states study found that 39% of patients came to the physician 's office with a family member or friend with majority ( 55% ) preferring to have a friend or family member in the examination room with them for some of their visits .
some reasons reported in the literature for accompanying the patient was to help with transportation , providing company and support .
another study showed that the accompanying person 's role was most frequently ( 68.6% ) as an advocate for the patient and their influence was usually described as positive ( 95.1% ) .
multiple studies have been done from the patient 's perspective to determine the role of companion during the consultation .
the companion views in a pakistani study demonstrated that their role during consultation assisted in the treatment of the patient .
however , data is lacking from pakistan with regards to patient 's perspective during family medicine consultations .
this study aimed at filling this gap by determining the patients perspective regarding the role and influence of the companion in the consultation .
a cross - sectional study was conducted at the family medicine clinics of aga khan university hospital karachi , pakistan .
this hospital is one of the major , not - for - profits , tertiary care teaching hospital in karachi , pakistan .
patients more than 18 years of age visiting the family medicine clinics accompanied by companions during the consultation were included in the study .
a structured questionnaire was developed in english after an extensive literature review using key words companion ,
consultation accompanying person , patient 's perspective , family medicine clinic . based on the literature review questionnaire was developed looking at the role and influence of the companion .
the demographic variables of patient were age , gender , educational status , occupation and number with relationship of accompanying persons during the consultation .
the study was conducted for a period of 1 month and was reviewed and approved by the family medicine research committee at aga khan university .
the perception variables were role of companion in consultation and influence of companion on consultation .
the role of companion included the following attributes : physical mobility , payment for the consultation , registration and form filling , overcoming language barriers , effective communication of concerns , remembering all complaints , remembering doctor 's advice and instructions , decision making and provision of emotional support during the consultation .
the influence of companion 's presence included : length of the visit , number of tests ordered , referrals , helping the doctor to understand the problem , understanding of the doctor 's advice and explanations , good relationship with the doctor , expectations achieved from the visit , focus on patient 's problems , comfort during physical examination and negotiation of mutually acceptable plan with the doctor during consultation .
the respondents had to mark the influence of the companion as passive , helpful or antagonist during the consultation .
an overall impression of how helpful the companion 's presence was assessed using five attributes ( dominant , distractive , observer , supportive and discouraging ) .
data was collected by the co - investigator after taking written informed consent and ensuring confidentiality . in all 110 patients
hundred ( 90% ) agreed to participate and were interviewed in a separate room without the companion .
data was entered and analyzed through ibm statistical product and service solutions ( spss ) software version 18 .
factors affecting perception such as age , gender , education , relationship of companion was compared with the role and influence of companion on consultation .
relationship of companion with the patient was subdivided in two groups , i.e. , immediate ( spouse parents and children ) and distant relatives .
a total of 100 patients participated in this study . majority of the participants were aged between 18 and 44 years , whereas , only 7% of the participants were more than 65 years of age [ table 1 ] .
approximately , 86% of the companions were immediate relatives of the patient including children accompanying in 42% of the cases .
59% were accompanied by one companion while 34% have two and only 6% had three people accompanying them .
companion 's characteristics nearly 93% of the patients were accompanied by a companion throughout consultation whereas 83% continued to accompany them during physical examination .
majority of the participants responded that companions were present to either provide company 90% and/or emotional support 90% [ figure 2 ] .
around 57% of the participants reported that their companion 's role was to facilitate communication regarding their concerns , 51% of the companions helped in recalling advice given by the doctor and 49% assisted in decision making during the consultations .
role of companion during the consultation ( n = 100 for each variable ) factors affecting the perceived role of the companion were analyzed to verify whether there was a significant gender difference .
results of comparing the educational level of the patient with the different roles did not show any statistical significance . comparing the relationship of the companion to the patient with respect to different roles showed statistical significance in mobility ( p = 0.016 ) and for decision making ( p = 0.006 ) by immediate relatives .
similarly , immediate relatives provided emotional support to patient in 68% cases but the results were not significant .
age was an important predictor for the companion 's role in being a helper for mobility purpose ( p = 0.002 ) .
overall patients less than 40 years of age were more satisfied with the medical care provided .
one - third 34% patients thought that consultations were longer when a companion was present than when they were alone [ figure 3 ] .
most of the companions remained passive during the consultation and they did not contribute in developing a good relationship between the doctor and patient ( p = 0.058 ) .
females were more helpful in influencing the understanding of the doctor 's advice and explanation , but the results were not found to be significant ( p = 0.667 ) .
influence of companion during consultation ( n = 100 ) around 75% ( n = 57 ) of the female companions were found to have no influence in achieving the expectations from the visit , whereas male companions were found to be relatively helpful in reaching the expectations of the patients ( 54% vs. 25% , p = 0.008 ) respectively .
similarly , females as compared with males had no influence in helping the patients negotiate a mutually acceptable plan with the doctor ( 21% , vs. 41% p = 0.045 ) respectively .
males were slightly more helpful 54.2% ( n = 13 ) in focusing on patients problems and keeping on track during consultation as compared with females 40.8% ( n = 31 ) .
overall the influence of companions over the consultation was reported to be supportive in 62% of the consultations , whereas 33% were observers and 5% dominated or had a discouraging effect on the consultation .
a total of 100 patients participated in this study . majority of the participants were aged between 18 and 44 years , whereas , only 7% of the participants were more than 65 years of age [ table 1 ] .
approximately , 86% of the companions were immediate relatives of the patient including children accompanying in 42% of the cases .
59% were accompanied by one companion while 34% have two and only 6% had three people accompanying them .
companion 's characteristics nearly 93% of the patients were accompanied by a companion throughout consultation whereas 83% continued to accompany them during physical examination .
majority of the participants responded that companions were present to either provide company 90% and/or emotional support 90% [ figure 2 ] .
around 57% of the participants reported that their companion 's role was to facilitate communication regarding their concerns , 51% of the companions helped in recalling advice given by the doctor and 49% assisted in decision making during the consultations .
role of companion during the consultation ( n = 100 for each variable ) factors affecting the perceived role of the companion were analyzed to verify whether there was a significant gender difference .
results of comparing the educational level of the patient with the different roles did not show any statistical significance . comparing the relationship of the companion to the patient with respect to different roles showed statistical significance in mobility ( p = 0.016 ) and for decision making ( p = 0.006 ) by immediate relatives .
similarly , immediate relatives provided emotional support to patient in 68% cases but the results were not significant .
age was an important predictor for the companion 's role in being a helper for mobility purpose ( p = 0.002 ) .
overall patients less than 40 years of age were more satisfied with the medical care provided .
one - third 34% patients thought that consultations were longer when a companion was present than when they were alone [ figure 3 ] .
most of the companions remained passive during the consultation and they did not contribute in developing a good relationship between the doctor and patient ( p = 0.058 ) .
females were more helpful in influencing the understanding of the doctor 's advice and explanation , but the results were not found to be significant ( p = 0.667 ) .
influence of companion during consultation ( n = 100 ) around 75% ( n = 57 ) of the female companions were found to have no influence in achieving the expectations from the visit , whereas male companions were found to be relatively helpful in reaching the expectations of the patients ( 54% vs. 25% , p = 0.008 ) respectively .
similarly , females as compared with males had no influence in helping the patients negotiate a mutually acceptable plan with the doctor ( 21% , vs. 41% p = 0.045 ) respectively .
males were slightly more helpful 54.2% ( n = 13 ) in focusing on patients problems and keeping on track during consultation as compared with females 40.8% ( n = 31 ) .
overall the influence of companions over the consultation was reported to be supportive in 62% of the consultations , whereas 33% were observers and 5% dominated or had a discouraging effect on the consultation .
the purpose of the study was to determine the influence of companion / s accompanying patients on the consultation in family medicine clinics .
our study showed that majority ( 62% ) of the companions had a supportive role during the consultation . in this study ,
majority 83% of the companions remained in the room during the physical examination as compared with 43% and 16% in the united states . among the possible reasons
could be that our sample mainly comprised of women 76% and due to cultural reasons the companions acted as chaperones even if the doctor and physician were of the same gender .
patients were accompanied by a companion for a variety of reasons and 90% did provide company and emotional support showing strong family relations which is in accordance with the international data .
our study highlighted the role of companion in effectively communicating concerns to doctors , which is also supported by literature .
role of the immediate relatives in decision making came out to be significant , this could be explained by the fact that most of our patients were women and traditionally they may not have the autonomy for independent decision making .
adelman et al . found that geriatric patients were accompanied with a companion because of ambulatory difficulties , mental illness and cognitive impairment .
this is corroborated in our case where patient 's age was an important predictor for help with regards to mobility ( p = 0.002 ) .
culturally in south asia it is a norm for older adults to have an accompanying person wherever they go out of respect and at times it is a perceived physical limitation of the person . in this study ,
67% of the companions were found to be helpful in understanding doctor 's advice and developing doctor 's understanding of the patient 's problems .
patient 's understanding was increased in 60% of cases by the companion 's presence similar to a study conducted in united kingdom .
an international study showed marginal to no effect on tests , treatment and length of visit this is similar to the results of our study . in one of the previous studies conducted by qidwai et al . in pakistan companions reported that females were more verbally active than their male counterpart that is not supported by our study as no influence of gender of the companion
an overall supportive influence of accompanying people on patient doctor interaction has been described in previous studies , which is also supported by our study in 62% of the cases .
a systematic review on the role of companion in the triadic medical consultation also highlights that companions are frequently perceived as helpful and assume a variety of roles .
the small sample size restricted the detailed exploration of subgroup differences and along with patients , opinions of companion and the physician could have been included . secondly , since this was a cross - sectional study therefore causality can not be established .
help in transport and effective communication of their concerns are the most common reported roles .
based on the results , we recommend that the consultation models need to be broadened to include the companion .
future studies are needed to include the doctor 's perspective on the role and influence of the companion . | background : companions often accompany the patient in family medicine clinics and may influence the consultation .
this study aims to determine the patients perspective regarding the role and influence of the companion in the consultation process.materials and methods : a cross - sectional study was conducted at the family medicine clinics of a university hospital .
adult patients accompanied by companions during the consultation were interviewed through a structured questionnaire .
attributes with respect to role and influence of companion on the consultation were assessed .
data was entered and analyzed through ibm statistical product and service solutions ( spss ) software version 18 using the chi - square test.results:a total of 100 patients accompanied by companions participated in the study .
majority of companions were present to either provide company ( 90% ) and/or emotional support ( 90% ) .
immediate relatives had a role in mobility ( p = 0.016 ) and decision making ( p = 0.006 ) .
most companions remained passive and did not contribute to the doctor patient relationship ( p = 0.058 ) .
male companions were relatively helpful ( 54% vs. 25% , p = 0.008 ) in achieving the expectations from the visit .
the companion played a supportive role in 62% of the consultations.conclusion:this study signifies a supportive role of companion in a consultation which emphasizes the need of consultation models to include the companion . |
chronic recurrent non - specific parotitis is characterized by recurrent episodes of swelling and pain of unknown etiology in the parotid gland .
sialography is a hallmark in the diagnosis of salivary gland disorders ; newer imaging modalities like ct - sialography , sialoendoscopy and mri can be used .
various treatment modalities have been tried , from conservative approach to surgical excision depending on the recurrence rate and severity of the condition .
although symptomatic treatment with antibiotics and analgesic , injection of intraductal medicament , aggressive treatment like duct ligation or excision of gland are some of the treatment modalities , there is no established algorithm as to which treatment method should be opted in such clinical situation .
a 20 years old male patient reported with pain and salty taste in the mouth that had began before a week .
examination revealed an elevated right parotid papilla ; ropy , cloudy appearing saliva was oozing out on milking the gland .
sialography as a treatment showed a good response with no recurrence after two years of follow - up .
recurrent attacks significantly affect the quality of life and also lead to progressive gland destruction .
hence , conventional sialography is useful in the diagnosis and also effective as a therapeutic aid in recurrent parotitis .
acute refers to sudden onset of pain and swelling in parotid gland whereas chronic recurrent parotitis ( crp ) is characterized by intermittent , painful and swelling of the gland which may or may not be associated with food intake ( 1 ) . the term chronic recurrent non - specific parotitisis used in cases where no definite etiology is identified ( 2 ) .
researchers have suggested that recurrent parotitis arises due to retrograde infections eventual to stasis of saliva , allergic , immune deficiency , genetic and hereditary factors ( 2 , 3 ) . however , none of these factors have been proven as an actual cause for the disease .
there is lot of disagreement regarding the treatment of recurrent parotitis due to ambiguity about its etiology .
treatment of acute phase is aimed at relieving symptoms and prevention of damage to gland parenchyma ( 4 ) . proposed
treatments for crp include steroids , tetracycline and 1% methyl violet as intra - ductal medicament ( 5 , 6 ) .
conventional sialography can also be used as a therapeutic aid in cases of recurrent infection as it helps in salivary gland lavage , removal of small calculi and mucous plugs within the ducts ( 7 , 8) . our primary aim in this case was to relieve the pain and reduce the frequency of recurrence . to achieve this
history : a 20 years old male patient presented with pain in front of the right ear and salty taste on having food that had began before a week .
pain in the right parotid gland region was sudden , intermittent , throbbing in quality and initiated while the patient was chewing food and increased in intensity especially on taking citrus food .
the patient gave history of at least two episodes of recurrent swelling and pain per year on the right side of the face since two - three years .
physical examination : on general physical examination , the patient was febrile and lymph nodes were palpable in the submandibular region bilaterally which was single , firm , freely mobile and tender . on extra oral examination ,
the right parotid gland was tender on palpation and firm in consistency whereas the left parotid gland was normal .
intra - oral examination revealed an elevated right parotid papilla ( figure 2 ) . on milking the gland a thick , ropy , cloudy appearing saliva was oozing out of the duct
extra oral view showing the bilaterally symmetrical face intra oral view showing elevated right parotid papilla investigation : although antibiotic sensitivity test was the norm of investigation , it was not advised as the patient was already taking antibiotic which was prescribed by a private practitioner .
salivary flow rate was assessed using drooling method . before unstimulated whole saliva was collected ,
the patient was instructed to refrain from eating and drinking for 90 minutes to avoid any salivary stimulation .
later , the patient was asked to drool the saliva in a vial at every one minute for five minutes . for stimulated method , 2% citric acid was placed on the tongue at every 30 seconds for five minutes and the patient asked to drool the saliva in a vial .
salivary flow rate of unstimulated and stimulated saliva was 0.3ml / min and 1ml / min respectively suggesting normal salivary flow rate .
sialography was performed with 2ml of sodium diatrizoate contrast media which was slowly injected into the gland until some resistance was felt , and the patient reported slight pain in the gland area .
digital opg showed uniform normal course and caliber of stensen 's duct measuring about 23 mm in diameter from opening till the periphery of the gland .
terminal ductules showed areas of blobs and dots of contrast media indicating sialectasis ( figure 3 ) .
fifty percent excretion of the dye was observed in digital opg after one minute ( figure 4 ) , and complete excretion of dye was observed in five minutes suggesting normal functioning of the gland .
the patient was instructed to use secretogogues ( lime juice ) for three days to clear the debris and to stimulate the salivation .
sialograph shows the duct which is normal in course and caliber with dots and blobs appearance at the terminal ductules approximately 50% excretion of contrast medium after 1 diagnosis and treatment : based on patient history , clinical finding , investigation and sialographic appearance a final diagnosis of chronic recurrent non - specific parotitis was made as we were not able to find out any specific etiologic factor .
sialography was performed not only for the diagnostic purpose but also for gland lavage which helped in clearing the mucus plug or cellular debris .
the patient was advised to continue antibiotics and analgesic for seven days and was kept under regular follow - up once in six months for a two years ' duration .
the treatment seemed to be effective as there was no recurrence during the two years ' follow - up .
crp patients suffer from recurrent swelling and tenderness of the involved gland which gradually leads to the destruction of the gland . reducing the frequency of recurrence and improving the quality of life are the objective of treatment .
key to the successful treatment of crp is the complete removal of cellular debris and precipitated serum proteins from the ductal lumen .
this can be skillful achieved with sialography , ductal dilation with lacrimal probe and gland lavage ( 9 ) .
elevated parotid papilla , reduced salivary flow and secretion are viscous and milky in appearance with clumps of material interspersed ( 10 ) .
the etiology of the disease is multifactorial .there are various theories to explain the pathogenesis , one theory postulates that reduced salivary flow results in decreased mechanical cleansing , allowing bacteria to colonize and invade the duct .
whereas the other proposes that repeated episodes of acute infection may lead to mucus metaplasia of ductal epithelium resulting in increased mucus content of secretions , stasis and further episodes of inflammation .
secretory disorders like difference in the secretion and excretion of fluid are also considered as having an important role in the pathogenesis(10 ) .
studies have reported that the ultrasonagraphy and sialography appearance for recurrent parotitis is characterized by sialectasis with strictures and dilatation of the major duct ( 9 ) .
sailoendoscopy revealed white wall and lack of vascularity in the ductal layer in 75% of crp cases and multiple fibrinous debris and mucous plug in 45% of juvenile recurrent parotitis ( 11 ) . in our case
although sialography is primarily used for diagnostic purpose , it can also be used as treatment for recurrent parotitis and obstructive disorders ( 12 ) .
sialography improves patency of duct during cannulation by flushing action of irrigant which helps in removing any epithelial debris and mucous plug .
the iodine content of the contrast medium acts as an antiseptic agent , thus reducing symptoms and preventing recurrence .
this treatment should be repeated once in every two days along with sialogouges until the swelling is subsided and saliva is clear . in our case ,
sialography was done only once and the patient showed no recurrence during the two years ' follow - up , similar with many other reported cases ( 5,7,8,13 ) .
other intracanal medicaments have been tried by many authors - bowling etal reported intraductal tetracycline instillation causing acinar atrophy in rats ( 6 ) .
mandel and kaynar ( 1995 ) stated that although steroid reduces swelling and inflammation , it is not effective in preventing recurrence ( 5).nahileli et al .
( 2004 ) stated that use of sailoendoscopy facilitates direct visualization of the intraglandular structures and combination of steroid lavage with ductal dilatation will help in reducing the symptoms as well as recurrence(14 ) .
however , the success of the treatment depends on intraductal lavage of the affected gland rather than the type of intraductal medicament used as various studies showed no difference in the frequency of recurrence rate .
watkin and hobsely found that 56% of adult and 64% of children showed good response to conservative treatment in a five years ' follow - up study ( 15 ) .
bilateral sailoendoscopy and lavage with intraductal hydrocortisone resulted in 92% recurrence free rate upto 36 months in juvenile recurrent parotitis cases ( 16 ) .
few case reports showed sialography as alternative treatment for this condition as it is minimally invasive procedure with favorable outcome in juvenile recurrent parotitis ( 58 ) .
however , if the symptom persists or worsens , then an aggressive treatment should be opted such as duct ligation , parotidectomy and tympanic neurectomy . in conclusion ,
as the cause for crp is multifactorial , patients should be educated to take higher liquid content in the diet , to do self - massaging of the gland and to maintain oral hygiene so as to avoid retrograde infection . in spite of various advanced imaging techniques , there is no established algorithm as to which imaging modality should be done in a given clinical situation .
in our case we preferred sialography as it is simple to perform and cost - effective .
it also has added therapeutic effect , especially in conditions where it can prevent recurrence and provide maximum benefit to the patient . | backgroundchronic recurrent non - specific parotitis is characterized by recurrent episodes of swelling and pain of unknown etiology in the parotid gland .
sialography is a hallmark in the diagnosis of salivary gland disorders ; newer imaging modalities like ct - sialography , sialoendoscopy and mri can be used .
various treatment modalities have been tried , from conservative approach to surgical excision depending on the recurrence rate and severity of the condition .
although symptomatic treatment with antibiotics and analgesic , injection of intraductal medicament , aggressive treatment like duct ligation or excision of gland are some of the treatment modalities , there is no established algorithm as to which treatment method should be opted in such clinical situation.case detaila 20 years old male patient reported with pain and salty taste in the mouth that had began before a week .
examination revealed an elevated right parotid papilla ; ropy , cloudy appearing saliva was oozing out on milking the gland .
unstimulated and stimulated whole salivary flow rate was assessed using drooling method .
sialography was used as a diagnostic and a therapeutic aid . in our case ,
sialography as a treatment showed a good response with no recurrence after two years of follow - up .
we highlighted the role of sialography as a therapeutic aid.conclusionrecurrent attacks significantly affect the quality of life and also lead to progressive gland destruction . preventing or reducing the frequency of recurrence remains the goal of therapeutic procedure .
hence , conventional sialography is useful in the diagnosis and also effective as a therapeutic aid in recurrent parotitis . |
natural killer ( nk ) cells are large granular lymphocytes that have the ability to kill cells without prior sensitisation and therefore play an important role in host defence .
nk cell - mediated target cell killing is mainly implemented by two pathways , namely the perforin / granzyme pathway and the fas ligand ( fasl ) pathway [ 2 - 5 ] . in the latter pathway ,
fasl on effector cells binds fas present on the target cells which results in oligomerization of fas and activation of caspase 8 .
perforin and granzymes , of which granzyme b is the most potent one , reside in the granules of nk cells and are released by exocytosis after conjugation between the effector and target cell . inside the cytoplasm of the target cell ,
granzyme b activates caspase 3 directly or indirectly , via a mitochondrion - dependent pathway .
nk cells display two types of surface receptors : ( i ) activation receptors , such as the cd161 molecule that recognises structures on target cells and triggers nk cells to kill ; ( ii ) inhibitory receptors , such as ly-49 molecules , that recognise target cell mhc class i molecules and inhibit killing by nk cells .
when mhc class i molecules are absent or expressed in reduced amounts , the nk cells proceed with their attack .
a recent study shows that h-2dmhc class i molecules on target cells partially inhibit granzyme a release from mouse ly-49ank cells .
however , it is unclear whether such partial inhibition of granzyme a release is sufficient to protect target cells .
moreover , the assay used in the past to detect cytotoxicity by cytolysis is the release of cr from loaded target cells .
a recent study questioned the relevance of the cr release assay compared to what occurs in vivo , whereas the dna fragmentation assay to measure apoptosis coincided with in vivo results .
therefore , it is needed to explore whether the protective role of mhc class i is also operative in apoptosis induced by nk cells .
compared with nk cells from spleen and peripheral blood , hepatic nk cells , also called pit cells , are much more cytotoxic .
strategically located in the liver sinusoids , they constitute a first line of cellular defence against invading cancer cells , like colon carcinoma cells [ 15,17 - 20 ] . in this study , using freshly isolated hepatic nk cells and cc531s , a syngeneic fas ligand - resistant colon carcinoma cell line , we ( i ) demonstrated that mhc class i protects colon carcinoma cells from hepatic nk cell - mediated killing ; and ( ii ) showed the involvement of the perforin / granzyme pathway in the mechanism of mhc class i protection .
protection of target cells from nk cell lysis by expression of mhc class i molecules has been demonstrated in different experimental systems in human , mouse and rat . in rat ,
several mhc class i genes have been identified , i.e. , rt1.a , rt1.c and rt1.e .
it has been shown that transfection of rt1.a and rt1.c protects target cells from lysis by nk cells .
however , other data indicate that rt1.a molecules inhibit nk cells , whereas rt1.c region molecules activate natural killing .
masking of rt1.a , rt1.c , or both alleles on target cells with allele - specific mabs , has no effect on lysis by nk cells . in view of these facts ,
mab ox18 was chosen to investigate the mechanism of mhc class i protection of cc531s target cells from hepatic nk cell - mediated killing .
it has been found that ( i ) mab ox18 binds total rat mhc class i , ( ii ) masking of mhc class i molecules on target cells by mab ox18 or f(ab')2 fragments of ox18 enhances the syngeneic target cell cytolysis by rat nk cells , and ( iii ) the enhanced nk cell - mediated target lysis by mab ox18 is not caused by antibody dependent cellular cytotoxicity ( adcc ) .
the expression of mhc class i molecules on cc531s cells was examined by flow cytometry . in agreement with a previous study ,
the mab cc52 , used as a negative control during functional assays , was shown to bind to cc531s cells , as has also been shown previously ( data not shown ) .
when cc531s cells were preincubated with mab ox18 against mhc class i molecules , the hepatic nk cell - mediated cytolysis against cc531s cells was increased in comparison with the lysis of untreated or control mab treated tumour cells ( fig .
similarly , the preincubation of cc531s cells with mab ox18 increased fragmented dna ( apoptosis ) in cc531s cells when coincubated with hepatic nk cells ( fig .
cc531s cells showed the typical morphological characteristics of apoptosis such as nuclear fragmentation , chromatin condensation ( fig .
when cc531s cells were pretreated with mab ox18 , the number of apoptotic cc531s cells increased ( figs .
it has been reported that anti - mhc class i antibody alone can induce apoptosis in cancer cells . in order to address the question whether the enhanced apoptosis and cytolysis in cc531s cells was induced by the binding of mab ox18
after 3 , 24 or 48 hours of incubation , no apoptosis or cytolysis in cc531s cells was observed ( data not shown ) .
this is the first time it is shown that , besides cytolysis , mhc class i molecules protect cancer cells from apoptosis induced by nk cells .
this is relevant because it has been suggested that in vitro assays quantifying effector cell - mediated apoptosis , but not cytolysis , are in accordance with in vivo results .
effect of anti - mhc i mab ox18 on hepatic nk cell - mediated cc531s cell cytolysis ( a , cr release ) and apoptosis ( b , dna fragmentation ) . (
a ) , cr - labeled cc531s cells were incubated at an e : t ratio of 10:1 with freshly isolated hepatic nk cells for 18 hours .
( b ) , [ h]-tdr labeled cc531s cells were incubated at an e : t ratio of 10:1 with hepatic nk cells for 3 hours .
conab , control antibody . * p < 0.05 , * * p < 0.01 vs. the treatment with medium only ( lsd test ) .
hepatic nk cell - induced apoptosis in cc531s cells as observed by fluorescence microscopy ( a , c , e ) and light microscopy ( b , d , f ) .
cc531s cells were coincubated with hepatic nk cells at an e : t ratio of 10:1 for 3 hours .
( a , b ) , coincubation of cc531s cells with hepatic nk cells in medium .
( e , f ) , cc531s cells were pretreated with anti - mhc i mab ox18 and hepatic nk cells were pretreated with dci .
( g ) , the percentage of apoptotic cc531s cells was determined in preparations by counting at least 300 cells per sample .
p < 0.05 , * * p < 0.01 vs. the corresponding control ( lsd test ) .
to address the mechanism of protection of mhc class i on cc531s cells , we used several approaches to assess the granule exocytosis pathway : granzyme inhibition by dci , cachelation by egta and caspase inhibition by z - vad - fmk .
when hepatic nk cells were preincubated with dci , a granzyme inhibitor in intact cells , hepatic nk cell - mediated cc531s cytolysis was largely inhibited ( fig .
3a ) and apoptosis was completely inhibited in the ox18-treated and untreated cc531s cells ( fig . 3b and figs .
effect of dci and egta on anti - mhc i mab ox18 enhanced cytolysis ( a , cr release ) and apoptosis ( b , dna fragmentation ) of cc531s cells by hepatic nk cells .
cc531s cells were pretreated with mab ox18 and hepatic nk cells were pretreated with dci .
( a ) , cytolysis was determined by a 18 hour cr - release assay .
( b ) , apoptosis was determined by a 3 hour quantitative dna fragmentation assay .
the e : t ratio was 10:1 . * * p < 0.01 vs. the corresponding control ( lsd test ) .
the perforin / granzyme pathway is ca - dependent , involving extracellular caat three distinct steps : ( i ) granule exocytosis ; ( ii ) binding of secreted perforin to the membrane of target cells ; and ( iii ) perforin polymerisation . when extracellular cawas chelated by egta during the co - incubation , the anti - mhc class i mab - enhanced cytolysis and apoptosis of cc531s cells by hepatic nk cells was completely inhibited ( figs . 2 , 3 ) .
the results obtained by granzyme inhibition and cachelation strongly suggest the involvement of the perforin / granzyme pathway in the anti - mhc i mab ox18 enhanced apoptosis and cytolysis . in order to verify these results , we made use , in a separate series of experiments , of the pan - caspase inhibitor z - vad - fmk .
it has been shown that in several apoptotic pathways , including the perforin / granzyme pathway and the fasl pathway , dna fragmentation is caspase dependent .
on the other hand , cytolysis is also caspase dependent in the fasl pathway , but caspase independent in the perforin / granzyme pathway [ 31 - 33 ] . as a consequence , this
indeed , when z - vad - fmk was present during the coincubation of cc531s cells with hepatic nk cells , the ox18 enhanced apoptosis was completely inhibited , while cytolysis was not inhibited at all ( fig .
fragmentation of the nucleus and condensation of the chromatin were also inhibited ( data not shown ) .
effect of the pan caspase inhibitor z - vad - fmk on anti - mhc i mab ox18 enhanced cytolysis ( a , cr release ) and apoptosis ( b , dna fragmentation ) .
cc531s cells were incubated at an e : t ratio of 10:1 with hepatic nk cells for 18 h ( cr release ) or 3 h ( dna fragmentation ) . * * p < 0.01 vs. the corresponding control ( lsd test ) .
mhc class i expression protects colon carcinoma cells from apoptosis and cytolysis induced by hepatic nk cells , by blocking the perforin / granzyme pathway .
this mechanism of immune escape could possibly contribute to the incomplete killing by hepatic nk cells of arriving colon carcinoma cells in the liver sinusoids , resulting in the formation of liver metastases .
hepatic nk cells were isolated and purified from 3- to 5-month old male wag / rij rats ( rt1 , a wistar - derived inbred strain , harlan , the netherlands ) according to the method described before .
the purity of the isolated hepatic nk cells was at least 90% , as evaluated by light microscopy using may - giemsa staining cytospins and by flow cytometric analysis using mab 3.2.3 , which recognises cd161a molecules on the surface of rat nk cells .
the viability of the recovered cells was more than 95% , as determined by trypan blue exclusion .
the procedures used in this study were approved by the local ethical committee ( license no .
cc531s , a dimethylhydrazine - induced colon carcinoma of wag / rij rats , was maintained in culture medium rpmi-1640 ( gibco , life technologies , gent , belgium ) , supplemented with 10% fetal calf serum ( eurobiochem , bierges , belgium ) , penicillin ( 100 u / ml ) , streptomycin ( 100 g / ml ) , and glutamin ( 0.2 mm ) ( gibco , life technologies , gent , belgium ) .
3,4-dichloroisocoumarin ( dci ) and ethylene glycol - bis(-aminoethyl ether)-n , n - tetraacetic acid ( egta ) , were purchased from icn ( asse - relegem , belgium ) .
the monoclonal antibody ( mab ) ox18 ( anti - rat mhc class i , igg1 ) was purchased from ecacc ( porton down , salisbury , uk ) .
mab cc52 ( igg1 ) was developed in the department of surgery and pathology , leiden university medical center , the netherlands .
z - val - ala - asp(ome)-fluoromethylketone ( z - vad - fmk ) was obtained from bachem ( bubendorf , switzerland ) .
the expression of mhc class i molecules on the cc531s cells was determined by one - colour flow cytometric analysis , as described previously .
briefly , 0.5 10cells were incubated ( 30 minutes , 4c ) with the primary antibody ox18 .
cells were then washed three times with cold phosphate - buffered saline ( pbs ) , containing 1% bovine serum albumin and 0.02% sodium azide .
subsequently , cells were incubated with fitc - conjugated antimouse igg1 ( gilbertsville , pa ) . after incubation and washing ,
cells were fixed with 2% paraformaldehyde in pbs and analysed ( facsort ; becton dickinson , mountain view , ca , usa ) .
[ methyl - h]thymidine ( [ h]-tdr ) labeled cc531s cells were preincubated with the mab ox18 ( final concentration was 10 g / ml ) for 15 minutes , at room temperature , and freshly isolated hepatic nk cells were preincubated with 50 m dci for 30 minutes .
it was shown that mab cc52 binds to cc531s cells and is used in this study as a negative control in the functional assays .
egta ( final concentration was 5 mm ) and z - vad - fmk ( final concentration 80 m ) were present during coincubation .
the hepatic nk cells ( 10cells in 100 l ) and cc531s cells ( 10cells in 100 l ) were placed in triplicate in 1.5 ml microcentrifuge tubes .
after 3 hours coincubation and centrifugation , the incubation medium was removed from the tubes .
the lysates were ultracentrifuged ( 10,000 g for 15 minutes at 4c ) to separate fragmented dna from intact dna . radioactivity ( cpm ) in the incubation medium , in the 10,000 g supernatant and in the 10,000 pellet was determined in a counter ( beckman , fullerton , ca , usa ) .
the percentage of fragmented dna was calculated using the following formula : in which : cpmfr = the radioactivity in the incubation medium plus the cpm in the 10,000 g supernatant ; cpmtotal = cpmfr + radioactivity in the 10,000 g pellet ; exp = experimental ( target cells with effector cells ) ; spont = spontaneous ( target cells and medium only ) .
cc531s cells ( 10cells in 100 l ) , were coincubated with hepatic nk cells ( 10cells in 100 l ) in a flat - bottom 96-multiwell plate , for 3 hours at 37c .
after coincubation , nuclei of the cells were stained with hoechst 33342 and propidium iodide , as described previously .
preparations were studied with a leica dm irb / e inverted fluorescence microscope ( leica , heidelberg , germany ) with ultraviolet excitation , at 340 to 380 nm . the images were recorded and the number of apoptotic cc531s cells was determined by the characteristic morphological changes of the apoptotic nucleus , i.e. , condensation of chromatin and nuclear fragmentation .
cc531s cells , not coincubated with hepatic nk cells , were used as a control .
the fragmented nuclei were counted in at least 300 cells in each preparation and the percentage of apoptotic cc531s cells was calculated using the following formula : cytolysis was measured in a 18 hour cr - release assay using 96-multiwell plates , as described previously .
briefly , cr - labeled cc531s cells and hepatic nk cells were treated with the mab or dci or egta or z - vad - fmk , as mentioned above .
cc531s cells at a concentration of 10cells / well were coincubated with hepatic nk cells at an effector - to - target ( e : t ) ratio of 10:1 in a final volume of 200 l . after 18 hours coincubation ,
the supernatant of each well was aspirated and radioactivity was determined in a counter .
the cpm usually ranged from 1200 cpm ( spontaneous release ) to 5000 cpm ( maximal release ) .
results were expressed as percentage of specific lysis according to the formula : in which : exp = experimental ( target cells with effector cells ) ; spont = spontaneous ( target cells and medium only ) ; max = maximal , obtained after the addition of sds ( 1% final concentration ) .
statistical analysis was performed by one - way anova ( n = 3 in each group , unless otherwise indicated ) with post - hoc multiple comparison analysis made by lsd ( the least - significant difference ) test , using spss statistical package ( spss inc . ,
statistically significant difference between two groups was considered at the level of p < 0.05 .
hepatic nk cells were isolated and purified from 3- to 5-month old male wag / rij rats ( rt1 , a wistar - derived inbred strain , harlan , the netherlands ) according to the method described before .
the purity of the isolated hepatic nk cells was at least 90% , as evaluated by light microscopy using may - giemsa staining cytospins and by flow cytometric analysis using mab 3.2.3 , which recognises cd161a molecules on the surface of rat nk cells .
the viability of the recovered cells was more than 95% , as determined by trypan blue exclusion .
the procedures used in this study were approved by the local ethical committee ( license no .
cc531s , a dimethylhydrazine - induced colon carcinoma of wag / rij rats , was maintained in culture medium rpmi-1640 ( gibco , life technologies , gent , belgium ) , supplemented with 10% fetal calf serum ( eurobiochem , bierges , belgium ) , penicillin ( 100 u / ml ) , streptomycin ( 100 g / ml ) , and glutamin ( 0.2 mm ) ( gibco , life technologies , gent , belgium ) .
3,4-dichloroisocoumarin ( dci ) and ethylene glycol - bis(-aminoethyl ether)-n , n - tetraacetic acid ( egta ) , were purchased from icn ( asse - relegem , belgium ) .
the monoclonal antibody ( mab ) ox18 ( anti - rat mhc class i , igg1 ) was purchased from ecacc ( porton down , salisbury , uk ) .
mab cc52 ( igg1 ) was developed in the department of surgery and pathology , leiden university medical center , the netherlands .
z - val - ala - asp(ome)-fluoromethylketone ( z - vad - fmk ) was obtained from bachem ( bubendorf , switzerland ) .
the expression of mhc class i molecules on the cc531s cells was determined by one - colour flow cytometric analysis , as described previously .
briefly , 0.5 10cells were incubated ( 30 minutes , 4c ) with the primary antibody ox18 .
cells were then washed three times with cold phosphate - buffered saline ( pbs ) , containing 1% bovine serum albumin and 0.02% sodium azide .
subsequently , cells were incubated with fitc - conjugated antimouse igg1 ( gilbertsville , pa ) . after incubation and washing ,
cells were fixed with 2% paraformaldehyde in pbs and analysed ( facsort ; becton dickinson , mountain view , ca , usa ) .
[ methyl - h]thymidine ( [ h]-tdr ) labeled cc531s cells were preincubated with the mab ox18 ( final concentration was 10 g / ml ) for 15 minutes , at room temperature , and freshly isolated hepatic nk cells were preincubated with 50 m dci for 30 minutes .
it was shown that mab cc52 binds to cc531s cells and is used in this study as a negative control in the functional assays .
egta ( final concentration was 5 mm ) and z - vad - fmk ( final concentration 80 m ) were present during coincubation .
the hepatic nk cells ( 10cells in 100 l ) and cc531s cells ( 10cells in 100 l ) were placed in triplicate in 1.5 ml microcentrifuge tubes .
after 3 hours coincubation and centrifugation , the incubation medium was removed from the tubes .
the lysates were ultracentrifuged ( 10,000 g for 15 minutes at 4c ) to separate fragmented dna from intact dna .
radioactivity ( cpm ) in the incubation medium , in the 10,000 g supernatant and in the 10,000 pellet was determined in a counter ( beckman , fullerton , ca , usa ) .
the percentage of fragmented dna was calculated using the following formula : in which : cpmfr = the radioactivity in the incubation medium plus the cpm in the 10,000 g supernatant ; cpmtotal = cpmfr + radioactivity in the 10,000 g pellet ; exp = experimental ( target cells with effector cells ) ; spont = spontaneous ( target cells and medium only ) .
cc531s cells ( 10cells in 100 l ) , were coincubated with hepatic nk cells ( 10cells in 100 l ) in a flat - bottom 96-multiwell plate , for 3 hours at 37c .
after coincubation , nuclei of the cells were stained with hoechst 33342 and propidium iodide , as described previously .
preparations were studied with a leica dm irb / e inverted fluorescence microscope ( leica , heidelberg , germany ) with ultraviolet excitation , at 340 to 380 nm .
the images were recorded and the number of apoptotic cc531s cells was determined by the characteristic morphological changes of the apoptotic nucleus , i.e. , condensation of chromatin and nuclear fragmentation .
cc531s cells , not coincubated with hepatic nk cells , were used as a control .
the fragmented nuclei were counted in at least 300 cells in each preparation and the percentage of apoptotic cc531s cells was calculated using the following formula :
cytolysis was measured in a 18 hour cr - release assay using 96-multiwell plates , as described previously .
briefly , cr - labeled cc531s cells and hepatic nk cells were treated with the mab or dci or egta or z - vad - fmk , as mentioned above .
cc531s cells at a concentration of 10cells / well were coincubated with hepatic nk cells at an effector - to - target ( e : t ) ratio of 10:1 in a final volume of 200 l . after 18 hours coincubation ,
the supernatant of each well was aspirated and radioactivity was determined in a counter .
the cpm usually ranged from 1200 cpm ( spontaneous release ) to 5000 cpm ( maximal release ) .
results were expressed as percentage of specific lysis according to the formula : in which : exp = experimental ( target cells with effector cells ) ; spont = spontaneous ( target cells and medium only ) ; max = maximal , obtained after the addition of sds ( 1% final concentration ) .
statistical analysis was performed by one - way anova ( n = 3 in each group , unless otherwise indicated ) with post - hoc multiple comparison analysis made by lsd ( the least - significant difference ) test , using spss statistical package ( spss inc . , chicago , il , usa ) .
statistically significant difference between two groups was considered at the level of p < 0.05 .
adcc , antibody dependent cellular cytotoxicity ; cpm , counts per minute ; dci , 3,4-dichloroisocoumarin ; egta , ethylene glycol - bis(-aminoethyl ether)-n , n - tetraacetic acid ; fasl , fas ligand ; mab , monoclonal antibody ; mhc , major histocompatibility complex ; nk , natural killer ; z - vad - fmk , z - val - ala - asp(ome)-fluoromethylketone .
p.j.k.k . provided the mabs ox18 and cc52 , and contributed to the text of the manuscript .
supported by grants g038000 and g000599 from the fund for scientific research flanders and grants ozr230 and ozr492 from the research council of the free university of brussels .
we thank carine seynaeve and marijke baekeland for their technical help , karen crits for her technical assistance in flow cytometry , chris derom for her photographic support and ronald de zanger for his assistance in statistics . | backgroundhepatic natural killer ( nk ) cells , the most cytotoxic cells of the natural occurring nk cells , are located in the liver sinusoids and are thus in a strategic position to kill arriving metastasising tumour cells , like colon carcinoma cells .
it is known that major histocompatibility complex ( mhc ) class i on tumour cells negatively regulates nk cell - mediated cytolysis , but this is found using blood- or spleen - derived nk cells .
therefore , using isolated rat hepatic nk cells and the syngeneic colon carcinoma cell line cc531s , we investigated whether this protective role of mhc class i is also operative in hepatic nk cells , and addressed the mechanism of mhc class i protection.resultswhen mhc class i on cc531s cells was masked by preincubation with monoclonal antibody ox18 , hepatic nk cell - mediated cytolysis ( 51cr release ) as well as apoptosis ( dna fragmentation , nucleus condensation and fragmentation ) increased .
when hepatic nk cells were preincubated with the granzyme inhibitor 3,4-dichloroisocoumarin , or when extracellular ca2 + was chelated by ethylene glycol - bis(-aminoethyl ether)-n , n - tetraacetic acid , the enhanced cytolysis and apoptosis were completely inhibited .
the involvement of the perforin / granzyme pathway was confirmed by showing that the enhanced cytolysis was caspase-independent.conclusionsmhc class i expression protects cc531s colon carcinoma cells from hepatic nk cell - mediated apoptosis and cytolysis , by blocking the perforin / granzyme pathway . |
the incidence of fungal liver abscess is rare compared to pyogenic or amebic liver abscess .
routes of exposure of bacteria can occur by biliary tree , portal vein , hepatic artery , direct extension , and cryptogenic abscess .
a 65-year - old female patient admitted with a complaint of upper abdominal pain for 15 days , more on the right hypochondrium and epigastric region , associated with a history of nausea and vomiting .
she was a known case of diabetes mellitus for 5 years , on oral hypoglycemic drugs .
respiratory , cardiovascular , central nervous system , and musculoskeletal system found to be normal .
routine blood investigations such as complete blood count and renal and liver function tests were normal .
ultrasound abdomen showed 7.15 cm 4.43 cm ill - defined echo texture lesion with internal anechoic area seen in segment vii and v of the liver [ figure 1 ] .
we are not sure whether we are dealing with chronic liver abscess or infected hydatid cyst ; hence , we proceeded with contrast computed tomography ( ct ) abdomen and immune assay for igg antibodies against hydatid cyst ( echinococcus ) .
contrast ct abdomen showed enlarged liver of 20.8 cm with ill - defined hypoechoic collection with air fluid level of size 13 cm 10 cm 7 cm noted in the right lobe of liver with enhancing walls suggestive of liver abscess [ figures 2 and 3 ] .
however , serum enzyme - linked immunosorbent assay ( elisa ) against echinococcus igg - positive ( 0.78 od ) ( reference interval - negative < 0.3 , positive > 0.3 ) . the patient was started on antibiotics and albendazole for hydatid cyst .
we are not sure with diagnosis whether synchronous hydatid cyst with pyogenic liver abscess or hydatid cyst becomes infected .
gram stain showed many pus cells and fungal filaments branching septate hyphae , suggestive of candida albicans and culture and sensitivity were also suggestive of c. albicans .
later , we placed pigtail catheter inside the abscess cavity and the cavity started resolving [ figure 4 ] .
ultrasound abdomen showed 7.15 cm 4.43 cm ill - defined echo texture lesion with internal anechoic area seen in segment vii and v of the liver axial computed tomography abdomen showed enlarged liver with hypodense fluid collection contrast computed tomography abdomen showed enlarged liver of 20.8 cm with ill - defined hypo echoic collection with air fluid level of size 13 cm 10 cm 7 cm noted in the right lobe of liver with enhancing walls suggestive of liver abscess ultrasound abdomen with pigtail catheter inside the abscess cavity with resolving abscess
hydatid cyst occurs due to infection with echinococcus granulosus . after ingestion of parasite embryo , it releases an oncosphere which penetrate the mucosa of intestine .
larvae of echinococcus reach portal venous system through intestine and spread to various organs such as liver , lung , spleen , brain , muscle , and other parts .
ultrasound abdomen mostly diagnoses hydatid cyst , but when the diagnosis is uncertain , we need ct abdomen or magnetic resonance imaging ( mri ) abdomen to fetch diagnosis .
when imaging fails to identify the lesion or when the lesion is doubtful , we need serological examination , which is confirmatory . following serological test used for the diagnosis of hydatid cyst .
they are complement fixation test , indirect hemagglutination test , latex agglutination test , elisa , indirect immunofluorescence antibody test , immunoelectrophoresis , and immunoblotting .
sensitivity and specificity of elisa vary from organ to organ , in which hydatid cyst is involved .
hydatid cyst liver carries higher sensitivity ( 90% ) compared to hydatid cyst of the lung ( 75% ) .
elisa for igg carries higher sensitivity ( 90% ) compared to elisa for igm ( 85% ) or ige ( 80% ) antibodies .
ultrasound abdomen shows calcification of the cyst wall with double echogenic shadow due to pericyst .
mri abdomen shows mixed low signals on t1-weighted images whereas mixed high signals on t2-weighted images with septations .
mostly , hydatid cysts with immunocompromised status are more prone to develop liver abscess following hydatid cyst .
the occurrence of abscess in hydatid cyst creates diagnostic difficulty when seropositive for hydatid cyst , but imaging fails to identify hydatid cyst or serology positive for hydatid cyst , but aspirate shows negative for hydatid . in our case , there was a diagnostic difficulty because imaging failed to identify typical hydatid cyst , but seropositive for hydatid cyst . with extensive search on pubmed , this is the first case reported with hydatid cyst with fungal liver abscess created diagnostic difficulty . the previous description of fungal abscess mostly associated with liver malignancies or hematological malignancies .
fungal liver abscess following hydatid cyst was treated with pair and medical management such as albendazole with antifungal agents .
this case created diagnostic difficulty whether we are dealing with liver abscess or hydatid cyst . sometimes , it may be possible that concurrent occurrence of hydatid cyst with liver abscess or hydatid cyst became infected and mimic like liver abscess .
immunocompromised states with hydatid may be more prone for fungal liver abscess compared to pyogenic liver abscess . this kind of cases can be managed with initially pair followed by pigtail for proper resolution .
| liver abscess is mostly either pyogenic or amebic .
fungal and mycobacterial liver abscesses are rare and mostly associated with immunosuppression .
the occurrence of fungal liver abscess with hydatid cyst was never reported previously .
this case created diagnostic difficulty , whether we are dealing with liver abscess or hydatid cyst .
sometimes , it may be possible that concurrent occurrence of hydatid cyst with liver abscess or hydatid cyst become infected and mimic like liver abscess . |
this cross - sectional study was conducted in the rural and urban field practice area of mahatma gandhi medical college and research institute , puducherry , from 1 december 2007 to 31 may 2008 on 214 elderly participants of age 60 years and above with no interventions .
we identified 225 eligible individuals from the electoral roll and included all of them in our study .
we prepared two separate lists , one for urban and another for rural area for data collection .
non - respondents ( unable to respond even with the help of caregivers on three separate attempts ) were 11 and 214 elderly persons finally participated .
the data collection tool used for the study was an interview schedule that was developed at the institute with the assistance from the faculty members and other experts .
the pre - designed and pre - tested questionnaire contained questions relating to family characteristics , residence , family history of diabetes mellitus and others chronic disease , income and personal characteristics like age , sex , education , occupation and type of food , dietary habit . by initial translation , back - translation , retranslation followed by pilot study , the questionnaire was custom - made for the study .
the pilot study was carried out at the outpatients department of the institute among comparable geriatric subjects , following which some of the questions from the interview schedule were modified .
the health workers informed and motivated the families to participate in the study along with the scope of future intervention , if necessary .
all the participants were explained about the purpose of the study and were ensured strict confidentiality .
informed consent was taken from the participants and were given the options not to participate in the study if they wanted .
data regarding family and personal characteristics were recorded by interview technique by the principal investigator . on an average , three visits were repeated for those who were missed during the first contact .
body weight was measured ( to the nearest 0.5 kg ) in the standing , motionless position on the standard ( bathroom ) scale with feet 15 cm apart , and weight equally distributed on each leg .
height was measured ( to the nearest 0.5 cm ) by a stadeometer in the standing position with closed feet , holding their breath in full inspiration and in the frankfurt line of vision .
waist and hip circumference was measured by a flexible , non - stretchable measuring tape in the standing position and the waist hip ratio was calculated .
the venous blood samples were taken after 1012 h of fasting and were examined in the department of biochemistry of the institute .
diagnosis of diseases was based on clinical evaluation , diagnosis and/or treatment of diseases done earlier elsewhere , available investigation reports and electrocardiography .
we followed the who guidelines for diabetes , hypertension , anemia and visual acuity as < 20/60 .
they were all compared with the bmi calculated as weight / height and used as cut - off point for normal , over weight and obesity.[811 ] data was analyzed using spss 10.0 windows version .
the prevalence of diabetes mellitus , hypertension , anemia and visual impairment was presented as percentage .
uni- and multiple logistic regression analyses were performed to evaluate associations with the prevalence of diabetes mellitus , hypertension , anemia and visual impairment .
odds ratio ( or ) was calculated for each categorical and continuous variables . the 95% confidence interval ( ci )
the data collection tool used for the study was an interview schedule that was developed at the institute with the assistance from the faculty members and other experts .
the pre - designed and pre - tested questionnaire contained questions relating to family characteristics , residence , family history of diabetes mellitus and others chronic disease , income and personal characteristics like age , sex , education , occupation and type of food , dietary habit . by initial translation , back - translation , retranslation followed by pilot study , the questionnaire was custom - made for the study .
the pilot study was carried out at the outpatients department of the institute among comparable geriatric subjects , following which some of the questions from the interview schedule were modified .
the health workers informed and motivated the families to participate in the study along with the scope of future intervention , if necessary .
all the participants were explained about the purpose of the study and were ensured strict confidentiality .
informed consent was taken from the participants and were given the options not to participate in the study if they wanted .
data regarding family and personal characteristics were recorded by interview technique by the principal investigator . on an average , three visits were repeated for those who were missed during the first contact .
body weight was measured ( to the nearest 0.5 kg ) in the standing , motionless position on the standard ( bathroom ) scale with feet 15 cm apart , and weight equally distributed on each leg .
height was measured ( to the nearest 0.5 cm ) by a stadeometer in the standing position with closed feet , holding their breath in full inspiration and in the frankfurt line of vision .
waist and hip circumference was measured by a flexible , non - stretchable measuring tape in the standing position and the waist
the venous blood samples were taken after 1012 h of fasting and were examined in the department of biochemistry of the institute .
diagnosis of diseases was based on clinical evaluation , diagnosis and/or treatment of diseases done earlier elsewhere , available investigation reports and electrocardiography .
we followed the who guidelines for diabetes , hypertension , anemia and visual acuity as < 20/60 .
they were all compared with the bmi calculated as weight / height and used as cut - off point for normal , over weight and obesity.[811 ]
the prevalence of diabetes mellitus , hypertension , anemia and visual impairment was presented as percentage .
uni- and multiple logistic regression analyses were performed to evaluate associations with the prevalence of diabetes mellitus , hypertension , anemia and visual impairment .
odds ratio ( or ) was calculated for each categorical and continuous variables . the 95% confidence interval ( ci )
of the 214 participants in the age range of 60 87 yrs , 43.0% were male .
majority were in the age group of 6069 years ( 67.3% ) , from the rural area ( 61.7% ) and belonged to nuclear families ( 53.3% ) . a greater part of them was leading a sedentary life ( 72.0% ) and was non - vegetarian ( 85.0% ) .
only 13.1% of the study subjects belonged to the below poverty line , 48.6% were illiterate ; addiction rate for alcohol and tobacco was 4.7% and 7.5% , respectively .
overweight and obese were noted in 31% of the participants ; more in females ( 87.5% ) [ table 1 ] .
correlates of geriatric health problems in the univariate analysis the prevalence ratios of diabetes mellitus , hypertension , anemia and visual impairment were 43.0% ( male = 41.3% and female = 44.3% ) , 47.7% ( male = 37.0% and female = 55.7% ) , 86.0% ( male = 89.1% and female = 83.6% ) and 68.2% ( male = 60.9% and female = 73.8% ) , respectively .
on univariate analysis , the risk of diabetes mellitus was significantly higher among elderly from urban areas than that among elderly from rural areas ( or = 2.026 ; 95% ci = 1.1573.549 ) , and significantly lower risk in elderly from below poverty line than in those belonging to normal ( not below poverty line ) ( or = 0.317 ; 95% ci = 0.1230.818 ) .
hypertension risk was significantly higher among female ( or = 2.148 ; 95% ci = 1.2353.738 ) , in those with a sedentary life ( or = 1.867 ; 95% ci = 1.0123.447 ) , among vegetarians ( or = 4.000 ; 95% ci = 1.7069.380 ) , among tobacco addicts ( or = 3.600 ; 95% ci = 1.12211.549 ) and in those with abdominal obesity ( or = 2.030 ; 95% ci = 1.1653.536 ) .
the risk of anemia was significantly lower among urban old ( or = 0.341 ; 95% ci = 0.0450.297 ) and among vegetarians ( or = 0.272 ; 95% ci = 0.1130.655 ) .
the risk of visual impairment was significantly higher in females ( or = 1.808 ; 95% ci = 1.0113.234 ) , in those living in joint families ( or = 2.398 ; 95% ci = 1.3124.384 ) , in those from below poverty line ( or = 7.150 ; 95% ci = 1.64531.074 ) , in elderly participants from the rural area ( or = 0.341 ; 95% ci = 0.1880.617 ) and in the obese ( or = 0.131 ; 95% ci = 0.0410.425 ) .
the proportions of diabetes mellitus , hypertension , anemia and visual impairment were higher ( 51.7% , 62.1% , 89.7% and 79.3% , respectively ) in the 7079 years age group .
family history of diabetes was significantly related with diabetes mellitus , hypertension , anemia and visual impairment . on the other hand , family history of hypertension
overall , a bmi of < 18.5 kg / m2 ( thin ) , 25.029.9 kg / m ( overweight ) and 30.0 kg / m ( obesity ) were observed in 30 participants ( 14.0% ) , 50 participants ( 23.4% ) and 16 participants ( 7.5% ) , respectively ; the proportion of abdominal obesity was 40.2% .
hypertension ranging from high - normal to grade-3 hypertension was significantly higher in the females ( chi - square value = 29.996 , p value 0.001 ) .
distribution of the study population according to their blood pressure in the final model , multiple logistic regression urban resident ( or = 2.773 ; 95% ci = 1.5155.078 ) , family history ( or = 4.893 ; 95% ci = 1.95812.231 ) and increasing waist hip ratio ( or = 35.873 ; 95% ci = 1.2731011.031 ) were significantly associated with diabetes mellitus .
female sex ( or = 2.517 ; 95% ci = 1.3044.858 ) , sedentary life style ( or = 2.091 ; 95% ci = 1.0414.202 ) , vegetarian diet ( or = 5.918 ; 95% ci = 2.34314.947 ) and tobacco addiction ( or = 5.081 ; 95% ci = 1.49117.310 ) were significantly associated with hypertension .
rural residence was significantly associated with anemia ( or = 7.787 ; 95% ci = 2.99020.277 ) . in our study participants , rural residence ( or = 6.166 ; 95% ci = 2.80213.569 ) , female sex ( or = 5.472 ; 95% ci = 2.23213.412 ) , lower literacy ( or = 3.115 ; 95% ci = 1.3886.992 ) , sedentary life style ( or = 4.480 ; 95% ci = 2.00010.036 ) , decreasing per capita income ( or = 0.999 ; 95% ci = 0.9981.000 ) and decreasing bmi ( or = 0.877 ; 95% ci = 0.8110.948 ) were significantly associated with visual impairment [ table 3 ] .
correlates of health problems in the final model : multivariate logistic regression by the backward lr method
among 214 elderly participants from 60 to 87 years , findings were 43% diabetic , 47.7% hypertensive , 86% anemic and 68.2% visually impaired ; all these were higher in the 7079 years age group .
researchers on the aged population in a rural area of wardha district reported that the common morbidities were cataract ( 30% ) , arthritis and arthralgia ( 15.6% ) , refractory error ( 13.6% ) , anemia ( 13.3% ) , chronic bronchitis ( 7.3% ) , dental caries ( 7% ) , hypertension ( 5.2% ) , which increased with increasing age to a maximum above the age of 65 years .
held that the main cause of illness reported were anemia ( 39.6% ) , cataract ( 24.3% ) , refractory error ( 20.1% ) , hypertension ( 16.5% ) .
a previous pondicherry study reported that decreased visual acuity due to cataract and refractive errors was observed in 57% of the elderly , and hypertension ( 14% ) , diabetes ( 8.1% ) .
comparable observations were also noted by other researchers from india . a study from rural area of rohtak district of haryana , reported that the leading symptoms among the male elderly were visual impairment ( 65% ) .
increasing trend of visual impairment with increasing age was also reported by other researchers in this field . in south korea ,
life style - related diseases , including hypertension , arthritis , diabetes mellitus and osteoporosis , were the most common morbidities ; most prevalent was hypertension ( 37.5% ) , followed by diabetes mellitus ( 14.9% ) .
observed that the prevalence of isolated systolic hypertension appeared to be greater for women than for men , whereas the who reports a common prevalence of 56% .
previous researchers in india reported a lesser magnitude of hypertension that ranged from 5.2 to 16.5% .
reported 25.9% hypertension among the geriatric population . yet , other reports were comparable with our findings .
prevalence of type 2 diabetes was four- to five - fold higher in the urban versus rural population reported by other indian researchers .
experiences from geriatric clinics in northern india revealed that hypertension was the most commonly reported physical diagnosis ( 50% ) ; other specific medical illnesses were osteoarthritis ( 15% ) , diabetes ( 13% ) and constipation ( 8% ) . in the rural geriatric population of tamil nadu ,
the main causes of illnesses were arthritis , cataract , bronchitis , skin diseases and malnutrition . in an indian council of medical research ( icmr )
study on the urban dwellers and the tea garden workers in dibrugarh , hypertension was the most common health problem ( urban , 68% and tea garden , 81.4% ) . in the joint icmr / who initiative study at the urban slums of faridabad , bmi was lower in men than in women .
the prevalence of hypertension was 17.2% in men and 15.8% in women . in a study in rural varanasi , the most common morbidity was arthritis , with an overall prevalence of 57.08% , followed by cataract ( 48.33% ) and hypertension ( 11.25% ) and the prevalence of geriatric morbidities increased with advancing age .
weinberger noted that almost half of the diabetics were aged 65 years or above , with an almost equal sex distribution .
hypertension as the most prevalent condition ( 44.9% ) was noted by kumar . on the other hand ,
bhatia et al . reported in the chandigarh study that the main health - related problems among the aged were those of the circulatory system ( 51.2% ) , with about two - fifths ( 41.6% ) suffering from hypertension , and this was significantly more in females ( 46.4% ) . also , diabetes mellitus was significantly more in females ( 18% ) than in males ( 6.4% ) . problems in relation to the circulatory system were higher in females ( 56.9% ) as compared with males ( 52.1% ) in the age group of above 65 years .
another chandigarh study noted that were anemia , hypertension , cataract among the commoner morbidities .
major morbidities were more common in the rural area , except for hypertension ( 56% ) , osteoarthritis ( 34% ) , anxiety ( 10% ) , diabetes mellitus ( 8% ) , obesity ( 8% ) and psychosis ( 5% ) , which was more common in the urban area .
the icmr report on the chronic morbidity profile in the elderly states that hearing impairment was the most common morbidity , followed by visual impairment .
a study on ocular morbidities among the elderly population in the district of wardha noted that refractive errors accounted for the highest number ( 40.8% ) among all the ocular morbidities , closely followed by cataract ( 40.4% ) . in a community - based study in delhi ,
elderly people from the middle and higher income groups are prone to develop obesity and its related complications due to a sedentary life style . in a study in delhi ,
researchers on health and social problems of the elderly in udupi taluk , karnataka , observed that all the respondents had some health problems ; the most common were hypertension , osteoarthritis , diabetes or bronchial asthma , followed by cataract , anemia and skin problems .
the udaipur study noted that in the morbidity profile of old age , 70% had problems related with vision ( cataract 44% , refractive error 24.7% ) and 48% had hypertension .
this study identified an increasing need for nationwide efforts to develop various intervention programs for surveillance of increasing geriatric health problems in the era demographic transition in india and other southeast asian countries .
second , because of the cross - sectional design , this study had a limited extrapolative value .
third , researchers in this field are troubled with age - related amnesia and other psychological problems that were not addressed .
lastly , the probability of missing data can not be excluded as we studied only older adults .
holistic researches are needed on all dimensions of aging including the psychosocial and social security standings of morbidity . in spite of professional indifference in geriatrics , current trends point toward the foundation of sensitization of medical teachers , advance speciality of psychosocial gerontology and accessibility of some research resources .
this study identified an increasing need for nationwide efforts to develop various intervention programs for surveillance of increasing geriatric health problems in the era demographic transition in india and other southeast asian countries .
second , because of the cross - sectional design , this study had a limited extrapolative value .
third , researchers in this field are troubled with age - related amnesia and other psychological problems that were not addressed .
lastly , the probability of missing data can not be excluded as we studied only older adults .
holistic researches are needed on all dimensions of aging including the psychosocial and social security standings of morbidity . in spite of professional indifference in geriatrics , current trends point toward the foundation of sensitization of medical teachers , advance speciality of psychosocial gerontology and accessibility of some research resources .
the incidence of all the study parameters among the elderly population was very high in comparison with other studies from other parts of india and even previous studies of puducherry .
this highlights the increasing trend of burden of geriatric health problems in south india . for a substantial impact on this burden , unique preventive health care strategies specific to the elderly need to be clearly formulated and tested | background : the geriatric health problems are related to chronic disease as a result of increasing life expectancy.objective:this study was undertaken to assess the health problems of the elderly in puducherry.materials and methods : this cross - sectional study was carried out on 214 elderly persons from the age group of 60 years and above using a pre - designed and pre - tested questionnaire that addressed the disease magnitude in comparison with the socioeconomic variables.results:overall , 43% of the participants were diabetic , 47.7% hypertensive , 86% anemic and 68.2% visually impaired .
all the morbidities were noted to be higher in the 7079 years age group .
diabetes was significantly higher in participants from urban areas , with family history and increasing waist
hip ratio , but significantly lower in the below poverty line areas .
hypertension risk was significantly higher among females , among those leading sedentary life , those eating vegetarian food , those addicted to tobacco and with abdominal obesity .
anemia was significantly lower among urban vegetarians .
overweight and obese were noted in 31% of the participants , and were higher in females ( 87.5% ) . rural residence , female sex , living in joint family , literacy , sedentary life style , decreasing per capita income and decreasing body mass index ( bmi )
were significantly associated with visual impairment.conclusion:this study highlights the burden of health problems of elderly individuals in south india . |
bubble hair is an acquired hair shaft deformity characterized by bubble - like areas in the hair shaft seen with light microscopy and corresponding cavitary defects with scanning electron microscopy .
it occurs due to thermal injury caused to the hair by hair dryers , heating tongs or hot curls .
hair appears dry , wiry , with patchy loss of hair due to excessive fragility .
it may be associated with other acquired hair shaft defects such as trichorrhexis nodosa and trichoptilosis .
a 22-year - old female patient reported to us with complaints of dry hair with excessive fragility of two - week duration .
there was history of using hot iron on wet hair to straighten the hair twice over the past one month .
clinical examination of scalp hair showed dry brittle hair which was broken unevenly [ figures 1 and 2 ] .
eyebrows and body hair was normal . hair was not easily pluckable but was brittle .
uneven broken , dry - looking hair uneven broken , dry - looking hair light microscopic examination of the hair showed spaces within the hair shaft [ figure 3 ] .
few hairs showed node - like formation with fraying ( trichorrhexis nodosa ) and there was distal splitting of hair ( trichoptilosis ) [ figures 4 and 5 ] .
these changes were noted in other hair samples and not the one which showed bubbles .
as the name suggests , bubble hair is full of bubbles much like a sponge .
the use of hair curling tongs operating at 125c and applied to the hair for one minute can also induce bubbles in hair fiber .
this vaporization of the water may force the spaces in the hair to expand , eventually turning the hair into a sponge - like structure .
these damaged hairs are weak and brittle as the bubbles destroy the integrity of the fiber .
chemical treatment may also precipitate the onset of bubble hair and any already weak hair , whatever the cause , may be more susceptible to bubble development .
electron microscopic studies of previously reported cases revealed a loss of cortical cells and medulla at these sites .
, dermatoscopy can be used to highlight hair that warranted closer examination under light microscopy .
clinically , hair appears to be kinked , break off , and over time , the condition may develop into a localized alopecia .
come out in clumps , and the overall texture of the hair changing from soft and naturally curly to straight and stiff has been reported .
it can be prevented and treated by avoidance of using excessive heat and chemicals on the hair and by cutting off the old damaged hair .
our case presented with a classical history of use of hot irons to straighten hair followed by hair changes . along with bubble hair , other shaft abnormalities like trichoptilosis and trichorrhexis nodosa were also noted .
there are a few reports of bubble hair in literature.[247 ] though it is a common condition , it is rarely diagnosed and reported .
light microscopic examination is sufficient to make a diagnosis and counseling the patient will prevent repeated injury to hair shaft . | bubble hair is an acquired hair shaft abnormality characterized by multiple airfilled spaces within the hair shaft .
it is a result of thermal injury .
we report a classic case of 22-year - old female who complained of dry brittle hair of two - week duration .
patient had used hot iron on wet hair twice to straighten hair .
hair microscopy was diagnostic and showed multiple air - filled spaces within the hair shaft . |
assessment of maximum aerobic capacity or vo2max has immense importance in the field of work physiology .
it is the primary determinant of physical work capacity and reflects the functional efficiency of cardiovascular , respiratory , and neuromuscular systems of our body .
assessment of this parameter is of pivotal importance to determine the fitness criteria of a person engaged in any sort of activities . till date , studies reporting aerobic capacity of underground miners are available only from overseas literatures .
indian studies determining aerobic capacity of miners are restricted only for opencast metalliferous mines and studies of similar type among haulage - based underground coal miners still represent a virgin area to undertake . in this scenario ,
an endeavour has been taken in the present study to assess the maximal aerobic capacity of underground coal miners .
the data from present study may be helpful in evaluating the required level of physical fitness for working in various categories of mining activities for workers of different age groups and also to utilize their potential more effectively to increase mine productivity .
ninety - eight healthy miners from three different underground mines of west bengal , india were selected following a random sampling technique stratified on the basis of the age . the subjects having a minimum work experience of five years
they had no report of medical history as confirmed by the respective health centers of the collieries .
the miners selected were engaged in three different mining works , namely , drilling , shoveling , and carrying ( table 1 ) .
the choice of miners from these three categories of work was based on the fact that these works demand a significant working time at a stretch in the allocated working areas ; secondly , these activities can be quantified in terms of work output and finally these activities were supposed to be physically demanding .
they had a mean age of 41.3 9.5 ( 2358 yrs ) , and accordingly subdivided into two age groups , namely , < 40 years ( younger group ) and 40 years ( older group ) . before the study
, interactions were carried out with the miners where they were explained about the objective of the study and the extent of their involvement .
the selected miners agreed to render them voluntarily in accordance with the design of the experiment .
conventional board and pillar method of work were employed in these mines where depth of workings , degree of gassiness , seam thickness , gradient , seam water bearance , strata temperature , and humidity were seemed to be of similar type .
heights and weights of the subjects were recorded using an anthropometric rod and human weighing balance , respectively .
body mass index ( bmi ) and body surface area ( bsa ) were calculated accordingly .
it was measured by using lightweight telemetric equipment sport tester pe 3000 ( polar electro , finland ) at a regular interval of 1 min for a period of 2030 minutes during their resting conditions .
maximal heart rate ( hrmax ) of individual subjects was derived from age as 220age .
heart rate reserve ( hrr ) of the subjects was derived as the difference between the maximal and resting heart rate of the subjects .
it was determined indirectly through step test procedure as described by martiz et al . .
now in each time firstly they performed work with a stool of 30 cm high at a rate of 15 cycles / minute and then at a rate of 25 cycles / minute for a period of eight minutes ; next with a stool of 40 cm high at a rate of 25 cycles / minute for a period of five minutes .
heart rate and oxygen consumption in each workload were recorded at an interval of one minute .
morgan england ) was used to measure the oxygen consumption ( vo2 ) of the subjects and the telemetric heart rate monitor to record the heart rate . for each subject ,
straight line equation was derived by method of least squares using heart rate as predictor and oxygen consumption as criterion variable .
finally vo2 was then extrapolated to the age predicted maximal heart rate to obtain the maximal aerobic capacity ( vo2max ) of the individual subjects which was expressed both in absolute terms ( l / min ) and in relative terms ( ml / kg / min ) .
all measurements were carried out in the surface in a comfortable rest area in the morning during 8.0010.00 hrs before the beginning of the work shift .
descriptive statistics comprising mean as a standard index of central tendency , standard deviation as the measure of dispersion was used to present the physical and physiological criteria . the relationship between physical parameters ( age and weight ) and vo2max was analyzed by using the product moment correlation coefficient ( r ) .
linear models with physical characters as the predictor variable and vo2max as criterion variable had been developed .
comparison between parameters was performed by means of test of significance and the p value was specified case wise .
anova ( at level of 0.05 ) was also done to find out any significant differences of different physiological parameters amongst various categories .
tables 2 and 3 summarized the physical and physiological characteristics of the miners in relation to different mining activities .
it was evident from the tables that the miners did not differ significantly in terms of all the parameters studied except for weight where the driller group showed maximum value .
the group also showed maximum absolute and relative vo2max values in comparison to the other two categories .
the relationship between relative vo2max ( ml / kg / min ) with age in two different age groups was depicted ( figure 1 ) , and the results were summarized in table 4 .
the average value of maximal oxygen uptake ( ml / kg / min ) in older group ( 35.1 3.6 ) showed an 8.1% decline as compared to the younger age group ( 38.2 4.2 ) whereas it showed a 6.45% reduction when expressed in l / min ( table 5 ) .
the average vo2max ( ml / kg / min ) for the entire group of miners classified into different age groups was depicted in figure 2
. a conspicuous reduction of 12.2% in the mean value of the parameter was observed from
2029 to 3039 groups compared to much less decline of 3.7% from
individual values of maximal oxygen uptake of two different age groups were also related to the body weight of the subjects and were depicted in figure 3 .
two different regression equations were computed for predicting the maximal oxygen uptakes ( l / min ) from weight of the miners in different age groups .
the coefficients of regressions , standard errors of estimates , and p values of the regressions are presented in table 5 .
it was evident that a high degree of positive correlation did exist at a high level of significance in case of both younger ( < 40 years ) and older ( 40 yrs ) miners .
underground miners were inclined to have a lower than average aerobic capacity compared with general population and to other occupational groups .
it was seen from the study that the average vo2max of the miners was found to be 36.6 ml / kg / min which was not only below with respect to their fellow counterparts abroad but also found to be lower ( 5.7% ) from their native working partners .
it was the 2nd lowest vo2max out of the other 16 values depicted in figure 4 where the maximal value had been found in case of silviculture workers ( 51.9 ml / kg / min ) .
the value in the present study was 41.8% lower than this group and only 0.5% higher than the average vo2max of the parcel sorters ( 36.4 ml / kg / min ) .
the different category of underground miners who voluntarily took part under this study seemed to be maintaining homogeneity in terms of various physical and physiological characteristics except weight .
however , the mean bmi for all categories showed that the subjects were typical of the average populations from eastern india .
the average maximum aerobic capacity of the underground coal miners ( 36.6 ml / kg / min ) obtained in this study had been lower than those for indian inland fisherman , industrial workers , porters , soldiers , and athletes ( 39.250.8 ml / kg / min ) in ascending order as depicted in figure 4 [ 711 ] .
so , the trend of lowered average aerobic capacity compared to general population and other occupations was in well concert with the results obtained by other investigators [ 1215 ] .
with respect to mining population abroad , the mean value was quite comparable with the spanish , polish and australian miners .
however , the aerobic capacities of south african miners ( 47 ml / kg / min ) and some other spanish mine workers ( 43.2 ml / kg / min ) as found by other investigators was reported to be far higher than the observed value .
the miners under present investigation showed a close similarity with the indian metalliferous mineworkers .
it was reported that vo2max in general increases up to a certain age after which generally a steady gradual decline occurs . in observation of indian subjects ,
it was reported that maximal oxygen intake was influenced by age but significant decline was found to occur after 30 years of age .
other studies in the same population reported a noticeable decrease of maximum aerobic capacity after 33 years of age both for industrial workers and porters as well [ 8 , 9 ] .
hermansen depicted that maximal oxygen uptake increased almost rectilinearly from the age of 11 to the age of 16 years in males wherefrom it increased at a lower rate reaching a peak value at an age of approximate 25 years .
thereafter , a steady gradual decrease of it was observed . similar decrease of maximal oxygen uptake with advancement of age was also observed among the lumber jacks who reported a mean vo2max of 48 ml / kg / min at the age group of 2236 years and decreases up to about 40 ml / kg / min in the age group of 5166 years .
studies on miners also found a steeper drop with advancement of age where the mean vo2max decreases from 3.4 l / min to 2.5 l / min in the age groups of 2130 to 3140 years , respectively .
however , the data as reported by ayoub et al . did not show a steep decline in these occupational personnel .
a similar decrease in vo2max in the present study between miners of < 40 years and 40 years of age group corroborated to the result of earlier studies ; in fact altogether the older group showed a decline as compared to the younger age group which was due to the declining capacity in attaining the maximal heart rates and the falling efficiency of circulatory regulation during exercise .
deterioration of the respiratory functional capacity with growing age could have been another attributing factor .
the direct relation of maximum oxygen uptake with body weight as reported by different authors [ 8 , 2729 ] was also well established in this study .
the correlation coefficients between these two variables were found to be 0.57 and 0.68 for younger and older age groups at a high level of significance ( table 5 ) .
these values were comparable to that reported by buskrik and taylor ( r = 0.63 ) and katch ( r = 0.53 ) , respectively , but lower than that reported by astrand .
in any occupation , for work stress evaluation , rationalization of workload in terms of acceptable work limit is of prime necessity to safeguard the health of the workers . in the study , carriers showed maximal functional capacities with the least values found in shovelers .
therefore , the knowledge of a comparatively lower maximal functional capacities of the indian miners engaged in different activities may be of great importance to determine the fitness criteria of personnel for working in this industry on the perspective of the tolerable limits of work . | miners fitness test was assessed in terms of determination of maximum aerobic capacity by an indirect method following a standard step test protocol before going down to mine by taking into consideration of heart rates ( telemetric recording ) and oxygen consumption of the subjects ( oxylog - ii ) during exercise at different working rates .
maximal heart rate was derived as 220age .
coal miners reported a maximum aerobic capacity within a range of 3538.3
ml / kg / min .
it also revealed that oldest miners ( 5059 yrs ) had a lowest maximal oxygen uptake ( 34.2 3.38 ml / kg / min ) compared to ( 42.4 2.03 ml / kg / min ) compared to ( 42.4 2.03 ml / kg / min ) the youngest group ( 2029 yrs ) .
it was found to be negatively correlated with age ( r = 0.55 and 0.33 for younger and older groups respectively ) and directly associated with the body weight of the subjects ( r = 0.57
0.68 ,
p 0.001 ) .
carriers showed maximum cardio respiratory capacity compared to other miners .
indian miners vo2max was found to be lower both compared to their abroad mining counterparts and various other non - mining occupational working groups in india . |
protein - energy malnutrition ( pem ) is frequently found in patients with chronic renal failure and is reported to occur in 40% of dialysis patients . besides inadequate intake of proteins and calories , various other factors are involved in the development of pem in patients with renal failure including acidosis , insulin resistance and uraemic toxins . with haemodialysis , loss of amino acids via dialysate may amount to 10 g per dialysis session , whereas with peritoneal dialysis ( pd ) , protein loss in infection free patients is 510 g per 24 h in addition to a loss of 24 g of amino acids . in the past few years , the role of inflammation has been in the spotlight .
a strong association has been found between malnutrition , inflammatory parameters and cardiovascular mortality [ 47 ] .
many strategies have been proposed to improve dietary nutrient intake in pd patients , but actual protein intake is frequently below the recommended amount of 1.2 g / kg body weight . in continuous ambulatory pd ( capd )
patients , amino acid containing dialysate has been used to compensate for a low dietary protein intake and peritoneal loss of amino acids and proteins [ 813 ] . till date , convincing clinical benefits have not been demonstrated unequivocally although amino acids containing dialysis solutions may lead to a significant increase in serum urea levels and metabolic acidosis .
currently , amino acid dialysates are not widely used for the improvement of nutritional status or as supplement to food intake .
it has been generally recommended to use amino acid dialysate together with a meal containing enough calories .
lately , it has been shown convincingly that simultaneous ingestion of calories is really of utmost importance to obtain an optimal anabolic effect of intraperitoneal amino acids .
however , anorexia may restrain patients from taking enough calories together with intraperitoneal amino acids .
recently , the authors could show that in patients on nightly automated peritoneal dialysis ( apd ) , a dialysis solution that contains a mixture of amino acids and glucose , as part of a regular dialysis schedule , induced an acute anabolic effect . in that study , the proportion of energy and protein given via dialysate varied between 160 and 340 kcal / gn although the western diet contains 150200 kcal / gn . taken together ,
these findings suggest that the body 's response to the amino acid glucose dialysis solution is similar to food ; this article is a discussion on dialysate as food. in the next sections , a more detailed discussion is made on whether this concept could make sense as nutritional support in clinical practice .
first , the role of diet and inflammation in the nutritional status is dealt with .
according to the kidney diseases outcomes quality initiative ( doqi ) guidelines , recommended daily dietary protein intake ( dpi ) should be at least 1.2 g / kg / day for pd patients .
this target is based on nitrogen balance studies in clinically stable patients assuming that the intake is within the safe limit in 97.5% of the population .
many patients , however , have a neutral or positive nitrogen balance with a dpi of 1.0 g / kg / day and some patients even at a value as low as 0.7 g / kg / day . various studies have shown that actual dpi in many pd patients is < 1.2
the european best practice guideline working group on pd allows for a lower dpi target ( > 1.0 g / kg / day ) if the patient remains in a stable nutritional status .
nutrient intake is closely correlated with the nutritional status , comorbid conditions , inflammatory parameters ( see the section on inflammation ) and the stage of renal insufficiency .
pro - inflammatory cytokines such as tnf and il-1 that are known to be implicated in anorexia and cachexia may be the connecting link .
in various epidemiological studies of dialysis , a strong association of pem , inflammation and increased risk of morbidity and mortality has been found .
various factors including volume overload , comorbid conditions such as infections , atherosclerosis and decreased clearance of pro - inflammatory cytokines and glucose degradation products may contribute to an inflammatory state in end - stage renal disease ( esrd ) . of note ,
atherosclerosis itself is an inflammatory process , which may deteriorate further by infections and other inflammatory conditions , as frequently found in dialysis patients [ 2022 ] .
several authors argue that pem is the result of inflammation and is a secondary marker rather than the cause of poor outcome .
however , associations , as found in cross - sectional epidemiological studies , can not be simply explained in terms of cause and effect .
there is evidence to suggest that inflammation , whatever its cause , may not be the sole explanation of pem in esrd , as suggested by imprecise association of several nutritional and inflammatory parameters .
preliminary data suggest that pem may independently promote and increase the risk of clinical illness , leaving room for the viewpoint that part of the association of pem and poor outcome is because of deficient nutrient intake as a result of anorexia .
further research is required to elucidate the pathophysiological mechanisms underlying the aforementioned associations . to assess the relative contribution of nutrient intake to outcome ,
interventional studies including large groups of patients are needed , selected on the basis of nutritional status , dpi and inflammatory parameters .
to improve the nutritional status in patients on capd , glucose in pd solutions was replaced with amino acids .
using a 1.1% amino acid solution ultrafiltration is similar to a 1.36% glucose solution . during a dwell of 46 h , 80% of the amino acids , that is 18 g ,
currently , the commercially available solutions ( nutrineal ) are composed of a mixture of all essential amino acids and six nonessential amino acids , three of which are considered to be essential for esrd patients .
these studies differed in their design , including patient selection , dpi , nutritional status and duration of follow - up although different nutritional parameters were used as endpoint [ 813,23 ] .
although in some studies improvement was found according to selected parameters , overall there was no consistent amelioration of nutritional status . in a prospective - controlled interventional study , it was found that 12 bags of a 1.1% amino acid solution induced a significantly positive nitrogen balance . in this study ,
malnourished pd patients were included who were ingesting 1.0 g protein / kg / day or less , whereas during the study , the patients were fed a constant diet containing 0.8 g protein / kg / day and 28 kcal / kg / day energy .
it is really of utmost importance that intraperitoneal administration of amino acids is accompanied by simultaneous intake of calories , as was convincingly shown by delarue who compared the effects of intraperitoneal amino acids with and without consuming a meal composed of carbohydrates and lipids in capd patients .
the amino acids stimulated protein synthesis and the oral calories induced an inhibition of protein breakdown ( i.e. proteolysis ) thereby reinforcing the positive effects of the amino acids solutions on protein balance . in this
study , oral energy and absorbed intraperitoneal amino acids were given in a proportion of 200 kcal / gn . the normal western diet contains energy and proteins in a proportion of 150200 kcal / gn .
anorexia , however , may restrain patients from taking enough calories simultaneously with intraperitoneal amino acids .
considering that the utilization of intraperitoneal amino acids could be optimized by giving them simultaneously with glucose , the hypothesis that in patients who are on nocturnal apd , a dialysis solution that contains a mixture of amino acids and glucose , as part of a regular dialysis schedule , could improve protein metabolism was put forward . in a randomized crossover study , it could be seen that the mixture of amino acids and glucose induced an acute anabolic effect on protein metabolism because of the combined effect of stimulation of protein synthesis and inhibition of protein breakdown .
apparently , the body 's response to the administration of intraperitoneal amino acids is similar to food .
the acute changes in protein metabolism were studied by primed constant infusion of c - leucine .
whole body protein ( wbp ) turnover , oxidation , synthesis and breakdown ( i.e. proteolysis ) were determined by measuring at isotopic steady state plasma stable isotope enrichment and co2 production . using this sophisticated technique ,
the protein gain was estimated at 13 g of protein during a nightly apd session , which is amply sufficient to compensate for protein losses via dialysate .
the results of the 24-h nitrogen balance studies showed a tendency towards improvement in nitrogen retention .
the studies were performed in the fasting state while intraperitoneal amino acids were given in a fixed amount of 27 g , of which 4050% was absorbed .
the proportion of energy and protein given via dialysate varied between 160 and 340 kcal / gn . as a supplement to deficient nutrient intake , an amount of 13 g of absorbed amino acids is relatively modest and may be inadequate if dpi is far below the targets .
the question arises as to whether more intraperitoneal amino acids , for example , a double amount , could be given within the scope of this concept .
the optimal energy - to - protein ratio is unknown and remains to be determined .
if a ratio of 100 kcal / gn or more is to be assumed , per 54 g of amino acids ( 2 bags of 2.5 l of a 1.1% solution ) 216 g of glucose should be given .
this can be achieved roughly when equal volumes of 1.1% amino acid and 3.86% glucose solutions are mixed with final concentrations of 0.55% and 1.93% for amino acids and glucose , respectively . whether this is acceptable with respect to adverse effects is discussed in a separate section .
the authors also investigated whether this concept could also be utilized for patients in the fed state .
this could be of importance for capd patients when the amino acids are given in the daytime as a supplement to their ( deficient ) food intake .
except that the study was performed during the day in patients on capd taking liquid food , the study protocol was the same as during nightly apd including the use of an apd cycler .
it could be seen that even in the fed state , intraperitoneal amino acids can make an extra contribution to protein synthesis .
furthermore , similar to intraperitoneal amino acids , feeding itself acted almost exclusively on protein synthesis rather than inhibiting protein breakdown thereby corroborating the concept of dialysate as food. a two - compartment bag system could make this approach feasible for capd patients .
further , the effects of combined amino acids and glucose solutions on fractional albumin synthesis rate ( fsr - albumin ) were studied .
it was found that neither intraperitoneal amino acids nor food induced a statistically significant stimulation of fsr - albumin . in contrast , both the amino acids / glucose mixture and food exerted a significantly stimulating effect on whole body protein synthesis ( wbps ) .
these findings demonstrate a differential effect of both oral and intraperitoneal amino acids on the synthesis rates of albumin and wbp .
as muscle protein synthesis contributes substantially to wbps , the stimulating effect of amino acids on wbps may be attributed to a large extent to increased muscle protein synthesis consistent with previous reports .
however , it should be mentioned in this context that the most marked stimulation of albumin synthesis by protein supply has been found under protein - depleted conditions .
this study was conducted in a small , relatively stable and well - nourished population of capd patients .
several studies on capd patients have shown that the use of amino acid dialysate is accompanied by acidaemia occurring within 14 weeks after starting the daily use of these solutions .
it is caused by metabolism of the sulfur - containing amino acid methionine and the cationic amino acids arginine and lysine - hcl .
therefore , the concentration of these amino acids was decreased in the newer commercially available dialysis solutions ( nutrineal ) . despite the use of dialysate with lower concentrations of aforementioned amino acids ,
a trend to acidosis has still been described especially when two bags per day were used giving reason for concern .
therefore , it is generally recommended to use no more than one bag of a 1.1% amino acid solution per day .
it should be noted in this respect that dietary proteins are the main source of the generation of h ions ( protons ) by hydrolysis of dietary phosphate existing as h2po4 and by oxidation of the sulfur - containing amino acids methionine and cysteine as well as the cationic amino acids arginine and lysine , which come available by food intake or endogenously by proteolysis . on the other hand ,
the metabolism of anionic amino acid glutamate and aspartate generates alkali . collectively , this results in a net hydrogen ion production of 12 meq / kg / day in healthy adults on a normal western diet . increasing intake of dietary proteins along with organic h2po4 results in production of increasing amounts of hydrogen ions that have to be removed by the kidney to maintain acid base homeostasis .
halperin estimated that in a diet containing 120 g of proteins ( note : 100 g of beef contain 20 g of protein ) , 72 meq and 138 meq of h are generated by metabolism of sulfur - containing amino acids and cationic amino acids , respectively . on the other hand , by metabolism of glutamate and aspartate ,
100 meq of h are removed , whereas the oxidation of various other dietary organic anions removes additionally 60 meq of h. this would imply that net acid production by amino acids in such a diet is 210100 meq = 110 meq .
organic h2po4 has not been taken into account as a source of acid production in the calculations . in patients with renal failure ,
table 1 shows that the estimated hydrogen ion generation by absorbed amino acids in 2.5 l of a 1.1% amino acid solution ( 13.5 g ) is 33 meq if the quantity of absorbed amino acids is completely oxidized .
the fact that net acid production by the current intraperitoneal amino acids solution is higher compared with the same amount of dietary protein can be largely explained by the absence of the alkali - generating glutamate and aspertate in the dialysis solution . on the other hand , lactate and bicarbonate
are added to dialysis solutions for the provision of alkali . in the fasting state study ,
a slight decrease of serum bicarbonate concentrations with amino acids containing dialysate was found , but the bicarbonate levels remained within the normal range when dialysis solutions containing a 40 mmol / l buffer was used .
furthermore , substantial part of the supplied amino acids was not oxidized but was utilized for anabolism as shown in the whole - body protein turnover ( wbpt ) studies and this may have resulted in a low production of hydrogen ions and urea as well . these findings may suggest that intraperitoneal amino acids , insofar as they are given to supply the deficit of protein intake , bring about only a limited increase in the generation of h ions and urea .
in addition , the findings of this study suggest that metabolic acidosis could be prevented even with higher doses of intraperitoneal amino acids when the concentration of buffer in the mixture of amino acids and glucose containing dialysis solutions is 40 mmol / l .
the intraperitoneal administration of amino acids combined with glucose can take place as part of a regular dialysis schedule in apd patients with the cycler regulating the mixing of amino acids and glucose . applying an empty bag procedure mixing occurs from the first cycle onward .
the dialysis procedure that is described in detail elsewhere is easy to perform at home .
developments in software could further simplify the practice of the dialysis procedure and could make the application of the concept of dialysate as food more versatile .
automated peritoneal dialysis with a mixture of amino acids and glucose brings about an acute improvement of protein metabolism .
such a response of the body to intraperitoneal amino acids is similar to food-dialysate as food. like dietary protein , intraperitoneal amino acids can bring about the generation of hydrogen ions and urea . no rise of serum urea levels
was found with the amount of amino acids given in this study and serum bicarbonate levels remained within the normal range when a buffer concentration of 40
the use of this approach may be an option for pd patients who can not fulfil dietary recommendations .
long - term clinical trials are required to evaluate the effects on morbidity and mortality . | protein - energy malnutrition is frequently found in dialysis patients . many factors play a role in its development including deficient nutrient intake as a result of anorexia .
peritoneal dialysis ( pd ) solutions containing a mixture of amino acids and glucose in an appropriate ratio could serve as a source of food .
the authors of this article found that such a dialysis solution when administered to fasting patients who were on nightly automated peritoneal dialysis ( apd ) , as part of a regular dialysis schedule , induced an acute anabolic effect .
also in pd patients in the fed state , dialysis solutions containing both amino acids and glucose were found to improve protein metabolism .
it appears that the body responds similar to intraperitoneal and oral amino acid : dialysate as food . like dietary proteins
, intraperitoneal amino acids can bring about generation of hydrogen ions and urea as a result of oxidation .
no rise of serum urea levels was found and serum bicarbonate remained within the normal range when a total buffer concentration of 40
mmol / l in the mixture was used .
the use of this approach may be an option for pd patients who can not fulfil dietary recommendations . |
the recovery of exfoliated cells from biological fluids is a non - invasive technology which is in high demand in the field of translational research as well as during long - term experiments designed to minimize the sacrifice of long - lived or precious animals .
exfoliated epithelial cells can be used as surrogate for tissue biopsies in predicting changes in gene expression , dna methylation , dna damage , protein expression , and accumulation of dietary components [ 1 , 2 ] .
exfoliation has also been described as an active biochemical process linked to the homeostasis of gut epithelium [ 36 ] .
it is believed that epithelial cells , loosing contact with companion cells ( like fibroblasts ) as well as extracellular matrix , enter anoikis .
recent in vitro models are opening new avenues to conceptualize the exfoliation of gut epithelia in order to explain this highly context - dependent phenomenon .
loss of extracellular matrix contact induces autophagy in normal epithelial cells , and autophagy promotes the survival of detached cells during both anoikis and lumen formation in 3d epithelial cell culture [ 8 , 9 ] . under these assumptions
, exfoliation may be understood as a natural process to remove external cells from the luminal surface of an epithelium .
consequently , exfoliation may have a physiological role by allowing the formation of a lumen , preserving the epithelium 's architecture , and , we can surmise , by providing sufficient flexibility to preserve the physical integrity of epithelia and allow its growth . in three - dimensional epithelial cell cultures ,
both autophagy and apoptosis are observed during lumen formation [ 8 , 9 ] . by loosing contact with the original mucosa ,
indeed , quiescent exfoliated epithelial cells without signs of apoptosis can be recovered under specific clinical conditions in gastric fluid aspirates or by suction from breast glands [ 11 , 12 ] or extensive rinsing at the end of routine colonoscopy .
many exfoliated quiescent epithelial cells can be cultured suggesting that detachment - induced autophagy contributes to the viability of these cells . however , the survival of quiescent epithelial cells outside the tissue structure is highly variable .
human mammary epithelial cells die after 2448 hours of detachment ; certain epithelial cells , notably rat intestinal epithelial cells , perish within a few hours following substratum detachment [ 9 , 14 ] .
this paper presents current understanding of exfoliation along with the influence of methodology on the isolation of exfoliated gut epithelial cell phenotypes and , finally , speculates on the balance between anoikis and apoptosis to explain the survival of epithelial gut cells in the environment .
exfoliation can be understood as a natural process to preserve tissue architecture . following that first point of view , exfoliation is a loss of cellular material retaining the basic cytological features of typical cells ( plasma membrane , cytoplasm , and nucleus ) .
exfoliated epithelial cells can be obtained from a wide range of mucosae whose line body passages and cavities communicating directly or indirectly with the exterior like mammary glands , oral , bronchial , urothelial , or gastrointestinal epithelia .
epithelia can be classified as simple cylindrical cell monolayers like colon or pseudostratified like urothelium . according to histology , epithelia
are organized in functional units containing different cellular compartments ( stem , proliferative , mature , or functional and senescent ) as shown in figure 1 .
these functional units are always at the interface with the environment . at a given time point ,
a mucosal epithelium is supposed to loose different categories of cells by different mechanisms of exfoliation .
however , the cell turnover of these epithelial cells is driven by a delicate balance between cellular loss and proliferation .
proliferation is running on two cellular compartments , the proliferative cells capable of rapid mitosis to amplify tissue regeneration and the stem cells which are giving rise to all phenotypes by asymmetric mitosis .
the speed of mitosis in proliferative compartment is dependent on cellular loss at the top of the structure and on tightly regulated cell migration along the functional units .
cell migration in the small and large bowels of mice shows a strong circadian rhythm , with cell velocity maximal at 9 a.m. and minimal at 5 p.m .
other rhythms which could be controlled by circadian clocks have been observed in the intestine like cellular proliferation [ 20 , 21 ] or apoptosis .
cell proliferation is also believed to be under the control of clockwork not only in hepatocytes but also along the rat 's gut .
seasonal rhythms of proliferation have been described in adult rats [ 25 , 26 ] .
circadian as well as seasonal rhythms in cell proliferation seem clearly relevant to the recovery of exfoliated quiescent cells retaining specific and functional biomarkers .
however , there is a second point of view where exfoliation is a loss of cells in the environment due to external mechanical forces like brushing or friction .
such forces are deeply altering the epithelium architecture but allow to yield rapidly high amounts of epithelial cells retaining phenotypes and physiological status as close as possible to the mucosal cells remaining in the epithelium .
manual exfoliation has been reported with brushing or scraping technique on oral epithelium of cheek or tongue , cervical , or rectal swabbings , airway epithelial cells in sputum and buccal mucosal cells obtained by rinsing the mouth or chewing - gum ( betel chewers ) , esophageal cells , mammary by nipple aspirate , ductal lavage klein et al .
, , breast milk , or bladder urothelial cells present in urine samples [ 32 , 33 ] .
manual exfoliation has also been proposed as a way to recover intact , normal epithelial cells on tissue biopsies made on colon resection [ 34 , 35 ] .
some device has also been designed to recover surface exfoliated cells of human rectal mucosa by a minimal invasive scraping .
the technique partially purifies the cell preparation by taking advantage of the cell 's inherent biology .
epithelial cells remained in small groups or sheets , detached from any stromal elements that may have been scraped off .
the problem is that in most clinical situation , there is no direct access to the mucosa and the technique simply can not be used .
consequently , we may wonder whether some useful biological information can be recorded from relatively low numbers of cells , isolated as a mixture of cellular phenotypes with different physiological states ?
magnetic beads and antibodies are well - known systems to recover low numbers of epithelial cells in biological fluids or to recover highly purified epithelial phenotypes .
antibodies against human cell surface antigens like anti - hep , or antiepithelial surface marker from an original antibody described by moldenhauer et al . , or anti - ber - ep4 [ 34 , 35 ] from an original antibody described by sheibani et al . labeled with paramagnetic particles are used to capture and to purify epithelial cells
. viability of recovered cells by this exfoliation / enrichment method as well as by other similar techniques is on average between 90 and 100% by the trypan blue exclusion assay .
however , in our experience , shieving is necessary to perform immunocapture . with samples containing sheets of 5 to 30 cells , shieving or percoll gradients
in addition , microbial contaminations are not easily removed by such density gradient methods because microbes are tightly associated with cells .
even with the manual exfoliation technique , the exfoliated cell populations may contain other cell types , most notably lymphocytes and plasma cells .
it should be underlined that the problem of cross - contaminations by other sources of exfoliated epithelial cells like breast cells from the milk with gastric cells of lactating infants or exfoliated cells from manipulators is particularly difficult to ward off calling for the development of biomarkers of tissue origin which can guarantee both the cellular origin and the affordability of testing .
the next section discusses recent works in 3d mammary reconstruction and the functioning of acini which have shed new light on the capacity of surface epithelial cells to survive outside their epithelium .
laboratory rodent models are also discussed as they open the possibility to induce exfoliation by nutritional manipulations .
primary cells are inoculated as single - cell suspensions or small clumps of cellular aggregates .
these cells have also lost contact with the tissue architecture ( companion fibroblasts , epithelial cell neighbors , and with the extracellular matrix ) , as well as with the nervous regulation or the blood nutriments . from tissue cultures , we know that a molecule of nutriment has to be within 50 nm away from a single cell to be accessible .
so even if some cells are exfoliated in a nutritious matrix ( milk for instance ) , they may have to trigger a survival mechanism .
some set of genes are progressively turned - down like clock genes , but in this particular situation , they can be reinduced under specific stimulation in culture . over the years
, the conditions of culture have been adapted to mimic the tissue architecture by creating three - dimensional ( 3d ) environment .
recent works have shown that autophagy can be observed during lumen formation in 3d cell cultures in vitro .
the mcf-10a cells are a nontransformed human mammary epithelial cell line , which can form spherical structures ( called acini ) in which a layer of polarized epithelial cells surrounds a hollow lumen , mimicking the glandular epithelium in vivo [ 8 , 9 ] .
the lesson we can learn from this 3d reconstruction of mammary gland is that epithelial cells are able to flexibly leave or reenter an epithelium .
the property is useful for tissular growth as well as to heal rapidly microlesion in the epithelium cell lining .
. their biochemical state should be close to the state of cells having lost contact with the 3d reconstructed gland . in the next section , we present recent works in laboratory rodents which have shown that this capacity of an epithelial cell to adapt to changing environmental conditions is highly context dependent .
laboratory rodent models have been developed to study the inducing effect of nutrient intake on the exfoliation of epithelial cells in the digestive lumen .
on adult rats fastened for 24 hours and refed for one hour , the feeding intake induces exfoliation of quiescent parietal cells at the top of the gastric gland through an unknown exfoliation factor . under these conditions , stem cells located in the neck region of gastric glands
are believed to be recruited actively to repopulate the surface of the adult rat stomach .
on lactating rat pups , we obtained similar results by fastening the pups for 5 hours and allowed them to be reunited with their mother for one hour before sacrifice .
by contrast , on adult laboratory mice , fatty acids ( like palmitate ) are inducers of intectin , a protein implicated in the exfoliation of apoptotic cells at the top of the villus of the small intestine within an hour after meal .
these models of nutritional manipulations to induce exfoliation on small intestine of mice or gastric mucosa of rats indicate that the mechanism of exfoliation is highly context dependent , but they also open the possibility to develop in vivo studies of anoikis and autophagy in relation with the functioning of peripheral circadian clocks .
the disponibility of laboratory rodent models is of paramount importance to develop in vivo studies on anoikis and its connection with molecular circadian clocks to evaluate the stability of chronobiological molecular information in exfoliated cells .
the proof that exfoliation of quiescent cells is following a circadian rhythm is still missing , probably because the set of physiological parameters leading to the induction of active exfoliation is difficult to handle and the interpretation of data obtained from manual exfoliation is also highly context - sensitive . in conclusion
, exfoliation is a broad term recovering many different biological or experimental situations but as illustrated by the next section , progress in the understanding of the delicate balance between autophagy and apoptosis will help scientists to design new bioassays tailored for specific clinical situations .
exfoliated cancerous cells of epithelial origin have been the first to be used to help design noninvasive screening assay of cancerous patients [ 52 , 53 ] .
the relatively high loss of cancerous epithelial cells by patients as well as the stability of molecular information ( genetic alterations related to colon cancer , for instance ) have helped to establish the methodology .
recently , chapkin et al . have developed and patented a transcriptomic approach to explore exfoliation in stools of infants as well as in adults .
the weak point of this approach is that the morphological information of the cell population is lost during the extraction process of mrna , and there is no possibility to check for the exact cellular origin of these molecules .
exfoliation in stools is still highly debated ; some visual proof of typical intestinal cells have been published [ 4 , 48 ] , but in my experience if whole crypt material or typical colonocytes can be found , most of the time the criticism of loktionov that these cells can not be distinguished from epithelial cells of the anal zone is correct
. the proof of similarity between exfoliated epithelial cells with the ones remaining in the mucosa will be probably easier to perform on gastric epithelium following the seminal work of aoyama et al . .
however , the detection of proteins and structural elements will remain possible only in a limited number of clinical situations narrowing the possibility of using exfoliated epithelial cells as indicator of good health .
however , a better understanding of the key factors allowing the cellular survival outside the tissue architecture will open new avenues to derive useful screening assays from clinical material .
the detachment of epithelial cells from the tissue architecture triggers both pro- and antiapoptotic signals , such as nuclear factor kappa - b and inhibitor of apoptosis protein family members ; these antiapoptotic mechanisms presumably delay the onset of apoptosis and allow cells to survive [ 5456 ] .
the balance between these signals and the duration of detachment determine further fate of these cells .
antiapoptotic signals presumably delay the onset of anoikis , allowing cells to survive provided that they can reestablish extracellular matrix contact in a timely manner . in cells
having lost contact with tissular structure , autophagy corresponds to the recycling of cellular material as well as to the cell capacity to mobilize reserves during periods of starvation .
autophagy is a biochemical pathway allowing survival during fasting period which can be stopped at the organism level to prevent self - digestion .
there are three main forms of autophagy : microautophagy , macroautophagy , and chaperone - mediated autophagy [ 5759 ] . in macroautophagy ,
a portion of the cytosol or organelles are sequestered in a double - membrane - bound vesicle , the autophagosome ( figures 2(a ) and 2(b ) ) .
a core molecule in autophagy regulation is the kinase mammalian target of rapamycin ( mtor ) . by sensing signals that monitor nutrient levels , mtor can trigger protein translation by specific phosphorylation of the ribosomal protein s6 kinase ( ps6k ) .
recent works on the molecular pathway regulating microtubule - associated protein light chain 3b ( lc3b ) and autophagy support the idea that regulation of autophagy is interconnected with regulation of apoptosis .
lc3b may regulate the extrinsic apoptosis pathway in the lung through direct interactions with caveolin-1 and fas .
implication of beclin-2 modifying factor and the antiapoptotic proteins of the bcl-2 family in the anoikis process have been proposed to play a central role in the survival of human intestinal epithelial cells ; this work partly explains , at the molecular level , the low survival rate of exfoliated epithelial intestinal cells .
however , autophagy has been demonstrated to occur in vivo in the surface epithelial cells of neonatal small intestine of piglets .
, the reports of nair et al . and chandel et al . are indicating that high amount of living colonocytes can be recovered from stools ( 5 102 10 cells / g of stool ) . from a physiological point of view in infants as well as in adults
, some epithelial cells may survive in a state of macroautophagy close to the surface of the epithelium up to finding their way back in the cellular lining .
a device can then easily remove such cells ( i.e. , exfoliate these cells ) by mechanical forces . in theory , the physiological status and the genetic profile of these epithelial cells should be close to the ones at the surface of the mucosa . at the intracellular level
, autophagosomes are connected to mtor and clock pathways , and if needed to apoptotic pathways .
autophagy can be described in amino - acid - free situations ( figure 2(a ) ) as well as in glucose - free situations ( figure 2(b ) ) .
the balance is specially relevant in protein kinetics in preterm infants where amino acids are provided by intravenous solutions .
the relationship between autophagy and circadian rhythms has been proposed , but the molecular link between these two phenomena is not yet known .
cells have to process diverse signals such as temperature , ph , and nutrient concentrations in order to maintain a normal physiology . in vivo
, cells are believed to use clock genes to organize and adapt cellular metabolisms and coordinate three - dimensional macromolecular organization ( their phenotype ) in a noisy molecular environment ( molecular signals criss - crossing in and between cells and irrelevant chemical messages ) .
exfoliated epithelial cells in anoikis can be seen as a way to obtain chronobiological information dating back to the time of cells leaving the top of the functional units .
signals encoded in the amplitude domain are predominantly based on concentrations of signaling molecules , a parameter difficult to measure on exfoliated cells in anoikis without proper normalization related to the single cell level on highly purified cellular phenotypes .
in addition , some highly labile biochemical modifications like phosphorylation are probably lost during the storage of biological fluids and in the isolation process or can be made irrelevant to the pathophysiology of the mucosa due to the turnover of the signal by the cellular machinery .
significant improvements in the quality of cellular extracts may be achieved by using extraction buffers suitable to preserve clock gene products .
the biological information encoded in the frequency domain of an oscillatory signal can be transmitted as concatenated signals with multiple biologically significant signals to gene behind the regulatory sequence within the promoter .
on transgenic mammals , oscillations can be measured by recording rhythms of light emissions by cells in which the promoter of some clock gene is linked to a luciferase reporter . on human or nontransgenic mammals , oscillations per se can not be measured in absence of spectrofluorimetric methods applicable on freshly recovered living cells , but indirect evidence of gene - circuit activation may be recovered .
long - lasting or resilient information may be accessible either through ( 1 ) the machinery of transcription at the site of fixation on the dna of the cells or ( 2 ) by the histone code as these epigenetics modifications are believed to be acquired with a stability related to the original tissue ( and to the time of day ) .
the chronobiological information that we can extract from exfoliated epithelial cells depends on the techniques used to isolate cellular material or the manipulation of physiological parameters ( figure 1 ) and on the affinity of interactions of clock molecular components with stable molecules like dna or the persistence of the physiological effects that they are inducing .
we may speculate that quiescent cells like epithelial gastric cells are retaining fully functional clocks , that is , consistent information with their time at exfoliation and subsequent cell survival out of the organism .
the induction of gastric cell exfoliation by nutrient cycle developed in rats that we have adapted on lactating rat pups can be used in the future to address questions about the stability of clock information during anoikis .
exfoliated epithelial cells can be followed by microscopic examination from the initial step of loss of contact at the mouth of the gastric gland to the recovery of cells in the stomach lumen . in addition , the model is clearly relevant to clinical situation in which patients are equipped with nasogastric tubing .
however , there may be tissue - specific differences in the molecular composition of the circadian clock , and clock components that have subtle effects on the central clock function may play a more prominent role in the regulation of peripheral clocks .
have used spontaneously immortalized mouse embryo fibroblasts to explore the main clock components ( proteins and mrna ) suggesting that peripheral clocks in cultured cells may be similar in composition and regulation as central clock , but all these components are not always present in cells depending on their tissular origin .
the most striking example is the apparent redundancy of clock with its homolog npas2 , which are largely equivalent molecules with strict structural differences [ 72 , 73 ] .
three main physiological pathways have been described associated to the regulation of autophagy : akt ( energy sensing ) , egr - r ( growth factor sensing ) , and bcl-2 ( stress - related programmed - cell death ) . according to gan et al .
clock components are probably also altered during this process , but there are no data on the relation between autophagy and clock regulation .
by contrast , explants of tissue isolated from transgenic rat for period1 gene is giving some chronobiological information about the chaotic expression of this gene under the drastic external conditions of explantation .
recording of luminescence emitted in vitro by the explants maintained in classic tissue culture conditions ( 37c , 5% co2 ) has clearly shown that the chaotic light emissions by the transgene system stands up to 1214 hours , thereafter the rhythms of light emissions by liver explants are organized according to an oscillatory model reminiscent of period1 's in vivo oscillations ( as of stokkan et al .
, , the phase of the peak has been recorded during the first subjective day in culture i.e. , between 12 and 36 hours ) . to avoid such chaotic evolution with the loss of chronobiological information , experimenters are using mechanical punches of mucosae which are directly snap frozen in liquid nitrogen .
this strategy is a reliable but invasive solution to study clock gene expression in time series .
otherwise , tissue biopsies can be explanted in culture to derive primary cells or cell lines and record clocks functioning just like with exfoliated cells .
however , cell lines have lost contact with body 's network , and their clock systems are probably quickly reorganized to tune up with their new in vitro environment [ 76 , 77 ] . in the future ,
the use of transgenic mice for autophagic gene circuitry will also help to appreciate the exfoliation status and the molecular link between clocks and autophagy .
the development of non - invasive methods is crucial to allow easy sampling of human populations in nutritional / clinical intervention studies .
exfoliated epithelial cells could be extremely useful to deal with subtle environmental influences during development causing persistent changes in epigenetic regulation .
they represent an alternative to fibroblasts which can be easier to collect on adults , and they putatively are giving molecular information from inner tissues difficult to access .
the problem in the recovery of exfoliated cells is to relate the cell phenotypes and their physiological status with the intact tissue structure of the donor .
in addition , the degradation of biological information depends on the bioactive compounds present in the biological fluids which can be heavily loaded with enzymes like digestive fluids .
a specific application explored in our laboratory is to develop studies in exfoliation in order to improve nursing care in preterm infants and to prevent the onset of such a syndrome during adult life .
tracking exfoliated epithelial cells can be used to follow the renewal of the gastric epithelium in order to monitor nutritional or pharmacological practices .
recently , we have shown that circadian clock genes were disregulated following an episode of perinatal denutrition .
the isolation of exfoliated epithelial cells from pups or infants suffering from perinatal denutrition at the onset of the problem or later in adult life may help to know whether the histone acetyltransferase 's activity of clock can be used to explore the stability of epigenetic profile in exfoliated epithelial cells . however , there is a lack of biomarkers to study exfoliated epithelial cells and the role of clock genes , if any , in autophagy . among many unsolved questions which can be listed ,
we can wonder what is the biological information retained , altered , or lost during anoikis ?
future works may focus on the mtor signaling pathway which has been found downregulated in detached epithelial cells and , in adipocytes , linked to diurnal gene expression and metabolic regulation .
recent data on the molecular biology of clock components indicate that central and peripheral clocks differ in their coupling with the different categories of synchronizers as well as in their output on rodent models [ 81 , 82 ] as well as on human data
. a better understanding of exfoliation may be useful not only to translational research but also to tissue reconstruction of mucosa . | the recovery of exfoliated cells from biological fluids is a noninvasive technology which is in high demand in the field of translational research .
exfoliated epithelial cells can be isolated from several body fluids ( i.e. , breast milk , urines , and digestives fluids ) as a cellular mixture ( senescent , apoptotic , proliferative , or quiescent cells ) .
the most intriguing are quiescent cells which can be used to derive primary cultures indicating that some phenotypes retain clonogenic potentials .
such exfoliated cells are believed to enter rapidly in anoikis after exfoliation .
anoikis can be considered as an autophagic state promoting epithelial cell survival after a timely loss of contact with extracellular matrix and cell neighbors .
this paper presents current understanding of exfoliation along with the influence of methodology on the type of gastrointestinal epithelial cells isolated and , finally , speculates on the balance between anoikis and apoptosis to explain the survival of gastrointestinal epithelial cells in the environment . |
when patients with spinal cord injuries have pain as an accessory symptom , training in the
activities of daily living ( adl ) is affected and sometimes does not progress smoothly1 .
transcranial magnetic stimulation ( tms )
pulses have been used as a noninvasive and painless means of stimulating the brains of
intact conscious human subjects through the scalp2 .
tms pulses were first used in patients with spinal cord injury
( sci ) in the early 19903 and are now used
most extensively in the corticospinal system because the output of the primary motor cortex
can be easily assessed in the form of motor - evoked potentials ( meps ) using surface
electromyographic recording electrodes .
rtms can be applied as continuous trains of low
frequency ( 1 hz ) or as bursts of higher frequency ( 5 hz ) . generally , low - frequency rtms
( stimulus rates 1 hz ) inhibits motor cortical excitability , leading to a reversible
virtual lesion , whereas high - frequency rtms ( 520 hz ) usually promotes an increase in
cortical excitability4 .
belci et al.5 first tested the efficacy of rtms in
modulating corticospinal inhibition and improving functional recovery in four patients with
chronic incomplete ( american spinal injury association impairment scale d ) cervical ( c5
level ) sci .
perceptual thresholds for electrical stimulation of the skin , asia clinical
measures of motor and sensory functions , and times to complete a pegboard were found to
improve during the entire 3-week follow - up period .
the activation of motor nerves due to
repetitive movements induces plastic changes in the primary somatosensory cortex6 which indicates that sensory and motor
nerves are directly related with each other .
although it is relatively well known that
sensory nerves directly affect motor nerves , it has not been established whether motor
nerves affect sensory nerves . in this study , we hypothesized that high - frequency rtms can
improve sensory recovery of the lower extremities in sci patients .
patients were recruited from the neurological physical therapy outpatient clinic of the
faculty of physical therapy , eulji university , after they agreed to participate in the
study .
the research ethics committee of eulji university hospital approved the study , and
all participants provided informed , written consent prior to enrollment .
all patients had
been diagnosed with sci , which was confirmed by computed tomography or magnetic resonance
imaging .
patients that met the following criteria were enrolled : ( 1 ) incomplete sci ( ais c
or d ) by trauma ( traffic accident or fall ) , ( 2 ) cervical or thoracic sci , and ( 3 ) time
elapsed since sci of < 6 months .
after
completing initial assessments , the subjects were randomly assigned to an experimental group
( n=10 ) or a control group ( n=10 ) .
for randomization ,
sealed envelopes were prepared in advance and marked inside with a or b , indicating the
experimental or control group , respectively .
subjects in the experimental group received
rtms and conventional rehabilitation therapy for a total of 50 min ( rtms , 20 min ;
conventional rehabilitation therapy , 30 min ) per day , with a 10 min rest period halfway
through the session .
a magstim rapid2 ( magstim co. , ltd . , wales , uk ) and a figure - of - eight
coil with a diameter of 80 mm were used to administer rtms . in each patient , 1 hz rtms was
applied to the hemispheric hotspot in 10 second trains , with 50 second intervals between
trains .
subjects in the experimental group received training five days per week for 6 weeks .
conventional rehabilitation therapy consisted of neurodevelopmental facilitation techniques
and was administered by therapists unaware of the study protocol or group assignments .
the
objectives of sci rehabilitation were to improve functional abilities , such as , transfer ,
ambulation , and balance , so as to help patients achieve earlier and/or greater independence .
subjects in the control group received sham rtms therapy and conventional rehabilitation
therapy for a total of 50 min ( sham rtms , 20 min , conventional rehabilitation therapy ,
30 min ) per day 5days / week for 6 weeks ; the subjects in both groups received therapy on the
sameday .
an electromyography / evoked potential system ( medelec , oxford instruments , abingdon ,
oxfordshire , uk ) was used for the sensory nerve conduction study ( sncs ) ; stimuli were
applied at a position 10 cm above the lateral malleolus , and sncs was conducted at the sural
nerve in the lateral malleolus region .
stimuli were administered at 2 hz to 10 khz and an
intensity of 10 to 20 ma , and the time was 0.5 sec7 .
intragroup comparisons of variables before and after training were
made using the paired t test , whereas intergroup comparisons were performed using the
independent t - test .
( ibm , armonk , ny , usa ) was used for
statistical analysis , and p values of < 0.05 were considered significant .
a summary of the clinical and demographic features of the sample ( n=20 ) is provided in
table 1table 1.general and medical characteristics of the subjects ( n=20)eg ( n=10)cg ( n=10)gender ( male / female)6/47/3age ( years)41.0 8.143.3 9.6time since injury ( months)3.8 1.63.7 1.1ais ( c / d)3/75/5cause ( f / ta)4/64/6eg : active rtms and conventional physical therapy group ; cg : sham rtms and
conventional physical therapy group ; ais : american spinal cord injury association
impairment scale ; f : fall ; ta : traffic accident .
a significant difference was observed between group post - test velocity
results ( p<0.05 ) , and significant differences were found between pre- and post - test
results for all variables ( p<0.05 ) .
the effect sizes of gains in the experimental and
control groups were very high for the sensory nerve conduction velocity ( effect size 1.00
for both ) ( table 2table 2.comparison of changes in characteristics of the experimental group and control
group with values presented as mean ( standard deviation)eg ( n=10)cg ( n=10)amplitude ( v)pre31.1 14.230.4 15.2post35.0 15.932.2 15.5latency(ms)pre3.6 1.03.6 0.7post3.2 0.73.3 0.4sncv(m / s)pre43.3 7.643.7 10.7post49.1 4.445.6
eg : active rtms and
conventional physical therapy group ; cg : sham rtms and conventional physical therapy
group ; sncv : sensory nerve conduction velocity ) .
eg : active rtms and conventional physical therapy group ; cg : sham rtms and
conventional physical therapy group ; ais : american spinal cord injury association
impairment scale ; f : fall ; ta : traffic accident values are shown as the mean sd . * significant difference from the pre - intervention
value ( p<0.05 ) . * * significantly difference from the pre - intervention value
( p<0.01 ) .
eg : active rtms and
conventional physical therapy group ; cg : sham rtms and conventional physical therapy
group ; sncv : sensory nerve conduction velocity
high - frequency rtms is known to have control effects on motor and sensory functions8 and the fact that high - frequency rtms
increases primary motor cortex excitability has been well established .
summers et al.9 reported when high - frequency rtms was
applied to the primary motor cortex , sensory and pain threshold values increased in normal
adults and in patients with central or peripheral nerve damage . however , the mechanism
responsible for sensory nerve network reactions induced by stimulating the motor cortex has
not been clearly identified .
repeated administration of rtms pulses can induce long - lasting
changes in the excitabilities of the corticospinal tract , m1 , and spinal cord structures and
result in significant improvements in aspects of sensory and motor functions in patients
with motor disorde10 .
the present study
was conducted to investigate the effect of active rtms on sensory recovery of the lower
extremities in patients with subacute sci . according to our results ,
the sncv was more
enhanced after the intervention in the experimental group than in the control group .
furthermore , active rtms was found to be more effective at improving sensory recovery than
sham treatment .
rtms could reduce corticospinal inhibition and thus induce motor
improvements in sci , and it is possible that motor score improvements induced by rtms in sci
could be due to enhancement of descending corticospinal projections and reductions in
corticospinal inhibition7 .
notably , caria
et al.11 reported a direct relation
between motor and sensory nerves .
ragert et al.12 reported that 5 hz rtms induced sustained increases of
somatosensory cortex excitability , and pleger et al.13 found that rtms of the somatosensory cortex improved tactile
discrimination and enhanced somatosensory cortex activation and that changes in primary
motor cortex were negatively correlated with gains in discrimination ability .
these results
support the notion that rtms augments sensory recovery in subacute -stage patients when they
are treated within 6 months of sci14 , 15 .
first , the small sample size may have adversely influenced the analysis and impacted our
results , and thus , our findings can not be generalized to all sci patients .
second , the
absence of follow - up after the end of the active rtms prevented determination of the
durability of the effects of this intervention .
further studies , including a long - term
follow - up assessment , are needed to evaluate the long - term benefits of rtms . | [ purpose ] the aim of the present study was to determine whether repetitive transcranial
magnetic stimulation can improve sensory recovery of the lower extremities in
subacute - stage spinal cord injury patients .
[ subjects and methods ] this study was
conducted on 20 subjects with diagnosed paraplegia due to spinal cord injury .
these 20
subjects were allocated to an experimental group of 10 subjects that underwent active
repetitive transcranial magnetic stimulation or to a control group of 10 subjects that
underwent sham repetitive transcranial magnetic stimulation .
the sci patients in the
experimental group underwent active repetitive transcranial magnetic stimulation and
conventional rehabilitation therapy , whereas the spinal cord injury patients in the
control group underwent sham repetitive transcranial magnetic stimulation and conventional
rehabilitation therapy .
participants in both groups received therapy five days per week
for six - weeks .
latency , amplitude , and sensory nerve conduction velocity were assessed
before and after the six week therapy period .
[ results ] a significant intergroup
difference was observed for posttreatment velocity gains , but no significant intergroup
difference was observed for amplitude or latency .
[ conclusion ] repetitive transcranial
magnetic stimulation may be improve sensory recovery of the lower extremities in
subacute - stage spinal cord injury patients . |
supraorbital neuralgia is a form of localized headache in or above the eyebrow with possible extension in the entire skin region of nerve v1 .
supraorbital neuralgia is defined by the international classification of headache disorders by the following diagnostic criteria : paroxysmal or constant pain in the region of the supraorbital notch and the medial aspect of the forehead of the area supplied by the supraorbital nerve .
the most important hallmark is the same pain experienced by pressure on the supraorbital notch . in general ,
trigeminal neuralgia ( tn ) is unilateral affecting the maxillary ( 35% ) , mandibular ( 30% ) , both ( 20% ) , ophthalmic and maxillary ( 10% ) and ophthalmic ( 4% ) branches and all branches of the trigeminal nerve ( 1% ) .
a case of tn involving supraorbital neuralgia and infraorbital neuralgia as the incidence of involvement of ophthalmic division and maxillary division is rare .
a 35-year - old man with a history of severe ( score of 10 in the verbal numerical scale ) , shock like and throbbing pain in the right v1v2 region , lasting for 510 s that increased on talking , chewing , smiling , with strong breeze and cold water while washing his face since last 67 years .
he visited a dental clinic for the same , for which he has undergone extraction of the upper right posterior teeth ( 16 ) .
the pain did not subside even he visited various clinics in various places where he was medicated with tablet carbamazepine 200 mg eight hourly .
he reported to department of oral and maxillofacial surgery , modern dental college and research centre , indore .
after taking a detailed history , the trigger zones were noted which were nasolabial fold , ala of nose , cheek region , supraorbital rim on right side of the face .
diagnostic block was given in the infraorbital and supraorbital regions on different occasions for which pain was relieved for several hours .
this confirmed the infraorbital and supraorbital neuralgia . to rule out the possible etiology of the neuralgia , mri of cranium
the treatment of peripheral neurectomy was planned as he was on already medication since last 6 years .
the patient was taken under ga with endotracheal intubation and the supraorbital nerve was exposed via upper eyebrow incision [ figure 1 ] .
the nerve was identified and avulsed by twisting the nerve on the artery forcep [ figure 2 ] .
then , the infraorbital nerve was exposed through intraoral approach by giving upper vestibular incision from 13 to 16 region [ figure 3 ] .
the term neuralgia is used to describe unexplained peripheral nerve pain and the head and neck are the most common sites of such neuralgias .
tn is by far the most frequently diagnosed form of neuralgia with mean incidence of 4 per 100,000 populations and mean age of 50 years at the time of examination .
tn is usually unilateral affecting the maxillary ( 35% ) , mandibular ( 30% ) , both ( 20% ) , ophthalmic and maxillary ( 10% ) and ophthalmic ( 4% ) branches and all branches of the trigeminal nerve ( 1% ) .
tn has long been recognized in the medical literature ; infact , it was described as early as the first century ad in the writings of aretaeus .
nicholas andre in 1756 used the term tic doulourex ( painful sensation ) to describe the disorder .
fothergill provided a vivid description of tn in 1773 , hence also called as fothergill 's disease .
although several hypotheses have been put forward , the cause of tn has not been fully explained in the literature . for most patients ,
mechanical compression of the tn can occur as the nerve leaves the pons and traverses the subarchonoid space toward meckel 's cave .
most commonly , the nerve compressed by a major artery , usually the superior cerebellar artery . when pain is felt in second and third divisions ,
the usual finding is the compression of the rostral and anterior portions of the nerve by superior cerebellar artery , if the pain is felt in ophthalmic division , the usual finding is compression of the nerve by the anterior inferior cerebellar artery .
however , in our case mri showed no compression of the nerve along its course .
other causes can be multiple sclerosis , vascular factors transient ischemia , autoimmune hypersensitivity , secondary to dental diseases such as maxillary sinusitis , third molar infections , trauma and congenital abnormalities in bony canal .
lesions with trigeminal ganglion and their rootlets such as central brain lesions , pressure from adjacent cranial structures , tumors of the posterior cranial fossa and vascular compression of nerve root fibers have been reported to be the other causes .
tn characterized by paroxysms of severe , lancinating , electric - like bouts of pain restricted to the distribution of the trigeminal nerve .
the pain predominantly occurs unilaterally , most commonly on the right side and involves the mandibular and/or maxillary branch or rarely the ophthalmic branch .
pain attacks occur spontaneously and also triggered by a nonpainful sensory stimulus to the skin , intraoral mucosa surrounding the teeth and tongue .
each attack usually lasts only seconds to minutes , but they may be repeated at short intervals ; consequently , individual attacks can overlap each other and may be described as lingering , painful sensation .
attacks can occur at any time and are triggered not only by sensory stimuli to the face , but also by movement of the face .
no medical test exists that can be used to diagnose clearly all cases of tn .
the diagnosis of tn rests on the clinician 's ability to recognize a distinctive series of signs and symptoms that define this disorder .
the criteria emphasize five major clinical features that in essence , define the diagnosis of tn .
they are :
the pain is paroxysmal.the pain may be provoked by light touch to the face ( trigger zone).the pain is confined to trigeminal distribution.the pain is unilateral.the clinical sensory examination is normal .
the pain may be provoked by light touch to the face ( trigger zone ) .
diagnostic criteria are defined by the international association for the study of pain ( iasp ) and by the international classification of headache disorders / international headache society ( ichd / ihs ) and include :
paroxysmal episodes lasting from a fraction of a 1 sec . to 2 min .
, affecting one or more divisions of the trigeminal nerve.the pain has at least one of the following characteristics :
a)severe , sudden , superficial , or stabbing ; andb)initiated by trigger factors or trigger points .
episodes are similar among patients.patients do not have clinically evident neurologic changes.it is not attributed to other disorders .
the pain has at least one of the following characteristics :
a)severe , sudden , superficial , or stabbing ; andb)initiated by trigger factors or trigger points .
severe , sudden , superficial , or stabbing ; and initiated by trigger factors or trigger points .
the most common disorders involved in the differential diagnosis include bursts of headaches , dental pain , giant cell arteritis , glossopharyngeal nerve neuralgia , intracranial tumor , migraine , multiple sclerosis , otitis media , paroxysmal hemicrania , postherpetic neuralgia , sinusitis , sunct headache ( short - lasting , unilateral , neuralgiform pain with conjunctival injection and tearing ) , temporomandibular joint syndrome and tn . initially , administration of anticonvulsant drugs was the treatment of choice .
there are several factors that can affect a treatment plan , including the patient 's age , life expectancy , associated medical and psychiatric conditions , compliance with medical therapy and tolerability of adverse effects of drugs .
invasive procedures ( peripheral neurectomy , radiofrequency thermocoagulation at gasserian ganglion , retrogasserian rhizotomy , medullary tractotomy , midbrain tractotomy and intracranial nerve decompression ) are usually reserved for those patients who are unable to obtain relief with medical management or experience unacceptable adverse effects from the use of pharmacologic treatments .
supraorbital neuralgia is a rare disorder clinically characterized by the following triad :
forehead pain in the area supplied by the supraorbital nerve , without side shift;tenderness on either the supraorbital notch or traject of the nerve ; andabsolute , but transitory relief of symptoms upon supraorbital nerve blockade .
forehead pain in the area supplied by the supraorbital nerve , without side shift ; tenderness on either the supraorbital notch or traject of the nerve ; and absolute , but transitory relief of symptoms upon supraorbital nerve blockade .
in addition , there may be signs and symptoms of sensory dysfunction ( hypoesthesia , paresthesia ) and typical neuralgic features
( lightning pain and exteroceptive precipitating mechanisms ) . the hallmark of supraorbital neuralgia is localized pain in or above the eyebrow ( sometimes extending into the parietotemporal scalp region ) .
although etiology and pathogenesis of supraorbital neuralgia are largely unknown , entrapment of the supraorbital nerve at its outlet , trauma to the face , such as when the head hits the windshield or after a punch to the face are thought to be the causative factor and neuralgic pain .
the headache might not present for many years until the scar cicatrix tightens enough around the nerve to finally cause entrapment .
supratrochlear nerve in this region can be injured by poor - fitting eyeglasses , presenting as a more midline forehead pain .
entrapments of first division of the trigeminal nerve can cause unilateral or bilateral throbbing headaches , often just before menses or triggered by bright lights that cause squinting .
the proposed treatment is an injection of 2 ml of 2% lidocaine , 1:60,000 adrenalin in the supraorbital canal , which relieves and mostly obviates the pain in 80% of the patients over a considerable time of span .
generally , there will be lack of , or only minor benefit from drug treatment , including carbamazepine and indomethacin .
there will clearly be tenderness over the supraorbital nerve , especially at its outlet and in some subjects occasionally , a slight local loss of sensation .
the persistence of protracted unilateral forehead / ocular pain , tenderness over the nerve and repeated blockade effect strongly suggests the diagnosis and patient 's willingness for surgical treatment .
complications reported are local hemorrhage , transient diplopia , transient anesthesia of supraorbital skin , mostly lasting only for few days .
correct diagnosis of supraorbital neuralgia is critical in choosing therapy . for persistent or recurrent pain , acupuncture , injection of phenol / glycerol or botulism toxin , neurolysis and root section of the trigeminal nerve are methods that have been successfully employed to treat this condition .
consensus on the best treatment for tn , clinical or surgical , does not exist . | supraorbital neuralgia is a rare disorder accounting for 4% of incidence with hallmark of localized pain in or above the eyebrow , clinically characterized by the following triad : ( 1 ) forehead pain in the area supplied by the supraorbital nerve , ( 2 ) tenderness on either the supraorbital notch and ( 3 ) absolute , but transitory relief of symptoms upon supraorbital nerve blockade .
the pain presents with a chronic or intermittent pattern .
the persistence of protracted unilateral forehead / occular pain , tenderness over the nerve and repeated blockade effect strongly suggest the diagnosis .
surgical treatment can be used when the medical treatment fails or in patients who do not tolerate the pharmacological treatment . |
the european youth heart study ( eyhs ) is a population - based mixed longitudinal cohort study comprising two age - groups of 9-year - old children and 15-year - old adolescents from four european countries : denmark , portugal , estonia , and norway .
the aim of the eyhs was to investigate the personal , environmental , and lifestyle influences on cardiovascular and metabolic disease risk factors .
the study aims , population , selection criteria , and methods have been described previously ( 15 ) . in brief , study participants were randomly selected on the basis of school - level groups , with at least 20 schools within each area .
the present study is based on those children and adolescents with data on maternally reported birth weight and fasting blood samples from denmark , portugal , and estonia ( n = 1,254 ) as fasting blood samples were not collected in the norwegian cohort
. a small number of children ( n = 9 ) , who were classified as very low birth weight ( < 1.5 kg ) were excluded from the analyses because very low birth weight may be may be associated with other health issues and can be indicative of premature birth , as information on gestational age was not available .
data collected via parental self - report were available for socioeconomic status ( ses ) , which was categorized according to the mean for parental income and educational level .
written informed consent was obtained from a parent or guardian , and the study procedures were explained verbally to all children .
ethics approval for the study was obtained from the local research ethics committees in each study region .
trained observers evaluated sexual maturity according to tanner stages of breast development in girls and pubic hair in boys ( 16 ) , with children categorized as being prepubertal ( tanner stage 1 ) , midpubertal ( tanner stage 2 ) , or pubertal ( tanner stages 3 , 4 , and 5 ) .
waist circumference was measured at the midpoint between the iliac crest and the lowest rib , using a metal anthropometric tape , with the mean of two measures being used for the analysis .
height was measured using a stadiometer ( harpenden ; baty international , burgess hill , west sussex , u.k . ) to the nearest 0.5 cm .
bmi was calculated as weight in kilograms divided by the square of height in meters .
body fat percentage or fat mass was estimated using seven different child - specific equations ( 17 ) and was expressed relative to height : fat mass index [ fmi ] = fat mass [ kilograms]/height [ meters ] .
the results from each equation were pooled to provide a mean fmi for each participant . because the study population is generally composed of healthy children and adolescents , we used fasting insulin as a marker of insulin resistance .
samples were divided into aliquots , separated within 30 min , and stored at 80c until transport to world health organization
all biochemical analysis was performed by one of two world health organization certified laboratories .
insulin was analyzed using an enzyme immunoassay ( microtiter plate format ; dako diagnostics , ely , u.k . ) in the bristol laboratory ( danish and estonian samples ) and by two - site immunometric assays with either i or alkaline phosphatase labels in the cambridge laboratory ( portuguese samples ) . to provide a further marker of insulin resistance , the homeostasis model assessment ( homa ) index
was calculated using the homeostasis model of insulin resistance : homa - ir = ( fasting glucose fasting insulin)/22 .
physical activity was objectively measured using a hip - worn accelerometer ( mti actigraph ; manufacturing technology , fort walton beach , fl ) for 4 days .
we derived two measures of physical activity : average activity was defined as total activity counts divided by monitor wear time and expressed as counts per minute per day .
time ( minutes per day ) spent in moderate and vigorous intensity physical activity ( mvpa ) was defined as all minutes above a threshold of 2,000 counts as described previously ( 18 ) . we excluded all time blocks with 10 consecutive zero counts , assuming that the monitor was not worn , and all children with < 600 min / day for <3 days were excluded .
all physical activity variables were also adjusted for total monitor wear time , to adjust for how long the monitor was worn .
aerobic fitness was assessed using a progressive cycle ergometer test ( 19 ) with workloads increased every 3 min until the child was unable to continue even after verbal encouragement .
heart rate data were collected every 5 s throughout the duration of the test ( polar sport tester , polar oy , finland ) .
a heart rate 185 bpm at the end of the test was used as the criterion for achieving a maximal test , and aerobic fitness was expressed relative to ffm as watts per kilogram ffm .
all data were analyzed in continuous form , and nonnormally distributed variables ( fasting insulin and homa - ir ) were log transformed .
multiple linear regression analyses were performed to assess the associations between birth weight and outcome variables ( fmi , waist , fasting insulin , and homa - ir ) .
our initial model was adjusted for sex , age - group , study location , sexual maturation , and ses .
further adjustment for adolescent height was made when waist circumference was the outcome of interest to investigate whether associations were independent of later height .
further adjustments for height and waist were also made when insulin was the outcome of interest to investigate whether these associations were independent of central adiposity .
models were assessed for age - group by sex interaction , but because inclusion of this interaction term did not materially change the effect size for any of the models , they were excluded from the final models .
we also tested for nonlinear associations with birth weight by entering birth weight as a quadratic term .
these models were then repeated , adjusting for total physical activity ( counts per minute ) or minutes of mvpa to investigate whether these variables moderated the association between birth weight and fmi , waist , and insulin .
finally , the model was adjusted for aerobic fitness ( watts per kilogram ffm ) .
we also examined whether physical activity or fitness modified the associations between birth weight and the outcomes of interest by introducing an interaction term of birth weight average activity , birth weight mvpa , and birth weight fitness in the models .
trained observers evaluated sexual maturity according to tanner stages of breast development in girls and pubic hair in boys ( 16 ) , with children categorized as being prepubertal ( tanner stage 1 ) , midpubertal ( tanner stage 2 ) , or pubertal ( tanner stages 3 , 4 , and 5 ) .
waist circumference was measured at the midpoint between the iliac crest and the lowest rib , using a metal anthropometric tape , with the mean of two measures being used for the analysis .
height was measured using a stadiometer ( harpenden ; baty international , burgess hill , west sussex , u.k . ) to the nearest 0.5 cm .
bmi was calculated as weight in kilograms divided by the square of height in meters .
body fat percentage or fat mass was estimated using seven different child - specific equations ( 17 ) and was expressed relative to height : fat mass index [ fmi ] = fat mass [ kilograms]/height [ meters ] .
the results from each equation were pooled to provide a mean fmi for each participant .
because the study population is generally composed of healthy children and adolescents , we used fasting insulin as a marker of insulin resistance .
samples were divided into aliquots , separated within 30 min , and stored at 80c until transport to world health organization
all biochemical analysis was performed by one of two world health organization certified laboratories .
insulin was analyzed using an enzyme immunoassay ( microtiter plate format ; dako diagnostics , ely , u.k . ) in the bristol laboratory ( danish and estonian samples ) and by two - site immunometric assays with either i or alkaline phosphatase labels in the cambridge laboratory ( portuguese samples ) . to provide a further marker of insulin resistance , the homeostasis model assessment ( homa ) index
was calculated using the homeostasis model of insulin resistance : homa - ir = ( fasting glucose fasting insulin)/22 .
physical activity was objectively measured using a hip - worn accelerometer ( mti actigraph ; manufacturing technology , fort walton beach , fl ) for 4 days .
we derived two measures of physical activity : average activity was defined as total activity counts divided by monitor wear time and expressed as counts per minute per day .
time ( minutes per day ) spent in moderate and vigorous intensity physical activity ( mvpa ) was defined as all minutes above a threshold of 2,000 counts as described previously ( 18 ) . we excluded all time blocks with 10 consecutive zero counts , assuming that the monitor was not worn , and all children with < 600 min / day for <3 days were excluded .
all physical activity variables were also adjusted for total monitor wear time , to adjust for how long the monitor was worn .
aerobic fitness was assessed using a progressive cycle ergometer test ( 19 ) with workloads increased every 3 min until the child was unable to continue even after verbal encouragement .
heart rate data were collected every 5 s throughout the duration of the test ( polar sport tester , polar oy , finland ) .
a heart rate 185 bpm at the end of the test was used as the criterion for achieving a maximal test , and aerobic fitness was expressed relative to ffm as watts per kilogram ffm .
all data were analyzed in continuous form , and nonnormally distributed variables ( fasting insulin and homa - ir ) were log transformed .
multiple linear regression analyses were performed to assess the associations between birth weight and outcome variables ( fmi , waist , fasting insulin , and homa - ir ) .
our initial model was adjusted for sex , age - group , study location , sexual maturation , and ses .
further adjustment for adolescent height was made when waist circumference was the outcome of interest to investigate whether associations were independent of later height .
further adjustments for height and waist were also made when insulin was the outcome of interest to investigate whether these associations were independent of central adiposity .
models were assessed for age - group by sex interaction , but because inclusion of this interaction term did not materially change the effect size for any of the models , they were excluded from the final models .
we also tested for nonlinear associations with birth weight by entering birth weight as a quadratic term .
these models were then repeated , adjusting for total physical activity ( counts per minute ) or minutes of mvpa to investigate whether these variables moderated the association between birth weight and fmi , waist , and insulin .
finally , the model was adjusted for aerobic fitness ( watts per kilogram ffm ) .
we also examined whether physical activity or fitness modified the associations between birth weight and the outcomes of interest by introducing an interaction term of birth weight average activity , birth weight mvpa , and birth weight fitness in the models .
descriptive statistics , including means sd for the study population are displayed in supplementary table 1 ( available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-1178/dc1 ) .
there were significant differences between sex and age - groups for most physical characteristics , so all models were adjusted for sex and age - group , as well as study location , ses , and sexual maturation .
higher birth weight was associated with higher fmi , with a 1-kg increase in birth weight associated with 0.49 kg fat mass / m increase in fmi ( = 0.49 [ 0.210.80 ] ; p = 0.001 ) , adjusted for sex , age - group , sexual maturity , and ses . further adjustment for physical activity , as either average activity or minutes of mvpa per day , had little influence on the association between birth weight and fmi and the coefficients were materially unchanged ( table 1 ) .
figure 1 shows fmi stratified by tertiles of birth weight and mvpa and indicates lower fmi by higher tertiles of mvpa , particularly in the third tertile of birth weight , although the confidence intervals overlap and do not reach statistical significance .
further adjustment for aerobic fitness also had little influence on the association between birth weight and fmi .
a formal test for interaction showed no evidence that the association between birth weight and fmi was modified by physical activity levels or aerobic fitness .
there was also no evidence for a sex age - group interaction for fmi .
associations between birth weight and fmi , waist circumference , and fasting insulin data are coefficients ( 95% ci ) .
model 1 : adjusted for sex , age - group , country , maturity , and ses .
model 2 : adjusted for sex , age - group , country , maturity , ses , monitor worn time , and mvpa ( minutes per day ) .
model 3 : adjusted for sex , age - group , country , maturity , ses , monitor worn time , and average physical activity ( counts per minute ) .
model 4 : adjusted for sex , age - group , country , maturity , ses , monitor worn time , total physical activity ( counts per minute ) , and aerobic fitness ( watts per kilogram ffm ) . * additionally adjusted for adolescent height . additionally adjusted for adolescent height and waist circumference .
associations between birth weight and fmi , stratified by tertiles of time spent in mvpa ( minutes per day ) . data
( adjusted means , 95% ci ) are adjusted for sex , age - group , country , sexual maturation , ses , and monitor wear time .
similar results were observed if fmi was substituted with percent body fat as the outcome variable , with birth weight being positively associated with percent body fat , independently of sex , age - group , country , sexual maturation , and maternal bmi , with little change in the magnitude of association if further adjusted for physical activity or fitness ( data not shown ) .
higher birth weight was associated with a greater waist circumference in childhood , with a 1-kg increase in birth weight being associated with a 0.90-cm increase in waist circumference ( = 0.90 [ 0.321.47 ] ; p = 0.002 ) , adjusted for sex , age - group , sexual maturity , height , and ses .
again further adjustment for physical activity , either for average activity or time spent in mvpa , made little change in the birth weight and waist circumference association and the magnitude of the association was largely unaffected .
further adjustment to the model for aerobic fitness produced a very slight increase in the association between birth weight and waist circumference ( 0.94 [ 0.371.50 ] ; p = 0.001 ) ( table 1 ) .
a formal test for interaction showed no evidence that the association between birth weight and waist circumference was modified by physical activity or aerobic fitness .
birth weight was not associated with fasting insulin ( = 0.005 [ 0.055 to 0.045 ] ; p = 0.844 ) , which again was materially unchanged after further adjustment for either total physical activity or time spent in mvpa ( table 1 ) . however ,
when adolescent waist circumference and height were introduced to the model , lower birth weight was associated with higher fasting insulin ( 0.059 [ 0.107 to 0.011 ] ; p = 0.016 ) , and further adjustment for physical activity or fitness had little influence on the birth weight fasting insulin association and the coefficients remained almost unchanged ( table 1 ) .
substituting fasting insulin for homa - ir did not change the observed effect size ( 0.056 [ 0.107 to 0.006 ] ; p = 0.029 ) , and further adjustment for physical activity or aerobic fitness did not modify this association .
similar results were observed when waist circumference was substituted by current body weight in the model , in that there was a significant association between birth weight and fasting insulin ( = 0.058 [ 95% ci 0.106 to 0.010 ] ; p = 0.018 ) , after adjustment for sex , age - group , sexual maturity , ses , and current body weight ( kilograms ) .
however , if waist circumference was substituted by current fmi , the association between birth weight and fasting insulin was attenuated and no longer significant ( 0.032 [ 0.080 to 0.015 ] ; p = 0.184 ) . there was also no evidence of statistical interaction in the association between birth weight and fasting insulin by level of physical activity or aerobic fitness .
higher birth weight was associated with higher fmi , with a 1-kg increase in birth weight associated with 0.49 kg fat mass / m increase in fmi ( = 0.49 [ 0.210.80 ] ; p = 0.001 ) , adjusted for sex , age - group , sexual maturity , and ses . further adjustment for physical activity , as either average activity or minutes of mvpa per day , had little influence on the association between birth weight and fmi and the coefficients were materially unchanged ( table 1 ) .
figure 1 shows fmi stratified by tertiles of birth weight and mvpa and indicates lower fmi by higher tertiles of mvpa , particularly in the third tertile of birth weight , although the confidence intervals overlap and do not reach statistical significance .
further adjustment for aerobic fitness also had little influence on the association between birth weight and fmi .
a formal test for interaction showed no evidence that the association between birth weight and fmi was modified by physical activity levels or aerobic fitness .
there was also no evidence for a sex age - group interaction for fmi .
associations between birth weight and fmi , waist circumference , and fasting insulin data are coefficients ( 95% ci ) .
model 1 : adjusted for sex , age - group , country , maturity , and ses .
model 2 : adjusted for sex , age - group , country , maturity , ses , monitor worn time , and mvpa ( minutes per day ) .
model 3 : adjusted for sex , age - group , country , maturity , ses , monitor worn time , and average physical activity ( counts per minute ) . model 4 : adjusted for sex , age - group , country , maturity , ses , monitor worn time , total physical activity ( counts per minute ) , and aerobic fitness ( watts per kilogram ffm ) . * additionally adjusted for adolescent height . additionally adjusted for adolescent height and waist circumference .
associations between birth weight and fmi , stratified by tertiles of time spent in mvpa ( minutes per day ) . data
( adjusted means , 95% ci ) are adjusted for sex , age - group , country , sexual maturation , ses , and monitor wear time .
similar results were observed if fmi was substituted with percent body fat as the outcome variable , with birth weight being positively associated with percent body fat , independently of sex , age - group , country , sexual maturation , and maternal bmi , with little change in the magnitude of association if further adjusted for physical activity or fitness ( data not shown ) .
higher birth weight was associated with a greater waist circumference in childhood , with a 1-kg increase in birth weight being associated with a 0.90-cm increase in waist circumference ( = 0.90 [ 0.321.47 ] ; p = 0.002 ) , adjusted for sex , age - group , sexual maturity , height , and ses .
again further adjustment for physical activity , either for average activity or time spent in mvpa , made little change in the birth weight and waist circumference association and the magnitude of the association was largely unaffected .
further adjustment to the model for aerobic fitness produced a very slight increase in the association between birth weight and waist circumference ( 0.94 [ 0.371.50 ] ; p = 0.001 ) ( table 1 ) .
a formal test for interaction showed no evidence that the association between birth weight and waist circumference was modified by physical activity or aerobic fitness .
birth weight was not associated with fasting insulin ( = 0.005 [ 0.055 to 0.045 ] ; p = 0.844 ) , which again was materially unchanged after further adjustment for either total physical activity or time spent in mvpa ( table 1 ) . however ,
when adolescent waist circumference and height were introduced to the model , lower birth weight was associated with higher fasting insulin ( 0.059 [ 0.107 to 0.011 ] ; p = 0.016 ) , and further adjustment for physical activity or fitness had little influence on the birth weight fasting insulin association and the coefficients remained almost unchanged ( table 1 ) . substituting fasting insulin for homa - ir did not change the observed effect size ( 0.056 [ 0.107 to 0.006 ] ; p = 0.029 ) , and further adjustment for physical activity or aerobic fitness did not modify this association .
similar results were observed when waist circumference was substituted by current body weight in the model , in that there was a significant association between birth weight and fasting insulin ( = 0.058 [ 95% ci 0.106 to 0.010 ] ; p = 0.018 ) , after adjustment for sex , age - group , sexual maturity , ses , and current body weight ( kilograms ) .
however , if waist circumference was substituted by current fmi , the association between birth weight and fasting insulin was attenuated and no longer significant ( 0.032 [ 0.080 to 0.015 ] ; p = 0.184 ) .
there was also no evidence of statistical interaction in the association between birth weight and fasting insulin by level of physical activity or aerobic fitness .
current levels of physical activity and aerobic fitness did not moderate or modify the associations between birth weight and fmi , waist circumference , or fasting insulin .
our findings suggest that higher birth weight was associated with increased fmi and greater waist circumference , whereas lower birth weight was associated with greater metabolic risk in terms of higher fasting insulin but only after further adjustment for a measure of current adiposity ( i.e. , waist circumference or weight ) .
our results are in contrast with two previous studies reporting that higher physical activity levels or aerobic fitness may moderate the associations between size at birth and metabolic risk .
( 14 ) found the associations for ponderal index ( ponderal index = birth length [ meters]/birth weight [ kilograms ] ) were attenuated in adult men reporting > 25 min / week of vigorous leisure time activity and in those classified in the fit above the 40th centile for vo2 max ( 28.6 ml / kg / min ) .
( 13 ) observed an interaction between reported physical activity levels and glucose intolerance in men , with both higher frequency and intensity of physical activity being associated with lower glucose intolerance , especially in those with birth weight <3 kg .
there are , however , a number of potential reasons for the differences between the current study and these previous reports .
the two previous studies investigating the influence of physical activity on the association between birth weight and metabolic risk both used self - reported methods to assess physical activity levels , whereas we used an objective measure of physical activity by accelerometry .
any self - report measure will be subject to issues of recall bias , but it should also be noted that questionnaires may capture different aspects of physical activity compared with accelerometry .
self - reported physical activity usually only considers regular , distinct activities , such as specific types of exercise and leisure time activity , whereas accelerometers measure body movement throughout the measurement period .
self - report methods are unlikely to fully capture incidental activity , which may be hard to recall , whereas accelerometers are limited to detecting certain movements .
for example in this study the hip - worn monitor may not capture cycling or activities for which the monitor was removed , such as swimming .
indeed , these two measures are only weakly correlated , typically at 0.3 in adults ( 20 ) . furthermore , the questionnaires used in the previous studies captured information on physical activity during the preceding 12 months , whereas we , for practical reasons , only measured physical activity for 34 days .
however , we included both weekdays and weekend days and a 4-day measurement period has been suggested to be sufficient when physical activity is assessed by accelerometry in youth ( 21 ) . although adiposity tends to reflect long - term energy balance , fasting insulin levels can be influenced by very recent physical activity levels ( 22 ) .
the lack of a modifying effect of physical activity or aerobic fitness in the present study compared with previous observations may also be explained by differences in the study populations .
we examined the influence of physical activity on the associations between birth weight and metabolic risk in healthy children and adolescents , whereas the two previous studies were performed in middle - aged men ( 14 ) and older adults aged 6575 years , respectively ( 13 ) .
it is possible that the beneficial effect of physical activity or aerobic fitness on the association between birth weight and metabolic risk may not be apparent until later in life when the age - related increase in metabolic risk is more pronounced ( 2 ) .
the finding that birth weight was positively associated with fmi is consistent with previous findings in adolescents ( 23 ) .
however , fmi includes an adjustment for current body size and therefore does not preclude the possibility that postnatal growth may influence the association between birth weight and fmi .
a detailed measure of body fat distribution was not available ; however , previous studies have also observed positive associations between birth weight and waist circumference in younger children ( 8) .
the observed association between low birth weight and insulin resistance was only observed after adjustment for current waist circumference or weight , but this association was attenuated if adjusted for any measure of general adiposity ( e.g. , fmi or fat mass ) .
this finding suggests that current adiposity more strongly influences insulin levels than current body size .
however , it is hard to disentangle the pathways involved between birth weight and later insulin resistance , when adjusting for a measure of body size , because measures such as current weight will be influenced by both fat mass and ffm . a previous study investigating the associations between birth weight and insulin resistance in the eyhs study population showed an association between lower birth weight and homa score , which was augmented after further adjustment for current body size ( bmi or height ) ( 3 ) .
the statistically weaker association observed in the present study , which included a subset of the eyhs population with complete physical activity data , may be explained by reduced statistical power .
it is also plausible that when an association between birth weight and a metabolic outcome ( e.g. , insulin resistance ) is only detected after adjustment for current body size , it may be indicative of an association between change in size between birth and the later measurement , such as rapid weight gain ( 4 ) .
however , we did not have an intermediate measure of body size or composition in earlier childhood to be able to investigate this further .
further studies with repeated measures of body composition would be particularly valuable for investigating associations among birth weight , infant and childhood weight gain , and later metabolic risk . although we did not detect any influence of physical activity or aerobic fitness on the birth weight metabolic risk association
, there is a wide range of evidence to suggest that higher levels of physical activity may be beneficial for reducing insulin resistance and metabolic risk ( 12 ) as well as adiposity ( 11 ) .
given that the influence of physical activity and aerobic fitness on the association between birth weight and metabolic health in the two previous studies was in older adults , it may be difficult to detect the influence in young healthy populations .
further research in older populations or those at higher metabolic risk , using objectively measured physical activity and aerobic fitness data , would be particularly useful to investigate whether increasing physical activity levels or improved aerobic fitness may reduce insulin resistance in those born small or improve body composition , particularly in those born at the higher end of the birth weight spectrum who may be at increased risk of later obesity . the following limitations should be considered when interpreting the results from the present study .
first , we used skinfold , height , and weight equations to derive fmi , which may not be as accurate as other methods , such as dual - energy x - ray absorptiometry , deuterium dilution , or plethysmography .
however , we estimated fmi as an individual aggregate using seven different equations to increase the accuracy of this method ( 17 ) .
further , this method is more feasible to use in large population - based studies , provides a more comprehensive measure of adiposity than bmi , and is comparable to more detailed measures of body composition ( 24 ) .
although birth weight was maternally reported and not objectively measured in this study , maternally reported birth weight correlates highly with measured birth weight ( 25 ) .
unfortunately , data on gestational age were not available , so residual confounding by gestational age may persist , although very low - birth - weight infants ( < 1.5 kg ) were excluded .
lastly , it should be noted that potential confounding variables included in the models ( maternal bmi and ses ) were self - reported and may be subject to recall bias
. strengths of this study include a large population - based sample of children and adolescents from three differing countries combined with an objective measure of physical activity , a maximal aerobic fitness test , and fasting blood samples . in summary
, the results from the present study did not show that physical activity or aerobic fitness can moderate or modify the associations between low birth weight and insulin resistance or between higher birth weight and increased fat mass and greater waist circumference in healthy children and adolescents
. however , higher levels of physical activity are beneficial for both body composition and metabolic risk throughout the life course and the moderating effect of physical activity on the birth weight and metabolic risk association may only become apparent later in adult life or within populations at greater metabolic risk . | objectivelower birth weight has been associated with a greater risk of metabolic diseases . the aim of this study was examine whether physical activity and aerobic fitness may modify associations between birth weigh and metabolic risk.research design and methodsthe european youth heart study is a population - based study of 9 and 15 year olds ( n = 1,254 ) .
birth weight was maternally reported .
skin fold measures were used to calculate body fat and fat mass index ( fmi = fat mass [ kilograms]/height2 ) .
insulin was measured using fasting blood samples .
physical activity was measured using a hip - worn accelerometer ( mti actigraph ) for > 600 min / day for 3 days and is expressed as average activity ( counts per minute ) and time spent in above moderate intensity activity ( > 2000 cpm ) .
aerobic fitness was assessed using a maximal cycle ergometry test ( watts per kilogram fat - free mass).resultshigher birth weight was associated with higher fmi ( = 0.49 [ 95% ci 0.210.80 ] ; p = 0.001 ) and greater waist circumference ( 0.90 [ 0.321.47 ] ; p < 0.001 ) , adjusted for sex , age - group , sexual maturity , height , and socioeconomic status .
lower birth weight was associated with higher fasting insulin only after further adjustment for adolescent waist circumference and height ( 0.059 [ 0.107 to 0.011 ] ; p = 0.016 ) .
there was no evidence for any modification of the associations after adjustment for physical activity or aerobic fitness.conclusionsthe present study did not find any evidence that physical activity or aerobic fitness can moderate the associations among higher birth weight and increased fat mass and greater waist circumference or between lower birth weight and insulin resistance in healthy children and adolescents . |
the medical literature is replete with articles verifying the usefulness of laparoscopic procedures under local anesthesia .
recent research has examined the efficacy of microendoscopy with local anesthesia . in this series of patients , we focused on new technology to determine if microendoscopy could be utilized in an office setting .
between july 1994 and april 1995 , we performed 51 microendoscopic office laparoscopy under local anesthesia ( micro - olula ) using the 1.5 mm pixie laparoscope by origin , a 1.7 mm laparoscope by optimed and 5 mm laparoscope by jarit .
all cases were performed in an office operating room at the women 's medical plaza in montgomery , alabama .
only one patient was unable to have the procedure completed due to intolerance under local anesthesia .
fifty - one micro - olulas were performed on these patients who had an average age of 31 years and an average weight of 157 pounds .
one case was done with a 5 mm laparoscope and five cases with the 1.7 mm optimed laparoscope .
our patients seemed to like the idea of a small device to view their pelvic cavities .
the small laparoscopes provide excellent cosmesis , and laparoscopes deserve further development and clinical trial to determine their most advantageous use in the office setting .
the medical literature is replete with articles verifying the usefulness of laparoscopic procedures under local anesthesia .
recent research has examined the efficacy of microendoscopy with local anesthesia . in this series of patients , we focused on new technology to determine if microendoscopy could be utilized in an office setting and to evaluate the patient 's pain responses to various aspects of micro - olula . between july 1994 and april 1995 , we performed 51 microendoscopic office laparoscopy under local anesthesia ( micro - olula ) using the 1.5 mm pixie laparoscope by origin , a 1.7 mm laparoscope by optimed and 5 mm laparoscope by jarit .
all cases were performed in an office operating room at the women 's medical plaza in montgomery , alabama . in a previous publication ,
only one patient was unable to have the procedure completed due to intolerance under local anesthesia .
all patients were evaluated preoperatively with a complete history and physical exam , viewed a video on laparoscopy under local anesthesia and given the belly test .
basic operative technique was similar to our previously published office laparoscopy cases : i.e. , intramuscular preop meds , field block anesthesia at the umbilicus and a paracervical block .
fifty - one micro - olulas were performed on these patients who had an average age of 31 years and an average weight of 157 pounds .
one case was done with a 5 mm laparoscope and five cases with the 1.7 mm optimed laparoscope .
we obtained pain data in 29 patients using the pain survey by fishburne from an earlier paper .
similar to fishburne 's original work , we evaluated our patient 's pain response to six parts of the procedure using a scale from 0 to 4 ( 0 = no pain , 1 = slight pain , 2 = moderate pain , 3 = severe pain , 4 = extremely severe pain ) .
for this study we evaluated the patient 's response to the paracervical block , skin evaluation , co2 gas insufflation , trocar insertion , uterine motion and fallopian tube pain ( table 2 ) .
most of the surveyed patients had minimal postoperative complaints of nausea , vomiting , syncope and other difficulties ( table 3 ) .
only two patients of this series said that they would not recommend micro - olula to a friend .
the remainder of the patients said that they would highly recommend micro - olula to their friends .
fishburne 's pain survey suggested that the most painful aspect of micro - olula was movement of the uterus .
it is possible , however , that painful uterine motion may be related to anxiety or pelvic pathology . from our small series of patients
it appears that the pain associated with micro - olula is minimal . from our initial experiences with microendoscopes
, we believe that clinicians can readily utilize diagnostic laparoscopy in an office setting . in the near future ,
we plan to do more micro - olula with two punctures to assess pelvic pain patients , adhesiolysis and patients needing assisted reproductive technology ( art ) .
ultimately , micro - olula technique may permit us to evaluate pelvic pain patients in the office with little preparation of the patient .
we do not believe that patient safety is compromised by using a no iv technique since we had ivs available in the office operating room and had extensive experience in performing office laparoscopy .
the no iv technique is not recommended for those beginning their experience with office laparoscopy .
there are disadvantages associated with micro - olulas including a small field of view and decreased magnification with small laparoscopes .
the pixie laparoscope has potential for use in an office setting but may be limited due to cost concerns .
our patients seemed to like the idea of a small device to view their pelvic cavities .
microendoscopes deserve further development and clinical trials , to determine their most advantageous use in the office setting . | background : the medical literature is replete with articles verifying the usefulness of laparoscopic procedures under local anesthesia .
recent research has examined the efficacy of microendoscopy with local anesthesia . in this series of patients , we focused on new technology to determine if microendoscopy could be utilized in an office setting.methods:between july 1994 and april 1995 , we performed 51 microendoscopic office laparoscopy under local anesthesia ( micro - olula ) using the 1.5 mm pixie laparoscope by origin , a 1.7 mm laparoscope by optimed and 5 mm laparoscope by jarit .
all cases were performed in an office operating room at the women 's medical plaza in montgomery , alabama .
only one patient was unable to have the procedure completed due to intolerance under local anesthesia.results:fifty-one micro - olulas were performed on these patients who had an average age of 31 years and an average weight of 157 pounds .
intraoperative abdominal time averaged 3 minutes .
one case was done with a 5 mm laparoscope and five cases with the 1.7 mm optimed laparoscope .
the 1.5 mm pixie laparoscope was used in 45 patients.conclusions:our patients seemed to like the idea of a small device to view their pelvic cavities .
the small laparoscopes provide excellent cosmesis , and laparoscopes deserve further development and clinical trial to determine their most advantageous use in the office setting . |
the sequencing of the human genome and the tentative identification of genes ' underlying susceptibility to mental disorders suggest the possibility of developing novel and more effective treatments for these disorders .
increased knowledge of the pathways for the pathophysiology of major mental illnesses can , it is hoped , lead to major therapeutic breakthroughs , the assumption being that understanding of the pathophysiological basis of these illnesses will enable the development of targeted drugs and new curative therapies .
on the basis of genetic knowledge about patients ' drug metabolic status ,
several studies recommend adjustment of therapeutic doses of antidepressants or antipsychotics in relation to cyp2d6 , cyp2c9 , and cyp2c19 phenotypes . the implementation of these techniques in clinical practice - which is the ultimate goal of pharmacogenomics research in this field - can significantly improve psychiatric treatment in terms of adequate dosing , reduced side effects , averted toxic events , and improved treatment adherence and efficacy . on the other hand ,
looking at the development in pharmacogenomics from the perspective of earlier hopes for gene transfer - based therapies , there is a non - negligible risk that scientists and their funding agencies , as well as the pharmaceutical industry , play up or hype the possibilities .
do the players sufficiently acknowledge the scientific uncertainties that are connected to pharmacogenomics research ; for example , the complex interactions between genes / brain / environment that underlie the development of mental disorders ? in order to appreciate the significance of genetic explanations of complex and heterogeneous disorders , such as schizophrenia , eg , in terms of the genetic susceptibility for its development , it is necessary also to understand the role of epigenetic factors ( heritable genomic functions that are not contained in the dna sequence code ) and factors related to the psychosocial environment .
likewise , in order to properly assess genotype -specific psychopharmacological products , complex epigenetic interactions must be taken into account .
the human brain is fundamentally a biosocial structure , and mental health throughout life depends on social as well as biological conditions .
the brain develops within a genetic envelope , but the evolution of its architecture is subject to important social impact , notably , through the gigantic weight of the cultural imprints epigenetically stored in our brains .
the formation of synapses is both prenatal and postnatal ; it is far from complete at birth .
the postnatal development of the human brain lasts considerably longer than in any other animal .
the most intense development occurs during the first 2 years , but it continues to puberty and after , and the highest executive functions that are determined by the frontal lobe are not fully mature until the age of around 20 . the environment is important for this process to be efficient .
if neural networks are not active , they vanish30 : use it or lose it ! , as the mantra goes . in the absence of adequate stimulation
genetic , epigenetic , neurophysiologic , and psychosocial explanations of mental illness are complementary ; they do not stand opposed in modern psychiatry . however , a correct understanding of the interactions between these distinct perspectives in the complex causal structures underlying mental disorders and their curative therapies is hard to achieve .
this is not a new challenge , specific to pharmacogenomics , but a classical one that is reactualized in this new context .
more effective treatments for mental disorders can indeed result if drugs are developed that specifically target the genes responsible . yet
the role of genes in causing mental disorders is extremely complex , as is the connection between genotype and phenotype in drug metabolism .
it is , for example , not possible to base high - probability predictions of drug responses on single genetic variations .
whilst the possible contributions of molecular biology to psychopharmacological drug discovery are important , they must not be overemphasized or oversimplified .
it is important and legitimate for science , health care , and the pharmaceutical industry to try to promote new ideas and new types of drugs ; however , if the expectations are exaggerated this may undermine public trust and reduce financial support in the longer perspective .
this is what happened to gene therapy : when legitimate promotion became hype , followed by very public failures of clinical trials , venture capital and government sponsors withdrew from the field .
the result was that scientific research suffered , and the public and other stakeholders were left holding an empty bag of promises .
it has been claimed that enthusiasts within the academic and business fields of pharmacogenomics are guilty of too much speculation and unsubstantiated claims .
skeptics point not only to the scientific uncertainty concerning the promises held out , but also to exaggerations in the promised reductions in adrs , and to the costbenefit ratio suggested .
there are signs of hype being created , when , in 2006 , the pharmaceutical industry predicted that by 2010 , the discovery and development process will take half as long as it does now , and costs per drug will fall to a quarter of the current average .
it is not impossible that their prediction will come true in due course , but we are not there yet , and at the time of writing that prediction seems , at least timewise , overly optimistic .
the sociological analyses of these expectations have focused on how key actors communicate visions about future prospects of the new technology ; these keyactors represent different interests , eg , industry , government , health care providers , or patient groups .
their visions are seen as coconstructions where each actor is actively helping to shape the trajectory of an emerging promising technology .
even bioethics is suggested as a helpmate , actively recruited by pharmaceutical companies and the biotech scientific community in order to serve as a political brooker .
a basic message in these sociological analyses is that industry , the medical profession , and patient groups are coresponsible for producing hype , and they call for a more social - science based analysis of the science behind pharmacogenomics to obtain a more realistic view of what can actually be achieved , to unravel the interests pressing for early implementation , and to deconstruct the hype . in that context
, it must not be ignored that social scientists , eg , ethicists , themselves may feed on the hype and be guilty of producing it .
in other words , the methods of social science should be used without , however , excluding social science as an object for scrutiny .
the first - generation antipsychotic drug clozapine is still recommended in the uk national institute of health and clinical excellence ( nice ) 2009 update to its schizophrenia guidance , but in a 2002 press release , nice
recommends newer antipsychotic drugs as one of the first - line options for schizophrenia . the choice between newer and first - generation drugs depends in part on the relative benefits of the drugs and their side effects , and in part on the health care budget .
an important reason to recommend newer rather than first - generation psychopharmacological drugs is that the latter tend to have more severe side effects ( eg , heart disorders such as myocarditis and cardiomyopathy , the blood disorder agranulocytosis , or tardive dyskinesia , a movement disorder that is potentially irreversible ) . on the other hand ,
often the incremental efficacy is not very spectacular , but the tolerance is improved at a cost that is unbearable for the health care system . hence , there is a clear health care budget issue involved in the selection of drugs .
the testing phase needed to determine , eg , if the drug is effective , safe , and by what method and dosage it is best delivered to the organ system , can also take many years and is likewise very expensive . more and more requirements are raised by the regulatory agencies , and , of potential new medicines , few will ever reach the stage of marketing and selling - a phase that can cost even more than the preceding two combined .
these factors jointly make pharmaceutical development extremely costly , and consequently , pharmaceutical companies do what they can to recoup their outlays . in recent years , the balance of power has shifted , and the market has become more difficult for the pharmaceutical companies , due to , for example , expiring patents , attrition in the pipelines , and the fact that governments , insurance companies , and patients increasingly- dictate what kind of drugs they want , and how much they are willing to pay for them .
this means that it is not just the drug makers who define the threshold of innovation , but also the health care demanders .
in this situation , where the pharmaceutical industry has seen its value dwindle compared with the glory days of the 1990s , the contributions of molecular biology to drug discovery hold promise of increased profit for the pharmaceutical companies . concerning the costbenefit ratio of pharmacogenomic drug development , there are profoundly different visions of the future . according to the optimistic vision ,
a better understanding of how different diseases function both at a molecular level and as part of a biological system might enable the industry to define diseases far more precisely , and to develop drugs that are targeted towards specific disease types , rather than making one - size - fitsall drugs focusing on symptoms shared by a range of different diseases .
many new drugs will then be based on biology rather than chemistry because biologic entities are typically more predictable and less toxic than chemical entities . in the aim to get the right drug into the right patient ,
human research subjects will be genotyped in clinical trials to find out likely drug responses , a development also predicted importantly to reduce the time and cost of making new drugs .
if that prediction is correct , then the cost of drug development might pose less of a problem in the case of targeted medication than in the case of one - size - fits - all drugs .
pharmacogenomic developments could thus lead to better health care without increasing the customer prices , and perhaps even reducing them .
this can then be a win - win situation , where patients receive better health care whilst industry boosts its revenues .
skeptics ( amongst whom we also find some sectors of the pharmaceutical industry ) recommend a more cautious view , arguing that the niche products that pharmacogenomics would produce risk segmenting the market , increasing the development costs , and reducing profits .
the research , argue the skeptics , will take longer than predicted to produce clinical applications , and that the alleged cost - saving will therefore not be provided .
of course , the costbenefit ratio of new therapeutic cures may be difficult to determine in advance ; yet the argument of pharmacogenomic cost - efficiency can be questioned on a general basis .
the market for a genotypespecific drug is perforce smaller than that of the one type fits all variety .
even if the development process becomes more efficient , the development of highly specialized drugs that target small rather than large populations can also lead to very expensive drugs .
the need for pharmaceutical companies to recoup their investments is an economic reality that can clash with the interests of health care , and it is not self - evident that the latter 's concerns will outweigh the former .
such stratification might lead to the unfair representation of specific groups in these trials , as well as a reduction in the number of subjects included , which could affect the study 's external validity and clinical applicability . even with more cost- and time - efficient clinical trials ,
if researchers can recruit only people with a certain genotype for the testing of a specific drug , there is a risk connected to the fact that the prospective drug is tested only on a small and genetically homogenous group .
side effects might go undetected in the case of people who do not have this genotype , which means that a drug could be marketed with less premarketing exposure and less information about adverse effects .
this may not be a problem if only patients with the tested genotype use it , but if ( eg , through prescription error , or nonprescribed uses ) someone with a different genotype takes it , the knowledge of possible additional side effects for these people is wanting .
this is different from drug errors with the randomized tested traditional drugs . in the case of the latter ,
if a person unjustifiably- takes a nonprescribed drug , or if a psychiatrist erroneously prescribes a drug , eg , an antidepressant , the possible risks and side effects are reasonably well foreseeable , and can probably be treated if the person seeks medical assistance .
if the same person erroneously takes a genotype - specific drug , there is no tested knowledge about what might happen .
this is not an argument against the development of genotype - specific drugs , but an argument for the development of a social infrastructure to handle their distribution .
the problem highlights many challenges involved in integrating pharmacogenomic drugs into psychiatric care , eg , the need for simple and accessible pharmacogenetic tests with clinical guidelines that allow psychiatrists and health care personnel to use these tests adequately , and to prescribe or recommend pharmacogenetic drugs , as well as the need for effective measures to prevent nonprescribed use .
the genetic information obtained must also be legally safeguarded to protect privacy and confidentiality , and calls for caution have been made to regulate the use of genetic tests .
a further problem remains , from the point of view of the patient , that is connected to the costs involved in targeted drug development .
this concerns the fact that some people may belong to less profitable patient groups . in order to regain the investment in a drug that is targeted towards a small population
, the price must be higher than if the drug were able to be distributed to a large population .
this economic principle poses a problem for so - called orphan diseases , ie , medical conditions that are either too rare , or that touch populations too poor for drug development in that area to be profitable .
less profitable patient groups stand a smaller chance of having remedies developed than profitable patient groups with diseases that are also prevalent in developed countries .
to remedy the situation , public policies in many countries fund or facilitate research aiming to produce orphan drugs specifically targeted to treat these rare conditions , or these diseases that primarily haunt poor populations .
now pharmacogenomics introduces a new way of belonging to a less profitable patient group . to the traditional criteria of having a rare disease , or being burdened by poverty
when new pharmacogenomic drugs are developed they need to be tested in specific patient groups targeted by specific drugs
. however , it might be difficult to find a sufficient number of patients for a trial of rare variants of individual biomarker profiles .
patients with less profitable genotypes are therefore at risk of becoming therapeutic orphans , and governments mayneed to extend their orphan drug policies to remedy this additional form of inequity .
if pharmacogenomic drug development enables precision in the inclusion of patients that can be helped by a drug , it ipso facto entails the equally targeted exclusion of those that can not .
the limit between pharmacological inclusions versus exclusions can in some cases be a question of race , or ethnicity .
for example , drugs to treat high blood pressure , or hypertension , have different effects on black versus caucasian populations , as the high number of clinical trials investigating this listed on the us national institute of health 's web site on clinical trials illustrates .
the concept race is scientifically controversial ; some claim that race is biologically meaningless , whereas others argue that this depends on how the concept is defined . in pharmacology
, it seems well established that different ethnic groups , at least , respond in different manners to drugs , which is one reason why the international conference on harmonization ( ich ) was created to harmonize the technical requirements for registration of pharmaceuticals for human use in the three main regions : europe , the us , and asia .
japan has insisted that due to their ethnic pharmacological specificity , phase 1 studies must always also be done in asian populations .
if therapeutic ( in)equity can be connected to race , or ethnicity , this is something that the social assessment of pharmacogenomic drug development needs to take into account .
as the problem of orphan drugs and diseases illustrates , pharmaceutical companies have no obligation to develop drugs in an equitable manner , eg , with racial or ethnic nonbias . if a racial or ethnic group is very small , for example , the costbenefit ratio for developing drugs to treat that group may not be economically rewarding .
this is a further form of possible discrimination that governments may need to deal with in their health care and health research policies in order to ensure the protection of genetic or ethnic minorities .
personalized medicine in psychiatry , eg , in the form of tailored antidepressant or antipsychotic treatment , has already made important progress , notably in terms of adjusted therapeutic doses , and predictable drug responses or drug - induced side effects .
although promising , these opportunities also give rise to numerous scientific , ethical , legal , and social challenges .
an adequate assessment of personalized medicine in psychiatry must within all these perspectives be based both on analyses of the science behind pharmacogenomics research to get a realistic view of what can actually be achieved , and on analyses of the relevant sociopolitical structures surrounding this research .
justified hopes must not be inflated to become hypes of exaggerated promises that would serve no legitimate purpose .
signs of hype , for instance in the form of pressures for rash implementation , should be forestalled and a realistic view presented .
realistic costbenefit analyses are needed to produce reasonable health care budgets ; pharmacogenetic tests must be developed together with guidelines for their use , so that the new techniques can be responsibly implemented in clinical practice ; public policies on orphan diseases and drugs may need to be extended to avoid creating a new group of genetic orphans ; whilst legal regulations are needed to ensure that the genetic information obtained is safely protected from misuse , and that genetic or ethnic minorities are protected from discrimination .
the ethical considerations that have here been considered in terms of adequacy , cost , and therapeutic equity raise no objections to the development of personalized medicine per se in this domain .
rather , they point to the necessity of developing a social infrastructure with adequate guidelines to ensure the responsible implementation of these promising new techniques . | pharmacogenomic developments hold promise for personalized medicine in psychiatry with adjusted therapeutic doses , predictable responses , reduced adverse drug reactions , early diagnosis , and personal health planning .
the prospects are exciting , but at the same time , these new techniques stand faced with important scientific , ethical , legal , and social challenges that need to be met in order for the scientific advances to be responsibly applied .
this review discusses the ethical balance between challenge and opportunity of personalized medicine in psychiatry under the aspects of adequacy , costbenefit ratio , and therapeutic equity .
it is argued that the promising nature of these therapeutic possibilities makes it all the more important to avoid exaggerating the expectations , and that a sophisticated social infrastructure needs to be developed in order to ensure the realistic and responsible application of personalized medicine in psychiatry . |
coronary artery disease , as an important manifestation of atherosclerosis , is one of the most frequent causes of death and disability in the western world .
it has been proposed that inflammation is the driving force in atherosclerosis [ 2 , 3 ] , and strong evidence supports the central role of proinflammatory cytokines , such as interleukin-1 ( il-1 ) and interleukin-6 ( il-6 ) in these pathologies .
human coronary artery endothelial cells ( hcaec ) have previously been shown to have a strikingly greater responsiveness than human umbilical vein endothelial cells ( huvec ) .
the endothelium is considered a dynamic organ with secretory , metabolic , immunologic roles , in addition to its regulatory function of nutrient transport .
endothelial cells from diverse environments are heterogenous with respect to their surface phenotype , mrna expression , and levels of il-6 and procoagulant proteins , such as tissue factor ( tf ) . within the past decades , the majority of endothelial proinflammatory / coagulation studies have been performed on huvec , derived from a vascular bed not present in the adult , making these cells an inappropriate model of endothelial inflammation and coagulation [ 5 , 6 ] .
tf is a pivotal factor found associated with endothelial cells within atherosclerotic plaques that can transform the endothelial cell membrane from an anticoagulant to a procoagulant surface following vascular injury .
unique sensitivity of hcaec to tumor necrosis factor ( tnf)-stimulated expression of adhesion molecules ( as compared to human aortic endothelial cells ) and greater susceptibility of hcaec to inflammatory stimuli , ( as compared to huvec and human dermal microvascular endothelial cells ( hmvec ) ) have been reported .
endothelial cells contribute to homeostasis and vasodilation , also by releasing prostacyclin ( pgi2 ) known to inhibit platelet aggregation and deposition .
however , no reports as far as we know , have addressed the comparative influence of il-1 on pgi2 release , tf activity , or il-6 protein release from hcaec versus other endothelial cell types .
previous epidemiological studies have suggested that black and green tea consumption may have beneficial effects on endothelial function and is associated with a decreased risk of cardiovascular events [ 1013 ] .
black tea inhibited the proliferation of smooth muscle cells involved in the development and progression of atherosclerosis and mechanisms for the beneficial effects of tea including vasculoprotective , antioxidative , antithrombogenic , anti - inflammatory , and lipid - lowering properties of tea flavonoids have been reported [ 11 , 1518 ] .
animal studies confirmed that black tea extract ( bte ) has anti - inflammatory activity , however , its effects on different types of endothelial cells is still not clear .
the polyphenolic stilbene resveratrol ( rsv ) is found in grape skins , red wine , and peanuts [ 19 , 20 ] .
trans -rsv has been shown to inhibit tf expression in vascular cells and to act anti - inflammatory [ 2123 ] .
however , it is still largely unknown how bte and/or rsv affect il-1-stimulated inflammatory and coagulation pathways in hcaec , as a novel model system , compared to huvec or other endothelial cell types .
so , our focus has been to elucidate the mechanisms that could modulate il-1 proinflammatory / procoagulant responses in hcaec .
the specific objectives of this study were to understand the influence of potential anti - inflammatory plant extracts , such as bte and rsv , on il-1-induced primary hcaec and to compare their il-6 , tf , and prostacyclin responses with other types of endothelial cells .
lyophilized human il-1 ( invitrogen - carlsbad , california , usa ) , resveratrol and extract from black tea ( sigma - saint louis , missouri , usa ) were reconstituted according to manufacturer 's instructions to stock concentration and stored until usage at 20c or 80c . the black tea extract used in the current report is composed of more than 80% theaflavins ( theaflavin and theaflavin gallates ) .
the final concentration of il-1 was 1000 pg / ml , resveratrol 40 mol / l , and the final concentration of black tea extract was 40 g / ml unless otherwise stated .
huvec , hcaec , and hmvec were purchased from cambrex bioscience ( walkesville , maryland , usa ) .
the cells were plated onto 12 or 6 well plates or 75 cm flasks ( tpp , trasadigen , switzerland ) at 37c in a humidified atmosphere at 5% co2 .
hcaec and hmvec were grown in egm-2 m medium ( cambrex bioscience , walkesville , maryland , usa ) containing 5% fetal bovine serum ; for huvec we used egm medium containing 2% fetal bovine serum ( cambrex bioscience , walkesville , maryland , usa ) . for experiments
, subconfluent cell cultures were used between 4 and 6 passages in serum - free medium with addition of stimulatory and/or modulatory substances for 24 hours , unless otherwise indicated . prior to experiments
il-6 from cell culture supernatants was measured and analyzed by human il-6 elisa from biosource international ( camarillo , california , usa ) according to manufacturer 's instructions .
enzyme immunoassay ( eia ) 6-keto pgf1 ( cayman diagnostica , michigan , usa ) was used to measure the concentration of nonenzymatically converted metabolite of prostacyclin or pgi2 in cell culture supernatants with competitive eia according to the instructions of the manufacturer .
6-keto pgf1 is a stable product of pgi2 . before rt - pcr , total rna from endothelial cell cultures
was isolated using total rna isolation system ( promega , usa ) following manufacturer 's instructions .
the purity and amount of rna were determined by measuring the od at a ratio of 260 to 280 nm .
1 g of total rna were transcribed into dna by reverse transcription system ( promega , usa ) and pcr was performed for -actin , il-6 , and tf ( table 1 ) .
tissue factor activity was measured following the actichrome tf ( american diagnostica , stamford , connecticut , usa ) procedure .
after cell treatment in 12 well plates , the medium was removed and 150 l
cells were then scraped and frozen at 80c for 15 minutes and then thawed at 37c .
cell lysates were then mixed with factor viia and factor x in 96 well plates . following a 15-minute incubation at 37c
, spectrozyme fxa was added for 20 minutes and the reaction was stopped with glacial acetic acid .
all experiments were repeated three times and the mrna expression studies were shown as 1 representative gel of two performed .
means were compared between the treated and control groups using student 's t - test .
in order to determine the inflammatory / coagulation responses of primary human endothelial cells , in particular hcaec , stimulated with different doses of il-1 , we measured released il-6 protein ( figure 1 ) .
semiconfluent primary huvec , hcaec , and hmvec were incubated in 6-well plates with increasing doses of il-1 ( from 0 to 2000 pg / ml ) for 24 hours in serum - free media .
released protein levels of il-6 were measured in supernatants by elisa , and in parallel , mrna expressions of -actin , il-6 , and tf were determined using rt - pcr . a comparison of released il-6 protein levels in the endothelial cell types showed highest levels coming from hcaec ( approximately 2-fold higher than from huvec ) and the lowest from hmvec ( figure 1 ) . the first rapidly increased il-6 protein levels were seen at an il-1 concentration of 500 pg / ml in hcaec and huvec , in comparison to hmvec where responses were consistently low .
the mrna expression results show that il-6 , as well as tf mrna expression dose dependently increased with il-1 in all cell types ( data not shown ) .
to investigate the effects of modulatory molecules on il-1-stimulated endothelial cells , we measured the il-6 protein levels in the presence or absence of bte and rsv .
both bte and rsv significantly inhibited il-6 protein levels of hcaec ( figure 2 ) .
il-1-induced tf activity showed the highest response in hcaec and was inhibited by bte and rsv in all three endothelial cell types ( figure 3(a ) ) .
the il-1-induced mrna expression of il-6 and tf in all endothelial cell types is down - regulated with bte and rsv ( figure 3(b ) ) . to investigate the effects of il-1 on homeostasis of endothelial cells ,
released prostacyclin pgi2 was measured as 6-keto pgf1 in cell supernatants ( figure 4 ) . to determine whether the responses were dose dependent , hcaec , huvec , and hmvec were incubated with increasing concentrations of il-1 ( figure 4(a ) ) .
the highest responses were shown in huvec , which were around 3 - 4 fold higher than in hcaec .
contrary to il-6 levels and tf activity , bte addition did not cause inhibition of il-1-stimulated prostacyclin release ( figure 4(b ) , left panel )
. however , rsv abrogated il-1-induced 6-keto pgf1 levels in all three cell types ( figure 4(b ) , right panel ) .
in this report , hcaec were used as a model cell system , shown to be highly responsive to il-1-stimulated il-6 released protein levels , tf activity , and inhibition of these by bte and rsv .
studies on hcaec reported in literature have looked at different stimulating molecules , such as il-1 and tnf , activated protein c , lipopolysaccharide [ 2528 ] , and their effects on different cytokine and chemokine expression , indicating unique cell type patterns and/or levels of expression .
previously indicated that hcaec display greater susceptibility to inflammation and potential atherogenesis than huvec or hmvec .
this is in accord with il-1-stimulated hcaec data indicated in this report . among the most accessible natural substances used worldwide
are black tea , green tea , and wine , which have been suggested to be important modulators of cardiovascular disease ( cvd ) .
both black and green tea have shown acute beneficial effects on aortic stiffness and wave reflections , as reported by vlachopoulos et al . .
since aortic stiffness and wave reflections are markers of cvd and prognostic factors of cardiovascular risk , they are important parameters to be studied in healthy individuals
one possible explanation for the lack of cardiovascular protection in some of the studies is the difference in infusion time , stirring , leaf size , and measurements in plasma / whole blood changes , although different brands and addition of milk did not show significant variances .
however , flavonoids were reported to bind to protein , which causes variations in bioavailability and also results in changed biological activity especially in the case of binding to specific receptors and/or enzymes [ 31 , 32 ] .
however , overall , the evidence suggests that individuals with the highest flavonoid intake have modestly reduced risks for cvd ( as reviewed in vita ja , 2005 ) . for tea , this conclusion is supported by a meta - analysis with 10 cohort studies and seven case - control studies included , which suggested an overall reduction in cvd risk of around 11% with consumption of 3 cups of tea per day .
a meta - analysis was also performed recently on the association between green or black tea consumption and the risk of stroke .
data from 9 studies involving 4 378 strokes among 194 965 individuals were pooled .
the authors conclude that although a randomized clinical trial would be necessary to confirm the effect , this meta - analysis suggests that regardless of their country of origin , individuals consuming 3 cups of tea per day had a 21% lower risk of ischemic stroke than those consuming less than 1 cup per day . in a large sample ( 6 597 subjects ) of the elderly ( over 65 years ) , debette et al . reported for the first time that carotid plaques were less frequent with increasing tea consumption in women .
usually 1 g of tea is used for 100 ml of infusion [ 30 , 32 ] . in the process of manufacturing ,
the black tea leaf catechins are allowed to oxidize into theaflavins which give the black tea its characteristic colour and taste .
the black tea flavonoid content accounts for 20%30% catechins , 10% theaflavins and 50%60% thearubigins , and both catechins as well as theaflavins have been shown to act as cardio - protectants in cardiomyocytes .
the present data in huvec , hcaec , and hmvec indicate that bte significantly abrogates il-1-induced il-6 protein released levels similarly to rsv ( figure 2 ) , while also decreasing both tf activity levels and expression ( figure 3 ) .
however , bte does not seem to have any effects on il-1-induced pgi2 in any of the three cell types ( figure 4(b ) , left panel ) .
these differences imply that cytokine - specific processes and differential signaling pathways might be involved . since black tea consumption has been previously associated with a decreased risk of cardiovascular events [ 10 , 11 ] , signaling events in response to bte are relevant .
bovine aortic endothelial cells when exposed to bte showed enos activity mediated through p38 mapk and estrogen receptors leading to phosphatidylinositol 3-kinase / akt pathway and enos generation [ 39 , 40 ] and vasorelaxation of aortic rat rings .
rsv - mediated cardio - protection is achieved through the preconditioning effect and thus achieves a number of cardio - protective functions ( reviewed in ) , such as effecting release and/or generation of inflammatory mediators and attenuation of various soluble intercellular cytokines .
rsv functions in scavenging free radicals and inhibiting lipid peroxidation , up - regulation of inducible no synthase , vascular endothelial growth factor , kinase insert domain - containing receptor , and endothelial no synthase .
dealcoholized wine ( 1 cup ) delivered in a single oral dose to healthy subjects less than 40 years old was found to increase endothelium - dependent vasodilation .
the authors indicate that this adds support to the hypothesis that antioxidant properties of red wine , rather than ethanol , may protect against cardiovascular diseases , however more research is needed on subjects with coronary heart disease .
usually the concentrations of rsv in cellular models of cvd protection are 0.1100 mol/ l , although some studies showed different effects in low / high doses in enhancing proliferation and inducing apoptosis . when rsv in humans is absorbed around 75%
serum levels were independent from meals and its lipid content , but rsv is rapidly metabolized into glucuronides and sulfates , which stay in the blood for 9 hours .
biologic activity of metabolites was not elucidated yet [ 20 , 42 ] , and it is suggested that prolonged administration could lead to increased concentrations [ 42 , 46 ] . it is necessary to apply caution when interpreting the literature data translating concentrations of rsv on potential cardiovascular effects . to our knowledge
, this is the first report to show the effects of rsv on il-1-induced il-6 and tf responses in hcaec , which could serve in cardioprotective processes similar to the ones described previously [ 24 , 42 , 47 , 48 ] .
mol / l ) in huvec at comparable concentrations to the 40 m used in the present report , to reduce expression of adhesion molecules on stimulated human saphenus vein endothelial cells , to inhibit adhesion of activated platelets to collagen or fibrinogen and lower icam , vcam [ 24 , 51 ] .
rsv was also reported to enhance the inhibitory activity of pgi2 on platelet aggregation in low doses , as well as to inhibit tnf-induced nad(p)h oxidase and nf-b activation and inflammatory markers ( at 0.110
mol / l ) [ 24 , 42 , 51 ] , similarly to our results . in porcine coronary arteries , short term treatment with rsv
significantly inhibited mapk activities , with reduced phosphorylation seen of erk1/2 , jnk-1 and p38 mapk [ 53 , 54 ] , and stat3 phosphorylation .
the data shown in huvec ( figure 4 ) indicates a similar level of il-1-stimulated pgi2 ( measured using 6-keto pgf1 ) as shown by olszanecki et al . .
all three cell types huvec , hcaec , and hmvec indicate a similar vasoregulatory role for il-1 , while rsv addition abrogated pgi2 levels ( figure 4(b ) , right panel ) .
rsv has also been shown to decrease the expression of vasoconstrictor endothelin and increase enos in huvec , which might counterbalance pgi2 inhibition and decrease nad(p)h oxidase activity . in conclusion ,
a growing body of evidence indicates that inflammation not only provides the baseline for future atherosclerotic events , but is a necessity for coronary plaque formation and coagulation leading to thrombosis .
the unique responsiveness of hcaec could account for the greater susceptibility of coronary arteries to inflammation and atherogenesis leading to cardiovascular pathology and substances , such as bte and rsv , also influence these effects at the cellular level . | the effects of anti - inflammatory plant extracts , such as black tea extract ( bte ) and resveratrol ( rsv ) could modulate cell activation leading to atherosclerosis , however there is little comparative information about how different endothelial cell types are affected by these compounds . in order to compare human endothelial cells derived from different origins ( umbilical vein or huvec , coronary artery or hcaec , microvascular or hmvec ) and their interleukin-1 ( il-1 ) responsiveness ,
il-6 elisa , rt - pcr , tissue factor assay , and prostacyclin responses using 6-keto pgf1 elisa were determined .
the il-1-induced il-6 levels were dose - dependent with highest responses seen in hcaec .
significant inhibition of il-1 responses was achieved with bte and rsv , with the largest decrease of il-6 and tf seen in hcaec .
prostacyclin levels were highest in huvec and were inhibited by rsv in all cell types .
the differences between the endothelial cell types could account for greater susceptibility of coronary arteries to inflammation and atherogenesis . |
benign prostatic hyperplasia ( bph ) is the most common benign tumor in men , and its incidence is age - related .
symptoms of bph are caused by either obstructive components of the prostate glands or secondary changes to the bladder resulting from bladder outlet obstruction .
there are many treatment alternatives , such as watchful waiting , pharmacologic medications , phytotherapy , minimally invasive therapy , transurethral resection of prostate ( turp ) , and open simple prostatectomy .
surgical management is often required when the symptoms induced by bph are refractory to pharmacologic treatments . in those cases ,
turp is the most frequently performed procedure for endoscopic management owing to its shorter hospitalization and low comorbidity and mortality . however , if the prostate gland is too large , conventional monopolar turp has limitations , such as prolonged operation time with use of non - electrolyte irrigation fluid and monopolar current , which can result in transurethral resection ( tur ) syndrome and an increased risk of bleeding .
presently , there have also been a few reports regarding the utilization of turp with bipolar energy in cases of prostate glands over 100 ml .
therefore , with three procedures being used to surgically treat bph and no clear agreement or comparison among the three , the purpose of this study was to compare the efficacy and safety of monopolar turp , bipolar turp , and open prostatectomy in large prostate glands .
a retrospective study was conducted with 48 bph patients who underwent monopolar turp , bipolar turp , or open prostatectomy .
exclusion criteria were abnormal digital rectal examination ( dre ) findings , elevated prostate - specific antigen ( psa ) , and presence of neurogenic bladder , urethral stricture , bladder stone , or tumor . among 48 bph patients with prostate glands larger than 100 ml
, 19 patients underwent monopolar turp ( group a ) , 17 patients underwent bipolar turp ( group b ) , and 12 patients underwent open prostatectomy ( group c ) from january 2004 to june 2009 . in this study ,
all of the operations were performed by a single surgeon who had previously performed 143 cases of turp on prostates smaller than 100 ml . among the groups , 6 , 7 , and 4 patients , respectively , had concomitant diabetes mellitus ( dm ) .
a total of 8 , 10 , and 7 patients from each group had at least one episode of acute urinary retention in the past .
twenty - six patients had been on an alpha-1-adrenoreceptor blocker and 6 patients had been on a combination of an alpha-1-adrenoreceptor blocker and 5-alpha - reductase inhibitors for a mean duration of 1.2 months before the surgical interventions .
monopolar turp was performed with a 24 fr resectoscope ( karl storz , tuttlingen , germany ) using urosol ( cj , seoul , korea ) .
bipolar turp was performed with a 27 fr continuous flow resectoscope ( gyrus acmi , olympus inc , germany ) using saline irrigation with the gyrus plasma - kinetic tissue management system . at the end of the monopolar and bipolar turp ,
a 20 fr 3-way urethral foley catheter was inserted and normal saline irrigation was applied .
continuous saline irrigation was done until the urine drained from the urethral foley catheter became clear in the absence of irrigation .
in cases of open prostatectomy , a 20 fr 3-way urethral foley catheter and suprapubic cystostomy catheter were inserted with continuous saline irrigation at a minimal rate to prevent urine passage blockage .
the patients were discharged upon spontaneous voiding . for the preoperative data , we collected the international prostate symptom score ( ipss ) , maximal flow rate ( qmax ) , prostate volume , intraoperative resected tissue volume , resection velocity , and operation time , which were recorded and analyzed .
data collected postoperatively were the hemoglobin / sodium change , length of postoperative hospitalization , and postoperative 6-month ipss , quality of life ( qol ) , and qmax .
the kruskal - wallis test , post hoc tamhane 's test , chi - square test , and wilcoxon signed - rank test were performed to analyze the data .
all statistical analyses were performed with spss ver . 18.0 ( spss inc , chicago , il , usa ) .
the preoperative prostate volumes of each group were 124.627.9 ml ( a ) , 117.918.6 ml ( b ) , and 131.421.0 ml ( c ) , respectively ( p=0.217 ) ( table 1 ) .
the preoperative mean serum sodium concentrations of each group were 136.42.3 meq / l ( a ) , 137.82.2 meq / l ( b ) , and 140.02.0 meq / l ( c ) .
the preoperative mean serum hemoglobin of each group were 14.30.8 meq / l ( a ) , 14.32.2 meq / l ( b ) , and 14.90.7 meq / l ( c ) ( table 2 ) .
six patients from the monopolar turp group experienced a significant decrease in the serum sodium concentration .
the mean operation time was 117.618.4 minutes ( a ) , 13249.8 minutes ( b ) , and 163.827.4 minutes ( c ) , respectively ( p=0.001 ) .
resected prostatic tissue volumes were 32.611.2 ml ( a ) , 41.411.9 ml ( b ) , and 60.813.6 ml ( c ) ( p<0.001 ) .
the resection velocity of groups a ( 0.28 ml / min ) and b ( 0.34 ml / min ) showed no statistically significant difference ( p=0.191 ) ( table 1 ) .
postoperative hemoglobin changes in the three groups showed a statistical significance ( p<0.001 , p<0.001 , and p=0.002 ) .
complications were noted in 5 cases in the monopolar turp group and in 4 cases in the open prostatectomy group . in the monopolar group ,
there were 2 cases of tur syndrome and 3 patients who required blood transfusions due to a mean reduction in hemoglobin of 4.2 g / dl .
even though the changes in hemoglobin were statistically significant , there were no postoperative hemoglobin changes severe enough to necessitate blood transfusions in the bipolar group . in the open prostatectomy group ,
the transfusion rate of each group was 15% , 0% , and 33% , respectively .
factors including the color of the urine drained from the urethral foley catheter and anemic conjunctiva postoperatively were triggers for deciding upon transfusion .
postoperative hospital stays were 9.42.3 days , 6.31.3 days , and 12.02.9 days , respectively ( p<0.001 ) .
patients in the bipolar turp group required shorter hospitalizations than did patients in the other groups .
the postoperative 6-month ipss / qmax of all groups showed statistically significant improvement ( table 2 ) .
no cases of urethral or meatal strictures were noted during the 6-month follow - up period in either turp group .
alpha-1-adrenoreceptor blockers and 5-alpha - reductase inhibitors are the mainstay of treatment for bph and have been shown to have a higher cost - efficiency than turp . however , the most effective treatment modality is known to be the surgical resection of prostatic adenomas , which cause obstruction .
open prostatectomy is considered when the prostate gland is too large to be resected endoscopically .
previously , a prostate gland larger than 75 ml was an indication for open prostatectomy .
concomitant bladder pathologies such as bladder diverticulum , bladder stones , urethral strictures , and a patient 's inability to be in the dorsal lithotomy position are other indications for open prostatectomy . park and chung reported that when comparing turp with open prostatectomy , open prostatectomy renders better postoperative ipps and a higher qmax than does turp due to the complete resection of adenomas , which leads to wider width and symmetry of the proximal prostatic urethra .
open prostatectomy offers advantages such as a lower retreatment rate , more complete removal of prostate adenomas , and avoidance of tur syndrome .
however , risks of incontinence , retrograde ejaculation , perioperative hemorrhage , and longer hospitalization still remain .
conventional turp was first developed in the united states in the 1920s and 1930s . over the years
, many advances in surgical instruments and technique have been made , and thus now turp is recognized as the gold standard for the surgical treatment of bph .
turp is known to offer improvement in voiding symptoms and qmax in over 80% of patients .
morbidities associated with turp have been decreasing over the past three decades . however , perioperative hemorrhage and tur syndrome , which is a consequence of excessive absorption of non - conductive irrigating solution , are still grave complications that can occur .
the risk is increased if the gland is larger than 45 ml and the resection time is longer than 90 minutes .
however , new technical advances to conventional turp with monopolar energy were made in early 2000 , most notably the development of bipolar current in turp .
the most noticeable difference is that saline is used as an irrigant , which reduces the morbidities associated with tur syndrome . as shown in our results , bipolar turp
when compared with monopolar turp resulted in a lower risk of developing tur syndrome due to a smaller change in serum sodium than with monopolar turp .
this enables surgeons to take a longer time to operate and to resect more prostatic tissue than is possible with monopolar turp .
moreover , bipolar turp seems to be more efficient for removing tissue and simultaneously controlling for bleeding when compared to monopolar turp .
it is noteworthy that no transfusions were required in the bipolar turp group , whereas there were 3 transfusion cases in the monopolar turp group . also , when compared with the other groups , bipolar turp required shorter postoperative hospitalization .
starkman et al reported that the patients treated with gyrus turp had their catheter removed a mean of 1.4 days earlier than the monopolar turp group .
eaton and francis , reported that among 40 patients , 32 patients could be discharged on the day of operation with use of the gyrus system .
de sio et al reported shorter catheterization and hospitalization for bipolar turp patients . in a multicenter study regarding bipolar turp
, operators preferred bipolar turp over monopolar turp owing to cleaner resection surfaces ( 64% ) and higher accuracy when resecting the apex of the prostate glands ( 93% ) . considering that utilization of monopolar turp in large prostate glands is limited , bhansali et al compared bipolar turp with monopolar turp in their series of 70 patients with prostate glands > 60 ml and reported that bipolar turp showed excellent results in terms of perioperative blood loss , change in serum sodium , and duration of catheterization .
baek et al reported perioperative outcomes of bipolar turp in patients with prostate glands > 80 ml in their series and found that bipolar turp showed advantages such as less serum sodium change and less hemoglobin change . in 2006 , kim et al reported that bipolar turp is superior to monopolar turp with fewer surgical complications .
kim et al also stated that turp with bipolar energy rendered postoperative outcomes similar to those of monopolar turp but with fewer complications , shorter catheterization , shorter hospitalization time , and lower cost .
unlike the above - mentioned reports , we studied only prostate glands larger than 100 ml and compared the perioperative parameters of monopolar and bipolar turp and open prostatectomy , which is indicated for prostate glands larger than 75 ml .
the patients had not been on alpha-1-adrenoreceptor blockers or 5-alpha - reductase inhibitors for a long period of time , because it was hard to expect satisfactory alleviations of voiding symptoms with medication alone with a prostate gland size of larger than 100 ml . in this study ,
volumes of prostate weights resected were lower than those reported previously , especially in the open prostatectomy group .
the lower volumes of prostatic tissue removed in this study can be accounted for by the smaller adenoma sizes in the open prostatectomy group compared with those of previous reports .
in addition , the lower prostate weights removed in both turp groups may be accounted for by the surgeon 's experience rather than a cautery effect . despite the lower volumes of prostatic tissues removed than in previous literature ,
bipolar turp and open prostatectomy resulted in significantly improved postoperative 6-month qmax and ipss , showing no statistically significant difference between the two groups in postoperative change in qmax and ipss at the 6-month follow - up .
one limitation of this study is that monopolar and bipolar turp were not performed with randomization .
a second limitation of this study is that the size of the study population was relatively small .
last , the patients were not randomized to exclude concomitant conditions , such as diabetes mellitus or episodes of acute urinary retention , that could have affected voiding symptoms .
bipolar turp showed similar efficacy to monopolar turp and open prostatectomy in improving voiding symptoms while rendering shorter hospitalizations , a low transfusion rate , and fewer complications such as tur syndrome .
bipolar turp can be considered as a safe substitute for monopolar turp and open prostatectomy even for large prostate glands over 100 ml . | purposetransurethral resection of the prostate ( turp ) is still considered the gold standard in the treatment of benign prostatic hyperplasia ( bph ) . however , open prostatectomy is indicated for prostate glands over 75 ml
. there have been few reports concerning the use of turp for large prostate glands over 100 ml .
herein we compared the effectiveness of monopolar turp , bipolar turp , and open prostatectomy in prostate glands larger than 100 ml.materials and methodswe reviewed the data of 48 patients with prostate glands larger than 100 ml .
a total of 19 , 17 , and 12 patients underwent monopolar turp ( group a ) , bipolar turp ( group b ) , or open prostatectomy ( group c ) , respectively .
preoperative international prostate symptom score ( ipss ) , maximal flow rate ( qmax ) , prostate volume , resected tissue volume , resection velocity , and operative time were documented .
postoperative hemoglobin , serum sodium change , hospital stay , and postoperative 6-month ipss and qmax were evaluated.resultsthe prostate volumes did not differ significantly among the three groups .
operative time was similar in the two turp groups , but open prostatectomy required a longer operative time .
there was no significant difference in the resected prostate tissue or resection velocity between the two turp groups .
there was a marked decrease in postoperative serum sodium in the monopolar group compared with the other two groups . among the groups , bipolar turp required a shorter hospitalization .
postoperative ipss , quality of life ( qol ) , and qmax improved significantly in all groups.conclusionseven for large prostate glands , the results of this study suggest that bipolar turp is an effective and safe operation owing to the significant improvements in voiding symptoms , shorter hospitalization , and fewer complications such as transurethral resection syndrome . |
the structure and the role of microvasculature has been progressively clarified in this last decade ( 1 , 2 ) .
we now have adequate information on the time course and percentage occurrence of microvascular obstruction ( mo ) .
we know that the venules are the site of leukocyte adhesion during inflammation and that their endothelial surfaces express a number of adhesion molecules , whose production is significantly up - regulated after the onset of tissue injury ( 3 ) . similarly we know that about one fifth to one third of patients with timi grade 3 flow after mechanical or pharmacological reperfusion show evidence of mo ( 4 , 5 ) which , in turn , seems the basis of intracardiac hemorrhage ( 6 , 7 ) and of the development of myocardial wall rupture ( 8) . in patients with acute coronary syndromes undergoing pci , aspiration of the coronary artery has revealed thrombus with or without plaque components in 1550% of the patients ( 911 ) .
this means that in a large percentage of cases , 5085% , mo is a dynamic phenomenon which begins gradually and progressively develops after the occluded vessel has been reopened ( 12,13 ) .
it then persists for at least 1 month after reopening of the epicardial coronary artery , predicting worse scar thinning , infarct expansion , poor survival , and ultimately annulling the effect of pci ( 1416 ) .
this explains all efforts made to prevent mo with mechanical devices ( 17,18 ) or with pharmacological strategies ( 1933 ) .
the rational of focusing downstream the open artery hypothesis may be further emphasized by considering that all cardiac ruptures , likely the main cause of death in the in - hospital course of myocardial infarction , seem to lag behind mo which represents a significant , and in all probability the principal independent predictor of cardiac rupture ( 34 , 35 ) magnetic resonance imaging ( mri ) has proved to be of great value in detecting and monitoring mo after occlusion and reopening of the coronary artery , both in experimental and in vivo studies ( 3646 ) .
it also provides evidence of its value in recognizing myocardial hemorrhage and impending wall rupture , thus allowing a window of interventional opportunity in this often catastrophic event ( 8 , 38 , 4755 ) .
the aim of this study was to evaluate , by means of mri , in subacute myocardial infarction , if the different pharmacological strategies of gusto v reperfusion protocol i.e. full dose reteplase vs half dose reteplase plus full dose abciximab ( r+abcx ) , display different effects on volumes and function of the left ventricle ( lv ) , as well as on miocardial infarct size ( misz ) and mo ( 29 ) .
from the list of consecutive patients randomized in the gusto v study at our institution , 20 male patients , mean age 58 years range 3775 , were addressed , after written consent , to mri study in the 4 day of myocardial infarction .
although selected from a progressive list , in agreement with the criteria of gusto v ( 29 ) , the grid of mri studies was created to fulfil the following criteria : age matched patients affected by anterior and posterior myocardial infarctions , age matched patients treated with reteplase or r+abcx .
the grid was thus composed of : 5 anterior treated with reteplase , 5 anterior treated with r+abcx , 5 inferior treated with reteplase , 5 inferior treated with r+abcx .
examinations were performed on a somatom vision 1.5 t scanner ( siemens erlangen germany ) and analyzed with the built - in numaris cardiac software .
after initial ecg triggered turbo - flash scouts in axial and in double oblique direction , stir t2 breath hold 10 mm thickness images , were obtained in four chambers and in consecutive contiguous short axis views ( sax ) , encompassing the whole lv from the base to the apex .
a complete three dimensional ( 3d ) stir t2 study was then created by assembling all base to apex slices in a 3d package , from which lv end diastolic volume ( edv ) and lv end diastolic mass could be calculated .
stir t2 hyperintense signal was then manually outlined in each sax slice and subsequently 3d reconstructed to obtain myocardial infarct size ( misz ) , representative of ischemic / infarcted myocardium .
1 ) . in order to quantify the degree of hypersignal level , a circular region of interest ( roi ) of 0.5 cm diameter was positioned in the center of stir t2 hyperintense area and the value was compared with a similar roi positioned in a region remote from the site of infarction .
a dimensionless value , stir intensity ratio , was obtained to represent the signal intensity on myocardial infarction .
1- from base ( a ) to apex ( f ) stir t2 contiguous slices .
endocardial and epicardial contours define the myocardial slice area from which a 3d quantification of lv mass can be obtained
. similarly contour of hypersignal area ( a ) applied to all slices , creates the misz , expressed in % of lv mass .
- from base ( a ) to apex ( f ) stir t2 contiguous slices .
endocardial and epicardial contours define the myocardial slice area from which a 3d quantification of lv mass can be obtained
. similarly contour of hypersignal area ( a ) applied to all slices , creates the misz , expressed in % of lv mass .
a bolus of 0.2 mmol gd - dtpa per kg body weight ( magnevist , schering - ag , berlin , germany ) was then injected .
the same sax positions of the stir study were repeated with 2d - flash cine sequences ( 2d - fl ) . by assembling base to apex contiguous sax 2d - fl cineloops ,
a new 3d study was created from which edv and ejection fraction ( ef ) were calculated as habitually done in cardiac mri procedure . as all t1 sequences ,
also 2d - fl is fit to visualize myocardial signal void in the presence of mo with the limitation of less contrasted images compared to more dedicated t1 sequences , but with the advantage of being able to follow the mo dynamically during systole ( 8) . in order to visualize only persistent mo , 2d - fl acquisition started five minutes after gd injection .
since delineation and quantification of small mo was practically unfeasible , mo was visually estimated and classified as : not present ( group 1 ) , small subendocardial ( group 2 ) , and large or transmural ( group 3 ) . due to the limited time allowed for each patient , potentially unstable in day four after myocardial infarction , to the limited contrast gain in late enhancement imaging of our present scanner , to the main goal of this study i.e. to discover differences in volumes and ef , and also to the still incomplete standardization of this technique for quantification of infarct size , ( 56 ) late enhancement quantification of infarct size was not performed .
thus each study could be contained in 30 minutes , the time allowed by the ethical committee of our hospital for the study of this type of patients .
the list of patients , treatment and measurement performed is reported in table i.
table i- list of patients with individual measurementsnameagemidrugstir3d misz % 2d - fl3d ef % stirintensity ratio2d - fl3d edv ml2d - flmo 1 - 2 - 3g.p.48ant.r+abcx31361.571731a.g.c.71ant.r+abcx73561.271311o.e.67ant.r+abcx13501.61202b.g.62ant.r+abcx11671.871151l.c.a.60ant.r+abcx14541.71361s.m.53ant.reteplase19441.651452n.m.75ant.reteplase41262.21042f.g.45ant.reteplase26351.822371f.l.59ant.reteplase24441.8762m.e.72ant.reteplase24431.51871m.c.57inf.r+abcx36341.982251p.d.53inf.r+abcx39601.671491a.u.73inf.r+abcx17421.961323g.g.51inf.r+abcx35561.392212s.g.66inf.r+abcx20531.94932g.f.48inf.reteplase22431.642123c.a.63inf.reteplase22451.751603p.s.37inf.reteplase19521.621403s.m.37inf.reteplase17491.931421s.s.65inf.reteplase36311.51283
examinations were performed on a somatom vision 1.5 t scanner ( siemens erlangen germany ) and analyzed with the built - in numaris cardiac software . after initial ecg triggered
turbo - flash scouts in axial and in double oblique direction , stir t2 breath hold 10 mm thickness images , were obtained in four chambers and in consecutive contiguous short axis views ( sax ) , encompassing the whole lv from the base to the apex .
a complete three dimensional ( 3d ) stir t2 study was then created by assembling all base to apex slices in a 3d package , from which lv end diastolic volume ( edv ) and lv end diastolic mass could be calculated .
stir t2 hyperintense signal was then manually outlined in each sax slice and subsequently 3d reconstructed to obtain myocardial infarct size ( misz ) , representative of ischemic / infarcted myocardium .
1 ) . in order to quantify the degree of hypersignal level , a circular region of interest ( roi ) of 0.5 cm diameter was positioned in the center of stir t2 hyperintense area and the value was compared with a similar roi positioned in a region remote from the site of infarction .
a dimensionless value , stir intensity ratio , was obtained to represent the signal intensity on myocardial infarction .
1- from base ( a ) to apex ( f ) stir t2 contiguous slices .
endocardial and epicardial contours define the myocardial slice area from which a 3d quantification of lv mass can be obtained .
similarly contour of hypersignal area ( a ) applied to all slices , creates the misz , expressed in % of lv mass .
- from base ( a ) to apex ( f ) stir t2 contiguous slices .
endocardial and epicardial contours define the myocardial slice area from which a 3d quantification of lv mass can be obtained
. similarly contour of hypersignal area ( a ) applied to all slices , creates the misz , expressed in % of lv mass .
a bolus of 0.2 mmol gd - dtpa per kg body weight ( magnevist , schering - ag , berlin , germany ) was then injected .
the same sax positions of the stir study were repeated with 2d - flash cine sequences ( 2d - fl ) . by assembling base to apex contiguous sax 2d - fl cineloops ,
a new 3d study was created from which edv and ejection fraction ( ef ) were calculated as habitually done in cardiac mri procedure . as all t1 sequences ,
also 2d - fl is fit to visualize myocardial signal void in the presence of mo with the limitation of less contrasted images compared to more dedicated t1 sequences , but with the advantage of being able to follow the mo dynamically during systole ( 8) . in order to visualize only persistent mo , 2d - fl acquisition started five minutes after gd injection . since delineation and quantification of small
mo was practically unfeasible , mo was visually estimated and classified as : not present ( group 1 ) , small subendocardial ( group 2 ) , and large or transmural ( group 3 ) . due to the limited time allowed for each patient , potentially unstable in day four after myocardial infarction , to the limited contrast gain in late enhancement imaging of our present scanner , to the main goal of this study i.e. to discover differences in volumes and ef , and also to the still incomplete standardization of this technique for quantification of infarct size , ( 56 ) late enhancement quantification of infarct size was not performed .
thus each study could be contained in 30 minutes , the time allowed by the ethical committee of our hospital for the study of this type of patients .
the list of patients , treatment and measurement performed is reported in table i.
table i- list of patients with individual measurementsnameagemidrugstir3d misz % 2d - fl3d ef % stirintensity ratio2d - fl3d edv ml2d - flmo 1 - 2 - 3g.p.48ant.r+abcx31361.571731a.g.c.71ant.r+abcx73561.271311o.e.67ant.r+abcx13501.61202b.g.62ant.r+abcx11671.871151l.c.a.60ant.r+abcx14541.71361s.m.53ant.reteplase19441.651452n.m.75ant.reteplase41262.21042f.g.45ant.reteplase26351.822371f.l.59ant.reteplase24441.8762m.e.72ant.reteplase24431.51871m.c.57inf.r+abcx36341.982251p.d.53inf.r+abcx39601.671491a.u.73inf.r+abcx17421.961323g.g.51inf.r+abcx35561.392212s.g.66inf.r+abcx20531.94932g.f.48inf.reteplase22431.642123c.a.63inf.reteplase22451.751603p.s.37inf.reteplase19521.621403s.m.37inf.reteplase17491.931421s.s.65inf.reteplase36311.51283
table i sets out the list of patients with individual measurements ; in table ii the descriptive statistics in both types of treatment ; and in table iii the descriptive statistics divided by drug regimen and site of myocardial infarction .
table ii- descriptive statistics in both types of treatmentsdrugminimummaximummeanstdr+abcxage487360.88.5stir 3d misz % 117328.918.72d - fl 3d ef346750.810.5stir intensity ratio1.2721.70.22d - fl 3d edvml93225149.544reteplaseage377555.413.6stir 3d misz % 1741257.72d - fl 3d ef265241.28.1stir intensity ratio1.502.201.750.22d - fl 3d edvml76237153.148.3
table iii- descriptive statistics divided by drug regimendrugmiagestir 3d misz % 2d - fl 3d efstirintensity ratio2d - fl3d edv mlr+abcxantmean61.628.452.61.6135std8.726.211.20.222.8infmean6029.4491.8164std9.310.110.70.357.6totalmean60.828.950.81.7149.5std8.518.710.50.244.reteplaseantmean60.826.838.41.8149.8std12.68.37.90.364.3infmean5023.2441.7156.4std13.67.58.10.233.1totalmean55.42541.21.8153.1std13.67.78.10.248.3
tables from iv to vii show the results of paired t - test ( 2 tailed significance ) for the two different regimens of therapy .
table iv- infarct size ( misz% ) as % of the whole , three dimensionally ( 3d ) calculated , myocardial massstir3d misz % meanstandard deviationsig .
( 2-tailed)r+abcx28.918.720.586reteplase25.07.70
table v- from contiguous base to apex cine 2d - flash slices , three dimensional ( 3d ) ejection fraction ( ef ) is calculated in both drug regimens2d - fl3d efmeanstandard deviationsig .
( 2-tailed)r+abcx50.8010.510.035reteplase41.208.08
table vi- ratio between intensity values obtained with stir images , in infarct area and in normal myocardium , in both drug regimensstirintensity ratiomeanstandard deviationsig .
( 2-tails)r+abcx1.690.250.653reteplase1.740.22
table vii- end diastolic volume ( edv ) , expressed in milliliters(ml ) obtained from cine 2d - flash ( 2d - fl ) sequences , in both drug regimens2d - fl 3d edvmlmeanstandard deviationsig .
( 2-tailed)r+abcx149.544.030.842reteplase153.148.36
as evident , mean values of misz , ef , intensity ratio and edv , were not statistically different in patients treated with reteplase and in those treated with r+abcx .
neither a further grouping for site of myocardial infarction provided additional differences . in spite of this , mean value of ef in abciximab was only slightly depressed but clearly higher than that of the reteplase group .
so when a correlation was attempted with ef and the other measures evaluated , it became clear that the linear regression between ef and misz was strongly significant in the reteplase group .
this clear and expected correlation was no longer present in r+abcx group with ef completely unrelated to misz ( fig .
2- inverse linear regression between infarct size ( misz% ) ad ejection fraction ( 2d - fl 3d ef ) in both drug regimens .
details in the text .
- inverse linear regression between infarct size ( misz% ) ad ejection fraction ( 2d - fl 3d ef ) in both drug regimens .
similarly , mo also showed a powerful relation to ef , with the strongest correlation in group 3 of patients , those with the greatest mo areas ( fig .
3 ) .
figure 3relationship between microvascular obstruction ( 2d - fl mo ) infarct size ( misz% ) ad ejection fraction ( 2d - fl 3d ef ) .
relationship between microvascular obstruction ( 2d - fl mo ) infarct size ( misz% ) ad ejection fraction ( 2d - fl 3d ef ) .
large mo ( group 3 ) was present in 25% of patients : i.e 5 out of 20 .
four of these patients were in the reteplase group whereas small subendocardial ( group 2 ) mo , were uniformly distributed in r+abcx groups : see table i. of note , two patients of this study died : c.a . and p.s . both for wall rupture , both in the reteplase group and with severe ( group 3 ) mo .
the first patient who died in day five , was the object of a previous publication ( 8) .
finally , no significant correlations could be found when patients were grouped according to the site of myocardial infarction ( fig .
4 - inverse linear regression between infarct size ( misz% ) ad ejection fraction ( 2d - fl 3d ef ) according to the site of myocardial infarction : anterior ( ant . ) or inferior ( inf . ) . details in the text .
- inverse linear regression between infarct size ( misz% ) ad ejection fraction ( 2d - fl 3d ef ) according to the site of myocardial infarction : anterior ( ant . ) or inferior ( inf . ) .
as already known , mri 3d reconstruction of the lv carries a small variability so that also a limited population can be sufficient to disclose differences not revealed by echocardiography ( 5762 ) .
this is also the case of this 20 patient study , in which mean ef in r+abcx patients was clearly higher , though with weak significance , compared to the reteplase group .
this occurred despite similar misz and intensity ratio , indicating that different degrees of cell damage may be represented by similar stir t2 signal , which thus seems unable to distinguish irreversible necrotic from reversible viable myocardium .
the traditional onion configuration of myocardial ischemia and infarction suggests that the outer layers are less damaged than the inner myocardium . under these circumstances with increasing misz a progressive impairment of the lv with lowering ef
all this happened , as represented by the clear inverse relation between misz and ef .
this was the result of epicardial fibrinolysis , which though successful , could not prevent the development of mo .
this was related , in our study with equivalent pain to treatment time between groups ( 63 ) to the extent of misz more than the success of epicardial trombolysis .
the above considerations were furthermore confirmed by the opposite behaviour observed in r+abcx patients where not only epicardial but also microvascular vessels were pharmacologically preserved . in these patients despite unchanged misz compared to reteplase , the inverse relationship of figure 2 was completely lost and almost no mo occurred .
almost contemporaneously some years ago , two different works indicated that t2 weighted ( 64 ) and t1 weighted sequences ( 39 ) were able to define infarct areas with good correspondence with the infarct size expressed by thallium irreversible defect . in experimental comparison however ( 65 ) , infarct areas seemed more accurately represented by t1 compared to those , slightly overestimated , obtained with t2 sequences .
nonetheless the same images also indicated that t2-weighted could detect subendocardial void of signal not visible in t1 sequence , indicating that two different tissue were at the same time present in that infarct area , both well detected by t2 approach .
this closely calls mri experimental data which indicate that in the same infarct area , irreversibly damaged myocites with patent microcirculation and irreversibly damaged myocytes with occluded microcirculation may coexist ( 12 ) .
since then , both t2 ( 6668 ) and t1 late enhancement imaging have been utilized to estimate infarct size , t1-weighted largely dominating the scene ( 36 , 39 , 6992 ) . in spite of this
, some limitations suggest that beyond the clear experimental and clinical evidence of late enhancement usefulness , the exact quantification of infarct size requires further technological , procedural and methodological steps to be completely defined ( 56 , 68 , 74 ) .
in addition , void of signal in t2 images most likely indicates hemorrhagic tissue , currently a prevalent domain of t2 imaging ( 9396 ) .
figure 5 whose imaging of wall rupture as been object of a previous publication ( 8) and p.s .
5- short axis stir image of the left ventricle ( a ) and the corresponding macroscopic autoptic specimen ( c ) .
subendocardial void of signal in a corresponds to hemorrhagic tissue in c , while hypersignal in a corresponds to edema in c. ( d ) small red cells dominate the center of hemorrhagic area ( dark subendocardium in c ) .
( b ) in the area of edema ( white area in c ) proceeding from the inner ( right - bottom ) to the outer ( left - top ) plane : the number of unbroken myocites progressively increases while the interstitial space progressively reduces .
- short axis stir image of the left ventricle ( a ) and the corresponding macroscopic autoptic specimen ( c ) .
subendocardial void of signal in a corresponds to hemorrhagic tissue in c , while hypersignal in a corresponds to edema in c. ( d ) small red cells dominate the center of hemorrhagic area ( dark subendocardium in c ) .
( b ) in the area of edema ( white area in c ) proceeding from the inner ( right - bottom ) to the outer ( left - top ) plane : the number of unbroken myocites progressively increases while the interstitial space progressively reduces .
6- long axis images of the left ventricle in cine 2d - flash ( a ) and in stir t2 sequence ( b).both indicate the presence of mo , stir image also suggesting the hemorrhagic nature of mo .
- long axis images of the left ventricle in cine 2d - flash ( a ) and in stir t2 sequence ( b ) . both indicate the presence of mo , stir image also suggesting the hemorrhagic nature of mo .
stir t2 short axis slice with clear evidence of transmural hyperenhancement of the inferior wall surrounding a subendocardial void of signal ( a ) .
this respectively corresponds to : oedema and subendocardial haemorrhage in the macroscopic autoptic specimen ( b ) .
the histological aspect of those layers indicate subendocardial red blood cells predominance ( d ) and in ( c ) the extensive loss of myocytes in the confining zone near the hemorrhagic endocardium , progressively replaced in the outer layers by unbroken myocytes and parallel reduction of " expanded " interstitium .
this last happened without a clear modification of signal intensity in hyperenhanced area of a thus similar or contiguous levels of t2 intensity , represents different degrees of cell injure as already outlined in previous mri studies on ischemia necrosis hemorrhage and healing tissue ( 97 ) in figure 6 is represented the second case of wall rupture : p.s .
a long axis 2d - fl after gadolinium injection clearly demonstrate the presence of a long mo extended from the base to the subepicardial inferior distal wall .
both 2d - fl ( a ) and stir t2 ( b ) images were able to identify the presence of severe mo , stir t2 also suggesting the haemorrhagic characteristics of mo , and 2d - fl allowing to follow mo dynamically during systole , thus indicating its threatening extension towards the epicardium .
r+abcx prevents mo : compared to traditional fibrinolytic therapy , this allow a better lv function and most likely an improved long term survival .
extensive mo was present and well recognized in 25% of all cases , 80% of which fall in the reteplase group of treatment .
the combination of t1 dynamic 2d - flash cine and stir t2 sequences may allow recognition and tissue characterisation of mo also suggesting the presence of impending ruptures . | background.about one third of patients with timi 3 after reperfusion have evidence of microvascular obstruction ( mo ) which represents an independent predictor of myocardial wall rupture .
this explains all efforts made to prevent mo .
magnetic resonance imaging ( mri ) has proved to be particularly useful in detecting mo .
the aim of this study was to evaluate with mri if different fibrinolytic regimens in acute myocardial infarction display different effects on left ventricle ( lv ) volumes and ejection fraction ( ef ) , as well as on myocardial infarct size ( misz ) and mo.methods.twenty male patients , mean age 58 years , affected by acute myocardial infarction , ten anterior and ten inferior , were treated with : full dose reteplase in ten , and half dose reteplase plus full dose abciximab ( r+abcx ) in the other ten patients . in the fourth day after hospital admission ,
mri stir t2 images were used to quantify misz , while 2dflash cineloops were used after the injection of gadolinium , to quantify lv volumes , ef and to detect mo.results.lv ef was higher in r+abcx 5110 than in reteplase 418 .
misz was similar in both treatment groups : however a close relationship was present between misz and ef in the reteplase group indicating that the greater the misz the lower the ef .
in r+abcx this relationship was no longer present , suggesting a protective effect of the drug on microcirculation .
in fact extensive mo was present in 25% of all cases , 80% of which in the reteplase group while only 20% in r+abcx.conclusion.r+abcx prevents mo : compared to traditional fibrinolytic therapy it allows better lv function and most likely improved long term survival . |
solitary fdg avid liver lesion in oncological setting is often metastatic in nature . at the same time , such lesions are less likely to be of tuberculous etiology .
however , we report an unusual scenario in a 15 year old boy , of a solitary liver lesion in a case of round cell tumor , which on follow up imaging , turned out to be hepatic tuberculosis .
a 15-year - old boy , presented with a right leg swelling , which increased in size over 2 months .
radiograph of right lower limb showed a lytic sclerotic mass in proximal meta - diaphysis of right fibula , which on biopsy was suggestive of ewing 's sarcoma .
whole body 18f - fluoro - deoxyglucose positron emission tomography / computed tomography ( fdg pet / ct ) was performed as a part of staging work - up .
maximum intensity projection ( mip ) image [ figure 1a ] showed intense focus of tracer uptake in the right leg ( arrow ) and liver ( arrow - head ) .
axial fused pet / ct images revealed intense tracer uptake in destructive lytic - sclerotic soft tissue mass in upper end of right fibula , with a maximum standardized uptake value ( max suv in millicurie / kilogram of body weight ) of 7.8 . an intense solitary focus of fdg uptake was seen in hypodense lesion in caudate lobe of liver [ figure 1c - arrow ] , which was presumed to be metastatic on the basis of imaging findings .
follow - up fdg pet / ct study after treatment completion showed complete regression of tracer concentration at primary site in tibia on mip image [ figure 1b - arrow ] , as well as reduction in size of the soft tissue mass with post treatment healing changes in the fibula seen on axial ct images .
contrary to this , the focal hepatic lesion in caudate lobe of liver showed significant increase in size and metabolic activity [ figure 1b - arrow head ] ; measuring 31 mm , with max suv of 14.6 on axial fused pet / ct images [ figure 1d - arrow ] .
this prompted a histological correlation and fine - needle aspiration ( fna ) was done from the liver lesion .
microscopic examination showed collection of epitheloid cells on papanicolaou stain [ figure 2a - arrows and figure 2b ] with pale oval shaped cells showing slipper shaped nuclei [ figure 2b - inset ] .
mip image showing focal intense tracer uptake at the primary site in right tibia ( a - arrow ) with another focus of fdg uptake in liver ( a - arrowhead ) , which was confirmed on axial fused pet / ct image ( b - arrow ) .
post chemotherapy mip image shows complete regression of fdg uptake in right tibia ( c - arrow ) ; however , there is increase in size and metabolic activity of fdg uptake in liver ( d - arrow , compared with b ) photomicrographs ( a : 100 , papanicolaou stain ) show epithelioid cells ( a - arrow ) , with pale elongated oval shaped cells ( b - 200 , papanicolaou stain ) showing slipper or sole of the foot shaped nuclei ( b - inset )
hepatic tuberculosis is rare and constitutes 1% of all cases of tuberculosis . in 70% patients ,
on morphologic imaging , it commonly appears as miliary tubercles , abscesses or as cholangitis .
very rarely , multiple tuberculomas are seen ; however , there is no report which shows solitary focal hepatic tuberculosis . on fdg pet
, there is intense tracer uptake in tuberculous lesions due to glut receptor expression on lymphocytes .
this forms the basis of multiple reports of tuberculosis mimicking malignancy on fdg pet ; majority of these in cases with fdg avid disseminated nodal disease , few with skeletal lesions , but none demonstrating focal solitary lesions .
report of hepatosplenic tuberculosis shows diffuse hot liver on fdg pet / ct .
only a single report , similar to our case , shows hepatic tuberculosis in the setting of malignancy , seen as focal fdg uptake on pet / ct ; but , the patient had past history of disseminated tuberculosis , unlike our case where there was no past history or stigmata on examination to suggest old tuberculosis .
considering the fact that liver is not the most common of metastatic sites for ewing 's family of tumors , an upfront histological confirmation should ideally be obtained if the imaging findings suggest an unusual pattern of disease spread .
however , the focal nature of uptake and the intensity of metabolic activity , depicted by max suv , which was identical for the primary site and metastatic lesion , tilted the odds more in favor of metastases .
there were other factors which also were considered , like the focality of lesion which also favors metastatic disease .
delbeke et al . , have shown that a focal pattern of fdg uptake in liver favors a metastatic etiology over infection .
furthermore , the fact that such a lesion was seen in the setting of ewing 's sarcoma which also demonstrates high grade fdg avidity , ruled it more in favor of metastases on baseline imaging .
hence , an isolated focal hepatic fdg avid lesion , in a clinically unremarkable scenario like ours , is bound to pose a diagnostic dilemma .
post chemotherapy scan showed complete regression of primary lesion ; however , the focal liver lesion showed metabolic and morphological progression .
treatment failure at the metastatic site with good response at primary site , indicated that the liver lesion was non - metastatic which was proven on fna .
thus , focal solitary liver lesion in an oncological setting , though fdg avid , should not be assumed to be metastatic particularly in tumors such as ewing 's sarcoma which do not have a high propensity for hepatic metastases at presentation .
clinically , occult focal tuberculosis of liver , which also shows similar uptake pattern on fdg pet , though rare , should be kept at the back of the mind and a tissue diagnosis should be asked for before starting treatment . | finding of focal 18f - fluoro - deoxyglucose ( fdg ) uptake in liver on fdg positron emission tomography / computed tomography ( fdg pet / ct ) in a known case of malignancy is often considered to be metastases .
we report a similar finding on fdg pet / ct in a case of ewing 's sarcoma of thigh , which turned out to be of tuberculous etiology , an unusual cause of false positive fdg uptake in the liver . |
the current understanding of multiple sclerosis ( ms ) as a progressive and long - term disabling disease has been based on studies of clinical course of the disease in areas of high disease prevalence [ 1 , 2 ] .
( 1989 ) have reported that approximately 50% of relapsing - remitting cases required an unilateral support to walk within an average of 15 years , recent data has suggested a better long - term prognosis [ 3 , 4 ] .
the age of onset , the number of relapses early , and the interval between initial relapses have been identified as predictive factors for the development of long - term disability outcomes [ 2 , 5 , 6 ] .
an increasing number of studies have identified the population ancestry as a risk factor , not only for susceptibility to ms but also for clinical progression .
disease outcomes have been shown to be poorer in patients with african ancestry [ 711 ] . in latin america , which has environmental and genetic factors that differ from those high disease prevalence areas , a worse prognosis for african descendants with the primary progressive form of ms ( primary progressive multiple sclerosis ( ppms ) )
was already identified , but there is a lack of studies on the clinical progression and long - term disability outcomes in the relapsing - remitting form of multiple sclerosis ( rrms ) .
the aim of this study was to describe and analyse the secondary progression of rrms in a tropical region with higher proportions of african descents , taking into consideration the influence of clinical characteristics and demographic as ancestry .
we conducted a study of survival on a subset of patients with rrms long term followed at the hospital da lagoa in rio de janeiro , brazil .
care for patients with ms was established at this hospital in 1990 , which is currently one of the referral centres for demyelinating diseases in the state of rio de janeiro .
care for patients suspected of having ms occurs through spontaneous demand or through a referral from health services in the southeast region of the country . by december 2010
, there were 623 registered patients with ms , and demographic information and data from clinical visits from rrms patients with the duration of the disease of ten or more years were extracted from the brazilian software database for multiple sclerosis research in tropical countries ( siapem ) .
ppms patients were not included due to the presence of progression since the onset of the disease which could generate bias in the measurement of time to the beginning of disability progression , the primary endpoint of this study .
additionally parameters like number of relapses and the time interval between them would not be possible to assess in primary progressive ms group . from the registry of all patients with rrms according to mcdonald et al .
criteria , 150 cases with the duration of the disease of ten or more years and regular monitoring data were included .
the observation period concluded with the last recorded evaluation in or before december 31 , 2010 .
information on relapses , recovery , disability , and progression scores was obtained from the records of follow - up visits .
cases with an initial optic spinal manifestation were reviewed and specific criteria for nmo were applied to exclude the possibility of neuromyelitis optica ( nmo ) .
relapse was defined as the presence of acute neurological symptoms or worsening of preexisting symptoms for longer than 24 hours and followed by partial or complete remission [ 13 , 15 ] .
initial clinical manifestations were categorised by functional system ( fs ) : pyramidal , cerebellar , sensory , visual , brainstem , sphincter , and psychiatric .
the clinical course was classified as benign if the edss score was 3 or less after ten years of disease and classified as malignant if the edss score was 6 or more after five years of disease . the secondary progression ( progressive phase onset of the disease or secondary progressive multiple sclerosis ( spms ) ) was defined as a maintained increase in edss score not attributed to a relapse that continued for six months or longer with no improvement or progressive worsening with each assessment .
the time to secondary progression was investigated in relation to the following factors : gender ( male versus female ) ; ancestry : ( african descent if there were blacks in the family as far back as the third generation versus white ) ; age at onset of disease ( less than 30 years versus 30 years or more ) ; type ( pyramidal , cerebelar , sensory , brain stem , visual , sphincter , and mental ) ; number of initial neurological manifestations ( one versus two or greater than two ) ; number of relapses in the first year of disease ( until two versus more than two ) ; first interattack interval ( until two years versus more than two years ) ; recovery from the first relapse : residual deficits absent versus present ; immunosuppressive or immunomodulatory therapy : used versus not used .
the statistical package for the social sciences ( spss ) 13.0 for windows was used to perform the analyses .
quantitative variables were represented by frequency ( % ) , and tests of skewness and kurtosis were applied to continuous variables to confirm normal distribution and enable the use of the means standard deviation .
the mann - whitney test was applied for the comparison of continuous variables and pearson chi - squared or fisher 's exact tests were used for categorical variables .
odds ratio was also calculated to identify factors associated with the long - term disability outcomes and faster onset of progression .
kaplan - meier curves with log - rank tests were used to assess the cumulative risk to the progressive phase according to demographic and clinical data . in the survival analysis , it was calculated the median time in years to reach the secondary progression .
cox multivariate analysis was performed to determine the variables independently associated with a faster onset of progression . only variables with p values of less than 0.05 in the bivariate analysis
. only kaplan - meier curves of statistically significant factors in cox regression were represented graphically . statistical significance was set at p < 0.05 .
of 623 patients with ms in the registry , 553 ( 88% ) were diagnosed with rrms [ 12 , 13 ] . of these cases ,
150 ( 27% ) had the disease for ten or more years and were included in the study .
the average duration of disease for this group was 19.7 9.1 years ( range : 1053 years ) .
the data are summarised for the entire group of patients and are broken down by gender and ancestry .
in most patients , the age of disease onset was between the third and fourth decades of life .
most patients ( 82% ) had one relapse in the first year of disease , and of those most experienced a full recovery ( 83% ) .
the initial clinical condition was characterised by the involvement of one functional system in two - thirds of the patients , and sensory manifestations were the most common .
stratification by gender and ethnicity showed a trend towards predominance of motor symptoms in male patients ( p = 0.05 ) .
the time interval between the first and second relapses was no more than two years in more than half of the patients .
no significant differences in initial clinical characteristics were noted when controlling for gender and ethnicity .
approximately 40% of patients , with a mean age of 44 years and an average duration of disease of 13 years , advanced to the progressive form of ms .
a higher frequency of men ( 45.2% ) and of african descent patients ( 51.5% ) progressed to the secondary progressive form , without statistical significance .
no significant difference was observed in the mean age at the onset of progression with respect to gender or ethnicity .
. a larger number of caucasians were significantly more often ( 85% , ic95% : 78.2%92.0% ; p = 0.002 ) to have benign ms than african descent patients ( 60,6% ; ic95% : 43.4%76% ) , while the latter more often to reach edss score of 6 ( 12.1% ; ic95% : 3,9%26.7% ; p = 0.007 ) within a time interval of five years or less ( malignant evolution ) than caucasians ( 1.7% ; ic95% : 0.3%5.5% ) .
disability was significantly different between groups of ancestry : edss median scores were higher in african descent patients than in non - african descent at five years of the disease ( 1.9 versus 0 , p = 0.002 ) , at ten years of the disease ( 2.0 versus 1.0 , p = 0.01 ) and at the last follow - up visit ( 5.5 versus 3.0 , p = 0.016 ) .
the shortest period between disease onset and diagnosis was one month and the longest was 29 years . over 70% of patients ( 111/150 )
were treated with disease - modifying drugs ( dmds ) for at least 3 months , including immunomodulators ( 102/111 ) and immunosuppressants ( 9/111 ) .
the average time before initiating therapy was greater than ten years in 54% of the patients and ranged from one to 38 years , with no significant differences with regard to gender .
african descent and non - african descent patients were diagnosed and treated after medians of time very close ( table 2 ) ; no significant differences were noted between the groups . there was no statistically significant difference between the genders with respect to the amount of time before the progression of disease ( p = 0.31 ) .
african descent patients reached the progressive phase more quickly than non - african descent ( 11.0 years versus 15.0 years , p = 0.006 ) . in patients who developed ms when they were 30 years and older , the time taken to reach the secondary progression was more rapid than in patients who developed ms when they were younger ( 14.0 years versus 17.0 years , p = 0.004 ) .
similarly , patients with first interattack interval less than two years reached the secondary progression of the disease more rapidly ( 13.0 versus 17.5 years , p < 0.0001 ) . patients who experienced first relapse that did not fully remit presented more short time to progression ( 15.0 years versus 11.0 years , p = 0.04 ) . the time to reach
disease progression was significantly less in patients who had more than one relapse in the first year of disease ( 11.7 versus 17.6 years p < 0.001 ) .
cox logistic regression was performed to assess the effect of ancestry and other initial clinical factors on time to the progressive phase onset of the disease ( table 3 ) .
patients of african descent , patients older than 30 years of age , and patients who experienced more than one relapse in the first year of disease had a higher risk for progression .
figure 1 shows the time - to - onset curves of the progressive phase of ms according to ancestry , age at onset , and number of relapses during the first year of the disease .
for the patients who reached the secondary progressive phase of ms , the use of dmd had no significant effects on median times in the kaplan - meier curves or on the risk for progression ( 25.5 years versus 29 years , p = 0.08 ) .
considering the scarcity of longitudinal studies and prognosis in latin america , the current study is the first to analyze the influence of demographic and clinical factors on the survival of rrms patients of mixed ethnicity .
the time to conversion in secondary progressive ms was analysed in 150 patients with more than 10 years of illness which remained in a followup on a reference centre for the treatment of ms .
( 2006 ) have suggested that the probability of and time to progression have been poorly explored despite having profound relevance .
additionally it is important to note that various therapeutic options currently available have not been able to prevent the progressive phase of the disease or disability yet [ 2022 ] .
the selection of cases with more than ten years of evolution was provided for sufficient time to observe both benign and malignant trajectories of the disease course .
moreover , this time frame would theoretically minimise the possible influence of dmd because the distribution of these drugs in our country began in the last decade .
another observation is that the average time to diagnosis of ms and to the initiation of treatment did not differ between african descendants and caucasians , which suggests that the potential influences of socioeconomic factors related to race did not affect our results .
the results obtained from clinical trials with immunomodulatory [ 2022 ] and immunosuppressive drugs ( cladribine ) and monoclonal antibodies ( alemtuzumab ) have not clearly shown that a reduction in relapses slows disease progression .
immune - mediated inflammation is the predominant pathogenic mechanism in the initial phases of ms .
anatomopathological studies indicate that the biological mechanisms responsible for neurodegeneration and disability are distinct from those that cause inflammation and relapses [ 25 , 26 ] .
the occurrence of relapses was initially implicated as one of the main determinants of degeneration and progression [ 1 , 2 , 6 , 27 , 28 ] . according to compston
the progression of ms is due to axonal loss initiated and maintained by the inflammatory response in individuals susceptible to neurodegeneration .
other authors consider the progressive phase of the disease to be an age - dependent degenerative process .
the time to progression and time to disability would be predetermined , with no influence of relapses or the initial course of the disease .
it remains unclear whether the accumulation of relapses and long - term disability are causally related .
the predictive value of the rate of early relapses on disease progression seems to be weaker once the progressive course of the disease is initiated [ 5 , 6 ] .
the results obtained in our study confirm previous observations that a higher rate of relapses in the initial phase of ms , especially in the first year , could increase the risk for progression [ 31 , 32 ] .
however , once the progressive phase is reached , the influence of relapses disappears . a difference in the speed to long - term disability outcomes between men and women has been identified , with a worse prognosis for male patients [ 1 , 2 , 6 ] .
however , in our results the time interval for the onset of progression did not differ significantly between genders .
this finding strengthens the observation made by leray et al . that the strength of the identified risk factors could be limited to early stages of the disease .
later age at disease onset is another factor that has been described as a risk factor for progression [ 4 , 30 , 3235 ] . according to our results , patients who were 30 years or older when they developed the disease had an increased risk for moderate disability and progressed after a shorter time interval , supporting the possibility of a degenerative age - dependent component .
the presence of residual deficits after the first neurological manifestation and a shorter time interval between the first and second relapses were identified as predictive of a worse course [ 1 , 3 , 68 , 32 ] .
our results confirm these findings . in the multivariate analysis , these factors lost strength when they were analysed together with the number of relapses in the first year , older age , and african ancestry .
african ancestry has been associated with a worse prognosis for various diseases [ 3639 ] .
genetic factors linked to ethnicity may be related to the initiation and evolution of ms .
studies of african americans analysed relapsing - remitting and initially progressive forms of disease in conjunction [ 710 ] . the brazilian study , which assessed the evolution of ppms in a multiracial population , proved that african ancestry increased disease severity even in the form of the disease with the worst prognosis .
in turn , the results of our study , which was conducted in the same population , but with rrms , also indicate that african ancestry is a strong predictive factor for worse outcomes .
in addition significantly higher median edss scores at five and ten years and at the last followup were observed in the african descent group which were more likely to have malignant forms of the disease than caucasians .
the poorer outcomes in individuals of african ancestry could suggest the participation of non - hla genes ; as an example is the polymorphisms in tnfrsf1a , that could also contribute to a more degenerative course of ms .
the intervals of time from the onset of the disease until the onset of the progressive phase were influenced by initial clinical characteristics and mainly by ancestry , the latter being a biological variable intrinsic to the patient , not the disease .
both conditions , demographic and clinical , are present at the onset of the disease and should be considered together with the therapeutic window in intervention strategies .
the recognition of the role of ancestry on prognosis also serves to stimulate genetics and pharmacogenomics research that may clarify the poorly understood neurodegenerative component of ms . | background . studies on the clinical course of multiple sclerosis have indicated that certain initial clinical factors are predictive of disease progression . regions with a low prevalence for disease , which have environmental and genetic factors that differ from areas of high prevalence , lack studies on the progressive course and disabling characteristics of the disease . objective .
to analyse the long - term evolution to the progressive phase of the relapsing - remitting multiple sclerosis and its prognosis factors in mixed population .
methods .
we performed a survival study and logistic regression to examine the influence of demographic and initial clinical factors on disease progression . among 553 relapsing - remitting patients assisted at a brazilian reference centre for multiple sclerosis
, we reviewed the medical records of 150 patients who had a disease for ten or more years .
results .
african ancestry was a factor that conferred more risk for secondary progression followed by age at the onset of the disease and the number of relapses in the year after diagnosis .
a greater understanding of the influence of ancestry on prognosis serves to stimulate genetics and pharmacogenomics research and may clarify the poorly understood neurodegenerative progression of ms . |
es cell lines including the g9a knockout were cultured based on the standard protocol of the es core laboratory at johns hopkins university ( see full methods for details ) .
we differentiated es cells for 1824 days by removing leukemia inhibitory factor ( lif , chemicon ) from the medium and culturing in plates without feeder cells .
chromatin was isolated without sonication or formalin cross linking , by digested with micrococcal nuclease ( mnase , ge healthcare , piscataway , nj ) , and then chromatin immunoprecipitation was performed with an antibody specific to h3k9me2 ( abcam , cambridge , ma ) .
chip and input dna were amplified , labeled by cy5 and cy3 respectively , and hybridized to nimblegen tilling arrays as described4 .
we first conducted within - array normalization to correct the probe sequence effects and position bias .
locks are defined as the genomic regions where smoothed values are above 97.5th quantile of log ratios in reference regions ( see full methods for details ) .
the pdf files containing all the pictures of locks can be obtained through our website : http://rafalab.jhsph.edu / k9locks/.
es cell lines including the g9a knockout were cultured based on the standard protocol of the es core laboratory at johns hopkins university ( see full methods for details ) .
we differentiated es cells for 1824 days by removing leukemia inhibitory factor ( lif , chemicon ) from the medium and culturing in plates without feeder cells .
chromatin was isolated without sonication or formalin cross linking , by digested with micrococcal nuclease ( mnase , ge healthcare , piscataway , nj ) , and then chromatin immunoprecipitation was performed with an antibody specific to h3k9me2 ( abcam , cambridge , ma ) .
chip and input dna were amplified , labeled by cy5 and cy3 respectively , and hybridized to nimblegen tilling arrays as described4 .
we first conducted within - array normalization to correct the probe sequence effects and position bias .
locks are defined as the genomic regions where smoothed values are above 97.5th quantile of log ratios in reference regions ( see full methods for details ) .
the pdf files containing all the pictures of locks can be obtained through our website : http://rafalab.jhsph.edu / k9locks/.
| higher eukaryotes must adapt a totipotent genome to specialized cell types with a stable but limited repertoire of functions .
one potential mechanism for lineage restriction is changes in chromatin , and differentiation - related chromatin changes have been observed for individual genes12 .
we have taken a genome - wide view of histone h3 lysine-9 dimethylation ( h3k9me2 ) .
we find that differentiated tissues exhibit surprisingly large k9-modified regions ( up to 4.9 mb ) , that are highly conserved between human and mouse , and differentiation - specific , covering only ~4% of the genome in undifferentiated mouse embryonic stem ( es ) cells , compared to 31% in differentiated es cells , ~46% in liver and ~10% in brain .
they require histone methyltransferase g9a , and are inversely related to expression of genes within them , and we term them large organized chromatin k9-modifications ( locks ) .
locks are substantially lost in cancer cell lines , and they may provide a cell type - heritable mechanism for phenotypic plasticity in development and disease . |
ultrasound imaging is currently a commonly acknowledged and widely used method in the diagnosis of rheumatic diseases . in the recent years
modern equipment enables imaging of structures with the resolution up to 0.1 mm , which helps detect slight inflammatory foci and early joint damage .
additionally , doppler modes ( power doppler , pd , and color doppler , cd ) help present evidence of enhanced vascularity in tissues affected by the inflammatory process .
moreover , ultrasound imaging is more sensitive in detecting rheumatoid erosions than conventional radiography ; wakefield et al . have demonstrated that us detects erosions 6.5 times more often than x - ray .
furthermore , ultrasound imaging facilitates the detection of tenosynovitis , tendinitis , bursitis and enthesopathy .
the us image is non - specific , which means that it does not allow rheumatologic entities to be distinguished but merely assessed in terms of their nature , location and activity of inflammatory changes .
it does not enable one to assess all articular surfaces due to limited access of an ultrasound transducer and is highly dependent on the physician 's experience in the diagnosis of motor organ diseases .
based on a literature review , experts of the european society of musculoskeletal radiology ( essr ) prepared recommendations concerning the usage of ultrasonography in the diagnosis of musculoskeletal diseases .
the following aspects were discussed for each peripheral joint : indications , level of research evidence ( a randomized clinical trials , cohort trials , b retrospective cohort trials , case - control studies , c case reports , d expert opinions ) as well as strength of clinical indications ( 0 no indications , 1 indicated if other techniques can not be applied , 2 comparable with other techniques , 3 first choice examination , other techniques rarely provide additional information ) . for peripheral joint assessment ,
ultrasound imaging obtained the third , i.e. the highest level of recommendation , which has proven that this method is highly significant in assessing synovitis .
this article discusses the role of ultrasound imaging in the diagnosis of rheumatic diseases , such as rheumatoid arthritis ( ra ) , spondyloarthropathies ( spa ) and polymyalgia rheumatica ( pmr ) , based on the latest recommendations of acr / eular ( american college of rheumatology / european league against rheumatism .
the role of medical imaging in the diagnosis of rheumatoid arthritis has become acknowledged , particularly in rheumatologic circles , after the new ra classification criteria were issued by acr / eular in 2010 ( tab .
these criteria are used for early ra diagnosis and are applicable for patients diagnosed for the first time when clinical synovitis is identified in at least one joint ( edema , tenderness ) , and its etiology can not be explained by any other cause but ra . medical history and clinical examination of peripheral joints
these principles enable many patients to be diagnosed and treated without the need for any additional examinations . in some cases , e.g. inflammation of low intensity ,
moreover , a result of clinical examinantion largely depends on the physician 's experience and patient 's reaction to pain .
that is why , according to acr / eular , us examinations and mri scans can be helpful not only to confirm arthritis , but also to detect inflammatory activity in subclinical patients .
studies that compare sensitivity and specificity of ra detection by us vs physical examination have demonstrated a higher diagnostic value of ultrasonography .
of 104 patients with a suspicion of chronic arthritis , 41 met the 2010 acr / eular criteria for ra and used methotrexate at baseline .
a us scan was performed in all patients prior to the observation . after a year
, treatment indications were re - evaluated , and a follow - up us scan was conducted using a semi - quantitative scale proposed by szkudlarek .
the best sensitivity to specificity ratio for the ra criterion was obtained for at least grade ii in the gray - scale or at least grade i in the doppler mode . according to the scale by szkudlarek , grade 0 in the gray - scale ultrasound score ( 03 )
denotes no inflammatory changes whereas changes in grades i iii ( mild , moderate and marked synovial hypertrophy ) occupy the consecutive third parts of maximum potential articular volume . as for the doppler scale ( 03 ) ,
the grades denote as follows : 0 no signs of synovial flow , grade i isolated signals within hypertrophied synovium , grade ii
vessels occupy < 50% of the hypertrophied synovial area of a given compartment , grade iii
according to acr / eular , remission is identified when the following conditions are met : number of tender joints 1 , number of swollen joints 1 , crp ( c - reactive protein ) 1 mg / dl , global patient - reported assessment of disease activity 1 ( scale 010 ) or sdai ( simplified disease activity index ) 3.3 . the author 's own practice ( unpublished data ) and published reports demonstrate that despite clinical remission , subclinical slight inflammatory activity persists in joint cavities or sheaths , leading to disease progression . of 90 ra patients examined during the remission period ,
progression of destructive changes was identified in 19% of patients within a year of observation .
the most important risk factor was enhanced blood flow in the synovium of joint cavities seen in doppler examinations .
the 2010 acr / eular classification criteria for rheumatoid arthritis ( ra ) * confirmed ra
when the total score is at least 6 the crucial role in preventing joint damage belongs to early diagnosis and initiation of treatment modifying the course of the disease .
that is why , in 2013 , a group of 19 eular experts from 13 countries prepared recommendations concerning medical imaging in ra in order to make a diagnosis in patients with at least one joint bearing clinical signs of inflammation , detect structural joint damage , predict the course of the disease and treatment response , monitor progression and determine remission .
each of 10 recommendations has its specific strength ( expressed in the visual analogue scale , vas 010 : 0 not recommended at all , 10 fully recommended ) and evidence level ( i randomized controlled trials ; ii at least one controlled study without randomization ; iii non - experimental descriptive studies ; iv , evidence from expert opinions ) .
although the level of evidence of the recommendations is iii and iv , their strength is relatively high ( 7.89.4 ) .
below , the said recommendations are listed , nine of which concern the usage of ultrasonography as a recommended but not obligatory tool ( fig .
1 a , b ) . grey - scale us ( a ) and color doppler ( b ) of the wrist : effusion , synovial hypertrophy in the radiocarpal joint ( synovitis ) and tenosynovitis of the extensor carpi ulnaris
recommendation 1 .
when there is diagnostic doubt , conventional radiography , ultrasound or mri can be used ( strength of recommendation : 9.1 ) .
the influence of imaging on establishing a diagnosis was assessed on the basis of five observational studies ( three with mri and two with us ) .
one study showed that the detection of synovitis improves the certainty of ra diagnosis from 42% to 53.2% . in another study ,
the presence of inflammation seen with ultrasound or mri can be used to predict the progression to clinical ra from so - called undifferentiated inflammatory arthritis ( strength of recommendation : 7.9 ) .
most studies concern the prognostic value of mri , but certain studies on doppler examination indicate the likelihood of progression of undifferentiated inflammatory arthritis to ra with or 9.9 if one joint is involved and or 48.7 if inflammation is detected in at least four other joints ( or odds ratio , which is a ratio of odds that a given event will occur in an investigated sample to its occurrence in another group ) .
us and mri are superior to clinical examination in the assessment of joint inflammation ; these techniques should be considered for improved detection of inflammation in joints ( strength of recommendation : 8.7 ) .
this recommendation is a result of the analysis of 51 studies comparing imaging and clinical examination in the detection of inflammation in various joints .
twenty - nine studies concerned us , 16 mri , 14 scintigraphy , and 2 positron emission tomography ( pet ) . ultrasound and mri detected joint inflammation twice as frequently as clinical examination .
the diagnostic value of scintigraphy and pet only slightly exceeded that of clinical examination .
conventional radiography of the hands and feet should be the initial imaging technique to detect damage ( erosions ) .
however , ultrasound or mri should be considered for earlier detection of erosions or if radiography is negative ( strength of recommendation : 9.0 ) .
in this recommendation , the role of ultrasound in detect ing ra and its superiority to conventional radiography in terms of sensitivity in identifying erosions is emphasized again .
mri bone edema is a strong independent predictor of subsequent radiographic progression in early ra and should be considered for use as a prognostic indicator .
early joint inflammation detected by mri or us as well as joint damage detected by conventional radiography , mri or us can also be considered for the prediction of further joint damage ( strength of recommendation : 8.4 ) .
this recommendation was prepared on the basis of 48 studies assessing the predictive value of joint damage in individual imaging techniques .
the predictive value of ultrasound synovitis for erosive progression detected by mri occurred superior to mri synovitis ( likelihood ratios of 1.75 and 1.45 , respectively ) .
inflammation seen on imaging may be more predictive of a therapeutic response than clinical features of disease activity ( strength of recommendation : 7.8 ) .
two prospective cohort studies have compared clinical measures with imaging in predicting the efficacy of tnf inhibitors .
measured inflammatory activity by doppler ultrasound ( cf assessment , color fraction ) and clinical parameters , such as the number of tender and swollen joints , crp , das28 ( disease activity score ) and haq ( health assessment questionnaire ) at baseline and after a year of tnf inhibitor therapy ( ( tumor necrosis factor ) .
cf assessment occurred to be the only effective tool for predicting a therapeutic response .
since mri and us are more effective than clinical examination in detecting inflammation , they may be useful in monitoring disease activity ( strength of recommendation : 8.3 ) .
according to the authors of the recommendation ,
there are no published data describing how imaging should be used to monitor disease activity .
however , there is evidence that us , together with das28 , is capable of detecting even slight changes in synovial inflammatory activity during treatment .
the periodic use of radiography of the hands and feet should be considered for joint damage monitoring .
mri ( and possibly ultrasound ) , being more sensitive , can also be used to monitor disease progression ( strength of recommendation : 7.8 ) .
as in the previous recommendation , there are no data on the frequency of imaging applied for the monitoring of progressive joint damage .
if cervical spine is suspected of being involved , it should be periodically evaluated for functional instability by lateral radiograph obtained in the neutral position , maximum flexion and extension .
when the radiograph is positive or specific neurological symptoms and signs are present , mri should be performed ( strength of recommendation : 9.4 ) .
recommendation 9 is the only recommendation that does not concern us ; only radiography and mri are mentioned .
mri and us can detect inflammation that predicts subsequent joint damage , even when clinical remission is present .
these methods can be used to assess persistent inflammation ( strength of recommendation : 8.8 ) .
there is good evidence that despite clinical remission shown by imaging , signs of ongoing inflammation persist in even 1562% of patients in remission according to das28 , acr or sdai .
the presence of persistent inflammation has an undisputed effect on disease progression to joint damage .
the presence of synovial hypertrophy , power doppler inflammatory activity and mri bone marrow edema in clinical remission are an indicator of the risk of structural and radiological progression in clinically asymptomatic joints , even within one year . moreover , us inflammation in patients who meet the clinical criteria of remission is predictive of a disease flare within 12 months : a disease flare is observed within this period of time in 20% of patients with no pd inflammatory activity at baseline compared with 47% with baseline power doppler activity .
polymyalgia rheumatica ( pmr ) is a disease entity manifested by pain and stiffness in the neck as well as shoulder or pelvic girdle .
new diagnostic criteria were established which have completely changed the attitude to this disease entity ( tab .
it was demonstrated that pmr is an inflammatory disease of the neck , shoulders and hips .
the role of ultrasound in the imaging of affected structures was emphasized , particularly in the context of poorly severe inflammation in clinical examination .
they enable pmr to be differentiated from non - inflammatory pathology of the shoulder and hip , such as post - traumatic changes , overload pathology or degenerative lesions , which frequently are asymmetrical .
however , this disease entity can not be differentiated from ra since the ultrasound image of inflammation that symmetrically affects the joints can be similar .
the score of at least 4 of 6 on the scale of these clinical criteria enables the disease to be diagnosed with the sensitivity of 68% and specificity of 78% .
however , the score of 5 on the 8-score ultrasound scale allows pmr to be detected with the sensitivity of 81% and specificity of 66% .
it seems , therefore , that us plays a particularly important role in the event of doubts ( fig .
2 ) .
us of the wrist : synovial hypertrophy with poorly enhanced synovial vascularity in the distal radioulnar joint ( synovitis ) the 2012 acr / eular classification criteria for polymyalgia rheumatica ( pmr ) age 50 years or older ; bilateral shoulder aching ; abnormal crp and/or esr ;
the role of imaging in the detection of spondyloarthropathies ( spa ) was discussed in 2014 during the latest eular congress in paris .
twenty - one members of the league ( rheumatologists and radiologists from 11 countries ) worked on 10 recommendations concerning axial and peripheral spa .
they are followed by us and computed tomography . in the clinical practice , imaging is significant in detecting changes , monitoring disease activity and structural progression , determining prognosis and predicting treatment outcome . as for axial spa , the first choice examination is sacroiliac joint radiography . in cases with a short duration of the disease or in young patients ,
this examination enables one to detect early active inflammatory changes , mainly bone marrow edema , and structural changes , such as erosions , sclerosis or fatty transformation of the bone marrow . in peripheral spa ,
they enable to detect and monitor joint synovitis , tenosynovitis and bursitis as well as to identify enthesopathy ( fig .
3 a , b ) . mri of the sacroiliac joints , tirm sequence ( turbo inversion recovery magnitude ) ( a ) and t1fs sequence ( t1 fat - suppressed sequence ) after contrast agent administration ( b ) : bilateral bone marrow edema in the subchondral layer of the iliac and sacral bone with changes prevailing on the left side undergoes contrast enhancement ; and ( b ) bilateral inflammation of the anterior joint capsule and synovitis
the past several years have brought more information confirming the necessity to support clinical assessment with imaging for early disease detection , its monitoring ( treatment efficacy ) and identification of complications ( joint damage ) .
it seems , however , that we are only starting the journey . among these criteria and disease entities ,
the spectrum of pathological changes is incomplete ( the recommendations concerning ra lack the aspect of tenosynovitis and bursitis ) .
there are few reports concerning the attempts of using quantitative methods for the detection and monitoring of rheumatic diseases , whilst still imperfect , poorly reproducible semi - quantitative systems are being promoted .
we still have no knowledge of the frequency with which imaging examinations should be performed for joint damage monitoring .
nevertheless , more and more common usage of ultrasonography is an optimistic sign . in essr recommendations from 2012
, it was considered the leading method in peripheral synovitis imaging , irrespective of the disease entity . however , as has already been mentioned , the limitations of this method should be borne in mind .
authors do not report any financial or personal connections with other persons or organizations , which might negatively affect the contents of this publication and/or claim authorship rights to this publication . | in the past years , ultrasound imaging has become an integral element of the diagnostic process in rheumatic diseases .
it enables the identification of a range of inflammatory changes in joint cavities , sheaths and bursae , and allows their activity to be assessed . in 2012 , experts of the european society of musculoskeletal radiology prepared recommendations concerning the role of ultrasonography in the diagnosis of musculoskeletal diseases .
ultrasound was considered the method of choice in imaging peripheral synovitis .
moreover , ultrasound imaging has been popularized thanks to the new classification criteria for rheumatoid arthritis issued by the american college of rheumatology and european league against rheumatism in 2010 .
they underline the role of ultrasound imaging in the detection of articular inflammatory changes that are difficult to assess unambiguously in the clinical examination .
these criteria have become the basis for recommendations prepared by experts from the european league against rheumatism concerning medical imaging in rheumatoid arthritis .
nine of ten recommendations concern ultrasonography which is relevant in detecting diseases , predicting their progression and treatment response , monitoring disease activity and identifying remission . in the new criteria concerning polymyalgia rheumatica from 2012 , an ultrasound scan of the shoulder and pelvic girdle was considered an alternative to clinical assessment . moreover ,
the relevance of ultrasonography in the diagnosis and monitoring of peripheral spondyloarthropathies was widely discussed in 2014 during the meeting of the european league against rheumatism in paris . |
major depressive disorder ( mdd ) is a highly prevalent psychiatric disorder affecting an estimated 1015% of the population worldwide ( bromet et al . , 2011 ) .
it is characterized by the persistent presence of several emotional , psychological and somatic symptoms including , but not limited to depressed mood , anhedonia , fatigue , sleep disturbances , cognitive dysfunctions and suicidal ideation ( american psychiatric , 2013 ) . in most developed and high - income countries ,
mdd has thus consistently been ranked among the top five public health issues with regard to socioeconomic burden ( murray et al . , 2012 ) .
akin to other neuropsychiatric illnesses , the currently available therapeutic interventions for mdd exhibit several unfavorable factors , limiting treatment success . among these
are the poorly understood latency in the onset of the clinical effect of most commonly used antidepressant medications , a high incidence of adverse side effects and the considerable amount of non - responders among the affected mdd patients ( holtzheimer and mayberg , 2011 , whiskey and taylor , 2013 ) .
furthermore , the heterogeneity and complexity of the disorder suggest a complex set of interactions between several endogenous and exogenous variables contributing to the pathogenesis of mdd , the underlying mechanisms of which still remain poorly understood .
elucidation of the pathophysiological principles at the molecular level , however , constitutes a prerequisite for the development of alternative therapeutic strategies and is largely dependent on the availability of specific animal models .
considering the relevance of chronic stress as a precipitating factor for the development of mdd ( bagot et al .
, 2014 , slavich and irwin , 2014 ) , several stress - based animal models of depression exist , featuring paradigms of stress exposure at various stages of life , including the prenatal period ( hammels et al .
animal models of prenatal infectious stress have recently been emerging as powerful tools allowing to test the role of early immune stimulation as a priming factor that induces long - lasting neuronal changes contributing to the emergence of depression later in life ( reisinger et al . , 2015 ) .
one frequently used rodent model of maternal immune activation ( mia ) is based upon the systemic administration of polyinosinic : polycytidilic acid ( poly(i : c ) ) , a synthetic analog of double - stranded rna ( dsrna ) and activator of toll - like receptor ( tlr ) 3 ( tatematsu et al . , 2014 ) , to the pregnant dam in order to mimic a gestational viral infection ( meyer , 2014
reisinger et al .
using this model , we have recently demonstrated behavioral , neural and molecular alterations associated with depression in the adult male offspring ( khan et al . , 2014 ) . here
we employed the poly(i : c ) mia model to test the hypothesis that the long - lasting nature of the impact of prenatal infectious stress on brain structure and function , at the molecular , cellular and behavioral levels , is associated with a modulation of epigenetic mechanisms , central mediators of the impact of environmental influences on brain and behavior ( bagot et al . , 2014 , tsankova et al . , 2007 ) .
in addition to examining the consequence of mia on key elements of epigenetic regulation globally in the hippocampus , a pivotal brain region in the neural circuitry of depression ( mckinnon et al . , 2009 , posener et al . , 2003
) , we specifically investigated its effect on the serotonin transporter ( sert ) - critically involved in the etiology of mdd and pharmacological antidepressant treatment .
all mice used were c57bl/6n mice obtained from charles river ( sulzfeld , germany ) .
behavioral and molecular experiments were carried out in separate cohorts of adult female offspring ( 812 weeks ) from maternal immune activation at embryonic day 12.5 ( pic ) and age matched control animals .
a diagram depicting the time course and experimental design of this study is provided in fig .
1 . animals were housed under standard conditions , all animal procedures were approved by the national ethical committee on animal care and use in austria ( bundesministerium fr wissenschaft und forschung : bmwf-66.009/0015-ii/3b/2012 ) and were carried out according to international laws and policies .
all efforts were made to minimize animal suffering and discomfort and to reduce the number of animals used . timed mating procedures were carried out following an established protocol , as previously described ( khan et al . , 2014 ) .
upon confirmation of a vaginal plug in the morning following the mating period , this time was denoted as embryonic day 0.5 ( e0.5 ) ( simard et al . , 2010 ) .
on e12.5 the total weight gain ( % ) since mating was calculated for each dam .
c57bl/6 mice can be expected to gain 25%40% of their initial body weight during the first 12.5 days of pregnancy , allowing the determination of pregnancy with up to 99% certainty at this time point ( hau and skovgaard jensen , 1987 ) .
pregnant mice were subjected to either mia or control treatment at e12.5 , since the effect of poly(i : c)-induced mia on depression - related behavior and associated neurobiological changes in mice has been previously described at this time point ( khan et al . , 2014 ) .
for mia , pregnant mice were injected intraperitoneally ( i.p . ) with 20 mg / kg poly(i : c ) ( polyinosinic polycytidylic acid potassium salt , sigma aldrich , st .
louis , mo , usa ) dissolved in vehicle or the vehicle alone ( physiological saline solution , 0.9% , fresenius kabi , bad homburg , germany ) .
all behavioral experiments were carried out during the light phase of the light - dark cycle . the experimental protocol used has been previously described in detail ( savalli et al . , 2015 ) .
briefly , mice were food and water restricted for 18 h prior to a two - bottle forced choice test ( regular drinking water vs 2% sucrose ( sigma aldrich , st .
louis , mo , usa ) solution ) conducted over a 3 h testing period .
the consumption of sucrose solution relative to the total liquid consumption was evaluated and the percentage of sucrose preference calculated from this measure .
the forced swim test was carried out as previously described ( khan et al . , 2014 ,
briefly , mice were placed into glass beakers filled with tap water ( 22 c ) for 6 min .
their mobility was recorded and automatically analyzed using the software videotrack ( viewpoint , champagne au mont d'or , france ) for the evaluation of the proportion of time spent immobile during the last 4 min of the test . for the epm test
, mice were placed in the center of a plus - shaped maze ( elevated 50 cm off the ground ) consisting of two opposing open arms and two opposing closed arms , the latter of which were enclosed by 20 cm high walls .
the movement within the maze was tracked using videotrack ( viewpoint , champagne au mont d'or , france ) , and the proportion of time spent in the open arms during the 5 min test period was calculated , as described elsewhere ( walf and frye , 2007 ) . for the oft , the locomotor activity of mice in a testing arena ( 27.3 cm 27.3 cm ) equipped with infrared beam arrays ( medassociates inc .
, st . albans , vt , usa ) was evaluated for 60 min .
albans , vt , usa ) to calculate the total distance travelled , as previously described ( khan et al . , 2014 ) .
in the rotarod test the motor coordination of mice was evaluated using an automated system consisting of a rotating drum and the accompanying software ( medassociates inc . , st .
the rotation speed was increased steadily from 4 rpm to 40 rpm and the latency of the animal to fall off the drum was recorded and averaged over three trials for each mouse , as previously described ( khan et al . , 2014 ) .
western blot experiments , mrna analysis and chromatin immunoprecipitation ( chip ) were carried out using tissue from parallel cohorts of mice . for chip and western blot experiments ,
the tissue was placed in reaction tubes , flash - frozen using liquid nitrogen immediately following dissection , and then stored at 80 c until used for analysis .
mrna samples were stored in rnase - free reaction tubes containing rnalater ( ambion , austin , tx , usa ) and stored at 20 c for subsequent experimental work - up .
standard western blot analysis ( monje et al . , 2011 ) was performed on hippocampal tissue of pic and control mice .
briefly , tissue was homogenized in 1 m pbs followed by lyzation in a protein lysis buffer ( 10 mm tris
hcl ph 7.5 , 150 mm nacl , 1% sds , 0.5% triton x-100 , 1 mm edta , 10 mm naf , 5 mm na4o2p7 , 10 mm na3vo4 and 1 protease inhibitor cocktail ( thermoscientific , waltham , ma , usa ) ) .
protein concentration was determined using the bca protein assay kit ( pierce biotechnology , rockford , il , usa ) according to the manufacturer 's instructions and using a synergy multi - mode microplate reader ( biotek , winooski , vt , usa ) for spectroscopic measurements .
50 g of total protein was mixed with 5 l loading buffer ( thermoscientific , waltham , ma , usa ) and subjected to sds - page electrophoresis followed by blotting onto a pvdf membrane .
membranes were incubated with primary antibodies ( sert : 1:1000 , santa cruz , dallas , tx , usa ; -actin : 1:2000 , us biological , salem , ma , usa ; h3 : 1:1000 , abcam , cambridge , uk ; ach3 : 1:1000 , millipore ; h4 : 1:1000 , millipore ; ach4 : 1:1000 , millipore , billerica , ma , usa ) overnight at 4 c followed by a one - hour incubation at room temperature ( rt ) with the appropriate secondary antibody ( sert : donkey anti - goat igg - hrp , 1:3000 , santa cruz , dallas , tx , usa ; -actin : goat anti - mouse igg - hrp , 1:3000 , cell signaling technology ; all histones : anti - rabbit igg - hrp , 1:3000 , cell signaling technology , danvers , ma , usa ) .
pierce ecl western blot substrate ( pierce biotechnology , rockford , il , usa ) was used to develop the membranes according to manufacturer 's instructions .
quantification was performed by chemiluminescent imaging with a fluorchem hd2 ( alpha innotec , kasendorf , germany ) using the respective software .
values obtained from densitometry of target proteins ( sert , acetylated h3 and h4 ) were normalized ( -actin for sert , total h3 and h4 for acetylated h3 and h4 ) for the semi - quantitative determination of protein levels as described elsewhere ( griesauer et al . , 2014 ) .
mrna was extracted using the rneasy mini kit ( qiagen , venlo , netherlands ) according to the protocol supplied by the manufacturer .
900 ng of mrna was used for the subsequent cdna synthesis using the dynamo cdna synthesis kit ( thermoscientific , waltham , ma , usa ) following the manufacturer 's instructions .
cdna samples ( dilutions : sert and hdac4 1:1 , hdac1 and hdac5 1:5 , -actin 1:10 ) were used for qrt - pcr assessment of the relative levels of hippocampal mrna and hdacs .
for each sample repeat , 7.5 l of sybr green mastermix ( lifetechnologies , carlsbad , ca , usa ) , 0.15 l each of forward ( sequences hdac1 : ccgcatgactcataatttgctg ; hdac4 : ggcccaccggaatctgaac ; hdac5 : tcttgtcgaagtcaaaggagg , invitrogen , waltham , ma , usa ) and reverse ( sequences hdac1 : tgtgagggcgatagatttccat ; hdac4 : gctgcgttttcccgtacca ; hdac5 : gaggggaactctggtccaaag , invitrogen , waltham , ma , usa ) primers , 6.2 l of rnase - free water and 1 l of sample were added to a well of a rt - pcr plate .
c(t ) values were obtained for each sample as well as a concomitant determination of the housekeeping gene -actin ( sequences forward : atggtgggaatgggtcagaag ; reverse : tctccatgtcgtcccagttg , invitrogen , waltham , ma , usa ) .
the c(t ) values for -actin were used for calculation of c(t ) , representing the relative quantification of mrna amounts in each sample .
this further allowed the calculation of c(t ) , subtracting the mean c(t ) value of the control group from the mean c(t ) value for the poly(i : c ) group .
c(t ) was then used to express the fold change of mrna levels observed between poly(i : c)-exposed mice and untreated mice , using the formula 2 . for chromatin immunoprecipitation ( chip )
analysis of h3 and h4 acetylation at the sert promoter , hippocampal tissue of two mice of the same treatment group ( randomly selected across different litters to eliminate any possible litter effects ) and sex were pooled to obtain one chip sample .
briefly , hippocampal tissue was homogenized in 1.42% formaldehyde in pbs ( 1 m ) using a hand homogenizer , followed by cross - linking , quenching ( 125 mm glycine ) , washing ( pbs ) and lysis in low salt ip buffer with protease inhibitors ( ip buffer , low salt : 150 mm nacl , 50 mm tris
hcl / ph 7.5 , 5 mm edta , 0.5% np-40 , 1% triton x-100 ; halt protease inhibitors added just prior to use in 1:100 dilution , thermoscientific , waltham , ma , usa ) . after cell lysis
, samples were centrifuged ( 2000 g , 4 c , 5 min ) , washed ( low salt ip buffer ) , centrifuged again and resuspended in 500 l low salt ip buffer .
shearing of chromatin was accomplished using a sonicator bath ( bioruptor plus , diagenode , liege , belgium ) after which samples were equally divided into three parts for immunoprecipitation with antibodies ( anti - acetyl - h3 , millipore ; and anti - acetyl - h4 , millipore , billerica , ma , usa ) and mock immunoprecipitation ( without antibodies ) .
7 l of antibody ( anti - ach3 and anti - ach4 ) or ip buffer ( for mock reaction ) and 20 l of protein a magnetic beads ( magna chip protein a magnetic beads , millipore , billerica , ma , usa ) were added and samples were incubated overnight at 4 c on a rotating platform . the following day , samples were washed and a magnetic rack ( magna grip rack , millipore , billerica , ma , usa ) was utilized to pellet the samples .
the final pellet was resuspended in 100 l pbs ( 1 m ) and 1 l of proteinase k ( 20 ug / ul ) and incubated for 30 min on a heated shaker ( 55 c ) after high speed centrifugation , samples were boiled at 95 c for 15 min to dissociate the magnetic beads from the antibodies .
the magnetic beads were removed using the magnetic rack and the pcr - ready dna samples were transferred to new reaction tubes and stored at - 20 c until used for qrt - pcr . for qrt - pcr , master mixes containing sybr green master mix ( 12.5 l per sample repeat , lifetechnologies , carlsbad , ca , usa ) and sert primers ( 4 l each , sequences forward : cagagctctcagtcttgtctcc ; reverse : tgctggtcagtcagtggtg ; invitrogen , waltham , ma , usa ) were prepared and 4.5 l of each sample was added per reaction .
c(t ) values for each sample and ip condition were recorded and used for statistical analysis .
briefly , qrt - pcr data were analyzed as described above , except that instead of -actin c(t ) values , mock ip c(t ) values were used as internal controls , accounting for potential differences in input tissue amounts and non - specific binding of the magnetic beads in each ip condition . for comparisons between two groups ( pic versus control mice ) in the behavioral and all molecular and biochemical experiments , two - sample t - tests ( two - tailed , equal variance )
were carried out and p - values 0.05 were considered statistically significant .
spt analysis was performed in order to characterize the effect of mia on depression - related anhedonia in female pic offspring as compared to control mice . a statistically significantly reduced sucrose preference ( p 0.001 , fig .
no significant difference between pic and control mice was observed in behavioral despair as reflected in the time spent immobile during the fst ( fig .
similarly , mice from the pic and control groups spent comparable proportions of time in the open arms of the epm ( fig . 2c ) .
locomotor activity in the oft , evaluated by the total distance travelled ( fig .
2d ) , and motor coordination , as measured by the latency to fall off the rota rod ( fig .
2e ) , was not significantly different between pic and control mice . in light of the relevance of epigenetic mechanisms for long - lasting alterations in neuronal structure and function and associated mental illnesses ( tsankova et al . , 2007 ) , we next set out to determine functionally relevant histone modifications in the hippocampus of pic and control mice .
western blot analyses demonstrated that the global relative level of acetylated histone h3 was significantly increased in hippocampal tissue of pic mice ( p 0.05 , fig .
the ratio of acetylated h4 versus total h4 was decreased in the hippocampus of pic mice ( p 0.05 , fig .
3b ) . seeking to examine the molecular mediators of altered histone acetylation patterns , levels of histone deacetylating enzymes ( hdacs ) were examined by qrt - pcr in the hippocampus of pic and control mice .
preliminary experiments ( data not shown ) showed that among hdacs 1 - 11 , only hdacs 1 , 4 and 5 were expressed at detectable levels .
hence , these hdacs were further analyzed for potential differences between pic and control mice .
a significant reduction in relative levels of hdac1 mrna was observed in pic animals ( p 0.05 , fig .
4a ) , while no differences for hdac4 and hdac5 expression were found between groups ( fig .
4b , c ) . in order to investigate whether global alterations in histone acetylation profile were also detectable at the promoter sites of specific genes ,
chromatin immunoprecipitation ( chip ) analysis was employed , focusing on sert , given its pivotal role in the pathophysiology of depression and therapeutic action of pharmacological antidepressant drugs ( haase and brown , 2014 ) . a significant increase in acetylated h3 and h4 associated with the sert promoter in the hippocampus of pic mice was revealed ( p 0.05 , fig . 5a and b ) . aiming to ascertain whether the observed modifications of histone structures at the sert promoter translated into alterations in protein expression , hippocampal sert levels were determined in pic and control mice indeed , western blots analysis revealed about 50% increase in hippocampal sert protein in pic as compared to control mice ( p 0.01 , fig .
the presented results suggest that maternal immune activation may exert its effect on offspring behavior via the long - term modulation of epigenetic mechanisms , which in turn can lead to alterations in gene expression , in particular of sert .
we first confirmed the effect of developmental infectious stress exposure through mia by the viral mimetic poly(i : c ) at e12.5 on depression - like behavior in adult female offspring .
as previously described for male progeny ( khan et al . , 2014 ) , we also observed enhanced anhedonic behavior in female offspring after mia , manifesting in significantly reduced sucrose preference in the spt .
in contrast , the fst showed that - as opposed to male pic offspring - behavioral despair was not increased in adult female pic offspring .
other behavioral tests , including the oft , epm and rotarod , showed no differences in the behavior of female pic vs. control offspring , in line with our previous report on males ( khan et al . , 2014 ) . while these data further support the general relevance of mia in mice as a model for specific symptoms reflecting depressive - like behavior , they also suggest a potential applicability of the paradigm in the investigation of the biological basis of gender differences in depression . in humans ,
depression has been repeatedly reported to affect women almost twice as often as men ( angst et al . , 2002
bebbington et al . , 1998 , kuehner , 2003
silverstein , 1999 , weissman and klerman , 1977 ) .
additionally , gender differences in symptoms associated with depressive episodes have been reported , with appetite disturbances highlighted as one major difference between women and men ( marcus et al . , 2005
romans et al . , 2007 ,
it is plausible to speculate that altered experience of reward , which relates to anhedonia , may underlie these gender specificities in people and are mimicked by the herein observed sex differences in response to prenatal infectious stress in mice .
indeed , the enhancement in anhedonic behavior in female pic offspring is slightly larger than the one found in males ( khan et al . , 2014 ) .
by contrast , a higher sensitivity of male rodents to the development of behavioral despair in the fst has been described in different animal models of depression ( alonso et al . , 1991 ,
2014 ) and is thus in line with the present findings in the pic paradigm .
overall , these first insights into the sex - differences in behavioral responses to gestational infection highlight the need for further investigations into their neurobiological underpinnings and translational implications . in an attempt to understand how gestational infection may lead to long - term alterations in brain structure and function at the molecular , cellular and behavioral level , selected epigenetic markers in the adult offspring brain were examined for changes induced by mia treatment .
epigenetic regulation of gene expression ( i.e. genetic control , independent of dna sequence ) is widely thought to represent a molecular substrate for the interaction between genes and the environment leading to long - lasting alterations in transcription and persistent physiological and pathophysiological functional consequences .
indeed , numerous studies propose a critical role for aberrant transcriptional regulation in the pathophysiology of several psychiatric disorders including mdd ( charney et al .
recently , first reports on the effects of prenatal infectious stress induced by mia on selected epigenetic markers have been emerging ( basil et al .
in contrast to previous studies , we here focused on the global histone acetylation profile in the adult offspring hippocampus , a central brain structure involved in the neural circuitry of mdd ( mckinnon et al . , 2009 ,
in particular , acetylation of h3 and h4 histones was deemed a suitable candidate mechanism , since it has been previously implicated in the pathophysiology of mdd , as well as being proposed as a molecular effector mediating long - lasting gene environment interactions ( liu et al . , 2008 , tammen et al . , 2013 ) .
to date , most studies investigating histone acetylation in association with a depression - related phenotype have used stress paradigms during the early postnatal phase or in adulthood and have mostly reported decreased h3 acetylation , with one study showing an increase in h4 acetylation ( reviewed in bagot et al .
thus while these studies support a general relevance for h3 and h4 acetylation in the pathophysiology of depression , the particular circumstances specifically inducing h3 and/or h4 modifications remain to be delineated as well as their respective contributions to the etiology of depression . with respect to mia ,
there has only been one other study investigating levels of histone acetylation : tang et al .
( 2013 ) reported no significant effect of mia on levels of histone acetylation in the hippocampus in adult mice , although the group noted a trend for reduced h4 acetylation , partially lending support to results of the present study ( tang et al . , 2013 ) .
however , the currently available information does not yet allow for the establishment of causal associations between the observed alterations in global hippocampal h3 and h4 acetylation and the behavioral disturbances resulting from mia .
rather , they suggest the dynamic regulation of h3 and h4 acetylation in the pic hippocampus that may serve as a foundation for future in - depth investigations into the involved regulatory mechanisms . in order to gain first insights into the intracellular mechanism potentially mediating the observed changes in histone acetylation in pic mice ,
we examined expression of several hdacs , which besides histone acetyl - transferases ( hats ) - are considered the major regulators of histone acetylation ( peserico and simone , 2011 ) .
while most hdacs ( hdac2 , 3 , 6 , 7 , 8 , 9 , 10 , 11 ) were not sufficiently expressed in our samples to allow pertinent analysis of their levels , the selective reduction in hdac1 expression observed in the pic hippocampus proposes this enzyme as a specific mediator of the impact of mia on epigenetic regulation in the offspring brain .
interestingly , while its defined role remains to be elucidated , evidence for an involvement of hdac1 in the pathophysiology of mdd and in the effects of pharmacological antidepressant treatment has been emerging lately from studies using various animal models ( covington et al . , 2011
schmauss , 2015 , schroeder et al . ,
it is conceivable that the modulation of hdac1 levels in the pic hippocampus may contribute to the observed increase in global h3 acetylation as well as the specific effects at the sert promoter .
however , it can not explain the decrease in h4 acetylation . in this respect ,
it is important to consider that hdac activity need not necessarily relate to expressional levels .
however , due to the lack of commercially available specific hdac1 activity assays one can not yet directly relate changes in hdac expression to activity , far less to the observed changes in histone acetylation and behavior in pic mice . furthermore , hats may play just as important a role in the regulation of histone acetylation levels and thereby gene expression but remain even less well studied than hdacs in the context of depression and have not yet been investigated within the mia paradigm at all .
we next set out to explore potential gene - specific epigenetic regulations , focusing on sert , a key molecule involved in mdd - related serotonergic signaling and prominent target of antidepressant drugs .
the more than two - fold increased binding of both ach3 and ach4 histones to the sert promoter in the pic hippocampus indicates sert as specific target of the mia - induced regulation of the epigenetic machinery which may underlie or contribute to the depression - like phenotype observed in mia offspring . at the molecular level ,
hippocampal sert protein expression was significantly increased in the mia - exposed group which is in agreement with the fact that acetylation of histones has previously been linked to enhanced gene transcription ( shahbazian and grunstein , 2007 , turner , 2014 ) . however , while the focus of this study lay on the relevance of histone acetylation , other epigenetic mechanisms , such as dna methylation , linked to mdd in different contexts ( domschke et al . , 2014 ) , may also act to regulate sert expression .
the observed increase in sert levels in pic mice , which display depression - like behavior , is in agreement with the generally held view that a reduction in sert function ( such as during administration of an ssri ) produces an antidepressant effect ( haase and brown , 2014 ) .
the present study provides evidence for alterations in several epigenetic processes in the adult female offspring brain resulting from mia and proposes altered hippocampal sert expression as one specific molecular effector .
furthermore , to the best of our knowledge , this is the first demonstration of an effect of mia on histone modifications specifically at the sert promoter . while acknowledging that other mechanisms may be involved , we propose that mia - dependent regulation of adult hippocampal sert expression is at least in part mediated by changes in histone ( h3 and h4 ) acetylation at the sert promoter .
as such , this study supports the general notion that epigenetic mechanisms contribute to the environmental programming of brain development and behavior by embedding the impact of early life experience on gene expression ( fig .
moreover , the specific effect on sert , together with the already documented involvement of sert in mdd , suggest that sert holds a critical role in the development of depression - related traits associated with early life infectious stress . in conjunction with previous findings investigating the influence of other exogenous adverse events at different stages of life , our data further highlight the complexity of gene environment interactions
involved in the development of mdd of which mia constitutes one specific contributing factor .
future analyses may build upon the data presented herein and may yield valuable information about the temporal course of the effect of mia on sert function and dependent behaviors as well as the precise molecular pathways employed .
jointly , this information may then allow the identification of critical windows suitable for the application of preventive interventions and potentially point towards new therapeutic targets for the treatment of depression . | major depressive disorder ( mdd ) is one of the most debilitating psychiatric diseases , affecting a large percentage of the population worldwide . currently , the underlying pathomechanisms remain incompletely understood , hampering the development of critically needed alternative therapeutic strategies , which further largely depends on the availability of suitable model systems.here we used a mouse model of early life stress a precipitating factor for the development of mdd featuring infectious stress through maternal immune activation ( mia ) by polyinosinic : polycytidilic acid ( poly(i : c ) ) to examine epigenetic modulations as potential molecular correlates of the alterations in brain structure , function and behavior .
we found that in adult female mia offspring anhedonic behavior was associated with modulations of the global histone acetylation profile in the hippocampus .
morevoer , specific changes at the promoter and in the expression of the serotonin transporter ( sert ) , critically involved in the etiology of mdd and pharmacological antidepressant treatment were detected .
furthermore , an accompanying reduction in hippocampal levels of histone deacetylase ( hdac ) 1 was observed in mia as compared to control offspring.based on these results we propose a model in which the long - lasting impact of mia on depression - like behavior and associated molecular and cellular aberrations in the offspring is brought about by the modulation of epigenetic processes and consequent enduring changes in gene expression .
these data provide additional insights into the principles underlying the impact of early infectious stress on the development of mdd and may contribute to the development of new targets for antidepressant therapy . |
a 75-year - old man with congestive heart failure and atrial fibrillation was transferred to our hospital for the management of dyspnea and coughing .
he had received posterolateral fusion with pedicle screw fixation of l4 and l5 foramina 5 years previously .
however , he suffered from sustained painful dysesthesia on the right leg and received follow - up decompression surgery for l4 and l5 foramina stenosis 2 days before admission to our hospital , during which the dura was torn and dural plasty was performed .
on the 18 hospital day at the department of internal medicine he complained of nuchal discomfort with headache .
after 3 days , a large egg - sized swelling on the wound site was detected without any symptoms or signs of infection .
opening of the skin and subcutaneous tissue to place a drain resulted in csf flushing .
severe headache developed when he raised his head , which was considerably relieved in the supine position although it did not completely disappear .
brain mri with enhancement showed diffuse nonnodular pachymeningeal enhancement and massive pneumocephalus involving bilateral lateral ventricles , basal cisterns , sylvian cisterns , the left ambient cistern , retrocerebellar cisterns , cerebellar folia , the anterior interhemispheric fissure , and the subarachnoid space ( fig .
a 54-year - old woman visited our hospital because of headache and vomiting without fever .
two days before visiting our hospital , she received an epidural block in the sitting position by a midline approach for the management of back pain with radiating pain to her right leg .
the air technique was applied to confirm that the needle was located in the epidural space , after which she felt that her head was being pulled to the ground for 10 minutes .
bupivacaine ( 0.5% ) mixed with triamcinolone was injected at the level of l5-s1 after checking for the proper position of the needle in the epidural space . the next day she experienced the same headache twice while performing her daily routine . on the third day after the procedure
2 ) . besides focal pneumocephalus , mild subdural hygroma in both anterior frontal areas with slightly prominent adjacent dural enhancement was observed .
brain ct performed 1 month later , mild subdural hygroma remained but the air had disappeared .
a 75-year - old man with congestive heart failure and atrial fibrillation was transferred to our hospital for the management of dyspnea and coughing .
he had received posterolateral fusion with pedicle screw fixation of l4 and l5 foramina 5 years previously .
however , he suffered from sustained painful dysesthesia on the right leg and received follow - up decompression surgery for l4 and l5 foramina stenosis 2 days before admission to our hospital , during which the dura was torn and dural plasty was performed .
on the 18 hospital day at the department of internal medicine he complained of nuchal discomfort with headache .
after 3 days , a large egg - sized swelling on the wound site was detected without any symptoms or signs of infection .
opening of the skin and subcutaneous tissue to place a drain resulted in csf flushing .
severe headache developed when he raised his head , which was considerably relieved in the supine position although it did not completely disappear .
brain mri with enhancement showed diffuse nonnodular pachymeningeal enhancement and massive pneumocephalus involving bilateral lateral ventricles , basal cisterns , sylvian cisterns , the left ambient cistern , retrocerebellar cisterns , cerebellar folia , the anterior interhemispheric fissure , and the subarachnoid space ( fig .
a 54-year - old woman visited our hospital because of headache and vomiting without fever .
two days before visiting our hospital , she received an epidural block in the sitting position by a midline approach for the management of back pain with radiating pain to her right leg .
the air technique was applied to confirm that the needle was located in the epidural space , after which she felt that her head was being pulled to the ground for 10 minutes .
bupivacaine ( 0.5% ) mixed with triamcinolone was injected at the level of l5-s1 after checking for the proper position of the needle in the epidural space . the next day she experienced the same headache twice while performing her daily routine . on the third day after the procedure
besides focal pneumocephalus , mild subdural hygroma in both anterior frontal areas with slightly prominent adjacent dural enhancement was observed .
brain ct performed 1 month later , mild subdural hygroma remained but the air had disappeared .
pneumocephalus is defined as the presence of air within the cranial cavity and can occur after trauma , spinal surgery , craniofacial surgery , lumbar puncture , epidural steroid injections , gas - forming bacterial meningitis , valsalva 's maneuver , subarachnoid - pleural fistulae , and osteoma.1,4 - 10 in our first case , the ' inverted soda - bottle mechanism ' could have been responsible for the pneumocephalus 4,5 - when a bottle containing soda is inverted , air rushes in to equilibrate the pressure differential as soda pours out .
similarly , as csf flows out of the subarachnoid space through a dural arachnoid tear , a negative pressure is created within the subarachnoid space and the pressure differential results in air being drawn from the atmosphere to the lower pressure intracranial space .
this air moves along csf pathway - the subarachnoid space , cisterns ( enlargements of subarachnoid space ) , and the ventricular system - via two foramina of luschka and the foramen of magendie . in our second case
there was no massive csf leakage , so the injection of air while attempting to identify the epidural space via the loss - of - resistance - to - air technique might have been the cause of pneumocephalus , as reported in other cases.6,9 - 11 such a loss - of - resistance - to - air technique is used to perform epidural block to locate the epidural space . during spinal tapping ,
resistance to the needle advancement after skin penetration is first encountered at the ligamentum flavum , and then the needle containing air arrives at the epidural space with a negative pressure ( mean of - 7 cm of water ) , where air aspiration occurs . since the dura is closely attached to the arachnoid , dural injury would rarely happen without damage to the arachnoid , and accidental dural puncture associated with the loss - of - resistance - to - air technique could cause pneumocephalus . whilst brain ct is a well - known diagnostic tool for detecting as little as 0.55 ml of intracranial air , gradient echo images are more sensitive .
in fact , in our second case , brain ct was performed 1 day before brain mri . among brain ct ,
t2-weighted , and gradient echo mri images in our patients , the last showed more - exaggerated pneumocephalus because of a paramagnetic effect of the air ( fig .
2 ) . therefore , in cases of orthostatic headache , it is preferable to perform gradient echo images in order to facilitate the detection of pneumocephalus .
follow - up brain ct performed 1 month later revealed that the air had been absorbed but mild subdural fluid remained .
intracranial air tends to resolve spontaneously with rehydration , normalization of the co2 level , n2o resorption , and replacement of csf.5 neither of our two patients showed cerebellar tonsillar descent , descent of the optic chiasm , reduction in the prepontine space , or crowding of the posterior fossa on brain images , instead showing pneumocephalus and good prognoses .
if the headache was relieved entirely by lying supine , it was identified as purely postdural puncture headache ; however , if it was unchanged by position , it was diagnosed as purely resulting from intrathecal air.2 other studies have similarly found that pneumocephalus caused a headache that was aggravated by any motion and was not relieved with lying down.1,9 however , our cases showed typical orthostatic headache despite the small degree of pneumocephalus , or more severe headache if a patient intended to raise his head , which was considerably relieved in the supine position .
we have been concerned about the existence of posterior fossa crowding or subdural hematoma in patients complaining of orthostatic headache , which indicates the need for surgical intervention or a poor outcome.12,13 when presented with cases of orthostatic headache , clinicians should keep in mind not only posterior fossa crowding and subdural hematoma but also pneumocephalus . | cerebrospinal fluid ( csf ) leak or shunt overdrainage is a well - known cause of orthostatic headaches and low csf pressures .
we report two cases of orthostatic headache with pneumocephalus on brain imaging .
the orthostatic headache developed after drainage of spinal operation site and epidural block .
brain mri revealed characteristic findings of csf hypovolemia including pachymeningeal enhancement and mild subdural fluid collections .
air was also observed in the ventricular or subarachnoid space in both patients , which might enter the subarachnoid or ventricular space during a procedure via the pressure gradient or an injection . |
pancreatic ductal adenocarcinoma ( pdac ) is a dismal disease with a 5-year survival rate of < 7%.1 despite tremendous efforts in pdac research and therapeutic development , no significant improvement in survival has been achieved within the last decades .
research efforts in pdac have traditionally focused on genetic alterations underlying malignant transformation , carcinogenesis and tumour progression .
early studies on these genetic abnormalities defined common mechanisms of oncogenesis in pdac , such as activating mutations of kras or inactivation of the tumour suppressor genes tp53 , dpc4 or cdkn2a.2 in addition to these well - characterised driver mutations , a plethora of diverse genetic events occurs in each pancreatic tumour , characterising pdac as one of the most heterogeneous malignant diseases.1
3 these studies led to the testing of targeted therapies , which have been evaluated in preclinical and clinical settings as monotherapies or in combination with standard chemotherapy.4
5 while small subgroups of patients with pdac show responsiveness towards selected therapeutic regimes , the majority of patients with pdac is refractory to these treatments a priori or rapidly acquires therapeutic resistance .
drug resistance in pdac is mediated by pronounced plasticity enabling pdac cells to switch between phenotypic states and to select for cellular clones that eventually evade therapy.6 importantly , apart from the restrictive contribution of genetic alterations , the acquisition of a drug - tolerant phenotype is frequently largely reversible .
indeed , the dynamic character of cell plasticity and drug resistance suggests the involvement of epigenetic regulation in controlling phenotypic heterogeneity in pdac.7 the term
epigenetics describes processes that comprise non - genetic , heritable information through alterations that do not change the dna sequence8 and refers to mechanisms involving dna - methylation , post - transcriptional control of gene expression via non - coding rnas as well as modifications and remodelling of chromatin .
in addition to its functions to package dna into a cell , its crucial involvement in mitosis and prevention of dna damage , chromatin significantly impacts on the transcriptional activity of a gene .
the nucleosome constitutes the functional subunit of chromatin and consists of approximately 147 bp of dna wrapped around an octameric structure composed of two histones each of h2a , h2b , h3 and h4.9 regulation of chromatin conformation is facilitated through dna methylation , chromatin remodelling or histone modifications , such as acetylation , methylation , ubiquitination and phosphorylation.8 these post - translational modifications alter chromatin architecture by non - covalent interactions within and between nucleosomes , resulting in changes of nucleosome structure and accessibility of the transcription machinery.8 the major effectors of post - translational histone modifications are chromatin - modifying enzymes that either add ( writers ) or remove ( erasers ) modifications or factors that recognise specific histone modifications or combinations of modifications ( readers ) ( figure 1 ) .
defects in these chromatin modulating proteins can have profound effects on vital cellular processes and hence contribute to development and progression of numerous diseases including cancer.10 consequently , several recent preclinical studies investigated the impact of epigenetic alterations in diverse cancer models and emphasised the significance of epigenetics in malignant transformation and tumour progression in haematological malignancies and solid tumours including pdac.1
11 importantly , in contrast to genetic defects , epigenetic alterations are reversible and therefore represent bona fide targets for novel cancer therapies .
not surprisingly , first clinical trials aiming at altered epigenetic signalling in pdac are underway .
furthermore , epigenetic alterations are increasingly being recognised for their predictive value in molecular tumour stratification in many cancer entities and thus extend the scientific and translational relevance of epigenetics in this particular tumour entity .
the switch between condensed and transcriptional inactive heterochromatin ( left panel ) and open , accessible euchromatin ( right panel ) is controlled by chromatin regulators that establish ( writers ) , maintain ( readers ) or remove ( erasers ) post - translational modifications on the lysine residues of histone tails .
exemplary chromatin regulators are illustrated to show their impact on chromatin conformation and gene transcription .
all inhibitors depicted in the blue boxes are evaluated in clinical trials in pancreatic ductal adenocarcinoma ( pdac ) .
ac , acetylation ; bet , family of bromodomain and external terminal proteins ; hdac , histone deacetylase ; h3 , histone 3 ; kdm6 , lysine demethylase 6 ; k27 , lysine 27 ; me3 , 3 methyl groups ; prc1/2 , polycomb repressor complex 1/2 ; swi / snf , switch / sucrose non - fermentable chromatin complex . in this review ,
we summarise recent advances in our understanding of altered chromatin regulation in pdac development and progression , and critically discuss ongoing initiatives to tackle epigenetic dysregulation in pdac disease .
moreover , we highlight the potential of epigenetic approaches in therapeutic pdac stratification strategies with a particular focus on chromatin - associated mechanisms ( box 1 ) .
box 1 inventory of epigenetic therapy in pancreatic cancer treatmenta plethora of phase i / ii clinical trials evaluate epigenetic therapies in pancreatic ductal adenocarcinoma ( pdac)targeting chromatin dysregulation in pdac can overcome cell plasticity and primary or secondary therapeutic resistancea hitherto underestimated vulnerability towards inhibitors of chromatin regulatory proteins exists in pdacmonotherapies using epigenetic drugs have been shown to be not beneficial , but the pharmaceutical targeting of epigenetic modifications can significantly alter the susceptibility of pdac towards standard chemotherapycombination of drugs targeting diverse chromatin regulators ( eg , combined inhibitors of bet proteins / histone deacetylase inhibitors ) to date represents the most promising concept for epigenetic therapies in pdac
box 2 essential aspects that need to be considered to increase the potential of epigenetics - based therapeutic approaches in pdacmolecular stratification is inevitable to perform therapeutic response prediction in pdac and thus to alleviate therapy decision making in pdacan intensified investigation of synthetic lethal interactions is essential to understand how epigenetic alterations influence each other and how they interfere with standard therapyalterations in the epigenetic landscape can be used to define certain pdac subtypes with distinct response towards standard therapythe elucidation of context - specific dependencies that facilitate maximal exhaustion of the therapeutic and predictive potential of epigenetic - based mechanisms in pdac will significantly determine the success of the epigenetic translational pdac research a plethora of phase i / ii clinical trials evaluate epigenetic therapies in pancreatic ductal adenocarcinoma ( pdac )
targeting chromatin dysregulation in pdac can overcome cell plasticity and primary or secondary therapeutic resistance a hitherto underestimated vulnerability towards inhibitors of chromatin regulatory proteins exists in pdac monotherapies using epigenetic drugs have been shown to be not beneficial , but the pharmaceutical targeting of epigenetic modifications can significantly alter the susceptibility of pdac towards standard chemotherapy combination of drugs targeting diverse chromatin regulators ( eg , combined inhibitors of bet proteins / histone deacetylase inhibitors ) to date represents the most promising concept for epigenetic therapies in pdac molecular stratification is inevitable to perform therapeutic response prediction in pdac and thus to alleviate therapy decision making in pdac an intensified investigation of synthetic lethal interactions is essential to understand how epigenetic alterations influence each other and how they interfere with standard therapy alterations in the epigenetic landscape can be used to define certain pdac subtypes with distinct response towards standard therapy the elucidation of context - specific dependencies that facilitate maximal exhaustion of the therapeutic and predictive potential of epigenetic - based mechanisms in pdac will significantly determine the success of the epigenetic translational pdac research
acetylation and deacetylation of lysine residues within histone tails represents a crucial mechanism within a plethora of epigenetic regulatory mechanisms controlling gene expression.10 while histone acetylation mediated by histone acetyltransferases ( hats ) , for example , creb - binding protein ( cbp ) , p300 and pcaf is associated with accessible chromatin and transcriptional activation , deacetylation by different groups of histone deacetylases ( hdacs ) is responsible for repression of gene transcription ( figure 1 ) .
histone acetylation and deacetylation levels are tightly controlled by antagonistic activities of hats and hdacs and hence , unbalanced enzyme activation in one way or the other can foster malignant transformation and tumour progression.12 hats control gene expression by catalysing acetylation of histones and non - histone proteins . specifically , acetylation neutralises the positive charge on the amino group of specific lysine residues , thus weakening the dna - chromatin complex and creating an open chromatin configuration.13 the p300 protein belongs to the best - studied hats and represents a ubiquitously expressed global transcriptional coactivator with critical involvement in a wide variety of cellular mechanisms.14 compared with hdacs , the contribution of hats to pancreatic cancer formation and progression is multifaceted and highly dependent on the cellular context and the selection of regulated target genes.12 while certain studies designate a tumour - promoting function of p300 in pdac , for example , by transcriptional activation of the c - myc promoter,15 other reports describing p300 as a metastasis repressive protein16 as well as the frequent occurrence of loss of function mutations in the ep300 gene in pdac cell lines14 argue for tumour - suppressive hats functions in pdac . due to the contradictory preclinical findings as well as
the unavailability of highly specific hat inhibitors , little progress has been made in evaluating the potential utility of hat inhibition for the treatment of patients with pdac .
the natural turmeric - derived polyphenol compound curcumin represents a potent inhibitor of p300 hat activity.14 a number of preclinical data have demonstrated antitumourigenic effects of curcumin in pdac using in vitro and in vivo systems.1719 these findings combined with a minimal toxicity profile led to the initiation of a few clinical trials to investigate the safety and efficacy of curcumin in pdac therapy . the first - in - patient study performed with the natural compound tested the efficiency and feasibility of curcumin application in combination with gemcitabine in chemotherapy - nave patients with advanced pdac ( nct00192842 )
( compare tables 2 and 3).20 in contrast to the following trials , the daily oral dose of 8 g caused severe and intractable abdominal pain , indicating an increased gi toxicity of the drug when applied together with gemcitabine.21 dhillon et al conducted a subsequent monotherapy trial with curcumin in patients with pdac ( nct00094445 ) . in a phase ii setting , pretreated or untreated patients received 8 g curcumin daily , which was well tolerated and , despite its limited bioavailability , showed biological activity in some patients with pdac with stable disease and a brief , but remarkable response ( 73% reduction of liver metastasis size ) as the best outcome.2123 another group performed two clinical trials with curcumin and a nanoparticle - based curcumin ( theracurmin ) . in a phase
i / ii study , patients who became resistant to gemcitabine - based chemotherapy were treated with a combined curcumin / gemcitabine regime.23 no cumulative toxicity from curcumin was observed , but unfortunately , no patient experienced a complete or partial response.23 the described improvement of quality - of - life scores following theracurmin administration needs to be confirmed in a randomised placebo - controlled trial.21 overall , the clinical trials evaluating curcumin in pdac therapy reflect the conflicting results obtained in preclinical studies . although high p300 specificity of curcumin has been reported in vitro,14 it remains unclear whether the activity of the drug is limited to acetyltransferase inhibition .
careful preclinical investigations are required to understand the involvement of p300 in tumour - promoting functions in pdac . if further evidence were to support a definitive function of hats as oncogenic drivers in subgroups of pdac , more specific and potent inhibitors would need to be developed to increase the chances of antitumourigenic activity of hat blockade .
hdac proteins counteract hat activity and have been extensively described as significant drivers of transformation and tumour progression in multiple tissues , including the pancreas .
hyperactivity of hdac proteins can foster proliferation and impair cell death regulation in pancreatic cancer2426 and hdac - mediated transcriptional control is associated with the regulation of epithelial - mesenchymal transition ( emt ) programmes in pdac cells ( table 1),2730 thereby contributing to pdac invasion and metastasis . based on their homology with yeast deacetylases ,
their subcellular localisation and diverse functions , hdac proteins are grouped into three different classes.31 as a result of the frequently observed dysregulation of hdac family members in cancer,32
33 and prompted by the finding that hdacs control various key oncogenic features of cancer cells,34 inhibition of hdac activity has been evaluated as a therapeutic strategy to restore the balance of histone acetylation and to subsequently interfere with hdac target gene expression .
several natural as well as synthetic compounds that inhibit hdac activity are now available.35
36 hdac inhibitors ( hdaci ) have been identified which either target all hdac family members ( pan - hdaci ) or selectively interfere with subgroups of hdac isoforms , thus facilitating a more specific manipulation of particular oncogenic hdac functions ( figure 2).12
31 several hdaci have been investigated in clinical trials , where they have shown beneficial effects in selected haematological malignancies and solid tumour entities.34 three hdaci , vorinostat ( zolinza ) , romidepsin ( istodax ) and panobinostat ( farydak ) have reached approval by the us food and drug administration ( fda ) or by the european medicines agency for the treatment of cutaneous t - cell lymphoma ( vorinostat and romidepsin ) , peripheral t - cell lymphoma ( romidepsin ) and multiple myeloma ( vorinostat and panobinostat).37 exemplary hdac targets in cancer emt , epithelial - mesenchymal transition .
histone deacetylase ( hdac ) classes and their inhibitors . according to their structural and functional qualities ,
class iii deacetylases ( silent mating type information regulation two ( sirt ) proteins ) are not depicted here .
based on the oncogenic activity of hdacs in pdac , several clinical trials were initiated to evaluate the safety and efficacy of hdaci in patients with pdac ( tables 2 and 3 ) . while hdaci monotherapy showed clinical activity in haematological malignancies , results have largely been disappointing in most solid tumours including pdac.34 consequently , recent clinical trials investigating hdaci in pdac focus on combined approaches of hdaci with small - molecule inhibitors or chemotherapeutic agents . in fact
, three clinical trials are currently evaluating hdac inhibition in combination with gemcitabine ( nct00379639 , nct00372437 , nct00004861 ) . while monotherapy with mocetinostat ( mgcd0103 ) stabilised tumour disease at best in some cases,38 it was significantly more active in combination with gemcitabine , as described in a recent phase i / ii study on advanced solid tumours ( nct00372437 ) .
among 14 evaluable phase i patients , 2 out of 5 patients with pdac showed partial response with tumour shrinking and 1 patient had stable disease ( american society of clinical oncology meeting 2008 , abstract 4625 ) .
in contrast to these results that suggest synergism of the gemcitabine / hdaci combination in patients with pdac,39 the majority of studies revealed restricted effects in a limited number of patients with distinct histological pdac subgroups40
41 or even characterised combination with hdaci to be inferior to gemcitabine monotherapy in this tumour entity ( nct00004861).42 inhibitors of epigenetic regulators validated in clinical trials in pancreatic cancer ( terminated , completed trials and active , but not recruiting clinical trails ) * estimated enrolment .
bet , bromodomain and extraterminal ; fu , fluorouracil ; mos , medium overall survival ; mtd , maximum tolerated dose ; nsclc , non - small cell lung cancer ; pdac , pancreatic ductal adenocarcinoma ; pfs , progression - free survival ; vpa , valproate . inhibitors of epigenetic regulators validated in clinical trials in pancreatic cancer ( recruiting trials ) * estimated enrolment .
fifty - five per cent disease control rate in solid tumours , responses have been restricted to smarcb1-mutated and smarca4-mutated tumours .
bet , bromodomain and extraterminal ; cll , chronic lymphocytic leukemia ; mtd , maximum tolerated dose ; os , overall survival ; pdac , pancreatic ductal adenocarcinoma ; pfs , progression - free survival . as an alternative approach to chemotherapeutic agents ,
several trials have been conducted to evaluate the combination of hdaci and targeted therapies in pdac treatment .
unfortunately , many hdaci combinatory treatment regimens with strong and promising mechanistic and functional synergism in preclinical pdac models failed in first - in - patient studies , thus reflecting the difficulties of translating these findings into the clinical setting ( eg , nct00667082 , nct01056601).43 nevertheless , a plethora of preclinical data on synthetic lethal interactions exist in the context of hdaci that can be used to optimise the potential of hdac inhibition in pdac treatment . for instance , a combinatory treatment of hdaci with ly294002-mediated phosphoinositide 3-kinase ( pi3-kinase ) inhibition has recently been reported to induce apoptosis in renal cancer cells44 and in a xenograft model of endometrial cancer.45 these findings might be of particular interest for pdac therapy , as dysregulation of pi3-kinase activity occurs in subgroups of pdac46 and might therefore represent an interesting target for synthetic - lethal approaches in the context of hdac inhibition . moreover , one of the neoadjuvant clinical trials investigating the efficiency of epigenetic drugs as a therapeutic option in pdac treatment combines vorinostat - mediated hdaci with standard therapy ( gemcitabine plus nab - paclitaxel or gemcitabine plus radiation ) and sorafenib in patients with stage i - iii pdac ( nct02349867 ) .
the combination of hdaci with sorafenib - mediated tyrosine - proteinase inhibition has been reported to show additive effects in preclinical hepatocellular carcinoma ( hcc ) models.47 until today , the mechanism of the reported synergistic or additive effects of combined hdac inhibition and tyrosine protein kinase inhibition remains elusive .
nevertheless , the fact that erlotinib - resistant glioblastoma cells could be resensitised for tyrosine kinase inhibition upon blockade of hdac activity48 and preclinical data on a vorinostat - driven overcoming of erlotinib resistance in pdac cells,49 suggests that hdaci might represent a promising treatment option in combination with erlotinib - mediated inhibition of epidermal growth factor receptor ( egfr ) signalling in patients with pdac .
however , clinical trials investigating combined egfr inhibition / hdac inhibition are currently limited to glioblastoma multiforme ( nct01110876 ) , lung cancer ( eg , nct00251589 ) and head and neck tumours ( nct00738751 ) .
overall , preclinical and clinical data on hdaci as a therapeutic strategy in pdac treatment are disappointing . to improve the potential of hdaci in pdac treatment , preclinical studies and clinical trials need to ( 1 ) systematically dissect the impact of the different hdac proteins on pdac progression in order to clarify which hdac classes represent preferable targets for
hdaci and ( 2 ) should concentrate on the identification of predictive markers that allow therapeutic stratification of patients with pdac that might benefit from hdac inhibition .
one such surrogate is the multiubiquitin chain receptor protein rad23b , which has been recently characterised as a determinant for hdaci - induced apoptosis and is highly expressed in cutaneous t - cell lymphoma , a tumour which responds favourably towards hdaci - based therapy.50 these results suggest that therapy response prediction to hdaci is feasible , thus potentially opening new avenues to better translate hdac inhibition strategies into the clinic .
moreover , future translational studies on hdaci need to extend the application of hdaci in combination with established and novel drugs in order to increase the potential of hdac blockade in pdac treatment . as indicated in the following sections of this review , the antitumourigenic potential of hdaci is highly dependent on the molecular context of the tumour and
can be significantly enhanced when combined with the right therapeutic agents ( box 2 ) .
while acetylation levels are regulated by hats ( writers ) and hdacs ( erasers ) , acetylation marks are recognised by bromodomains , which can be found in chromatin - associated and transcription - associated proteins that drive the formation of protein complexes that mediate active transcription.13 the bromodomain and extraterminal ( bet ) domain family of proteins ( brd2 , brd3 , brd4 and brdt ) constitutes the probably best characterised group of chromatin reader proteins in cancer.51 by binding to acetylated chromatin via their tandem - bromodomains , bet proteins regulate the transcription of specific subsets of genes , including those that promote cell - cycle progression and the evasion of apoptosis.52 furthermore , bet proteins function as critical mediators of transcriptional elongation by promoting the recruitment and activation of the positive transcription elongation factor - b complex ( p - tefb).53 based on the importance of bet proteins in controlling important numerous cancer - relevant genes such as c - myc , bcl2 , fosl154 and others , as well as the activity of the emt - related transcription factor twist1,55 several potent and selective inhibitors of bet proteins ( beti ) have been developed.13 the apparent selectivity of beti for tumour cells appears to originate from a particular dependence of many tumour - relevant genes ( notably c - myc ) on the recruitment of brd4 to larger , composite distal regulatory regions frequently referred to as
super enhancers. this requirement is gene - specific and context - specific , where even for c - myc different tumour types are dependent upon different brd4-dependent enhancer regions.56
57 one of the founding beti molecules was jq1 , which was initially described to be a potent suppressor of nut midline carcinoma,53 b - cell lineage malignancies58 and other tumour entities.59 in a subcutaneous xenograft model of pdac , garcia et al60 observed a remarkable decrease of tumour size upon jq1 administration , indicating antitumourigenic activity in this tumour entity .
moreover , administration of jq1 blocked acinar - to - ductal metaplasia in the pancreas , a key event in pdac initiation , decreased formation of panin lesions as well as pdac cell proliferation61 and attenuated the progenitor phenotype of dedifferentiated pdac in favour of enhanced cellular maturity.62 a more recent study confirmed a beneficial effect of beti in mouse pdac xenograft studies and suggested a specific importance of bet proteins in controlling the activity of gli transcription factors downstream of oncogenic hedgehog signalling.63 these data strongly support a role of the bet proteins as important drivers of both pdac development and progression and clinical trials using different beti agents have been initiated with great hope and expectation ( nct01987362 , nct02259114 , nct02369029 ) .
however , first results of clinical studies testing monotherapeutic applications of beti in pdac are discouraging : a randomised phase ii trial in patients with pdac with unresectable tumours using bi-2536 , an inhibitor of the polo - like kinase that has been shown to block brd4 activity in vitro ( nct00710710 ) , yielded poor response rates and the second stage of the study was not even initiated.13 since it is unclear whether the dose of bi-2536 used in this study is sufficient to adequately inhibit bet protein activity in vivo , this result does not exclude the biological activity of beti in pdac .
however , a recent preclinical approach in a genetically engineered mouse model of pdac combining jq1-mediated bet inhibition with gemcitabine also did not show a benefit in survival , when compared with single applications of the inhibitors,61 suggesting that neither beti monotherapies nor beti / chemotherapy combinations may represent beneficial therapeutic strategies in pdac treatment .
in contrast to chemotherapy - based combinatory anticancer therapies , bet inhibitors applied together with non - chemotherapeutic agents have recently attracted much attention in various preclinical tumour models . surprisingly ,
despite apparent opposing mechanistic effects , bet inhibitors seem to synergise with hdaci in defined tumour entities .
for instance , myc - induced murine lymphoma mouse models are highly responsive to bet inhibition , while beti application sensitised myc - overexpressing lymphoma cells to hdac inhibition.52 similar results have been reported in acute myelogenous leukaemia ( aml ) , where panobinostat - mediated hdac inhibition synergised with jq1 to induce apoptosis in human aml cells.64 most importantly , this mechanism of synergism has recently been confirmed in pdac , where therapeutic co - application of jq1 and the fda - approved hdaci vorinostat potently suppressed tumour growth in advanced pdac.61 strikingly , pdac bearing kras;p53 mice , an established genetically engineered mouse model of pdac,65 displayed a significantly reduced tumour volume upon combined jq1 and vorinostat treatment .
importantly , mice that received the combination of both epigenetic drugs did not show any signs of tumour relapse , such as regularly seen with other therapies and died as a consequence of neurological symptoms rather than tumour burden.61 this strongly indicates that beti / vorinostat cotreatment may be sufficient to overcome therapeutic resistance in pdac .
a similar effect could be observed in a second transgenic pdac model that is driven by deletion of the cdkn2a gene locus in combination with oncogenic kras activation , a genetic event that regularly occurs in pdac1 and in experimental lung cancer models , arguing that the antitumourigenic activity of beti / hdaci treatment is an attractive strategy in otherwise highly resistant ras - driven cancers.61 several mechanisms have been proposed to explain the antitumour activity of beti in general and of combined beti / hdaci efficiency in particular .
while several reports suggest transcriptional downregulation of oncogenic c - myc upon bet inhibition as the crucial mechanism of antitumour activity ( reviewed in),66 other studies strongly support the notion that beti activity is frequently independent of effects on c - myc expression.52
57 recently , jq1 has been demonstrated to suppress tumour cell growth specifically in colon cancers that are characterised by a cpg island methylator phenotype ( cimp ) , one of the main subtypes of colorectal cancer.57 genome - wide analyses led to identification of a specific brd4-bound
super enhancer in cimp colon cancers , which serves to promote the expression of the long non - coding rna colon cancer - associated transcript 1 ( ccat1 ) and can be utilized as a marker for sensitivity to beti .
these data characterise ccat1 as a potential clinical marker that predicts beti responsiveness and might have a strong impact on the selection of patients who could benefit from beti.57 recent studies have also uncovered resistance mechanisms against beti,67 demonstrating that their effective clinical application requires additional information about their precise , context - specific molecular mechanisms and biomarkers both predictive for and indicative of their biological activity .
the unexpected synergism of hdaci and beti in cancer therapy prompted several groups to dissect the mechanisms that underlie this phenomenon .
mazur et al61 proposed that de - repression of p57 upon combined jq1 and vorinostat treatment is responsible for cell death induction upon treatment .
further mechanistic evidence comprises synergistic attenuation of c - myc and bcl-2 expression.64 in their lymphoma model , bhadury et al identified gene sets that are similarly induced upon isolated bet or hdac inhibition . to explain this phenomenon , the authors used a model which has been proposed for beti in hiv , inflammation and arteriosclerosis .
specifically , they propose that p - tefb , which is inactivated by a complex containing hexim1 and the 7sk snrnp in untreated cells , is transiently released from this complex following hdac or bet inhibition , thus enabling p - tefb recruitment to and subsequent transcriptional induction of a defined set of alternative target genes.52 a more recent study demonstrated that hdaci treatment blocks transcriptional elongation and results in a re - distribution of brd4 across the genome.68 based on these findings , it is conceivable that beti synergise with hdaci by targeting non - redundant regulatory mechanisms controlling transcriptional elongation of a specific subset of genes relevant for cancer progression .
however , further studies will be necessary to definitively address the complex mechanisms by which bet and hdac inhibition synergise in cancer treatment .
a beti - similar effect on the transcriptional activity in cancer cells might be achieved by the cyclin - dependent kinase ( cdk ) inhibitor dinaciclib , which also displays high potency against cdk9 .
bet bromodomains recruit cdk9 , the catalytic subunit of p - tefb , which catalyses the phosphorylation of serine 2 in the heptapeptide repeat sequence within the c - terminal domain of rna polymerase ii , a post - translational modification associated with transcriptional elongation.66 importantly , dinaciclib has been reported to abrogate pdac growth and progression in vitro and in vivo69
70 and is currently being evaluated for its therapeutic potential in patients with pdac in combination with the poly [ adp - ribose ] polymerase ( parp ) inhibitor veliparib ( nct01434316 ) and mk2206-mediated akt inhibition ( nct01783171 ) .
interestingly , cdk9 and bet inhibitors were also shown to function synergistically.71 thus , it will be necessary to analyse overlapping and diverse functions of cdk9 inhibition and bet inhibition in cancer to determine in which context the combination of different therapeutic strategies may optimally work to have synergistic or additive effects in pdac treatment .
prospective clinical trials need to consider the promising effects of combined hdac and bet targeting in preclinical pdac models and have to validate whether this therapeutic strategy can be translated into the clinic .
monomethylation , dimethylation and trimethylation of histones elicit distinct changes in chromatin conformation and transcriptional activity dependent on the particular location and context of the modified lysine residues.10 for example , trimethylation of histone 3 lysine 4 by trithorax group proteins is strongly associated with active gene expression , while the trimethylation of lysine 27 ( h3k27me3 ) induces gene silencing.72 the histone mark h3k27me3 is catalysed and maintained by the polycomb repressor complex-2 ( prc2).10 the prc2 constitutes an approximately 600 kda complex with four subunits : suz12 , embryonic ectoderm development ( eed ) , raap46/48 and the catalytic component enhancer of zeste homologue-2 ( ezh2 ) , which mediates h3k27 methylation.7375 physiologically , the polycomb proteins ( pcg ) function as crucial epigenetic repressors of differentiation and are responsible for the maintenance of stem cell capacities.76 importantly , pcg proteins in general and ezh2 in particular are frequently overexpressed in cancer.77 high expression levels of the histone methyltransferase regularly correlate with tumour stage and poor prognosis , while depletion of ezh2 can restrict proliferation and tumour progression.78 the role of prc2 proteins as epigenetic regulators of tumour progression has only recently become a focus in pdac.79 ougolkov et al80 showed nuclear overexpression of ezh2 in pdac cell lines and in 68% of investigated human pdac samples , while the nuclear accumulation of the enzyme was more prevalent in dedifferentiated pdac ( 91% ) .
accordingly , an inverse expression profile of ezh2 and the epithelial marker protein e - cadherin81 and a robust ezh2-dependent promotion of cancer stem cell self - renewal76 have been demonstrated in pdac , characterising ezh2 as a strong promoter of cancer cell plasticity in the pancreas .
consequently , ezh2 inactivation sensitised pdac cells to chemotherapy in preclinical pdac models.76
80 reports demonstrating a significant longer survival of gemcitabine - treated patients with pdac with low pancreatic ezh2 levels81 emphasise the oncogenic capacities of the histone methyltransferase .
its involvement in a wide range of oncogenic functions in several cancer entities has prompted the development of specific inhibitors of ezh2 activity . with tazemetostat ( epz-6438 ) , cpi-1205 and gsk2816126
three different ezh2 inhibitors are being assessed , for their tolerability and efficiency in clinical trials for haematological and solid malignancies .
the potent inhibitor of ezh2 methyltransferase activity tazemetostat82 is currently being evaluated in a multicentre , open - label phase i / ii study ( nct01897571 ) .
patients with haematological and solid tumours including pdac are enrolled in the phase i arm , while the phase ii portion is restricted to lymphoma patients .
preliminary results for a tazemetostat trial investigating dose escalation and expansion of the drug in b - cell lymphoma and refractory or relapsed solid tumour patients ( nct02601950 ) have been presented at the european society for medical oncology ( esmo ) 's european cancer congress in vienna , austria in september 2015 .
importantly , tazemetostat monotherapy induced a 55% disease control rate in solid tumours , including rhabdoid tumours and epitheloid sarcoma .
it is worth mentioning that the subgroup of responding tumours exhibited inactivating mutations of either smarcb1 ( also known as ini1 or snf5 ) or smarca4 ( also designated as brg1 ) .
both proteins belong to the switch / sucrose non - fermentable chromatin complex ( swi / snf ) chromatin remodelling complex and have been characterised for their tumour - suppressive potential .
intriguingly , mutations of the swi / snf complex can be found in approximately 20% of all human cancers.83 the dependency of antitumour activity of ezh2 inhibition on swi / snf mutations has recently been described in a preclinical approach . in a detailed mechanistic study , kim et al demonstrate that genetic depletion of ezh2 sufficiently blocked proliferation of a wide panel of swi / snf mutation containing cancer cells , while loss of ezh2 had no impact on cells harbouring wild - type expression of swi / snf proteins .
surprisingly , the dependency of swi / snf - mutated cells on prc2 expression did not necessarily always require ezh2 enzymatic activity , but was rather based on the stabilisation of the prc2 complex in the context of ras or raf mutation.78 these data suggest the existence of methyltransferase - independent oncogenic ezh2 functions and indicate that ezh2 inhibitors may not fully repress the oncogenic activity of the enzyme under some contexts , unless they are able to intervene with ezh2 expression or its interaction with the prc2 complex .
although patients with pdac are eligible for the ezh2 inhibitor trials , no data are currently available on the enrolment of patients with pdac into the trials or the efficiency of ezh2 blockade in pdac . nevertheless , since recent whole genome sequencing approaches reported frequent occurrence of swi / snf mutations ( of complex members such as arid1a , arid1b , smarca2 and smarca4 ) in pdac,1
3 beneficial effects of ezh2 inhibition in this subgroup of patients with pdac are worth further investigation .
synthetic lethal interactions between ezh2 inhibition and the disturbance of other epigenetic mechanisms or signalling pathways are not limited to the swi / snf complex , but have been described in other contexts as well .
for example , ezh2 inhibition sensitised colorectal cancer cells to egfr inhibition by the induction of autophagy84 and blockade of ezh2 activity increases the susceptibility of small cell lung cancer with egfr gain - of - function mutations towards topoisomerase ii inhibition.85 moreover , an interesting connection between prc2 integrity and rat sarcoma ( ras ) activity has been recently revealed in malignant peripheral nerve sheath tumours . herein ,
deficiency of the non - catalytic prc2 subunit suz12 or eed has been shown to amplify ras - driven transcription.86 as attenuation of the h3k27me3 mark upon suz12 or eed ablation resulted in an increase of h3k27 acetylation and subsequent recruitment of bromodomain proteins , the authors hypothesised that suz12-deficient tumours might respond to pharmacological bromodomain blockade . indeed , jq1 treatment counteracted activation of ras signalling upon suz12 deficiency by suppressing ras signature genes.86 these preclinical studies indicate that the functional consequences of prc2 inactivation are diverse across tumour entities and underscore that methyltransferase - independent functions of ezh2 should be considered to exhaust the therapeutic potential of prc2 disruption in pdac treatment .
moreover , the experience and knowledge gained from preclinical and clinical studies in the context of ezh2 highlight the utmost importance of molecular stratification approaches as a central component of epigenetically based cancer therapy .
acetylation and deacetylation of lysine residues within histone tails represents a crucial mechanism within a plethora of epigenetic regulatory mechanisms controlling gene expression.10 while histone acetylation mediated by histone acetyltransferases ( hats ) , for example , creb - binding protein ( cbp ) , p300 and pcaf is associated with accessible chromatin and transcriptional activation , deacetylation by different groups of histone deacetylases ( hdacs ) is responsible for repression of gene transcription ( figure 1 ) .
histone acetylation and deacetylation levels are tightly controlled by antagonistic activities of hats and hdacs and hence , unbalanced enzyme activation in one way or the other can foster malignant transformation and tumour progression.12 hats control gene expression by catalysing acetylation of histones and non - histone proteins . specifically , acetylation neutralises the positive charge on the amino group of specific lysine residues , thus weakening the dna - chromatin complex and creating an open chromatin configuration.13 the p300 protein belongs to the best - studied hats and represents a ubiquitously expressed global transcriptional coactivator with critical involvement in a wide variety of cellular mechanisms.14 compared with hdacs , the contribution of hats to pancreatic cancer formation and progression is multifaceted and highly dependent on the cellular context and the selection of regulated target genes.12 while certain studies designate a tumour - promoting function of p300 in pdac , for example , by transcriptional activation of the c - myc promoter,15 other reports describing p300 as a metastasis repressive protein16 as well as the frequent occurrence of loss of function mutations in the ep300 gene in pdac cell lines14 argue for tumour - suppressive hats functions in pdac . due to the contradictory preclinical findings as well as
the unavailability of highly specific hat inhibitors , little progress has been made in evaluating the potential utility of hat inhibition for the treatment of patients with pdac .
the natural turmeric - derived polyphenol compound curcumin represents a potent inhibitor of p300 hat activity.14 a number of preclinical data have demonstrated antitumourigenic effects of curcumin in pdac using in vitro and in vivo systems.1719 these findings combined with a minimal toxicity profile led to the initiation of a few clinical trials to investigate the safety and efficacy of curcumin in pdac therapy . the first - in - patient study performed with the natural compound tested the efficiency and feasibility of curcumin application in combination with gemcitabine in chemotherapy - nave patients with advanced pdac ( nct00192842 )
( compare tables 2 and 3).20 in contrast to the following trials , the daily oral dose of 8 g caused severe and intractable abdominal pain , indicating an increased gi toxicity of the drug when applied together with gemcitabine.21 dhillon et al conducted a subsequent monotherapy trial with curcumin in patients with pdac ( nct00094445 ) . in a phase ii setting , pretreated or untreated patients received 8 g curcumin daily , which was well tolerated and , despite its limited bioavailability , showed biological activity in some patients with pdac with stable disease and a brief , but remarkable response ( 73% reduction of liver metastasis size ) as the best outcome.2123 another group performed two clinical trials with curcumin and a nanoparticle - based curcumin ( theracurmin ) . in a phase
i / ii study , patients who became resistant to gemcitabine - based chemotherapy were treated with a combined curcumin / gemcitabine regime.23 no cumulative toxicity from curcumin was observed , but unfortunately , no patient experienced a complete or partial response.23 the described improvement of quality - of - life scores following theracurmin administration needs to be confirmed in a randomised placebo - controlled trial.21 overall , the clinical trials evaluating curcumin in pdac therapy reflect the conflicting results obtained in preclinical studies . although high p300 specificity of curcumin has been reported in vitro,14 it remains unclear whether the activity of the drug is limited to acetyltransferase inhibition .
careful preclinical investigations are required to understand the involvement of p300 in tumour - promoting functions in pdac . if further evidence were to support a definitive function of hats as oncogenic drivers in subgroups of pdac , more specific and potent inhibitors would need to be developed to increase the chances of antitumourigenic activity of hat blockade .
hdac proteins counteract hat activity and have been extensively described as significant drivers of transformation and tumour progression in multiple tissues , including the pancreas .
hyperactivity of hdac proteins can foster proliferation and impair cell death regulation in pancreatic cancer2426 and hdac - mediated transcriptional control is associated with the regulation of epithelial - mesenchymal transition ( emt ) programmes in pdac cells ( table 1),2730 thereby contributing to pdac invasion and metastasis . based on their homology with yeast deacetylases ,
their subcellular localisation and diverse functions , hdac proteins are grouped into three different classes.31 as a result of the frequently observed dysregulation of hdac family members in cancer,32
33 and prompted by the finding that hdacs control various key oncogenic features of cancer cells,34 inhibition of hdac activity has been evaluated as a therapeutic strategy to restore the balance of histone acetylation and to subsequently interfere with hdac target gene expression .
several natural as well as synthetic compounds that inhibit hdac activity are now available.35
36 hdac inhibitors ( hdaci ) have been identified which either target all hdac family members ( pan - hdaci ) or selectively interfere with subgroups of hdac isoforms , thus facilitating a more specific manipulation of particular oncogenic hdac functions ( figure 2).12
31 several hdaci have been investigated in clinical trials , where they have shown beneficial effects in selected haematological malignancies and solid tumour entities.34 three hdaci , vorinostat ( zolinza ) , romidepsin ( istodax ) and panobinostat ( farydak ) have reached approval by the us food and drug administration ( fda ) or by the european medicines agency for the treatment of cutaneous t - cell lymphoma ( vorinostat and romidepsin ) , peripheral t - cell lymphoma ( romidepsin ) and multiple myeloma ( vorinostat and panobinostat).37 exemplary hdac targets in cancer emt , epithelial - mesenchymal transition .
histone deacetylase ( hdac ) classes and their inhibitors . according to their structural and functional qualities ,
class iii deacetylases ( silent mating type information regulation two ( sirt ) proteins ) are not depicted here .
based on the oncogenic activity of hdacs in pdac , several clinical trials were initiated to evaluate the safety and efficacy of hdaci in patients with pdac ( tables 2 and 3 ) . while hdaci monotherapy showed clinical activity in haematological malignancies , results have largely been disappointing in most solid tumours including pdac.34 consequently , recent clinical trials investigating hdaci in pdac focus on combined approaches of hdaci with small - molecule inhibitors or chemotherapeutic agents . in fact
, three clinical trials are currently evaluating hdac inhibition in combination with gemcitabine ( nct00379639 , nct00372437 , nct00004861 ) . while monotherapy with mocetinostat ( mgcd0103 ) stabilised tumour disease at best in some cases,38 it was significantly more active in combination with gemcitabine , as described in a recent phase i / ii study on advanced solid tumours ( nct00372437 ) .
among 14 evaluable phase i patients , 2 out of 5 patients with pdac showed partial response with tumour shrinking and 1 patient had stable disease ( american society of clinical oncology meeting 2008 , abstract 4625 ) .
in contrast to these results that suggest synergism of the gemcitabine / hdaci combination in patients with pdac,39 the majority of studies revealed restricted effects in a limited number of patients with distinct histological pdac subgroups40
41 or even characterised combination with hdaci to be inferior to gemcitabine monotherapy in this tumour entity ( nct00004861).42 inhibitors of epigenetic regulators validated in clinical trials in pancreatic cancer ( terminated , completed trials and active , but not recruiting clinical trails ) * estimated enrolment .
bet , bromodomain and extraterminal ; fu , fluorouracil ; mos , medium overall survival ; mtd , maximum tolerated dose ; nsclc , non - small cell lung cancer ; pdac , pancreatic ductal adenocarcinoma ; pfs , progression - free survival ; vpa , valproate . inhibitors of epigenetic regulators validated in clinical trials in pancreatic cancer ( recruiting trials ) * estimated enrolment .
fifty - five per cent disease control rate in solid tumours , responses have been restricted to smarcb1-mutated and smarca4-mutated tumours .
bet , bromodomain and extraterminal ; cll , chronic lymphocytic leukemia ; mtd , maximum tolerated dose ; os , overall survival ; pdac , pancreatic ductal adenocarcinoma ; pfs , progression - free survival . as an alternative approach to chemotherapeutic agents ,
several trials have been conducted to evaluate the combination of hdaci and targeted therapies in pdac treatment .
unfortunately , many hdaci combinatory treatment regimens with strong and promising mechanistic and functional synergism in preclinical pdac models failed in first - in - patient studies , thus reflecting the difficulties of translating these findings into the clinical setting ( eg , nct00667082 , nct01056601).43 nevertheless , a plethora of preclinical data on synthetic lethal interactions exist in the context of hdaci that can be used to optimise the potential of hdac inhibition in pdac treatment . for instance , a combinatory treatment of hdaci with ly294002-mediated phosphoinositide 3-kinase ( pi3-kinase ) inhibition has recently been reported to induce apoptosis in renal cancer cells44 and in a xenograft model of endometrial cancer.45 these findings might be of particular interest for pdac therapy , as dysregulation of pi3-kinase activity occurs in subgroups of pdac46 and might therefore represent an interesting target for synthetic - lethal approaches in the context of hdac inhibition . moreover , one of the neoadjuvant clinical trials investigating the efficiency of epigenetic drugs as a therapeutic option in pdac treatment combines vorinostat - mediated hdaci with standard therapy ( gemcitabine plus nab - paclitaxel or gemcitabine plus radiation ) and sorafenib in patients with stage i - iii pdac ( nct02349867 ) .
the combination of hdaci with sorafenib - mediated tyrosine - proteinase inhibition has been reported to show additive effects in preclinical hepatocellular carcinoma ( hcc ) models.47 until today , the mechanism of the reported synergistic or additive effects of combined hdac inhibition and tyrosine protein kinase inhibition remains elusive .
nevertheless , the fact that erlotinib - resistant glioblastoma cells could be resensitised for tyrosine kinase inhibition upon blockade of hdac activity48 and preclinical data on a vorinostat - driven overcoming of erlotinib resistance in pdac cells,49 suggests that hdaci might represent a promising treatment option in combination with erlotinib - mediated inhibition of epidermal growth factor receptor ( egfr ) signalling in patients with pdac .
however , clinical trials investigating combined egfr inhibition / hdac inhibition are currently limited to glioblastoma multiforme ( nct01110876 ) , lung cancer ( eg , nct00251589 ) and head and neck tumours ( nct00738751 ) .
overall , preclinical and clinical data on hdaci as a therapeutic strategy in pdac treatment are disappointing . to improve the potential of hdaci in pdac treatment , preclinical studies and clinical trials need to ( 1 ) systematically dissect the impact of the different hdac proteins on pdac progression in order to clarify which hdac classes represent preferable targets for
hdaci and ( 2 ) should concentrate on the identification of predictive markers that allow therapeutic stratification of patients with pdac that might benefit from hdac inhibition .
one such surrogate is the multiubiquitin chain receptor protein rad23b , which has been recently characterised as a determinant for hdaci - induced apoptosis and is highly expressed in cutaneous t - cell lymphoma , a tumour which responds favourably towards hdaci - based therapy.50 these results suggest that therapy response prediction to hdaci is feasible , thus potentially opening new avenues to better translate hdac inhibition strategies into the clinic .
moreover , future translational studies on hdaci need to extend the application of hdaci in combination with established and novel drugs in order to increase the potential of hdac blockade in pdac treatment . as indicated in the following sections of this review , the antitumourigenic potential of hdaci is highly dependent on the molecular context of the tumour and
can be significantly enhanced when combined with the right therapeutic agents ( box 2 ) .
while acetylation levels are regulated by hats ( writers ) and hdacs ( erasers ) , acetylation marks are recognised by bromodomains , which can be found in chromatin - associated and transcription - associated proteins that drive the formation of protein complexes that mediate active transcription.13 the bromodomain and extraterminal ( bet ) domain family of proteins ( brd2 , brd3 , brd4 and brdt ) constitutes the probably best characterised group of chromatin reader proteins in cancer.51 by binding to acetylated chromatin via their tandem - bromodomains , bet proteins regulate the transcription of specific subsets of genes , including those that promote cell - cycle progression and the evasion of apoptosis.52 furthermore , bet proteins function as critical mediators of transcriptional elongation by promoting the recruitment and activation of the positive transcription elongation factor - b complex ( p - tefb).53 based on the importance of bet proteins in controlling important numerous cancer - relevant genes such as c - myc , bcl2 , fosl154 and others , as well as the activity of the emt - related transcription factor twist1,55 several potent and selective inhibitors of bet proteins ( beti ) have been developed.13 the apparent selectivity of beti for tumour cells appears to originate from a particular dependence of many tumour - relevant genes ( notably c - myc ) on the recruitment of brd4 to larger , composite distal regulatory regions frequently referred to as
super enhancers. this requirement is gene - specific and context - specific , where even for c - myc different tumour types are dependent upon different brd4-dependent enhancer regions.56
57 one of the founding beti molecules was jq1 , which was initially described to be a potent suppressor of nut midline carcinoma,53 b - cell lineage malignancies58 and other tumour entities.59 in a subcutaneous xenograft model of pdac , garcia et al60 observed a remarkable decrease of tumour size upon jq1 administration , indicating antitumourigenic activity in this tumour entity .
moreover , administration of jq1 blocked acinar - to - ductal metaplasia in the pancreas , a key event in pdac initiation , decreased formation of panin lesions as well as pdac cell proliferation61 and attenuated the progenitor phenotype of dedifferentiated pdac in favour of enhanced cellular maturity.62 a more recent study confirmed a beneficial effect of beti in mouse pdac xenograft studies and suggested a specific importance of bet proteins in controlling the activity of gli transcription factors downstream of oncogenic hedgehog signalling.63 these data strongly support a role of the bet proteins as important drivers of both pdac development and progression and clinical trials using different beti agents have been initiated with great hope and expectation ( nct01987362 , nct02259114 , nct02369029 ) .
however , first results of clinical studies testing monotherapeutic applications of beti in pdac are discouraging : a randomised phase ii trial in patients with pdac with unresectable tumours using bi-2536 , an inhibitor of the polo - like kinase that has been shown to block brd4 activity in vitro ( nct00710710 ) , yielded poor response rates and the second stage of the study was not even initiated.13 since it is unclear whether the dose of bi-2536 used in this study is sufficient to adequately inhibit bet protein activity in vivo , this result does not exclude the biological activity of beti in pdac .
however , a recent preclinical approach in a genetically engineered mouse model of pdac combining jq1-mediated bet inhibition with gemcitabine also did not show a benefit in survival , when compared with single applications of the inhibitors,61 suggesting that neither beti monotherapies nor beti / chemotherapy combinations may represent beneficial therapeutic strategies in pdac treatment .
in contrast to chemotherapy - based combinatory anticancer therapies , bet inhibitors applied together with non - chemotherapeutic agents have recently attracted much attention in various preclinical tumour models .
surprisingly , despite apparent opposing mechanistic effects , bet inhibitors seem to synergise with hdaci in defined tumour entities .
for instance , myc - induced murine lymphoma mouse models are highly responsive to bet inhibition , while beti application sensitised myc - overexpressing lymphoma cells to hdac inhibition.52 similar results have been reported in acute myelogenous leukaemia ( aml ) , where panobinostat - mediated hdac inhibition synergised with jq1 to induce apoptosis in human aml cells.64 most importantly , this mechanism of synergism has recently been confirmed in pdac , where therapeutic co - application of jq1 and the fda - approved hdaci vorinostat potently suppressed tumour growth in advanced pdac.61 strikingly , pdac bearing kras;p53 mice , an established genetically engineered mouse model of pdac,65 displayed a significantly reduced tumour volume upon combined jq1 and vorinostat treatment .
importantly , mice that received the combination of both epigenetic drugs did not show any signs of tumour relapse , such as regularly seen with other therapies and died as a consequence of neurological symptoms rather than tumour burden.61 this strongly indicates that beti / vorinostat cotreatment may be sufficient to overcome therapeutic resistance in pdac .
a similar effect could be observed in a second transgenic pdac model that is driven by deletion of the cdkn2a gene locus in combination with oncogenic kras activation , a genetic event that regularly occurs in pdac1 and in experimental lung cancer models , arguing that the antitumourigenic activity of beti / hdaci treatment is an attractive strategy in otherwise highly resistant ras - driven cancers.61 several mechanisms have been proposed to explain the antitumour activity of beti in general and of combined beti / hdaci efficiency in particular .
while several reports suggest transcriptional downregulation of oncogenic c - myc upon bet inhibition as the crucial mechanism of antitumour activity ( reviewed in),66 other studies strongly support the notion that beti activity is frequently independent of effects on c - myc expression.52
57 recently , jq1 has been demonstrated to suppress tumour cell growth specifically in colon cancers that are characterised by a cpg island methylator phenotype ( cimp ) , one of the main subtypes of colorectal cancer.57 genome - wide analyses led to identification of a specific brd4-bound
super enhancer in cimp colon cancers , which serves to promote the expression of the long non - coding rna colon cancer - associated transcript 1 ( ccat1 ) and can be utilized as a marker for sensitivity to beti .
these data characterise ccat1 as a potential clinical marker that predicts beti responsiveness and might have a strong impact on the selection of patients who could benefit from beti.57 recent studies have also uncovered resistance mechanisms against beti,67 demonstrating that their effective clinical application requires additional information about their precise , context - specific molecular mechanisms and biomarkers both predictive for and indicative of their biological activity .
the unexpected synergism of hdaci and beti in cancer therapy prompted several groups to dissect the mechanisms that underlie this phenomenon .
mazur et al61 proposed that de - repression of p57 upon combined jq1 and vorinostat treatment is responsible for cell death induction upon treatment .
further mechanistic evidence comprises synergistic attenuation of c - myc and bcl-2 expression.64 in their lymphoma model , bhadury et al identified gene sets that are similarly induced upon isolated bet or hdac inhibition . to explain this phenomenon , the authors used a model which has been proposed for beti in hiv , inflammation and arteriosclerosis .
specifically , they propose that p - tefb , which is inactivated by a complex containing hexim1 and the 7sk snrnp in untreated cells , is transiently released from this complex following hdac or bet inhibition , thus enabling p - tefb recruitment to and subsequent transcriptional induction of a defined set of alternative target genes.52 a more recent study demonstrated that hdaci treatment blocks transcriptional elongation and results in a re - distribution of brd4 across the genome.68 based on these findings , it is conceivable that beti synergise with hdaci by targeting non - redundant regulatory mechanisms controlling transcriptional elongation of a specific subset of genes relevant for cancer progression .
however , further studies will be necessary to definitively address the complex mechanisms by which bet and hdac inhibition synergise in cancer treatment .
a beti - similar effect on the transcriptional activity in cancer cells might be achieved by the cyclin - dependent kinase ( cdk ) inhibitor dinaciclib , which also displays high potency against cdk9 . bet bromodomains recruit cdk9 , the catalytic subunit of p - tefb , which catalyses the phosphorylation of serine 2 in the heptapeptide repeat sequence within the c - terminal domain of rna polymerase ii , a post - translational modification associated with transcriptional elongation.66 importantly , dinaciclib has been reported to abrogate pdac growth and progression in vitro and in vivo69
70 and is currently being evaluated for its therapeutic potential in patients with pdac in combination with the poly [ adp - ribose ] polymerase ( parp ) inhibitor veliparib ( nct01434316 ) and mk2206-mediated akt inhibition ( nct01783171 ) .
interestingly , cdk9 and bet inhibitors were also shown to function synergistically.71 thus , it will be necessary to analyse overlapping and diverse functions of cdk9 inhibition and bet inhibition in cancer to determine in which context the combination of different therapeutic strategies may optimally work to have synergistic or additive effects in pdac treatment .
prospective clinical trials need to consider the promising effects of combined hdac and bet targeting in preclinical pdac models and have to validate whether this therapeutic strategy can be translated into the clinic .
monomethylation , dimethylation and trimethylation of histones elicit distinct changes in chromatin conformation and transcriptional activity dependent on the particular location and context of the modified lysine residues.10 for example , trimethylation of histone 3 lysine 4 by trithorax group proteins is strongly associated with active gene expression , while the trimethylation of lysine 27 ( h3k27me3 ) induces gene silencing.72 the histone mark h3k27me3 is catalysed and maintained by the polycomb repressor complex-2 ( prc2).10 the prc2 constitutes an approximately 600 kda complex with four subunits : suz12 , embryonic ectoderm development ( eed ) , raap46/48 and the catalytic component enhancer of zeste homologue-2 ( ezh2 ) , which mediates h3k27 methylation.7375 physiologically , the polycomb proteins ( pcg ) function as crucial epigenetic repressors of differentiation and are responsible for the maintenance of stem cell capacities.76 importantly , pcg proteins in general and ezh2 in particular are frequently overexpressed in cancer.77 high expression levels of the histone methyltransferase regularly correlate with tumour stage and poor prognosis , while depletion of ezh2 can restrict proliferation and tumour progression.78 the role of prc2 proteins as epigenetic regulators of tumour progression has only recently become a focus in pdac.79 ougolkov et al80 showed nuclear overexpression of ezh2 in pdac cell lines and in 68% of investigated human pdac samples , while the nuclear accumulation of the enzyme was more prevalent in dedifferentiated pdac ( 91% ) .
accordingly , an inverse expression profile of ezh2 and the epithelial marker protein e - cadherin81 and a robust ezh2-dependent promotion of cancer stem cell self - renewal76 have been demonstrated in pdac , characterising ezh2 as a strong promoter of cancer cell plasticity in the pancreas .
consequently , ezh2 inactivation sensitised pdac cells to chemotherapy in preclinical pdac models.76
80 reports demonstrating a significant longer survival of gemcitabine - treated patients with pdac with low pancreatic ezh2 levels81 emphasise the oncogenic capacities of the histone methyltransferase .
its involvement in a wide range of oncogenic functions in several cancer entities has prompted the development of specific inhibitors of ezh2 activity . with tazemetostat ( epz-6438 ) , cpi-1205 and gsk2816126 three different ezh2 inhibitors
are being assessed , for their tolerability and efficiency in clinical trials for haematological and solid malignancies .
the potent inhibitor of ezh2 methyltransferase activity tazemetostat82 is currently being evaluated in a multicentre , open - label phase i / ii study ( nct01897571 ) .
patients with haematological and solid tumours including pdac are enrolled in the phase i arm , while the phase ii portion is restricted to lymphoma patients .
preliminary results for a tazemetostat trial investigating dose escalation and expansion of the drug in b - cell lymphoma and refractory or relapsed solid tumour patients ( nct02601950 ) have been presented at the european society for medical oncology ( esmo ) 's european cancer congress in vienna , austria in september 2015 .
importantly , tazemetostat monotherapy induced a 55% disease control rate in solid tumours , including rhabdoid tumours and epitheloid sarcoma .
it is worth mentioning that the subgroup of responding tumours exhibited inactivating mutations of either smarcb1 ( also known as ini1 or snf5 ) or smarca4 ( also designated as brg1 ) .
both proteins belong to the switch / sucrose non - fermentable chromatin complex ( swi / snf ) chromatin remodelling complex and have been characterised for their tumour - suppressive potential .
intriguingly , mutations of the swi / snf complex can be found in approximately 20% of all human cancers.83 the dependency of antitumour activity of ezh2 inhibition on swi / snf mutations has recently been described in a preclinical approach . in a detailed mechanistic study , kim et al demonstrate that genetic depletion of ezh2 sufficiently blocked proliferation of a wide panel of swi / snf mutation containing cancer cells , while loss of ezh2 had no impact on cells harbouring wild - type expression of swi / snf proteins .
surprisingly , the dependency of swi / snf - mutated cells on prc2 expression did not necessarily always require ezh2 enzymatic activity , but was rather based on the stabilisation of the prc2 complex in the context of ras or raf mutation.78 these data suggest the existence of methyltransferase - independent oncogenic ezh2 functions and indicate that ezh2 inhibitors may not fully repress the oncogenic activity of the enzyme under some contexts , unless they are able to intervene with ezh2 expression or its interaction with the prc2 complex .
although patients with pdac are eligible for the ezh2 inhibitor trials , no data are currently available on the enrolment of patients with pdac into the trials or the efficiency of ezh2 blockade in pdac . nevertheless , since recent whole genome sequencing approaches reported frequent occurrence of swi / snf mutations ( of complex members such as arid1a , arid1b , smarca2 and smarca4 ) in pdac,1
3 beneficial effects of ezh2 inhibition in this subgroup of patients with pdac are worth further investigation . synthetic lethal interactions between ezh2 inhibition and the disturbance of other epigenetic mechanisms or signalling pathways are not limited to the swi / snf complex , but have been described in other contexts as well .
for example , ezh2 inhibition sensitised colorectal cancer cells to egfr inhibition by the induction of autophagy84 and blockade of ezh2 activity increases the susceptibility of small cell lung cancer with egfr gain - of - function mutations towards topoisomerase ii inhibition.85 moreover , an interesting connection between prc2 integrity and rat sarcoma ( ras ) activity has been recently revealed in malignant peripheral nerve sheath tumours .
herein , deficiency of the non - catalytic prc2 subunit suz12 or eed has been shown to amplify ras - driven transcription.86 as attenuation of the h3k27me3 mark upon suz12 or eed ablation resulted in an increase of h3k27 acetylation and subsequent recruitment of bromodomain proteins , the authors hypothesised that suz12-deficient tumours might respond to pharmacological bromodomain blockade . indeed
, jq1 treatment counteracted activation of ras signalling upon suz12 deficiency by suppressing ras signature genes.86 these preclinical studies indicate that the functional consequences of prc2 inactivation are diverse across tumour entities and underscore that methyltransferase - independent functions of ezh2 should be considered to exhaust the therapeutic potential of prc2 disruption in pdac treatment .
moreover , the experience and knowledge gained from preclinical and clinical studies in the context of ezh2 highlight the utmost importance of molecular stratification approaches as a central component of epigenetically based cancer therapy .
epigenetic mechanisms in general , and chromatin alterations in particular , are involved in all aspects of cancer development and progression .
a number of elegantly conducted translational studies have provided significant evidence that dysregulation of chromatin organisation strongly contributes to the aggressive behaviour of pdac , for instance , by promoting cellular plasticity and therapeutic resistance .
consequently , several clinical trials have been initiated to determine the safety and efficiency of epigenetic drugs in patients with pdac .
the small number of predominantly non - randomised studies on epigenetic targeting in this tumour entity and restrictive enrolment of patients with pdac in some of the studies both limit the informative value of these trials .
nevertheless , the following conclusions can be drawn : ( 1 ) similar to chemotherapy , monotherapeutic targeting of epigenetic alterations in pdac has thus far not proven to be beneficial ; ( 2 ) efficiency of epigenetic drugs could be reported in selected patients with pdac , especially following targeting of hdac or bet proteins ; ( 3 ) the mechanistic basis of the tumour cell selectivity of some epigenetic inhibitors remains largely unclear .
as demonstrated in diverse preclinical studies , a striking vulnerability of pdac cells exists towards epigenetic - based therapy in this disease .
however , targeting chromatin alterations in cancer to date is limited to a subset of histone writers , readers and erasers , while the potential targetability of other epigenetic regulators in the therapeutic landscape of cancer treatment is unknown . whether this is
a consequence of less academic and pharmaceutical research interest or a result of reduced vulnerability compared with the established targets of epigenetic drugs is unclear . for instance
, it is conceivable that inhibition of selective histone demethylase activities may be effective in the treatment of tumours displaying mutations in histone methyltransferases such as mll2 , mll3 and setd2,1
3 while tumours with mutations in kdm6a might be expected to respond well to ezh2 inhibitors .
it remains a tremendous hurdle to identify the most beneficial therapeutic targets of epigenetic cancer therapy and to detect those subpopulations of patients that will profit from targeting of a particular epigenetic alteration in pdac .
while initial indications suggest that smarcb1 and/or smarca4 mutations may be predicative of tumour responsiveness to ezh2 inhibitors in rhabdoid tumours , it remains to be determined whether pancreatic tumours displaying mutations in kdm6a , arid1a , arid2 or other baf complex components also depend upon ezh2 activity .
significant preclinical and clinical efforts are required to develop a paradigm of molecular stratification to address this challenge .
first advances in the prediction of responses towards epigenetic therapies57 indicate that this is a difficult , but feasible task .
recently developed high - throughput techniques can be used to identify molecular signatures that allow therapeutic response prediction to certain epigenetic drugs and alleviate therapy decision making in pdac .
this strategy is extremely important to enrol patients into the right clinical trials and to learn about the determinants of epigenetic drug responses .
intriguingly , considering molecular stratification approaches in pdac , chromatin deregulation contributes to the development of epigenetic targeting strategies , and also influences therapy decision making in standard care , as alterations in the epigenetic landscape might characterise certain subtypes of pdac , which are susceptible to defined ( non - epigenetic ) therapies .
therefore , epigenetic dysregulation in pdac can function as both a therapeutic target and therapy - response predictor . as a result of its tremendous cellular plasticity
therefore , the identification of the right drug combinations should significantly impact the therapeutic response of patients with pdac . combinations of epigenetic drugs with standard chemotherapy or targeted therapies or even combinations of different epigenetic drugs with one another are conceivable approaches that need to be validated in preclinical and clinical settings . due to the dynamic character of epigenetic modifications ,
their pharmaceutical targeting can significantly alter the susceptibility of the tumour towards standard chemotherapy , when applied in the right combination and sequence .
intriguingly , a rising number of preclinical and clinical studies in the past years emphasise the relevance and chances of therapeutic strategies that combine epigenetic inhibitors with each other to combat cancer .
the increasing understanding of the mechanistic and functional consequences of targeting central chromatin regulatory proteins in pdac cells and the subsequent implications of these therapeutic strategies on the epigenetic balance of a tumour reveals a hitherto underestimated vulnerability of these cancer cells towards inhibitors of other chromatin - modifying or remodelling proteins with similar or inverse functions . in this context
, the identification and characterisation of synthetic lethal interactions represents a crucial component to understanding how epigenetic mechanisms interact with each other and how they function within the genetic background of a tumour cell .
unfortunately , in contrast to the good tolerability of epigenetic monotherapies , combinatory applications of epigenetic drugs with other antitumourigenic agents frequently show additive and dose - limiting toxicities ( table 4).28 considering both the documented chances of epigenetic combination therapies in pdac treatment as well as their toxicity - related limitations , extensions of synthetic lethality studies and their translation to clinical settings might significantly expand the therapeutic potential and the feasibility of epigenetic therapeutic approaches in pdac treatment .
furthermore , the utilisation of epigenetic drugs at or near the maximum tolerated dose may not be the best approach . given their mechanisms of action , which function primarily through gene expression changes rather than cytotoxic effects , the definition of an effective dose based on biomarkers may significantly increase the potential utility of combinatorial approaches and reduce toxicity .
side effects of exemplary clinical trials testing epigenetic inhibitors in cancer treatment nsclc , non - small cell lung cancer . without a doubt
, the explosive scientific and pharmaceutical interest in epigenetic mechanisms in pdac biology and therapy represents a significant advance in the field and contributes to our understanding of key mechanisms of pdac biology .
finally , the success of the epigenetic era in translational pdac research will be determined by the elucidation and creation of molecular and context - specific dependencies that guarantee maximal exhaustion of the therapeutic and predictive potential of epigenetic - based mechanisms in pancreatic cancer . | pancreatic ductal adenocarcinoma ( pdac ) constitutes one of the most aggressive malignancies with a 5-year survival rate of < 7% . due to growing incidence , late diagnosis and insufficient treatment options , pdac is predicted to soon become one of the leading causes of cancer - related death .
although intensified cytostatic combinations , particularly gemcitabine plus nab - paclitaxel and the folinic acid , fluorouracil , irinotecan , oxaliplatin ( folfirinox ) protocol , provide some improvement in efficacy and survival compared with gemcitabine alone , a breakthrough in the treatment of metastatic pancreatic cancer remains out of sight .
nevertheless , recent translational research activities propose that either modulation of the immune response or pharmacological targeting of epigenetic modifications alone , or in combination with chemotherapy , might open highly powerful therapeutic avenues in gi cancer entities , including pancreatic cancer .
deregulation of key epigenetic factors and chromatin - modifying proteins , particularly those responsible for the addition , removal or recognition of post - translational histone modifications , are frequently found in human pancreatic cancer and hence constitute particularly exciting treatment opportunities .
this review summarises both current clinical trial activities and discovery programmes initiated throughout the biopharma landscape , and critically discusses the chances , hurdles and limitations of epigenetic - based therapy in future pdac treatment . |
vaccines have been developed for many infectious diseases since the early twentieth century and they have provided numerous benefits to human society .
one of these benefits is the increased lifespan caused by the prevention of infectious diseases .
however , the types of diseases have changed alongside the increased lifespan caused by the prevention of infectious disease .
these new health threats are chronic diseases such as cancer , cardiovascular diseases , diabetes , and obesity .
many therapeutic vaccine approaches have been developed for preventing chronic diseases . in this review ,
we discuss the prophylaxes and therapeutic vaccinations that could be used to reduce the incidence of obesity and diabetes .
obesity is classified as one of the eight significant causes of chronic disease by the world health organization ( who ) .
sixty - five percent of the world 's population lives in countries where overweight and obesity kills more people than underweight .
the number of health problems linked to chronic diseases is increasing dramatically and obesity is related to numerous chronic diseases .
many studies have also shown that obesity has a specific relationship with type 2 diabetes [ 4 - 6 ] .
obesity causes many problems in humans , but the treatment options for obesity are very limited .
it is widely accepted that a combination of dieting and physical activity is the most effective way of reducing obesity .
thus , healthy practices are readily stopped and subjects may return to their previous weight , which is called the yo - yo effect . therefore
however , current medications only have a beneficial effect if the treatment is sustained continuously . in addition
, bariatric surgery may lead to permanent weight loss but this method has significant perioperative risks and an economic burden for the patient . to address the problems of obesity treatment
, recent studies have shown that therapeutic vaccines may be new targets for the development of anti - obesity medications .
the therapeutic vaccines could treat alternatively the obesity by suppressing the appetite - stimulating hormone and blocking absorption of nutrients .
one therapeutic strategy is to block endogenous signals to reduce the appetite and body weight . in particular , immunization against the gut peptide , ghrelin ,
ghrelin is produced mainly in the small and large intestines , although it is also secreted by the lungs , pancreatic islets , gonads , kidney , and brain .
in particular , it promotes weight gain by increasing the appetite and food intake , while reducing the energy expenditure .
however this vaccine could cause emotional side effects . to identify the possibility of its use as a vaccine , synthetic ghrelin analogs were conjugated to haptens .
mice immunized with the ghrelin peptide sequence gained less body weight and had lower body fat and circulating leptin levels .
in addition , a therapeutic vaccine has been tested that used a noninfectious virus to carry ghrelin to elicit an immune response to obstruct this hormone .
vaccinated mice had higher levels of anti - ghrelin antibodies compared with unvaccinated mice . moreover , the vaccinated mice had a lower food intake and increased energy expenditure , i.e. , obese mice had 82% of the food intake consumed by the control mice after the first vaccination injection and only 50% of the food intake of the control mice after the final vaccination .
in addition , the vaccinated obese mice exhibited reduced neuropeptide y ( npy ) expression .
npy is the most potent signal that increases the appetite via the central nervous system .
furthermore , a ' flab jab ' vaccine has been reported that reduced the body weight by 10% four days after a single injection .
the vaccine was designed to block the effects of somatostatin , which has many different functions in various organs .
the release of somatostatin from the pancreas prevents insulin secretion and reduces the release of glucagon . blocking this growth hormone
for example , vaccinated mice produced antibodies against somatostatin and their food intake was reduced compared with control mice at six weeks after vaccination .
the vaccinated mice lost 12 - 13% of their body weight at four days after the first injection , although all of the mice consumed similar amounts of food .
mice treated with the two vaccines , jh17 and jh18 , exhibited 4% and 7% increases in their body weight , respectively , compared with their body weight at the start of the study . by contrast , control mice exhibited a 15% increase in their body weight .
however , this study had several limitations , such as problems with the control vaccination , the overall weight gain , and the unrealistic volume of vaccine required .
in addition , this vaccine could cause steatorrhea , diarrhea , gastrointestinal cramps , and occasional nausea
. therefore , somatostatin vaccines can reduce weight gain and the final body weight compared with the baseline weight , although there are some problems with this approach .
the recombinant virus - like particle ( vlp ) has a similar structure to viruses but lacks sufficient genetic information to replicate .
moreover , vlps derived from the coat protein of bacteriophage q have no preexisting immunity . during vlp assembly ,
single - stranded rna triggers toll - like receptors 7 and 8 , and these receptors induce co - stimulatory molecules and cytokines that promote antigen - specific igg2a responses .
chemical conjugation can be used to attach antigens to the surface of q-vlp , thereby triggering potent antibody responses in animals and humans . in particular
, vlp - based vaccines can induce antibodies against interleukin ( il)-1 to treat type 2 diabetes .
the cytokine il-1 triggers islet cell apoptosis and is a primary agonist in the loss of beta cell mass in type 2 diabetes .
therefore , the prevention of il-1 may improve the symptoms of type 2 diabetes patients .
when mice were immunized with the full - length il-1 protein coupled to q-vlp , they produced high neutralizing antibody titers with specificity for il-1 .
the antibody response against the mutant form of il-1 conferred protection in a rheumatoid arthritis animal model and the response also ameliorated the diabetic phenotype in a diet - induced obesity model .
interestingly , the immune system is functionally linked to obesity . in particular , lymphoid tissues appear to be very sensitive to nutrient imbalances .
therefore , these tissues have effects on metabolic pathways and the functions required for immune defense .
in addition , it is well known that the effect to vaccination is reduced by obesity ( fig .
1 ) . a previous study demonstrated an association between low antibody levels , obesity , and the response to hepatitis b vaccines .
another study showed that a standard hepatitis b vaccine had a 71% protection rate in obese adults ( body mass index > 30 ) compared with 91% in the healthy control group .
a further study investigated the mechanism related to the reduced antibody response to vaccination , where ob / ob obese mice exhibited 21% and 12% lower levels of pre - b and immature b cells , respectively , compared with wild type c57bl/6 mice .
these results indicate that obesity can modify the immune system to produce an immunodeficient state , including altered lymphocyte and monocyte functions .
diet - induced and genetic obesity increase the susceptibility to bacterial and viral infections in humans and animals .
therefore , it is necessary to perform intensive studies to determine the effects of obesity on the efficacy of vaccinations .
recently , many studies have reported that infections with pathogens can induce obesity and metabolic diseases .
thus , preventing and treating infection by selected pathogens may help to reduce the risk of the adverse effects of obesity . of the known obesity - inducing pathogens ,
human ad36 induces adiposity but paradoxically it improves insulin sensitivity [ 36 - 38 ] .
ad36-infected animals have a higher body weight and fat content , but hypolipidemia compared with control animals .
there is a strong association between ad36 infection and human obesity [ 36 - 38 ] .
ad36 is a human adenovirus that belongs to serotype d and it is antigenically distinct . according to epidemiological data , 30% of obese and 11% of non - obese adults in the united states possess antibodies against ad36 .
moreover , it has been reported that there is a relationship between viral infections with ad36 and obesity in several nations [ 41 - 44 ]
. however , research into the treatment of viral infections and vaccine development is still lacking in this area .
a previous study tested the possibility of using an inactivated ad36 vaccine , where ad36 was inactivated using ultraviolet ( uv ) irradiation . in trials ,
mice were inoculated with live ad36 , uv - inactivated ad36 , or the medium alone .
live ad36 increased the size of the epididymal fat pad at 4 days post - inoculation , whereas uv - inactivated ad36 did not cause an increase .
furthermore , our group demonstrated a ' proof of concept ' using an ad36 vaccine ( unpublished data ) .
we injected mice with uv - inactivated ad36 , live ad36 as the positive control , and medium as the negative control , before challenge with live ad36 ( unpublished data ) .
the mice were sacrificed and their organs were used to study the chronic effects at 90 days post - challenge .
live ad36-injected mice had larger epididymal fat pads and exhibited inflammation of their fat deposits .
however , the body weight and epididymal fat levels of the uv - inactivated ad36-injected mice were similar to those of the control mice . moreover ,
treatment with uv - inactivated ad36 decreased the level of inflammation in the fat deposits .
overall , these results show that uv - inactivated ad36 can prevent increases in body fat and inflammation
hormones have been tested as targets to treat ' conventional ' obesity by developing therapeutic vaccines .
the incidence of pathogen - induced obesity is increasing , but the development of vaccines to treat these pathogens is insufficient at present .
several studies have demonstrated the ' proof of concept ' of the potential application of a prophylactic vaccine against ad36 as an anti - obesity agent .
an inactivated ad36 vaccine can prevent increases in the body weight and fat content , as well as reducing inflammation in fat deposits .
however , this type of anti - obesity vaccine research is just beginning . therefore , more intensive studies are required to develop prophylactic and therapeutic vaccines to prevent obesity . | chronic diseases such as obesity and diabetes are major causes of death and disability throughout the world .
many causes are known to trigger these chronic diseases , and infectious agents such as viruses are also pathological factors . in particular
, it is considered that adenovirus 36 infections may be associated with obesity .
if this is the case , a vaccine against adenovirus 36 may be a form of prophylaxis to combat obesity .
other types of therapeutic vaccines to combat obesity are also being developed .
recently , hormones such as glucagon - like peptide-1 , ghrelin , and peptide yy have been studied as treatments to prevent obesity .
this review describes the ongoing development of therapeutic vaccines to treat obesity , and the possibility of using inactivated adenovirus 36 as a vaccine and an anti - obesity agent . |
because the initial deposition pattern of inhaled particles of various toxic agents determines their future clearance and insult to tissue , respiratory tract deposition is important in assessing the potential toxicity of inhaled aerosols .
factors influencing the deposition of inhaled particles can be classified into three main areas : ( 1 ) the physics of aerosols , ( 2 ) the anatomy of the respiratory tract and ( 3 ) the airflow patterns in the lung airways . in the physics of aerosols ,
the forces acting on a particle and its physical and chemical properties , such as particle size or size distribution , density , shape , hygroscopic or hydrophobic character , and chemical reactions of the particle will affect the deposition .
with respect to the anatomy of the respiratory tract , important parameters are the diameters , the lengths , and the branching angles of airway segments , which determine the deposition .
physiological factors include airflow and breathing patterns , which influence particle deposition .
various lung models used in predicting particle deposition are reviewed and discussed .
the air - way structures of various animal species are compared , showing the unique structure of the human lung compared to the animal species under study .
regional deposition data in man and dog are reviewed .
recent deposition data for small rodents are presented , showing regional difference in deposition with the right apical lobe having the highest relative deposition.imagesfigure 5.figure 5 . | |
when the treatment of acute heart failure and respiratory failure is difficult with existing conventional methods , treatment with an extracorporeal membrane oxygenator ( ecmo ) has become an alternative ( 1 ) . although heparin has been used as an anticoagulant among a variety of methods to reduce bleeding complications during ecmo usage , bleeding complications still occur in 10%-30% of patients ( 1 - 4 ) .
nafamostat mesilate , a synthetic protease inhibitor with a short half life , has been widely used as an anticoagulant for hemodialysis patients with a tendency to bleed ( 5 - 7 ) .
it has been reported that nafamostat mesilate produces good results when it is applied for anticoagulation to cardiac surgery and ecmo ; however , different dosages were used in each study ( 8 - 12 ) .
the present study investigated the ideal dosage and efficacy of nafamostat mesilate for use with ecmo in patients with acute cardiac or respiratory failure .
we retrospectively reviewed the records of 73 consecutive patients who received ecmo due to acute cardiac or respiratory failure between january 2006 and december 2009 .
tokyo , japan ) was used as an anticoagulant in 17 patients and 56 patients received heparin .
we excluded 5 of the 56 heparin patients because they underwent an operation just after ecmo : 3 pulmonary artery thromboembolectomies due to acute pulmonary thromboembolism , 1 coronary artery bypass graft due to acute myocardial infarction , and 1 reoperation due to cardiac arrest at 10 hr after receiving a coronary artery bypass graft .
we started to use nafamostat mesilate in october 2008 as an anticoagulant during ecmo support in patients with acute renal failure or with a high risk of bleeding due to antiplatelet medication .
the criteria for venoarterial ecmo use was refractory cardiogenic shock , cardiac arrest , and septic shock that did not respond to conventional therapy .
the inclusion criteria were a systolic blood pressure < 80 mmhg despite adequate intravascular volume replacement and the infusion of high dose catecholamines ( dopamine > 30 g / kg / min and/or norepinephrine > 0.2 g / kg / min ) .
the inclusion criteria for venovenous ecmo were based on the lung dysfunction measured with a pao2/fio2 ratio < 100 for an fio2 of 1.0 , or an arterial blood gas ph < 7.25 due to hypercapnia despite receiving the optimal treatment .
three types of centrifugal pumps were used for the ecmo system : capiox emergency bypass system ( terumo , inc . , tokyo , japan ) , bio - pump ( medtronic inc , minneapolis , mn , usa ) , and centrifugal rotaflow pump ( maquet inc . , hirrlingen , germany ) .
we used 3 types of polypropylene hollow - fiber membrane oxygenators : capiox rx25 ( termo , inc . ) , d903 avant ( sorin group italia s.r.l .
, mirandola modena , italy ) , and capiox emergency bypass system ( terumo , inc . ) .
to enable ecmo , all patients received 17 - 21 fr arterial cannulae ( dlp : medtronic inc . , or rmi : edward 's lifescience llc , irvine , ca , usa ) and 17 - 28 fr venous cannulae ( dlp : medtronic inc . or rmi : edward 's lifescience llc ) according to the patient 's size .
after the intravenous injection of 10 mg / kg heparin , the femoral artery and femoral vein were cannulated percutaneously using the seldinger method , except for 1 patient who was cannulated after an inguinal incision . in the case of venovenous ecmo , both femoral veins were cannulated .
initially , 3 patients were observed for a high infusion rate of nafamostat mesilate ( 1.15 - 2.19 mg / kg / hr ) to maintain the activated clotting time ( act ) at 140 - 180 sec . from the 4th patient ,
nafamostat mesilate was adjusted at 0.41 - 0.93 mg / kg / hr according to the activated partial thromboplastin time ( aptt ; target range : 60 - 80 sec ) .
the heparin patients received a continuous infusion at a rate of 1 - 2 mg / kg / hr to maintain the act at 140 - 180 sec .
the patients with acute myocardial infarction ( ami ) who received percutaneous coronary intervention were administered aspirin ( 250 mg ) and clopidogrel ( 300 mg ) on the day of the procedure , and received aspirin ( 200 mg ) and clopidogrel ( 75 mg ) on the following day .
we tried to maintain the hematocrit levels > 35% and the platelet count > 80,000 per l .
if the hematocrit and platelet counts fell below these levels , we transfused blood products .
in addition , fresh frozen plasma ( ffp ) and cryoprecipitate transfusion was performed once after 3 or 4 days according to the occurrence of hemorrhagic complications . after weaning
was successfully performed , the cannulae were surgically removed in the operating room to avoid complications such as leg ischemia , aneurysm , or arteriovenous fistula .
nafamostat mesilate was discontinued after removing the cannulae , while heparin was discontinued at 12 hr before the cannulae were removed .
4.1 ; dbstat co. , chuncheon , korea ) was used for all statistical analysis .
categorical variables were expressed as percentages and evaluated with pearson 's chi - square test or fisher 's exact test .
continuous variables were expressed as the mean and standard deviation and were evaluated with student 's t test or the mann whitney u - test .
this study received institutional review board approval of the hallym university chuncheon sacred heart hospital ( irb no
this study received institutional review board approval of the hallym university chuncheon sacred heart hospital ( irb no
the clinical characteristics of the 17 patients treated with nafamostat mesilate during ecmo support are as follows .
six , 3 , 5 , and 3 patients were diagnosed with ami , cardiac arrest , septic shock , and acute respiratory distress syndrome ( ards ) , respectively .
the mean dosage of nafamostat mesilate was 0.64 mg / kg / hr to maintain an aptt of 60 - 80 sec .
the mean duration of ecmo was 270.7 hr . seven patients survived and were discharged . to evaluate the efficacy of nafamostat mesilate ,
a clinical comparison between the nafamostat mesilate and heparin groups is shown in table 1 .
the patients ' ages , sex , diagnosis , ecmo duration , and peak blood urea nitrogen , and total and direct bilirubin levels were found to be statistically significant variables ( p < 0.05 ) .
the number of mortalities within 24 hr after applying ecmo in the heparin group was 14 , which was 1 in the nafamostat mesilate group ; however , this was not a significant difference ( p = 0.092 ) .
the average time of oxygenator use in the nafamostat mesilate group was longer than in the heparin group ( p = 0.003 ) .
the daily transfusion volume of packed rbcs , ffp , and cryoprecipitate was lower in the nafamostat mesilate group than in the heparin group ( p < 0.001 , p < 0.001 , p = 0.035 ) .
the number of complications related to hemorrhage and thrombosis was higher in the heparin group ( 34 in 31 patients ) than in the nafamostat mesilate group ( 4 complications in 4 patients ) ( p = 0.011 ) .
the long term survival and cause of death according to anticoagulants is shown in table 3 .
the ecmo support of 8 patients in the heparin group was withdrawn because of uncontrolled bleeding .
the nafamostat mesilate group provided a better survival rate than the heparin group ( p = 0.048 ) .
the number of cases in which ecmo is used to treat cardiopulmonary failure is increasing .
although the incidence of bleeding complications has decreased in various trials , bleeding remains one of the most fatal complications .
nafamostat mesilate is a synthetic serine protease inhibitor with a very short half - life that inhibits coagulation , fibrinolysis , and platelet aggregation by inactivating the action of thrombin , activated coagulation factors xiia and xa , complement c1r and c1s , plasmin , trypsin , and kallikrein ( 13 - 15 ) .
nafamostat mesilate has been used as an anticoagulant instead of heparin for extracorporeal oxygenation , left ventricular assist devices , cardiac surgery , and hemodialysis in patients at high risk of hemorrhage ( 5 , 8 , 9 , 16 ) .
the anticoagulant effect of nafamostat mesilate , like heparin , is dependent on the dosage ; however , the ideal dosage of nafamostat mesilate for ecmo has not yet been determined . according to 2 case studies that administered nafamostat mesilate instead of heparin as an anticoagulant to treat pulmonary hemorrhage during ecmo use , daimon et al .
( 10 ) and kotani et al . ( 11 ) used a nafamostat mesilate infusion rate of 1.0 mg / kg / hr and 1.0 - 1.7 mg / kg / hr , and act was maintained at 150 sec in a 49-yr - old male patient and 190 - 200 sec in a 27-yr - old female patient , respectively .
( 8) successfully treated bleeding complications in 12 neonates on ecmo by administering nafamostat mesilate at 0.48 mg / kg / hr and heparin at 21.0 u / kg / hr , while act was maintained at 205.7 sec . in the present study , a nafamostat mesilate infusion rate of 1.15 - 2.19 mg / kg / hr was needed to maintain an act of 140 - 180 sec in 3 patients ; however , in the other patients , the infusion rate of nafamostat mesilate was lower ( 0.64 mg / kg / hr ) , while maintaining an aptt of 60 - 80 sec .
the test results of act are affected by patient characteristics and technical factors ( 17 - 19 ) . in this study ,
the use of aptt monitoring in the nafamostat mesilate group might allow more precise control of anticoagulation than act monitoring .
two cases of amputation due to leg ischemia occurred in patients who were diagnosed with septic shock ; however , these were related to the existing disease , disseminated intravascular coagulation , and not to the insertion of the cannula .
a patient who was diagnosed with ami and acute aortic dissection died after 24 hr due to left hemothorax .
pulmonary hemorrhagic complications occurred in another patient who was diagnosed with septic shock , and he was relieved by nafamostat mesilate ; however , the patient died after 404 hr on ecmo because of a previously existing disease .
the incidence of bleeding complications in the nafamostat mesilate group was less than in the heparin group .
transfusion with packed rbcs is needed because hemoglobin levels are decreased during ecmo due to thrombocytopenia , hemolysis , and hemodilution caused by continuous systemic heparinization ( 20 ) .
( 21 ) reported that a transfusion volume of 3.1 units / day was required .
bakhtiary et al . ( 22 ) transfused 16.3 units of packed rbcs over an average of 6.3 day during ecmo .
patients with post - cardiotomy and non - cardiotomy received transfusions of 23.3 and 17.3 units of packed rbcs over an average of 5.5 and 11.6 day on ecmo , respectively ( 23 ) . in the present study ,
the incidence of bleeding complications in the nafamostat mesilate group was significantly less than in the heparin group because 1.6 units / day of packed rbcs were transfused in the nafamostat mesilate group compared to 7.5 units / day in the heparin group .
such a large transfusion volume was needed in the heparin group because bleeding complications occurred in 31 patients , and , in particular , the greatest transfusion volume was used in the 13 patients who died from bleeding .
we had to change the circuit every 2 - 3 days due to failure of the oxygenator because we do not have access to long - term support ecmo oxygenators .
the average time on ecmo oxygenators in the nafamostat mesilate group was 91.7 hr , which was longer than in the heparin group ( 41.6 hr ) because 14 patients ( 27.5% ) in the heparin group died within 24 hr .
( 24 ) , in which short - term support ecmo was replaced once by the use of an oxygenator for 2 - 3 days .
the duration of ecmo for the nafamostat mesilate group was also longer than for the heparin group because 47% of the nafamostat mesilate patients underwent ecmo due to septic shock or ards , and 73% of the heparin patients underwent ecmo due to ami .
therefore , the different existing diseases had differing recovery periods , resulting in the varying durations of ecmo ( 20 , 25 - 27 ) .
( 28 ) reported that complement and neutrophils were suppressed by nafamostat mesilate before reperfusion ; therefore , myocardial damage was decreased after reperfusion .
the survival rate of the ami patients who were treated with nafamostat mesilate was 50% ( 3 of 6 patients ) , which was higher than in the patients who were treated with heparin ( 11% , 4 of 37 patients ) .
however , additional studies are needed because the small number of patients is not sufficient to determine whether the survival rate is increased due to decreased myocardial damage by nafamostat mesilate .
first , our data describe a retrospective analysis of our experience with mixed indication for ecmo implantation .
therefore it is difficult to exclude that higher prevalence of ami and elderly in the heparin group influenced our results .
second , this study is limited in its ability to suggest the ideal dosage of nafamostat mesilate because it is a retrospective examination of a small number of patients who underwent ecmo for various diagnoses . however , in the present study , the incidence of bleeding complications and transfusions in patients on ecmo decreased when a lower dosage of nafamostat mesilate was needed maintain the aptt than for the dosages used in previous studies to maintain the act .
higher amounts of peak total and direct bilirubin were observed in the nafamostat mesilate patients than in the heparin patients ; however , additional studies are needed to examine whether this was caused by the long - term administration of nafamostat mesilate or existing diseases . in conclusion
, nafamostat mesilate should be considered as an alternative anticoagulant to heparin to reduce bleeding complications during ecmo .
use of nafamostat mesilate as an anticoagulant during extracorporeal membrane oxygenation sang jin han , hyoung soo kim , gun il kim , sung mi whang , kyung soon hong , won ki lee and sun hee lee we investigated the effective dosage and efficacy of nafamostat mesilate for use with extracorporeal membrane oxygenator ( ecmo ) in patients with acute cardiac or respiratory failure .
the daily volume of transfused packed red blood cells , fresh frozen plasma , and cryoprecipitate was lower in patients treated with nafamostat mesilate than with heparin . also , the number of complications related to hemorrhage and thrombosis was lower than the heparin group . | although the incidence of bleeding complications during extracorporeal membrane oxygenator ( ecmo ) support has decreased in various trials , bleeding is still the most fatal complication .
we investigated the ideal dosage and efficacy of nafamostat mesilate for use with ecmo in patients with acute cardiac or respiratory failure .
we assessed 73 consecutive patients who received ecmo due to acute cardiac or respiratory failure between january 2006 and december 2009 . to evaluate the efficacy of nafamostat mesilate , we divided the patients into 2 groups according to the anticoagulants used during ecmo support .
all patients of nafamostat mesilate group were male with a mean age of 49.2 yr .
six , 3 , 5 , and 3 patients were diagnosed with acute myocardial infarction , cardiac arrest , septic shock , and acute respiratory distress syndrome , respectively .
the mean dosage of nafamostat mesilate was 0.64 mg / kg / hr , and the mean duration of ecmo was 270.7 hr .
the daily volume of transfused packed red blood cells , fresh frozen plasma , and cryoprecipitate and the number of complications related to hemorrhage and thrombosis was lower in the nafamostat mesilate group than in the heparin group .
nafamostat mesilate should be considered as an alternative anticoagulant to heparin to reduce bleeding complications during ecmo . |
menopause is a biological event rising from ovary failure , for which a diagnosis is retrospectively made after 12 consecutive months of amenorrhea that is not explainable through pathological causes and is associated with plasma values of follicle - stimulating hormone higher than 40 iu / l.1 it is preceded by a transitory shift from the reproductive to the nonreproductive stage , which lasts approximately 28 years in 95% of women.2 this transitory phase is usually characterized by specific vasomotor , psychological , and urogenital signs and symptoms , as well as more generalized physical complaints , such as weight gain , changes in the thickness of the skin and hair , and the appearance of fatigue , vertigo , and joint pain.3,4 the intensity of menopause - related complaints ranges from mild to severe in 96% of the women , affecting their quality of life ( qol ) not only from the physical and psychological point of view but also at the social level .
the qol scores of middle - aged women are usually lower than those of middle - aged men , young adults , and elderly women.57 despite the general observation of a negative association between menopause and/or the symptoms of menopause and qol scores,6,8,9 especially at the psychological level,10 some researchers have investigated the influence of lifestyle and , more specifically , physical activity ( pa ) on menopause symptoms and/or qol scores in middle - aged women , independent of their menopausal stage.11,12 high levels of pa have been associated with a better qol , mainly in the physical domain,13 as well as with a decrease in psychological14,15 and physical11 menopause - related complaints .
conversely , low levels of pa seem to correlate with weight gain and obesity during menopause.16 evidence for the influence of pa on the symptoms of climacterium / menopause and on qol rises from intervention studies which apply exercise ( targeted pa).1719 exercise programs with a fundamentally aerobic component , of moderate or higher intensity , an approximate duration of 30 minutes per session , three or four sessions per week , and lasting at least 6 months , have shown positive effects on qol.18,19 other studies on the influence of habitual pa ( nontargeted pa ) performed in different contexts ( leisure , household chores , occupation , and transportation ) have not yet quantified the exact level of pa necessary to achieve favorable effects on qol or on the menopause symptoms in middle - aged women;13,14,20 these data would be highly relevant for establishing recommendations regarding habitual pa in the promotion of health .
however , these studies indicate a decrease in the overall frequency of symptoms,14 especially psychological symptoms,14,20 in addition to an increase in qol , mainly in the physical domain.13 thus , the main aim of this study was to analyze the influence of the duration of habitual pa on the symptoms of climacterium / menopause and on the various domains of health - related qol scores in middle - aged women .
one hundred and twenty 45- to 59-year - old women voluntarily entered the study ; participants were recruited through work or institutions associated with educational , health , sport , religious , or insurance services .
the study excluded participants who had serious reproductive or hormonal illnesses such as breast , ovarian or endometrial cancer , diabetes , liver disease , current use of psychotropic drugs , or any clinical condition that prevented women from adhering to the pa recommendations for public health that is the accumulation of at least 30 minutes activity of moderate or greater intensity per day .
participants were divided into three groups at the end of the study according to the characteristics of the habitual pa they performed during the period of observation .
group a maintained habitual pa to less than 30 minutes / day ( n = 42 ) ; group b continued or began to engage in habitual pa for 3060 minutes / day ( n = 16 , of which 56% maintained the same level of initial habitual pa ) ; and group c continued or began to engage in habitual pa for more than 60 minutes / day ( n = 46 , of which 65% maintained the same level of the initial pa ) ( figure 1 ) .
at the beginning of the study , all participants were informed of the health benefits of pa and were advised to be more active in tasks of daily living and to accumulate at least 30 minutes / day pa of moderate or greater intensity ( great if 60 minutes / day ) , eg , using stairs instead of elevators or escalators , moving by foot , bicycle , or public transport instead of using the car , and doing active breaks or leisure activities rather than passive activities .
contact was maintained with participants by telephone once a week to encourage them to maintain or increase habitual pa .
three sessions per week of walking was organized during the 12 weeks in one place ( park ) for participants who wished to do this activity together , but without supervision . it was explained that moderate - intensity physical exertion corresponded to five or six points on a 010 scale , where zero represents the absence of exertion and 10 represents maximum exertion.21 a five or six on a 010 scale is essentially 45% to 64% of aerobic capacity reserve for moderate intensity .
similarly , a seven or eight on a 010 scale means 65% to 84% of reserve is the range for relatively vigorous - intensity activity .
data were collected at the beginning and at the end of the study period by the same evaluator . at the beginning of the study ,
the participants were informed of the aims and procedures of the study and signed an informed consent form according to resolution 196/96 of conselho nacional de sade , brazil .
this observational study was carried out between september and december 2010 , after approval from the research ethics committee of the state university of santa catarina , brazil .
habitual pa was assessed through the short form of the international pa questionnaire ( ipaq ) , which was developed by researchers from several countries and has been used by the world health organization ( who ) within a multicentric study embracing several countries .
this questionnaire was validated by the studies center of the laboratory of physical aptitude of so caetano do sul , which is an ipaq coordination center in brazil.22 the evaluation of habitual pa through ipaq quantified the number of times each participant walked for at least 10 consecutive minutes ( 3.3 metabolic equivalents [ mets ] ) and engaged in moderate- ( 4.0 mets ) and vigorous - intensity pa ( 8.0 mets ) during the previous week in various settings : leisure , household chores , occupation , and transportation . because walking is assigned a level of exertion of 3.3 mets , which is higher than the lower limit for moderate activity ( 3 mets ) , the total pa resulting from adding walking , moderate activity , and strong activity corresponds to at least moderate - intensity activity .
the reproductive state of the participants was evaluated through a questionnaire that included age of menarche , regularity of menstrual cycles , and nature of menopause ( ie , natural or surgical ) .
participants who reported 111 months of amenorrhea were rated as perimenopausal ( 45.2% of the women ) , and those with 12 or more months of amenorrhea were rated as postmenopausal ( 54.8% of the women).23 the age of menopause was calculated only for the women with natural menopause ( 79% of the women ; 21% reported surgical menopause ) .
the use of hormonal replacement therapy ( 19.2% of the women ) was also included in the questionnaire .
the symptoms of menopause were assessed through the kupperman menopausal index , comprising ten symptoms or complaints ( vasomotor symptoms , insomnia , paresthesia , nervousness , vertigo , weakness , joint / muscular pain , headache , palpitations , and tinnitus ) .
an addition of six menopause symptoms was included : decreased memory , decreased sexuality ( libido , sexual activity , and satisfaction ) , urinary complaints ( exertion - induced urinary incontinence or difficult micturition ) , vaginal dryness ( feeling of dryness and difficulties with sexual intercourse ) , anxiety , and weight gain.24 the occurrence / frequency of each symptom was assessed on a four - point likert scale , in which 0 = absence , 1 = mild ( occasionally ) , 2 = moderate ( repeatedly ) , and 3 = intense ( constantly ) . after adding the scores for all of the symptoms , participants were classified either as asymptomatic or as having mild ( up to 19 points ) , moderate ( 20 to 35 points ) , or intense ( higher than 35 points ) symptoms.25,26
this questionnaire was previously validated in brazil.26 the qol was assessed by means of the who qol brief version ( whoqol - bref ) questionnaire , which has been validated for brazilian portuguese.27 this questionnaire comprises 26 questions ( out of the original 100 ) , 24 questions examining physical ( physical pain , energy , locomotion , everyday life activities , medical treatments , and work ) , psychological ( positive feelings , concentration , self - esteem , self - image , negative feelings , and spirituality ) , social ( personal relationships , social support , and sexual activity ) , and environmental ( physical safety , housing , financial resources , health - care facilities , information , leisure , physical environment , and transportation ) domains and the remaining two are general questions on qol .
the questions refer to the previous 2 weeks , and the participants answer them according to a likert scale for intensity ( none / extremely ) , ability ( none / completely ) , frequency ( never / always ) , or evaluation ( very unsatisfied / very satisfied ; very bad / very good ) , in which values are calculated from scores ranging from zero ( very bad ) to 25 ( fair ) , 50 ( good ) , 75 ( very good ) , and 100% ( excellent ) . body weight and height were reported by the participants themselves .
such values were used to calculate body mass index ( weight [ kg]/height [ m ] ) .
years of schooling and the number of diseases were calculated from a self - reported questionnaire .
data were analyzed using spss software ( v 16.0 ; spss inc , chicago , il ) .
descriptive statistics were applied ( mean , standard deviation , and amplitude ) to characterize the age , age of menarche , age of menopause , body mass index , education , number of diseases , habitual pa variables , qol domain scores , and symptoms of menopause .
comparisons of the qol scores and symptoms of menopause in middle - aged women between groups ( a vs b vs c ) after 12 weeks were performed using analysis of covariance ( ancova ) , adjusted for the baseline values of each dependent variable .
intragroup comparisons between the qol scores and symptoms of menopause at the beginning and end of the study were made through paired t - tests ( in groups a and c ) and wilcoxon signed - rank test ( group b ) .
the dose - response relationships between habitual pa and the variations in qol scores in the physical , psychological , and social domains , the variations in weight , and the variation in the symptoms of menopause were analyzed through ancova adjusted for age , initial body mass index , years of schooling , hormonal replacement therapy , and number of diseases .
one hundred and twenty 45- to 59-year - old women voluntarily entered the study ; participants were recruited through work or institutions associated with educational , health , sport , religious , or insurance services .
the study excluded participants who had serious reproductive or hormonal illnesses such as breast , ovarian or endometrial cancer , diabetes , liver disease , current use of psychotropic drugs , or any clinical condition that prevented women from adhering to the pa recommendations for public health that is the accumulation of at least 30 minutes activity of moderate or greater intensity per day .
participants were divided into three groups at the end of the study according to the characteristics of the habitual pa they performed during the period of observation .
group a maintained habitual pa to less than 30 minutes / day ( n = 42 ) ; group b continued or began to engage in habitual pa for 3060 minutes / day ( n = 16 , of which 56% maintained the same level of initial habitual pa ) ; and group c continued or began to engage in habitual pa for more than 60 minutes / day ( n = 46 , of which 65% maintained the same level of the initial pa ) ( figure 1 ) .
at the beginning of the study , all participants were informed of the health benefits of pa and were advised to be more active in tasks of daily living and to accumulate at least 30 minutes / day pa of moderate or greater intensity ( great if 60 minutes / day ) , eg , using stairs instead of elevators or escalators , moving by foot , bicycle , or public transport instead of using the car , and doing active breaks or leisure activities rather than passive activities .
contact was maintained with participants by telephone once a week to encourage them to maintain or increase habitual pa .
three sessions per week of walking was organized during the 12 weeks in one place ( park ) for participants who wished to do this activity together , but without supervision . it was explained that moderate - intensity physical exertion corresponded to five or six points on a 010 scale , where zero represents the absence of exertion and 10 represents maximum exertion.21 a five or six on a 010 scale is essentially 45% to 64% of aerobic capacity reserve for moderate intensity .
similarly , a seven or eight on a 010 scale means 65% to 84% of reserve is the range for relatively vigorous - intensity activity .
data were collected at the beginning and at the end of the study period by the same evaluator . at the beginning of the study ,
the participants were informed of the aims and procedures of the study and signed an informed consent form according to resolution 196/96 of conselho nacional de sade , brazil .
this observational study was carried out between september and december 2010 , after approval from the research ethics committee of the state university of santa catarina , brazil .
habitual pa was assessed through the short form of the international pa questionnaire ( ipaq ) , which was developed by researchers from several countries and has been used by the world health organization ( who ) within a multicentric study embracing several countries .
this questionnaire was validated by the studies center of the laboratory of physical aptitude of so caetano do sul , which is an ipaq coordination center in brazil.22 the evaluation of habitual pa through ipaq quantified the number of times each participant walked for at least 10 consecutive minutes ( 3.3 metabolic equivalents [ mets ] ) and engaged in moderate- ( 4.0 mets ) and vigorous - intensity pa ( 8.0 mets ) during the previous week in various settings : leisure , household chores , occupation , and transportation . because walking is assigned a level of exertion of 3.3 mets , which is higher than the lower limit for moderate activity ( 3 mets ) , the total pa resulting from adding walking , moderate activity , and strong activity corresponds to at least moderate - intensity activity .
the reproductive state of the participants was evaluated through a questionnaire that included age of menarche , regularity of menstrual cycles , and nature of menopause ( ie , natural or surgical ) .
participants who reported 111 months of amenorrhea were rated as perimenopausal ( 45.2% of the women ) , and those with 12 or more months of amenorrhea were rated as postmenopausal ( 54.8% of the women).23 the age of menopause was calculated only for the women with natural menopause ( 79% of the women ; 21% reported surgical menopause ) .
the use of hormonal replacement therapy ( 19.2% of the women ) was also included in the questionnaire .
the symptoms of menopause were assessed through the kupperman menopausal index , comprising ten symptoms or complaints ( vasomotor symptoms , insomnia , paresthesia , nervousness , vertigo , weakness , joint / muscular pain , headache , palpitations , and tinnitus ) .
an addition of six menopause symptoms was included : decreased memory , decreased sexuality ( libido , sexual activity , and satisfaction ) , urinary complaints ( exertion - induced urinary incontinence or difficult micturition ) , vaginal dryness ( feeling of dryness and difficulties with sexual intercourse ) , anxiety , and weight gain.24 the occurrence / frequency of each symptom was assessed on a four - point likert scale , in which 0 = absence , 1 = mild ( occasionally ) , 2 = moderate ( repeatedly ) , and 3 = intense ( constantly ) . after adding the scores for all of the symptoms , participants were classified either as asymptomatic or as having mild ( up to 19 points ) , moderate ( 20 to 35 points ) , or intense ( higher than 35 points ) symptoms.25,26 this questionnaire was previously validated in brazil.26 the qol was assessed by means of the who qol brief version ( whoqol - bref ) questionnaire , which has been validated for brazilian portuguese.27 this questionnaire comprises 26 questions ( out of the original 100 ) , 24 questions examining physical ( physical pain , energy , locomotion , everyday life activities , medical treatments , and work ) , psychological ( positive feelings , concentration , self - esteem , self - image , negative feelings , and spirituality ) , social ( personal relationships , social support , and sexual activity ) , and environmental ( physical safety , housing , financial resources , health - care facilities , information , leisure , physical environment , and transportation ) domains and the remaining two are general questions on qol .
the questions refer to the previous 2 weeks , and the participants answer them according to a likert scale for intensity ( none / extremely ) , ability ( none / completely ) , frequency ( never / always ) , or evaluation ( very unsatisfied / very satisfied ; very bad / very good ) , in which values are calculated from scores ranging from zero ( very bad ) to 25 ( fair ) , 50 ( good ) , 75 ( very good ) , and 100% ( excellent ) . body weight and height were reported by the participants themselves .
such values were used to calculate body mass index ( weight [ kg]/height [ m ] ) .
years of schooling and the number of diseases were calculated from a self - reported questionnaire .
habitual pa was assessed through the short form of the international pa questionnaire ( ipaq ) , which was developed by researchers from several countries and has been used by the world health organization ( who ) within a multicentric study embracing several countries .
this questionnaire was validated by the studies center of the laboratory of physical aptitude of so caetano do sul , which is an ipaq coordination center in brazil.22 the evaluation of habitual pa through ipaq quantified the number of times each participant walked for at least 10 consecutive minutes ( 3.3 metabolic equivalents [ mets ] ) and engaged in moderate- ( 4.0 mets ) and vigorous - intensity pa ( 8.0 mets ) during the previous week in various settings : leisure , household chores , occupation , and transportation . because walking is assigned a level of exertion of 3.3 mets , which is higher than the lower limit for moderate activity ( 3 mets ) , the total pa resulting from adding walking , moderate activity , and strong activity corresponds to at least moderate - intensity activity .
the reproductive state of the participants was evaluated through a questionnaire that included age of menarche , regularity of menstrual cycles , and nature of menopause ( ie , natural or surgical ) .
participants who reported 111 months of amenorrhea were rated as perimenopausal ( 45.2% of the women ) , and those with 12 or more months of amenorrhea were rated as postmenopausal ( 54.8% of the women).23 the age of menopause was calculated only for the women with natural menopause ( 79% of the women ; 21% reported surgical menopause ) .
the use of hormonal replacement therapy ( 19.2% of the women ) was also included in the questionnaire .
the symptoms of menopause were assessed through the kupperman menopausal index , comprising ten symptoms or complaints ( vasomotor symptoms , insomnia , paresthesia , nervousness , vertigo , weakness , joint / muscular pain , headache , palpitations , and tinnitus ) .
an addition of six menopause symptoms was included : decreased memory , decreased sexuality ( libido , sexual activity , and satisfaction ) , urinary complaints ( exertion - induced urinary incontinence or difficult micturition ) , vaginal dryness ( feeling of dryness and difficulties with sexual intercourse ) , anxiety , and weight gain.24 the occurrence / frequency of each symptom was assessed on a four - point likert scale , in which 0 = absence , 1 = mild ( occasionally ) , 2 = moderate ( repeatedly ) , and 3 = intense ( constantly ) . after adding the scores for all of the symptoms , participants were classified either as asymptomatic or as having mild ( up to 19 points ) , moderate ( 20 to 35 points ) , or intense ( higher than 35 points ) symptoms.25,26 this questionnaire was previously validated in brazil.26
the qol was assessed by means of the who qol brief version ( whoqol - bref ) questionnaire , which has been validated for brazilian portuguese.27 this questionnaire comprises 26 questions ( out of the original 100 ) , 24 questions examining physical ( physical pain , energy , locomotion , everyday life activities , medical treatments , and work ) , psychological ( positive feelings , concentration , self - esteem , self - image , negative feelings , and spirituality ) , social ( personal relationships , social support , and sexual activity ) , and environmental ( physical safety , housing , financial resources , health - care facilities , information , leisure , physical environment , and transportation ) domains and the remaining two are general questions on qol .
the questions refer to the previous 2 weeks , and the participants answer them according to a likert scale for intensity ( none / extremely ) , ability ( none / completely ) , frequency ( never / always ) , or evaluation ( very unsatisfied / very satisfied ; very bad / very good ) , in which values are calculated from scores ranging from zero ( very bad ) to 25 ( fair ) , 50 ( good ) , 75 ( very good ) , and 100% ( excellent ) .
such values were used to calculate body mass index ( weight [ kg]/height [ m ] ) .
years of schooling and the number of diseases were calculated from a self - reported questionnaire .
data were analyzed using spss software ( v 16.0 ; spss inc , chicago , il ) .
descriptive statistics were applied ( mean , standard deviation , and amplitude ) to characterize the age , age of menarche , age of menopause , body mass index , education , number of diseases , habitual pa variables , qol domain scores , and symptoms of menopause .
comparisons of the qol scores and symptoms of menopause in middle - aged women between groups ( a vs b vs c ) after 12 weeks were performed using analysis of covariance ( ancova ) , adjusted for the baseline values of each dependent variable .
intragroup comparisons between the qol scores and symptoms of menopause at the beginning and end of the study were made through paired t - tests ( in groups a and c ) and wilcoxon signed - rank test ( group b ) .
the dose - response relationships between habitual pa and the variations in qol scores in the physical , psychological , and social domains , the variations in weight , and the variation in the symptoms of menopause were analyzed through ancova adjusted for age , initial body mass index , years of schooling , hormonal replacement therapy , and number of diseases .
table 1 describes the mean characteristics of the participants who were chronologically 50 years of age ( 4559 years ) , age of menarche at 13 years , and age of menopause at 49 years ( excluding surgical menopause ) .
participants had attended school for an average of 11 years , which corresponds to secondary education .
most of the women had a body mass index between 18.524.9 kg / m ( average 21 kg / m ) .
the clinical conditions most often reported were migraine ( 12% ) , osteoporosis ( 11% ) , high total cholesterol ( 10% ) , hypertension ( 9% ) , and asthma ( 2% ) , with no differences between groups . the duration of total daily habitual pa ranged from 0200 minutes .
the average was 24 minutes / day of moderate- to high - intensity activity ( excluding walking ) and 23 minutes / day of walking .
the best score in the qol assessment was observed in the social domain ( 65% ) , although it also exhibited the widest variation ( 0%100% ) , followed by the psychological ( 60% ) and the physical ( 57% ) domains ; the latter exhibited the lowest variation ( 21%78% ) .
only 11% of participants did not report any symptoms of menopause . among those who did report symptoms , 41% rated them as moderate in intensity ( table 2 ) .
tables 3 and 4 describe the initial and final scores of qol and of the symptoms of menopause , set into the three groups according to the amount of habitual pa practiced during the 12 weeks of the study .
ancova adjusted for baseline values indicated that the participants who engaged in habitual pa for more than 60 minutes / day had improved physical domain qol scores compared with participants who engaged in habitual pa for less than 30 minutes / day .
the most active participants also showed increased qol scores in the psychological and social domains and a decrease in almost all of the symptoms of menopause compared with the participants who engaged in habitual pa for 60 minutes / day or less .
figure 2 presents the variations in the qol scores and in the symptoms of menopause according to total habitual pa adjusted for age , initial body mass index , years of schooling , hormonal replacement therapy , and number of diseases .
improvements in the psychological and social domains and in the symptoms of menopause were observed in women who engaged in habitual pa for more than 60 minutes / day .
the effects of reducing menopause symptoms and body weight on the qol scores in each habitual pa group are shown in figures 3 and 4 .
the results indicate improvement in the psychological domain in participants who engaged in habitual pa for more than 60 minutes / day and had a decrease in menopause symptoms or in body weight .
the main aim of this study was to analyze the influence of the duration of habitual pa on the symptoms of climacterium / menopause and on different domains of health - related qol in middle - aged women .
the results indicate a positive dose - response relationship between the amount of total habitual pa assessed through ipac ( ie , the addition of walking , and moderate or vigorous activity lasting at least 10 minutes per session ) and improvement in the symptoms of menopause and in qol scores . at the end of 12 weeks
, there were improvements in the psychological ( approximately 5% ) and social ( approximately 2.5% ) domains of qol in middle - aged women who engaged in pa for at least 60 minutes / day .
engaging in habitual pa for at least 60 minutes / day showed more favorable effects on the psychological qol ( as well as a positive trend in the social domain , as the levels of significance were borderline ) of the women who lost weight and/or had eased symptoms of menopause .
weight loss in overweight women has been associated with a better qol,28,29 and weight gain has been associated with both a worse qol3033 and an increase in menopause - related physical complaints ( vertigo , joint pain , abdominal pain , fatigue , and alterations of the skin ) , particularly when weight gain is over 5 kg.32 in this study , the average weight loss associated with improvement in the psychological domain scores of middle - aged women who engaged in habitual pa for more than 60 minutes / day was close to 5% ( approximately 3 kg ) .
this level of habitual pa is usually recommended to lose weight or to prevent weight gain.34 other studies conducted with shorter durations / amounts of pa / exercise ( 30 minutes / day ) but over a longer period of time ( 6 months ) also indicated positive effects on qol ; these effects were mainly in the psychological domain18,19 but were also observed in the physical domain.12,18,19 the physical domain , as assessed by whoqol - bref , includes physical pain , energy , locomotion , performance of everyday activities , medical treatments , and work . in this study , no influence of duration or intensity of habitual pa on physical domain scores was observed .
approximately 41% of women report / exhibit a moderate frequency of physical complaints that can cause limitations or reductions in their physical health.8 however , the decrease in symptoms of the women who engaged in moderate- or high - intensity habitual pa for at least 60 minutes / day in this study did not favorably influence their physical domain scores .
overall , almost all of the symptoms of menopause decreased in the women who engaged in habitual pa for 60 minutes / day or more .
this result agrees with previous findings that pa contributes to a decreased occurrence of several symptoms of menopause.11,35,36 however , these results also indicate that engaging in at least moderate - intensity habitual pa for 30 minutes / day in sessions of 10 or more successive minutes can be insufficient for the purposes of promoting qol and decreasing the frequency of menopause symptoms in middle - aged women.37 this was not a randomized controlled trial . at baseline , it was not possible to recruit a significant number of women with insufficient habitual pa ( accumulation < 30 minutes / day activity of moderate or greater intensity ) and consequently habitual pa of participants was not similar . on the other hand , about 85% of participants who were not sufficiently active at the start remained insufficiently active during the study .
since typically less active people are generally those who benefit most from habitual pa , it is likely that the size of the effects on symptoms and qol could have been larger if a greater number of insufficiently active women had increased their habitual pa .
the habitual practice of at least moderate - intensity pa for 60 minutes / day has a favorable influence on the prevention of symptoms of climacterium / menopause and on qol , particularly in the psychological and social domains in middle - aged women .
the influence of habitual pa at the psychological level seems partially associated with a decrease in the symptoms of menopause and/or with weight loss . | aim : to analyze the influence of the duration of habitual physical activity ( pa ) on the symptoms of climacterium / menopause and on several domains of the health - related quality of life ( qol ) in middle - aged women.methods:one hundred and four 45- to 59-year - old women were placed into three groups : group a , subjects who maintained pa less than 30 minutes / day ; group b , subjects who maintained or began to perform pa 3060 minutes / day ; and group c , subjects who maintained or increased pa to more than 60 minutes / day . symptoms of menopause , qol ( physical , psychological , and social ) , and pa were assessed through the kupperman menopausal index , world health organization quality of life brief version questionnaire , and international physical activity questionnaire , respectively.results:the analysis of covariance ( ancova ) results , adjusted for age , initial body mass index , schooling years , hormonal replacement therapy , and the number of diseases , indicated that the women who maintained or increased their total habitual pa to more than 60 minutes / day had reduced symptoms of climacterium / menopause ( 5.4 0.5 ; p = 0.001 ) and improved qol in the psychological ( 4.4% 0.8% ; p = 0.001 ) and social domains ( 2.0% 0.9% ; p = 0.035 ) .
ancova revealed a further improvement of approximately 5% in the psychological domain of qol in group c , who also experienced decreased menopause symptoms ( p = 0.001 ) and lost weight ( p = 0.009).conclusion : the habitual practice of at least moderate - intensity pa for 60 minutes / day has a favorable effect on climacterium / menopause symptoms and on qol , particularly on its psychological and social domains .
the influence of habitual pa at the psychological level seems to be at least partially associated with a decrease in menopause symptoms and/or weight loss . |
ramipril ( see scheme 1 ) contains not less than
98.0% of c23h32n2o5 ; ( 2s,3as,6as)-1-[(2s)-2-[[(2s)-1-ethoxy-1-oxo-4-phenylbutan-2-yl]amino]propanoyl]-3,3a,4,5,6,6a - hexahydro-2h - cyclopenta[d]pyrrole-2
carboxylic acid .
it belongs in a class of drugs
called angiotensin converting enzyme ( ace ) inhibitors which are used for
treating high blood
pressure and heart failure and for
preventing kidney
failure due to high blood pressure and
diabetes .
angiotensin ii contracts the muscles of most
arteries in the body , including the heart , thereby
narrowing the arteries and elevating the blood pressure . in the kidney ,
the narrowing
caused by angiotensin ii also increases blood pressure and decreases the flow
of blood .
ace inhibitors such as ramipril lower blood pressure by reducing the
production of angiotensin ii , thereby relaxing the arterial muscles and
enlarging the arteries .
the enlargement of the arteries throughout the body
reduces the blood pressure against which the heart must pump blood , and it
becomes easier for the heart to pump blood .
this increases the flow of blood and oxygen to the
heart , and this improves further the ability of the heart to pump blood .
the
effects of ace inhibitors are particularly beneficial to people with congestive
heart failure . in the kidneys ,
the
enlargement of the arteries also reduces blood pressure and increases blood
flow .
methods in current use for the assay of ramipril ,
in pharmaceutical preparation , are based on spectrophotometry [ 16 ] , liquid
chromatography [ 712 ] , gas chromatography [ 13 , 14 ] , enatioselective biosensors
, enatioselective membrane , voltammetry , amperometric biosensor
, and mass spectrometry
. however , most of these methods are
sophisticated , tedious , and required many manipulation steps . on the other hand ,
although , ion - selective electrodes and potentiometric sensors are much simpler ,
fast , and inexpensive , only one ion - selective electrode has been reported for
the determination of ramipril drug as anionic species . in this paper , the preparation ,
characterization , and analytical application of new two ramipril cationic ion - selective electrodes based on phosphomolibdate and tetraphenylborate - ramipril
ion - pair complexes have been reported .
the merits offered by the proposed
electrodes include the high cationic sensitivity of the drug in the acid media
with fast response time ( < 30 seconds ) and long life span ( 2 months ) .
the
potentiometric measurements were made at 25 1c , using an orin ( model
a720 ) digital ph / mv meter and orion ross combination ph electrode ( model 81 - 02 )
for all ph measurements . the suggested ramipril pvc membrane - based electrode
was used for all potentiometric measurements in conjunction with a double
junction reference electrode ( orion model 90 - 02 ) containing kno3 ( 10% w / v ) in the outer compartment .
1430 ratio recording ir
spectrophotometer was used for structure elucidation of the ion - pair complexes .
all chemicals were of analytical reagent
grade unless otherwise stated and doubly distilled water was used throughout .
poly ( vinyl chloride ) powder ( pvc ) of high molecular weight ( 10 000 ) and dioctyl
phthalate plasticizer of purity 98% were obtained from aldrich chemical company ,
inc .
( milwaukee , wis , usa ) .
tetrahydrofuran ( thf ) with a purity of 99% containing 0.025%
butylatedhydroxytoluene inhibitor was used as solvent .
ramipril
stock solution ( 10 mol l ) was prepared by dissolving 0.4165 g in a minimal
volume of acetic acid with continuous stirring and then diluted to 100 mllwith
distilled water .
the resulting clear solution of ph 3 was obtained by the addition
of small aliquots of 10 mol l hcl .
( 0.2 mol l ) were individually prepared
by dissolving appropriate weight of sodium phosphomolibdate and tetraphenylborate ,
respectively , in a minimum volume of distilled water followed by filtration then
completed to 100 ml with distilled water .
ramipril - phosphomolibdate and ramipril - tetraphenylborate
ion - pair sensing materials were individually prepared by mixing 30 ml aliquot
of 10 mol l ramipril solution with a 30 ml aliquot
of 10 mol l aqueous phosphomolibdate and tetraphenylborate solutions , respectively in l00 ml beaker .
the obtained precipitates were filtered using a g4 sintered
glass crucible , washed thoroughly with distilled water , and dried at room
temperature .
two
pvc master membranes based on the suggested sensing materials containing 0.01 g ion - pair complex , 0.350 g dioctylphthalate
( dop ) , and 0.190 g of poly ( vinyl chloride ) were individually prepared . each membrane contents
were thoroughly mixed , dissolved in 6 ml aliquot of thf , and transferred to a
glass petri dish ( 3 cm diameter ) .
the petri dish was covered with a filter paper
and left to stand overnight to allow slow evaporation of the solvent at room
temperature .
the membranes were sectioned with a cork borer ( 10 mm diameter ) and attached
to a length of polyethylene tubing ( 3 cm length , 8 mm i.d ) by using thf . a home
-made electrode body was used , which consists of a glass tube , to one end of
which the poly ethylene tubing was attached and filled with an equimolar
mixture of 10 mol l of potassium chloride and
ramipril as the internal reference solution .
an ag / agc1 internal reference wire
electrode ( 1.0 mm diameter ) was immersed in the internal solution .
this assembly
was used in the potentiometric characterization of the electrodes and the
subsequent determination of the drug .
in
order to calibrate the suggested electrodes , aliquots ( 10 ml ) of aqueous
ramipril solutions ( 1.0 101.0 10 mol
l )
were transferred into 50 ml beakers , and the pvc membrane electrode , in
conjunction with a double junction ag / agcl reference electrode , was immersed in
the solution .
alternatively , the drug pvc membrane electrode in conjunction
with a double junction ag / agc1 reference electrode was immersed in a 50 ml
beaker containing a l0 ml aliquot of water .
the solutions were gently stirred during the measurements and the potential
recorded after stabilization to 0.2 mv and the e.m.f plotted on semilogarithmic
paper as a function of the drug concentration .
the calibration graphs were used
for subsequent determination of unknown concentration of the drug .
the
potentiometric selectivity coefficient indicates the extent to which a foreign
ion b interferes with the response of the electrode to its primary drug ion a.
the potentiometric selectivity coefficients k
a , b
for the suggested electrodes were measured by
separate solutions method ssm . in this method ,
the potential responses of
the electrode in 10 mol l solution of the
interferents were measured and recorded .
the potential response of the
electrode for the drug was separately , obtained in a similar manner at the same
concentration level .
the selectivity coefficient values were calculated using
the simplified form of eisemnan nicolsky equation:(1)ka , bpot = e1e2s+(11z2)log a1 , where e
1 and e
2 are the potential readings of the electrode in separate
solutions of the same concentration of the drug and interferants , respectively ,
s is the slope of the drug calibration graph ( mv / concentration decade ) , a
1 is the activity of the drug , and z
2 is the charge number of the
interfering ion .
the
effect of ph of the test solution on the potential reading of the suggested
drug electrodes was studied by immersing a ross combination glass electrode
( orion model 81 - 02 ) , pvc membrane electrode , and a double junction ag / agc1
reference electrode in 50 ml beakers containing 30 ml aliquots of 10 and 10 mol l drug solutions .
the ph of each solution
was gradually increased and decreased by adding small aliquots of dilute sodium
hydroxide and hydrochloric acid , respectively .
the mv - ph profile at each drug concentration was plotted for
the two electrode systems . in
order to investigate the reliability of the proposed electrodes ,
they have been
applied in the determination of the drug using direct potentiometry and
potentiometric titration . in the direct potentiometry study ,
a pvc membrane - based
ramipril electrode in conjunction with a double junction reference electrode
was immersed in a l0 ml of the appropriate drug solutions of unknown
concentration .
the potential readings were recorded after stabilization to 0.2 mv and compared with the calibration graph .
the solutions were stirred during
measurements , and the electrodes were thoroughly washed with distilled water
between measurements . in the
potentiometric titration of ramipril , aliquots ( 26 ml ) of 10
mol
l of ramipril solution were transferred to 50 ml beakers and
diluted to 10 ml with distilled water .
the solution was stirred and titrated
with a standard 10 mol l sodium tetraphenylborate
solution using the suggested ramipril membrane electrode in conjunction with a
double junction ag / agc1 reference electrode .
the electrode potential ( e ) was
recorded as a function of the titrant volume ( v ) added , ( e versus v ) curves were
plotted .
the end point was calculated from the maximum slope e/v versus
v.
moreover ,
different forms and dosages of pharmaceutical preparations were assayed to
determine ramipril in different formulations . in this study ,
aliquot of 5 ml of
the drug was transferred to 25 ml beaker containing 15 ml of deionised water , and
the ph of the solution was adjusted to ph 3 with a drop of dilute hc1 solution .
the solution was then transferred to 25 ml volumetric flask , completed to the
mark , shaken well , and transferred to a 100 ml beaker for ise measurement . for
the assay of tablet formulations ,
10 tablets were finely powdered , mixed , and an
accurate weight equivalent to 0.1% of the tablet was transferred into 50 ml
beakers containing 20 ml of deionized water , the ph of the solution was
adjusted to ph 3 with a drop of dilute hc1 solution , and transferred to 25 ml
volumetric flask , completed with water to the mark , shaken well .
the suggested
ramipril - based membrane electrode was immersed in conjunction with a double
junction ag / agc1 reference electrode into the solution .
the potential was
measured after a stable reading was obtained and compared with that on a
calibration graph previously constructed for standard solutions .
ramipril phosphomolibdate and ramipril tetraphenylborate ion - pair complexes have been
prepared and examined as new electroactive ionophores in pvc matrix membranes
responsive to ramipril cation . in acid media ,
ramipril cations readily react
with phosphomolibdate and tetraphenylborate anions to form stable water insoluble
ion association complexes .
the ir studies confirm that the formation of 1:1
ramipril : anion ion - pair association .
the potentiometric response
characteristics of the proposed electrodes were evaluated , according to iupac
recommendations using the following electrochemical cell : ag / agcl | 102 mol l1 kc1102 mol l1 ramipril | pvcmembrane | | ramipriltest solution | | 10%kc1 | agc1/ag
the potentiometric
response characteristics of the investigated ramipril pvc membrane - based electrodes
were evaluated from the data collected from four assemblies for each membrane
electrode .
the responses of ramipril
electrode systems are linear over the concentration range 1 101 10 mol l. the slopes
of the calibration plots ( figure 1 ) are typically 53 0.5 mv and 54 0.5 per concentration decade for ramipril
deviation from the ideal nernstian
slope ( 59.2 mv / concentration
decade ) stems from the fact that most potentiometric drug sensors respond to
the activity of the drug cations rather than the concentration .
the response time and stability of the membranes have been
investigated . in these studies , the
time required for ramipril poly ( vinyl chloride ) membrane electrodes to reach a
value of 1 mv from the final equilibrium potential in the same day after
successive immersion in different ramipril solutions was measured .
the results
obtained ( figure 2 ) show that s the electrode attain stable potential values
within 20 seconds .
in addition , the potentials displayed by the electrode in
the linear concentration range of ramipril in the same day do not vary by more
than 0.5 mv .
the stability of the potential reading for the ramipril - based
electrodes is within 2 mv during the lifetime ( 2 months ) of the electrodes .
the
effect of ph on the potential readings of the proposed electrode was also examined
by recording the e.m.f .
of ramipril test solutions ( 10 and 10 mol l ) at various ph values , which were obtained by the addition
of very small volumes of hydrochloric acid and/or sodium hydroxide solutions 10 mol / l of each .
-ph plots presented in figures 3 and 4 revealed that
the potential readings are insensitive to ph changes in the ranges 1.03.8 and 1.04.0 for the
ramipril - phosphomolibdate and ramipeil - tetraphenylborate , respectively .
the shape of mv - ph profile depends
on the stability of the ion - pair in the membrane as a function of ph , the
nature of the drug ( protonation or complexation equilibrium ) in the test
solution , and the sensitivity of the membrane to either [ h ] or [ oh ]
at low or high ph values , respectively . it was observed that ramipril ion - pair
complexes deteriorate in alkaline media causing severe potential shift . at
relatively
higher ph values , the e.m.f decreased this is probably due to deprotonated
species in test solution .
the
selectivity coefficients of the investigated electrodes were evaluated using
separate solution method ( ssm ) . in this study , the performance of the ramipril
electrodes in the presence of some tested organic and inorganic cations was studied .
the selectivity coefficient values ( k
a , b
) are calculated and presented in table
2 .
as can be seen , the electrode offers a reasonable selectivity for the ramipril
cation over most of the tested species .
in order to investigate the analytical usefulness of the
proposed electrodes , they have been successfully applied in the potentiometer
determination of ramipril in aqueous samples as well as in some local pharmaceutical
formulations . in the former study ,
solutions of concentration in the liner
range of the tested electrode are prepared from pharmaceutical grade of
ramipril and determined by direct potentiometry and potentiometric titration
using the proposed ramipril electrodes .
some local
pharmaceutical formulations have been prepared and analyzed by direct
potentiometry using the investigated ramipril electrodes .
as can be seen , the two electrodes provide a good
accuracy ( average recovery > 96% ) and high
precision ( rsd < 3% , n
they provide
analytical , useful sensitivity to the drug with fast response time , reliable , and
reproducible response .
the proposed electrodes have been successfully applied
in the determination of ramipril in some pharmaceutical formulations with good
accuracy and high precision . | the fabrication and electrochemical evaluation of two pvc membrane - based ion - selective electrodes responsive for ramipril drug have been proposed .
the sensitive membranes were prepared using ramipril - phosphomolibdate and ramipril - tetraphenylborate ion - pair complexes as electroactive sensing materials in plasticized pvc support .
the electrodes based on these materials provide near - nernestian response ( sensitivity of 53 0.554 0.5 mv / concentration decade ) covering the concentration range of 1.0 1021.0 105 mol l1 with a detection limit of 3.0 1064.0 106 mol l1 .
the suggested electrodes have been successfully used in the determination of ramipril drug in some pharmaceutical formulations using direct potentiometry with average recovery of > 96% and mean standard deviation of < 3% ( n = 5 ) . |
natural
product modification with photoredox catalysis allows for
mild , chemoselective access to a wide array of related structures
in complex areas of chemical space , providing the possibility for
novel structural motifs as well as useful quantities of less abundant
congeners .
while amine additives have been used extensively as stoichiometric
electron donors for photocatalysis , the controlled modification of
amine substrates through single - electron oxidation is ideal for the
synthesis and modification of alkaloids . here ,
we report the conversion
of the amine ( + ) -catharanthine into the natural products ( )-pseudotabersonine ,
( )-pseudovincadifformine , and ( + ) -coronaridine utilizing visible
light photoredox catalysis . | |
this may be accomplished by free dissection and clamping of the branches , which add time and operative trauma to the operation , or by occluding balloons introduced into branch ostia for , for example , visceral and large segmental arteries and stay sutures for small segmental ones , both of which clutters the operative field
. a simpler yet rapid and reliable method of temporary arterial occlusion is therefore needed .
the more rapidly and reliably bleeding from arterial ostia can be stopped during open aortic and other vascular operations , the less untoward blood loss .
legoo ( lg ) ( pluromed , woburn , ma , usa ) is a thermosensitive polymer ( 20 weight percent of purified poloxamer 407 in saline ) that undergoes rapid transition from liquid to a high viscosity gel when warmed from refrigerator temperature to body temperature and has been used successfully for temporary vascular occlusion in , for example , coronary artery bypass surgery .
when used for temporary coronary artery occlusion , lg has been injected by a cannula that has been introduced via the arteriotomy into the artery proximally and distally to the arteriotomy , henceforth called the
intra - arterial pressure and flow rate have been reduced during lg injection by compression of the artery by a finger or a small surgical swab [ 13 ] .
when the task is to temporarily stop bleeding from arterial ostia , for example during aortic surgery , digital compression of the artery to reduce intra - arterial pressure and flow rate during lg injection may not be possible , and the cannulation method therefore may not be applicable .
it may , however , be possible to inject lg into the ostium without cannulating it using an injection device with , for example , a balloon to seal the connection between the device and the ostium , henceforth called a retrograde method . using this method blood flow
a retrograde method may be applicable when arteries are so calcified that hemostasis can not be obtained either by application of vascular clamps or intravascular occlusion balloons and when obstructing calcified plaques render it impossible to inject lg using the cannulation method .
lg does not seem to cause permanent arterial occlusion [ 18 ] but the return of flow may be delayed by an lg plug that dissolves slowly because it is excessively long or because it is inaccessible to dissolution by cooling [ 9 , 10 ] .
it may be important that lg is not injected so far as to cause side - branch embolization .
the risk of this occurring will be smaller , the shorter distance from the ostium lg is injected into a vessel .
a retrograde method may possibly enable plug formation without injecting lg as far into the vessel as is needed using the cannulation method .
the objectives of this study was to assess in an in vitro model whether a retrograde method of lg injection may be a feasible method of obtaining temporary hemostasis , whether it may enable temporary hemostasis with lg being injected for a shorter distance into a vessel than with the cannulation method , and whether temporary hemostasis may be obtained more reliably than when the cannulation method is used .
in a series of experiments , the feasibility of temporarily stopping flow of body - warm tap water from a polyvinyl chloride tube using lg was examined with both the retrograde and the cannulation method . for the retrograde method ,
the retrograde method was compared with the cannulation method under a number of experimental conditions to see which method most reliably produced a durable lg plug . a paediatric size
10 french foley catheter ( rochester medical corporation , stewartville , mn , usa ) was modified by cutting off the portion in front of the balloon and by cutting off sufficiently from the proximal part of the main lumen to accommodate a polyethylene tube with 3.5 mm inner and 4.6 mm outer diameter as a connector to a 3-way stop cock ( discofix , b. braun melsungen ag , melsungen , germany ) .
the lg for injection , contained in a 50 ml syringe , was transferred to the injection syringe via another polyethylene tube and the 3-way stop cock and kept in an iced water bath ( temperature 2.57c ) between injections . for the cannulation method , an olivary - tipped legoo 1.5 mm 40 mm cannula ( pluromed inc , woburn , ma , usa ) or a 1.3 mm 32 mm intravenous cannula ( venflon , becton dickinson infusion therapy ab , helsingborg , sweden ) was attached to the 3-way stop cock and used for injection instead of the modified foley catheter ( figure 1 ) .
resistance of flow through the olivary - tipped legoo 1.5 mm 40 mm cannula and the 1.3 mm 32 mm intravenous cannula was tested by timed aspiration of 6 ml of cold water to vacuum in a 10 ml syringe .
a polyvinyl chloride ( pvc ) intravenous tube ( codan pvb medical gmbh , lensahn , germany ) of 4 mm outer diameter , 0.5 mm wall thickness , and 7.07 mm luminal area with a narrowing at its orifice was perfused , using gravity , from a reservoir of tap water at 37c ( 34.142.8c ) with food colour added ( figure 2 ) .
the tube passed through a circular hole ( diameter 4.7 mm ) in a board ( board thickness : 7.3 mm ) .
a ring of silicon tube ( inner diameter 3.45 mm , outer diameter 5.4 mm ) made the connection between the tube and the board watertight and narrowed the tube at its end . the tube could be opened and closed using a clamp .
water pressure in the tube was determined by the height of the water column . in some experiments ,
a sponge around the horizontal part of the tube was irrigated with water at a temperature between 35.4c and 44c . water flow rate was determined by timed collection of water in a beaker , and flow velocity in the tube ( v ) was calculated by dividing flow rate by lumen area ( a ) .
water velocity through the ostium ( vo ) and effective orifice area ( ao ) were calculated by measuring the downward deflection of the water jet ( s ) over a horizontal distance ( l ) and applying ( 1)-(2 ) as follows :
( 1)s=0.5gt2 g = gravitational acceleration ( approximately 9.81 ms ) ,
( 2)vo = lt , voao = va .
the luminal area of the tube orifice was 3.19 mm , hence there was a 55% reduction in luminal area , and olivary - tipped legoo cannulas thicker than 1.5 mm were too thick to be used in this experimental setup . at a water pressure of 91 mmhg ,
water velocity in the tube was 0.8 m / s , flow rate was 5.7 ml / s , and at 30 mmhg , water velocity was 0.42 m / s , and flow rate was 2.97 ml / s . under the experimental conditions of each experiment ( table 1 ) , it was recorded whether an occluding lg plug was obtained .
the plug 's length , any peculiarities about its appearance , and time till flow resumed were noted .
most experiments were made with one selected experimental parameter in mind and , given the exploratory and preliminary nature of the study , not all parameters were noted during each experiment .
plug duration of at least 3 minutes was used as a threshold value for successful plug formation .
prior to each experiment , the plug from a previous experiment that resulted in successful plug formation was removed until coloured water seemed to fill the tube by flushing the surrounding tube with water of 14.5 c , by inserting a 0.9 mm guide wire through the orifice and moving it repeatedly through the plug ( figure 3 , lower panel ) , or by aspiration over the orifice with a syringe or modified foley catheter ( figure 3 , upper panel ) .
since a number of plugs appeared to be longer than calculated from the lg volume injected , excess plug volume was calculated as the difference between plug volume and injected lg volume .
the fischer - irvine 2-sided exact test was used for comparison of frequencies and the wilcoxon two - sample test was used for comparison of two groups .
fifty - two of 104 lg injections produced lg plugs that lasted at least 3 minutes .
most plugs that were observed for > 5 minutes were stable and did not change for the next 1015 minutes .
table 2 shows the effect of selected experimental parameters on success of plug formation . with the retrograde method ,
successful plugs were produced in 27 of 53 of injections when water pressure was 91 mmhg and in 10 of 10 injections when water pressure was 30 mmhg , p < 0.004 . with 21c water in the balloon , gelatinous lg was pressed out between the balloon and the board ( figures 2 and 3 , upper panel ) rather than being pressed into the orifice in at least 3 of 5 unsuccessful injections using the retrograde method .
some plugs lasting less than 3 minutes had admixture of some air bubbles . with the retrograde method ,
the use of a 1 ml syringe produced successful plugs in 12 of 14 injections and the use of a 0.5 ml syringe produced successful plugs in 11 of 30 injections , p < 0.004 .
an estimated median injection time of 0.32 s produced successful plugs in 19 of 42 injections , while an estimated median injection time of 0.64 s produced successful plugs in 8 of 11 injections , p = 0.175 .
although not a significant difference , there is a trend that slower injections produced successful plugs more frequently . using the cannulation method and a water pressure of 30 mmhg , with the 1.3 32 mm intravenous cannula , successful plugs were produced in 11 of 13 injections ,
while with the 1.5 40 mm lg cannula successful plugs were produced in 3 of 24 injections , p < 0.00003
. there was water distally to one of the three successful plugs as well as to some plugs lasting less than 3 minutes showing that the cannula had been inserted unnecessarily far into the tube . with the cannulation method
, it appeared that lg could not be injected fast enough using hand injection at 91 mmhg perfusion pressure , water flow velocity 0.8 m / s using the 1.5 mm 40 mm olivary - tipped lg cannula . to compare resistance through the cannulas
, 6 ml of cold water was aspirated through the cannulas to vacuum in a 10 ml syringe .
it took 5.4 s to aspirate 6 ml of cold water to vacuum through the olivary - tipped 1.5 mm 40 mm legoo cannula and 0.5 s to aspirate the same volume through the 1.3 mm 32 mm intravenous cannula .
when the olivary - tipped cannula was withdrawn after plug formation , in some experiments the olive at the tip of the cannula seemed to effect a drag on the plug , causing the plug to be withdrawn a few millimeters , partially disrupting and making a path in the plug that filled with water ( figure 4 , upper panel ) .
also , in most experiments when the legoo cannula was used for injection , the boundaries between the lg plug and water were indistinct .
none of the other parameters examined , volume of lg injected , heating of lg shortly before injection , external heating of tube with water , balloon content and temperature , time from beginning of lg injection till removal of balloon ( 3.05.6 s versus 5.810 s ) , or retraction of cannula during lg injection were shown to significantly determine whether a plug was produced .
plug length in 7 experiments with plug duration <3 minutes , 2.75 cm ( 2.05.0 cm ) , was not significantly different from that of 29 experiments with plug duration > 3 minutes , 3.45 cm ( 0.98.0 cm ) , p = 0.19 .
there was a trend of less excess plug volume , 0.006 ml ( 0.0590.055 ml ) in 7 experiments with plug duration <3 minutes , than in 29 experiments with plug duration > 3 minutes , 0.055 ml ( 0.1370.266 ml ) , p = 0.055 . when lg was injected immediately after being cooled in the ice bath , resistance to injection felt similar to that encountered during water injection .
when lg had been in a water bath at 21c before injection or there was water at 21c in the balloon , one could feel some resistance to injection , and some injections failed because the higher injection pressure made the catheter disengage from the connection to the syringe or made the handle of the 3-way stop - cock disengage from the rest of the stop cock .
lg made the components of the stop cock slippery . when the catheter was held with warm fingers for more than a few seconds
lg plugs could be removed within a couple of minutes by flushing the tube containing the lg plug with water of 14.5c , within a minute by moving a guide - wire repeatedly through the plug ( figure 3 , lower panel ) or , immediately , by aspiration over the orifice with a syringe or modified foley catheter ( figure 3 , upper panel ) .
the most important finding in this study was that water flow in a pvc tube with a narrow orifice at its end could be arrested more reliably by injecting lg by the retrograde method than by the cannulation method using a legoo cannula . in the experimental setup
it was elected to use a narrow orifice to simulate the frequently occurring clinical situation of a calcified stenotic arterial orifice that may not allow introduction of thicker olivary cannulas or occlusion balloons .
the pressure values , 91 and 30 mmhg , were chosen to simulate high and low collateral back pressure . at high water pressure and flow rate through the tube , water stasis
could only be obtained with the retrograde method and not with the cannulation method using the legoo cannula .
lg flow rate through the high - resistance legoo cannula was probably lower than water flow rate through the tube in most experiments , prohibiting plug formation with manual injection . at low pressure and flow rate ,
cannula resistance may still have played a role , although pulling the olive through the plug , at least in some experiments , seemed to disrupt and move the plug slightly , at least contributing to early plug dissolution .
the lack of success with the cannulation method for lg injection using the legoo cannula in this in vitro study is in contrast to the success seen in studies with temporary coronary occlusion with lg during coronary artery bypass [ 1 , 10 ] . in those studies , however , coronary artery pressure and flow at the site of injection was reduced during lg injection , probably below 30 mmhg , by compression of the coronary artery with a finger or small surgical swab . in the current study variable partial obstruction of the orifice by the proximal wider part of the cannulas may also have retarded water flow and facilitated plug formation . if coronary arteries and perivascular tissues have higher heat capacity and thermal conductivity than that of the pvc tube in the current in vitro study , it could also contribute to explain the discrepancy . with the retrograde method
, more successful plugs were produced using a 1 ml syringe than with a 0.5 ml syringe . since a large syringe produces more resistance to injection than a small one
, injection velocity may have been slower with the 1 ml syringe than with the 0.5 ml syringe , syringe size most likely having been a proxy for injection velocity . using the retrograde method with the selected catheter dimension , there may be an optimum injection velocity with injections using the 0.5 ml syringe being too rapid and injections using the 2.5 ml syringe possibly being too slow .
the attempt to standardize injection velocities by counting to 1 or 2 during injection did not result in uniform injection velocities within each injection velocity group ( table 1 ) explaining the lack of a significant effect of this experimental parameter on success of plug formation .
viscosity of blood and water are similar ( approximately 0.004 and 0.0007 pa s , resp .
, at 37c ) , orders of magnitude lower than that of lg ( approximately 1500 pa s at 37c ) [ 8 , 11 , 12 ] .
therefore , resistance during injection is dominated by the viscosity of lg as it is warmed up during injection . during retrograde injection
, ice - cooled lg appeared to retain a sufficiently low viscosity throughout the injection so that no increase in resistance could be felt .
with lg at 21c , increasing viscosity , hence higher resistance during injection as lg was warmed up further explains why some injections failed . while suboptimal injection velocity in part may explain why retrograde injections did not produce successful plugs in 49% of injections , none of the other parameters examined , volume of lg injected , heating of lg shortly before injection , external heating of tube with water , balloon content and temperature , time from beginning of lg injection till removal of balloon , or retraction of cannula during lg injection were shown to explain the binary outcome of successful plug formation , but this preliminary study was not sufficiently powered to show an influence of these parameters .
one hypothetical , unstudied cause of lack of success with the retrograde method is that the plug in the tube , being in continuity with the gel in front of the balloon catheter may have been retracted by removing the latter backwards instead of laterally which may shear the plug without pulling on it .
another hypothetical cause is that water admixture from the ice - water bath to the lg at the end of the catheter may have occurred . with the retrograde method using the modified balloon catheter
it is necessary to press the latter against the arterial wall at the site of the orifice through which lg is to be injected .
this will be possible when the arterial wall is stiff , for example , due to calcification or fibrosis . whether the method is applicable when the arterial wall and surrounding tissues are soft and yielding needs to be ascertained in further studies .
possibly , some of the available coronary cannulas may be better suited when the artery around the orifice is soft and pliable .
lg has been used for temporary coronary artery occlusion without evidence of detrimental effects due to possible embolization to side branches . in the heart ,
the massaging effect on the coronary arteries by the moving myocardium may help to dissolve and get rid of remaining lg .
the safety with regard to side branch embolization has not been similarly well documented in other organs .
avoidance of side - branch embolization may therefore be important and is most likely to be avoided by injecting only the least necessary lg volume starting at the orifice to obtain temporary hemostasis . with the cannulation method using the legoo cannula
there is a risk that the cannula may be inserted further than necessary into the vessel ( figures 3 and 4 , middle panels ) with attendant unnecessary risk of embolization and prolonged occlusion . using the retrograde method
, the lg plug always extends from the ostium ( figure 3 , upper panel and figure 4 , lower panel ) .
the instructions accompanying legoo as well as some authors recommend retraction of the cannula during lg injection to avoid uneven coating of the gel [ 10 , 13 ] .
other rationales could be more rapid warming of lg by injecting along a stretch of vessel wall and prevention of path formation and partial plug disruption due to retraction of the olive through the plug . in the experimental setup used in this study , however , no advantage was seen by retraction of the cannula during injection although the optimal speed of cannula retraction in relation to injection and blood velocity has not been defined , and retraction velocities may not have been optimal in the current study .
the use of an olivary cannula may reduce the risk of intimal injury and , since an olive causes some obstruction and reduces blood flow rate , plug formation may be facilitated compared with a cannula without an olive .
the present in vitro study suggests that these possible advantages may be offset by the greater resistance during injection and the disruptive effect on the plug of the olivary cannula .
although all visible lg was removed after each injection , the presence of positive excess plug volumes show that some lg was present on the interior tube wall after the previous experiment .
the trend of less excess plug volume when plug duration was <3 minutes than when plug duration was > 3 minutes suggest more successful plug formation when some lg was present in the tube after the previous experiment than when it was not present .
a retrograde method of injection of thermosensitive polymers into arterial ostia without cannulation , using an injection device that arrests blood flow during the injection , is feasible .
it can produce more pressure - resistant plugs more reliably and by less deep lg injection , hence with less risk of embolization and prolonged occlusion than the cannulation method with the legoo cannula .
the olive of olivary cannulas may prevent the entrance of sufficiently thick cannulas through arterial stenoses and it tends to disrupt and move the plug during retraction contributing to early plug dissolution . | during vascular surgical operations , there is a need for a simpler and more reliable method of temporary arterial occlusion than those currently employed , especially of heavily calcified arteries .
a thermosensitive polymer , legoo ( lg ) ( pluromed , woburn , ma ) , has been used successfully for temporary vascular occlusion .
it has hitherto been injected by a cannula that has been introduced into the artery to be occluded , here henceforth called the
cannulation method .
injection into arterial ostia without cannulation , using an injection device that arrests blood flow during the injection , here henceforth called a retrograde method may enable temporary hemostasis when ostial stenoses render it impossible to inject lg using the cannulation method .
the objective of the present study was to study the feasibility of a retrograde method and to compare it with the cannulation method in an in vitro model , incorporating a narrow orifice to simulate ostial stenosis , using tap water at 37c instead of blood .
the retrograde method of lg injection , using a modified paediatric foley catheter , turned out to be feasible to produce a durable lg plug more reliably , at higher water pressure and with less deep lg injection than with the cannulation method . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.